article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
propofol is an intravenous (iv) anaesthetic drug used for induction and maintenance during anaesthesia. in addition, the hyperdynamic cardiovascular response to the pain can precipitate adverse events in high - risk patients with a history of coronary artery disease and/or abnormal heart rhythm. many factors appear to affect the incidence of pain, which include site of injection, size of vein, speed of injection, buffering effect of blood, temperature of propofol and concomitant use of drugs such as local anaesthetics and opiates. corticosteroids are systemic anti - inflammatory agents, systemic analgesics and are known to block nociceptive c fibres when applied locally. methylprednisolone is commonly used during cardiopulmonary bypass to reduce inflammatory response at doses of 10 - 30 mg / kg body weight. methylprednisolone sodium succinate for injection is available in 40 mg, 125 mg, 500 mg and 1000 mg strengths. the study was approved by the hospital ethical committee and written informed consent was obtained from all the patients. in this study, 165 patients between 21 and 60 years irrespective of sex belonging to the american society of anesthesiologists (asa) physical status i and ii undergoing elective cardiac surgery were included. patients with allergy to propofol, lignocaine, anticipated difficult venous access, patients with cardiac conduction defects, congenital heart disease, low ejection fraction, haemodynamically instability, diabetes mellitus, chronic pain syndromes, convulsions, head injury and systemic fungal infections were excluded from the study. this was an interventional, randomised, prospective, double - blind, parallel group study. a 20-gauge cannula was placed into the largest vein on the dorsum of the left hand. patients were randomly assigned to three groups of 55 patients each according to a computer - generated random number sequence. group s patients received 2 ml of normal saline as a placebo ; group l patients received pre - treatment with lignocaine (20 mg of 2% solution diluted to 2 ml with distilled water), and group mp patients received pre - treatment with methylprednisolone sodium succinate (125 mg diluted into 2 ml of distilled water). after limb elevation for 15 s, venous drainage was occluded by placing a tourniquet inflated to 40 mmhg. according to the experimental group, respective drug was injected, and the investigator was blinded to the content of the solution. tourniquet was deflated after 1 min, and then 0.5 mg / kg of propofol (long chain triglycerides lct) was administered at the rate of 0.5 ml / s. the intensity of pain on injection of propofol was assessed by a second anaesthesiologist who was unaware of the group to which the patient had been allocated. assessment included standard questions asked to the patients about the comfort of the injection, verbal response and behavioural signs (such as facial grimacing, arm withdrawal or tears from the eyes). pain was graded using a four - point scale : 0 = no pain, 1 = mild pain (pain reported only in response to questioning without any behavioural signs), 2 = moderate pain (pain reported in response to questioning and accompanied by a behavioural sign or pain reported spontaneously without questioning) and 3 = severe pain (i.e. strong vocal response or response accompanied by facial grimacing, arm withdrawal or tears). anaesthesia induction was continued with fentanyl 35 g / kg and midazolam 0.03 mg / kg intravenously. the trachea was extubated and were assessed for pain, swelling or allergic reaction at the site of injection by a blinded anaesthesiologist. considering previous studies, the incidence of propofol - induced pain was assumed as 80% and 50% reduction was considered significant. based on the alpha value of 0.05 and a power value of 80%, our study required at least 41 patients per group. comparison of age, sex, weight and asa between the three groups was obtained by student 's t - test. categorical data are reported as numbers and percentages and are analysed using chi - square test or fisher 's exact test as appropriate. there were no significant differences in demographic characteristics between the three groups [table 1 ]. no incidence of pain or discomfort was reported during the injection of pre - treatment solution in any group. the overall incidence of pain was 70.9% (64.2%77.6%) in the saline group, 30.9% (21.2%40.6%) in the lignocaine group, and 36.4% (31.5%41.3%) in the methylprednisolone group [table 2 ]. the incidence of pain was significantly less (p < 0.012) in patients receiving drugs for pre - treatment than those receiving saline. moderate to severe pain was observed in 3 (5.4%) and 4 (7.3%) patients in groups l and mp respectively as compared to 34 (62%) patients in s group. the difference in moderate to severe pain between the study groups (l and mp) was not statistically significant. incidence and severity of pain following propofol injection among groups in this study, the incidence of pain during the injection of propofol in the lignocaine group was 30.9%, whereas in the methyl prednisolone group, it was 36.4%. moderate to severe pain was reported in 5.4% of the patients in the lignocaine group whereas 7.3% was reported in the methyl prednisolone group. there are very few studies on the use of pre - treatment with steroid - based drugs for the alleviation of pain on propofol injection. the mechanism for propofol injection pain is unknown ; however it could be due to irritation of the endothelium, osmolality differences, unphysiological ph and the activation of pain mediators. the immediate vascular pain on propofol injection is attributed to direct irritation of the drug by stimulating the venous nociceptive receptors or free nerve endings involving myelinated a fibres. the delayed pain of injection has a latency of 1020 s mediated by activation of kallikrein kinin system. there are many strategies to reduce the incidence of pain on injection which include the following : pre - treatment with iv lignocaine, adding lignocaine to propofol, cooling or warming propofol, injection of propofol into a large vein, preadministration of 5-ht3 receptor antagonist, dexamethasone, hydrocortisone with or without tourniquet. among these studies, the most commonly accepted technique is the administration of lignocaine just before the injection of propofol. corticosteroids are used routinely in cardiac surgery to attenuate the release of pro - inflammatory cytokines. methylprednisolone is a commonly used steroid during cardiopulmonary bypass in our institute, so we choose methylprednisolone to test the efficacy in reducing pain on propofol injection. a previous study found that 31% of patients felt pain (p < 0.01) after dexamethasone pre - treatment and moderate to severe pain was noticed in 17.14%. another study comparing lignocaine, pethidine and dexamethasone as pre - treatment found that 48% of the patients with dexamethasone pre - treatment had no pain. the combination of lignocaine 20 mg and dexamethasone 6 mg with venous occlusion for 1 min was more effective than lignocaine 20 mg (34.3%) or dexamethasone 6 mg (37.1%) alone for pain control during propofol injection. these results show an effective reduction in the incidence and severity of propofol injection pain after pre - treatment with dexamethasone. pre - treatment with either 10 mg or 25 mg of hydrocortisone was associated with no significant reduction of propofol injection pain (66.66% and 94.44% respectively) when compared to a placebo (94.44%). it was administered 30 s before the administration of propofol, which may be a short contact time. the incidence of pain was 70.9% in the group s whereas in those pre - treated with lignocaine and methylprednisolone, it was 30.9% and 36.4%, respectively. these results show that there is a significant reduction in the propofol injection pain, and both lignocaine and methylprednisolone are equally effective. there is a significant decrease in moderate to severe pain (5.4% and 7.3% in each l and mp group) when compared with group s (62%). the use of methylprednisolone should be individualised with due consideration to the cost - effectiveness and benefit to the patient. the analgesic efficacy of methylprednisolone given as pre - treatment with propofol is as effective as lignocaine in preventing propofol - induced pain. therefore, it can be administered before propofol in patients who require methylprednisolone for other indications. | background and aims : propofol (2, 6-di - isopropylphenol) used for the induction of anaesthesia often causes mild to severe pain or discomfort on injection. we designed this double - blind study to compare the efficacy of methylprednisolone and lignocaine in reducing the pain of propofol injection in patients scheduled for cardiac surgery.methods:a total of 165 adult patients, scheduled for elective cardiac surgery, were divided into three groups : saline (group s, n = 55), lignocaine 20 mg (group l, n = 55) and methylprednisolone 125 mg diluted into 2 ml of distilled water (group mp, n = 55). drugs were administered after tourniquet application and occlusion was released after 1 min and 1/4th of the total dose of propofol (2 mg / kg) was administered at the rate of 0.5 ml / s. pain on propofol injection was evaluated by four - point verbal rating scale. statistical methods used included student 's t - test and chi - square test / fisher 's exact test.results:the overall incidence of pain was 70.9% in the saline group, 30.9% in the lignocaine group and 36.4% in the methylprednisolone group. the intensity of pain was significantly less in patients receiving methylprednisolone and lignocaine than those receiving saline (p < 0.012).conclusion : pre - treatment with intravenous methylprednisolone was found to be as effective as lignocaine in reducing propofol injection - induced pain. |
traditionally, the fields of ageing and disability have been addressed separately both in terms of research and service structures and systems of care. however, in recent years, public awareness into topics involving ageing and disability twin - track approach has been growing and research linking both fields enjoys rising attention. ageing as viewed from the perspective of people with disabilities those with life - long disabilities as well as those with age - related disabilities is the main focus of the graz declaration of june 2006. considering international declarations developed separately for the fields of ageing and disability, the graz declaration aims at analysing and bridging the rights and responsibilities of these two groups while including the conception of the person with a disability, as expressed in principles such as inclusion, participation, equal opportunities, non - discrimination, and self - determination. the declaration aims at clarifying common variance, and emphasizes the unique requirements and needs of specific groups of older people with disabilities. besides conceptual and strategic reasons the declaration follows straightforward reasons affecting the life of older people with disabilities directly or indirectly such as bridging the practice models of care of the ageing field with that of the area of intellectual disability, or defining tools to detect commonalities as well as differences between the needs of older people with a life - long disability and those with age - related disabilities. the graz declaration s effect on developing a more coherent support systems aiming at equal opportunities and full citizenship for older people with disabilities in diverse, yet integrated fields such as politics, care, training, research, culture, ethics and economics will be addressed. | introductiontraditionally, the fields of ageing and disability have been addressed separately both in terms of research and service structures and systems of care. however, in recent years, public awareness into topics involving ageing and disability twin - track approach has been growing and research linking both fields enjoys rising attention.a twin - track modelageing as viewed from the perspective of people with disabilities those with life - long disabilities as well as those with age - related disabilities is the main focus of the graz declaration of june 2006. considering international declarations developed separately for the fields of ageing and disability, the graz declaration aims at analysing and bridging the rights and responsibilities of these two groups while including the conception of the person with a disability, as expressed in principles such as inclusion, participation, equal opportunities, non - discrimination, and self - determination. the declaration aims at clarifying common variance, and emphasizes the unique requirements and needs of specific groups of older people with disabilities. besides conceptual and strategic reasons the declaration follows straightforward reasons affecting the life of older people with disabilities directly or indirectly such as bridging the practice models of care of the ageing field with that of the area of intellectual disability, or defining tools to detect commonalities as well as differences between the needs of older people with a life - long disability and those with age - related disabilities.conclusionthe graz declaration s effect on developing a more coherent support systems aiming at equal opportunities and full citizenship for older people with disabilities in diverse, yet integrated fields such as politics, care, training, research, culture, ethics and economics will be addressed. |
migration is a process of social change during which people move from one cultural setting to another in order to settle for a longer period of time or permanently. though migration has been occurring since the beginning of time, the advent of the era of globalization has resulted in the increased movement of people across and within national boundaries for various reasons. the social, cultural, financial, and other aspects of migration have been the focus of much research and many new policies initiated as a result. the relationship between migration and health has also been well explored. however, there is a lack of consistency among studies of migration and health with results indicating both higher and lower prevalence of diseases among migrants in relation to the residents [19 ]. the health status of return migrants, migrants, who have returned to their place of origin, has not been the focus of much research. a study from mexico had previously reported on the disadvantages faced by the return migrants. more research is needed in this area as the health status of the return migrants may be much different from that of the resident community. in this exploratory study, we address this information gap by studying a rural community in the south indian state of kerala which has a long history of migration. the state of kerala with a population of 34 million enjoys one of the best health indicators in india with an infant mortality rate of 12 and life expectancy at birth of 74 years. these levels are far better than the other indian states and are quite close to those of developed countries. kerala has also made significant progress economically with recent economic indicators showing that kerala is one of the indian states with the least reported levels of poverty. a significant proportion of the total receipts of kerala are contributed by remittances from emigrants. as of 2007, 1.85 million keralites were living abroad ; of theses, 89% were residing in the persian gulf countries. surveys also indicate that one out of four households in kerala had at least one resident abroad. an interesting feature of migration in kerala is that a good proportion of the migrants return home after working for various periods in foreign countries. as in 2007, there were 890,000 return emigrants, roughly one return emigrant for every two living abroad. another thing to note is the very high prevalence of chronic diseases in kerala, with the burden of deaths from cardiovascular diseases now exceeding that of industrialized countries. our own previous study has shown that the prevalence of self - reported diabetes was higher among the richer socioeconomic groups than the poorest group. with the kerala society at an advanced stage of demographic and epidemiological transition, research which focuses on it was with this view that the population registry for life style diseases (prolife) study was initiated. the initial goal was to assemble a cohort to study the epidemiology of chronic diseases in the selected rural community and to estimate the burden of risk factors. here we study the influence of migration on the health status of individuals by comparing the health status of return migrants with that of the residents who had never worked abroad. the present study explores the prevalence of selected chronic disease / risk factors among return migrants in comparison to age and sex matched local residents. we also explore the relationship between the duration of migration and prevalence of risk factors. prolife is a prospective cohort study initiated in 2001 involving the long time follow - up of the residents of varkala integrated child development services all residents were enrolled in the study ; 1, 61,942 subjects living in 33,379 households were included in the baseline survey. separate adult questionnaires were administered to 78,173 subjects (33,978 men and 44,195 women) who were 20 years as of january 1, 2002. the shortfall was primarily on account of some subjects being absent from home on three consecutive visits. other than deaths, migration would be the main reason for loss to follow - up. as of december 31, 2004, 721 subjects moved out of the study area and were lost to followup. 105 female healthly workers involved in routine mother and child care served as field investigators. a team of physician epidemiologists trained the workers in survey methods and in the recognition of common disease conditions. the workers were also trained on collecting cause of death information using a structured questionnaire. the baseline survey collected household level information capturing demographic, educational, and a host of socio economic attributes. additionally, information on deaths and births that occurred during the year previous to the survey was gathered. a pretested questionnaire was administered to every adult subject, (aged 20 years or more on 1 january, 2001). this questionnaire captured information on diagnosed diabetes, hypertension, and cardiac diseases, in addition to lifestyle attributes like physical activity, habits and migration history. diabetes, hypertension and cardiac diseases were reported by the subjects as diagnosed by a physician on the basis of clinical and biochemical parameters. information on the duration and destination of migration and type of employment during that time was ascertained. resource limitations prevented us from capturing dietary details and anthropological measurements in the present survey. the objectives of the study were explained to the head of each household who had the freedom to refuse. informed oral consent was obtained from every respondent and the study was overseen by an independent ethics committee. statistical analysis for differences between nonmigrants and migrants age - specific prevalence of diabetes, hypertension, and history of cardiac complaints among males and females was calculated. we analyzed data for possible relationship between the duration of migration and observed prevalence of the diseases by doing mantel test for trend. logistic regression analysis adjusting for confounders such as gender, education, and age was carried out to calculate the adjusted odds ratio. table 1 provides the salient features of the population and compares the characteristics of subjects with and without history of migration. the majority of subjects who reported a history of living outside kerala were male (86.3%). the mean age of subjects with a history of migration was higher than that of subjects with no history of migration (45.7 versus 41.4 years). return migrants had better educational levels with only 15.6% of subjects reporting low or less than 5 years of education, whereas 28% of subjects with no history of migration reported their educational status as low. prevalence of risk factors such as smoking (49.7% versus 17.6%) and alcohol consumption (34.6% versus 11.6%) were higher among return migrants. similarly, return migrants reported higher prevalence of diabetes (14.1% versus 6.0%), cardiac conditions (6.6% versus 3.7%), and hypertension (14.7% versus 9.9%). age - specific prevalence of diabetes, hypertension and history of cardiac complaints among males and females aged 3069 with a history of living outside kerala for more than 5 years and those with no history of migration is provided in figures 1(a) and 1(b). figure 1(a) presents data on age - specific prevalence of the diseases among males with a history of migration and nonmigrants. diabetes, hypertension, and cardiac complaints are more prevalent among those with duration of migration of over 5 years when compared with those with no history of migration. the age - specific increase in prevalence is substantially higher among migrants for diabetes and hypertension though the trend is unmistakable even for cardiac diseases. the same trend is seen for women aged 3069 as seen in figure 1(b). table 2 provides the odds ratio for the presence of physician diagnosed chronic diseases (diabetes, hypertension, and cardiac conditions). after adjustment for age, gender, and education, subjects with a history of migration had higher odds of having chronic diseases (or 2.2, 95% ci 2.12.3). the highest prevalence of all risk factors was noted in persons with a history of migration of more than 10 years. statistical analysis for differences between nonmigrants and migrants reveals high significance. we analyzed that data for possible relationship between the duration migration and observed prevalence of the diseases by doing mantel test for trend. table 3 shows that there is a clear trend of increased prevalence in relation to duration of migration. in our study, residents with a history of migration reported a higher prevalence of cardiac diseases, hypertension, and diabetes. the prevalence increased with the duration of migration with those residents who lived outside kerala for more than 5 years showing the highest prevalence. our finding that diabetes, hypertension, and cardiac diseases are substantially higher in migrants corroborates some of the previous publications in this regard. like similar studies, prevalence of chronic conditions has been estimated based on the self reporting of physician diagnosed conditions. also, our analysis is restricted to subjects who are currently residing in the study area. since these diseases tend to increase with age, the higher prevalence may be attributed to the age effect and not to the fact of a history of migration. however, logistic regression analysis showed that, after adjustment for age and gender, subjects with a history of migration had a higher prevalence of chronic diseases. the data on age - specific prevalence also disproves such an explanation ; between 30 and 70 years the prevalence is significantly higher among migrants in all four age groups. we can therefore conclude that the most important contributory factor to the observed increase in prevalence is history of migration. our analysis on the prevalence of 2 significant risk factors namely smoking and alcohol consumption for noncommunicable diseases in our study subjects clearly establishes that the prevalence for both risk factors is more than double that in those with a history of migration. also to be noted that there are the unusual high rates of drinking and smoking among women with a history of migration. this phenomenon requires further study and we believe that in the context of this study we explain the high prevalence of chronic diseases among migrant women in this rural community. infectious diseases like tb have been shown to be high among migrants than the resident population [18, 19 ]. chronic diseases like diabetes and stroke have also been shown to be high among migrants [6, 20, 21 ]. higher incidence of mental disease and alcohol and drug abuse was also seen among migrants [22, 23 ]. migrants from the indian subcontinent in many cases had higher incidence of disease than migrants from elsewhere [6, 20, 24, 25 ]. however, some studies have shown that the mortality rate of migrants though higher than that of the residents are lower than that of their country of origin [2628 ]. this apparent paradox has been explained as due to reasons such as the healthy migrant effect, where by the persons who migrate are healthier than the nonmigrants and the salmon effect, where by elderly migrants return to their country of origin to die [2932 ]. it has been observed that the urbanization process associated with migration leads to the availability and abundance of calorie - dense / low - fiber foods and the adoption of sedentary lifestyles. this leads to increased risks of morbidity and mortality from diet and lifestyle - related chronic diseases. a recent report which focused on return migrants reported that the health of returning migrants is impacted by the cumulative exposure to social determinants and risk factors of health during the migration process, during the return movement, and following return. the remittances from migrants constitute a major part of the revenue for the state of kerala and the economy of kerala is much dependent on continuing remittances from the migrants. the government of kerala has initiated various programs which focus on the welfare of the nonresident keralites and has a dedicated department which looks after affairs of the nonresident keralites called norka. however, at present, most of the programmes concentrate on providing financial, labor, and rehabilitation assistance to return migrants. the inclusion of health as a major component in norka roots programme and similar programmes can have a significant effect on the health of migrants and return migrants. it is imperative that the state initiates programs that target the health and wellbeing of this very important segment of the population. | aim. to study the relationship between a personal history of migration and prevalence of chronic diseases and risk factors in a rural population. method. cross sectional survey data from prolife, a cohort study involving the long time follow - up of the residents of an administrative unit in kerala, india, was used. pre - tested questionnaire was administered to 78,173 adult residents. information on physician diagnosed diabetes, hypertension, and cardiac diseases and lifestyle attributes like physical activity, habits, and migration was captured. results. subjects with a history of migration had a higher prevalence of chronic disease when compared with those with no history of migration. diabetes (19.6% versus 4.1%), hypertension (18.8% versus 6.6%), and cardiac complaints (8.6% versus 4.1%) are more prevalent among those with history of migration of over 5 years. after adjustment for age, gender, and education, we found that chronic diseases are higher among persons with a history of migration (or 2.2, 95% ci : 2.12.3). age - specific increases in prevalence of chronic diseases are also substantially higher among migrants. conclusion. people with a history of migration have a higher prevalence of chronic diseases and risk factors. |
idiopathic hypogonadotropic hypogonadism (ihh) is comprised of absent puberty, infertility and low serum gonadotrophins in the absence of a pituitary tumor. ihh is due to impaired gonadotrophin releasing hormone (gnrh) release / action or gonadotrophin secretion. ks appears to be the result of impairment of gnrh and olfactory neuron migration from the olfactory placode to the hypothalamus (bhagavath and layman, 2007). mutations in genes involved in gnrh neuron migration (kal1 and fgfr1), as well as those expressed in either the hypothalamus or pituitary, including gnrhr, nrob1, gpr54, lep, lepr and pcsk1 account for the molecular etiology of 1520% of all ihh / ks patients (hardelin, 2001 ; de roux, 2005 ; pitteloud., 2006 ; bhagavath and layman, 2007 ; seminara, 2007). kal1, gnrhr and fgfr1account for the majority of causative mutations. the molecular basis for most ihh / ks cases digenic disease has been reported in two families with fgfr1 and either a gnrhr or a nelf mutation (pitteloud., 2007). most mutations identified in genetic diseases, including ihh / ks, are point mutations and small deletions / duplications detected by pcr - based dna sequencing (kim., 2008). pcr based sequencing may not detect heterozygous gene deletions, however, since the remaining normal allele will be amplified. therefore, it is possible that a substantial number of mutations remain undiagnosed. multiplex ligation - dependent probe amplification (mlpa) is a relatively new method for detecting copy number variations in genomic sequences (schouten., 2002). mlpa involves overnight hybridization of adjacent primer pairs to the individual exons of multiple target genes simultaneously, followed by a ligation reaction of the probe pairs, which then serve as a template for multiplex pcr. stuffer sequences that produce different sized fragments for resolution based upon size (schouten., since all probes have identical primer binding sites, only a single primer pair is required for multiplex pcr of all genes being studied. heterozygous intragenic deletions have been found in 1520% of patients with cystic fibrosis (audrezet., 2004), deafness (del castillo., 2003) and breast / ovarian cancer (hogervorst., 2003) who did not have point mutations in the corresponding genes. we hypothesized that a similar percentage of ihh / ks patients would have heterozygous deletions of autosomal genes (fgfr1, gnrh1, gnrhr, gpr54 or nelf) and/or hemizygous kal1 gene deletions, deletions which would be missed by the traditional pcr - based sequencing methods. additionally, since kal1 has a pseudogene homolog on the y chromosome, this may complicate the dna sequencing analysis (del castillo., 1992). one - hundred and twelve probands with ihh / ks were studied by mlpa (table i). absent / impaired puberty by age 17 in girls and age 18 in boys, low serum gonadotrophins, no evidence of a pituitary tumor and otherwise normal pituitary function (crowley., 1985 ; bhagavath., all males had total testosterone 3 ml in males. patient characteristics are shown in table i. the medical college of georgia human assurance committee approved this study ; each patient signed informed consent. fifty - four patients were studied for the presence of kal1 deletions (kal1 kit) and 100 ihh / ks patients were studied for deletions of an autosomal panel of fgfr1, gnrh1, gnrhr, gpr54 and nelf genes (kal2 kit). we estimated that we needed a sample size of 50 for study of kal1 gene deletions, since the prevalence of mutations is about 6% in anosmic males (bhagavath., 2007). the sample size for the autosomal gene panel (kal2 kit) was estimated to be 100. the prevalence of fgfr1 mutations in both normosmic ihh and ks is about 10% (pitteloud., 2006), whereas gnrhr mutations occur in 34% of normosmic ihh (bhagavath., 2005). the prevalence of gnrh1, nelf and gpr54 mutations in ihh and ks is currently unknown, but is probably low. by screening 100 patients, we could determine if the prevalence was at least 1%. since kal1 mutations have been exclusively identified in anosmic / hyposmic patients, the majority of patients studied (40/54) were anosmic / hyposmic. all patients were randomly selected from available dna samples without regard to prior mutation analysis from our large ihh / ks cohort. dna was extracted from white blood cells in all ihh / ks using standard methods. mlpa was performed in patients according to schouten (schouten., 2002 ; a total of 125 ng of dna was hybridized overnight to the probe sets of the commercially available kits. the p132 kal1 kit (mrc holland, amsterdam, netherlands) contains 34 probe pairs for all 14 kal1 exons and control sequences for other regions on xp, xq and yq11. the p133 kal2 kit contains 39 probe pairs covering the following exons of autosomal genes : gnrh1 (exons 13 of 4 exons), gnrhr (exons 13 of 3 exons), gpr54 (exons 1, 4 and 5 of 5 exons), fgfr1 (13, 5, 6, 8,10,13,14 and 18 of 18 exons) and nelf (exons 5, 11 and 15 of 16 exons). these probes also include control sequences on chromosomes 13, 6, 11, 1517, 19, 20 and y. following hybridization, a ligation reaction was performed which served as a template for 35 cycles of multiplex pcr using universal primers. pcr products were analyzed on an abi 310 autoanalyzer using the gene scan program and data were evaluated using genotyper 2.0 (both from applied biosystems, foster city, ca, usa). peak areas for each exon were converted into an excel file and the relative copy number of each fragment was compared to the same fragments from 2 to 3 controls. deletions were confirmed by pcr and dna sequencing (bhagavath., 2007). one - hundred and twelve probands with ihh / ks were studied by mlpa (table i). absent / impaired puberty by age 17 in girls and age 18 in boys, low serum gonadotrophins, no evidence of a pituitary tumor and otherwise normal pituitary function (crowley., 1985 ; bhagavath., all males had total testosterone 3 ml in males. patient characteristics are shown in table i. the medical college of georgia human assurance committee approved this study ; each patient signed informed consent. fifty - four patients were studied for the presence of kal1 deletions (kal1 kit) and 100 ihh / ks patients were studied for deletions of an autosomal panel of fgfr1, gnrh1, gnrhr, gpr54 and nelf genes (kal2 kit). we estimated that we needed a sample size of 50 for study of kal1 gene deletions, since the prevalence of mutations is about 6% in anosmic males (bhagavath., 2007). the sample size for the autosomal gene panel (kal2 kit) was estimated to be 100. the prevalence of fgfr1 mutations in both normosmic ihh and ks is about 10% (pitteloud., 2006), whereas gnrhr mutations occur in 34% of normosmic ihh (bhagavath., 2005). the prevalence of gnrh1, nelf and gpr54 mutations in ihh and ks is currently unknown, but is probably low. by screening 100 patients, we could determine if the prevalence was at least 1%. since kal1 mutations have been exclusively identified in anosmic / hyposmic patients, the majority of patients studied (40/54) were anosmic / hyposmic. all patients were randomly selected from available dna samples without regard to prior mutation analysis from our large ihh / ks cohort. dna was extracted from white blood cells in all ihh / ks using standard methods. mlpa was performed in patients according to schouten (schouten., 2002 ; a total of 125 ng of dna was hybridized overnight to the probe sets of the commercially available kits. the p132 kal1 kit (mrc holland, amsterdam, netherlands) contains 34 probe pairs for all 14 kal1 exons and control sequences for other regions on xp, xq and yq11. the p133 kal2 kit contains 39 probe pairs covering the following exons of autosomal genes : gnrh1 (exons 13 of 4 exons), gnrhr (exons 13 of 3 exons), gpr54 (exons 1, 4 and 5 of 5 exons), fgfr1 (13, 5, 6, 8,10,13,14 and 18 of 18 exons) and nelf (exons 5, 11 and 15 of 16 exons). these probes also include control sequences on chromosomes 13, 6, 11, 1517, 19, 20 and y. following hybridization, a ligation reaction was performed which served as a template for 35 cycles of multiplex pcr using universal primers. pcr products were analyzed on an abi 310 autoanalyzer using the gene scan program and data were evaluated using genotyper 2.0 (both from applied biosystems, foster city, ca, usa). peak areas for each exon were converted into an excel file and the relative copy number of each fragment was compared to the same fragments from 2 to 3 controls. deletions were confirmed by pcr and dna sequencing (bhagavath., 2007). using mlpa for the kal1 gene, deletions were identified in 4/54 (7.4%) patients and in 4/40 (10%) of anosmic / hyposmic patients (table when only anosmic males were considered, kal1 deletions were present in 4/33 (12.1%). three whole gene deletions were detected, as indicated by absence of peaks for each exon (fig. 1). all three whole gene deletions were confirmed by the absence of bands by pcr. in one of these patients, deletion of exons 113 had previously been identified (bhagavath., 2007) ; however, dna sequencing of exon 14 was consistent with pseudogene sequence, thereby confirming the whole gene deletion by mlpa. 1) which, upon dna sequencing, revealed a 3 bp deletion (tgt) of codon 164, deleting a cys (cys164del) rather than the deletion of the entire exon. no heterozygous / homozygous deletions were identified in the fgfr1, gnrh1, gnrhr, gpr54 or nelf genes in 100 ihh / ks patients. (a) the kal1 exon 4 deletion ; (b) whole kal1 gene deletion ; (c) normal control. arrows indicate the deleted exons. the horizontal axis (top) shows the size of the fragment in base pairs. a difference in relative copy peak height or peak area indicates a copy number change of the probe target sequence. the genetic basis of ihh / ks has been identified in 1520% of patients, most commonly in kal1, gnrhr or fgfr1 genes (bhagavath and layman, 2007). kal1 mutations have been identified in anosmic males approximately 5% of ks males without a family history and 3070% of those with clear x - linked recessive inheritance (bhagavath., 2007). gnrhr mutations cause autosomal recessive ihh in 35% of ihh patients, all of whom are normosmic (bhagavath., interestingly, fgfr1 mutations occur in 10% of anosmic or normosmic patients (pitteloud., in contrast, only a very few gross deletions been identified in ihh / ks candidate genes. available prevalence studies likely underestimate ihh / ks gene deletions as traditional pcr - based dna sequencing is unable to detect heterozygous gene deletions. therefore, it is possible that a substantial number of mutations remain undiagnosed. using mlpa, heterozygous intragenic deletions have been found in 1520% of patients with cystic fibrosis (audrezet., 2004), deafness (del castillo., 2003) and breast / ovarian cancer (hogervorst., 2003) who did not have point mutations. mlpa is an effective technique used to detect genomic deletions and duplications (schouten., 2002). if probe pairs for individual exons are utilized, mlpa can successfully determine the relative copy number of all exons within gene / genes simultaneously. mlpa has gained acceptance in genetic diagnostic laboratories due to its simplicity, relatively low cost and capacity for reasonably high throughput analysis. (gerdes., 2005), analysis of dna methylation (procter., 2006), relative mrna quantification (wehner., 2005), chromosomal characterization of cell lines and tissue samples (wilting., 2006) and the detection of polymorphisms (volikos., 2006). the frequency of gene deletions in ihh / ks candidate genes has not been previously reported. we hypothesized that mlpa would identify intragenic deletions in 1520% of ihh / ks patients. using mlpa three patients had whole gene deletions one of which was previously described by pcr to be deleted of exons 113 (bhagavath., 2007). mlpa also revealed one subject who appeared to have a deletion of exon 4. in this case, it is likely that the probe pair did not specifically anneal to the template of exon 4, therefore, no ligation and subsequent pcr could be performed (schouten., 2002). our findings indicate that putative deletions indicate identified by mlpa requires confirmation by another technique. probe pairs were dispersed across the coding regions of these genes, affording the opportunity to detect intragenic deletions. only three exons were studied for the nelf gene, but at the time that this kit was designed, no nelf mutations had been described. we can not exclude that intragenic deletions of exons not included in the kits occur, which would underestimate the prevalence of intragenic gene deletions. nevertheless, no deletions of any of the five autosomal genes were identified in 100 ihh / ks patients. although the prevalence of deletions in ihh / ks in autosomal genes was much less than that expected, the prevalence of kal1 deletions approximated 1015% that we hypothesized. the findings from this pilot study demonstrate the feasibility of mlpa to detect deletions in ihh / ks and suggest the benefits of future studies with an increased sample size of ihh / ks. | idiopathic hypogonadotropic hypogonadism (ihh) and kallmann syndrome (ks) are clinically and genetically heterogeneous disorders caused by a deficiency of gonadotrophin - releasing hormone (gnrh). mutations in three genes kal1, gnrhr and fgfr1account for 1520% of all causes of ihh / ks. nearly all mutations are point mutations identified by traditional pcr - based dna sequencing. the relatively new method of multiplex ligation - dependent probe amplification (mlpa) has been successful for detecting intragenic deletions in other genetic diseases. we hypothesized that mlpa would detect intragenic deletions in 1520% of our cohort of ihh / ks patients. fifty - four ihh / ks patients were studied for kal1 deletions and 100 were studied for an autosomal panel of fgfr1, gnrh1, gnrhr, gpr54 and nelf gene deletions. of all male and female subjects screened, 4/54 (7.4%) had kal1 deletions. if only anosmic males were considered, 4/33 (12.1%) had kal1 deletions. no deletions were identified in any of the autosomal genes in 100 ihh / ks patients. we believe this to be the first study to use mlpa to identify intragenic deletions in ihh / ks patients. our results indicate 12% of ks males have kal1 deletions, but intragenic deletions of the fgfr1, gnrh1, gnrhr, gpr54 and nelf genes are uncommon in ihh / ks. |
at the time of cataract surgery, many patients select intraocular lenses (iols) to reduce or eliminate their dependency on spectacle correction. to satisfactorily achieve both distance and near uncorrected visual acuity (ucva), several options are currently available. multifocal iols may provide excellent distance and near ucva with spectacle independence in a high percentage of patients. however, multifocal iols are known to have some potentially undesirable side effects, preventing many patients from selecting these implants.1,2 in addition, a number of patients have preexisting ocular conditions, unrealistic expectations, or low tolerance of risk, which may exclude them from being a good candidate for a multifocal iol.3 accommodative iols are another good option to reduce dependence upon spectacle correction. these iols appeal to patients who do not wish to risk side effects associated with multifocal iols or those who may have some ocular conditions that exclude them from using a multifocal iol. the accommodative iol has the advantage over a multifocal lens in that it does not require diffraction to achieve greater depth of focus. rather, the accommodative iol works on the premise of two flexible hinges allowing the central monofocal optic to move forward with accommodation (figures 1 and 2) the monofocal nature of the optic reduces light scatter, loss of contrast sensitivity, and halos around lights as compared to a multifocal iol. the monofocality of an accommodating iol also makes it an attractive option over a multifocal iol for the growing number of postrefrac - tive surgery patients facing cataract surgery who may have some degree of irregular astigmatism observed with corneal topography or a higher order aberration (hoa) profile excluding them from multifocal iol use. (this concept is further explained in discussion section.) while accommodative iols may be associated with fewer visual side effects than multifocal iols, a number of cases have been reported describing capsular contraction syndrome (ccs) with a negative effect upon visual acuity, with some cases leading to explantation of the iol.4,5 with appropriate observation and early detection, surgeons can avoid and manage ccs in accommodating iols. in this article, the authors describe a method to avoid ccs and outline a stepwise approach for the management of capsular contraction with accommodative iols. the goal of this approach is to allow surgeons to improve surgical outcomes for their accommodative iol patients, thus avoiding complications and achieving greater spectacle independence for many of them. after successful implantation of a hinge - based accommodative iol, the patient should have standard postoperative slit lamp examinations. the authors typically see patients on postoperative day (pod) # 1, pod # 7, pod # 30, pod # 60, and pod # 90. the iol and capsular bag should be examined for any signs of fibrosis, striae, or capsular opacification as shown in table 1. a baseline refraction should be established within the first several weeks to 1 month to monitor the patient for any significant changes in sphere or cylinder. monthly dilated examinations at postoperative 1 month, 2 months, and 3 months will also allow for the early detection of fibrosis or ccs. if changes in refractive error are occurring during the monthly postoperative visits, the surgeon should consider taking action to prevent a significant fibrotic contraction of the capsule and subsequent malposition of the lens. if fibrotic contraction and malposition with refractive error change occur, we follow a stepwise approach for the management of the condition. the inclusion criteria for initiating an intervention begin with any change in refractive error that appears to be based on fibrosis of the capsule. mild changes in refractive error due to fibrosis are defined as up to 1.0 d of change in refractive error. moderate changes in refractive error due to fibrosis are defined as > 1.0 d. a stepwise approach to refractive error changes induced by capsular contraction is shown in table 2. if the patient s refractive error has a shift of up to 1.0 d in either sphere or astigmatism, the surgeon should be alerted to the possibility of early capsular contraction affecting the iol position. if the signs of ccs are present, including fibrotic bands, striae, or capsular opacification (figures 3 and 4), intervention should be taken as the effect of further contraction can be halted with yttrium aluminum garnet (yag) laser capsulotomy. a yag capsulotomy may also alleviate some of the contractile forces acting upon the iol, thus improving the refraction and ucva.5 three separate posterior capsulotomies are made with the yag laser as depicted in figures 5 and 6. a small linear capsulotomy is created distal to the hinge on each haptic, and a central capsulotomy is also created. for example, if a distinct fibrotic band is an obvious source of capsular contraction and the refractive error has changed by > 1.0 d, a yag lysis of the fibrotic band is often sufficient to alleviate the contraction. the potential disadvantage of this maneuver is that it diminishes the possibility of surgical repositioning of the lens and use of a capsular tension ring (ctr) if the yag fails to correct the problem. if the patient develops a significant change, defined as > 1.0 d of astigmatism or sphere due to capsular contraction, a yag capsulotomy may not alleviate the refractive effects of contraction. rather, a viscodissection of the fibrosis and rotation of the lens 3 to 4 clock hours (or 180 for a toric accommodative iol) with insertion of a ctr will be most effective in correcting the iol position and preventing further contraction. the technique for this maneuver is as follows. under topical or peribulbar anesthesia, a cohesive ocular viscoelastic device (ovd) is injected into the capsular bag to viscodissect any adhesions between anterior and posterior capsular capsules. the iol will likely be observed to return to its original position during this maneuver. furthermore, viscodissection should be used to open the entire capsular bag, freeing any fibrosis to the fornix of the bag. when possible, rotation of the iol several clock hours, or 180, for a toric accommodating iol ensures release of adhesions. performing these maneuvers prior to 3 months postoperatively can lead to a higher degree of success as fibrosis of the capsule and haptics will be less likely. if fibrosis or adhesions create difficulty in rotating the iol, the unique haptic design of the accommodating iol allows for rotation in either direction. if difficulty is encountered during ctr insertion or displacement of the capsular bag is noted during ctr deployment, the surgeon should retract the ctr and perform further viscodissection. if the leading eyelet of the ctr continues to encounter resistance from either fibrosis or the haptics of the iol, one may consider retracting the ctr and redirecting it in the other direction that may bypass the area of resistance. in addition, a simple modification of ctr insertion with a suture - guided technique as previously published may facilitate insertion of the ctr (video s1).6 if the capsule has already undergone yag capsulotomy without satisfactory resolution of the z syndrome, an iol exchange may be considered. the patient and surgeon should discuss preoperatively whether the patient is a good candidate for a three - piece sulcus placed monofocal versus a three - piece sulcus placed multifocal iol. for the iol exchange technique, a dispersive ovd is injected above and below the iol to help prevent vitreous prolapse and protect the corneal endothelium. additional ovd is injected below the iol and a microscissor suitable for cutting iols is used to cut along the plate haptic of the iol, distal to the hinge if possible. it is important not to pull on the polyimide footplates as they are usually fibrosed into the fornix of the capsular bag and any attempt to explant them may result in an iatrogenic zonular dialysis. after the haptics have been cut, they may be trimmed down with microscissors so that they will not be within the pupillary margin in mesopic or scotopic conditions. the optic may then be grasped with lens removal forceps and pulled through a 3.0 mm incision or can be cut in half and removed. if vitreous prolapse occurs, the surgeon must perform a vitrectomy following the basic principles of removing any vitreous that is anterior to the posterior capsule, inject dispersive ovd into the sulcus and implant the predetermined three - piece iol, and remove the ovd and inject a miotic to be sure that the iol is centered and the pupil is round with no vitreous prolapse (video s2). if the patient s refractive error has a shift of up to 1.0 d in either sphere or astigmatism, the surgeon should be alerted to the possibility of early capsular contraction affecting the iol position. if the signs of ccs are present, including fibrotic bands, striae, or capsular opacification (figures 3 and 4), intervention should be taken as the effect of further contraction can be halted with yttrium aluminum garnet (yag) laser capsulotomy. a yag capsulotomy may also alleviate some of the contractile forces acting upon the iol, thus improving the refraction and ucva.5 three separate posterior capsulotomies are made with the yag laser as depicted in figures 5 and 6. a small linear capsulotomy is created distal to the hinge on each haptic, and a central capsulotomy is also created. for example, if a distinct fibrotic band is an obvious source of capsular contraction and the refractive error has changed by > 1.0 d, a yag lysis of the fibrotic band is often sufficient to alleviate the contraction. the potential disadvantage of this maneuver is that it diminishes the possibility of surgical repositioning of the lens and use of a capsular tension ring (ctr) if the yag fails to correct the problem. if the patient develops a significant change, defined as > 1.0 d of astigmatism or sphere due to capsular contraction, a yag capsulotomy may not alleviate the refractive effects of contraction. rather, a viscodissection of the fibrosis and rotation of the lens 3 to 4 clock hours (or 180 for a toric accommodative iol) with insertion of a ctr will be most effective in correcting the iol position and preventing further contraction. the technique for this maneuver is as follows. under topical or peribulbar anesthesia, a cohesive ocular viscoelastic device (ovd) is injected into the capsular bag to viscodissect any adhesions between anterior and posterior capsular capsules. the iol will likely be observed to return to its original position during this maneuver. furthermore, viscodissection should be used to open the entire capsular bag, freeing any fibrosis to the fornix of the bag. when possible, rotation of the iol several clock hours, or 180, for a toric accommodating iol ensures release of adhesions. performing these maneuvers prior to 3 months postoperatively can lead to a higher degree of success as fibrosis of the capsule and haptics will be less likely. if fibrosis or adhesions create difficulty in rotating the iol, the unique haptic design of the accommodating iol allows for rotation in either direction. if difficulty is encountered during ctr insertion or displacement of the capsular bag is noted during ctr deployment, the surgeon should retract the ctr and perform further viscodissection. if the leading eyelet of the ctr continues to encounter resistance from either fibrosis or the haptics of the iol, one may consider retracting the ctr and redirecting it in the other direction that may bypass the area of resistance. in addition, a simple modification of ctr insertion with a suture - guided technique as previously published may facilitate insertion of the ctr (video s1).6 if the capsule has already undergone yag capsulotomy without satisfactory resolution of the z syndrome, an iol exchange may be considered. the patient and surgeon should discuss preoperatively whether the patient is a good candidate for a three - piece sulcus placed monofocal versus a three - piece sulcus placed multifocal iol. for the iol exchange technique, a dispersive ovd is injected above and below the iol to help prevent vitreous prolapse and protect the corneal endothelium. additional ovd is injected below the iol and a microscissor suitable for cutting iols is used to cut along the plate haptic of the iol, distal to the hinge if possible. it is important not to pull on the polyimide footplates as they are usually fibrosed into the fornix of the capsular bag and any attempt to explant them may result in an iatrogenic zonular dialysis. after the haptics have been cut, they may be trimmed down with microscissors so that they will not be within the pupillary margin in mesopic or scotopic conditions. the optic may then be grasped with lens removal forceps and pulled through a 3.0 mm incision or can be cut in half and removed. if vitreous prolapse occurs, the surgeon must perform a vitrectomy following the basic principles of removing any vitreous that is anterior to the posterior capsule, inject dispersive ovd into the sulcus and implant the predetermined three - piece iol, and remove the ovd and inject a miotic to be sure that the iol is centered and the pupil is round with no vitreous prolapse (video s2). many patients are electing presbyopia - correcting iols at the time of cataract surgery to provide them with less dependence on spectacles. it is incumbent upon ophthalmologists to guide our patients to the best possible iol choice to meet their visual needs while minimizing potential complications associated with presbyopia - correcting iols. patients should always be advised on the high quality of vision that can be achieved with monofocal iols and use of spectacles for near or distance vision. in addition, mono vision with monofocal iols should be discussed in the preoperative counseling and may be a satisfactory alternative for many patients.7 almost any iol option that a patient may choose today has its own set of advantages and disadvantages. a surgeon must exercise great diligence to screen any potential existing ocular conditions that may prevent a patient from realizing the benefits of a multifocal iol. while multifocal iols may provide excellent near and distant ucva, coexisting macular or corneal conditions may render the patient with unsatisfactory ucva or even best corrected visual acuity. it is important to center negative spherical aberration iols within the visual axis to prevent higher degrees of coma.8 furthermore, hoas in the cornea may interfere with the functionality of a multifocal iol. in our practices, patients are also screened for higher degrees of angle kappa to prevent hoas associated with malalignment of negative spherical aberration iols. although the monofocal optic of the accommodating iol allows a greater number of patients to use the lens, not every patient is a good candidate for these iols. patients with a history of uveitis may be at increased risk for fibrosis and ccs affecting the iol, and it should be avoided in this subset of patients. a hinge - based accommodative iol functions by having flexible hinges vaulting the optic forward during accommodation. however, this flexibility at the hinge is what makes it vulnerable to distortion in the event of capsular contraction. the surgeon must be vigilant to observe for posterior capsular striae, fibrotic bands, and contraction in the postoperative period. asymmetric fibrosis in the capsular bag and ovalization of the anterior capsulotomy along the axis of the haptics are often the early signs of contraction. to avoid ccs, first, during cataract surgery, careful attention should be paid to cortical material removal and capsular epithelial cell removal. careful polishing of the posterior capsule and the underside of the anterior capsular leaflet is important (video s3). a single interrupted 10 - 0 nylon suture helps to insure a non - leaking stable wound. finally, prolonged anti - inflammatory agents such as steroids and nonsteroidal anti - inflammatory drugs used for up to 8 weeks help to prevent inflammation and potential ensuing capsular contraction. if a refractive error change occurs and contraction is suspected but not obvious, diagnostic equipment such as the nidek opd iii or itrace may help to determine iol tilt or a z syndrome. yag capsulotomy should be considered at the first signs of fibrosis to prevent further contraction or distortion of the iol. z syndrome with greater than 1.0 d of induced lenticular astigmatism, the patient should be assessed for any single fibrotic band that may be causing the distortion. if it appears that a single band is causing the contraction, a yag capsulotomy may be performed, but the surgeon must realize that if the contraction is not alleviated, the possibility of inserting a ctr has been all but eliminated. in addition with an open capsule, it may be necessary to later perform an iol exchange with an anterior vitrectomy. with greater degrees of ccs and induced refractive change as defined by > 1.0 d, and in the absence of yag capsulotomy, viscodissecting the capsular bag open and inserting a ctr are highly effective in correcting the iol position. it is worth mentioning that inserting the ctr earlier in the postoperative period, rather than later, makes it much easier to place the ctr into the capsular bag. a yag capsulotomy performed 2 weeks or 3 weeks after ctr insertion can aid in preventing any further fibrotic effects on the iol. while the incidence of capsular contraction resulting in asymmetric folding of the haptic optic junction has been reported in the literature as a rare complication, we have managed a number of these cases, ostensibly the largest series of cases published to date, with the techniques described in this article. our method of managing ccs is based upon the degree of refractive error change from baseline to determine intervention with yag laser or ctr. this may present a challenge as accurate measurement of pseudophakic lenticular astigmatism or refractive change may be difficult to determine in cases where contraction of the capsule results in irregular astigmatism, capsular fibrosis, opacification, and displacement of the optic. a surgeon might not be able to rely solely upon the refractive error change to determine the appropriate intervention and should evaluate the degree of vaulting of the haptic optic junction. for example, if ucva has significantly decreased and is consistent with displacement of the optic or a large degree of vaulting, a yag capsulotomy is unlikely to correct the contracted iol and a ctr would be the intervention of choice. table 3 illustrates eyes with ccs and refractive error changes of > 1.0 d with subsequent change in ucva that have been managed with this technique with iol repositioning and ctr implantation. in the event where a yag capsulotomy has already been done and failed to alleviate the ccs, an iol exchange should be considered. if an iol exchange is performed, it is important to remember that the polyimide haptics may be left in the capsular fornix and not pulled from the fibrotic fornix to avoid an iatrogenic zonular dialysis. if there are no contraindications to use a multifocal iol, a three - piece multifocal may be placed in the sulcus to give the patient the increased range of vision they may have had with the accommodative iol. although the goal is to prevent an iol exchange by using the steps outlined in this article, we have had two patients present with yag capsulotomies that failed to correct the ccs and required an iol exchange (table 4). the limitation of this study is that it is presented as a technique and a case series utilizing a methodical approach for the management of an iol complication. further study comparing our technique to an alternative management in a randomized comparative prospective cohort study would be beneficial to determine best practices in the management of ccs. however, with the relatively low incidence of ccs, such a study may be difficult to collect enough data for statistical significance. furthermore, comparative studies to determine the prophylactic placement of a ctr at the time of cataract surgery and accommodative iol implantation would be of great interest. finally, the role of inflammation and the use of anti - inflammatory medications in terms of both potency and duration of use in the postoperative period would be an area of useful research to prevent ccs. in our experience, following this methodical approach for the avoidance and treatment of capsular contraction has led to excellent surgical and patient satisfaction outcomes with accommodative iols. as the ability to provide superior refractive results with increasing spectacle independence continues to improve, we must remain vigilant in our iol selections for each individual patient and be prepared to manage any potential complications. for patients choosing accommodative iols, the unlikely event of ccs is best avoided with careful cortical and epithelial cell removal with postoperative anti - inflammatory agents and early detection and treatment of the contraction. | purposethe aims of this study are to define the various stages of capsular contraction syndrome (ccs) and its effect on refractive error with hinge - based accommodating intraocular lenses (iols) and to describe a systematic approach for the management of the different stages of ccs.methodshinge-based accommodative iols function via flexible hinges that vault the optic forward during accommodation. however, it is the flexibility of the iol that makes it prone to deformation in the event of ccs. the signs of ccs are identified and described as posterior capsular striae, fibrotic bands across the anterior or posterior capsule, and capsule opacification. various degrees of ccs may affect hinge - based accommodating iols in a spectrum from subtle changes in iol appearance to significant increases in refractive error and loss of uncorrected visual acuity. the signs of ccs and its effect on iol position and the resulting changes in refractive error are matched to appropriate treatment plans.resultsa surgeon can avoid ccs and manage the condition if familiar with the early signs of ccs. if ccs is identified, yttrium aluminum garnet laser capsulotomy should be considered. if moderate ccs occurs, it may be effectively treated with insertion of a capsular tension ring. if ccs is allowed to progress to advanced stages, an iol exchange may be necessary.conclusionsurgeons should be familiar with the stages of ccs and subsequent interventions. the steps outlined in this article help to guide surgeons in the prevention and management of ccs with hinge - based accommodative iols in order to provide improved refractive outcomes for patients. |
although the first report on circulating tumors was published by ashworth in 1869, the lack of technology precluded further investigations on their clinical use until recently. developments in immunological and quantitative real - time pcr - based analysis have enabled the detection, enumeration and characterization of circulating tumor cells (ctcs). the monitoring of ctcs has the potential to improve therapeutic management at an early stage and also to identify patients with increased risk of tumor progression or recurrence before the onset of clinically detected metastasis. furthermore, the molecular profiling of ctcs can provide new insights into cancer biology and systemic treatment in neoadjuvant or adjuvant settings. it is assumed that the detection of ctcs is associated with cancer, based on the finding that ctcs can be detected in all major cancers and not in healthy subjects or those with benign disease. most of the assays are based on enrichment and subsequent identification of ctcs using monoclonal antibodies directed against epithelial epitopes, for example, the transmembrane glycoprotein epithelial cell adhesion molecule (epcam) or cytokeratins that are expressed on both normal and malignant cells. this widely based approach is based on the fact that blood cells usually lack detectable expression of epithelial markers, being of mesenchymal origin. what remains to be confirmed is whether or not trafficking of normal epithelial cells could occur in certain benign conditions and might contribute to false positive findings in the current assay methods unless unambiguous criteria for the malignant nature of the marker positive cells are used. however, although the number of epithelial cells in the blood of healthy individuals and patients with a variety of nonmalignant disease is low, they may be present in 0.3% of cases. furthermore, using the epcam - based cellsearch (veridex) methodology, pantel. showed that circulating epithelial cells are found in between 0% and 18.7% of patients with benign colonic disease ; the epispot cytokeratin 19 assay found circulating epithelial cells in between 8.3% and 28.6% of patients with benign colonic disease. therefore, in patients 's pretreatment, with suspicion of cancer, or during followup of cancer patients where normal tissue persists, such as in breast or colon cancer, the detection of these benign cells could be interpreted as a relapse of the primary cancer. this is in addition to the potential problem of ctcs that do not express epcam or cytokeratins. the use of the biomarker p504s, although not prostate specific, has facilitated the differentiation between normal, dysplastic, and malignant tissues in prostate biopsy samples. normal or benign cells do not express p504s, whereas cells arising from prostatic intraepithelial neoplasia (pin) or cancer are positive. thus, at least in prostate cancer patients, the use of double immunomarcation could resolve this problem, whereby a malignant circulating prostate cell (cpc) would need to express both psa and p504s, a benign cpc only psa. the prostate tumor early cancer test (protect) study was started in 2008 ; the first stage evaluated 409 consecutive men attending a prostate cancer screening program in chile. the thirty women acting as controls were all cpc negative ; in the 409 men, the frequency of malignant cpc detection increased significantly with age and psa level and is associated with a biopsy positive for cancer. it was possible to detect malignant cpcs even at serum psa levels of 0.75 ng / ml / year, and/or digital rectal examination (dre) abnormal or suspicious of cancer. this was defined as the presence of a nodule, areas of indurations, or asymmetry in the size of the lateral lobes. immediately before pb, an 8ml venous blood sample was taken in a tube containing edta (beckinson - vacutainer). samples were maintained at 4c and processed within 48 hours. the prostate biopsy and cpc detection were independently analyzed, with the evaluators being blinded to the clinical details and results of the biopsy or cpc test. mononuclear cells were obtained by differential centrifugation using histopaque 1.077 (sigma - aldrich), washed and resuspended in 100 l of autologous plasma. 25 l aliquots was used to make slides (silianized, dako, ca usa), dried in air for 24 hours, and fixed in a solution of 70% ethanol, 5% formaldehyde and 25% phosphate buffered saline ph 7.4. cpcs were detected using a monoclonal antibody directed against psa, clone 28a4 (novocastra laboratory, uk), and identified using an alkaline phosphatase - anti alkaline phosphatase - based system (lsab2, dako, usa), with new fuschin as the chromogen. positive samples underwent a second process with anti - p504s clone 13h4 (dako, usa) and identified with a peroxidase - based system (lsab2, dako, usa) with dab (3,3diaminobenzidine tetrahydrochloride) as the chromogen, according to the manufacturers ' instructions. a cpc was defined according to the criteria of (international society of hematotherapy and genetic engineering) ishage and the expression of p504s according to the consensus of the american association of pathologists. a malignant cpc was defined as a cell that expressed psa and p504s and a benign cpc as a cell that expressed psa but not p504s, and leucocytes could be p504s positive or negative but did not express psa (figures 1(a)1(c)). the discrimination of the detection of benign cpcs was defined using the normal parameters : true positive (tp), false positive (fp), false negative (fn), and true negative (tn). the predictive values, positive (ppv), and negative (npv) were evaluated, as well as the positive and negative likelihood ratios (+ lr and lr, resp.). descriptive statistics were used for demographic variables, expressed as mean and standard deviation in case of continuous variables with a normal distribution. in case of an asymmetrical distribution, the median and interquartile range (iqr) values were used. student 's t - test was used to compare continuous variables with a normal distribution, the mann - whitney test for ordinate and continuous variables with a nonnormal distribution, and chi - squared for the differences in frequency. the diagnostic yield for the test - detecting benign cpcs for this purpose patients were classified as having or not having prostate cancer. for the purpose of the use of the number of mcpcs detected / ml as a diagnostic tool, and only as a mathematical exercise, the number of mcpcs / ml was considered as a continuous variable. analysis was performed using the stata 11.0 program (statacorp lp, college station, tx, usa). the mean age was 65.6 8.9 years and the median serum psa was 5.20 ng / ml (interquartile range (iqr) 4.317.30 ng / ml). a total of 21(5.9%) men had cpcs p504s negative detected (table 1). the presence of p504s negative cpcs had a sensitivity of 9.29% (95% ci 5.8513.85%) of detecting benign disease with a specificity of 100% (95% ci 96.78100.00). the positive predictive value for benign disease was 100% (95% ci 83.75100.00%) and the negative was predictive value 35.74% (95% ci 30.4841.23%). the prevalence of benign disease (no cancer) was 61.67% (95% ci 61.6871.47%). of the men with prostate cancer detected on biopsy, none had cpcs psa (+) p504s () detected. the pathology report was defined as benign hyperplasia, benign hyperplasia with small foci of chronic prostatitis, or hyperplasia benign with chronic prostatitis. cpcs psa (+) p504s () were associated with chronic prostatitis, with the frequency of benign cpcs being detected in 226 biopsies without evidence of prostate cancer, being 1/98 (1.0%) benign hyperplasia, 4/89 (4,5%) benign hyperplasia with small foci of chronic prostatitis, and 16/39 (41.0%) of men with benign hyperplasia with chronic prostatitis. chi - squared for trends, p < 0.0001, with an overall risk of 1.00, 4.51, and 82.00, respectively. it has been considered that only cancer cells have the ability to disseminate or migrate into the circulation. however, these results and those published by pantel. suggest that benign inflammatory disease cells can escape into the circulation. the diagnosis of positively tested patients for psa positive cpcs was based according to the strict criteria defined by ishage with internal positive and negative controls. this finding is consistent with the fact that inflammatory cytokines can stimulate the migration of epithelial cells. with respect to prostate cancer and the role of cpcs in its detection or in patients ' pretreatment, the potential background of nonmalignant prostate cells in blood may be an important confounding factor and lead to false - positive findings in cpc diagnostics. the fact that these benign cpcs do not express p504s is important. in published studies using cpcs as a sequential test to detect prostate cancer, double immunostaining was used, only cpcs psa (+) p504s (+) were considered to be malignant, whereas cells psa (+) p504s () were considered to be benign and patients were classified as negative for cancer. the results suggest that although p504s () cpcs are specific for benign disease, they are not sensitive in its detection ; however, there is no association with the presence of a cancer. this has implications on systems based on epcam, cytokeratin, or psa alone and may explain why no significant differences were found on the frequency of cpcs detected in early prostate cancer and controls [1315 ]. similarly using rt - pcr, 8% of patients with benign prostatic disease had cpcs detected. in men after radical prostatectomy, there are no native prostate cells ; thus all cpcs detected in blood have disseminated from metastatic microfoci and thus clinically represent cancer cells. this may explain why after primary surgery the use of epcam-, cytokeratin- or psa - based markers is associated with prognosis and survival. however, after radiotherapy or brachytherapy with residual normal prostate tissue, this may not be the case. the fact that men with benign prostate cells detected did not have prostate cancer in the second or third biopsies decreases the possibility that some of these false - positive events were actually tumor cells arising from undetected cancer. however, in other tumors such as colon or breast where there is normal tissue present, this may cause clinical uncertainty as there is no marker such as p504s to differentiate between benign and malignant. this study stresses the need that cpc detection, and by inference ctc detection used as a screening test or in patients with normal tissue remaining after primary treatment, should be further classified to determine their malignant state. in prostate patients, the use of double immunomarcation with p504s permits this differentiation and allows the test to be used in patients ' pretreatment. in other cancers, the use of epcam- or cytokeratin - based methods does not permit this differentiation, given that most patients with benign inflammatory diseases have an excellent prognosis and will not develop cancer. in summary, patients with chronic prostatitis may have circulating prostate cells detected in blood, which do not express the enzyme p504s and should be thought of as benign in nature. in other cancers, the presence of benign inflammatory tissue may cause migration of benign cells into the blood and thus cause false - positive findings. | introduction. developments in immunological and quantitative real - time pcr - based analysis have enabled the detection, enumeration, and characterization of circulating tumor cells (ctcs). it is assumed that the detection of ctcs is associated with cancer, based on the finding that ctcs can be detected in all major cancer and not in healthy subjects or those with benign disease. methods and patients. consecutive men, with suspicion of prostate cancer, had blood samples taken before prostate biopsy ; mononuclear cells were obtained using differential gel centrifugation and cpcs detecting using anti - psa immunocytochemistry. positive samples underwent further classification with anti - p504s. results. 329 men underwent prostate biopsy ; of these men 83 underwent a second biopsy and 44 a third one. of those with a biopsy negative for cancer, 19/226 (8.4%) had cpcs psa (+) p504s () detected at first biopsy, 6/74 (8.1%) at second biopsy, and 5/33 (15.2%) at third biopsy. men with cancer - positive biopsies did not have psa (+) p504s () cpcs detected. these benign cells were associated with chronic prostatitis. conclusions. patients with chronic prostatitis may have circulating prostate cells detected in blood, which do not express the enzyme p504s and should be thought of as benign in nature. |
endoscopic mucosal resection (emr) is an endoscopic alternative to surgical resection of mucosal and submucosal neoplastic lesions and intramucosal cancers. lesions limited to the mucosa and the superficial layers of the submucosa appear to be the most amenable to endoscopic cure. the techniques for emr can be broadly divided into two groups : suction and non - suction techniques. this topic will provide an overview of useful accessories for colorectal emr such as cap and band. this technique is most commonly performed with a transparent cap (disposable distal attachment ; olympus, tokyo, japan) attached to the tip of the endoscope. cap - assisted colonoscopy (cac) uses a transparent plastic hood attached to the tip of the colonoscope to flatten the semilunar folds and improve mucosal exposure. several studies have examined that cac facilitated shortening of the cecal intubation time in difficult cases, and was more sensitive for detecting adenomas than was conventional colonoscopy.1,2 a meta - analysis and systemic review suggests that a transparent cap on the end of the colonoscope may give a marginally faster cecal intubation time compared with standard colonoscopy. it also suggests that there is a better polyp detection rate and less pain with the cap.3,4 cac may reduce the time required for colonoscopic emr of each polyp and may also improve the polyp detection rate.5 this technique is most commonly performed using a distal attachment fitted to the distal end of the endoscope, with saline solution with a low concentration of epinephrine injected underneath the lesion. the lesion was snared and drawn into the cap using the suction function of the endoscope, and then ligated and resected using electrocautery. the most serious complication of this technique may be perforation due to the lack of submucosal saline injection and too much suction. therefore, large volume injection, which creates a large bleb and potentially reduces the risk of perforation, is recommended.6 moreover, emr using a cap (emr - c) is effective at removal of carcinoid tumor which is diagnosed increasingly each year. it is widely accepted that rectal carcinoid tumors with a diameter of 10 mm or less can be treated with local excision, including endoscopic resection.7 complete resection of rectal carcinoid tumors, however, is difficult to achieve with conventional endoscopic resection techniques because these tumors often extend into the submucosa. resection via polypectomy or conventional emr is often associated with resection margin involvement, which necessitates further intervention.8,9 the rate of positive resection margin for tumor is lower in the group of emr - c than conventional polypectomy group.10 - 12 and secondary endoscopic treatment for remnant lesions of rectal carcinoid tumors after primary emr or polypectomy is technically difficult because of fibrosis of the residual tissues. emr - c, a method to resect the submucosal layer by suction by using a transparent cap, may be feasible as a salvage treatment a variation of the suction technique is the band and snare procedure. during the band (endoscopic ligator ; conmed, new york, ny, usa) and snare procedure, tissue is banded using an esophageal variceal banding device and then snared off in the standard fashion.14 after submucosal injection beneath the lesion to elevate it away from the muscularis propria, the lesion was aspired into the ligator device and the elastic band was then deployed. next, snare resection was performed below the band with a blended electrosurgical current (fig. the resection specimen was then removed by aspiration into the cap or by retrieving it with a grasping forceps. after resection of the specimen, the ulcer floor was endoscopically closed with clips to prevent postoperative bleeding and perforation. as with emr - c, complete resection of rectal carcinoid tumor is important but is difficult to achieve with conventional endoscopic resection techniques because these tumors often extend into the submucosa. resection via polypectomy or conventional emr is often associated with resection margin involvement. among various endoscopic resection techniques, endoscopic submucosal resection with a ligation device (cac is more sensitive for detecting adenomas and may reduce the time required for colonoscopic emr of each polyp. emr - c and emr with a ligation device (or esmr - l) may be a superior method to conventional emr for removing small rectal carcinoids. | endoscopic mucosal resection (emr) is an endoscopic alternative to surgical resection of mucosal and submucosal neoplastic lesions. prior to the development of knives, emr could be performed with accessories to elevate the lesion. after the development of various knives, en bloc resection was possible without other accessories. so, recently, simple snaring without suction or endoscopic submucosal dissection using knife in the epithelial lesions such as adenoma or early mucosal cancer has been performed. however, for easy and complete resection of subepithelial lesions such as carcinoid tumor, a few accessories are needed. complete resection of rectal carcinoid tumors is difficult to achieve with conventional endoscopic resection techniques because these tumors often extend into the submucosa. the rate of positive resection margin for tumor is lower in the group of emr using a cap (emr - c) or emr with a ligation device (emr - l) than conventional emr group. emr - c and emr - l (or endoscopic submucosal resection with a ligation device) may be a superior method to conventional emr for removing small rectal carcinoid tumors. |
ulcers are an open sore of the skin or mucus membrane characterized by sloughing of inflamed dead tissue. ulcers are lesions on the surface of the skin or a mucous membrane characterized by a superficial loss of tissue. ulcers are most common on the skin of the lower extremities and in the gastrointestinal tract, although they may be encountered at almost any site. there are many types of ulcer such as mouth ulcer, esophagus ulcer, peptic ulcer, and genital ulcer. of these peptic ulcer. the two most common types of peptic ulcer are called gastric ulcer and duodenal ulcer. gastric ulcers are located in the stomach, characterized by pain ; ulcers are common in older age group. although patients with gastric ulcers have normal or diminished acid production, yet ulcers may occur even in complete absence of acid. duodenal ulcers are found at the beginning of small intestine and are characterized by severe pain with burning sensation in upper abdomen that awakens patients from sleep. a duodenal ulcer is more common in younger individuals and predominantly affects males. in the duodenum, peptic ulcer can be life threatening with symptoms like bloody stool, severe abdominal pain, and cramps along with vomiting blood. the pathophysiology of peptic ulcer disease involves an imbalance between offensive (acid, pepsin, and helicobacter pylori) and defensive factors (mucin, prostaglandin, bicarbonate, nitric oxide, and growth factors). peptic ulcers are once believed to be caused by spicy food and stress ; these have been found merely to be aggravating factors and the real causes have been found by research to include bacterial infection (helicobacter pylori) or reaction to various medications, particularly nsaids (nonsteroidal anti - inflammatory drugs). helicobacter pylori, nsaids drugs, emotional stress, alcohol abuse, and smoking are the principal etiological factors associated with peptic ulcer. the gram - negative bacterium helicobacter pylori remains present between the mucous layer and the gastric epithelium and is strategically designed to live within the aggressive environment of the stomach. initially, helicobacter pylori resides in the antrum but over time migrates toward the more proximal segments of the stomach. peptic ulcer is one of the world 's major gastrointestinal disorders and affecting 10% of the world population. annual incidence estimates of peptic ulcer hemorrhage and perforation were 19.457 and 3.814 per 100,000 individuals, respectively. the average 7-day recurrence of hemorrhage was 13.9% and the average long - term recurrence of perforation was 12.2%. in the indian pharmaceutical industry, antacids and antiulcer drugs share 6.2 billion rupees and occupy 4.3% of the market share. in this modern era also 7580% of the world populations still use herbal medicine mainly in developing countries, for primary health care because of better cultural acceptability, better compatibility with the human body, and lesser side effects. preliminary photochemical screening of this medicinal plant identified the presence of important secondary metabolites like flavonoids and tannins which are the active principles of antiulcer activity. present study was conducted to review medicinal plants considered as gastroprotective and healing agents on ulcers in ayurvedic resources and beside that to gather evidence for their effectiveness and biological mechanisms in modern investigation. in order to achieve this aim, indian ayurvedic book meteria medica and electronic databases including science direct, pubmed, scopus, and google scholar were explored for each of the medicinal plants for peptic ulcers and all retrieved articles were evaluated to achieve any in vitro, in vivo, or clinical evidence for their efficacy and possible mechanisms. the retrieved studies either demonstrate obviously effectiveness of these herbs or indirectly their efficacy on the involved mechanisms in the treatment of peptic ulcers. meteria medica provides lots of information about ethno medicinal herbs, which are valuable as antiulcer agents and their use experimentally was evaluated and proved by many researchers for its antiulcer activity. following compiled data acacia arabica (family mimosaceae), is common all over india in dry and sandy localities. it is commonly known as babul tree and locally called as karuvelam. chemical constituents reported in this plant are gum containing arabic acid combined with calcium, magnesium, and potassium and also small quantity of malic acid, sugar, moisture 14%, and ash 3 - 4%. bark contains a large quantity of tannin ; pods contain about 22.44% tannin. in ayurvedic. bruised tender leaves formed into a poultice and applied to ulcers act as stimulant and astringent. in recent studies. aqueous extract of a. arabica gum showed protection against meloxicam - induced intestinal damage and attenuated intestinal enzymes activity. adansonia digitata belonging to the family malvaceae is commonly known as boabab or monkey - bread tree of africa. it is one of the largest and long - lived trees in the world, met with chiefly in bombay, gujarat, and coromandal coast and ceylon. chemical constituents in this plant are pulp that contains phobaphenes, mucilage and gum, glucose, tartrate and acetate of potash, and other salts. bark contains wax, soluble and insoluble tannin, acid gum, albuminous carbonate and chloride of sodium and potassium, and a glucoside adansonin. in ayurvedic. fresh juice of the leaves mixed with powdered ginger together with the expressed juice of the fresh root of salvadora indica is applied with considerable benefit to indolent syphilitic ulcer. aegle marmelos which is commonly known as a bael tree belonging to the family rutaceae is the plant that chiefly grows on throughout india. chemical constituents in this plant are flavonoids, tannins, and saponins. in folk medicine. the fruit of a. marmelos is traditionally used for the treatment of ulcer among the kani tribes in kanyakumari district, tamil nadu, india. in recent studies. ulcers are induced by aspirin plus pylorus ligated gastric ulceration in rats and aqueous extract of leaves is to be administered orally for 21 days, daily dose of 1 gm / kg. the result indicated a significant reduction in the ulcer lesion count compared to control. allium sativum belonging to the family liliaceae is commonly known as garlic and locally called as vellapundu. chemical constituents in this plant arean acrid volatile oil which is the active principle, starch, mucilage, albumen, and sugar. the juice, more particularly its oil constituents, is rich in organically bound sulphur, iodine, and salicylic acid combinations, apart from important nutrient and complementary substances containing vitamins. in ayurvedic. mustard or coconut oil in which garlic has been fried is an excellent application for maggots infesting ulcers, ulcerated surfaces, and wounds. garlic juice mixed with 3 or 4 parts of ordinary or distilled water has been used as a lotion for washing wounds and foul ulcers. in recent studies. the extract of a. sativum bulb juice was administered at the doses of 250 and 500 mg / kg orally in rats, against cysteamine induced gastric ulcer. the extract significantly increases healing of gastric ulcer and prevents the development of experimentally induced gastric and duodenal ulcers in rats. active constituents. aloe vera belonging to the family liliaceae is commonly known as aloe gel. chemical constituents in this plant are aloin, isobarbaloin, and emodin. in ayurvedic. first the pain diminishes and after a few weeks the ulcers heal. in recent studies. aloe vera powder was mixed with gum acacia ; the solution was administered orally in rats at dose of 200 it is cultivated in gardens all over india which is locally called as sitapalam. chemical constituents in this plant are alkaloids, flavonoids, saponins, and tannins. seeds yield oil and resin ; seeds, leaves, and immature fruit contain an acrid principle. in ayurvedic. leaves made into a paste without adding water are applied to unhealthy ulcers. in recent studies. the aqueous leaf extract protected against pylorus ligation and ethanol induced gastric ulcer in rats. active constituents. azadirachta indica (family meliaceae) is indigenous to and cultivated nearly all over india and in bengal. chemical constituents reported in this plant are nimbidin, phenolic compounds, saponin, and flavonoids. the volatile fatty acids probably consist of a mixture of stearic and oleic acids with a small amount of lauric acid. in ayurvedic. a poultice of leaves mixed with sesamum seeds is very useful in unhealthy ulcerations. in recent studies. azadirachta indica leaf extract protected against pylorus ligation and cold restraint stress induced gastric ulcer in rats. active constituents. stearic and palmitic acid isolated from the nimbidin fraction of neem seeds oil is considered. it is grown on the sind, rajputana, eastern bengal, berars, assam, khandesh, and mysore which is locally called gukkulu. chemical constituents in this plant are volatile oil, gum - resin, and bitter principles. in ayurvedic. guggul gum is mixed with lime juice or coconut oil ; it is applied as a plaster or in the form of a lotion in indolent ulcers. gum obtained from other species, b. pubescens found in sind, karachi, and baluchistan, is used as ointment in bad ulcers such as delhi sores, combined with sulphur, catechu, and borax. bauhinia variegate (family caesalpiniaceae) is indigenous to and grow on the sub - himalayan tract and the forests of india and burma. it is commonly known as orchid tree and locally called shemmandarai. chemical constituents reported in this plant are quercetin, rutin, apigenin, and apigenin 7 - 0-glucoside. bark contains tannin (tannic acid), glucose, and a brownish gum. in ayurvedic. a preparation known as kanchanara guggula made of the following ingredients is useful in ulcers : take the bark of bauhinia variegate (10 parts), 3 myrobalans, ginger, black - pepper, long - pepper, bark of crataeva nurvala, cardamoms, cinnamon, and tejpatra leaves, each one part. powder them all and add guggula (15 parts) to make a pill mass. this is given in doses of half a tola every morning with a decoction of sphaeranthus mollis or of triphala or of catechu. the ethanolic and aqueous extract of root of b. variegate was administered at the doses of 200 and 400 mg / kg orally, in rats against pylorus ligation, ethanol, and aspirin induced gastric ulcer. the extract significantly inhibited gastric mucosal damage and reduced the basal gastric acid secretion. berberis aristata (family berberidaceae) is grown on the nilgiris and all over the temperate himalayas, from bhutan to kunawer. chemical constituents reported in this plant are roots and wood which are rich in a yellow alkaloid berberine bitter substance, which dissolves in acids and forms salts of the alkaloid ; root contains two more alkaloids. in ayurvedic. crude extracts known as rasaut (in hindi) are prepared from the root ; bark mixed with honey is useful application to ulcerations of the skin. it is native of the sea - coasts of tree mediterranean, now extensively cultivated in europe and america, and is known as sugar - beet. it is also cultivated in gardens in many parts of india for the sake of its flesh roots and leaves. chemical constituents in this plant are an active principle betin. in ayurvedic. a decoction of the root with a little vinegar added is excellent for all kinds of ulcers and running sores. leaves made into a pulp and used as poultice 3 to 4 times a day rapidly heal obstinate ulcers. in recent studies. the ethanol stem bark extract of c. arborea was administered at the doses of 300 and 600 mg / kg orally in rats for 5 days against ethanol, cold restraint stress, and pylorus ligation induced ulcer models. the extract significantly increases healing of gastric ulcer as compared to control. chemical constituents in this plant are papain, chymopapain, pectin, carposide, carpaine, carotenoids, and antheraxanthin. in folk medicine the unripe fruit can be cooked as parts of salads, jellies, and stews while the ripe fruits are usually eaten raw without the skin or seed. intake of the unripe fruit of the plant has been linked with an antiulcer effect. in recent studies. the aqueous seed extract of c. papaya was administered at the doses of 50 and 100 mg / kg orally, in rats against ethanol induced gastric ulcer. the extract protected the gastric mucosa against ethanol effect. c. papaya extract significantly reduced the gastric juice volume and gastric acidity. active constituents. chymopapain and papain are widely known as being useful for digestive disorders and disturbances of the gastrointestinal tract. chemical constituents in this plant are euphorbon, resin, gum, caoutchouc, malate of calcium, and so forth. in ayurvedic. plant juice is largely used with clarified or fresh butter as an application to unhealthy ulcers and scabies. this sacred peepul is a large tree round wild and cultivated all over india by the hindus. chemical constituents in this plant are bark containing tannin, caoutchouc (cochtone), and wax. in ayurvedic. bark is useful in ulcers in infusion or decoction (simple kashayam) with a little honey. in recent studies. the hydro alcoholic extract leaves of f. religiosa were studied at two dose levels (250 and 500 mg / kg, oral) in rats against absolute ethanol, aspirin, and pylorus ligation induced gastric ulcer. chemical constituents in this plant are yields gum, a trace of albumen and colouring matter, ash containing a trace of manganese, brown resin and chlorophyll and a principle allied to quercetin or querritrin, and glucoside rutin. in ayurvedic. it is native to china and grown widely as an ornamental plant through india. chemical constituents in this plant are flavonoids, anthocyanins, quercetin, cyanidin, kaempferol, and hydrocitric acid. in folk medicine. the root of h. rosa sinensis is traditionally used for the treatment of ulcer among the kani tribes in kanyakumari district, tamil nadu, india. in recent studies. the aqueous and alcohol extracts of h. rosa sinensis roots possessed significant antiulcer activity in pylorus ligated rats at the doses of 250 and 500 mg / kg. thus, it has been scientifically proven that these extracts possess enough potential as an antiulcerogenic agent. this small weed is common all over india, growing plentifully in moist localities. chemical constituents in this plant are an oleaginous white crystalline substance vellarin which is the active principle of the leaves, resins and some fatty aromatic body, gum, sugar, tannin, albuminous matter, and salts, mostly alkaline sulphates. in ayurvedic. for ulcerations, the powder, in 3 to 5 grain doses, may be given thrice daily ; at the same time some of the powder may be sprinkled on the ulcers or preferably poultices of the fresh leaves may be applied. this small erect shrub is cultivated extensively in northern india, especially in bengal, bihar, orissa, sind, oudh, southern india, madras, and bombay. chemical constituents in this plant are indican (a glucoside), the oxidized form of luc - indigo, or indigo - white, what is produced from the fermentation of the fresh green plant. in ayurvedic. leaves crushed are used as stimulant poultice or plaster in various skin affections and to cleanse and to heal wounds and ulcers. it is common all over india, cultivated chiefly as a hedge and garden plant. chemical constituents in this plant are leaves that yield a colouring matter (henna dye) 12 to 15% hanno, tannic acid, a kind of tannin, and an olive green resin soluble in ether and alcohol. chemical constituents in this plant are alkaloids, sterols, saponins, tannins, and flavonoids. in ayurvedic. leaf extracts were dissolved in rice bran oil and given orally for ulcer. traditionally the plant is reported to have antiulcer activity. in recent studies. the flower decoction was administered in the doses of 250, 500, and 1000 mg / kg orally, in rats with gastric lesions in dose - dependent manner. chemical constituents in this plant are flavonoids, quercitin, naringin, saponins, tannins, gums, and mucilage. in ayurvedic. decoction of the fresh leaves and seeds are consumed for intestinal ulcer. in recent studies. ethanolic extract of the leaves of mimosa pudica have been reported to possess antiulcer activity in a dose - dependent manner and these leaf extracts may be useful as a natural antioxidant in treatment of ulcer. active constituents. chemical constituents in this plant are bitter glucoside soluble in water and insoluble in ether, a yellow acid, resin, and ash 6%. fresh vegetable contains 88.75% moisture, albuminoids 1.62%, soluble carbohydrates 85.41%, woody fiber 1.51%, and ash 8.53%. in ayurvedic. whole plant powdered is used for dusting over leprous and other intractable ulcers and in healing wounds ; when mixed with cinnamon, long pepper, rice, and chaulmugra oil it forms a good ointment in malignant ulcers. in recent studies. alcoholic and aqueous extract of m. charantia fruit at the doses of 200 and 400 mg / kg separately are used against pylorus ligation, aspirin, and stress induced ulcer in rats. moringa oleifera (moringaceae) is commonly known as drum - stick, horse radish tree. it is native to the western and sub - himalayan region, india, pakistan, asia minor, africa, and arabia. chemical constituents in this plant are alkaloids, flavonoids, saponin, tannins, zeatin, quercetin, kaempferom, and terpenoids. in folk medicine. the medicinal value of the different parts of the plant has long been recognized in folklore medicine. the leaf tea treats gastric ulcers by kani tribals of pechiparai hills, tamil nadu, india. flower buds of m. oleifera are widely consumed in pakistan and have been reported to possess antiulcer activity. in recent studies. the alcoholic leaves extract of m. oleifera was administered in the doses of 125, 250, and 500 mg / kg orally, in rats against pylorus ligation, ethanol, cold restraint stress, and aspirin induced gastric ulcer. myrica nagi (myricaceae) is commonly known as box myrtle ; bay - berry. it is an evergreen plant of the subtropical himalayas, simla district, syihet, and southwards to singapore and found also in the khasia mountains and the hills of burma. chemical constituents in this plant are bark that contains tannin, saccharine matter, and salts. the ground bark yields a colouring principle named myricotin. in ayurvedic. a poultice made by bruising the bark and simmering it in water and stirring in indian meal till it obtains the proper consistence cures scrofulous ulcers (tukina). fruits when boiled yield a kind of wax called myrtle wax which is used as a healing application to ulcers. chemical constituents in this plant are ripe berries that contain an essential volatile oil (oil of myrtle), resin, tannin, citric acid, malic acid, and sugar.. in ayurvedic the fruit, myrtle berry, is carminative and given in the form of infusion for internal ulcerations. in recent studies. a topical formulation of m. communis in low doses demonstrated wound healing activity in rat excision wounds. m. communis fruits protected against gastric ulcer caused by ethanol, indomethacin, and pylorus ligation in rats via suppressing gastric secretion and acidity and enhancing its mucosal barrier. active constituents. chemical constituents in this plant are alkaloids, tannins, saponins, flavonoids, and sterols. in ayurvedic. a tea prepared with the leaves of tulsi is commonly used for intestinal disorders. in recent studies. the fixed oil of o. sanctum was administered in the doses of 1, 2, and 3 ml / kg intraperitoneally, in the rats in which ulcer is induced by aspirin, indomethacin, alcohol, and stress - induced ulceration. it is cultivated generally in hotter parts of india.chemical constituents in this plant are barks that contain tannin and ash that contains considerable quantity of potassium carbonate. in ayurvedic. this is a principal food crop of india, ceylon, burma, china, japan, and siam and is spread over the tropical and subtropical regions of both hemispheres. chemical constituents in this plant are rice that contains more starch than any other starchy grains, but no appreciable fat, a very small quantity of proteins, and a trace of mineral matter. in ayurvedic. where there is an irritable or inflammatory state of the stomach, rice gruel or conjee water, as it is commonly called, (decoction 1 in 40) or thicker liquid made by boiling the rice powder in water, with a pinch of salt and a squeeze of lemon, makes a good drink and without the lime - juice and salt in gastric ulcer. schnabel in american journal of medical science reports good results from the use of rice - water mixture in the treatment of gastric and duodenal ulcers. in recent studies. the extract of o. sativa bran (rice bran oil) was administered at the dose of 1 ml / day for 4 days against swimming stress induced and pylorus ligation induced ulcer in rats. chemical constituents in this plant are fruits that contain an essential oil of a light yellow colour. in ayurvedic. infusion (1 in 10) of fruit is used in doses of 12 to 1 ounce like that of fennel seeds as carminative, gastric and intestinal disorders, and so forth,. phyllanthus niruri (euphorbiaceae) is commonly known as stonebreaker or seed - under - leaf. chemical constituents in this plant are alkaloids, saponins, tannins, flavonoids, carbohydrates, and glycosides. in ayurvedic. whole plant pounded with its root and combined with rice water is used as poultice for ulcers. in recent studies. the metanolic aerial part extract of p. niruri was administered at the dose of 400 mg / kg orally in rats and significantly inhibited the development of ulcer induced by indomethacin. active constituents. alkaloids-4-methoxy - securinine, ellagic acid, beta sitosterol, gallic acid, and hypophyllanthin are considered. pinus longifolia (coniferae) is commonly known as long - leaved pine. it is common on the slopes of the himalayas, north western frontier province from afghanistan to kashmir, the punjab, u.p. to bhutan, assam, and upper and lower burma. chemical constituents : its sapwood yields on incision an oleoresin from which turpentine is obtained which contains 20% volatile oil of turpentine called pinene with a small quantity of limonene and about 80% of residue which is very largely used under the name of calophony or resin. in ayurvedic. wood is useful to cool the burning sensation of the body and as an application in ulcerations. it is the source of the resin usually employed as a stimulating application for ulcers. this persian herb is found also in north - west india, the punjab, and sind and cultivated to a small extent in bengal, mysore, and coromandel coast. the genus plantago comprises about 50 species, of which ten are natives of india. chemical constituents in this plant are mucilage, fixed fatty oil, and albuminous matter, in large quantities. in ayurvedic. the decoction in doses of 2 to 3 drachms, plain or mixed with sugar, is very beneficial in gastritis, gastric, and duodenal ulcers. chemical constituents in this plant are bark that contains tannin 27.4%, resin, and crystals of calcium oxalate. leaves contain resin, fat, cellulose, tannin, volatile oil, chlorophyll, and mineral salts. in ayurvedic. locally, decoction of the leaves is employed in unhealthy ulcers and is an efficacious gargle for swollen gums and ulceration of the mouth. in recent studies. the methanol leaf extract of p. guyava was administered at the doses of 500 and 1000 mg / kg orally, in rats for 10 days against ethanol induced gastric ulcer. chemical constituents in this plant are ellagic acid, gallic acid, isoquercitrin, myricitrin, and tannic acid. in ayurvedic. it is generally used in the form of powder or extract ; dose of the powder is 20 to 30 grains. locally the paste mixed with charcoal powder is applied to unhealthy ulcers. in recent studies. the hydro alcoholic extract of r. coriaria was administered at the doses of 145 and 248 mg / kg orally in rats against ethanol induced gastric ulcer. it is an ornamental plant and is found in the plains of western himalayas to sri lanka. chemical constituents in this plant are saponins, tannins, and triterpenes. in folk medicine. sesbania grandiflora leaves prepared in the form of soup and taken orally by the valaiyan tribe of alagarkoil hills, madurai district, tamil nadu, india, are used as vermifuge and against peptic ulcer. 50 ml of leaf decoction is taken orally on an empty stomach as vermifuge and against stomach ailments by tribal and rural people of sirumalai hills, dindigul district, tamil nadu, india. leaves are boiled in cow milk and orally taken in kikuku village, muleba district, tanzania, for treatment of peptic ulcers. the boiled leaves are taken orally for ulcer by paliyar tribals in dindigul district of tamil nadu, india. in recent studies. the ethanol leaf extract of s. grandiflora was administered at the dose of 400 mg / kg orally, in rats against aspirin, ethanol, and indomethacin induced gastric ulcer. the extract significantly inhibited gastric mucosal damage and reduced the basal gastric acid secretion. active constituents. tannins and saponins it is common in the sub - himalayan regions and the forests of western bengal. chemical constituents in this plant are ursolic acid, tri and tetrehydroxy ursenoic acid, asiatic acid alpha and beta amyrin, and mangiferonic acid uvaol. in ayurvedic. take s. robusta : 5, cinnabar : 2, mastiche : 3, calamus draco : 3, and ghee (10 parts). mix and make an ointment ; it is used for foetid ulcers. in recent studies. the extract of s. robusta was administered at the doses of 150 and 300 mg / kg orally in rats against ethanol and pylorus ligation induced gastric ulcer. the extract significantly increases the gastroprotective activity as compared to control. active constituents. chemical constituents in this plant are alkaloids, saponins, flavonoids, and phytosterols. in folk medicine. the fresh leaves are consumed for intestinal ulcer by paliyar tribals in dindugal district, tamil nadu, india. in recent studies. aqueous leaf extract of solanum nigrum protected against pylorus ligation induced gastric ulcers in rats. active constituents. this evergreen tree which is indigenous to south india is cultivated throughout india and burma. chemical constituents in this plant are pulp that contains tartaric acid 5%, citric acid 4%, malic and acetic acids, tartaric of potassium 8%, invert sugar 2540%, gum, and pectin. seeds contain albuminoids, fat, carbohydrates 63.22%, fibre, and ash containing phosphorus and nitrogen. decoction of the leaves is used as a wash for indolent ulcers and promotes healthy action. in recent studies. the methanolic extract of the seed coat of t. indica at doses of 100 and 200 mg / kg significantly reduces the total volume of gastric juice and free and total acidity of gastric secretion in pylorus ligation induced ulcer model as compared to control. active constituents. terminalia chebula (combretaceae) is commonly known as myrobalan ; ink - nut ; gullnut. this tree is wild in the forests of northern india, central provinces, and bengal and common in madras, mysore, and in the southern parts of the bombay presidency. chemical constituents in this plant are tannin (tannic acid) 45% and a large amount of gallic acid, lucilage, a brownish yellow colouring matter, and chebulinic acid which when heated in water splits up into tannic and gallic acids. in ayurvedic. ashes of triphala mixed with sindhu salt (saindhava, that is, potassium nitras or nitricum) are dusted over syphilitic ulcers for washing away the exudation from the ulcers. equal parts of dried myrobalans in combination with emblic and beleric myrobalans and catechu, both finely powdered and rubbed into a thick paste with sufficient ghee or some bland oil, make an excellent ointment as an application to aphthae for chronic ulcerations and ulcerated wounds. in recent studies. methanolic extract of t. chebula was administered in the doses of 250 and 500 mg / kg orally. the extract showed significant reduction in gastric volume, free acidity, and ulcer index as compared to control. some of the herbal drugs have been chemically characterized and the entities involved in the activity have been isolated. these are summarized in table 1. from this study we can conclude that studies with plant sources can result in novel and effective pattern of treatment. current stalemates of modern medicine in the management of various ailments incline research tendencies to traditional medicine. in this respect, all of the remedies presented here had adequate evidence from traditional or scientific source for their efficacy in management of ulcers. according to the old hypothesis, acid secretion was thought to be the sole cause of ulcer formation and reduction in acid secretion was thought to be the major approach towards therapy. now treatment of ulcer mainly targets the potentiation of the defensive system along with lowering of acid secretion. chemical substances derived from plants have been used to treat human diseases since the dawn of medicine. roughly 50% of new chemical entities introduced during the past two decades are from natural products., efforts should be directed towards isolation and characterization of the active principles and elucidation of the relationship between structure and activity. there are various medicinal plants and their extracts (containing active chemical constituents, e.g., tannins and flavonoids) that have significant antiulcer activity in in vivo experiments on animal models. furthermore, detailed analysis of the active constituents of natural drugs should be directed towards clinical relevance. although the clinical efficacy of these preparations is reported by traditional practices, they have not been scientifically validated. ayurveda, the oldest medicinal system in the world, provides leads to find therapeutically useful compounds from plants. therefore, ayurvedic knowledge supported by modern science is necessary to isolate, characterize, and standardize the active constituents from herbal sources for antiulcer activity. the combination of traditional and modern knowledge can produce better drugs for the treatment of peptic ulcer with fewer side effects. it is apparent that experimental evaluation of herbal drugs for the treatment of gastric ulcer is rather impressive but very few have reached clinical trials and still few have been marketed. this shows that the benefits of research are not reaching the people to whom medical research is directed and hence the time, manpower, and resources are not efficiently utilized. hence, pharmacologists need to take more active interest in evaluation of herbal drugs for potential antiulcer activity and standardization of such herbal drugs to be clinically effective and globally competitive. | ulcer is a common gastrointestinal disorder which is seen among many people. it is basically an inflamed break in the skin or the mucus membrane lining the alimentary tract. ulceration occurs when there is a disturbance of the normal equilibrium caused by either enhanced aggression or diminished mucosal resistance. it may be due to the regular usage of drugs, irregular food habits, stress, and so forth. peptic ulcers are a broad term that includes ulcers of digestive tract in the stomach or the duodenum. the formation of peptic ulcers depends on the presence of acid and peptic activity in gastric juice plus a breakdown in mucosal defenses. a number of synthetic drugs are available to treat ulcers. but these drugs are expensive and are likely to produce more side effects when compared to herbal medicines. the literature revealed that many medicinal plants and polyherbal formulations are used for the treatment of ulcer by various ayurvedic doctors and traditional medicinal practitioners. the ideal aims of treatment of peptic ulcer disease are to relieve pain, heal the ulcer, and delay ulcer recurrence. in this review attempts have been made to know about some medicinal plants which may be used in ayurvedic as well as modern science for the treatment or prevention of peptic ulcer. |
we report here a case of prolonged fever post infected pacemaker (pm) and lead extraction, with late diagnosis of a retained lead in the right subclavian vein and superior vena cava, whose removal resulted in clinical resolution. a 49-year - old man underwent removal of a pm due to infective endocarditis. in this procedure, the electrodes were left in place and the pm was implanted on the contralateral site. after 2 weeks, the patient was readmitted with sepsis related to the cardiac device, which was completely removed followed by the implantation of an epicardial pm. as the patient continued to have fever, he was referred to the university hospital, federal university of minas gerais, belo horizonte, brazil, which is a tertiary care center. extensive workup for fever of unknown origin did not clarify the cause of the fever, which remained in spite of the use of different antibiotics including agents to cover enteroccocus sp that was isolated from the blood cultures. a vascular duplex scan was performed and showed the presence of an endovascular foreign body in the right subclavian vein and superior vena cava associated with thrombus. the diagnosis was confirmed by computed tomography (ct) (fig. 1). the patient underwent endovascular removal of the foreign body, which was identified as the distal part of the right ventricular lead, measuring about 10 cm long. after the procedure, he presented clinical and laboratory improvement consistent with complete resolution of the infection, and was discharged from the hospital after completing 28 days of antibiotic therapy guided by blood culture. from the last decades, the indications for implant of cardiac electronic devices continue to expand. as a result, we have observed increasing complications related to the removal of these devices. in spite of the evolution of the extraction techniques from simple traction to extraction with dilators, powered sheaths and laser assistance, percutaneous removal of the device leads is still associated with morbidity and mortality, though in a small proportion of cases,. the more frequent indications for cardiac device extraction are lead dysfunction, pocket infection and systemic infection, and the rate of successful lead remove is over 94%,,. procedural - related major complications include death, cardiac and/or vascular avulsion, pulmonary embolism, stroke, and pacing system - related infection of a previously non - infected site. pericardial effusion or hemothorax, hematoma at the surgical site, arm swelling or vein thrombosis, migration of lead fragment without any sequelae, and blood loss during surgery requiring blood transfusion are considered minor complications of lead extraction. death within 30 days from the extraction is also included among the outcomes of lead extraction procedures. our patient developed blood stream infection due to the persistence of the retained the distal part after percutaneous lead extraction coating cable of the pm associated with thrombus formation in the right subclavian vein and superior vena cava, which may be considered a major complication of lead extraction. as the lead extraction was performed in a low volume center, we hypothesized whether this fact could have contributed to the development of the complication. this possibility is reinforced by the results of a recent meta - analysis, in which the outcome of lead extraction was evaluated according to the center experience based on the volume of procedures carried out (low, medium, and high volume centers), demonstrating that procedure volume is a major determinant of outcomes of transvenous lead extraction. the diagnosis of the cause of the infection presented by our patient was challenging especially because of the lack of local manifestations. the absence of these manifestations also contributed to overlooking the foreign body on imaging methods initially. indeed, we noticed the foreign body on ct scan only after the result of the vascular duplex scan. we conclude that a retained foreign body should be considered in the differential diagnosis of persistent fever after removing a pm system. firstly, it reinforces the need of examining the extracted material after lead extraction ; so that any missing fragment / coating can be identified and looked for. secondly, it shows the importance of having a detailed scheme of analysis of the imaging methods. vascular doppler and chest ct are part of the basic work up for such cases ; thus, a proper scheme of analysis of their results would have allowed diagnosing the presence of a retained foreign body at an earlier stage in our patient. | the implant indication of cardiac electronic devices continues to expand ; therefore, we have observed increasing complications related to their removal. we describe the case of a patient who presented with prolonged bloodstream infection after having undergone removal of a pacemaker. after extensive workup for fever of unknown origin and antibiotic therapy without any improvement, it was possible to demonstrate a foreign body in the right subclavian vein and superior vena cava corresponding to the distal part of the right ventricular lead. endovascular removal of the foreign body and prolonged antibiotic administration was followed by complete resolution of the clinical picture. we ascribed the difficulty in diagnosing the source of the infection especially to the lack of local manifestations. |
medicinal applications of metal complexes as therapeutic drugs have a more than 5000-year history. since the discovery of the anticancer activity of cisplatin by shimizu and rosenberg 35 years ago, there has been a rapid expansion in research to find new, more effective metal - based anticancer drugs. the major classes of metal - based anticancer drugs include platinum (ii), gold (i) and gold (iii), metalloporphyrin, ruthenium (ii) and ruthenium (iii), bismuth (iii), rhenium (i), and copper (ii) compounds. cisplatin represents one of the most potent drugs available in the cancer chemotherapy for several solid tumors, such as testicular, ovarian, bladder, and neck cancers. it is generally believed that cisplatin exhibited its anticancer effects through preferentially binding to quinine n-7 of dna, and then cause dna damage specifically in cancer cells, subsequently leading to cell death. after successes achieved with platinum complexes, there is a tremendous increase in the search for platinum complexes with different ligands that might produce more specific anticancer effects. some of these platinum - based drugs have been approved by the food and drug administration (fda), including carboplatin for the treatment of ovarian cancer [5, 6 ], oxaliplatin for metastatic colorectal cancer [7, 8 ], satraplatin for hormone - refractory prostate cancer, and picoplatin for small - cell lung cancer. transplatinum compounds follow different patterns of cell killing in comparison to cisplatinum, thus giving a reason for optimism in their development as a new class of platinum - based anticancer drugs. the initial report of anticancer properties of a dinuclear platinum complex in 1988 started a new paradigm in platinum - based chemotherapy. several multinuclear platinum complexes have entered clinical trials in recent years, with varying results [12, 13 ]. the major limitations of cisplatin and other platinum anticancer drugs are related to drug resistance and their side effects, including nephrotoxicity, neurotoxicity, and emetogensis. resistance to cisplatin is multifactorial, most cases consist of mechanisms limiting the formation of dna adducts or operating downstream of the cisplatin - dna interaction to promote cell survival. gold (i) complexes had been used for the treatment of arthritis some decades ago, but most of them disappeared from the drug market because of intolerable side effects, such as gastrointestinal adverse reactions, nephrotoxicity, and haematological reactions. however, the design and testing of gold complexes, especially gold (iii) complexes with anticancer activity begin to be intensively pursued in the past few years. the potential use of gold (iii) complexes as anticancer drugs were based on three rationales [1618 ] : (a) analogies between square planar complexes of both platinum (ii) and gold (iii) are d ions ; (b) analogy to the immunomodulatory effects of gold (i) antiarthritic agents ; and (c) complexation of gold (i) and gold (iii) with known anticancer agents to form new compounds with enhanced activity. buckley. first reported some organogold (iii) complexes endowed with significant cytotoxic and anticancer properties. during the past decades, various gold (iii) complexes with sufficient stability in the physiological environment have been synthesized and evaluated for in vitro anticancer properties. some of these gold (iii) complexes turned out to exhibit relevant cytotoxic effects in vitro and were the subject of further biochemical and pharmacological investigations [2033 ]. our previous findings showed that gold (iii) mesotetraarylporphyrin 1a was stable against demetallation in physiological conditions and exhibited higher cytotoxicity than cisplatin against a panel of human cancer cell lines [3437 ]. the major limitation of gold (iii) complexes is that few exhibit good stability under physiological conditions, due to the reduction of gold (iii) to gold (i). however, low cisplatin cross resistance has been observed in gold complexes. there is therefore considerable interest in the development of tumor - selective and stable gold anticancer drugs. metalloporphyrin drugs are new class of antioxidant enzyme mimetics with novel structure : a metal in the center of porphyrin ligand. metalloporphyrins (e.g., mntbap) have previously been used to inhibit age - related oxidative damage in myocardium of mice that are lacking mitochondrial enzyme manganese superoxide dismutase. afterwards, metalloporphyrin drugs began to be used as photodynamic therapy agents for certain solid tumors. photodynamic therapy is based on the concept that porphyrins are known to be rapidly and preferentially taken up by the tumor cells with higher intakes of lipoproteins [42, 43 ]. when such photosensitizers are irradiated with an appropriate wavelength of visible or near infrared (nir) light, the excited molecules can transfer their energy to molecular oxygen in the surroundings, which is normally in its triplet ground state. this results in the formation of cytotoxic reactive oxygen species (ross), particularly singlet oxygen. ross are responsible for oxidizing various cellular compartments including plasma, mitochondrial, lysosomal, and nuclear membranes, resulting in irreversible damage of tumor [34, 44 ]. therefore, under appropriate conditions, photodynamic therapy offers the advantage of an effective and selective method of destroying diseased tissues without damaging adjacent healthy cells [42, 43 ]. since the approval of photofrin by fda for chemotherapy, porphyrin derivatives with different metal in the center of the molecule have been widely used as photosensitizers for photodynamic therapy in the treatment of cancer, including chlorophyllin copper complex as superoxide dismutase mimics [46, 47 ], fetbap and mntbap [48, 49 ], zntbap, motexafin gadolinium (mgd). for example, mgd has been shown to inhibit heme oxygenase-1 (ho-1) activity that results in inactivation of the antiapoptotic properties of the products of ho-1. while fetbap and mntbap have been reported to be superoxide anion scavengers. mgd is also an active inhibitor of cytochrome p450 enzymes, although with a lower potency than that exhibited for inhibition of ho-1. in recent years, other approaches in the search for new, metal - based anticancer agents are to examine complexes that contain other transition metals. in the design of these new drugs, octahedral ruthenium (ii) and ruthenium (iii) complexes tetraammine-, pentaammine-, heterocycle-, and dimethylsulfoxide - coordinated ruthenium complexes have been synthesized and shown high affinity for nitrogen donor ligands in vitro and as a result exhibit anticancer action in vivo [5254 ]. other transition metals have been used as anticancer drugs, including bismuth (iii) labeled antibodies for systemic radioimmunotherapy [55, 56 ], rhenium (i) complexes as dna - binding agents, (mtr)2zn complex that induces cancer cell death by binding to chromatin, and cu compound chlorophyllin initiated apoptosis in human colon cancer cells through caspase-8 and apoptosis - inducing factor (aif) activation in a cytochrome c - independent manner. the proteome is defined as all expressed protein complement of a cell, organ or organism, and it includes all isoforms and posttranslational variants. proteomic technology, first coined in 1995, attempts to separate, identify, and characterize a global set of proteins in an effort to provide information about protein abundance, location, modification, and protein - protein interaction in the proteome of a given biological system [59, 60 ]. this postgenomic technology provides a direct measurement of the presence and relative abundance of proteins, and reveals the consequence of protein functioning in establishing the biological phenotype of organisms in different states. by studying interrelationships of protein expressions and modifications in health and disease or drug treatment, proteomics contributes important insights into determining the pathophysiological basis of disease, validating drug targets, and illustrating drug action, toxicity, and side effects. in the field of proteomics, several well - established methods persist as means to resolve and analyze complex mixtures of proteins derived from cells and tissues. currently, the most commonly used proteomic platforms include two - dimensional gel electrophoresis (2de) and protein chip arrays, isotope - coded affinity tages (icats), and immobilized metal affinity chromatography (imac) (table 1). these technological platforms are most often incorporated with matrix - assisted laser desorption / ionization time of flight (maldi - tof), surface enhanced laser desorption ionization time of flight (seldi - tof), electrospray ionization (esi), and/or tandem mass spectrometry (ms / ms). in addition, inductively coupled plasma (icp) mass spectrometry has also been applied in proteomic - based research of drug discovery. ever since the initial discovery of the anticancer activity of cisplatin, major efforts have been devoted to elucidate the biochemical mechanisms of anticancer activities of metal - based drugs to facilitate rational design of novel metal - based drugs with better pharmacological profiles. a comprehensive understanding of the molecular action mechanisms, which are triggered by metal - based drugs to kill cancer cells can lead to the design of more effective anticancer drugs, as well as to provide new therapeutic strategies based on the molecular activity of metal - based drug activity. target discovery, which involves the identification and early validation of disease - associated targets, is an essential first step in the drug discovery pipeline. indeed, the drive to determine protein function has been stimulated, both in industry and academia, by the human genome and proteome projects in progress. proteomics, the study of cellular protein expression, is an evolving technology platform that has the potential to identify novel proteins involved in key biological processes in cells. it must be pointed out, however, that numerous drug - targeted proteins are membrane - bound proteins, for example, receptors and ion channels. these proteins may not be amenable for study by proteomics due to their poor solubility and low abundance, and thus they are disproportionally represented in proteome profiles. up to date, only a fraction of putative drug targets has been identified by proteomic approaches, including the volume - sensitive organic osmolyte / anion channel as key elements of tumor development, migration, and invasiveness, and integrin alpha-4 as a molecular target of oxidative stress. studying protein expression profiling of drug - treatment leads to the identification of a number of drug - specific targets both in vivo and in vitro. using hplc - maldi - tof ms, hasinoff. have identified topoisomerase ii contained at least five free cysteins (170, 216, 300, 392, and 405) and two disulfide - bonded cyteine pairs (427 - 455 and 997 - 1008). cisplatin was found to antagonize the formation of a fluorescence adduct between topoisomeraser ii and the sulfhydryl - reactive maleimide reagent 10-(2,5-dihydro-2,5-dioxo-1h - pyrrol-1-yl)-9-methoxy- 3-oxo-3h - naphtho[2,1-b]pyran-2-carboxylic acid methyl ester (thioglo-1). based on these results, the authors suggested that topoisomeraser ii cysteines may be possible sites responsible for the inhibition of the catalytic activity of topoisomeraser ii observed in the presence of cisplatin, and topoisomeraser ii cysteins and dna as targets responsible for cisplatin - induced inhibition of topoisomeraser ii. besides, mitochondrial proteins, especially atp synthase - beta subunit, have been reported to be key proteins that serve as primary target of manganese porphyrin [mntnhex-2-pyp(5 +) ] treatment during renal ischemia / reperfusion injury by proteomic study. icp ms coupled with capillary electrophoresis (ce) has been used in the identification, characterization, and determination of different chemical species of an element in complex biological systems, that is, the impetus of biochemical speciation analysis [87, 88 ]. polec - pawlak. have used this approach to study the platinum group metallodrug - protein binding aiming to characterize the interactions between cancer - inhibiting metal complexes and serum transport proteins. such binding does not only regulate the uptake and accumulation of the drug in tumor tissue but also determines its overall distribution and exertion and differences in efficacy, activity, and toxicity [90, 91 ]. their study provides clear evidence that a ruthenium (iii) complex [trans - tetrachlorobis(1h - indazole)ruthenate (iii) ] (kp1019) preferentially binds toward albumin whose adduct is a dominating protein - bound species of ruthenium. insights into toxic responses are an asset for the interpretation of adverse drug effects and contribution to accurate risk assessment for humans. proteomics in combination with combinatorial chemistry and high - throughput screening can help to bring forward validating toxicity and resistance of an unprecedented number of potential lead compounds. benefits can be expected in optimized clinical trials based on the availability of biologically relevant markers of drug efficacy and safety. proteomics has demonstrated proof - of - concept in toxicology as shown by a number of successful applications in mechanistic toxicology and lead selection. proteomic studies of liver toxicity have been carried out with thioacetamide and ethanol. other researches have studied nephrotoxicity of cyclosporine a by proteomic approaches [94, 95 ] and reported a profound downregulation of the calcium binding protein calbindin d28 responsible for cyclosporine a - induced kidney toxicity. however, this technology - driven acceleration in drug discovery moves the bottlenecks in drug development to the downstream, which is the improvement in the selection of patient populations for clinical trials. proteomic approaches have been used to identify the underlying mechanisms for cisplatin resistance. in this study, the authors used cervix squamous cell carcinoma cell line a431 and its cisplatin - resistant subline, a431/pt as model system. the identified differentially expressed proteins can be classified into several groups, including molecular chaperones (e.g., heat - shock protein hsp60, hsp90, and hsc71), ca - binding proteins (e.g., calmodulin and calumenin), proteins involved in drug detoxification (e.g., peroxiredoxin 2 and 6, and glutathione - s - transferase), antiapoptotic proteins (e.g., 14 - 3 - 3 switched on in cisplatin - exposed cells) and ion channels (e.g., voltage - dependent anion channel 1, voltage - dependent anion - selective channel). besides this, proteome profile of cisplatin sensitive ovarian cell line igrov1 and its cisplatin - resistant counterpart igrov1-r10 have been compared aiming to find any protein markers or to establish new therapeutic strategies [97, 98 ]. increased expression of cytokeratin 8 and cytokeratin 18 was considered to play a role in acquired chemoresistance of igrov1-r10 cancer cell line to cisplatin [97, 98 ]. cytokeratin 8 and cytokeratin 18 have been implicated in resistance to tnf--induced apoptosis by binding the cytoplasmic domain of tumor necrosis factor receptor 1 [69, 99 ]. moreover, human nasopharyngeal carcinoma cells deficient for cytokeratin 8 were more sensitive to cisplatin - induced apoptosis. in addition, acquired and intrinsic cellular drug resistances are multifactorial processes, involving induction of drug detoxifying mechanisms, quantitative and qualitative modification of drug targets, cell cycle arrest, regulation of dna replication or reparation mechanisms, modulation of apoptosis, and other mechanisms [101, 102 ]. global examination of the glycoproteomes of the cisplatin - resistant ovarian cancer cell line igrov-1/cp using shotgun glycopeptide capture approach coupled with ms has been used to study cisplatin resistance. in this approach, glycopeptides derived from glycoproteins are enriched by selective capture onto a solid support using hydrazide chemistry followed by enzymatic release of the peptides and subsequent analysis by ms / ms. this method improves solubility of large membrane proteins and exposes all of the glycosylation sites to ensure equal accessibility to capture reagents. stewart. also used isotope - coded affinity tags (icats) integrated with mrna expression levels to study cisplatin resistance in ovarian cancer cells. their study identified three pathways in panther database (http://www.pantherdb.org/) that were significantly (p <.05) upregulated in cisplatin - sensitive cells, including glycolysis, interleukin signaling pathway, and pi 3-kinase pathway. an understanding of protein function within the context of complex cellular networks is required to facilitate the discovery of novel drug targets and, subsequently, new therapies directed against them. being the basic biochemical mode of drug activities, drug action mechanism should be better understood to provide valuable insights into drug modification and new drug development [34, 105 ]. successful examples in drug mechanism study using proteomics include the illustration of insulin - like growth factor - binding protein-6-induced sublethal hydrogen peroxide stress in human diploid fibroblasts cells. by using esi ms / ms, kanski. have applied proteomic analysis of protein nitration in aging skeletal muscle and identified nitrotyrosine - containing sequences in vivo. in our previous study, we have used 2de - based proteomic technology to compare the protein profile of human nasopharyngeal carcinoma sune1 cell line treated with gold (iii) porphyrin 1a, and a number of differentially expressed proteins were identified. these proteins can be classified into several categories based on their major biological functions, including cellular structural proteins, stress - related and chaperone proteins, proteins involved in ros, enzyme proteins and translation factors, proteins that mediate cell death and survival signaling, and proteins that participate in the internal degradation system. among these proteins, one of the significant increased proteins is voltage - dependent anion channel 1 (vdac 1). vdac 1 is a mitochondrial outer membrane channel protein, which functions as the pathway for the movement of various substances in and out of the mitochondria. it is considered to be a component of the permeability transition pore oligoprotein complex that plays a role in the permeability transition [109, 110 ]. vdac 1 also plays an essential role in bax / bak - induced apoptotic mitochondrial changes in the process of mammalian cell death [111113 ]. in this process, the proapoptotic proteins bax and bak bind to vdac 1, and enhance its permeability so that cytochrome c passes through the channel and releases to cytoplasm [111113 ]. our data on vdac 1 upregulation and bax overexpression suggest that gold (iii) porphyrin 1a may induce cell death via the mitochondria - mediated apoptosis pathway. further functional studies revealed that gold (iii) porphyrin 1a caused depletion of mitochondrial transmembrane potential (m) soon after uptake with suppression of bcl-2, and activation of caspase 9 and caspase 3. taken together, these results suggested that mitochondria are the primary target of gold (iii) porphyrin 1a. quantitative proteomic analysis on other metal - based anticancer drugs has also been pursuit. schmidt. have used nano - lc coupled offline maldi - tof / tof - ms to study cisplatin - induced apoptosis in jurkat t cells. their results showed that this method is more accurate than the commonly used online lc - esi - ms. the potential value of proteomics in metal - based drug development, especially in mapping drug action mechanisms, has been demonstrated in many successful examples. proteomic approaches have been recognized as promising techniques that can facilitate the systematic characterization of a drug targets ' physiology, thereby helping to reduce the typically high attrition rates in discovery projects, and improving the overall efficiency of pharmaceutical research processes. however, at present stage, the bottleneck for taking full advantage of this new experimental technology is the rapidly growing volumes of automatically produced biological data, and technical challenges with regards to sampling, tumor heterogeneity, and lack of standardized methodologies. in addition, to complement the limitation of current proteomic technology, systematic biological and pharmaceutical studies should be integrated with proteomics to better serve the purpose of illustrating the action mechanism of drugs and thus contribute to the success in metal - based drug development. | medicinal inorganic chemistry has been stimulating largely by the success of the anticancer drug, cisplatin. various metal complexes are currently used as therapeutic agents (e.g., pt, au, and ru) in the treatment of malignant diseases, including several types of cancers. understanding the mechanism of action of these metal - based drugs is for the design of more effective drugs. proteomic approaches combined with other biochemical methods can provide comprehensive understanding of responses that are involved in metal - based anticancer drugs - induced cell death, including insights into cytotoxic effects of metal - based anticancer drugs, correlation of protein alterations to drug targets, and prediction of drug resistance and toxicity. this information, when coupled with clinical data, can provide rational basses for the future design and modification of present used metal - based anticancer drugs. |
avian influenza virus type a, subtype h5n1, is becoming the world s largest pandemic threat due to its high virulence and lethality in birds, quickly expanding host reservoir, and high rate of mutations.(1) antigenic drift has given rise to new strains that are resistant to existing drugs, and antigenic shift is resulting in new virulent subtypes of the flu virus, underscoring the need to design novel therapeutics. influenza s two major membrane glycoproteins, hemagglutinin (ha) and neuramindase (na), together play important roles in the interactions with host cell surface receptors. na facilitates viral shedding by cleaving terminal sialic residues on host cell surface proteoglycans, which are bound by ha.(2) the neuraminidase enzymes are phylogenetically categorized into two groups : group-1, which includes n1, n4, n5, and n8, and group-2, which includes n2, n3, n6, n7, and n9.(3) although active - site residues are largely conserved across both groups, different na subtypes exhibit varied drug susceptibility(4) and resistance profiles. since the first na crystal structure was published in 1983,(7) a number of structure - based computational studies against the group-2 subtypes have added significant insight to our understanding of substrate recognition and inhibitor design. currently available na inhibitors, including oseltamivir(8) and zanamivir,(9) have been designed against crystal structures of group-2 enzymes (ref (2) and references therein). oseltamivir, which has been stockpiled by many nations in efforts to avert a possible pandemic, is the only orally available drug effective against h5n1 ; yet, oseltamivir - resistant strains have already been isolated. recent studies of the avian - type n1 enzyme have enriched our understanding of the binding process. the first crystal structures of a group-1 na in apo form and in complex with currently available drugs(12) revealed that, although the binding pose of oseltamivir was similar to that seen in previous crystallographic complexes, the 150-loop adopted a distinct conformation, opening a new cavity adjacent to the active site. under certain crystallization conditions, however, the 150-loop adopted the same closed conformation as previously seen in group-2 na structures, suggesting a slow conformational change may occur upon inhibitor binding.(12) it was conjectured that the new structural observation of the n1 strain s open 150-loop could be exploited in structure - based drug discovery efforts. despite this detailed structural information, the interpretation of the loop dynamics based on crystal structures alone is a difficult task. to complement the crystallographic structures, all - atom explicit solvent molecular dynamics (md) simulations of the apo and oseltamivir - bound systems were carried out.(14) the extensive simulations suggested that the 150-loop and adjacent binding site loops may be even more flexible than observed in the crystal structures.(14) in the apo simulations, the 150-loop was seen to open more widely than observed in the crystal structures, and its motion was often coupled to an outward movement of the adjacent 430-loop. these coupled motions significantly expanded the active - site cavity, increasing its solvent - accessible surface area compared with both the open and closed crystal structures. subsequent computational solvent mapping (cs - map) experiments assessed the ability of small, solvent - sized molecules to bind within close proximity to the sialic acid binding region and the newly discovered 150- and 430-cavities.(15) the consensus binding sites (i.e., hot spots) of these probes, as determined by the cs - map algorithm, have been shown to relate directly to experimental druggability and are thus able to identify important binding site features. mapping analyses of the nonredundant md conformations revealed the presence of additional hot spot regions in the 150- and 430-loop regions, confirming the druggability of these newly revealed sites. furthermore, small - molecule docking to the new 150- and 430-cavities indicated favorable binding of several compounds to these areas, in addition to the sialic acid binding site.(19) a complete understanding of the comparative human- and avian - type neuraminidase structural dynamics is lacking, despite the relevance of this knowledge to antiviral development. our current understanding of the active - site dynamics for these medically relevant enzymes is predominantly based on x - ray crystallography experiments(12) and the aforementioned explicitly solvated md simulations of the open 150-loop n1 enzyme. in this work, in order to assess the dynamical differences in the 150-loop, 430-loop, and sialic acid binding regions between the avian and human subtypes, we present a series of generalized born molecular dynamics (gb md)(20) simulations of the n1 and n9 na enzymes. gb md, which employs a continuum representation of the solvent water molecules and salt ions, offers computational efficiency over the more rigorous poissonboltzmann solvers or explicit solvent simulations.(21) the implicit solvent approach essentially reduces solvent friction and has been shown to enhance conformational sampling for a wide variety of peptide, protein, and nucleic acid systems. to date, however, the application of gb md to larger biomolecular systems, such as the neuraminidase enzyme, has been much fewer in number than its application to smaller proteins and peptides. this work therefore presents an important methodological example that highlights the utility of employing generalized born implicit solvent models for elucidating the dynamics and energetics of large protein systems. although crystallographic experiments provide critical time / ensemble - averaged structure and ligand binding information, atomic - level simulations yield additional insights and relevant biophysical information that is otherwise inaccessible with standard experimental techniques. as oseltamivir does not rely on water - mediated interactions with the protein active site, unlike other sialic acid analogue na inhibitors,(26) the n1 and n9 oseltamivir - bound systems are particularly well suited for treatment with implicit solvent. the comparative dynamics that we present here allow us to gain insights into the flexibility of the 150- and 430-loops, which are important due to their proximity to the sialic acid binding site. a more complete understanding of the dynamical differences between the subtypes, especially in the 150- and 430-loop regions, may assist in the design of antiviral compounds that are able to take advantage of the newly revealed ligand binding areas. here we show that the extensive conformational sampling gained through the gb md simulations allows us to attain a significantly enhanced conformational sampling speedup, as compared to explicit solvent md. the dynamics of residues that have been shown by computational solvent mapping to be potentially important in the binding of ligands to this expanded area are investigated and discussed, and a comparison of the resulting structures to the explicitly solvated md simulations is provided. the closed - loop oseltamivir - bound n1 simulation started from one of the monomers from the 2hu4 (pdb code) structure. the open - loop oseltamivir - bound n1 simulation started from one of the monomers from the 2hty structure. the closed - loop n9 oseltamivir - bound simulation was initiated from one of the monomers from the 2qwk structure. for each of the monomer systems, several residues on the n - terminus were removed (first six residues in n1, v83n88 ; first nine residues in n9, r82g90). coordinates of the three corresponding apo systems were obtained by removing the inhibitor oseltamivir, respectively. to study the impact of the adjacent subunits on loop structure and dynamics, a tetramer system comprised of the closed - loop n1 neuraminidase in complex with oseltamivir (2hu4) protonation states for histidines and other titratable groups were determined at ph 6.5 by the pdb2pqr web server and manually verified.(27) hydrogen atoms were added by using the leap module in amber. the ff99sb force field, which has modifications to backbone torsional terms, was used for the protein.(28) parameters for oseltamivir were obtained from antechamber module using the generalized amber force field (gaff)(29) with resp hf 6 - 31 g charges as described previously.(14) all md simulations were carried out with amber 8.(30) temperature was maintained by using langevin dynamics with a collision frequency of 5 ps. the time step was 2 fs, and all bonds involving hydrogen were constrained with the shake algorithm with a tolerance of 10. seven simulations of the n1 (group-1, avian) and n9 (group-2, human) neuraminidases are summarized with their system name, initial pdb structure identifier, brief description, total simulation time, and number of atoms. the gb model has been demonstrated to provide improved conformational sampling as compared to simulations with explicit representation of solvent molecules. the improved sampling arises from an acceleration of transitions due to the lack of solvent viscosity, as well as through reduced cost of calculating forces of explicit solvent. a modified gb model (gb, igb = 5) was employed for more accurate solvation of large proteins.(23) the born radii were adopted from bondi with modification (mbondi2) and an offset of 0.09. the salt concentration was set to 0.2 m. a reaction field cutoff (rgbmax = 25) was used to speed - up the calculation of effective born radii. no cutoff was used for the long - range interactions for the monomer systems, while a cutoff of 50 was used for the tetramer system. the starting structure was minimized for 2000 steps to remove close contacts and then gradually heated to 300 k at 50 k intervals during six simulations of 200 ps. positional restraints on backbone atoms were gradually decreased from 3 to 0 kcal/(mol) in several stages. each production run was 16 ns for the monomer systems and 5 ns for the tetramer system. system performance benchmarks are as follows : for the tetramer system, 0.8 ns per day using 1024 processors on the ibm bluegene / l platform at san diego supercomputer center ; for the monomer system, 9 ns per day on the ncsa abe platform using 256 processors (32 nodes), and 2 ns per day on the ibm bluegene / l machine using 256 processors. in order to generate reduced, representative structural ensembles for the simulations and for the cs - map calculations, root - mean - square deviation (rmsd) conformational clustering was performed, based on a previously reported clustering algorithm.(31) to be able to compare to previous clustering results, the gromos method within gromacs (g_cluster) was employed.(33) structures were extracted in 10 ps intervals over each of the simulations ; 1.6 10 trajectory structures for each simulation were superimposed using all c atoms to remove overall rotation and translation. the rmsd - clustering was performed on a subset of 62 residues that line the entire binding - site area, which we define here as the binding - site residues : 117119, 133138, 146152, 156, 179, 180, 196200, 223228, 243247, 277, 278, 293, 295, 344347, 368, 401, 402, and 426441. these residues were clustered into batches of similar configurations using the atom - positional rmsd of all atoms (including side chains and hydrogen atoms) as the similarity criterion. a cutoff of 1.3 was chosen on the basis of previous work using explicit solvent.(15) using equidistant snapshots extracted from the gb md trajectories, the total binding free energy was computed using the mm - gbsa scheme. for computational efficiency, a single trajectory approach was used and the calculations were performed on 800 snapshots with a sampling interval of 20 ps. where emm represents the sum of electrostatic, van der waals, and internal energies (we note that the internal energies cancel out in eq 2 due to the single trajectory approach). gsolvation is the desolvation free energy penalty, estimated from gb and solvent - accessible surface area (sasa) calculations which yield gpolar and gnonpolar. a surface tension coefficient () of 0.0072 kcal/(mol) is used to calculate the nonpolar solvation free energy contribution. the modified gb model (gb, igb = 2),(23) the modified born radii (mbondi2), and 0.2 m salt concentration were adopted, to be consistent with the gb md simulations. the best results (i.e., most closely reproduced experimental binding constants) were obtained with igb2. ts is the product of temperature (at 300 k) and solute entropy, derived from normal - mode analyses of the solute coordinates after energy minimization of solute structures to within a root - mean - square of the energy gradient of 1.0 kcal/(mol). the normal - mode analysis was carried out on eight snapshots at 2 ns sampling intervals due to its prohibitive computational cost on large proteinligand systems. the minimum ts results were selected to compute the total binding free energy in eq 1. the seven simulations with various starting conditions allow us to investigate the comparative dynamics of the avian- and human - type neuraminidase enzymes in several states, including the apo and oseltamivir - bound n1 enzyme starting with the open 150-loop crystal structure (n1ao, n1ho, respectively), the apo and oseltamivir - bound n1 enzyme starting with the closed 150-loop crystal structure (n1ac, n1hc), the apo and oseltamivir - bound n9 crystal structures (n9a, n9h), and the tetramer closed 150-loop oseltamivir - bound n1 (table 1). as the human - type n9 enzyme has never been crystallized with the 150-loop in the open conformation, the starting conditions are with a closed 150-loop. overall, the backbone rmsd establishes that all of the systems are stable during the trajectories (supporting information, figure s1). an rmsd - based clustering analysis of 62 residues lining the binding site allows us to compare the relative structural populations of n1 and n9 in the different trajectories. the clustering procedure was performed in a manner identical to that described by landon.(15) (using a 1.3 cutoff) and thus provides a basis of comparison for the explicit solvent and gb md simulation cluster structures (table 2). the central member structures of the most dominant clusters for each of the simulations illustrate the range of structural fluctuation in this loop region (figure 1). the clustering results indicate that the gb md simulations enhance the conformational sampling of the n1 enzyme, as compared to the explicit solvent simulations, while maintaining the relative population trends established in the latter. loop conformations are shown in cartoon representation for the most dominant configurations of (a) the n1-apo - closed (orange) and the n1-oseltamivir - bound - closed (red), (b) the n1-apo - open (orange) and the n1-oseltamivir - bound - open (red), and (c) the n9-apo - closed (orange) and the n9-oseltamivir - bound - closed (red) trajectories. the n1 open (blue) and n1 closed (green) crystal structures are shown for comparison. first, regardless of the open vs closed 150-loop configuration, the apo systems are more flexible in the binding - site region compared to the oseltamivir - bound systems. these results are consistent with the explicitly solvated simulations.(14) second, the relative cluster populations of the open 150-loop n1 systems indicate that the gb simulations are able to sample a larger conformational space than the explicitly solvent simulations, despite the fact that the gb simulations were 1 order of magnitude shorter in time scale. this is due to the reduced solvent friction in the gb md simulations and highlights the utility of the gb method for exploring receptor conformational space. in terms of the comparative dynamics between the n1 and n9 systems, both the n1 and n9 apo systems are represented by 55 clusters, indicating that the dynamics are similar between the subtypes in the absence of substrate. in contrast, the n1hc system has more clusters than the n9h system, suggesting that the n9 subtype is more stable than the n1 subtype when oseltamivir is bound. the dynamics of residues lining the sialic acid, 150-, and 430-cavities are of interest for drug design investigations as well as to better understand the fundamental basis of molecular recognition in the neuraminidase enzymes. in order to characterize the dynamics of residues within the n1 and n9 systems, a root - mean - square fluctuation (rmsf) analysis the dynamics of hot - spot residues (table 3 ; supporting information, figure s3) are of particular interest, as they have been suggested to provide additional opportunities for drug discovery that could potentially mitigate the effects of drug resistance.(15) the first column lists the residue type, the second column lists the residue number, and the third through eighth columns list the rmsf per residue for the n1-apo - open, n1-apo - closed, n1-holo - open, n1-holo - closed, n9-apo, and n9-holo systems, respectively. most notably, with the exception of y406, all the hot - spot residues lining the sialic acid cavity in n9 exhibit much lower rmsf values than the same residues in the n1 strain (table 3). this is also illustrated in the equilibrium binding poses of oseltamivir, which, in the n9 subtype, undergoes the least amount of movement from the original crystal structure pose versus the n1 subtypes (figure 2). the increased positional fluctuations of the sialic acid binding residues in the n1 subtype may contribute to the reduced efficacy of several known inhibitors against n1. in addition, the n9h system shows significant stabilization of the 150-loop upon binding of oseltamivir (table 3). the increased rigidity in this area substantiates available crystallographic data that, to date, have not provided evidence of 150-loop mobility in the n9 subtype. overall orientations (left panel) and active - site interactions (right panel) of oseltamivir bound to (a) the n1-closed, (b) the n1-open, and (c) the n9-closed system. the original conformations of the 150- and 430-loops are shown in blue and red, respectively, to highlight the loop motion observed in the course of the dynamics. the presence of oseltamivir in the closed 150-loop n1 system actually increases the rmsf of the sialic acid and 150-loop hot - spot residues (table 3). this is in contrast to both the open 150-loop n1 and n9 systems, which exhibit reduced fluctuations in the 150-loop in the presence of oseltamivir. the stabilization of the 150-loop residues in the n1ho system is in agreement with the explicitly solvated md simulations.(14) taken together, these findings suggest relative structural instability of the n1 system in this region due to the presence of inhibitor as compared to n9, lending support to the potential importance of targeting the 150- and 430-cavities for developing inhibitors that bind more strongly to the n1 subtype. at approximately 6 ns into the n1hc trajectory, a strained salt bridge forms between r152 and the carboxylate group of oseltamivir. is not seen in any of the other gb or explicit solvent simulations, it is likely that this salt bridge is an artifact of the continuum solvent approach. the formation of overstabilized salt bridges, especially those involving arginine residues, is a known weakness of the gb model.(38) in all other trajectories, r152, which is within a stable region of the 150-loop, forms varying salt bridge interactions with neighboring aspartate residues in the protein. hot - spot residue rmsf values for n1hc simulation time segments before (05.2 ns) and after (10.015.2 ns) formation of the strained salt bridge indicate that the positional fluctuations of residues in the vicinity of r152 are slightly dampened after the salt bridge is formed (data not shown). the trends in rmsf values for both time segments, however, are the same as the mean values reported in table 3. the crystal structures of the n1 enzyme published by russell. first revealed the flexibility of the 150-loop.(12) adjacent to the sialic acid binding site, the outward movement of the 150-loop expanded the n1 active site and was suggested to present a new opportunity for antiviral drug design. explicitly solvated md simulations presented by amaro. sampled a single openclose loop transition in chain d of the oseltamivir bound system, as demonstrated by the instantaneous rmsd of the 150-loop from the closed (2hu4) and open (2hty) 150-loop crystal structures during 40 ns of tetramer simulations (figure 1 in ref (14)). in addition, the explicit md sampled a so - called wide - open 150-loop structure that significantly altered the size and topology of the n1 binding pocket. in this work, a similar analysis of the six monomer systems provides dynamical and structural insights into this region. for the open 150-loop n1 system, the apo and holo systems each demonstrate two openclose loop transition events (figure 3). in comparison to the explicit solvent md, which sampled only one transition event in the n1ho system over 160 ns of simulation, the four loop transition events sampled here point to the advantage of the gb method for sampling conformational transitions on a much faster time scale compared to explicit solvent md. similar to the explicit solvent md, the most dominant central member cluster structure of the n1 apo system is significantly more open than the open 150-loop crystal structure (figure 1). the general agreement between the resulting structures determined by both computational methods substantiates the idea that the n1 subtype generally exists in a more open conformation in the absence of ligand. by contrast, the closed 150-loop n1 systems remain relatively stable across the trajectories, and no loop transition events are sampled (figure 3). root - mean - square deviations of the 150-loop (comprising residues n146r152) from the md with respect to the open (gray) and closed (black) crystal structures are shown for the n1-apo - closed (a), the n1-oseltamivir - bound - closed (b), the n1-apo - open (c), the n1-oseltamivir - bound - open (d), the n9-apo - closed (e), and the n9-oseltamivir - bound - closed (f) structures. in the (closed - loop) apo n9 system, the openclose loop transition analysis indicates that the enzyme adopts an intermediate conformation (figure 3). this is also illustrated in the most dominant cluster representative structure, which indicates that the 150-loop in the apo n9 system takes on characteristics of both the closed and open loops but is definitively more open. our analysis indicates that the most populated structure in the n9a system has an open 150-cavity. this structural finding suggests that, in the absence of inhibitor, both subtypes take on a more relaxed and open conformation in the 150-loop region. in contrast, the holo n9 system remains in a more closed conformation throughout (figures 1 and 3). it is also worth noting that, in each of the most dominant structures extracted from all six monomer simulations, the 430-loop adopts a more open conformation (figure 1). these results reveal motion in the 430-loop region for the n9 enzyme and, more broadly, indicate that motion in the 430-loop region is independent of bound ligand. importantly, this suggests that compounds designed to target the more open 430-cavity have the potential to be viable against both n1 and n9 subtypes. in order to quantify the individual contributions to oseltamivir binding in the n9 and n1 systems, the theory of end - point energy, also known as mm - pb(gb)sa, calculations relies on a set of assumptions, elegantly reviewed in ref (39). a simple thermodynamic cycle and single - trajectory postprocessing allows the efficient computation of the various contributions. here, the application of the mm - gbsa approach allows us to decompose the terms that contribute to ligand binding while providing relative free energies of binding that correlate well with experimental data for both n9 and n1 subtypes (table 4). the absolute values of the binding free energies, however, are off by approximately 57 kcal / mol in all three cases, which is not surprising given the assumptions present in the underlying theory and also considering that we neglected to include the internal energy change (i.e., strain energy) for oseltamivir binding.. showed that the range of ligand strain energy may be in the range of 5 to 5 kcal / mol for known inhibitors of na, although they recognized the inherent difficulty in determining accurate absolute quantities due to insufficient sampling.(26) the average contributions to the oseltamivir binding free energies to the n9, n1-open, and n1-closed systems over the 16 ns trajectories are given in kcal / mol ; standard errors of the mean are given in parentheses. eelec and evdw are the molecular mechanics electrostatic and van der waals contributions, respectively. gsolv, polar is the polar component of the solvation free energy, whereas gsolv, nonpolar is the nonpolar component. ts is the contribution from the rotational (rot), translational (trans), and vibrational (vib) entropies. experimental binding free energies (gbinding, exp) are provided for comparison.. in theory, if the configurational space sampling is sufficient, the n1 open- and closed - loop systems should converge to the same binding free energy, since they are the same enzyme (merely different starting configurations of the 150-loop). although our results are not identical between the two systems, it is promising that they are within the standard error of the mean for each. a plot of the convergence of the binding free energies as a function of trajectory length indicates that the differences between running 1 and 16 ns in terms of the enthalpic contributions are minor (supporting information, figure s4). it also indicates that the salt bridge artifact between r152 and oseltamivir in the n1hc system (which was not present before 6 ns) has a negligible effect on the binding free energy. the absolute values of the electrostatics terms are similar to those recently published by chachra and rizzo for the n1 system, using explicit solvent simulations.(41) although they and others have shown that within a single na enzyme, the electrostatics term trends well with experimental binding free energies, our results suggest this is not the case when comparing across human and avian subtypes. notably, it is only with the inclusion of the entropic component that the free energies of binding agree with what is known experimentally (table 4). our work indicates that the n1 systems (whether initiated from a closed- or open-150 loop) pay a larger entropic penalty upon binding oseltamivir. these results are in good correspondence with the loop transition sampling events (figure 3) and the per - residue rmsf values (table 3), which indicate increased flexibility in the n1 subtype. thus, we would expect the n1 systems to pay a higher entropic penalty upon complexation with oseltamivir, as compared to n9, which appears to be intrinsically less flexible. future antiviral development efforts against the n1 subtype may benefit from considering these entropic contributions. as a control for our monomer simulations, we also present data from a 5 ns gb simulation of the closed 150-loop n1 tetramer system. the tetramer system, with 21 732 atoms (table 1), exhibited excellent parallel performance scaling : we were able to generate 0.8 ns per day when scaled to 1024 processors on the ibm bluegene machine at the san diego supercomputer center. the comparison of the tetramer n1hc system to the monomer n1hc system reveals largely similar behavior, especially in the sialic acid, 150-, and 430-loop regions. the openclose loop transition behavior was also similar for each of the monomers within the tetramer (figure 3 ; supporting information, figure s5). the exception is chain b of the tetramer, in which the 150- and 430-loops (data not shown) shift to a more open conformation after 3 ns. notably, the interaction of r152 with the carboxylate group of oseltamivir occurs in two of the four chains of the tetramer, indicating the intermittent occurrence of this interaction. we anticipate that this extended arginine interaction may occur in all four chains if the tetramer simulations were run for longer than 5 ns. again we note that this salt bridge is likely overstabilized and could be an artifact of the gb electrostatics. a comparison of the rmsf difference per residue of the tetramer to the monomer systems does indicate slight structural variation between the simulations in a region far from the active site. in particular, in the monomer simulations, a helix on the opposite side of the 430-loop, comprised of residues d103f115 (hereafter referred to as the 110-helix), exhibited larger rmsf values (supporting information, figure s6) and in several cases appeared to completely unravel. in the physiologically relevant tetrameric form of the enzyme, the 110-helix makes contact to a neighboring subunit. correspondingly, in the tetramer simulation, the contacts formed among the subunits appear to stabilize this region. the percentage of secondary structure formed (helix) within the core of this 110-helix (residues s105g109) as a function of simulation time was investigated (table 5 and figure s6) and indicates that the tetrameric contacts play a role in stabilizing this region of the enzyme. although the tetramer simulation was performed only for the n1 enzyme, we expect similar results for the n9 subtype. recent explicit solvent simulations of the monomer form of the n9 subtype also indicate that restrained dynamics were necessary to maintain the proper backbone fold,(41) whereas explicit solvent simulations of the tetramer enzyme were stable.(14) our work here supports these observations, although the increased structural fluctuations are localized to the 110-helix and the termini strand, not generalizable to the entire protein backbone. this study points to the promise and utility of generalized born implicit solvent models for elucidating the dynamics and energetics of large - scale atomistic protein systems. the reduced solvent friction in the simulations enhances the receptor conformational space sampling for the n1 and n9 neuraminidase enzymes, as compared to explicitly solvated md simulations. the 16 ns gb md trajectories sample twice as many openclose loop transition events as compared to 160 ns of explicit solvent simulations, suggesting a conformational sampling speed - up of at least 10 times that of equivalent explicit solvent simulations. our work also shows that end - point free energy calculations performed with the mm - gbsa protocol are able to recapture experimentally known oseltamivir binding profiles, thus providing an important computational framework to understand the various contributions to substrate recognition in the neuraminidase enzymes. moreover, our estimates of the entropic contributions to the binding free energies suggest that these contributions can not be neglected when comparing binding affinities across the subtypes. this work also provides several provocative insights into the structural dynamics of the avian- and human - type na enzymes, including that the apo n9 enzyme may also present 150- and 430-cavities to antiviral compounds. especially promising is the persistence of the open 430-cavity in both the oseltamivir - bound and apo systems. consequently, we anticipate that novel antiviral compounds targeting the recently discovered 150- and 430-cavities in the n1 subtype may also be effective against n9, and we suggest the targeting of these new pockets as a general anti - influenza drug development strategy. this could have important implications for developing new therapeutics that maintain efficacy over currently known resistant strains, for both seasonal and potentially pandemic influenza subtypes. | the comparative dynamics and inhibitor binding free energies of group-1 and group-2 pathogenic influenza a subtype neuraminidase (na) enzymes are of fundamental biological interest and relevant to structure - based drug design studies for antiviral compounds. in this work, we present seven generalized born molecular dynamics simulations of avian (n1)- and human (n9)-type nas in order to probe the comparative flexibility of the two subtypes, both with and without the inhibitor oseltamivir bound. the enhanced sampling obtained through the implicit solvent treatment suggests several provocative insights into the dynamics of the two subtypes, including that the group-2 enzymes may exhibit similar motion in the 430-binding site regions but different 150-loop motion. end - point free energy calculations elucidate the contributions to inhibitor binding free energies and suggest that entropic considerations can not be neglected when comparing across the subtypes. we anticipate the findings presented here will have broad implications for the development of novel antiviral compounds against both seasonal and pandemic influenza strains. |
the patient is a 46-year - old african american male with a history of stroke, diabetes, and hiv, who presented with a sudden onset shortness of breath, palpitations, and chest discomfort. physical examination was unremarkable except for tachycardia and right - sided weakness associated with an episode of stroke 10 years earlier. ct chest angiography demonstrated a large bilateral pulmonary embolism (pe) with straightening of the interventricular septum suggesting right heart strain (fig. right heart strain necessitated a transthoracic echocardiogram (tte) that showed a possible thrombus versus mass in both atria. to confirm the diagnosis, the tee showed a pfo with a large thrombus measuring 10 cm lodged in the pfo (fig. a tee with bubble study, which was done as part of the previous stroke workup, did not show any right - to - left shunt. cardiac surgery was consulted for possible surgical removal of the thrombus and repair of the pfo. after a discussion of the risks and benefits of surgical versus medical management a year later, follow - up tte did not show a pfo or any clot in the heart. the mortality rate in cases of pe with thrombus in transit is very high (1). there is no general consensus about the best treatment for a thrombus entrapped in a pfo (2). because of the high risk of death from thrombus in transit, a cardiothoracic surgeon should be consulted immediately upon confirming the diagnosis (3). if the pfo is not repaired, the patient should remain on anticoagulation indefinitely (4). this case is also a reminder that a negative tee does not rule out the presence of a pfo (5). the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | in rare cases, thrombus in transit can be entrapped in a patent foramen ovale (pfo). a patient with this condition is at high risk of embolic stroke and death. early diagnosis and treatment is essential to help prevent stroke and death in these cases. there is no universal management guideline for this rare condition. the decision between medical versus surgical treatment should be made individually for each patient. we present a case of thrombus in transit entrapped in a pfo that was treated medically by lifelong anticoagulation. |
muscle regeneration is a multistep process that includes myofiber degradation, regeneration, and remodeling (ten broek., the repair process is characterized by the activation of a primary myogenic stem cell population referred to as satellite cells, which give rise to activated proliferating myoblasts or myoblast precursor cells (mpcs), followed by cell differentiation and fusion into regenerated myofibers. satellite cells, that are normally quiescent, can be activated to proliferate and generate committed progeny in response to a variety of stimuli, including degenerative muscle diseases (brack and rando, 2012 ; dhawan and rando, 2005 ; rudnicki., 2008). the active thyroid hormone (th), t3, derives in large part from the monodeiodination of the prohormone thyroxine (t4) by one of two iodothyronine selenodeiodinases (d1 or d2). conversely, th signaling terminates consequent to inactivation of t3 and t4 induced by removal of a tyrosyl ring iodine by type 3 deiodinase (d3). d3 converts the active hormone t3 to inactive metabolites thereby terminating th action within cells. this provides a mechanism by which th action can be terminated in a tissue - specific chronologically programmed fashion (bianco., 2002). the high expression of d3 in fetal compartments and the growth retardation and partial neonatal mortality of d3-null mice (hernandez., 2006) normal th levels are required for efficient muscle homeostasis, function, and regeneration (mcintosh., 1994 ; simonides and van hardeveld, 2008). indeed, a broad set of genes are positively or negatively regulated at the transcriptional level by th (salvatore., 2014 ; simonides and van hardeveld, 2008). one of the genes transcriptionally stimulated by t3 is myod (muscat., 1995), which is a master regulator of the myogenic developmental and regeneration program. while it is well known that muscle function is altered in patients with thyrotoxicosis or hypothyroidism, it has also been shown that th excess impairs the regeneration process in the mdx mouse (anderson., 1994). there are two sources of t3 in muscle tissue ; one is the fraction that enters the cells directly from the plasma, the second is locally produced from t4-to - t3 conversion via d2 action (dentice. similarly, little is known about how the balance between the t3-activating and -inactivating deiodinases in muscle and in muscle progenitor cells is determined. clarification of these issues would be a significant advance in the understanding of the cellular pathways governing the progression of muscle stem cell lineage. the aim of our study was to dissect the role of the intracellular th metabolism and signaling in muscle progenitor cells. we identified d3 in satellite cells and mpcs, and found that it is induced upon stem cell activation early after muscle injury. this event was associated with the expansion of the satellite cell population that occurs after muscle injury. despite normal plasma t3 concentrations, selective depletion of d3 in the satellite cell compartment resulted in severe cell apoptosis thereby disrupting the normal pattern of tissue response to acute injury and causing a marked delay in muscle regeneration. thus, we demonstrate that d3 and modulation of local th metabolism represent a survival mechanism during the progression of the muscle stem cell lineage. to assess whether d3 is expressed in satellite cells, we measured its expression in facs - sorted cells from tg : pax7-ngfp mice (rocheteau., 2012) and found elevated d3 levels, which declined as differentiation proceeded (figures 1a and 1b), a pattern observed also in c2c12 as well as in primary cultures of skeletal muscle enriched in satellite cells (pp6 cells ; qu., 1998) d3 levels increased rapidly during muscle development, and peaked in the second postnatal week, after which they progressively declined to reach very low levels in the adult (figure s1b). d3 expression, detectable in isolated pax7-positive cells, increased in dividing myod1-positive cells of muscle fibers (figures 1c and s1c). interestingly, d3 activity in limb muscles was significantly higher in the dystrophic mdx mouse than in controls (figure 1d), which is consistent with the increased proliferation of satellite cells in the dystrophic context. we examined d3 expression during regeneration after cardiotoxin (ctx) injection (charg and rudnicki, 2004). d3 mrna, protein, and enzymatic activity were significantly increased at early stages after ctx injection (48 days) in the tibialis anterior (ta) muscle. then d3 declined, reaching nearly normal adult levels by day 15 (figures 1e and 1f). coimmunofluorescence analysis showed d3 staining in the pax7-positive cells as well as in the newly regenerating fibers and in f4/80 macrophages infiltrating the injury site (figures 2a and 2b). d3 showed a dynamic cell - type specific expression, i.e., a robust expression at day 7 in the satellite cell compartment and declined thereafter (figures 2a and 2b). to determine whether d3 might serve as a novel marker of a specific subset of pax7-positive cells, we isolated satellite cells and fractionated them according to ngfp intensity by flow cytometry. we analyzed facs - isolated pax7-ngfp (top 20%), pax7-ngfp (intermediate 60%), and pax7-ngfp (bottom 20%) from ctx - injured or control - uninjured muscles. interestingly, within the pax7-ngfp - expressing cells, d3 expression was higher in pax7-ngfp cells, which have the highest commitment to progress toward a myogenic lineage (figure 2c) (mourikis., 2012). within the d3-positive pax7-ngfp fraction, this is illustrated by the expression profile of well - characterized positively (serca2, foxo3, pgc-1, troponin 2) and negatively (pgc-1 and troponin 1) (figures 2d and s2) regulated th target genes, which points to a relatively hypothyroid state in the pax7-ngfp / d3high - expressing cells (figure 2d). the pattern of d3 expression and the expression profile of the th - responsive gene in gfp - sorted cells provide functional evidence that intracellular th concentrations are tightly regulated in satellite cells during lineage progression. to this aim, we generated a satellite cell - specific conditional dio3 knockout mouse (see experimental procedures). the homozygous dio3 mice were viable and fertile, with no alterations in d3 protein, body mass, fertility, or serum th concentrations (figures s1 and s3 ; data not shown). adeno - cre infection of primary myoblasts resulted in effective deletion of the selenocysteine insertion sequence (secis) element and inactivation of d3 (see experimental procedures), without affecting d3 mrna levels (figure s1d) in agreement with the genetic strategy used. we crossed the dio3 floxed mouse with a tg : pax7-cre mouse (mourikis., 2012) in order to specifically delete d3 in the satellite cells. we subjected 2-month - old dio3 ; tg : pax7-cre mice (cd3ko) to tamoxifen (tam) treatment followed by ctx injury (figure 3a). after tam treatment, d3 in satellite cells was markedly and specifically reduced as demonstrated by immunofluorescence staining (figures 3b and s3). as expected, d3 protein levels were significantly reduced, but not abolished, in muscle by tam treatment, in agreement with the expression of d3 in pax7-negative cells, e.g., in infiltrating macrophages (figures 2b and 3b). after ctx injection (4 days), the pattern of regeneration in the ta was similar in the control and cd3ko mice. however, following d3 depletion at day 7 post - ctx, we observed a significant reduction in the number of pax7-positive cells (figures 3a3c). this reduction was due to massive apoptosis, as measured by tunel assay and parp cleavage in regenerating muscles (figures 3c3f, s3d, and s3e). examination of muscle sections at later times showed a striking difference between the cd3ko and wild - type (wt) animals, a difference particularly evident at day 14 postinjury and thereafter (figure 4a). indeed, while regeneration was active at this time in control muscle, with most of the myonuclei in the central position of myofibers and a sharp increase in the myogenic markers myod, myogenin, and mhc, these markers were greatly decreased in cd3ko muscles (figures 4b and 4c). there was also a dramatic reduction in the number of regenerating fibers in the mutant animals (figure 4d), which is consistent with a block in the initial wave of muscle regeneration. at day 40, when regeneration was almost complete and the number of centrally located nuclei was similar in the cd3ko and wt mice (figure 4d), regeneration was persistently aberrant and incomplete in the mutant tissues (figure 4a). in addition, the cross - sectional area was significantly reduced in cd3ko mice versus control mice (figure 4e). systemic hypothyroidism significantly rescued apoptosis in cd3ko mice (figures 3d3f), indicating that apoptosis was due to an excessive intracellular th concentration. overall, these results indicate that d3 depletion in satellite cells and the consequent cell apoptosis significantly impair the regeneration process. in dio3 myoblasts, apoptosis followed d3 depletion or th treatment (figures 5a, 5b, s4a, and s4b). this did not occur in adeno - cre - infected cells from wt mice or in the fibroblast - like primary cell population from dio3 mice (figures s4c s4f). since d3 serves only to inactivate th, we speculated that apoptosis would not occur in the absence of th in the serum, which was in fact the case (figure 5a). furthermore, apoptosis was dependent on, and related to, cell proliferation. when differentiated dio3 cells were infected with the adeno - cre virus or treated with supraphysiological th concentrations, no apoptosis was detected, nor did apoptosis occur in cells arrested in s phase before th treatment (figures s4 g and s4h). these results indicate that proliferating, but not cell cycle - arrested or differentiated, mpcs, undergo apoptosis following exposure to elevated th concentrations. accordingly, in cultured fibers, th treatment significantly induced apoptosis in proliferating myoblasts (figures s4i and s4l). finally, we tested whether apoptosis occurred also in vivo after th treatment. in ctx - injured th - treated mice, impairment of the regeneration process (figures s5a s5c) was associated with a significant reduction in pax7-positive cells and a corresponding increase in apoptosis (figures 5c and 5d). interestingly, after th treatment, the expression levels of th - regulated myogenic markers were normally increased in uninjured muscle, but not in ctx muscle (figure s5d). this finding is in agreement with the concept that systemic thyrotoxicosis causes massive apoptosis of activated myogenic precursor cells. these results demonstrate that d3 expression protects activated satellite cells from a physiological, but spatiotemporally excessive, intracellular th concentration. to identify the molecular mechanisms underlying d3-dependent apoptosis, we evaluated the effects of d3 depletion on the expression of various transcription and myogenic factors. d3 depletion was associated with a spike in th - dependent signaling (figure s5e) and a transient induced transcription of differentiation markers (figures 6a and 6b), which is in agreement with the marked similarity between the apoptotic cascade and muscle differentiation (fernando., 2002). interestingly, foxo3 was significantly induced upon d3 depletion in vitro and confirmed in vivo (figures 6a, s5f, and s5 g). the upregulation of foxo3 preceded the peak of myod, a well - established th - responsive gene, thereby confirming data showing that foxo3 induces myod in muscle cells (hu., 2008) (figures 6a and 6b). to verify that th induces foxo3 levels, we measured the response of foxo3 to th treatment in myogenic cells. foxo3 was induced by th at mrna and protein levels (figure 6c). this effect was abrogated when a dominant - negative th receptor (tr) was transfected (figures 6d and s4b), which indicates that it requires a functional tr. th also significantly increased foxo3 transcriptional activity, as demonstrated by the significant increase in the activity of a foxo3-responsive artificial promoter upon treatment with th, as well as its reduction by intracellular t3 depletion obtained by reverse t3-mediated (dentice., importantly, the dependence of foxo3 on th levels was confirmed in vivo by the appropriate foxo3 levels in both hypo- and hyperthyroid muscles (figure 6f). interestingly, foxo3 was reduced in d2ko cells and muscles (figures 6 g and 6h), in which intracellular t3 concentrations are reduced, despite normal circulating t3 (marsili., 2011), indicating a direct correlation between intracellular th and foxo3 levels. in summary, this set of experiments provides compelling evidence that th is a master regulator of foxo3 and demonstrates that foxo3 responds to the modulation of th signaling in muscle. to assess the functional relevance of the foxo3-myod axis in th - dependent apoptosis, we analyzed separately the roles of foxo3 and myod in th - treated cells. interestingly, th failed to induce apoptosis in cells expressing a dominant - negative foxo3 protein (figures 7a and s4b) and in myoblasts genetically depleted of foxo3 (figures 7b and 7c), which indicates that foxo3 plays a crucial role in th - induced apoptosis. we also assessed the effects of th in myoblasts in which myod expression was efficiently blocked by rnai (figures s6a and s6b). this result indicates that an active myod is also required for th - induced apoptosis, and is consistent with a linear cascade in which th induces foxo3, which lies upstream of myod. consistent with this model, both foxo3 and myod deficiency were rescued by transfecting a constitutively active pakt - resistant foxo3 (figure 7c) as well as by myod overexpression (figure s6b), thereby restoring in both cases the capacity of th to induce apoptosis. these gain- and loss - of - function analyses clearly indicate that foxo3 is a critical mediator of the apoptosis driven by th. finally, we asked whether th - mediated muscle differentiation also requires an intact foxo3. the expression of several well - known t3-dependent myogenic markers was not responsive to th in foxo3-depleted cells (figure 7f), and this was not due to altered expression of th receptors (figure s6c). these results indicate that foxo3 is a critical mediator of th action in skeletal muscle and that, notwithstanding exposure to excessive th, foxo3-depleted myoblasts do not undergo apoptosis upon th treatment and are phenotypically hypothyroid at nuclear level. we show that a time - dependent and cell - autonomous degradation of th signaling via d3 expression is required for correct satellite cell amplification and muscle repair. in the absence of d3, proliferating myoblasts undergo apoptosis, and this is functionally critical in regenerating muscle, but less evident under homeostatic conditions (figure s7). to our knowledge, this study is the first to describe how a ubiquitous endocrine signal th is integrated and adapted in the stem cell niche to enable cell lineage progression. in muscle stem cells, only activated proliferating cells apoptose, not those that are quiescent or arrested in s phase (figure 5). therefore, differentiating cells express d2 in order to locally produce extra t3 to allow proper differentiation. vice versa, proliferating myoblasts require lower than circulating th levels, and to this aim activate d3-mediated t3 inactivation. levels of t3 present in the plasma. therefore, satellite cells are able to customize their intracellular t3 concentrations based on their functional state and dynamic needs. it is not yet clear why this is the case, but we speculate that temporally excessive th creates a metabolic or mitotic catastrophe, which can not be overcome by the proliferating cells. in vitro, d3 is potently induced by growth factors (egf, fgf, and pdgf) and cytokines (dentice., 2009). we demonstrated in neoplastic contexts that the wnt and shh pathways are potent inducers of dio3 (dentice., we found that -catenin, sonic hedgehog, c - met, cmyc, and pax7 induced d3 in myoblasts in vitro (figure s6d). it is conceivable that d3 is induced by a set of integrated signals from growth factors, cytokines, morphogens, and other signaling pathways that are active at the injury site. t3 is a circulating hormone whose plasma concentrations are relatively stable in the healthy state. in plasma, the hypothalamic - pituitary - thyroid axis prevents potentially adverse oscillations of t4 and t3 via a potent homeostatic mechanism that controls hormone secretion by the thyroid gland (bianco and kim, 2006). a major question in this context is how muscle stem cells customize their th signature and adapt it to their physiology. the rapid increase in d3 in proliferating muscle stem cells and the consequent attenuation of t3 nuclear receptor saturation is an ideal solution to this problem. the local metabolism of th is a highly regulated process during embryonic and fetal life, as well as during muscle regeneration. in general, d3 is reciprocally regulated with d2 to maintain local control of the t3 concentration. these interlocking pathways facilitate specific chronotropic and tissue - specific changes in t3 concentrations during periods when developmental or regenerative programs call for a transient increase or decrease in specific cells (gereben., 2008). the rapid increase of d3 in proliferating myoblasts clearly indicates that the ambient plasma and cellular concentrations of th are too high to sustain their proliferation. d3 is also expressed in activated macrophages at the injury site (boelen., 2011), although its role in this cell context is presently unknown. this mechanism also occurs in the mdx mouse model, where d3 is expressed at significantly higher levels compared with healthy muscle (figure 1d). skeletal muscle stem cells are a heterogeneous population of cells that span from stem - like cells to cells more committed toward myogenic lineage progression and differentiation. there are at least two populations of pax7-positive satellite cells resident in skeletal muscle. one population rapidly contributes to muscle repair ; the second is more stem cell - like and remains longer in a quiescent state in the recipient muscle. these functional differences are reflected by the different levels of pax7 (rocheteau., 2012). in this context, pax7 represents a reversible dormant stem cell state during homeostasis (mourikis., 2012). here we show that t3 availability is differentially regulated in these two subpopulations of myogenic cells via d3 action. during muscle homeostasis, d3 is expressed in the satellite cells that are poised for myogenic commitment (pax7), wherein d3 expression does not simply reflect a secondary homeostatic regulation of this enzyme, but causes an intracellular attenuation of the th signal compared to the pax7 cells. this is reflected in the divergent expression of oppositely regulated th - responsive genes, which change depending on the reduced th signaling mediated by d3 (figures 2e and 2f). such a regulation could correlate with the metabolic status of the cells, e.g., pax7 quiescent cells are more metabolically active than the corresponding pax7 (rocheteau., 2012). here we show that the control of th signaling in the muscle stem compartment occurs, and that it is necessary for muscle cell lineage progression. this is in agreement with the critical role of th action in neurons, where th signaling represses sox2 levels and regulates neurogenesis (lpez - jurez., 2012). hyperthyroidism in humans may cause a severe muscle myopathy associated with a failure in muscle regeneration (anderson., 1994 ; simonides and van hardeveld, 2008). while it was thought that the effects of hyperthyroidism occurred at the level of myofibers (simonides and van hardeveld, 2008), the reduced expression of pax7 and increased apoptosis in hyperthyroid muscle in mice characterized in this study point to a failure at stem cell level, which may well occur also in humans. here importantly, the identification of foxo3 as a t3 target links two potent systems controlling multiple aspects of muscle physiology. in silico examination of the mouse foxo3 locus showed multiple potential candidate sequences containing tr - binding elements, although none was evolutionally conserved, and chip assays failed to identify functional relevance under our experimental conditions. nevertheless, the accumulating evidence indicating crosstalk between t3 and the akt pathway (figure 6) points to a complex network involving foxo3 regulation by t3. intriguingly, foxo3 is a potent inducer of d2the t3-producing enzyme thus suggesting that a positive autoregulatory loop might be one mechanism by which foxo3 is a target of t3, and also indirectly sustains t3 intracellular concentration by inducing d2 (figure 7 g). asakura and colleagues suggested that myod is a proapoptotic transcription factor in muscle stem cells (asakura., 2007). here we show that myod, a target of both t3 and foxo3 (dentice., 2010 ; hu., 2008), is required for the proapoptotic cascade triggered by t3. finally, we show that not only does foxo3 act as a th target, but also that its action is required to sensitize muscle stem cells to th levels. in summary, the absence of d3 in activated muscle stem cells causes a time - dependent and irreversible stem cell death due to excessive intracellular nuclear t3. d3 depletion renders these cells incapable of overcoming the t3 excess, thus promoting the apoptotic pathway. the finding that d3 plays a crucial role in controlling nuclear t3 in muscle stem cells and in the triggering of a death pathway via the foxo3-myod axis has broad implications and opens a future research scenario for the development of translational therapeutic strategies based on the local control of potent endocrine signals by modulating their metabolic pathways. primary muscle cultures (pp6) were isolated as described (qu., 1998) from the indicated mouse lines. foxo3-depleted (foxo - ko) pp6 cells were prepared from foxo3 mice as previously described (dentice., 2010). transient transfections were performed using lipofectamine 2000 (life technologies) according to the manufacturer s instructions. single myofibers were prepared from the extensor digitorumlongus and gastrocnemius muscles of 6- to 12-week - old mice as previously described (rosenblatt., 1995). pax7 isolation by facs has been described elsewhere (rocheteau., 2012). anti - myod (sc-304), myogenin (sc-12732), tubulin (sc-8035), and anti - foxo3 antibodies were purchased from santa cruz biotechnology. polyclonal anti - mhc antibody (mf-20a) and anti - pax7 antibody were from developmental studies hybridoma bank. anti - d3 antibody is described elsewhere (huang., 2003). anti - total akt was from upstate, and anti - pakt and anti - parp were from cell signaling technology. cells isolated by facs were prepared from tg : pax7-ngfp mice as previously described (rocheteau., 2012). in brief, muscle dissection was done with a scalpel by removing the tissue from the bone in dmem. the collagenase / trypsin solution was added to continue the digestion until the process was completely terminated and muscle totally digested. satellite cells have been cultured in 1:1 dmem : mcdb containing 20% serum fbs and its (1, insulin - transferrin - selenium ; gibco). cells were plated on matrigel (bd biosciences ; catalog # 354234) or collected in a lysis buffer (rneasy micro kit, quiagen) for rna extraction. foxo3, foxodn, and dbe plasmids are described elsewhere (dentice., 2010). tr plasmid was kindly provided by dr. s. cheng. to knock down myod, two different stealth sirna targeting two different regions of the coding sequence (myod-7, gacgacuucuaugaugacccguguu ; and myod-8, cacuacaguggcgacucagaugcau) were designed with the block - it technology (invitrogen) and purchased from invitrogen corporation. effective myod knockdown was assessed by measuring endogenous myod levels in satellite cells following 48 hr stealth sirna transfection (figure s6a). all three deiodinases contain a critical selenocysteine residue in the catalytic domain, which is encoded by a uga codon and requires a specific secondary mrna loop (secis element) in the 3 utr of the mrna that overrides the stop function and inserts selenocysteine (berry., 1991). given the absolute requirement of a secis element for correct d3 protein translation, we selectively ablated the secis region in the dio3 gene, thus preserving the dio3as transcript encoded in the antisense orientation in the dio3 locus, the function of which is not known (figure s2). we generated a plasmid harboring floxed sites in the dio3 locus, and specifically flanking the secis mrna structure located at nt 1,001 and nt 1,706 from the atg in the dio3 mrna (figure s2). in the absence of the secis, the tga codon, within the d3 catalytic domain, is recognized as stop codon, and protein translation terminated. once we obtained the homozygous dio3 mice, we crossed these mice with heterozygous tg : pax7-cre mice, expressing the cre - ert2 fusion protein. the cre - ert2 protein consists of cre recombinase fused to a triple - mutant form of the human estrogen receptor and catalyzes the lox sites recombination tam inducible. the expected recombination event occurred in the progeny, as documented in the pcr in figure s1d. dio3 not expressing recombinase, but tam treated, were used as negative controls. for immunofluorescent staining, cells were fixed with 4% formaldehyde and permeabilized in 0.1% triton x-100, then blocked with 0.5% goat serum and incubated with primary antibody. dissected muscle was snap frozen in liquid nitrogen, sectioned (7 m thick), and stained with hematoxylin and eosin stain (h&e) or immunofluorescence using standard protocols. western blots were run in triplicate, and bands were quantitated in one representative gel. ctx was injected as described previously (yan., 2003). briefly, 1020 l of 10 m ctx (naja mossambica mossambica, sigma - aldrich) was injected into the right ta and gastrocnemius muscles of anesthetized 12-week - old c57bl/6 male mice (the jackson laboratory) (wt), and age- and gender - matched cd3ko mice. the uninjected left ta muscles served as controls. for ctx experiments in cd3ko mice, animals were treated daily with 75 g / g tam for 5 days, and ctx was injected on day 4. mice were killed 4, 14, or 40 days after ctx injection. for ctx experiments in wt mice, animals were treated daily with th (2.5 g / mouse t3 + 10 g / mouse t4) 4 days before ctx injection ; mice were killed 4 and 14 days after ctx injection. hypothyroidism was obtained by supplying the drinking water with 0.1% mmi and 1% kclo4 for 6 weeks. animal experimental protocols were approved by the animal research committee of the university of naples federico ii. differences between samples were assessed by the student s two - tailed t test for independent samples. in all experiments, asterisks indicate significance at p < 0.05, p < 0.01, and p < 0.001 throughout., s.b., and l.d.v. provided observations and scientific interpretations ; p.r.l. and s.t. provided essential reagents and scientific insight ; m.d. performed most experiments and analysis, prepared figures, and wrote the paper ; d.s. designed the overall study, supervised the experiments, analyzed the results, and wrote the paper ; and all authors discussed the results and provided input on the manuscript. | summaryprecise control of the thyroid hormone (t3)-dependent transcriptional program is required by multiple cell systems, including muscle stem cells. deciphering how this is achieved and how the t3 signal is controlled in stem cell niches is essentially unknown. we report that in response to proliferative stimuli such as acute skeletal muscle injury, type 3 deiodinase (d3), the thyroid hormone - inactivating enzyme, is induced in satellite cells where it reduces intracellular thyroid signaling. satellite cell - specific genetic ablation of dio3 severely impairs skeletal muscle regeneration. this impairment is due to massive satellite cell apoptosis caused by exposure of activated satellite cells to the circulating th. the execution of this proapoptotic program requires an intact foxo3/myod axis, both genes positively regulated by intracellular th. thus, d3 is dynamically exploited in vivo to chronically attenuate th signaling under basal conditions while also being available to acutely increase gene programs required for satellite cell lineage progression. |
gastrojejunocolic fistula (gjf) is a rare and late complication of the surgical technique of gastrectomy and gastrojejunostomy applied for recurrent peptic ulcer disease. generally gjf is considered to be induced by a stomal ulcer due to inadequate gastric resection, incompleteness of vagotomy and long afferent loop. the most frequent symptoms of such a fistula are upper abdominal pain, severe weight loss, diarrhea, gastrointestinal bleeding and sometimes fecal vomiting. the diagnosis is most reliably and frequently made by barium enema and gastroscopy. in the management of the gjf, the historical approach was 2 - 3-phased operations which included colostomy in order to ameliorate the nutritional status and minimize the mortality of the patient. however today, because of improved parenteral and enteral support treatments and the developments in intensive care conditions, single - stage procedures can be applied and these have been favored to minimize mortality. although the occurence of gjf has decreased remarkably as a result of better medical treatment, the modern management of this condition and the generally accepted surgical treatment strategies must be discussed. a 51-year - old man was admitted to the surgical unit of yuksek ihtisas hospital in october 2006 with complaints of chronic diarrhea, epigastric pain and discomfort, severe weight loss and weakness. his medical history was marked by a gastroenterostomy due to duodenal ulcer disease in 1992. the patient was cachectic and dehydrated. at physical examination, liquidated intestine loops were sensed in the epigastrium and upper right quadrant. a complete blood count revealed a hemoglobin level of 10.3 g / dl (normal range 10.016.0) and an albumin level of 2.1 g / dl (normal range 3.44.8) in the electrolyte values, the blood sodium level was 132 upper gastrointestinal series assessment confirmed the passage between the corpus of the stomach and the proximal jejunum (fig. 1). transabdominal ultrasonography and tomography showed liquidated small intestine with edema and liquid between the intestine loops (fig. 2). gastroscopy showed a previous gastrojejunostomy and a fecaloid secretion from the anastomotic region of the lumen. colonoscopy showed an ulcer mass obstructing the transverse colon lumen and preventing the endoscope from passing to the proximal region. total parenteral nutrition (tpn) was started immediately and continued in the postoperative period till the albumin level returned to normal. after improving his state of malnutrition, the patient was taken into the operation room and an exploratory laparotomy was undertaken. at surgery, a radical en bloc resection was performed involving a subtotal gastrectomy, posterior vagectomy, partial transverse colon and jejunum resection. recovery was uneventful and the patient remained well at follow - up ; once his general status had improved, he was taken into the normal service. today, the surgical operation necessity for peptic ulcer disease has decreased dramatically. especially developments in the medical treatments with the usage of h2 receptor blockers, proton pump inhibitors and the eradication regimes for helicobacter pylori play an active role. so the incidence rate of these fistulas has been remarkably lowered because of the decrease in surgery. since fistula formation needs a 20 - 30-year latent period after the initial surgery, this severe and rare complication may occur presently. therefore, gjf is still an important and current complication [2, 3, 9 ]. the symptoms of gjf are diarrhea with lienteric stools, epigastric pain and discomfort, gastrointestinal bleeding, feculent eructation, fecal vomiting, weight loss and weakness. the most frequently used diagnostic tools are barium enema and endoscopy [1, 11, 12, 13 ]. the success rate of barium enema in correctly diagnosing the fistula is approximately 95 - 100% [10, 12, 13 ]. however, its determination success in the phenomenons which are related to malignancy is low. computerized axial tomography is used to determine this complex fistula and to exlude extraluminal diseases that may define underlying etiology. especially the fistula orifice can be followed by upper gastrointestinal system endoscopy and when necessary, preoperative histological confirmation can be done. because of the fading effect of the disease, in the postoperative period, careful clinical and laboratory evaluation must be carried out. as specified before, in a large majority of these patients, the physical examinations and laboratory studies reveal low to medium malnutrition, anemia and electrolyte imbalance. as soon as possible therefore, tpn or total enteral nutrition (ten) should be administered in patients who are suffering from malnutrition and this treatment protocol should continue in the postoperative period. because of the physiologic effects of ten over tpn, it should be the first choice if a nasoenteric tube can be placed into the jejunum. the surgical options and treatments of gastrocolic fistula / gjf have changed over the years. the historical approach was 2 - 3-staged operations even involving a preliminary diversion colostomy in order to ameliorate the nutritional status of the patient and to decrease mortality [4, 6, 7 ]. in the late 1930s, the three - staged procedures included (1) colostomy, (2) resection of the fistula and (3) colostomy closure. this operation, which is known as lahey 's procedure, was very popular because it was done with lower morbidity and mortality. in the 1960s, it was stated that single - stage procedures could be applied. today, because of the parenteral and enteral support treatments and the developments in intensive care conditions, one - stage resection can be applied, and the mortality rates are getting lower [2, 3, 8, 21, 22 ]. in conclusion, as a result of developments of the agents used in peptic ulcer treatment, gjf incidence has decreased dramatically. in the ancient times, recovering the medical status and staged operations were applied in gjf treatment, but today one - stage resections are preferred if the general status of the patient is suitable. tpn or ten should be administered in patients suffering from malnutrition. in the preoperative diagnosis stage, a possible malignancy must be eliminated. | we herein report the case of a 51-year - old man with gastrojejunocolic fistula. it is one of the late severe complications of gastrectomy and gastrojejunostomy and is considered to be induced by a stomal ulcer due to inadequate resection of the stomach and incompleteness of vagotomy. the main clinical presentation of this condition is chronic abdominal pain, weight loss, diarrhea, gastrointestinal bleeding and fecal vomiting. the diagnostic workup should include barium enema, gastroscopy and sometimes colonoscopy and abdominal tomography for excluding and ruling out the possibility of malignant extraluminal disease. the historical approach of the treatment of this rare entity was 23-phased operations which included colostomy. however today, medical management has recently been recommended as the first - line therapy, with parenteral and enteral support treatments. the preferred surgical approach is single - stage gastrocolic resection and anastomosis and this has been favored to minimize mortality. |
my first real exposure to natural products chemistry came in my third and final year as an undergraduate at cambridge university, when i attended a course of lectures on the chemistry of natural products by the nobel prize - winning chemist sir alexander todd (later to become lord todd). the lectures included many references to his own work in the field, with stories of his early work on the structure of cholesterol, the structure and function of various vitamins, and the structures of the nucleotides and nucleosides, and i was fascinated by the complex structures and biological importance of these substances. it was during this course that i decided to study the chemistry of natural products, and this study has been one of the loves of my life for the last 48 years. within the large field of natural products chemistry, i was particularly drawn to those compounds with biological activity, especially anticancer activity, and much of my research has been centered around the study of naturally occurring anticancer agents. i was fortunate to be funded by nih for work in this area soon after my move to virginia polytechnic institute and state university in 1971, and this funding has been crucially important to my success in the study of natural products. my initial studies involved the isolation and structure elucidation of potential anticancer agents from plants supplied by the national cancer institute, and this work has continued to the present, but with a new focus on the combination of natural products chemistry and biodiversity conservation. the other major thrust of my research has been on the chemistry and bioactivity of natural products with tubulin - assembly activity, and this will be discussed first. although taxol1 (1) was first isolated by wall and wani in the late 1960s, and its structure published in 1971,(1) it was still very much a laboratory curiosity to most chemists in 1978. the oncologists at nci were not initially enthusiastic about its prospects as a drug because it had two obvious drawbacks in spite of its clear activity ; it was extremely insoluble in water, and it was difficult to obtain in quantity from the relatively scarce tree taxus brevifolia. prospects for its development as an anticancer drug were thus very slim, but fortunately, some scientists within nci, notably matthew (matt) suffness, believed in its prospects and argued for its further development. these arguments were buttressed by some encouraging responses for taxol when treating solid tumor xenografts in nude mice, and in 1977, the nci approved funds to develop a formulation of taxol for clinical use as well as funds to isolate enough taxol for this work. the following year, fuchs and johnson showed that it acted as a spindle poison,(2) and the year after this, in 1979, susan horwitz published her pivotal paper documenting that taxol caused the polymerization of tubulin to microtubules.(3) this discovery significantly increased the attractiveness of taxol as a potential drug and helped to maintain interest in its development when it encountered problems with toxicity in its initial clinical trials. 1the name taxol has been trademarked by bristol - myers squibb for their formulation of the chemical compound formerly known as taxol. because of the historical nature of this review, the name taxol is retained for compound 1. the name taxol has been trademarked by bristol - myers squibb for their formulation of the chemical compound formerly known as taxol. because of the historical nature of this review, the name taxol is retained for compound 1. no infringement of the bristol - myers squibb trademark is implied. a conversation with my then colleague bob holton in 1978 started me on a new and particularly fruitful research area involving this novel compound. bob had initiated an approach to the total synthesis of taxol, but he had no experience with the actual natural product, and so he suggested a research collaboration. we agreed that he would continue his total synthetic approach, while i would investigate the chemistry of taxol, about which very little was then known. we submitted a joint r01 grant proposal to nih, but we were ahead of our time and the proposal was not funded. i thus began my studies on the chemistry of taxol on a shoestring budget, although a year or so later i was able to obtain some much needed support from the american cancer society, and later still (once taxol had become a hot property) i was able to obtain nih funding for the work. from the earliest days, i did, however, receive strong support from matt suffness and the natural products branch at nci, who provided me with relatively large amounts of crude taxane mixtures, consisting of side - cuts from the purification of taxol for clinical trials by polysciences, inc. these supplies were crucial to my early work, which could not have been done without them. my group s early studies of the chemistry of taxol have been reviewed on several occasions and will only be summarized briefly here. their focus was on the systematic modification of the functional groups of the taxane ring system and on the effect of variations in the ring system itself on bioactivity. among other discoveries, we found that removal of the c1 hydroxyl group,(7) the c2 benzoyl group,(8) and the c4 acetyl group(9) all produced analogues with significantly reduced bioactivities, but removal of the c7 hydroxyl group(10) or the c10 acetoxyl group(11) yielded products with much less activity loss. contraction of the a - ring gave the a - nortaxol 2, which was several orders of magnitude less cytotoxic than taxol but which surprisingly retained much of taxol s tubulin - polymerization activity.(12) contraction of the c - ring by an interesting mechanism gave the c - nortaxol 3, which was significantly less active than taxol both in its cytotoxicity and in its tubulin - assembly activity.(13) the oxetane ring was the focus of several studies. oxidation at c7 allowed simple base - promoted opening of the oxetane ring to give the enone 4,(14) while treatment with meerwein s reagent gave the ring - opened product 5.(12) both of these compounds were essentially completely inactive, and these findings led to the conclusion that the oxetane ring was essential for activity. this conclusion was reinforced by the finding that the sulfetane analogue 6 was also much less active than taxol.(15) later work from dubois., however, suggested that the lack of activity of compounds 4 and 5 was due more to the lack of the c4-acetate group than of the oxetane ring per se, since the 5(20)-deoxydocetaxel analogue 7 was as active as taxol in promoting tubulin assembly.(16) the lack of activity of the sulfetane analogue 6 could then be explained by the fact that the large size of the sulfur atom prevented proper docking into the active site on tubulin.(17) one of the most interesting observations to come from this early work was that changes to the c2-benzoate group had a profound effect on the activity of taxol. para - substituents on the benzene ring uniformly made the resulting taxane much less active than taxol, but some ortho and meta substituents, especially the m - azido and m - methoxy substituents, significantly enhanced activity.(18) it was gratifying that this discovery has been incorporated into two taxanes in preclinical development, compounds sb - t-11033 (8) and sb - t-121304 (9).(19) the work that my group did, combined with studies from several other research groups, especially those of georg,(20) ojima,(21) and potier,(22) established the main outline of the structureactivity relationships of taxol. what remained to be determined was the nature of the crucial interaction between taxol and tubulin. the pioneering work of horwitz had shown that taxol bound stoichiometrically and noncovalently to tubulin, and the binding site was also shown to be on -tubulin by labeling studies.(24) photoaffinity labeling studies by horwitz in collaboration with swindell showed that 3-(p - azidobenzamido)taxol photolabeled the n - terminal 31 amino acids of -tubulin,(25) while studies by horwitz in collaboration with my group showed that 2-(m - azidobenzoyl)taxol photolabeled amino acids 217231 of -tubulin.(26) this work did not, however, address the exact binding site or the conformation of taxol in the binding site. the complex of taxol with tubulin is polymeric and noncrystalline, and so the direct approach of examining the binding site by x - ray crystallography is not available. fortunately, the structure of the tubulin dimer has been determined at 3.7 by electron crystallography of taxol - stabilized zinc - induced tubulin sheets,(27) and this result established the location of taxol on the protein. however, this structure lacked the resolution to define the detailed conformation of taxol on the tubulin polymer. taxol has several flexible side chains, and notably that at c13, so many possible binding conformations are possible. several attempts to define these conformations have been made by studies of the solution nmr spectra of taxol. conformation, while a polar conformation featuring hydrophobic interactions between the c2 benzoate, the c3 phenyl group, and the c4 acetate was proposed on the basis of nmr studies in polar solvents. a combination of nmr studies using the namfis deconvolution approach showed that taxol adopts 910 conformations in cdcl3,(35) and an analysis of the electron crystallographic data in combination with the namfis results suggested that the actual binding conformation had a t - shaped structure, designated t - taxol (figure 1).(36) t - taxol conformation. the c2-benzoate is in the lower middle and the c13-side chain is to the lower left in this perspective. these studies, important as they were, did not provide direct experimental evidence for the actual conformation of taxol on the tubulin polymer. this requires a different technique, one that enables the determination of internuclear distances on the solid tubulin polymer sample. fortunately, the relatively new technique of rotational - echo double - resonance (redor) nmr spectroscopy(37) was developed for precisely this situation, and so we entered into a fruitful collaboration with professors susan bane (suny binghamton), jacob schaefer (washington university), and jim snyder (emory university) to bring the combined forces of synthetic chemistry, biochemistry, redor nmr, and computational chemistry to bear on the problem of determining the binding conformation of taxol on -tubulin. a knowledge of this binding conformation of taxol was an attractive goal because such a knowledge could guide the design of taxol analogues with improved activity by locking the molecule into the binding conformation. taxol s relatively weak association with tubulin may, in part, be due to the presence of an ensemble of nonproductive conformers,(35) and these studies provided an opportunity to test this hypothesis. in addition, it was possible that simplified taxol analogues could be designed which might retain all or most of taxol s anticancer activity. the first compound investigated was the c- and fluorine - labeled analogue 10, and this yielded distances of 10.3 and 9.8 for the two distances a and b, respectively.(38) a later study with the deuterated and fluorinated analogues 11 and 12 gave distances of 6.3, 7.8, and > 8 for the distances c, d, and e, respectively.(39) a careful analysis of these data and comparison with the other proposed conformations indicated that the t - taxol conformation provided the best fit to the redor data (table 1).(39) simultaneously with these studies we also designed an approach to the synthesis of taxol analogues which would be locked into the t - taxol conformation. several other investigators had prepared conformationally locked taxols, including those based on the nonpolar confomation and on the polar conformation, but with one exception(46)these bridged analogues were less bioactive than taxol. an important conclusion from analysis of the t - taxol structure was that the c4 acetate group and the c3 phenyl ring were in close proximity ; the centroid of the c4 acetate was only 2.5 from the ortho position of the c-3 phenyl ring (figure 2).(47) this conclusion informed our synthetic approach, which involved linking the c4 acetate to the c3 phenyl ring using linkers of variable length. t - taxol conformation, illustrating the short h --- h distance between the centroid of the c-4 acetate methyl group and the ortho position of the c-3 phenyl ring. our retrosynthetic approach was based on using the flexible and versatile grubbs metathesis reaction as the final ring - closing step ; this reaction had previously been successfully used by ojima in the synthesis of some bridged taxols.(45) the basic retrosynthetic approach is shown in scheme 1, with the key diene 14 being prepared by coupling of the -lactam 15 with the modified baccatin iii 16. our first synthetic products were the compounds 17 and 18, in which the bridge was linked via the meta position of the c3-phenyl ring. these compounds were both active, but disappointingly, they were significantly less active than taxol itself. the reason for this relative lack of activity became clear from a docking study of compound 17 into the taxol binding pocket of the electron crystallographic structure(48) of -tubulin, which showed that the meta bridge was interacting with phe272 of the protein, resulting in the displacement of 17 out of the binding pocket (figure 3).(49) this finding also suggested an obvious solution, which was to remove the objectionable interaction by relocating the bridge to the ortho position of the c3-phenyl ring. compound 17 is seated higher in the same pocket as a result of close contact between the propene moiety of the tether and phe272 of the protein (black) at the bottom of the illustration. gratifyingly, when this was done, and when the bridge was adjusted to the correct length, the activity improved dramatically. the two best derivatives were compounds 19 and 20, with just two carbons inserted between the c4 acetate methyl group and the ortho position of the c3-phenyl ring.(50) compound 19, for example, was 50-fold more potent than taxol to the a2780 ovarian cancer cell line and was twice as potent toward the pc3 prostate cancer cell line. it was also almost twice as effective as taxol at promoting the polymerization of tubulin.(47) both 19 and 20 were also much more potent than taxol to taxol - resistant cell lines ; compound 20, for example, was 150-fold more potent than taxol to the 1a9-ptx10 cell line with the f270v mutation and almost 50-fold more potent than taxol to the 1a9-a8 cell line, with the t274i mutation.(47) these results thus confirmed the t - taxol conformation as the bioactive tubulin - binding conformation of taxol. a combination of namfis analysis of the conformation of 19 with docking into the -tubulin binding site showed that this compound fit nicely into the taxol binding site and mapped well onto the t - taxol conformation (figure 4). not only was the objectionable interaction with phe 272 removed, but a favorable interaction with a histidine residue was created. t - conformations of taxol (blue) and 19 (red) in the -tubulin binding site, the latter having been docked by the glide software. reproduced from ref (47). although these results confirmed the t - taxol conformation as the tubulin - binding conformation, it was desirable to test the predictive power of the conformation by carrying out two further tests, one positive and one negative. as noted earlier, the a - nortaxol 2 was essentially noncytotoxic, although it retained moderate tubulin - assembly activity.(12) could this compound be made cytotoxic by constraining it to the t - taxol conformation ? compound 21 was prepared and was found to be approximately one - third as cytotoxic to pc3 cells as taxol, a far cry from the difference of at least 1000-fold in cytotoxicity between paclitaxel and compound 2. interestingly, the bridged derivative 21 was approximately twice as effective at promoting the assembly of tubulin as taxol, a clear testimony to the importance of the t - taxol conformation.(51) the second test was a negative one. docetaxel (22) is a clinically used semisynthetic taxane discovered by potier and differs from taxol only in the nature of the n - acyl and c10 substituents;(52) its 10-acetyl derivative 23 is equipotent.(53) if the carbamate oxygen of docetaxel were linked to the c3-phenyl group and the c10 hydroxyl group were acetylated, the resulting compound 24 would possess all the basic structural features necessary for bioactivity. it would not, however, be able to adopt the t - taxol conformation (figure 5) and would thus be expected to be inactive in spite of its correct chemical connectivity. compound 24 was prepared to test this hypothesis,(54) and satisfyingly, it was at least 2 orders of magnitude less active than taxol in the a2780 bioassay and was also significantly less active in a tubulin - assembly assay. this thus provided a conclusive negative test of the t - taxol conformation. conformation of compound 24, viewed from the same perspective as t - taxol in figure 1. given that the t - taxol conformation is the most probable tubulin - binding conformation for taxol, can this knowledge be used to design simplified compounds which mimic taxol s tubulin - assembly activity ? the answer at this point is a qualified yes. we synthesized the simplified analogue 25 and its diastereomer 26,(55) and both compounds, as well as some related ones, proved to have clear cytotoxic activity to the a2780 cell line and also to be effective in promoting the assembly of tubulin into microtubules. this activity in such drastically simplified compounds was encouraging, even though the cytotoxicities observed were over 2 orders of magnitude less than that of taxol. a part of the lack of activity may be due to solubility, since both compounds were very insoluble in water, but it is probably also due in part to the fact that the benzoyl group corresponding to the c2 benzoate of taxol is forced deeper into the hydrophobic binding pocket, leading to the conclusion that the compounds are not sufficiently tailored to fully exploit the t - taxol concept.(55) we are thus continuing our studies in this area in an attempt to discover simplified taxols that have superior biological profiles to compounds 25 and 26. in addition to preparing simplified taxols, we have sought to develop improved ways of delivering taxol to the cancer. the most promising approach has been carried out in collaboration with colleagues at cytimmune, inc., and involves the preparation of taxols with suitable linkers to bond to gold nanoparticles. the nanoparticles are also loaded with tumor necrosis factor alpha (tnf), which targets the taxol - loaded nanoparticles to cancer cells, where the taxol is released.(56) initial animal studies of this construct have been encouraging, and further development is in progress. these exciting anticancer agents have very different structures and origin than taxol and yet have a very similar mechanism of action. epothilones a (27) and b (28) were originally isolated as antifungal agents from the soil - derived mycobacterium sorangium cellulosum in 1987,(57) but it was the discovery of their taxol - like tubulin - polymerization activity in 1995(58) and the elucidation of their absolute configuration in 1996(59) that led to a surge of interest in their development as potential anticancer agents. epothilone b (epo 906, patupilone) is in phase iii clinical trials, and the lactam analogue of epothilone b (ixabepilone, 29) has been approved for clinical use for treatment of certain forms of breast cancer.(64) given the success of bridging in improving the activity of taxol, it was natural to ask whether this strategy could provide the same benefits to the epothilones. a model for the binding conformation of epothilone b on tubulin was proposed by nettles and snyder (figure 6),(65) and this model juxtaposes the c4-methyl group with the c12-methyl group. (a) nettlessnyder proposed epoa model based on ec density (left) with juxtaposition of the c4-methyl and c12-h (methyl for epob) ; r(c --- c) = 4.5. (b) mmff - energy minimized structures of the ec template and the designed bridged epod analogue 31 (overlayed with three - point selection in pymol). extensive synthetic studies, which will be reported elsewhere, led to the synthesis of the bridged epothilone 31 by olefin metathesis of the precursor 30. compound 31 had a much lower antiproliferative activity toward the a2780 cell line than epothilone d, and it was also much less active than the deprotected precursor 32. these data suggest either that the original nettlessnyder model does not reveal the correct binding conformation of the epothilones or that some unusual structural features of compound 31 contribute to its lack of activity. we are thus continuing our studies in an effort to prepare conformationally constrained epothilones with improved bioactivity. as indicated earlier, my initial studies on natural products were focused on the discovery of potential anticancer agents from plants, and this is the second important focus of my group s work. drug discovery from natural sources requires continued access to plant, marine, and microbial biomass, and as far as plants are concerned this biomass is concentrated in the tropical rainforests of the world. these forests cover less than 7% of the earth s surface, but hold 50% of its plant biomass. sadly, tropical forests are disappearing fast ; their coverage is down from 16% of the earth s land surface in 1950 to less than 7% today. the preservation of tropical rainforests and tropical reef systems is or should be an important part of any comprehensive drug discovery program. one way to encourage preservation is to demonstrate the value of tropical forests and reef systems as potential sources of new pharmaceutical or agrochemical products. the rio convention on biological diversity (cbd) in 1992 established three main goals : the conservation of biological diversity, the sustainable use of its components, and the fair and equitable sharing of the benefits from the use of genetic resources. these objectives were subsequently incorporated into the innovative international cooperative biodiversity group (icbg) program based at the fogarty international institute at nih, and we were fortunate to receive an award under this program to carry out drug discovery and biodiversity conservation work in suriname and later in madagascar. these results are all from my laboratory and do not include other discoveries made by our icbg partners eisai research institute and dow agrosciences. the ipomoeassins are a series of related resin glycosides isolated from the suriname plant ipomoea squamosa. their isolation was challenging, but eventually 60 mg of the most abundant compound (ipomoeassin a, 33) was obtained, and its structure was elucidated by nmr and mass spectra combined with chemical conversions and mosher ester formation for determination of stereochemistry. the compounds were of interest in part because of their unusual structures but primarily because they showed potent but selective antiproliferative activity to the a2780 cell line.(66) ipomoeassin a showed selective antiproliferative activity in the nci 60-cell line screen, and its pattern of activity did not match other known anticancer agents when subjected to a compare analysis. these compounds have been synthesized(67) and are currently being considered for development by the national cancer institute. the schweinfurthins are a class of highly potent cytotoxic agents that were originally discovered by beutler.(68) we isolated four new compounds, of which schweinfurthins e (34) and g (35) had submicromolar antiproliferative activity against the a2780 ovarian cancer cell line.(69) these compounds are being evaluated by a pharmaceutical partner against additional cell lines, with a view to discerning their development potential. schweinfurthin f has recently been synthesized by wiemer,(70) and the relative simplicity of these compounds makes them attractive candidates for synthetic chemistry and sar studies should their biology warrant it. the three particularly complex cytotoxic triterpenoid saponins 3638 were obtained from albizia gummifera ; their structure elucidation required a demanding interpretation of complex nmr spectra.(71) although these compounds had micromolar antiproliferative activity against the a2780 ovarian cancer cell line, they are unlikely to be attractive development candidates because of their complex structures and presumed unfavorable pharmacokinetics. a madagascar plant of the malleastrum genus yielded several new bioactive diterpenoids, of which 39 is one example,(72) while casearia nigrescens yielded several new diterpenoids with submicromolar activities, including compound 40.(73) finally, the new and relatively unusual cardenolide 41 from an elaeodendron sp. had potent antiproliferative activity to the a2780 cell line.(74) in addition to the chemical work, the suriname and madagascar icbg programs have made significant contributions to conservation and economic development in their respective countries. in suriname, the icbg program contributed to the establishment of the central suriname nature reserve, a unesco world heritage site.(75) this important conservation success was brought about primarily through a cooperative agreement between conservation international, a partner in the suriname icbg program, and the government of suriname, but the icbg program provided important scientific justification for the value of the rain forest and thus of establishing this protected area. in madagascar, the montagne des franais is an area of outstanding natural beauty and importance in the north of the country. the work to achieve protected area status for this area was complex and included making a botanical and economic evaluation, developing a plan for an ecotourism concession, establishment of steering committees to lead the process of setting up the new protected area, development of a community structure to assist with security and conflict management, consultation with local and regional authorities, development of the legal tools needed for protected status, and compilation of a complete initiative dossier documenting these and other steps for submission to the necessary government departments. as a result of all these steps, the montagne des franais was granted temporary protected status in the systme daires protges de madagascar (sapm) in 2006 and will achieve full protected status in mid-2008. these and other conservation achievements were accomplished by the icbg madagascar partners centre national dapplication des recherches pharmaceutiques, conservation international, and the missouri botanical garden. these and other conservation and development successes have given significant added value to the suriname and madagascar icbg programs, over and above the value of the novel bioactive natural products isolated. the foregoing account gives some taste of the joys and the challenges of natural products research in the 21st century. natural products have proven to be the most reliable single source of new and effective drugs, and especially anticancer agents. thus, newman and cragg have shown that 63% of anticancer drugs introduced over the last 25 years are natural products or can be traced back to a natural products source.(76) natural products have not only yielded new and effective drugs, but they have also provided insight into new mechanisms of action, and cancer treatment would be immeasurably poorer without the insights and the compounds provided from nature. it is thus instructive to ask why it is that natural products have proved to be such a prolific source of bioactive agents. there are several reasons, but certainly one of the most important is that plants and other organisms produce many biologically active substances for defense and other purposes, and so these substances are uniquely tailored to fit into a biological receptor of some kind.(77) second, natural products are often large molecules with built - in chirality and are thus uniquely suited to bind to complex proteins and other biological receptors. as a result of these considerations, there is a high correlation between the properties of drugs and those of natural products. the misconception that natural products research has not produced many drugs recently is laid to rest by butler, who writes another misconception has been that np research has failed to deliver many new compounds that have undergone clinical evaluation over the last few years. however, in reality, 15 np - derived drugs have been launched in the key markets of the united states, europe, and japan over the last three years, and an additional 15 np - derived compounds were in phase iii clinical trials at the end of 2003.(80) although it has been enormously successful, the pharmaceutical industry is under continuing pressure to speed up the process of drug discovery, and the natural products approach to drug discovery must compete in the scientific marketplace with other approaches which might appear to give more rapid short - term results. the three major components of any successful natural products drug discovery program are the availability of adequate source materials, the use of new and selective bioassays, and the use of rapid and efficient isolation and structure elucidation methods. the available source materials include not only the traditional microbial, plant, and marine organisms but also novel source materials such as extremophiles and unculturable microorganisms. the use of novel culturing environments or of heterologous dna - based approaches, for example, has given encouraging results in the search for new antibiotics.(81) it goes without saying that any approach that involves collection of biomass must be done in a way that is fully consistent with the cbd and with full recognition of the rights of the host country. the second key component of a successful natural products based drug discovery program is the use of selective and predictive bioassays. in the anticancer area, these will include assays for individual enzymes such as the protein kinases and phosphatases rather than whole cell cytotoxicity assays, while in the antiinfective area a genetics - based fitness test holds promise for detecting novel agents with known and unusual mechanisms of action.(85) the third key requirement is that isolation and structure elucidation be carried out as efficiently as possible. this will usually require some level of dereplication to avoid the reisolation of known compounds, as well as the use of the best nmr and mass spectrometric instrumentation available today. two final considerations are the problem of compound supply, which can be severe in the case of plant and especially marine natural products, and of analogue synthesis. although compound supply will always be a factor in evaluating potential drug candidates, it need not be a fatal one. the problem has been met in several ways in the past. in the case of taxol, a partial synthesis from 10-deacetylbaccatin iii proved crucial in the early years,(86) while it is currently produced by plant tissue culture(87) as well as by direct isolation and semisynthesis. another example is the marine natural product ecteinascidin (yondelis), which is prepared by semisynthesis from the microbial natural product cyanosafracin.(88) in other cases, direct synthesis is possible ; the most dramatic example of this is the approximately 70-step synthesis used for production of the phase iii clinical candidate eribulin, a simplified derivative of the complex marine natural product halichondrin b.(89) it is thus safe to say that the combination of synthetic ingenuity with informed sourcing will succeed in providing adequate supplies of most if not all natural products of pharmaceutical interest. the second consideration is that chemical synthesis can often produce modified natural products with improved properties. natural products can thus also lead to new analogues with greater synthetic accessibility or improved activity, as exemplified by the many analogues of taxol that are in clinical trials(90) as well as numerous other examples such as the exciting activity of 26-trifluoro-(e)-9,10-dehydro-12,13-desoxyepothilone b as an improved epothilone analogue.(91) in summary, the future of natural products research remains bright. if novel source organisms are combined with innovative bioassays and efficient structure elucidation, the natural products approach to drug discovery will continue to compete very effectively with other approaches, and will continue to contribute many novel bioactive agents for pharmaceutical use, as well as providing synthetic chemists with challenging targets for synthesis and for improvement. | recent research on the chemistry of natural products from the author s group that led to the receipt of the acs ernest guenther award in the chemistry of natural products is reviewed. redor nmr and synthetic studies established the t - taxol conformation as the bioactive tubulin - binding conformation, and these results were confirmed by the synthesis of compounds which clearly owed their activity or lack of activity to whether or not they could adopt the t - taxol conformation. similar studies with the epothilones suggest that the current tubulin - binding model needs to be modified. examples of natural products discovery and biodiversity conservation in suriname and madagascar are also presented, and it is concluded that natural products chemistry will continue to make significant contributions to drug discovery. |
sleep disturbances increase with aging and it is estimated that nearly 67% of the elderly people have at least one sleep - related complaint. various sleep - related problems identified in elderly people include long time to fall asleep, disturbed sleep at night, and decreased daytime alertness etc. researchers have observed direct correlation between poor sleep quality and increased physical and psychiatric morbidity, decline in cognitive function, and impaired quality of life (qol). most common factors cited for sleep disturbances are lack of sufficient physical activity, poor sleep - related hygiene, and excessive daytime napping. although sleep - related problems in older people put extra burden on healthcare services and consume valuable economic resources, many physicians ignore this problem and consider them as a part of a normal aging process. various drugs like benzodiazepines and non - benzodiazepines are available for the pharmacological treatment of sleep - related problems. however, all these agents are not free from side effects, especially in geriatric population. even short - term use of these agents have been associated with number of adverse drug reactions, which include dependence (both physical as well as psychological), impairment of psychomotor performance, disturbances in rapid eye movement sleep pattern, cognitive function abnormalities, and rebound insomnia etc. in this respect, adverse effects produced by sleep medications can further compromise the qol of an elderly person. aging is also associated with reduced exercise capacity due to decrease in muscle mass resulting in loss of self - sufficiency. so any non - pharmacological therapy minimizing the decline in physical capacity or sleeping disturbances will improve the qol of geriatric population. beneficial effects of yoga like reduction of blood pressure, relieving of anxiety, delaying functional decline, decreasing sleep disturbances, and improvement in serum lipid profile have been observed. manjunath and telles reported in a randomized trial that after regular yoga exercises for 6 months in a geriatric sample, there was significant reduction in time to fall asleep, decreased sleep disturbance during night time, better sleep quality, decreased use of medications for sleep when compared with control group. similar findings were reported in a study by chen and tseng, where improvement in different aspects of sleep and decrease in depressive symptoms was observed after yoga intervention. however, extremely limited amount of data is available whether these benefits of yoga are retained over long term yoga practice. accordingly, current study was planned to assess the effect of long term yoga exercises on sleep quality and qol in elderly people. control group consisted of community dwelling older adults not doing any kind of yoga exercises from nagpur city, whereas, study group participants were recruited from patanjali yog centre, nagpur. survey samples consisted of two groups : yoga and non - yoga groups. in yoga group, 35 volunteers were included whereas non - yoga group consisted of 30 participants. study was started only after getting the clearance from the institutional ethics committee, government medical college, nagpur. participants in both these groups were community - dwelling elders with age 60 years or more from nagpur city. control group participants were of age 60 years or more, of either gender and those who were not doing any kind of yoga exercises. as this study was self - reporting type, participants who were bed - ridden or requiring assistance for their daily living activities, with severe cardiovascular, neurological, musculoskeletal, pulmonary disorders, or suffering from chronic infectious disorders like tuberculosis were not included in this study. in yoga group, participants doing daily yoga exercises for 2 years or more were included. all these participants were regularly attending patanjali yog centre of nagpur city, doing regular yoga exercises for at least one hour, with a certified yoga instructor daily, from 6 a.m. to 7 a.m. different yoga exercises performed by these participants were physical postures (various asanas like mountain pose [tadasana ], triangle pose [trikonasana ], revolved triangle pose [parivrtta trikonasana ], standing forward bend [uttanasana ], hands to feet [pada hastasana ], tree pose [vrksasana ], lotus pose [padmasana ], half spinal twist [ardhamatsyendrasana ], wind relieving poses [pavanamuktasana ], bow pose [dhanurasana ], locust pose [salabhasana ], fish pose [matsyasana ], cobra pose [bhujangasana ], bridge pose [setu bandhasana ] etc.) bandhas (jalandhar bandh, mulabandha, uddiyanbandha nadishuddhi pranayama or anuloma - viloma [alternate nostril breathing - i ], anuloma - viloma [alternate nostril breathing - ii ], surya bhedan [right nostril breathing ], ujjayi, bhramari, pranayama from hatha yoga [surya bhedan, bhasrika, ujjayi, shitali, sitkari, bhramari, murchha, and plavini pranayama ]). prior to survey, participants were given complete information about the study procedure and all doubts regarding this study were clarified. data collection was done by visiting each participant at his / her home and administering two commonly used instruments, pittsburgh sleep quality index (psqi) and qol leiden - padua (leipad) questionnaire. for better understanding of these questionnaires by participants, we translated each questionnaire into hindi (national language) and marathi (regional language) and as per request of the participant, suitable versions were administered to them. psqi is an effective instrument useful for measuring subjective sleep quality and sleep disturbances in older people. psqi contains 19 self - rated questions and five questions rated by the bed partner or room - mate (if available). responses from room partner or room - mate were not included in the scoring system. nineteen questions were designed to measure seven aspects of sleep having scoring range of 0 - 3 each where a score of zero indicated no sleep disturbance, whereas a score of three indicated significant sleep disturbance. the scores from all these seven domains were then added to calculate psqi, which had a scoring range of 0 - 21, where a score of zero meant no disturbance in sleep or good sleep quality whereas higher scores indicated poor or worse sleep quality. the seven aspects of sleep used in this instrument were total duration of sleep, sleep disturbances during the past month, time taken to fall asleep or sleep latency, daytime dysfunction due to somnolence, habitual sleep efficiency, overall sleep quality, and use of medicines for sleep. other instrument we used in this study was leipad questionnaire, which is a useful tool to measure qol of older people. this popular instrument consists of 49 items, which measure six domains : cognitive functioning (cf), depression / anxiety (da), life satisfaction (ls), physical functioning (pf), self - care (sc), and social functioning (sf). score of all items are combined to yield a global score from 0 to 81, where score of 81 indicates maximum impairment of qol. descriptive statistics such as mean and percentage were used to describe demographics of each group. mann - whitney u test was used to compare the qol and sleep quality of yoga and non - yoga groups and p value less than 0.05 was considered statistically significant. control group consisted of community dwelling older adults not doing any kind of yoga exercises from nagpur city, whereas, study group participants were recruited from patanjali yog centre, nagpur. survey samples consisted of two groups : yoga and non - yoga groups. in yoga group, 35 volunteers were included whereas non - yoga group consisted of 30 participants. study was started only after getting the clearance from the institutional ethics committee, government medical college, nagpur. participants in both these groups were community - dwelling elders with age 60 years or more from nagpur city. control group participants were of age 60 years or more, of either gender and those who were not doing any kind of yoga exercises. as this study was self - reporting type, participants who were bed - ridden or requiring assistance for their daily living activities, with severe cardiovascular, neurological, musculoskeletal, pulmonary disorders, or suffering from chronic infectious disorders like tuberculosis were not included in this study. in yoga group, participants doing daily yoga exercises for 2 years or more were included. all these participants were regularly attending patanjali yog centre of nagpur city, doing regular yoga exercises for at least one hour, with a certified yoga instructor daily, from 6 a.m. to 7 a.m. different yoga exercises performed by these participants were physical postures (various asanas like mountain pose [tadasana ], triangle pose [trikonasana ], revolved triangle pose [parivrtta trikonasana ], standing forward bend [uttanasana ], hands to feet [pada hastasana ], tree pose [vrksasana ], lotus pose [padmasana ], half spinal twist [ardhamatsyendrasana ], wind relieving poses [pavanamuktasana ], bow pose [dhanurasana ], locust pose [salabhasana ], fish pose [matsyasana ], cobra pose [bhujangasana ], bridge pose [setu bandhasana ] etc.) bandhas (jalandhar bandh, mulabandha, uddiyanbandha nadishuddhi pranayama or anuloma - viloma [alternate nostril breathing - i ], anuloma - viloma [alternate nostril breathing - ii ], surya bhedan [right nostril breathing ], ujjayi, bhramari, pranayama from hatha yoga [surya bhedan, bhasrika, ujjayi, shitali, sitkari, bhramari, murchha, and plavini pranayama ]). prior to survey, participants were given complete information about the study procedure and all doubts regarding this study were clarified. data collection was done by visiting each participant at his / her home and administering two commonly used instruments, pittsburgh sleep quality index (psqi) and qol leiden - padua (leipad) questionnaire. for better understanding of these questionnaires by participants, we translated each questionnaire into hindi (national language) and marathi (regional language) and as per request of the participant, suitable versions were administered to them. psqi is an effective instrument useful for measuring subjective sleep quality and sleep disturbances in older people. psqi contains 19 self - rated questions and five questions rated by the bed partner or room - mate (if available). responses from room partner or room - mate were not included in the scoring system. nineteen questions were designed to measure seven aspects of sleep having scoring range of 0 - 3 each where a score of zero indicated no sleep disturbance, whereas a score of three indicated significant sleep disturbance. the scores from all these seven domains were then added to calculate psqi, which had a scoring range of 0 - 21, where a score of zero meant no disturbance in sleep or good sleep quality whereas higher scores indicated poor or worse sleep quality. the seven aspects of sleep used in this instrument were total duration of sleep, sleep disturbances during the past month, time taken to fall asleep or sleep latency, daytime dysfunction due to somnolence, habitual sleep efficiency, overall sleep quality, and use of medicines for sleep. other instrument we used in this study was leipad questionnaire, which is a useful tool to measure qol of older people. this popular instrument consists of 49 items, which measure six domains : cognitive functioning (cf), depression / anxiety (da), life satisfaction (ls), physical functioning (pf), self - care (sc), and social functioning (sf). score of all items are combined to yield a global score from 0 to 81, where score of 81 indicates maximum impairment of qol. descriptive statistics such as mean and percentage were used to describe demographics of each group. mann - whitney u test was used to compare the qol and sleep quality of yoga and non - yoga groups and p value less than 0.05 was considered statistically significant. yoga group comprised 35 participants out of which percentage of men and women were 65% and 35%, respectively, whereas in case of non - yoga group, percentage of men and women was 66% and 34%, respectively. average age of participant in yoga group was 63.7 years whereas that of non - yoga group participants was 62.8 years. yoga group participants were doing yoga exercises regularly and the average duration was 5.26 years. table 1 shows comparison of various sub - scales of psqi between yoga and non - yoga group. participants in the yoga group had a mean total sleep quality score of 3.771 0.3623. participants in the non - yoga group had a mean total sleep quality score of 8 0.4315. the total psqi score in yoga group was below the cut off level of five and differed significantly (p < 0.0001) from the total psqi score of non - yoga group participants. though the average sleep duration score was less in yoga group participants, the difference was not statistically significant between the two groups. yoga group participants had significantly less (p < 0.0001) sleeping disturbances, shorter sleep latency, and decreased use (p < 0.05) of sleep medications. furthermore, subjective sleep quality and habitual sleep efficiency scores were significantly better (p < 0.0001) in yoga group than non - yoga group participants. scores of various domains of pittsburgh sleep quality index in yoga and non - yoga group participants table 2 shows comparison of scores between two groups for various items of leipad questionnaire. yoga group participants had significantly better (p < 0.0001) pf, sc functioning, and sf scores than non - yoga group participants. although average scores of ls scale and da scale were lower in yoga group, no statistical difference was observed between the two groups. scores of various domains of quality of life leiden - padua quality of life in yoga and non - yoga group participants results of our study indicate that older adults practicing yoga regularly had better overall sleep quality, less episodes of disturbed sleep, took less time to fall asleep, less day time dysfunction, less use of sleep medications and also felt more rested and energetic in the morning. these results were in accordance to previous studies where effect of 6 months yoga intervention on elder people was studied and found that yoga group participants had better sleep quality and less sleeping disturbances when compared with the control group. one possible reason explained for better sleep quality in yoga practitioners is that yoga exercises involve stretching and relaxing of muscles causing significant physical and mental exertion resulting in less sleep latency, more deep sleep, less sleep disturbances, and better sleep efficiency.[1618 ] as average duration of yoga practices of participants was 5.26 years, we can say that benefits of yoga were retained even after long - term yoga practice in yoga group of our study. however, exact relationship between yoga and better sleep quality still remains to be elucidated. similarly, in a study reported by dam., association between poor sleep quality and low wake time oxygen saturation (less than 90%) resulting in poor physical performance in the form of decreased grip strength and walking speed was observed. soni., concluded that yogic breathing exercises can improve strength of the respiratory muscles which resulted in better tissue perfusion and improved oxygen saturation. considering the fact that sleep apnea is associated with decreased oxygen saturation, improved oxygen saturation due to yoga exercies might be another possible explanation for less sleep disturbances in yoga group of our study. snoring increases the chances of sleep disturbances two fold and this has been attributed to the weakened upper airway muscles, narrowing of the respiratory passage that causes snoring. regular yogic breathing exercises might have beneficial effect by strengthening upper airway muscles resulting in less sleep disturbances observed in this population. previous studies of yoga on health volunteers have shown that after short term yoga exercises, there is significant increase in the vagal tone, decrease of sympathetic discharge in the form of significantly decreased heart rate response on standing as well as decreased catecholamine levels in plasma. this decreased physiological arousal effect of yoga has been cited as one of the reasons for less sleep disturbances. earlier studies have demonstrated association of poor quality of sleep with a poor physical function score ; however, the exact mechanism behind this association is still not known. aging is associated with decreased muscular strength and muscle mass which results in decreased exercise capacity. functional abilities are reduced, and hence restrictions in performing daily activities and loss of self - sufficiency can occur. yoga exercises improve joint flexibility, prevent decline in the physical function, and improve the qol of elderly people. our results also suggest similar findings in the form of improved pf and sc scores of leipad qol questionnaire., in which data were collected from 83 elderly yoga practitioners aged 60 years and above. researchers found that joint flexibility measured using goniometry was significantly more than the control group, also significant reductions in activity execution timings were noted in latin - american development to the maturity group (ladeg) autonomy protocol. in a systematic review, woodyard has inferred that yoga exercises involve stretching of the joints and long - term practice might be causing gradual loosening of the muscles and connective tissues surrounding the bones and joints. regular stress on joints in yoga exercises thus, it is suggested that yoga exercises are associated with less sleep disturbances (low psqi score), which in turn are associated with better pf ; consequently, elderly people can confidently live self - sufficient life with no dependency, which is reflected in better sf score in our study. better cognitive function scores in our research are consistent with previous studies where yoga has shown to improve cognition. though the exact mechanism of how yoga improves cognition is not known, two hypotheses have been put forward including the role of yoga in improving the mood and relieving the stress as chronic stress can lead to down - regulation of 5ht1a (5-hydroxytryptamine 1a) receptors with subsequent apoptosis of hippocampal neurons. second mechanism suggested is the improvement of attention and alertness abilities as yoga exercises involve concentrating on breathing or any specific part of the body. earlier studies have reported that disturbed sleep causes impaired psychomotor alertness, which can lead to decline in cognitive function known to be associated with prefrontal cortex. with the advancing age, there is decrease in blood flow to the brain. regular practice of yoga might decrease autonomic over - activity and increase in parasympathetic activity with reduction of oxygen consumption and metabolic rate of prefrontal cortex cells. thus, preventing the neuronal loss which might have the beneficial effect in arresting the decline in cognitive function. incorporation of other qualitative methods like interviews or focus group discussions could have been more helpful in better understanding of factors related to reduced qol in elderly such as, effects of social and lifestyle changes like death of spouse, chronic disorders associated with aging, depression, etc. this study was just a cross - sectional survey with small sample size, so findings in this study reflect only preliminary data regarding the impact of long - term practice of yoga on sleep quality and qol. as aging is a continuous process, addition of non - pharmacological intervention like regular practice of yoga in daily routine can improve sleep qualities, which in turn will improve physical function and cognitive function, thereby improving the qol of elderly. incorporation of other qualitative methods like interviews or focus group discussions could have been more helpful in better understanding of factors related to reduced qol in elderly such as, effects of social and lifestyle changes like death of spouse, chronic disorders associated with aging, depression, etc. this study was just a cross - sectional survey with small sample size, so findings in this study reflect only preliminary data regarding the impact of long - term practice of yoga on sleep quality and qol. as aging is a continuous process, addition of non - pharmacological intervention like regular practice of yoga in daily routine can improve sleep qualities, which in turn will improve physical function and cognitive function, thereby improving the qol of elderly. long - term practice of yoga exercises by elderly people is associated with less sleep disturbances and good sleep quality and these results are in accordance with many studies involving yoga intervention for 6 month duration only. considering the limited sample size and subjective data of our study, further studies are required to substantiate the findings in this study. | background : sleep disturbances and decline in the physical functionality are common conditions associated with aging. pharmacological treatment of sleep disturbances can be associated with various adverse effects. short term trials of yoga on sleep have shown beneficial effects.objectives:to evaluate the effect of long - term yoga exercises on sleep quality and quality of life (qol) in the elderly.materials and methods : this was a cross - sectional study in which data were collected from elderly people aged 60 years or more living in nagpur city. we employed two types of survey questionnaires : pittsburgh sleep quality index (psqi) and qol leiden - padua (leipad) questionnaire. a total of 65 elderly men and women who signed an informed consent and completed questionnaires were included in the study. sleep quality score psqi and qol (leipad questionnaire) score of the study group were evaluated and compared with the control group using mann - whitney u test.results:total psqi score in yoga group was lower than that of the control group. also various qol scores of the yoga groups were higher than the control group.conclusion:addition of regular yoga exercises in the daily routine of elderly people can help to achieve good sleep quality as well as improve the qol. |
producing high - quality images in computerised tomography (ct) is important for image interpretation to ensure that the maximum diagnostic information is available to facilitate the visualisation of discrete changes in anatomy indicating early pathological processes [13 ]. higher quality ct images, however, normally imply a higher radiation dose to the patient since changes in scan parameters are required to facilitate high resolution. the standard of image quality mainly depends on the preferences of radiologists and their willingness to balance low - noise, high - quality ct images with the impact upon radiation levels administered. noise is a major factor in determining acceptable image quality and often dictates the radiation dose for a particular ct protocol. increases in noise degrade both low - contrast resolution and spatial resolution and therefore influence the radiologists perception of the image [58 ]. however, an increase in noise up to certain levels may not necessarily impair the image diagnosis [9, 10 ]. the aim of image quality optimisation is to provide an image that is suitable for the clinical task with the lowest radiation dose given to the patient. it is whether the clinical information required is contained in the image and can be interpreted by the observer that is important rather than whether the appearance of the image is pleasing to the eye. the threshold of image quality should be one able to deliver enough information to the radiologist to permit a medical decision to be taken with an acceptable amount of assurance. hence, there is a need to have a keen understanding of image quality evaluation tools and methods of data analysis to identify the required level of image quality required for diagnosis in the development of optimised scan protocols using the lowest possible radiation dose. effective and scientifically accepted methods of assessing image quality are needed for the implementation of such optimised imaging protocols across all imaging modalities including ct [13, 1215 ]. to limit any uncertainties in interpretation, observer performance tests on images obtained using ct scanning protocols the usefulness of observer performance studies where observers visually grade image quality is attributed to the following characteristics : the validity of such studies is assumed to be high since the observer s ratings take into account all technical factors in reproducing anatomical structures on the image together with the experience and confidence of the observer in identifying and interpreting the image.image assessment is based on the visualisation of clinically relevant anatomical structures using established standards such as the european guidelines on quality criteria.the studies are easy to conduct following a clear and reproducible methodology and take practical consideration of radiology availability increasing the chances for participation. the validity of such studies is assumed to be high since the observer s ratings take into account all technical factors in reproducing anatomical structures on the image together with the experience and confidence of the observer in identifying and interpreting the image. image assessment is based on the visualisation of clinically relevant anatomical structures using established standards such as the european guidelines on quality criteria. the studies are easy to conduct following a clear and reproducible methodology and take practical consideration of radiology availability increasing the chances for participation. observer performance methods such as image criteria (ic) studies, visual grading analysis (vga) and receiver - operating characteristic (roc) analysis are now established methods for the analysis of image quality. ic and vga are useful in the majority of cases where the patient examinations present as normal anatomy. ct examinations producing anatomical structures obtained from either anthropomorphic phantoms or animal models make it easier to produce large numbers of images with no concern about the ethical issues associated with the irradiation of patients. results of such studies facilitate the comparison of optimised protocols with current ones prior to their implementation on patients in the clinical setting [13, 1921 ]. established methods in performing observer and diagnostic performance tests make it possible to measure image quality by the evaluation of anatomical structures seen on the ct images against a set of criteria that have to be fulfilled [2124 ]. visual grading analysis (vga) facilitates the quantification of subjective opinions and involves grading of the visibility of anatomical structures on the images. in relative vga, the visibility of anatomical structures is compared and graded against the visibility of the same structures within a reference image. 0 implies a visibility equal to the structure within the reference image, while negative or positive values imply inferior or superior visibility respectively. in absolute vga, the scales are ordinary and are usually given a description facilitating interpretation and improving the agreement between observers. a vga score calculated from the results of such analysis allows statistical analysis of the differences [13, 21 ]. in 2007 bath and mansson indicated the inappropriate analysis of visual grading data using parametric tests and recommended a novel method of analysing such data called visual grading of characteristics : vgc analysis. vgc treats the scale steps as ordinal with no assumptions on the distribution of the data. the resemblance between vgc and receiver - operator characteristic (roc) analysis leads to the possibility of using the well - established roc evaluation methods in analysing vgc data. the variation in the visual grading of the reviewers of two imaging techniques can be used to describe the variation between the two techniques in the same way as in an roc study. vgc can be considered as a repeated image criteria scoring, where reviewers change their threshold for the necessity of fulfilling each criterion in a similar way to the scale steps in an roc study. the reviewers therefore state their confidence concerning the fulfilment of a criterion obtaining an ordinal scale. as in roc analysis, the different ratings do not necessarily correspond to the same numerical intervals on the decision scale nor do all reviewers use the ratings with the same meaning since the ordinal scale is just used to test the probability distribution for each imaging technique. in 2010, smedby and fredrikson proposed a method for analysing ranked visual grading data using ordinal logistic regression analysis. ordinal logistic regression is a statistical technique able to process data on an ordinal scale that handles situations involving several factors that could potentially influence the outcome [27, 28 ]. scott (1997) states that a lack of a full review of ordinal data increases the potential for lost information and that ordinal regression facilitates the analysis whilst taking account of a number of explanatory variables, accounting for the effects of each in the form of an odds ratio, so excluding unverifiable assumptions. in 2011, smedby presented a study quantifying potential radiation dose reduction with visual grading regression at the medical imaging perception society s (mips) 14th conference held in august 2011 in dublin, ireland. this study was published in the british journal of radiology (bjr) in 2012. although ordinal logistic regression analysis is an established statistical method for analysing ordinal data, only recently have publications specifically recommended its use in the investigation of diagnostic efficacy. effective and scientifically accepted methods of assessing image quality are needed for the clinical implementation of optimised ct protocols [13, 1215 ]. this study investigated image quality evaluation using vgc during optimisation of ct examinations of the head. image quality scores obtained from this visual grading assessment were analysed using vgc and ordinal regression analysis and the impact of their findings upon the achieved radiation dose savings during the review of the optimised scanning protocols. detail of the optimisation process for the maltese data set was previously published [30, 31 ]. ethical approval was obtained from the clinical centres and from the governing ethics institution (urec ref no : 001/2009). this research group had previously identified ct examinations of the head (43 %) as the most commonly requested and performed ct examination in malta. head ct examinations using the locally optimised protocols were performed in each participating ct suite (n = 2) : a ge brightspeed elite16-slice ct scanner at a public hospital with an annual ct referral rate of 6,460 head ct examinations and a philips brilliance 64-slice ct scanner in a private centre with an annual ct referral rate of 300 head ct examinations. the resulting 66 ct data sets for image quality evaluation included the current protocol (n = 30), optimised protocol (n = 30) and duplicate examinations (n = 6) to facilitate inter- and intra- reviewer reliability. the coded ct data sets were reviewed by six local resident radiologists including : two consultant radiologists, one with more than 20 years experience in ct reporting and the second having more than 5 years, two senior radiology registrars, both with more than two years experience and two radiology trainees. these images were presented using viewdex, a java - based software for presentation and evaluation of medical images in reviewer performance studies developed at sahlgrenska university hospital, goteborg university and sodra alvsborg hospital. the images were displayed on primary monitors using a general electric (ge) advantage workstation (aw) v.4.3_07, previously tested and satisfying the recommendations by the american association of physicists in medicine (aapm) as outlined in task group 18, having 3-megapixel monitors (1,536 2,048 pixels) driven by a barcomed coronis graphics card, with a maximum luminance of 725.22 cd / m. ambient lighting levels adhered to aapm recommendations for diagnostic reading workstations (1560 lux) [33, 35 ] and were measured with a calibrated unfors light - o - meter photometer (billdal, sweden). the radiologists declared their confidence for each of the eu ct anatomical criteria using a five - point scale as follows:1 : confident that the criterion is not fulfilled;2 : somewhat confident that the criterion is not fulfilled;3 : indecisive whether the criterion is fulfilled of not;4 : somewhat confident that the criterion is fulfilled;5 : confident that the criterion is fulfilled. 1 : confident that the criterion is not fulfilled ; 2 : somewhat confident that the criterion is not fulfilled ; 3 : indecisive whether the criterion is fulfilled of not ; 4 : somewhat confident that the criterion is fulfilled ; 5 : confident that the criterion is fulfilled. clinical indications included head trauma, cerebrovascular accident (cva) or stroke and headaches. eight cases presented abnormal findings : four subdural haematomas and four infarcts, all classified as obvious pathologies by a consultant radiologist. the overall reductions in radiation dose measured in terms of radiation dose quantities : volume ct dose index (ctdivol) and dose length product (dlp) following optimisation are summarised in table 1. ctdivol is the main radiation dose indicator in spiral ct, integrating the radiation dose for a single slice delivered both within and beyond the scanned volume, representing the average radiation dose for a single slice in the scanned volume for contiguous scans. ctdivol given in milligrays (mgy) is an accurate indicator of the radiation dose per slice within the scanned volume [1, 3639 ]. the ctdivol multiplied by the total scan length in centimetres is given as the dose length product (dlp) given in milligray cm (mgy cm) [2, 3638, 40 ]. dlp correlates better with the patient radiation dose than ctdivol and can easily be used as an indicator of the given radiation dose. there is a linear relationship between dlp and radiation dose and a linear relationship between radiation dose and the stochastic risk. hence, dlp can be used to compare the stochastic risk between different ct examinations. dlp is a more realistic indicator of the radiation dose and, in calculating the dlp, the measure of ctdivol is still required. while ctdivol is estimated based on the selected scan parameters prior to imaging, dlp is calculated after the examination has taken place.table 1comparison of mean ct doses between current and optimised protocols (confidence interval p 0.5) indicates better image quality for the scan protocol on the vertical axis of the plot [16, 25 ]. image quality scores together with radiation dose measurements and protocol type were also analysed using ordinal regression analysis. ordinal logistic regression analysis takes into account potential confounders of the association between two cohorts : the independent variables and the end result (dependent variable), with the measure of association being the odds ratio. in this study, random effects include the patients and the radiologists participating in the study while the independent variables are the scan protocols and the radiation dose administered as the dlp. the ordinal logistic regression model (proportional odds model) is the appropriate model for analysing rating scores since these are ordinal categorical responses. ordinal regression analysis was performed using the ibm statistical package for social sciences (spss version 19), where differences were considered significant outside the 95 % confidence interval (p 0.05). this research group had previously identified ct examinations of the head (43 %) as the most commonly requested and performed ct examination in malta. head ct examinations using the locally optimised protocols were performed in each participating ct suite (n = 2) : a ge brightspeed elite16-slice ct scanner at a public hospital with an annual ct referral rate of 6,460 head ct examinations and a philips brilliance 64-slice ct scanner in a private centre with an annual ct referral rate of 300 head ct examinations. the resulting 66 ct data sets for image quality evaluation included the current protocol (n = 30), optimised protocol (n = 30) and duplicate examinations (n = 6) to facilitate inter- and intra- reviewer reliability. the coded ct data sets were reviewed by six local resident radiologists including : two consultant radiologists, one with more than 20 years experience in ct reporting and the second having more than 5 years, two senior radiology registrars, both with more than two years experience and two radiology trainees. these images were presented using viewdex, a java - based software for presentation and evaluation of medical images in reviewer performance studies developed at sahlgrenska university hospital, goteborg university and sodra alvsborg hospital. the images were displayed on primary monitors using a general electric (ge) advantage workstation (aw) v.4.3_07, previously tested and satisfying the recommendations by the american association of physicists in medicine (aapm) as outlined in task group 18, having 3-megapixel monitors (1,536 2,048 pixels) driven by a barcomed coronis graphics card, with a maximum luminance of 725.22 cd / m. ambient lighting levels adhered to aapm recommendations for diagnostic reading workstations (1560 lux) [33, 35 ] and were measured with a calibrated unfors light - o - meter photometer (billdal, sweden). the radiologists declared their confidence for each of the eu ct anatomical criteria using a five - point scale as follows:1 : confident that the criterion is not fulfilled;2 : somewhat confident that the criterion is not fulfilled;3 : indecisive whether the criterion is fulfilled of not;4 : somewhat confident that the criterion is fulfilled;5 : confident that the criterion is fulfilled. 1 : confident that the criterion is not fulfilled ; 2 : somewhat confident that the criterion is not fulfilled ; 3 : indecisive whether the criterion is fulfilled of not ; 4 : somewhat confident that the criterion is fulfilled ; 5 : confident that the criterion is fulfilled. clinical indications included head trauma, cerebrovascular accident (cva) or stroke and headaches. eight cases presented abnormal findings : four subdural haematomas and four infarcts, all classified as obvious pathologies by a consultant radiologist. the overall reductions in radiation dose measured in terms of radiation dose quantities : volume ct dose index (ctdivol) and dose length product (dlp) following optimisation are summarised in table 1. ctdivol is the main radiation dose indicator in spiral ct, integrating the radiation dose for a single slice delivered both within and beyond the scanned volume, representing the average radiation dose for a single slice in the scanned volume for contiguous scans. ctdivol given in milligrays (mgy) is an accurate indicator of the radiation dose per slice within the scanned volume [1, 3639 ]. the ctdivol multiplied by the total scan length in centimetres is given as the dose length product (dlp) given in milligray cm (mgy cm) [2, 3638, 40 ]. dlp correlates better with the patient radiation dose than ctdivol and can easily be used as an indicator of the given radiation dose. there is a linear relationship between dlp and radiation dose and a linear relationship between radiation dose and the stochastic risk. hence, dlp can be used to compare the stochastic risk between different ct examinations. dlp is a more realistic indicator of the radiation dose and, in calculating the dlp, the measure of ctdivol is still required. while ctdivol is estimated based on the selected scan parameters prior to imaging, dlp is calculated after the examination has taken place.table 1comparison of mean ct doses between current and optimised protocols (confidence interval p 0.5) indicates better image quality for the scan protocol on the vertical axis of the plot [16, 25 ]. image quality scores together with radiation dose measurements and protocol type were also analysed using ordinal regression analysis. ordinal logistic regression analysis takes into account potential confounders of the association between two cohorts : the independent variables and the end result (dependent variable), with the measure of association being the odds ratio. in this study, random effects include the patients and the radiologists participating in the study while the independent variables are the scan protocols and the radiation dose administered as the dlp. the ordinal logistic regression model (proportional odds model) is the appropriate model for analysing rating scores since these are ordinal categorical responses. ordinal regression analysis was performed using the ibm statistical package for social sciences (spss version 19), where differences were considered significant outside the 95 % confidence interval (p 0.05). image quality scores obtained from the evaluation of the image data sets by local radiologists were analysed using vgc. vgc analysis is performed in three steps : a frequency table (2 n frequency table, where n = number of categories) summarises the results for the two scan protocols separately.the vgc data points in the frequency table represent the coordinates of the vgc curve. as in an roc curve the origin of a vgc curve per definition is 0. the data points are arranged according to the cumulative (relative) frequencies of the corresponding categories..the vgc points are plotted to produce a vgc curve indicating the sensitivity or true positive fraction (tpf). the vgc curves for this study were created using the roc analysis web - based calculator for roc curves developed by john eng, m.d., and russell h. morgan at the department of radiology and radiological science, johns hopkins university, baltimore, md, usa (available online at : http://www.rad.jhmi.edu/jeng/javarad/roc/jrocfiti.html). a frequency table (2 n frequency table, where n = number of categories) summarises the results for the two scan protocols separately. the vgc data points in the frequency table represent the coordinates of the vgc curve. as in an roc curve the origin of a vgc curve per definition the data points are arranged according to the cumulative (relative) frequencies of the corresponding categories. the vgc points are plotted to produce a vgc curve indicating the sensitivity or true positive fraction (tpf). the vgc curves for this study were created using the roc analysis web - based calculator for roc curves developed by john eng, m.d., and russell h. morgan at the department of radiology and radiological science, johns hopkins university, baltimore, md, usa (available online at : http://www.rad.jhmi.edu/jeng/javarad/roc/jrocfiti.html). the area under the curve (aucvgc) can be considered as a measure or accuracy index of the difference in image quality between the two techniques. a vgc curve situated on or near the diagonal (aucvgc = 0.5) indicates that the two scan protocols produce identical image quality. the greater the aucvgc (> 0.5) indicates better image quality for the scan protocol on the vertical axis of the plot [16, 25 ]. image quality scores together with radiation dose measurements and protocol type were also analysed using ordinal regression analysis. ordinal logistic regression analysis takes into account potential confounders of the association between two cohorts : the independent variables and the end result (dependent variable), with the measure of association being the odds ratio. in this study, random effects include the patients and the radiologists participating in the study while the independent variables are the scan protocols and the radiation dose administered as the dlp. the ordinal logistic regression model (proportional odds model) is the appropriate model for analysing rating scores since these are ordinal categorical responses. ordinal regression analysis was performed using the ibm statistical package for social sciences (spss version 19), where differences were considered significant outside the 95 % confidence interval (p 0.05). vgc curves (figs. 1 and 2) indicate that the optimised protocols do not differ significantly from the current protocols in terms of image quality. a one - sample t - test on the values of the area under the curve (aucvgc) (table 2) demonstrated no significant difference from the 0.5 value (p 0.05) despite radiation dose reductions.fig. 2vgc curve philips brilliancetable 2aucvgc results of one - paired sample t - testheadtest value = 0.5nmeansdse meantdfp - valuemean difference95 % confidence interval of the differencemalta aucvgc 40.560.060.031.8930.160.060.040.15 vgc curve ge brightspeed vgc curve philips brilliance aucvgc results of one - paired sample t - test ordinal regression analysis was applied to further identify differences between the protocols and their effect on the quality of the images produced and therefore as predictors of image quality. overall results presented in table 3 show that dlp and criteria have no significant impact on the rating scores (p 0.05). the protocol used however does have a significant impact on the quality of the images in terms of rating scores (p 0.05). the difference in the protocols is based on the imaging parameters selected with the optimised protocol administering a significantly lower radiation dose (table 1).table 3overall results : ordinal regression analysisomnibus testlikelihood ratio chi - squaredfp - valuephilips brilliance170.1960.00ge brightspeed310.0060.00tests of model effectstype iiisourcewald chi - squaredfp - valuephilips brilliancedlp1.2510.26criteria1.2510.26protocol44.5310.00ge brightspeeddlp0.0210.90criteria11.8110.00protocol278.4740.00dependent variable : rating scoremodel : (threshold), dlp, criteria, protocol overall results : ordinal regression analysis dependent variable : rating score model : (threshold), dlp, criteria, protocol results presented in table 4 indicate that only criteria 2 (visually sharp reproduction of the basal ganglia) had a negative odd for the ge brightspeed, while criteria 1 (visually sharp reproduction of the border between white and grey matter) and again criteria 2 had a negative odd for the philips brilliance. for every one - unit increase, the odds that the selected protocol is the current protocol rather than the optimised protocol increase by : (odds ratio (b) 1) 100.table 4criteria results : ordinal regression analysisparameter estimates95 % wald confidence intervalhypothesis testparameterodds (b)s elowerupperwald chi - squaredfp - valuege brightspeedthreshold [rating score = 1]1.870.572.980.7510.7310.00[rating score = 2]0.600.571.710.511.1210.29[rating score = 3]0.440.570.671.550.6110.44[rating score = 4]1.460.570.352.586.6210.01dlp0.000.000.000.000.0210.90[criteria = 1]0.610.200.231.029.4210.00[criteria = 2]1.170.151.460.8760.8010.00[criteria = 3]0.950.150.651.2439.2210.00[criteria = 4]0.380.150.090.676.62210.01[criteria = 5]0.00...... [protocol = 1 ] 0.350.10050.150.5411.8110.00[protocol = 2 ] 0...... (scale)1philips brilliancethreshold [rating score = 1]4.460.565.563.3663.4510.00[rating score = 2]2.470.533.501.4422.0110.00[rating score = 3]1.160.522.180.144.9710.03[rating score = 4]1.280.520.262.296.0110.01dlp0.000.000.000.001.2510.26[criteria = 1]1.020.201.420.6224.8610.00[criteria = 2]1.370.201.770.1045.3410.00[criteria = 3]0.620.200.231.029.4210.00[criteria = 4]0.030.200.370.430.0210.90[criteria = 5]0.00...... [protocol = 1 ] 0.860.1290.611.1244.5310.00[protocol = 2 ] 0...... (scale)1dependent variable : rating score model : (threshold), dlp, criteria, protocol criteria results : ordinal regression analysis dependent variable : rating score model : (threshold), dlp, criteria, protocol the kappa (k) values for resident radiologists (n = 6) ranged between 0.33 and 0.59 showing fair to moderate agreement in their interpretation of the repeated scans, while the p - value was 0.05, implying significant agreement between the two interpretations of the repeated scans. cronbach s alpha () measured 0.76, indicating an acceptable level of internal consistency within the local resident radiologist, with inter - reviewer correlations ranging between 0.26 and 0.45. vgc curves (figs. 1 and 2) indicate that the optimised protocols do not differ significantly from the current protocols in terms of image quality. a one - sample t - test on the values of the area under the curve (aucvgc) (table 2) demonstrated no significant difference from the 0.5 value (p 0.05) despite radiation dose reductions.fig. 2vgc curve philips brilliancetable 2aucvgc results of one - paired sample t - testheadtest value = 0.5nmeansdse meantdfp - valuemean difference95 % confidence interval of the differencemalta aucvgc 40.560.060.031.8930.160.060.040.15 vgc curve ge brightspeed vgc curve philips brilliance aucvgc results of one - paired sample t - test ordinal regression analysis was applied to further identify differences between the protocols and their effect on the quality of the images produced and therefore as predictors of image quality. overall results presented in table 3 show that dlp and criteria have no significant impact on the rating scores (p 0.05). the protocol used however does have a significant impact on the quality of the images in terms of rating scores (p 0.05). the difference in the protocols is based on the imaging parameters selected with the optimised protocol administering a significantly lower radiation dose (table 1).table 3overall results : ordinal regression analysisomnibus testlikelihood ratio chi - squaredfp - valuephilips brilliance170.1960.00ge brightspeed310.0060.00tests of model effectstype iiisourcewald chi - squaredfp - valuephilips brilliancedlp1.2510.26criteria1.2510.26protocol44.5310.00ge brightspeeddlp0.0210.90criteria11.8110.00protocol278.4740.00dependent variable : rating scoremodel : (threshold), dlp, criteria, protocol overall results : ordinal regression analysis dependent variable : rating score model : (threshold), dlp, criteria, protocol results presented in table 4 indicate that only criteria 2 (visually sharp reproduction of the basal ganglia) had a negative odd for the ge brightspeed, while criteria 1 (visually sharp reproduction of the border between white and grey matter) and again criteria 2 had a negative odd for the philips brilliance. for every one - unit increase, the odds that the selected protocol is the current protocol rather than the optimised protocol increase by : (odds ratio (b) 1) 100.table 4criteria results : ordinal regression analysisparameter estimates95 % wald confidence intervalhypothesis testparameterodds (b)s elowerupperwald chi - squaredfp - valuege brightspeedthreshold [rating score = 1]1.870.572.980.7510.7310.00[rating score = 2]0.600.571.710.511.1210.29[rating score = 3]0.440.570.671.550.6110.44[rating score = 4]1.460.570.352.586.6210.01dlp0.000.000.000.000.0210.90[criteria = 1]0.610.200.231.029.4210.00[criteria = 2]1.170.151.460.8760.8010.00[criteria = 3]0.950.150.651.2439.2210.00[criteria = 4]0.380.150.090.676.62210.01[criteria = 5]0.00...... [protocol = 1 ] 0.350.10050.150.5411.8110.00[protocol = 2 ] 0...... (scale)1philips brilliancethreshold [rating score = 1]4.460.565.563.3663.4510.00[rating score = 2]2.470.533.501.4422.0110.00[rating score = 3]1.160.522.180.144.9710.03[rating score = 4]1.280.520.262.296.0110.01dlp0.000.000.000.001.2510.26[criteria = 1]1.020.201.420.6224.8610.00[criteria = 2]1.370.201.770.1045.3410.00[criteria = 3]0.620.200.231.029.4210.00[criteria = 4]0.030.200.370.430.0210.90[criteria = 5]0.00...... [protocol = 1 ] 0.860.1290.611.1244.5310.00[protocol = 2 ] 0...... (scale)1dependent variable : rating score model : (threshold), dlp, criteria, protocol criteria results : ordinal regression analysis dependent variable : rating score model : (threshold), dlp, criteria, protocol the kappa (k) values for resident radiologists (n = 6) ranged between 0.33 and 0.59 showing fair to moderate agreement in their interpretation of the repeated scans, while the p - value was 0.05, implying significant agreement between the two interpretations of the repeated scans. cronbach s alpha () measured 0.76, indicating an acceptable level of internal consistency within the local resident radiologist, with inter - reviewer correlations ranging between 0.26 and 0.45. the advantages of using visual grading studies in the evaluation of clinical images are that these can be carried out with clinically available images and there is no need for a gold standard during the evaluation. the terminology in this field is somewhat confusing as some authors use vga to denote standard statistical tests with assumptions that may not be appropriate since the data in a vga str ordinal. analysing visual grading analysis methods with parametrical statistical tests such as t - tests and analysis of variance (anova) incorrectly assumes the grading data are an interval variable ; vgc and ordinal regression analysis correctly treat visual grading data as ordinal and categorical. an added advantage of the logistic regression model is that it can simultaneously consider multiple factors influencing the quality of the image. the inclusion of multiple factors in the logistic statistical model means that more complete detailed information can be obtained [27, 28 ]. the findings of the vgc and ordinal regression analysis also led to consultation with participating resident radiologists highlighting the importance of image quality criteria for ct head imaging, which could be weighted differently depending on the pathology being investigated. asked to rate the five criteria in order of importance, they concluded that criterion 1 (visually sharp reproduction of the border between white and grey matter) and criterion 5 (visually sharp reproduction of the cerebrospinal fluid space over the brain) are the two most important. the majority of brain pathologies such as infarcts and brain tumours require image quality levels that allow differentiation between these structures. in the case of suspected fresh haemorrhage, since it is hyperdense in relation to the surrounding brain tissue, a lower image quality may be sufficient for diagnosis. no specific criteria were indicated for white matter disease as this is normally determined by mri. based on the results of both vgc and ordinal regression analysis performed in this study, the optimised protocols were implemented for all patient presentations (inclusive of trauma) for general brain on the ge brightspeed scanner as the negative odds did not affect any of the two most important criteria. however, the optimised protocol was limited to follow - up cases on the philips brilliance as criteria 1 findings were affected by the optimisation process and this was considered important for initial diagnosis by the radiology experts. while low - dose ct has been shown to be viable in high contrast imaging, it is still unclear whether the same radiation dose reductions are possible in areas of low contrast differences such as intracranial brain structures. initial ct examinations are mainly targeted for the diagnosis of subtle changes in intracranial structures such as lacunar infarcts requiring optimal contrast resolution and therefore it may not be appropriate to use low - dose, high - noise scan protocols. follow - up ct examinations on the other hand are performed with the purpose of identifying gross morphological changes involving structures with high contrast or large structures and can therefore benefit from the use of radiation dose reduced protocols especially if performed for repeat patient imaging. the indications of follow - up brain scans are frequently gross imaging findings that may change or affect the clinical management of the patient. examples include follow - up for traumatic or non - traumatic haemorrhage, raptured aneurysms, stroke or evaluation of ventricular size in cases of hydrocephalus [6, 43, 44 ]. a limitation of this study is that image quality evaluation was based primarily on morphologically normal anatomical structures. radiologists were not asked to evaluate or comment on any pathology present in the image data sets. so the question still remains as to whether this low radiation dose is applicable for specific brain pathologies, which frequently present as low contrast differences in comparison to normal brain tissue [6, 4345 ]. the inclusion of pathologies together with an roc analysis to investigate the applicability of the optimised protocols in the diagnosis of subtle to obvious pathologies is recommended. consideration of different weighting levels for anatomical criteria is suggested by the authors to be incorporated in future image quality research. the absence of a significant finding may be related to an insufficient number of observations rather than as a result of the statistical approaches applied ; however the number of observations involving six expert readers and 66 ct data sets pre and post optimisation aligns with similar observer studies and exceeds several [4649 ]. additionally, as the ct images were of the brain, the variability in subject matter was minimal with respect to anatomical criteria due to patient size differences compared to studies that have looked at other anatomical regions such as the chest or abdomen.. currently research incorporating both vgc and ordinal regression analysis in review of clinical images and anatomical criteria is limited and therefore further research involving these statistical test tools is recommended. european guidelines on quality criteria for computed tomography (eur 16262) list anatomical structures for the visualisation for specific ct examinations such as the cranium (general brain and skull base) ; face and neck (face, sinuses, petrous bone, orbits, sella, salivary glands, pharynx and larynx) ; spine (vertebral and paravertebral structures, lumbar spine, disc herniation and spinal cord) ; chest (general chest, mediastinal vessels and high resolution ct) ; abdomen and pelvis (general abdomen, liver, spleen, kidneys, pancreas, adrenal glands and general pelvis) ; bones and joints (pelvis and shoulder). additional research is recommended to encompass the range of ct examinations indicated in the european guidelines with increased focus upon anatomical structural criterion definition and the weighting of criteria with respect to the diversity of patient presentation. this work has confirmed the utility of vgc and ordinal regression during optimisation of radiation dose and image quality in ct. the use of this method should be encouraged over statistical tests for vga that assume normality or continuous data. | objectivesto evaluate visual grading characteristics (vgc) and ordinal regression analysis during head ct optimisation as a potential alternative to visual grading assessment (vga), traditionally employed to score anatomical visualisation.methodspatient images (n = 66) were obtained using current and optimised imaging protocols from two ct suites : a 16-slice scanner at the national maltese centre for trauma and a 64-slice scanner in a private centre. local resident radiologists (n = 6) performed vga followed by vgc and ordinal regression analysis.resultsvgc alone indicated that optimised protocols had similar image quality as current protocols. ordinal logistic regression analysis provided an in - depth evaluation, criterion by criterion allowing the selective implementation of the protocols. the local radiology review panel supported the implementation of optimised protocols for brain ct examinations (including trauma) in one centre, achieving radiation dose reductions ranging from 24 % to 36 %. in the second centre a 29 % reduction in radiation dose was achieved for follow - up cases.conclusionsthe combined use of vgc and ordinal logistic regression analysis led to clinical decisions being taken on the implementation of the optimised protocols. this improved method of image quality analysis provided the evidence to support imaging protocol optimisation, resulting in significant radiation dose savings.main messages there is need for scientifically based image quality evaluation during ct optimisation. vgc and ordinal regression analysis in combination led to better informed clinical decisions. vgc and ordinal regression analysis led to dose reductions without compromising diagnostic efficacy. |
understanding the developmental patterns of vegetative and reproductive organs and factors that influence those patterns is of critical importance for conserving rare plants. we recently determined that leaf and leaflet expansion of the endangered cycas micronesica were influenced by spatial and temporal factors, but reproductive organ expansion was unaffected or only minimally influenced by the same factors. we pointed out that empirical approaches for fitting models to organ growth and development may be used to inform horticultural or conservation questions of other rare cycad taxa. here we argue that this approach may improve our understanding of the evolutionary and developmental biology of cycads. while slow to gain traction in botany, especially in studies of gymnosperms (but see refs. 2 and 3), evo - devo has become one of the most promising and productive perspectives in biology. this should not be surprising given that development describes processes within a generation and evolution describes processes among generations. in writing about fossil cycads, mamay first suggested that angiosperm carpels evolved from megasporophylls, possibly of cycads. in more modern terms, examining regulatory genes, frohlich suggested that angiosperm carpels evolved from microsporophylls. these two hypotheses are probably incommensurate given that female and male strobili of cycads are homologous, unlike strobili of all other extant gymnosperms. cycad megastrobili and microstrobili are effectively a telescoped flush of leaves (fig. 1). both female and male strobili are still highly modified, so we still expect different developmental pathways in vegetative leaves, megastrobili and microstrobili. development in cycads is undoubtedly modular, as in other gymnosperms, although maybe not as modular as in angiosperms. thus ontogeny of various cycad organs should progress differently from other organs in the same individual plant. we expect different developmental timing in vegetative vs. reproductive organs because cycad strobili are likely highly endoploid. thermogenesis probably requires extra mitochondria, as we see in several skunk cabbage (symplocarpus) species. while almost exclusively documented in angiosperms, plants have plenty of endoploidy, especially succulent plants, which might include stems and strobilus axes in cycads. furthermore, animal tissues with high metabolic demand are often highly endoploid, such as heart muscles, flight muscles and liver cells. we suspect that endoploidy provides a way around otherwise rate - limiting production of mrna. efforts to confirm endoploidy in cycad strobili are warranted because endoploidy alters developmental rates insofar as mitotic cycle rates are inversely proportional to ploidy levels and probably inversely proportional to chromosomal content per nucleus, i.e., c - values. there are four modes of evolutionary response to changing environments : (1) environmental tracking, (2) phenotypic plasticity, (3) bet hedging, and (4) extinction. a priori, we expect greater environmental tracking and phenotypic plasticity in vegetative structures because the individual plant can not grow without leaves. however, we expect more bet hedging (risk aversion) in reproductive organ production for any perennial plant ; especially in cycas micronesica, which makes large investments in both female and male strobili. but these are all mechanisms by which organisms evolve via selection. by contrast, gorelick and olson argued that drift should play a disproportionate role in cycad evolution compared with selection because of the peculiar genomic architecture and small population sizes (see also ref. similarly, lynch and conery hypothesized that large genome size, which we see in cycads, may be maladaptive. thus developmental rates of different plant parts may be nothing more that what gould and lewontin mistakenly called spandrels. maybe there are no adaptationist explanations nor fitness benefits to the developmental patterns we described. or, alternatively, maybe these developmental patterns are nothing more than a corollary of endoploidy levels, which we presume are greater in thermogenic cones than in other plant parts. cycads are a threatened group of plants worldwide for which recovery plans have already been proposed or implemented for some taxa (e.g., see ref.. a full understanding of evolutionary developmental trajectories of cycads may be a prerequisite for restoring habitats during recovery efforts. thus far, we have only examined phenology and evolutionary responses in the most basal genus of cycads, cycas, with its disaggregated female strobili. because of the putative recent ancestry of all extant cycads, we anticipate similarities among all living cycads, which may not be due to any selective advantage. does plasticity of cycad male cone development differ from that of other gymnosperms ? because cycad male cones are presumably not homologous with those of other extant gymnosperms, the relative roles of selection and drift may not be the same in evolution of cycads vs. other gymnosperms. given that cycads are the most basal of living seed plants, it is incumbent upon us to better understand these fascinating plants. measurement of effective population sizes, plasticity, heterochrony, and endoploidy will help immensely in answering these evolutionary questions about cycads and may well help in their conservation. figure 1. a cycas seemannii megastrobilus (or indeterminate strobilus sensu in ref. 28) emerges as a flush of megasporophylls bearing naked ovules, which are almost certainly homologous to the pinnately compound vegetative leaves. the genus cycas contain some species with pinnately compound megasporophylls, e.g., c. revoluta and c. pectinata, while all members of the genus have new flushes of vegetative leaves that emerge from the center of the megastrobilus, as seen in this figure, further indicating homology between sporophylls and vegetative leaves in cycads. | we recently described lack of phenotypic plasticity in reproductive organ development and substantial plasticity in vegetative organ development for the cycad cycas micronesica. is there an evo - devo explanation for the disparity in phenotypic plasticity of vegetative vs. reproductive organs ? despite modularity, might evolution of cycad phenology be controlled more by drift than selection ? |
untreated, mortality is 50% when the central nervous system (cns) is involved and 85% for disseminated infection, with up to 50% of survivors demonstrating developmental abnormalities [1, 2 ]. administration of high - dose acyclovir decreases mortality to 4% for cns and 29% for disseminated disease. diagnosis of neonatal herpes, however, is challenging : vesicles are absent in nearly 40% of severe infections [2, 3 ] ; other early symptoms and signs are nonspecific, and disseminated infection can appear identically to bacterial sepsis. in the usa, this risk is more than 300 times higher when herpes simplex virus (hsv) is isolated versus not isolated from the genital tract during labor. more than half of neonatal herpes cases in the usa and europe are associated with maternal acquisition of hsv-1 or hsv-2 near the time of delivery and the remainder result from exposure of the baby to reactivating maternal infection [57 ]. the rate of transmission to the infant is higher (2550%) in first episode infections than reactivation (1.1 was positive, 4 hours) [5, 30, 31 ]. of these 27 infants, (7.4%) died during the follow - up period. the cause of death was pneumonia in one case and possible pneumonia in the other. it is uncertain if either infant was exposed to hsv during birth, however, as the genital swabs were obtained thirteen and five days, respectively, prior to the delivery date. for the other 25 potentially exposed neonates, 13 were healthy at the postpartum visit, six additional neonates were doing well on follow - up phone call (range, 1021 days after delivery), and six were lost to follow - up. our study demonstrates that prior hsv-2 infection is frequent among pregnant women in south africa, as is genital hsv shedding during labor, especially among hiv - positive women. among hsv-2 seropositive women, the shedding frequency is similar to women in the usa during labor, where genital hsv was detected in 30.8% of hiv - positive and 9.5% of hiv - negative women [32, 33 ]. our study suggests that the lack of published reports of neonatal herpes in south africa is not due to infrequent exposure to hsv-2 during birth. while we did not identify any cases of overt neonatal herpes, the study was not powered to estimate the frequency of neonatal herpes. the two infants born vaginally to women with hsv-2 reactivation at enrollment (five and thirteen days prior to delivery) were unlikely to be infected with hsv. while pneumonia can be a feature of disseminated hsv infection, this typically occurs at days 1012 of life. a systematic evaluation of acutely ill neonates, with diagnostic testing by hsv pcr or viral culture, would be required to accurately estimate the incidence of neonatal herpes in developing countries. we collected genital specimens from women thought to be in early labor, but only half of women are known to have delivered within one day of genital swab collection. for the 119 hsv-2 seropositive women who delivered within one day of sampling, the hsv-2 shedding rate was 17%, the same as the larger cohort. thus, it is clear that exposure to hsv-2 during birth occurs frequently in infants in south africa. our ability to determine which neonates were at greatest risk for neonatal herpes due to contact with hsv-2 during delivery was limited. in immunocompetent persons, with daily swab collection, subclinical shedding episodes last a median duration of only 2 days (iqr, 1.03.5). studies with more frequent sampling (four times daily) in hiv - positive and immunocompetent persons have suggested that half of episodes may be < 12 hours in duration [17, 34 ]. the low rate of hsv-2 detection among hsv-2 seropositive women with genital lesions in our study suggests that rapid clearance of hsv-2 by pregnant women may be common. to more accurately assess which neonates are at greatest risk for neonatal herpes, genital swabs for hsv pcr would need to be collected closer to the time of delivery in a larger cohort of women. although 41% of participants were hsv-2 seronegative at enrollment, we did not detect any episodes of hsv-2 acquisition in late pregnancy : no women seroconverted and hsv-2 shedding was detected in no hsv-2 seronegative women. in neighboring zimbabwe, the incidence of hsv-2 seroconversion was 1.8% between 36 weeks of gestation and 6 weeks after delivery and among hiv - positive women, 17.3% seroconverted between delivery and 6 weeks after delivery. these rates are considerably higher than in the usa, where between the first prenatal visit and delivery (median interval of 6.5 months) the hsv seroconversion rate is 1.3%, with 1.0% developing hsv-2 antibodies. although we have complete data on genital hsv-2 shedding in hsv-2 seronegative women, the expected shedding rate with recent hsv-2 acquisition is less than 50% ; first episode infections in late pregnancy, therefore, may not have been captured by detection of genital hsv shedding alone. our incomplete follow - up, however, limits the number of women evaluated for seroconversion. with an estimated hsv-2 incidence of 510%, only 1.3 to 2.5% of the study population would be expected to have acquired hsv-2 in the past three months. while no participants seroconverted, the 95% confidence interval (03.2%) includes the percentage of women expected to seroconvert if annual hsv-2 incidence was 10% and remained unchanged in late pregnancy. despite the limitations in detecting hsv-2 acquisition in late pregnancy, this study demonstrates a high rate of genital hsv-2 shedding during labor in hsv-2 seropositive women in south africa. while the risk of neonatal transmission for women with hsv reactivation is thought to be < 1% due to protection by maternal neutralizing antibodies, 2050% of neonatal herpes cases in the usa and europe are associated with hsv-2 reactivation [68 ] due to the high prevalence of hsv-2 relative to the low incidence of hsv-2 in late pregnancy. if the absence of published reports of neonatal herpes from south africa reflects decreased neonatal infection with hsv, as opposed to decreased identification and reporting, given the high genital shedding rate that we have found among hsv-2 seropositive women, there may be differences in the transmissibility of hsv-2 to the neonate due to virologic, host, or iatrogenic (e.g., decreased use of invasive fetal monitoring devices) factors. studies investigating hsv-2 shedding patterns, genetic differences in hsv-2 strains, and immunologic differences between south african and usa mother - infant pairs may provide insights into the pathogenesis of neonatal hsv. | background. despite high herpes simplex virus type 2 (hsv-2) incidence and prevalence among women in africa, we are unaware of published neonatal herpes reports. to assess neonatal hsv transmission potential in south africa, we investigated the frequency of the strongest risk factors : hsv acquisition in late pregnancy and hsv shedding during labor. methods. women admitted in early labor to a hospital in soweto underwent hsv serologic testing and genital swab collection for hsv pcr. hsv-2 seronegative women were assessed for seroconversion 46 weeks after delivery. results. of 390 women enrolled, 229 (58.7%) were hsv-2 seropositive. genital hsv-2 was detected in 17.2% of hsv-2 seropositive women, including 26 of 115 hiv - positive and 13 of 110 hiv - negative women (22.6% versus 11.8% ; rr, 1.91 ; 95% ci, 1.043.53 ; p = 0.038), but in none of 161 hsv-2 seronegative women. among the 91 hsv-2 seronegative women followed after delivery, none seroconverted. conclusions. hsv-2 reactivation is common among south african women during labor, especially those with hiv coinfection. to determine the epidemiology of neonatal herpes in south africa and to investigate whether the lack of reported cases is due to alterations in immune control or hsv-2 virulence, studies evaluating acutely ill neonates for hsv and studies of maternal hsv-2 shedding patterns are needed. |
s. aureus isolates can be divided into independently evolving clonal complex (cc) lineages. each cc lineage has a unique and stable combination of surface protein variants and a unique restriction - modification (rm) system combination that controls horizontal gene transfer (hgt) between lineages. while there are ten major human s. aureus lineages, only some lineages have acquired meca which is carried on variants of the relatively stable staphylococcal cassette chromosome (scc). the most successful hospital - associated (ha)-mrsa clones include cc22 sccmeciv, cc30 sccmecii, st239 sccmeciii, cc5 sccmecii, and cc45 sccmeciv. these mrsa clones have evolved during the last two to three decades and in some cases have spread worldwide. in more recent years, independently evolving clones have caused infections predominately in the community [cc8 sccmeciv (usa300), cc1 sccmeciv and cc59 sccmeciv ] and in pigs and persons with livestock contact (cc398 sccmeciv). mobile genetic elements (mges) account for approximately 1520% of the s. aureus genome. they include scc elements, bacteriophage, s. aureus pathogenicity islands (sapis), plasmids and transposons. a range of resistance, virulence, toxin, immune evasion and host specificity factors can be encoded on these mges. indeed, the emerging mrsa clones in the community and livestock have acquired stable and distinct mges that are responsible for their ability to adapt to new niches and hosts. in addition, over 80 whole genome sequencing projects are currently in the public domain, and these already show an enormous variety of mges in different isolates. however, relatively little is known about mge stability, movement and selection during evolution of s. aureus populations. we investigated the evolution of mrsa in a single acute - care teaching hospital in london, uk over a ten - year period. we saw mrsa cc22 sccmeciv become the dominant clone concurrent with acquisition of resistance to a range of antibiotics including aminoglycosides, chloramphenicol, clindamycin, fusidic acid, mupirocin, tetracyclines and trimethoprim (fig. 1). instead, the antibiograms of isolates from both cc22 sccmeciv and cc30 sccmecii mrsa over time were highly variable, and could only have arisen due to frequent exchange of resistances, as well as frequent loss. circle size corresponds to the proportion of total mrsa in each year and color represents the number of phenotypic resistances contained within the antibiogram. cc22 became the dominant lineage by 2006 corresponding with an expanded resistance profile. over time instead the frequent shuffling of resistance determinants is seen ; new antibiograms appear each year and resistances do not accumulate. as mrsa cc22 sccmeciv became dominant in our hospital, it displaced mrsa cc30 sccmecii and mrsa st239 sccmeciii. mrsa cc30 was also able to shuffle resistance genes, but mrsa st239 was not (fig. 1). this suggests that both fitness and shuffling may provide an advantage for successful ha - mrsa clones. in order to investigate mge variation, we characterized mrsa cc22 sccmeciv isolates (n = 40) found in our hospital during summer 2009 in more detail. we compared their genomes by using a recently constructed 62-strain s. aureus microarray (sam-62) that contains 60-mer probes to all the predicted genes in the first 62 whole genome sequencing projects and 153 plasmids. the range of mge variation among the 40 isolates was enormous, despite all isolates being found in the same hospital at the same time, and all belonging to the same mrsa clonal type. figure 2 illustrates variation in known antibiotic, heavy metal and biocide resistance genes. mccarthy. shows additional substantial variation in other mges, including 4/8 known bacteriophage families, 4/5 known sapi families, 9/18 known plasmid rep families, and 1/4 known transposon families detected in at least one of the isolates. clustering of ha - mrsa cc22-sccmeciv isolates and distribution of mge - carried antibiotic, heavy metal and resistance genes by microarray. isolates have been clustered using data from 60-mers that represent all genes on mobile genetic elements (mges). horizontal lines represent different 60-mer oligo probes specific to 43 different antibiotic, heavy metal and biocide resistance genes. the color in the main figure is an indicator of test over reference signal ratio. thus ; (1) yellow indicates presence in both test and reference (mrsa252) isolates, (2) red indicated presence in the test but not the reference isolate, (3) blue indicates absence in the test but not the reference isolate, and (4) black indicates absence in both test and reference isolates. color intensity is an indicator of signal intensity and may vary due to copy number or due to differences in probe homology. this amount of mge variation has potential to be used as a typing tool to discriminate between isolates of clonal mrsa. to test this, we followed up patients from whom we had previously isolated nasal mrsa at hospital admission and subsequently developed mrsa infection. in 6/8 cases, the admission isolate was identical to the infecting isolate, and in one case the two isolates differed by one mge. this shows that the majority of patients colonised with mrsa at admission, that subsequently develop an infection, became infected with their own endogenous strain rather than circulating hospital strains. this raises important issues for our understanding of how mrsa and s. aureus spread between patients and how we can best combat infection. we identified two small clusters of related isolates in our hospital that had very similar mge profiles. upon returning to the patient s notes, we were able to uncover a link between the patients suggesting previously unrecognized transmission of mrsa in the hospital. at least 1.8% of patients admitted to hospital are positive on nasal screen for mrsa. colonisation is the greatest risk factor for subsequent infection, and this is because the colonising isolate is usually the same as the infecting isolate. if mrsa can spread from infected patient to infected patient, then patients must also be at risk of becoming colonised with mrsa in hospital. the proportion of colonised patients in hospital or at discharge are unknown, but more than half of admitted patients have previous hospital exposure, generating a cycle of mrsa isolates transmitted, discharged and re - admitted to hospital. the diversity of mge seen in the cc22 population could indicate this substantial reintroduction of cc22 variants to the hospital by newly admitted patients. our study showed that mge profiles have the potential to develop into rapid and inexpensive typing methods for tracking hospital spread and outbreaks in the healthcare setting. current typing methods for mrsa concentrate on the cc lineage (such as multi - locus sequencing typing (mlst) or restriction - modification (rm) typing) and sccmec type. however, these patterns are relatively stable and do not include the fine detail necessary for a typing method to discriminate between isolates to measure transmission and spread and to identify outbreaks. spa - typing allows some variants of clonal types to be distinguished, but is ineffective for many clones such as mrsa cc22 sccmeciv. variation in mge carriage could be developed into a rapid and inexpensive method using pcr or microarray / hybridization platforms. alternatively, once bench - top genomic sequencing is widespread, data interpretation based on mge content may provide the clearest and most reliable interpretive data. these studies also raise very interesting questions about the stability of mges in s. aureus and mrsa populations. while we saw substantial diversity in mge profiles among mrsa of the same clonal group, the mges were stable enough to use as a typing method to identify isolates from the same patient or reservoir. this suggests the mges are relatively stable, but our data also showed evidence of low level transfer and loss of a wide range of mge. during the time scale of a hospital stay, there can be some variation in mge carriage in clonal isolates from the same patient, but within a hospital the variation is large, possibly due to the accumulation of differences over longer time scales. if we look back through the literature, we can now put this into context. based on epidemiology, early typing methods such as pulse field gel electrophoresis (pfge) grouped isolates as the same if they had four or less band pattern differences. as a band shift is usually due to acquisition or loss of an mge, this argues that mge movement in isolates spreading in the hospital setting is frequent in epidemiologically linked isolates. more recently, the acquisition and loss of bacteriophage from s. aureus during cystic fibrosis infection in individual patients has been well described. the mechanism of hgt in mrsa is likely to be transduction, as transformation has not been demonstrated in s. aureus, and conjugative plasmids and transposons are found in only a small proportion of isolates. transduction is dependent on bacteriophage ; it occurs when dna is packaged into a bacteriophage and then transferred from a donor cell to a recipient cell. all clinical mrsa have prophage integrated into their chromosome and these bacteriophage can be induced to replicate and lyse the host cell by stresses such as uv light, mitogens and antibiotics. some bacteriophage heads are able to package bacterial or plasmid dna, efficiently delivering their payload to s. aureus of the same lineage. mges and resistances did not systematically accumulate suggesting the loss of mge is very important. they may have a fitness cost on the host, or there may be mechanisms to limit the total size of the genome or number of variants of particular mge types. in the laboratory, most mges are stable, and the mechanisms for mge loss are unknown. at this stage it is difficult to definitively prove that shuffling of mges is responsible for the success of ha - mrsa clones. we are continuing to investigate a genetic explanation for how mrsa cc22 sccmeciv became more amenable to mge acquisition over time. perhaps mrsa clones that can easily acquire or lose mges may adapt more quickly to new environmental conditions such as antibiotic prescribing or transfer between patients. this may give them an advantage over other commensals that do not adapt so readily, leading to successful colonisation of patients, and ultimately to infection. | methicillin - resistant staphylococcus aureus (mrsa) cc22 sccmeciv is a successful hospital - associated (ha-) mrsa, widespread throughout the world, and now the dominant clone in uk hospitals. we have recently shown that mrsa cc22 is a particularly fit clone, and it rose to dominance in a uk hospital at the same time as it began acquiring an increased range of antibiotic resistances. these resistances were not accumulated by individual cc22 isolates, but appear to shuffle frequently between isolates of the mrsa cc22 population. resistances are often encoded on mobile genetic elements (mges) that include plasmids, transposons, bacteriophage and s. aureus pathogenicity islands (sapis). using multi - strain whole genome microarrays, we show that there is enormous diversity of mge carried within a mrsa cc22 sccmeciv population, even among isolates from the same hospital and time period. mge profiles were so variable that they could be used to track the spread of variant isolates within the hospital. we exploited this to show that the majority of patients colonised with mrsa at hospital admission that subsequently became infected were infected with their own colonising isolate. our studies reveal mge spread, stability, selection and clonal adaptation to the healthcare setting may be key to the success of ha - mrsa clones, presumably by allowing rapid adaptation to antibiotic exposure and new hosts. |
thirteen f. tularensis isolates collected over the past 10 years in switzerland (figure 1) were subjected to extensive genetic characterization. the species and subspecies designations of all strains were confirmed by real - time pcr that targeted the fopa gene and by amplification of the rd1 region (8), which showed that all strains were f. tularensis subsp. holarctica strains (7) and the genome sequence of the strain isolated in france, ftnf002 (genbank accession no. nc_009749), were included in the study to represent the currently known genetic subpopulations within the subspecies. all strains from switzerland were genetically characterized at 6 highly variable loci (by mlva) and 14 more stable loci that indicate the classification f. tularensis subsp. the rd analysis was also performed because a 1.59-kb deletion marker, rd23, was reported to be restricted to strains from france and spain (3). the mlva markers (m3, m6, m20, m21, m22, and m24) and ftind markers (ftind 2538) were amplified by pcr and then sequenced with an abi prism 3100 genetic analyzer (applied biosystems, foster city, ca, usa) and the bigdye terminator cycle sequencing kit (applied biosystems). dna fragment sizes were calculated from the nucleotide sequences of the mlva and ftind markers and used to compare the isolates with previously analyzed strains from the united states, japan, france, and russia (3,7). the rd23 marker was assayed by using standard pcr and agarose gel methods as previously described (3). a cluster analysis based on the mlva and indel size data was performed by using bionumerics version 3.5 (applied maths, kortrjik, belgium). the unweighted pair group method with arithmetic mean phylogram is based on the combined ftind and multiple - locus variable - number tandem repeat analysis. bootstrap values > 80% are given at the respective nodes and were calculated by using 10,000 iterations. as expected, the indel markers served to place each strain into major branches of the cluster tree, and the more variable mlva markers provided the fine resolution at the tips of the tree. the switzerland strains belonged to the same genetic cluster as the f. tularensis strain ftnf002 from france (figure 1) that in a previous work clustered with strains from spain (3,9). moreover, all the swiss strains exhibited the 1.59-kb genomic deletion at the rd23 locus and the unique 464-bp size at mlva marker m24, which confirmed their close relationship to the french strain ftnf002 as well as to other strains from france and spain (3). the finding of f. tularensis strains in switzerland represent sporadic occurrences of tularemia without any obvious epidemiologic connection. the strains originated from 6 hares, 3 monkeys, and 4 persons and were collected at different locations in switzerland over a period of 10 years (figure 2). the human infections most likely occurred through direct contact with wild animals, through rodent bites, and through consumption of a hare cooked at low temperature. four swiss strains displayed a genetic profile identical to that of the representative french strain ftnf002 (3). the other 6 genotypes were closely related to ftnf002, and all corresponded to the subclade b.br:ftnf00200 as defined by canonical single nucleotide polymorphisms by vogler. this cluster, which also contained the strains from the iberian peninsula, seems to have spread throughout central and western europe. moreover, all the swiss strains were susceptible to erythromycin (mics 0.25 g / ml to 1 g / ml), which is a phenotypic marker that has previously been suggested to divide f. tularensis subsp. strains of f. tularensis from switzerland (central europe) genetically clustered with strains from france and spain (western europe) as determined by the unique 464-bp genetic marker m24 and a specific deletion at marker rd23. furthermore, strains within the cluster differed at only 2 mlva markers, and 4 other mlva and 14 ftind markers were identical. in a previous study that included strains from the 19971998 tularemia outbreak in spain, the specific m24 allele and the rd23 deletion were found in 49 of 49 strains from spain and france but in only 1 of 189 strains from 7 northern and eastern european countries and japan (3). the tularemia outbreak of 19971998 in spain, which resulted in > 500 human cases (5), was thus caused by f. tularensis strains that were genetically closely related to strains recovered in switzerland from 1996 onwards, before the beginning of the outbreaks in spain. this genetic relationship shows that factors other than the presence or introduction of a specific clone of the infectious agent per se determined the magnitude of the tularemia outbreaks in spain. for epidemiologists to understand the distribution of f. tularensis (and other rare disease agents) in the environment and their propagation across national and geographic borders, surveillance programs that include molecular analyses of these agents should be undertaken in multiple countries, and the resulting data should be shared internationally. | we conducted a molecular analysis of francisella tularensis strains isolated in switzerland and identified a specific subpopulation belonging to a cluster of f. tularensis subsp. holarctica that is widely dispersed in central and western continental europe. this subpopulation was present before the tularemia epidemics on the iberian peninsula. |
human immunodeficiency virus (hiv) is a deadly infectious disease and has been declared as a serious concern worldwide.13 the world health organization confirms > 35 million hiv - infected people. among them, 28 million people are eligible for antiretroviral therapy (art). however, only 11.7 million could afford antiretroviral (arv) drugs. in spite of significant advances in highly active art, the elimination of hiv-1 reservoirs from the peripheral nervous system and central nervous system (cns) remains an ultimate challenge.4 this is attributed to the integration of hiv-1 genome with host genome, thereby causing viral latency in the periphery and in brain, as well. furthermore, the inability of art to penetrate the blood brain barrier (bbb) after systemic administration makes brain as one of the most dominant hiv infection reservoirs.1 developing the best suitable therapeutics for hiv demands multidisciplinary research and development approaches involving smart sensors, novel imaging agents, smart portable diagnostic tools, biomarkers, novel bioimaging, efficient affinity agents, smart assaying, real - time disease monitoring, and disease management systems to develop accessible cost - effective diagnosis and treatment for hiv patients.1 advancements in analysis have proven a significant role in hiv diagnostics and monitoring of disease progression. the therapeutic effects of these drugs have been studied using advanced analytical tools and methods. in the present scenario, appreciated efforts have been made to explore effective dual antiviral drugs and long - acting (la) drugs and vaccines to eradicate hiv infection without adverse effects. recently, dual therapy, ie, an optimized cocktail of two arv drugs, has been explored to manage hiv infection. a comprehensive review on the effects, advantages, and disadvantages of the dual therapy is described by kelly.5 the authors claimed that the dual therapy containing tenofovir (tef) exhibited more therapeutic advantages than triple therapy. however, the selection of appropriate drug according to the patient condition is very crucial because this therapy may reduce virologic efficacy in hiv - infected patient while lowering cd4 counts per high pre - art hiv-1 rna level. this report proposed that new nanoformulations (nfs) of la cabotegravir (ctg) and rilpivirine (rpv) may have bright future prospects for hiv therapeutics. such a viable dual therapy is useful to manage art options and performance, which lowers the costs and the globally unmet needs of pill - fatigued and adherence - challenged individuals.5 la drugs, as hiv therapeutic agents, are in practice for hiv prevention due to their effective longer therapeutic effects at a very low dose in comparison to daily consumption of art. the strengths, weaknesses, opportunities, and challenges of la - injectable therapies for hiv have been described excellently by owen and rannard.6 the pharmacology and formulation of la ctg were described in a comprehensive review presented by trezza.7 the authors concluded that the pharmacologic profile of ctg has great potential for the treatment and prevention of hiv-1 infection. this drug exhibited half - life of 40 days and showed therapeutic action at a low dose. thus, monthly and bimonthly oral administration in the form of tablet would be enough to control hiv infection.7 the multi - component pharmacokinetic evaluation of la rpv, 300 mg, 600 mg, or 1,200 mg (for 84 days), in 66 hiv - negative volunteers for preexposure prophylaxis was performed by jackson.8 the authors assessed ex vivo antiviral activity of cervicovaginal lavage and claimed that each rpv dose exhibited effective therapeutic effect, lasting till 84 days, upon exposure to plasma and genital tract. this study is useful to decide the appropriate dose for hiv therapeutics.8 in another study, the safety, tolerance, and pharmacokinetics of la rpv (tmc278, 300 mg / ml) formulation on administration, single and multiple intramuscular injection, in healthy volunteers were assessed by verloes.9 the outcomes of this study suggested that a clinically relevant plasma concentration of rpv could be optimized via tuning la formulation.9 very recently, margolis presented a multicenter study based on long - acting arv treatment enabling trial, for phase iib, using hiv - infected adults (> 18 years old). the results suggested that ctg plus dual nucleoside reverse transcriptase inhibitors (nrtis) therapy exhibited antiviral activity and ctg (30 mg, once a day) plus rpv (25 mg, once a day) also exhibited 96 weeks longer antiviral activity similar to efavirenz plus nrtis. the authors claimed that the injectable formulation of rpv plus ctg can be used as a two - drug regimen for hiv infection therapeutics.10 besides significant advancements in arv drug development for hiv therapeutics, very few efforts were made to develop an effective anti - hiv vaccine. gautam demonstrated the long - term efficacy and protection evaluation of passively transferred four anti - hiv-1-neutralizing monoclonal antibodies (vrc01, vrc01-ls, 3bnc117, and 10 - 1074), with a single high dose (20 mg / kg), in an hiv - infected monkey model. the authors claimed that a specific single neutralizing antibody demonstrated virus reduction up to 23 days. the results of this study suggested that all four antibodies showed plasma - neutralizing efficacy, which is dependent on antibody potency and half - life. based on the outcomes, a specific anti - hiv antibody could be selected and injected to control high - risk transmission of hiv infection.11 to avoid the adverse effects of multitherapeutic agents, efforts are being made to design novel therapeutic agents that could work singly for activation and eradication of hiv infection. cas9/grna system, are recently being investigated to eradicate hiv in latently infected hiv reservoirs.3,12,13 unfortunately, these studies were performed either in vitro or in periphery. hiv - infected and latently infected hiv brain reservoirs could not be targeted due to negligible transmigration of therapeutics against hiv across the bbb.2 therefore, efforts should be made to explore novel analytical science and nanotechnology for developing strategies to deliver therapeutics across the bbb to prevent neuroacquired immunodeficiency syndrome (neuroaids) in the brain.14 the major challenge to cure neurohiv is the inability of effective anti - hiv therapeutic agents to cross the complex integrity of the bbb. specific receptor binding,15,16 focused ultrasound,17 microbubble - assisted focused ultrasound,18 and magnetic field19-based approaches have been demonstrated to open the bbb for delivery of therapeutic agent. receptor - functionalized therapeutic cargos are bigger in size and thus affect efficacy, while an externally stimulated approach results in transient bbb opening, which may also allow the delivery of unwanted agents to the brain.20 such agents, in the brain, may cause additional neuroinflammation and associated dementia. recently, a noninvasive magnetically guided approach has been demonstrated by kaushik.20 in this approach, the authors injected a biocompatible dose of magnetoelectric nanoparticles (menps ; 10 mg / kg), potential drug nanocarriers (ncs), into the mice brain via tail under a static magnetic field (0 t) for 3 hours to achieve cns delivery. the transmission electron microscopy study conducted on the brain tissue of mice showed uniform distribution of menps in all cell types without agglomeration (figure 1). hematoxylin and eosin staining, blood toxicity assessment, and neurobehavior evaluation studies confirmed that the adopted methods using menp are safe for living beings and also did not affect motor coordination function of mice.20 the ncs of metal, metal oxides, gels, biopolymer, composites, and core - shell nanostructures are being designed and explored for binding of anti - hiv drugs and release of stimuli responses.2,20,21 the successful release of binded drugs is demonstrated in either a sustained or externally stimulated on - demand controlled manner. at present, developed nfs, ie, optimized combination of ncs and specific drug, were tested using an in vitro model that exhibited a high therapeutic effect and less adverse effect.1,21,22 carson demonstrated a tunable sustained release of multiclass water - soluble (hydrophilic) anti - hiv drugs, ie, tef, using polyester - blended electrospun fibers as a potential drug nc.23 the authors claimed that binding and release of anti - hiv drug was dependent on the affinity level between tef and the functional groups available on the biocompatible fiber. this developed nf is able to carry high drug loading, ~40 wt%, and demonstrated sustained release from 24 hours to 30 days.23 however, this in vitro model needs to be confirmed using an in vivo model to evaluate the ability to cross the bbb. destache developed an nf containing tef to prevent hiv-1 vaginal transmission in a humanized mouse model. the authors formulated tef disoproxil fumarate at the nanoscale using a thermosensitive gel of poly(lactic - co - glycolic acid) prepared using oil - in - water emulsification. the efficacy of this formulation was tested in humanized bone marrow liver thymus mice. the results of this study suggested that tef disoproxil fumarate - nf acted as an la drug via sustained release of tef to show coitus - independent hiv-1 vaginal protection modality.24 freeling developed an nf containing three la anti - hiv drugs (lopinavir, ritonavir, and tef) loaded in a lipid nanoparticle for longer exposure in primate plasma cells within lymph nodes (persistent hiv reservoirs) and blood to cure hiv infection. this developed nf showed 50-fold higher intracellular drug concentration in lymph in comparison to free drug administration. after single administration to plasma, the authors demonstrated that the intracellular drug level was enhanced until 7 days. thus, the presented nf can be used as oral therapy for hiv at the periphery level.25 roy developed an nf (140 nm) to eradicate hiv infection in the gut - associated lymphoid tissue (galt), a reservoir of early hiv infection and host pathogen interaction. the authors explored paracellular transport property of m - cells for targeted delivery of pluronic ncs containing anti - hiv drug (efavirenz) functionalized with m - cell - specific antibody of the galt. the sustained release of anti - hiv drug significantly reduced the hiv infection level in the galt, compared to the free drug.26 recently, nanomedicine technology has been explored to improve the efficacy of la rpv via developing an nf for pericoital and coitus - independent hiv infection therapeutics, demonstrated by kovarova.27 in this research, the authors binded rpv with poly(lactic - co - glycolic acid) nanoparticles and encapsulated them with a thermosensitive gel for delivery purpose. this nf, considered as solid nanosuspension of la rpv, was administrated intra - muscularly in the bone marrow a single dose of this nf in mice, after a week, showed significant protection against high dose of vaginal challenge with hiv-1. the authors claimed that sometime in the presence of the antiviral drug, hiv infection may show systematic replication even on sustained release of arv. thus, implication of la rpv for hiv therapeutics is crucial and can be achieved by infecting such developed la rpv - based nf.27 to manage hiv-1 infection in the brain, significant efforts must be made to deliver this nf to the cns. numerous reports confirm that navigation across the bbb depends on the properties of ncs and nfs.1,2 thus, exploring the properties of ncs and nfs independently is crucial to design an effective therapeutic cargo to cure hiv completely in the brain. surface science has explored making the surface of ncs hydrophobic and generating functionality on ncs to bind with the bbb - related specific biomolecules, such as antibody, protein, and enzyme, to achieve cns delivery. externally controlled navigation strategy based on magnetic field and ultrasound strategy has recently been demonstrated for transmigration of ncs across the bbb.1,2 recently, magnetic nanoparticles (mnps) have been proposed as potential ncs to prepare effective nfs for the eradication of hiv in the brain and periphery.4,21 jayant developed layer - by - layer technology - based novel nfs consisting of tef, vorinostat (a latency - breaking agent), and fe3o4 (103 nm) as ncs for the treatment of neuroaids. the authors demonstrated magnetically guided delivery of this nf across the bbb and sustained release of both agents to activate and then eradicate hiv infection. the outcomes of this study suggested that loading and release of drug are dependent on layer - by - layer formulation later. this nf showed sustained release of therapeutic agent over a period of 5 days after hiv infection in primary human astrocytes, with good cell viability (90%).4 raymond demonstrated the magnetically guided delivery of nef peptides across the bbb using mnps as ncs to induce microglial cytokine / chemokine secretion. the exnef is a novel mediator of hiv - induced neuropathogenesis and could be modulated in the presence of nef peptides. the successful delivery functionality of nef peptides in the cns may be useful to develop novel personalized nanomedicine for hiv therapeutics.28 externally controlled on - demand controlled release of an nrti, 3-azido-3-deoxythymidine-5-triphosphate (azttp), an anti - hiv drug, was demonstrated using menps as a potential nanodrug carrier. an nf, consisting of menps and azttp, was formulated and magnetically delivered across the bbb.29 an external alternating current (ac) magnetic field through an electromagnetic coil was applied to release azttp from nf. in this mechanism, menps showed polarization on ac magnetic field stimulation, which changed the electrostatic bond between menps and the bound drug. this phenomenon occurred rapidly and repeatedly, resulting in release of the drug from the surface of menps. menp - based nfs were magnetically guided across the bbb, and 100% drug release was achieved via tuning the frequency and applying ac magnetic field. this nf significantly eradicated hiv-1 infection level across the bbb and has potential to be tested using animal models.21,29 it is well known that antiviral drug in cns induces neuroinflammatory resulted in neurotoxicity. recently, magnetically guided delivery of an anti - inflammatory agent, namely, tissue inhibitor of metalloproteinase-1 (timp1), across the bbb is demonstrated to reduce hiv infection using mnps as ncs and sk - n - mc neuroblastoma cells as in vitro model.30 this report claimed that timp1 reduced neuronal toxicity and significant recovery of spinal density and thus confirmed neuroprotective effects of timp1 in the cns.30 the above discussed in vitro model showed impressive reduction in the hiv infection level across the bbb ; therefore, efforts must be made to demonstrate these models in vivo to develop personalized nanomedicine to cure neurohiv. besides successful in vitro demonstration, an nf, prepared using biocompatible nanogels binded with nrtis, was developed by senanayake,31 and they claimed this nf as a novel antiviral agent of high efficacy to combat against hiv infection. this group developed a cationic nanogel, ie, cholesteryl--polylysine, to encapsulate nrti 5-succinate derivatives to evaluate anti - hiv activity using in vitro microphage model in the cns as well. this nf demonstrated tenfold suppression in reverse transcriptase activity (ec90) in hiv - infected macrophage in comparison to single / double / triple drug cocktails recommended for clinical trials.31 the sustained release of nrtis for long time, enhanced efficacy, and biocompatible nature proposed this nf as a promising candidate to be tested in humanized mouse (hu - pbl) hiv model for the development of personalized nanomedicine. recent success in the cns delivery of arv, ie, zidovudine (azt), through the nasal route using chitosan microparticles (cp), prepared by spray drying techniques, as a carrier to cure brain hiv sanctuaries has been reported by dalpiaz.32 the authors produced a prodrug via conjugating azt with ursodeoxycholic acid (ucda azt) to overcome the issue of active efflux transporter systems. the ucda azt (5 m or 10 m) system demonstrated 20 times higher efficacy than azt to cure hiv in the cns and in macrophages.32 to demonstrate delivery to rat brain, the authors administered this prodrug - encapsulated cp through the nasal route, aiming to achieve high cns uptake. the results suggested that utilization of cp increased the dissolution rate of udca azt and reduced water uptake, resulting in high levels in cerebrospinal fluid in rats, which is required for better efficacy in the cns.32 currently, scientists are exploring novel multi - functional nfs to block unwanted disorders in hiv - infected patients using substance of abuse.33 sagar developed a highly selective magnetic nf for the delivery of a therapeutic agent to block the effects induced by morphine. a morphine antagonist, ie, d - pen - cys - tyr - dtrp - orn - thr - pen - thr - nh2 (ctop), was bound with mnp and magnetically delivered across the bbb. over time, release of ctop showed significant efficacy via protecting modulation of neuronal dendrite and spinal density. this nf was tested in hiv - infected cell lines, and outcomes were similar to those obtained in normal cell lines. in future, efforts must be made toward the encapsulation of ncs, anti - hiv drugs, and antagonists against substances of abuse to develop an effective nf. such developed nfs would be capable of eradicating hiv infection and to block the effects induced by substances of abuse in hiv patients. the state - of - the - art and possible future strategy to eradicate and manage hiv nanoengineered ncs, highly sensitive technologies, and smart assays are being explored to develop an ideal nanomedicine via improving properties of ncs, pharmacokinetics, and acceptable neurobehavioral alteration.34 during virus progression, the dysfunction of related biomarkers and genes has been quantified using sensitive analytical assays, namely, polymerase chain reaction, and enzyme - linked immunosorbent assay. ultrasensitive histopathology, immunohistopathology, and optical fluorescence imaging have been adopted recently to explore the biodistribution, pathogenesis, and toxicity of both ncs and nfs. recently, transmission electron microscopy (figure 1) with illuminating features was introduced to study the distribution of ncs in various organs to explain particle - to - particle interaction and elemental composition of ncs over time after injection.20 biodistribution and therapeutic effects of contrast agents containing ncs and nfs in the periphery and brain were studied using magnetic resonance imaging. the homeostatic effect of ncs in the living system was also studied using magnetic resonance imaging via real - time monitoring of contrast exposure. it has been reported that hiv infection is serious, but it turns worst in combination with drugs of abuse. for example, hiv patients due to life style and ingestion of drug of abuse were found to be psychologically stressed which resulted in delayed response to therapeutics.35 thus, stress monitoring in hiv patients is crucial to decide therapeutics. stress management of hiv patients has been declared necessary to obtain information for clinicians to avoid delay in therapeutics.35 the addition of such analytical devices is new to hiv therapy, but clinicians expect bright future prospects to assess social assessment impact of patients.36 the introduction of analytical sensing systems for hiv incidence will be of great significance.36,37 enzyme - linked immunosorbent assay and real - time / quantitative polymerase chain reaction have demonstrated estimation of potential hiv biomarkers such as hiv-1 rna viral load and cd4 cell counts. these methods have also quantified other hiv - infection - related biomarkers such as serum concentration of neopterin, beta-2 microglobulin (iga), interleukin-2 receptor, cd8 cell counts, anti - hiv antibodies, p24 antigen, hemoglobin level, platelet concentration, and erythrocyte sedimentation rate. both these methods are very well established, but the need for high operation expertise and longer analysis time has raised the demand for rapid diagnostic tools to detect / monitor hiv infection in the physiological range. the available detection tools for detection of hiv biomarkers with performance parameters are summarized in table 1. recently, electrochemical biosensing system has been developed to detect physiological stress markers in hiv patients. the electrochemical biosensors recently emerged as a potential analytical tool to detect target biomarkers at the picomolar level.3841 shafiee have described the available potential techniques to detect hiv biomarkers to estimate hiv infection level. this group also proposed that the development of electrochemical system with features of affordability, sensitivity, specificity, user friendliness, rapidity, robustness, equipment - freeness, and desirability can be promoted at point - of - care application to detect hiv infection for personalized health care.36 the performance of available detection tools to detect and monitor hiv infection is summarized in table 2. as per state of the art and according to assured, a biosensor fabricated using a nanoplasmonic resonance detected ~100 copies / ml of hiv-1 subtype d using a very small volume (100 l) of whole blood and plasma.42 a label - free optical biosensor developed using a nanophotonic crystal was used to detect 1010 copies / ml of hiv-1 in blood plasma.43 such nanoenabled biosensors were operated simply with the salient feature of integration with nanosensing components such as nanoelectronics, miniaturized transduction techniques, and microelectromechanical systems for detection of potential hiv - infection biomarkers (cd t lymphocytes and viral load) in the real sample, even at the point - of - care application.4446 using lab - on - chip - based approach, the capturing and quantification of cd lymphocytes has been demonstrated by watkins.47 the authors reported that lab - on - chip functionalized by a specific antibody detected viral lysate ranging from 100 cells / ml to 700 cells / ml, with a detection limit of 9 cells/l and a detection range from 100 cells / ml to 700 cells/l.47 however, the detection of neurohiv infection and also hiv incidences was not well explored by these sensing systems. the significance of neurohiv monitoring and management using advanced nanoenabling sensing systems is described by nair,1 as shown in figure 3. recently, electrochemical monitoring of hiv - infection in presence of cocaine and specific drugs related with hiv - infection and cocaine was demonstrated using an elctrochemical monitoring - on - chip (e - moc) approach. authors developed a cultureware chip and human astrocytes based in - vitro model for hiv - infection, cocaine explore, treatment with tef, along with rimcazole (ra, a cocaine antagonist). electrochemical impedance spectroscopy was performed to evaluate electro - physiology of cells during infection and therapeutic. author claimed this methodology as an effective analytical tool for hiv - infection monitoring in various conditions.48 in summary, to cure hiv and neurohiv / aids, we believe that significant research must be performed to design novel biocompatible nfs with salient features of target site delivery, novel easy mechanism to release arv drugs, and effective cns delivery to eradicate latent hiv infection. the investigation of novel diagnostic tools for detection of infection and its integration with nf - based hiv eradication will be useful to assess nf functionality with real - time monitoring of hiv infection. therefore, we can say that involvement of new analytical diagnostic tools and nanoenabling formulations will simplify both hiv diagnosis and cure to manage personalized care. | this viewpoint is a global call to promote fundamental and applied research aiming toward designing smart nanocarriers of desired properties, novel noninvasive strategies to open the blood brain barrier (bbb), delivery / release of single / multiple therapeutic agents across the bbb to eradicate neurohuman immunodeficiency virus (hiv), strategies for on - demand site - specific release of antiretroviral therapy, developing novel nanoformulations capable to recognize and eradicate latently infected hiv reservoirs, and developing novel smart analytical diagnostic tools to detect and monitor hiv infection. thus, investigation of novel nanoformulations, methodologies for site - specific delivery / release, analytical methods, and diagnostic tools would be of high significance to eradicate and monitor neuroacquired immunodeficiency syndrome. overall, these developments will certainly help to develop personalized nanomedicines to cure hiv and to develop smart hiv - monitoring analytical systems for disease management. |
elderly patients presenting with st - segment elevation myocardial infarction (stemi) are less likely to receive reperfusion therapies, both fibrynolysis and primary percutaneous coronary intervention (pci) [13 ]. common reasons for excluding older patients from reperfusion therapy are their delayed presentation and atypical symptoms. also, up to 9 % of elderly patients have absolute contraindication to fibrynolytic therapy. nowadays, primary pci is the preferred method of reperfusion for stemi, also in elderly patients. it has been shown to be more effective than fibrynolysis in reduction of ischemic events in patients 75 years old with stemi with chest pain 1 stent in ira2120.423.426.50.85thrombectomy12.211.710.412.20.86non - ira pci45.45.74.90.55pci complications (no - reflow, distal embolization, side branch occlusion, artery perforation)7.39.314.414.60.003intra - aortic balloon pumping3.44.74.32.40.69values are presented as percentages or medians (inter - quartile range)ira infarct - related artery, lad left anterior descending, lcx circumflex artery, lmca left main coronary artery, pci percutaneous coronary intervention, rca right coronary artery concomitant medications, timing information and invasive treatment details stratified by age values are presented as percentages or medians (inter - quartile range) ira infarct - related artery, lad left anterior descending, lcx circumflex artery, lmca left main coronary artery, pci percutaneous coronary intervention, rca right coronary artery in the coronary angiography prevalence of multivessel disease increased with age. a total of 1,537 patients (93.2 % of study population) underwent immediate pci. elderly patients were more likely to be treated conservatively after coronary angiography and were less likely to receive stents, especially drug - eluting stents during immediate pci (table 2). timi grade 3 flow frequency before pci was similar among age groups, but elderly patients were less likely to achieve optimal epicardial flow (timi grade 3 flow) after pci, and were more likely to have pci complications than their younger counterparts (fig. 1 ; table 2). similarly, rate of st - segment resolution > 50 % after pci has shown age-dependency.fig. 1thrombolysis in myocardial infarction flow before and after pci, and st - segment resolution > 50 % frequency in 1,537 patients undergoing immediate percutaneous coronary intervention stratified by age. pci percutaneous coronary intervention, str st - segment resolution, timi thrombolysis in myocardial infarction thrombolysis in myocardial infarction flow before and after pci, and st - segment resolution > 50 % frequency in 1,537 patients undergoing immediate percutaneous coronary intervention stratified by age. pci percutaneous coronary intervention, str st - segment resolution, timi thrombolysis in myocardial infarction as shown in fig. 2a, the rates of death, death + reinfarction and all major adverse cardiovascular events at 30 days were increased with age. in contrast, incidences of reinfarction and urgent revascularization at 30 days were independent of age. the kaplan meier curves for survival according to age are shown in fig. 3. in cox regression analysis, independent predictors of 30-day death were : age, diabetes mellitus, previous stroke, heart rate on admission, systolic blood pressure on admission, cardiogenic shock (killip iv) on admission, diagnosis - to - balloon time, stent implantation during pci, drug - eluting stent implantation during pci, non - infarct - related artery pci, left anterior descending artery as infarct - related artery, timi grade 3 flow after pci, st - segment resolution > 50 % after pci and major bleeding requiring transfusion (table 3).fig. 2ischemic events a (death, death + reinfarction, death + reinfarction + revascularization) and bleeding events b (puncture site hematoma, intracranial hemorrhage, major bleeding requiring transfusion, total bleeding events) at 30-day follow - up stratified by age. 3one - year kaplan meier survival curves stratified by agetable 3multivariate cox regression analysis for 30-day deathvariablehazard ratio95% confidence intervalp valueage (per 1 year)1.0491.0261.072 50% after pci0.3520.2050.602<0.0001major bleeding requiring transfusion3.0571.0568.8450.039values are presented as hazard ratios with 95% confidence intervalsira infarct - related artery, lad left anterior descending, pci percutaneous coronary intervention, timi thrombolysis in myocardial infarction ischemic events a (death, death + reinfarction, death + reinfarction + revascularization) and bleeding events b (puncture site hematoma, intracranial hemorrhage, major bleeding requiring transfusion, total bleeding events) at 30-day follow - up stratified by age. remi reinfarction one - year kaplan meier survival curves stratified by age multivariate cox regression analysis for 30-day death values are presented as hazard ratios with 95% confidence intervals ira infarct - related artery, lad left anterior descending, pci percutaneous coronary intervention, timi thrombolysis in myocardial infarction as clearly shown in fig. 2b there were no differences in the occurrence of puncture site hematoma and intracranial hemorrhage (which did not occur in either group) across age groups. a trend toward higher risk of major bleeding requiring transfusion and significantly higher incidence of all bleeding complications in elderly patients (especially 85 years of age) were observed. our study suggests that age is still an important determinant of treatment strategies selection, even in well - organized networks of stemi treatment. elderly patients are treated less aggressively in terms of antiplatelet therapy, have experienced longer delays to successful reperfusion, and they are at higher risk of death during follow - up. in our study, similar to previous studies, and as expected, higher mortality rate was observed in older patients. one of potential explanations of the short- and long - term clinical outcome worsening in elderly stemi patients is higher prevalence of comorbidities. in line with previous studies, elderly patients were more likely to have diabetes mellitus, previous myocardial infarction, previous heart failure symptoms, previous stroke, and chronic kidney disease [1, 1014 ]. older patients experienced longer time - delays to admission and primary pci, and presenting more frequently with acute heart failure symptoms. another important risk factor for higher mortality in patients with acute coronary syndromes is the presence of renal function impairment [15, 16 ]. preexisting impairment of renal function, diabetes mellitus and advanced age are also associated with increased risk of contrast induced nephropathy development after coronary angiography and primary pci, which may led to worsening of long - term prognosis [17, 18 ]. elderly patients are also at higher risk of non - cardiac death during follow - up related to cancer or lung diseases. similarly, to previous reports in our study observed frequency of reinfarction and need of repeated revascularization was comparable across age groups [1, 10 ]. it is well established that in elderly patients primary pci success rate is lower, with higher risk of angiographic complications than in younger counterparts [1214 ]. in our study, the frequency of optimal epicardial flow (timi grade 3 flow) after primary pci decreases with age. in contrast, in the controlled abciximab and device investigation to lower late angioplasty complications (cadillac) trial correlation between final epicardial flow after pci and age was not observed. the complex coronary anatomy observed in elderly patients may be associated with a higher incidence of distal embolization, which is a important determinant of myocardial perfusion after primary pci, as well as long - term clinical outcome [13, 14, 19 ]. in addition, de luca. have found a relationship between increased age and impaired myocardial perfusion assessed by myocardial blush grade, and st - segment resolution. the higher prevalence of multi - vessel disease and the fear of complications among elderly may account for more frequent selection of initial conservative approach, with postponed pci or coronary artery bypass grafting. presence of multi - vessel disease in stemi patients influences the clinical outcomes of patients treated with primary pci. also, as confirmed by our study patients with advanced age are less likely to be treated with drug - eluting stents in stemi setting. in the analyzed patients population there was a trend toward higher rate of major bleeding requiring transfusion in patients with advanced age. importantly, major bleeding occurrence is a strong predictor of short- and long - term mortality [2226 ]. also, major bleeding may be associated with higher incidence of ischemic events, for example myocardial infarction, unplanned ischemic revascularization, and stent thrombosis. an increased likelihood of the vascular access site complications (hematomas or aneurysm) in elderly patients is a result of the presence of calcified, fragile and bleeding prone vessels in these patients. in addition, in elderly patients frequently reduced kidney function is leading to overdosing of antithrombotic drugs, and to the increased risk of bleeding. access site bleeding complications could be decreased by broad usage of radial approach, which was used in < 15 % of patients in the eurotransfer registry. safety and efficacy of transradial catheterization in the elderly is similar to observed in younger patients. importantly, it may improve the comfort of the patients, especially in the context of the age - related diseases that frequently affect elderly patients. however, advanced age was identified as an independent predictor of selection femoral over radial access by the operator during primary pci in our registry. also, a fear of bleeding may limit the use of antiplatelet agents, especially glycoprotein iib iiia inhibitors in patients 75 years of age. importantly, previous studies have shown that patients who present with an acute coronary syndrome and do not receive guideline - recommended therapies, including glycoprotein iib first, the study group is relatively small, and the very eldery patient subset (85 years of age) comprised only 3 % of the study population. also, the study focused mainly on 30-day clinical outcomes. secondly, patients were not screened for contraindications to use of each medication and appropriateness of used dosage was not assessed. it is very likely that in some of patients various therapies were not used due to an important clinical reason. the registry was conducted between november 2005 and january 2007 when new p2y12 inhibitors (prasugrel, ticagrelor) were not available. also, the frequency of bivalirudin monotherapy was rather low, as it was recommended as alternative to unfractionated heparin and glycoprotein iib thus, the study did not cover most contemporary pharmacological treatment patterns for stemi. on the other hand, since year 2007 there was no significant change in the recommendations concerning the application of primary pci in stemi setting. finally, the interpretation of the timi flow grade measurements, as well as st - resolution was limited by the fact that these represent not independent core - lab, but physician s assessments. age was an important determinant of treatment strategies selection and clinical outcomes in the group of consecutive stemi patients transferred for primary pci. further efforts should be made to reduce delays and to optimize treatment of stemi, regardless of patients age. | data concerning the benefits and risks of primary pci in the elderly patients presenting with st - segment elevation myocardial infarction (stemi) are limited. thus, the objective of the study was to assess age - dependent differences in the treatment and outcomes of stemi patients transferred for primary pci. data were gathered on 1,650 consecutive stemi patients from hospital networks in seven countries of europe from november 2005 to january 2007 (the eurotransfer registry population). patients 50 % after pci, and were more likely to have pci complications. the rates of death at 30 days, as well as at 1 year were increased with age. in the cox regression analysis model age was an independent predictor of 30-day mortality. a trend toward higher risk of major bleeding requiring transfusion was observed. age was an important determinant of treatment strategies selection and clinical outcomes in the group of consecutive stemi patients transferred for primary pci. further efforts should be made to reduce delays and to optimize treatment of stemi, regardless of patients age. |
laparotomy with cornual wedge resection or hysterectomy has been the traditional treatment for the rare cases of cornual pregnancy. in the last 2 decades, several reports have been published of minimally - invasive surgical techniques used to successfully treat cornual ectopic pregnancies. consistent with the goals of minimally - invasive surgery, these techniques have introduced a surgical alternative with reduced blood loss, less postoperative pain, shorter hospital stay, and a more expeditious recovery. in this report, we describe a simple, stepwise laparoscopic technique used successfully for the management of two patients with large cornual pregnancies, along with a review of risks, benefits, and the pertinent literature. carol was a 28-year - old, african american female, gravida 3, para 2 at 8-weeks gestation based on her last menstrual period. she originally presented to the emergency department complaining of intermittent vaginal bleeding for 24 hours. her medical history was significant for morbid obesity, pseudotumor cerebri, sagittal sinus thrombosis, and asthma complicated by a previous lung collapse requiring intubation. her obstetric history revealed one uncomplicated, full - term pregnancy with a normal vaginal delivery. her second pregnancy was complicated by cervical incompetence requiring rescue cerclage placement, but ended successfully with a normal vaginal delivery at term. the patient reported no plans for future pregnancies and that this was an undesired pregnancy. her physical examination on presentation showed stable vital signs, a benign abdominal and pelvic examination with minimal old blood in the vaginal vault. abdominal and transvaginal ultrasounds revealed an eccentric gestational sac, 2.7 cm x 2.5 cm, located in the right uterine fundus with a thin myometrial mantle measuring 3.5 mm in thickness, consistent with an interstitial tubal pregnancy. the embryo had a crown - rump length of 7.7 mm, with no cardiac activity. after much discussion and counseling regarding treatment options including the limited data on the risk of uterine rupture with future pregnancy, the decision was made to proceed with laparoscopic surgical excision. during the course of these discussions, the patient received one dose of intramuscular methotrexate with planned outpatient management, but she was then brought back to the hospital on day 3 for definitive surgical management, as the consensus among the providers was that definitive surgical treatment was more prudent. an intact 6 cm x 4 cm right cornual pregnancy with a thinned - out hyperemic myometrial capsule was noted (figure 1). dilute vasopressin (10 iu in 100 ml of normal saline) was prepared, and a total of 46 ml was injected throughout the cornual pregnancy by using a long 20-gauge spinal needle, introduced directly through the anterior abdominal wall in the midline under direct visualization with the laparoscope. a linear incision was made with monopolar cautery in the thin myometrial capsule, along the long axis of the cornual pregnancy. a well - formed gestational sac was clearly identified and expressed from the cornua using blunt, sharp and hydro - dissection (figure 3). a large, very thin capsule (mantle) overlying the myometrium that had previously housed the ectopic pregnancy was noted and excised at the base in an elliptical fashion, with bipolar cautery and scissors. significant myometrial thickness was still maintained at the base of the cornua, and no gross myometrial defect was noted. the remaining myometrial bed at the right cornua was judiciously cauterized to obtain excellent hemostasis (figure 4). the specimen was retrieved from the pelvis with the 10-mm autosuture endo catch (us surgical, norwalk, ct) and sent to pathology where the diagnosis of an ectopic pregnancy was confirmed. a spinal needle introduced directly through the abdominal wall. a linear incision along the capsule of the cornual pregnancy has been made after complete blanching with vasopressin. only a minimal portion of the right cornua has been removed (minicornual excision) with complete excision of the ectopic gestation. the patient tolerated the procedure well with a total operative time of 2 hours and estimated blood loss of 50 ml. the patient 's quantitative -hcg was closely followed until it returned to essentially zero (table 1). traditionally, cornual ectopic gestations have been treated with exploratory laparotomy and wedge resection of the uterine cornua or even hysterectomy. with the advent of minimally - invasive techniques and the growing evidence and expertise in the field, laparoscopic mini - cornual excision offers a valuable option for patients desiring definitive minimally - invasive surgical treatment of cornual ectopic pregnancy. because patient safety is always the prime goal, mini - cornual excision for cornual pregnancies should only be recommended to hemodynamically stable patients in a tertiary care facility with the necessary laparoscopic skills and expertise to ensure patient safety. the availability of blood products, immediate anesthesia, and critical care staff, and surgical equipment and facilities are also essential for the safe practice of this minimally - invasive procedure. with these conditions and appropriate patient selection, laparoscopic treatment of interstitial pregnancy offers significant advantages over laparotomy, such as short hospital stay, faster return to normal activities, and decreased health care cost, without compromising treatment or patient safety. as illustrated in this case series, we advocate a simple method of a stepwise, minimally - invasive treatment of cornual ectopic pregnancies. several reports over the last 2 decades have illustrated various techniques for treatment of cornual pregnancy, including methotrexate injection, cornuostomy, salpingostomy, and the use of endoloop (ethicon, cincinnati, ohio) for small cornual pregnancies. several reports have also indicated the need for ligation of the ascending branches of the uterine arteries or mesosalpingeal vessels to maintain hemostasis. one can argue that suturing may decrease the risk of future uterine rupture, but at this time, evidence is minimal that either approach is superior. in this stepwise technique of mini - cornual excision (table 2), excellent hemostasis is adequately achieved with generous injection of dilute vasopressin along with judicious use of cautery to minimize tissue necrosis. no vascular ligation is utilized, maintaining adequate blood supply and avoiding the unnecessary tissue ischemia that potentially impairs healing and compromises the tensile strength of the cornual region, negatively impacting future pregnancies. in our technique, only a minute portion of the cornua is excised (the thin overlying myometrial capsule), preserving most of the integrity and architecture of the uterus and likely maintaining significant tensile strength at the surgical site. simply stated, the cornual pregnancy is deroofed, leaving the base intact. stepwise approach for mini - cornual excision several important issues associated with mini - cornual excision must be addressed, including hemorrhage, chronic ectopic pregnancy, recurrent cornual pregnancy, and the care of future pregnancies. risk of hemorrhage remains the paramount concern for all clinicians caring for women with cornual ectopic pregnancies. mini - cornual excision is not advisable in cases of ruptured cornual pregnancy due to the catastrophic hemorrhage and the associated hypovolemic shock commonly encountered in these cases. expeditious laparotomy after initial resuscitation remains the mainstay in such cases. the same principle applies if uncontrollable hemorrhage is encountered during laparoscopic mini - cornual excision. however, several measures can be used preemptively to minimize this possibility, such as vasopressin and bipolar cautery in this case, and the use of endoloops prior to manipulation of the cornual pregnancy. the potential for chronic ectopic pregnancy due to inadequate removal of the ectopic gestation is a rare but real concern. non - excisional management options for cornual pregnancy, such as methotrexate, cornuostomy, salpingostomy, and including mini - cornual excision, all carry a small risk of incompletely removing the cornual gestation and the persistence of chorionic villi in the cornua. this is usually diagnosed by failure of serum hcg to drop to non - pregnant levels. the advantage that mini - cornual excision offers over other methods is that the cornual pregnancy is deroofed, providing easy access that facilitates complete removal of the gestational sac and chorionic villi, minimizing the risk of chronic cornual pregnancy. however, more studies are necessary to examine and compare this new technique with other non - excisional methods. recurrent cornual pregnancy remains a risk, similar to any surgical treatment for an ectopic gestation at any site. conservative management of cornual pregnancy, i.e., without radical cornual resection, obviously carries a risk of recurrence at the same location. patients should be carefully counseled about the associated risks of cornual pregnancy resection as well as the benefit of maintaining uterine integrity, vascularity, and structure, especially in patients desiring future fertility. risk to future pregnancies and the care of any subsequent pregnancies remain valid concerns after mini - cornual excision, particularly regarding the potential risk of uterine rupture. this concern originates from the potential risk of leaving a weakened cornual region following mini - cornual excision, allowing for potential uterine rupture with future gestations. in addition, excessive use of electrocautery may cause significant concealed damage to the myometrium that can further weaken the cornual region and increase the risk of uterine rupture with future pregnancies. if a significant gap is created in the cornual region while evacuating the contents, the incision should be approximated with laparoscopic suturing, and, if not feasible, a minilaparotomy may be necessary. these considerations should be clearly addressed when counseling patients regarding their management options and the risk of uterine rupture with future pregnancies. with regards to the care of future pregnancies, all patients should be carefully counseled on the importance of early presentation with future pregnancies for complete evaluation, primarily to rule out a recurrent cornual or ectopic pregnancy, and also to establish reliable dates and timely delivery plans. two case reports describe successful, uncomplicated vaginal delivery following laparoscopic management of cornual pregnancy. however, at this time, we recommend close monitoring of future pregnancies for patients treated conservatively for cornual pregnancy, with a planned cesarean delivery at term or upon failure of tocolytic therapy for preterm labor. cornual pregnancy is a potentially life - threatening condition that should be managed safely in a timely fashion. the stepwise approach presented here ; mini - cornual excision, achieves a rapid, systematic, safe, and definitive treatment of cornual pregnancy that is minimally - invasive with minimal blood loss and rapid return to normal activities. careful patient selection and counseling regarding treatment options is essential, particularly for patients desiring future pregnancy. | cornual pregnancy often poses a diagnostic and therapeutic challenge, with a significant risk for morbidity and mortality. traditional treatment for cornual pregnancy has been through laparotomy, wedge resection, or hysterectomy. early diagnosis is now possible through transvaginal ultrasonography and highly - sensitive -human chorionic gonadotropin assays. consequently, several less - invasive therapies and techniques have been introduced over the last 2 decades. we present a simple, stepwise laparoscopic technique for the definitive, minimally - invasive excision of cornual pregnancy, along with a review of the pertinent literature. |
since the parenteral administration is the only route of insulin delivery, alternative routes of administration (oral, nasal, rectal, pulmonary, and ocular) have been extensively investigated. insulin is a protein composed of two polypeptide chains which are covalently bound by disulfide bonds between cysteine residues. although peroral application is considered as the most convenient route of drug administration especially in long - term treatment, it is well known that the bioavailability of insulin after oral application is very low due to its instability in the gastrointestinal (gi) tract and its low permeability through the intestinal mucosa, requiring nonoral routes of delivery. moreover, oral administration of insulin would be directly channeled from the intestine or colon to the liver to avoid peripheral hyperinsulinemic effects. for successful protein absorption from gi route, both the proteins and peptides must overcome several barriers. secondly, they have to be protected from the intensive proteolytic enzyme activity of the intestine, and, finally, they have to pass through the intestinal epithelial cells which prevent transport of macromolecules due to their structural properties. consequently, researchers have used different strategies for manufacturing tablets or developing drug carrier systems capable of controlling drug delivery after oral administration. recent researches have determined that polymeric compounds are useful carriers for high molecular weight drugs. biodegradable polymers such as chitosan have been used extensively in biomedical fields in the form of sutures, wound covering and as artificial skin. deacetylation of chitin, the second most abundant biopolymer isolated from insects, crustacea such as crab and shrimps, as well as fungi, leads to poly(-1,4-d - glucosamine) or so called chitosan. chitosan with excellent biocompatible and biodegradable properties has been used extensively in the pharmaceutical industry as drug delivery system. moreover, chitosan has been extensively investigated for its potential as a permeation enhancer across intestinal epithelium for peptides and proteins. the mucoadhesive property of chitosan is mediated by its ability to spread over the mucus layer and additionally its positive ionic interactions with the negative charges of the cell surface membranes. arabic gum (acacia), a biocompatible and biodegradable polymer, is mainly used in oral and topical pharmaceutical formulation as a suspending and emulsifying agent. arabic gum has also been evaluated as a bioadhesive in novel tablet formulations and modified release tablets. in the last decades, many strategies have been developed to enhance oral protein delivery. among these approaches, secondly, they can improve the drug transmucosal transport and transcytosis by m cells, and thirdly, the particulate systems can provide controlled release properties for encapsulated drugs. in recent years, ion gelation or polyelectrolyte complex formation (pec) has drawn increasing attention for producing nanoparticles containing peptides. the nanoparticles prepared by this method have several characteristics favorable for cellular uptake and colloidal stability, including suitable diameter and surface charge, spherical morphology, and a low polydispersity index indicative of a relatively homogeneous size distribution. in addition, this method has the advantage of not necessitating aggressive conditions such as the presence of organic solvents and/or sonication during preparation ; therefore, minimizing possible damage to proteins and peptides during ion gelation formation. this study deals with in vitro insulin release and ex vivo studies on intestinal section of sheep to investigate the permeation of insulin in free form and in nanoparticle form. chitosan (95% deacetylated with viscosity of 1% w / v solution, 30 mpa.s) was purchased from primex (siglufjordur, iceland). crystalline recombinant human insulin (28.3 iu / mg) and arabic gum were purchased from eli - lilly (suresnes, france) and arthur branwell (braintree, essex, england), respectively. the preparation of insulin nanoparticles was performed by a method previously set up in our laboratory. briefly, known amounts of chitosan were dissolved in 0.1% of acetic acid solution to obtain define concentration under stirring at room temperature. in the second step, arabic gum was dissolved in water to obtain a known concentration under magnetic stirring at room temperature. nanoparticles were prepared by adding arabic gum solution dropwise to chitosan solution containing insulin under gentle magnetic stirring (200300 rpm) at room temperature. nanoparticles were recovered by centrifugation at 4c and 14,000 rpm for 15 min, and the supernatant was used for measurement of free insulin by hplc chromatography (hplc, youngling, sdv sos, anyang, south korea). the best formulation was selected using a 2 factorial design experiment (table 2) and was further used for in vitro release studies as well as ex vivo permeation studies. mean diameter, polydispersity index (pdi), and z - potential of insulin nanoparticles were measured using zeta sizer apparatus (malvern, z - s, worcestershire, uk), and the range of polydispersity index between 0 - 1 was determined. nanoparticles were analyzed with transmission electron microscopy (tem, phillips 400, kw 80, eindhoven, and holland). the amount of insulin encapsulated in the nanoparticles was calculated by measuring the difference between the total amounts of the insulin added in the nanoparticle preparation solution and the amount of nonentrapped insulin remaining in the clear supernatant after the centrifugation. the insulin loading level in nanoparticles was calculated based on the amount of insulin in the nanoparticles that was determined by measuring insulin in the hcl medium after filtering through a 0.1 m syringe filter by hplc method. insulin release from nanoparticles was done in three different ph values of 0.1 n hcl, phosphate buffer solution (pbs) ph 6.5 and 7.2 in a 25 ml tube at 37c and 75 rpm. samples were withdrawn at predetermined time intervals and filtered through a 0.1 m filter. the procedure used is a modification of barr and riegelman method with some adjustments. at first a section of intestine (about 7 cm) was removed from a male sheep under phenobarbital anesthesia and washed with krebs - ringer bicarbonate solution, ph 7.4. the lumen was inverted with a glass rod and a tube was inserted in one side of the intestine and tied securely with tape. the other side of the intestine was tied and 1ml of krebs - ringer bicarbonate solution was poured through the hypodermic needle in the tube. the lumen of intestine was placed in a medium standard with 95% o2, 5% co2 in phosphate buffer solution ph 6.5 at 37c. in absorption studies, o2 and co2 mixture was bubbled into the intestinal to obtain intestinal peristaltic movement (figure 1). in certain periods of time samples with known volume were collected from the medium and were assayed by hplc method, and the amount of insulin was calculated. the insulin nanoparticles were prepared by ion gelation method using the electrostatic interactions between positively charged chitosan and negatively charged arabic gum. in our previous study, various formulations (f1f8) were prepared using 2 factorial design experiments. according to the results of factorial design experiments, the association efficiency (ae) of the nanoparticles was investigated in this study. moreover, the electrostatic interactions between the positively charged group of chitosan and negatively charged groups of arabic gum plays an important role in the association efficiency of insulin in nanoparticles. these studies have shown that increasing the concentrations of chitosan and arabic gum or the amount of insulin used in nanoparticle preparation are important factors in ae (table 2). according to these figures and the results obtained from the zeta potential studies, the positive charges on the surface of nanoparticles could prevent the aggregation process. the particle size of nanoparticles is presented in table 3 for the three selected formulations. the mean diameter of particles is 191, 172, and 177 nanometers for formulations f1, f2, and f3, respectively, and exhibited relatively narrow particle size distribution, as indicated by a relatively low polydispersity index values (table 3). this could be related to the type of particle formation mechanism between positively charged amine groups of chitosan that are neutralized by their interaction with negative charge of arabic gum polymer. this effect may be related to the absorption of anionic groups by the long amino groups of chitosan to keep the high value of the electrical double layer thickness which in turn prevents the aggregation. the insulin release of nanoparticles was studied as a function of time for formulation f3. figures 3 and 4 have shown the release profile of insulin in three different ph medium hcl 0.1 n, pbs ph 6.5, and ph 7.2. a burst effect of insulin release in acidic medium is related to high solubility of both chitosan and insulin (figure 3). furthermore, it is fair to say that a lot of insulin molecules are loosely attached on the surface of nanoparticles, and therefore insulin tends to easily move out and diffuse to the external medium. as shown in figure 4 the release profile of insulin from the nanoparticles is different in higher ph values of 6.5 and 7.2. moreover, the solubility of chitosan and insulin in pbs is lower than acidic medium and therefore a burst effect was not observed. the difference in insulin release at pbs ph 6.5 and 7.2 is probably related to the presence of arabic gum. arabic gum has a ph value of 4.55.0 in 5% w / v aqueous solution and therefore the polymer chains may swell in ph mediums higher than 6.5 and obtain more porosity in nanoparticle structures, resulting in more insulin release. for more studies, fickian and nonfickian behavior equation mt / m = kt was used, where mt is the amount of released insulin in a given time, m is the total amount of insulin within nanoparticles, k and n are the equation constants, and t is the time. table 4 has shown the result for kinetic constant, diffusional constant, and type of release mechanism in formulation f2 and f3. the value of 0.823 for formulation f2 and 0.494 for formulation f3 are related to nonfickian transport. the result suggests that transport is possibly controlled by diffusion and/or swelling of the polymer chains. today, the uptake of nanoparticulate systems through the gastrointestinal tract is a well - known and accepted phenomenon, and excellent reviews of the intestinal uptake of particles have been published. the bioactive molecules are transported into the gi by carriers with specific physicochemical characteristics that have no effect on the drug. figure 5 shows the simplified schematic of preabsorption and postabsorption processes in nanoparticle dependent drug delivery to gastrointestinal sites following oral administration. the amount of insulin transported across the intestine barrier was measured by using modified gut sac method. permeation profiles of insulin from formulation f1, f2 f3 as well as free insulin samples are depicted in figure 6. it is clearly demonstrated that the permeation of insulin in the serosal medium in nanoparticulate form is much more enhanced in comparison with free - soluble insulin. moreover, insulin is a macromolecule with hydrophilic properties that is not easily transported across the cellular membrane. nanoparticulate systems facilitate the transport of insulin through the intestinal barrier due to their protective effect as well as their charge properties. for the nanoparticles to be able to be permeated via the gut - associated lymphoid tissues the physical characteristic of the nanoparticles such as size, shape, specific surface, surface charge, and chemical stability are important factors to be considered. moreover, the potential interactions with gut contents, transit time through the gi, transport through the mucosa, adhesion to epithelial surfaces, and aggregation of the particulates in contact with the fluid content of the gut must be considered. some phenomena, such as aggregation, adsorption, and adhesion, can alter the zeta potential, hydrophilicity, and size of the nanoparticles. the zeta potential and mean diameter for f1, f2, and f3 formulations are close to each other so we can not show the significant difference between these formulations (p < 0.05). in the intracellular pathway, it seems that nanoparticles regardless of their particle size are able to move through the cellular membrane via transcytosis or endocytosis mechanisms. in intercellular pathway, the presence of tight junction between adjacent epithelial cells is the main barrier to the passage of macromolecules and hydrophilic agents such as peptides and proteins. the presence of the positive charge on the surface of the nanoparticles may interact with the actin filaments of intestinal epithelium disrupting the structure of the tight junctions and enabling the permeability of insulin through these junctions. the main goal of administration of nanoparticles by the oral route is to lower the dose of the drug (and consequently to diminish its toxicity) as well as to improve patient compliance and supply an easy administration route. other aims may be to decrease the fed / fasted variability and patient - to - patient variability. hydrophilic nanoparticles based on chitosan are receiving increased interest as they could control the rate of drug release, prolong the duration of the therapeutic effect, and deliver the drug to specific sites in the body. in this study, we developed a new nanoparticle system with arabic gum for oral delivery of insulin. results have indicated a small size, positive charge, and median ae for nanoparticles. it was shown that the release of insulin from nanoparticles was obtained with more than one mechanism (possibly diffusion, dissolution, and relaxation of the polymer chains). results showed that chitosan nanoparticles are able to enhance permeation of insulin as hydrophilic models through intestine epithelium. indeed, our preliminary studies have shown that all the nanoparticles formulations are able to increase the amount of insulin transported across the intestine barrier compared to free insulin sample. understanding the structure and function of bilayer of cell membrane and proteins that are involved in the formation of the intercellular junctions may create a new field for developing different mechanisms of drug permeation. further investigations are required and are in progress in our laboratory to fully characterize and optimize these systems. | polymeric delivery systems based on nanoparticles have emerged as a promising approach for peroral insulin delivery. the aim of the present study was to investigate the release of insulin nanoparticulate systems and ex vivo studies. the nanoparticles were prepared by the ion gelation method. particle size distribution, zeta potential, and polydispersity index of the nanoparticles were determined. it was found that the nanoparticles carried positive charges and showed a size distribution in the range of 170200 nm. the electrostatic interactions between the positively charged group of chitosan and negatively charged groups of arabic gum play an important role in the association efficiency of insulin in nanoparticles. in vitro insulin release studies showed an initial burst followed by a slow release of insulin. the mucoadhesion of the nanosystem was evaluated using excised rat jejunum. ex vivo studies have shown a significant increase in absorption of insulin in the presence of chitosan nanoparticles in comparison with free insulin. |
aspirin - exacerbated respiratory disease (aerd) is a syndrome in which chronic asthma is accompanied by nonallergic hypersensitivity to nonsteroidal anti - inflammatory drugs (nsaids), leading to acute bronchoconstriction and exacerbation of other lower and upper airway symptoms [1, 2 ]. the ability of classical nsaids to inhibit prostaglandin synthesis by cyclooxygenase (cox) isozymes, particularly cox-1, is implicated in these acute exacerbations, but it is not known how they activate mast cells, eosinophils, macrophages, epithelium, and other cells to release a range of inflammatory mediators in susceptible subjects. prominent among these mediators are the cysteinyl - leukotrienes (cys - lts), which are potent bronchoconstrictor lipids synthesised by the 5-lipoxygenase (5-lo)/ltc4 synthase pathway. compared to nsaid - tolerant asthmatics, aerd patients have chronically elevated production of cys - lts, as demonstrated in bronchoalveolar lavage (bal) fluid, induced sputum, exhaled breath condensate, and urine. together with the clinical efficacy of antileukotriene drugs, this suggests a key role of cys - lts in chronic aerd, even when nsaids are entirely avoided. exposure to nsaids is postulated to shunt the shared substrate arachidonic acid from the prostaglandin (cyclooxygenase) pathway to the leukotriene (5-lipoxygenase) pathway, or to reduce production of a prostaglandin, putatively pge2, that normally suppresses leukotriene synthesis via an ep receptor mechanism, possibly via phosphorylation of ltc4 synthase. increased cys - lt production is prominent in the acute bronchoconstriction that results, but it is not understood why nsaids trigger the acute surge in cys - lt levels only in aerd subjects. in 1998, we described with our collaborators a marked overexpression of ltc4 synthase, the terminal enzyme for the cellular biosynthesis of the first of the cys - lts, ltc4, in the bronchial mucosa of aerd patients. ltc4 synthase overexpression was also described in nasal polyps from aspirin - sensitive rhinitic patients. a model for nsaid sensitivity was proposed in which enhanced expression of ltc4 synthase in airway macrophages, mast cells, and eosinophils provides the enzymatic capacity for constitutive overproduction of cys - lts in aerd [7, 9 ]. indeed, total numbers of ltc4 synthase - positive cells in the bronchial mucosa correlate strikingly with increased cys - lt levels in bal fluid in aerd subjects. overexpression of ltc4 synthase may also explain why only aerd subjects respond adversely to nsaid challenge, as suggested by the unique relationship between bronchial ltc4 synthase and airway hyperresponsiveness to aspirin challenge. the view that ltc4 synthase overexpression is a central anomaly in aerd is supported by recent work in ltc4 synthase transgenic mice, although the potential mechanisms involved remain unclear. ltc4 synthase can be upregulated by cytokines, including interleukin (il)-3 and il-5 in maturing eosinophils and il-4 and il-13 in human cord - blood mast cells, while tnf downregulates ltc4 synthase in monocytes. immunoexpression of il-5, but not il-3 or gmcsf, is increased in aerd biopsies relative to aspirin - tolerant subjects, but there are no studies of il-13 in aerd lung. macrophages from resected human lung may represent a useful cellular model for aerd as they are primary cells that express both the 5-lo / ltc4 synthase and cox biosynthetic pathway enzymes, and also receptors for il-13 that mediate increased expression of the cyslt1 receptor. we hypothesised that culture of human lung macrophages with il-13 would increase ltc4 synthase gene transcription and cys - lt synthesis compared to control macrophages. we also hypothesised that the nsaid, indomethacin, would trigger a further release of cys - lts only in the il-13-treated cells. taqman universal master mix, -actin and ltc4s gene expression assays, and microamp optical adhesive film were purchased from applied biosystems (warrington, uk). the improm - ii reverse transcription system was purchased from promega (southampton, uk). the cysteinyl - leukotriene enzyme immunoassay (eia) kit was from cayman chemical europe (tallinn, estonia). calcium ionophore calcimycin (a23187), indomethacin, trypan blue solution (0.4%), and dimethylsulphoxide (dmso) were from sigma chemical company (poole, uk). samples of lung tissue (wet weight 1.835.2 g) were collected from male and female patients undergoing bullectomy or lobectomy for lung cancer at the southampton general hospital, in accordance with ethical approval (08/ho502/32) from the southampton and south - west hampshire research ethics committee. tissue samples were dissected into 3 mm fragments and suspended in dulbecco 's phosphate - buffered saline (pbs) containing 0.1 m nacl, 2.7 mm kcl, 1.8 mm kh2po4, and 10 mm na2po4 (ph 7.4). the suspension was centrifuged (80 g, 20c) for 5 min, the supernatant was discarded, and the pellet was resuspended in 30 ml of lysis buffer (155 mm nh4cl, 10 mm khco3, 0.1 mm edta ; ph 7.4). after 5 min at room temperature, the suspension was filtered (70 m filter) and centrifuged (80 g, 20c, 5 min) to remove erythrocyte fragments and other debris. the pellet was resuspended in rpmi medium supplemented with antibiotics (penicillin 55 u / ml, streptomycin 5 mg / ml, and gentamycin 10 mg / ml). the resulting cell population was > 90% pure macrophages by morphology and had viability > 90% as determined by exclusion of trypan blue dye. macrophage aliquots were cultured in rpmi (0.5 10 cells / ml) at 37c for 16 h overnight with or without il-13 (10 ng / ml) in a 5% co2 humidified atmosphere. for cys - lt assays, il-13-treated and untreated cells were incubated for a further 30 min in fresh rpmi medium (0.5 10 cells in 1 ml) in a 37c water bath with no addition (control), with indomethacin (100 m), with calcimycin (a23187, 1 m), or with both indomethacin and a23187 at the same concentrations. calcimycin (a23187) is a calcium ionophore that liberates arachidonic acid from membrane phospholipids and activates 5-lo to initiate leukotriene synthesis. indomethacin is a classical nsaid which inhibits both cox-1 and cox-2 at the concentration used. these reagents were diluted from stock solutions in dimethylsulfoxide (dmso) such that final dmso concentration in the cell incubations was always 1.8, indicating an adequate level of purity, and rna was stored at 80c. to generate cdna, 1 g of rna was reverse transcribed (improm - ii rt system, promega, southampton, uk) using random hexamer primers and stored at 20c. rt - qpcr was performed on the lightcycler 480 (roche diagnostics, uk) in 384-well reaction plates using ~100 ng of template cdna in quadruplicate 20 l reactions using taqman gene expression assays for ltc4s (hs00168529_m1) with actb (beta - actin, hs99999903_m1) as a reference gene, both using fam - labelled hydrolysis probes and taqman universal mastermix ii for 40 cycles, as in the manufacturer 's protocol (applied biosystems). gene expression relative to actb was calculated using the 2 method. paired statistical comparison between il-13-treated and untreated cells from n = 12 donors was performed by wilcoxon signed rank test for nonparametric data. evaporated supernatants from 30 min incubations of il-13-treated and untreated macrophages with and without indomethacin and calcimycin were resuspended in appropriate volumes of pbs buffer and aliquots taken in duplicate for eia quantification of released cys - lts. the total cys - lt eia kits (cayman europe) use a monoclonal primary antibody with 100% specificity for ltc4 and ltd4 and 79% specificity for lte4. cross - reactivity to ltb4, various hetes, and arachidonate is less than 4% and the assay has high sensitivity (34 pg / ml) for cys - lts. the assay is based on competition with a standard ltc4-acetylcholinesterace tracer with ellman 's reagent as substrate. cys - lts were assayed in duplicate, and concentrations are expressed as nanograms of ltc4 released per million viable macrophages. data are presented as mean sem for n = 8 tissue donors, and comparisons between mean values were made by two - tailed paired student 's t - tests, with p 0.05). as expected, the calcium ionophore a23187 (calcimycin, 1um) boosted the mean release of total cys - lts by about 10-fold compared with spontaneous release. mean release of total cys - lts after 30 min of a23187 stimulation was significantly greater in il-13-treated cells (7770 630 pg / million cells) than in cells not treated with il-13 (5480 670 pg / million cells) (p = 0.005), a mean increase of 42 10% (figure 2). coincubation of indomethacin (100 m) and a23187 (1 m) however did not show different values for cys - lt release compared with a23187 alone in either il-13 pretreated or untreated cells. interleukin (il)-13 is a th2 cytokine with well - established roles in promoting airway responsiveness, mucus secretion, and chemokine production in the allergic lung, acting principally via a receptor shared with il-4 and leading to phosphorylation of the transcription factor stat6. il-4 can powerfully upregulate ltc4 synthase expression and activity in human cord - blood mast cells, while il-13 can upregulate the principal receptor for cysteinyl - leukotrienes, cyslt1r, on human airway smooth muscle cells and on macrophages. this suggested that increased il-4/il-13 activity may be responsible for upregulating tissue expression of ltc4 synthase, as observed in the upper and lower airways in aerd patients [7, 8 ], and for enhancing responsiveness to cys - lts by increasing the expression of cyslt1 receptors, as described in aerd nasal biopsies. this study therefore explored whether il-13 can upregulate ltc4 synthase transcriptional expression in macrophages isolated from resected human lung and whether it leads to a higher release of cys - lts, either spontaneously or in response to a calcium ionophore, compared with macrophages not cultured with il-13. taqman gene expression assays failed to show significant changes in ltc4s mrna, standardised to the beta - actin housekeeping gene (actb), in il-13 cultures of macrophages from twelve lung tissue donors (figure 1). increases in ltc4s mrna are detectable after six hours of il-4 treatment in human mast cells derived from cord blood mononuclear cells, and maximal at 24 to 120 hours, suggesting that the 16-hour culture with il-13 employed in our experiments was reasonable. il-13 may be less potent on myeloid cells than il-4, and our cells were mature lung macrophages from mainly elderly subjects undergoing lobectomy or bullectomy ; these cells may not be as responsive to il-13 or other stimuli as cord - blood - derived mononuclear cells from healthy neonates. despite the lack of effect on ltc4s transcription, culture of lung macrophages with il-13 did cause significant increases in cys - lt release, an effect that was apparent both on the low levels of spontaneous cys - lt production in unstimulated cells and on the tenfold higher levels of cys - lt release measured in cells stimulated with calcimycin a23187 (figure 2). calcimycin acts as a receptor - independent trigger of arachidonate release from membrane phospholipids ; a high turnover of substrate through the 5-lo / ltc4 synthase pathway was intended to simulate rate - limiting conditions, such that an increase in ltc4 synthase enzyme expression induced by il-13 could be revealed by a raised ceiling of cys - lt synthesis. in the event, the lack of upregulation of ltc4s mrna suggests either a nontranscriptional effect of il-13 or an action on other components of the pathway, possibly on 5-lo activating protein (flap), which is inducible by cytokines and increases markedly during human alveolar macrophage maturation. the increases in cys - lt release seen in the il-13-cultured macrophages were relatively modest (4252%), but suggest that il-13 could contribute to increased cys - lt releasability in macrophages in the allergic asthmatic or aerd lung. nsaids such as indomethacin are proposed to cause acute aerd reactions by shunting of arachidonate from the inhibited cox pathway to the 5-lo / ltc4 synthase pathway or by suppressing synthesis of an inhibitory prostanoid such as pge2, thus enhancing cys - lt production. although isolated anomalies in cox isozyme expression, prostanoid synthesis, and ep receptor signalling have been described in aerd cells and tissues [19, 20 ], a coherent picture of a systemic prostanoid defect in aerd has yet to emerge. we postulated that endogenous cox pathways in human lung macrophages may therefore provide an adequate target for nsaid action, resulting in enhanced cys - lt release if the 5-lo / ltc4 synthase pathway has previously been induced by il-13. no effect of indomethacin was observed however on either spontaneous or a23187-stimulated cys - lt release in either il-13-treated or untreated cells (figure 2). in the absence of an effect of il-13 on ltc4s mrna levels, it is not possible to reject our hypothesis that ltc4 synthase overexpression in a single cell type could provide a simple cellular model of the key functional changes within the aerd lung. in vivo, intercellular interactions may be required, possibly with pge2 derived from airway epithelial cells or it may depend on the recruitment of new populations of ltc4-synthase - expressing cells, such as eosinophils. it is nevertheless intriguing that human mast cells derived in culture from the blood mononuclear cells of aerd subjects show an intrinsically raised capacity for cys - lt synthesis and that this is suppressed by pge2, suggesting that the aerd paradigm can be detected at the level of a single cell type and that it persists in prolonged cell culture. further comparative studies are required in primary lung cell populations from normal and aerd subjects. the key features of aerd have recently been replicated in ovalbumin - sensitised ltc4 synthase transgenic mice (ltc4s - tg), including its overexpression in airway macrophages and other leukocytes, leading to increased cys - lt synthesis both before and after nsaid challenge, accompanied by dramatically increased th2 cytokines, including il-13. this model suggests that primary dysregulation of ltc4 synthase in resident lung cells including macrophages may initiate overproduction of cys - lts in patients with aerd. the cys - lts may then promote the secondary synthesis of il-4, il-5, and il-13 from lymphocytes and eosinophils, leading to myocyte cyslt1r expression, suppression of epithelial pge2 synthesis and ep2 expression, and further induction of ltc4 synthase. while the ltc4s 444a / c promoter polymorphism has been discounted as an aetiological factor in most aerd populations, other genetic, immunological, and microbial factors that could directly dysregulate ltc4 synthase in human lung cells merit further investigation. | aspirin - exacerbated respiratory disease (aerd) is associated with constitutively elevated synthesis of bronchoconstrictor cysteinyl - leukotrienes, associated with increased expression of leukotriene (lt)c4 synthase and th2 cytokines and airway eosinophilia. we examined whether interleukin-13 can increase ltc4 synthase gene transcription and cysteinyl - leukotriene synthesis in macrophages isolated from resected human lung tissue and whether an nsaid (indomethacin) can trigger further cysteinyl - leukotriene synthesis in these cells. overnight culture of human lung macrophages with il-13 (10 ng / ml) increased spontaneous and ionophore - stimulated production of cysteinyl - leukotrienes by 42% (p = 0.02) and 52% (p = 0.005), respectively, as quantified by enzyme immunoassays, but pcr gene transcription assays did not demonstrate an effect on ltc4s mrna. the addition of indomethacin (100 m) did not modulate cysteinyl - leukotriene production in either il-13-treated or untreated macrophages. we conclude that while il-13 enhances cysteinyl - leukotriene synthesis in human lung macrophages, it does not replicate the enhanced ltc4 synthase expression observed in the aerd lung nor confer sensitivity to nsaids. |
noninvasive brain stimulation (nibs) finds increasingly more applications in clinical neuroscience. under the term nibs, different techniques are summarized that allow a noninvasive stimulation of the brain but that are characterized by different modes of action. recent studies in the field have made clear that the response capacity to any nibs protocol is subject of a significant interindividual variability [25 ]. contrary to initial expectations, these studies displayed that a specified number of subjects will not show the expected effects following a given nibs protocol but showed that these subjects may show no responses or even the opposite effects. taking into consideration that nibs are currently been applied in clinical practice to treat various neuropsychiatric disorders (e.g., depression, schizophrenia, and stroke), it is necessary to better understand the response variability following nibs. thus, we decided to perform a comparative study of the efficacy and the response variability of two well - established nibs protocols with different physiological modes of action : transcranial direct current stimulation (tdcs) and paired - associative stimulation (pas). tdcs is one of the most widespread techniques in clinical trials and experimental settings, because the application is simple and the neurophysiological and behavioural effects are discussed to be rather strong. animal studies showed that tdcs modulates spontaneous neuron activity by a tonic depolarisation (anodal tdcs) or hyperpolarisation (cathodal tdcs) of their membrane potentials resulting in consecutive long - lasting changes in the neuronal firing rates [68 ]. a more recent animal study conducted on motor - cortex slices from the mouse brain slices confirmed the polarity - specific effects of anodal tdcs and showed that anodal tdcs induces long - lasting synaptic potentiation outlasting the duration of stimulation. human studies confirmed these findings by showing similar polarity - dependent changes in motor - cortical excitability following anodal or cathodal tdcs. anodal tdcs led to an increase of motor - evoked potentials (meps) and cathodal tdcs resulted in a decrease of meps following a stimulation of 13 minutes or respective 9 minutes [10, 11 ]. pharmacological challenges in healthy subject demonstrated that this modulation in motor - cortical excitability following tdcs is critically dependent on calcium homeostasis and the activity of glutamatergic nmda receptors [12, 13 ]. in summary, these findings from animal and human studies suggest that the after - effects following tdcs are related to neural plasticity and to the molecular mechanisms of long - term potentiation and long - term depression. on the other hand, pas is mainly used in experimental settings because the application is more complicated than the application of tdcs. pas fulfils several criteria of a plasticity protocol, as the after - effects are long - lasting, persist the duration of the intervention, and are input - specific and nmda - dependent. however, the special characteristics are that the after - effects of pas seem to be synapse - specific following hebbian principles and that they are related to spike - dependent plasticity [3, 14, 16 ]. human studies indicate that the repeated pairing of an electric stimulus of a peripheral nerve (somatosensory afferent) followed by a single magnetic pulse of the contralateral motor cortex with an interstimulus interval of 25 ms (or adjusted to the individual n20-latency plus 2 ms) results in a long - lasting mep increase in terms of ltp - like plasticity [1, 14, 16 ]. an adjustment of the interstimulus interval to 10 ms (or adjustment to the n20-latency minus 5 ms) causes a reduction of mep amplitudes (ltd - like plasticity) [1, 14, 16 ]. the aim of this study was to compare the efficacy and response variability of two ltp - like plasticity inducing nibs protocols using the most established stimulation configurations. anodal tdcs was applied with 1 ma for 13 minutes [7, 17 ] and pas25 consisted of 180 pairs of peripheral nerve stimulation followed by a magnetic pulse with an interstimulus interval of 25 ms [14, 15, 18 ]. only one previous study has yet directly compared these two ltp - like plasticity inducing protocols. this study showed the same level of excitability change and the same proportion of responders following anodal tdcs and pas25 but no mean change of motor - cortex excitability when all subjects were analysed. these findings contrast earlier reports that investigated either anodal tdcs (for review see) or pas (for review see) and showed significant group - level changes in cortical excitability. we aimed to either replicate or refute these initial findings and to extend the current knowledge of response variability following nibs. we hypothesised that both plasticity protocols will result in a mean increase in cortical excitability but that a certain proportion of subjects will not show the expected results. the study protocol was conducted in accordance with the declaration of helsinki and approved by the ethics committee of the ludwig maximilians university of munich. after giving written informed consent, 30 healthy participants, all aged between 19 and 42 years, all subjects were medication - free and screened by clinically experienced psychiatrists for psychiatric comorbidities. subject received two experimental sessions (anodal tdcs versus pas25) on two different days and sessions for each subject were 7 to 8 days apart. subjects received on the first study day anodal tdcs and on the second study day pas25. subjects were examined in half - reclined sitting position with their arms resting passively supported. electromyographic activity (emg) was recorded by surface electrodes on the right first dorsal interosseous muscle (fdi). raw signals were amplified and bandpass - filtered (3 hz2 khz range) using a digitimer d-360 amplifier setup (digitimer ltd., uk)., cambridge, uk) controlled by signal software (version 5, cambridge electronic design, cambridge, uk). motor - evoked potentials (mep) were induced by tms applied to the left primary motor cortex (m1) with a standard figure - of - eight magnetic coil (outer diameter 70 mm, the magstim company ltd., uk) and a monophasic magstim bistim stimulator (the magstim company ltd., uk). throughout all experiments, the coil was held tangentially to the skull, with the handle pointing backwards and in a 45 angle lateral to the midline. the stimulation site that produced the largest motor - evoked potential (mep) at moderately suprathreshold stimulation intensities was defined as the hot spot and marked for further optimal coil positioning. rmt was recorded in the resting fdi muscle and defined as the minimum stimulator intensity that resulted in an mep amplitude of 50 v in at least 5 of 10 measurements. the stimulation intensity corresponding to mep amplitudes of 1 mv (0.3 mv) (s1mv) was adjusted at baseline and kept unchanged throughout the experiments. single - pulse mep measurements using the s1mv intensity were conducted at baseline (40 stimuli) and after stimulation (time points 0, 5, 10, 20, and 30 minutes ; 20 stimuli at each time point) to monitor after - effects following both plasticity protocols (pas and tdcs). to test for after - effects on cortical recruitment, input - output curves (io) were measured at baseline and 8 minutes after stimulation using an increasing stimulus intensity order (90%, 110%, and 130% of rmt) with 7 stimuli for each intensity (figure 1). single- and paired - pulse tms was applied at 0.2 hz. to assess the after - effects of the respective stimulation types on inhibitory and facilitatory intracortical networks, short - latency intracortical inhibition (sici) and intracortical facilitation (icf) were obtained at baseline and 15 minutes after stimulation using a standardized paired - pulse protocol. the conditioning stimulus was set at 80% rmt intensity and the test stimulus at s1mv (0.3 mv) in the resting fdi. the intensity of the test pulse was not adjusted after the intervention for paired - pulse measures. in total, 65 randomised stimuli were applied, with 15 stimuli using the test stimulus alone and 10 stimuli for each interstimulus interval (isi) (sici : 2 ms and 3 ms ; icf : 7 ms, 9 ms, and 12 ms). anodal tdcs was applied through saline soaked rectangular surface sponge - electrodes (35 cm) using a ce - certified standard stimulator (dc - stimulator - plus, neuroconn gmbh, ilmenau, germany). the anodal electrode was positioned on the left side of the skull over the representational field of the right fdi as identified by tms ; the cathodal electrode was contralaterally above the right orbit. the stimulation intensity of the tonic electrical field was set at 1 ma and applied for a total duration of 13 minutes [7, 17 ], which has been consistently shown in previous tdcs publications to be an optimal duration time for the induction of cortical excitability changes in terms of ltp - like plasticity lasting for approximately one hour following tdcs. according to foregoing publications [14, 15, 18 ], the pas25 protocol consisted of 180 pairs of peripheral nerve stimuli followed by tms stimuli after an interstimulus interval (isi) of 25 ms. the peripheral nerve stimulation was applied to the right ulnaris nerve at the level of the wrist using a ce - certified ds7a peripheral nerve stimulator (digitimer ltd., uk). the stimulation intensity was set at 300% of the individual perceptual threshold, resulting in an average electrical intensity of 9.8 2.1 ma, which has been demonstrated to result in a reliable plasticity response. the tms stimuli were applied to the motor - cortical representation of the right fdi as identified in the excitability measurements. to maintain a constant level of attention during the stimulation, subjects were asked to watch their right hand, silently count the number of stimuli delivered, and report the adding number to the examiners request every 2030 stimuli (random choice by examiner). all subjects mean count of the total number of paired stimuli was 176182 (mean = 179.5 1.5) and did not significantly differ from the total count of 180 stimuli, indicating a sufficient level of attention [22, 23 ]. for statistical analysis, spss 22 for windows was used and the level of significance was set at alpha = 0.05. to test for differences concerning baseline parameters between the two experimental sessions paired - samples t - tests were computed for all depending variables. cortical excitability changes were expressed as increase or decrease in mean mep amplitudes before and after stimulation. as the assumption of normal data distribution was violated for most depending variables (kolmogorov - smirnov test, p between 0.129, table 2). a repeated - measures analysis of variance (rm - anova) was conducted with the factors time course (baseline, 0 min, 5 min, 10 min, 20 min, and 30 min) and stimulation this analysis revealed a significant main effect on time course (f5,25 = 4.412, p = 0.001) but neither an effect on stimulation (f1,29 = 2.190, p = 0.150) nor an effect on the time course stimulation interaction (f5,25 = 0.617, p = 0.687). in addition, the overall rm - anova with the factors time (baseline, mean post - meps averaged) and again stimulation (anodal tdcs, pas) showed also a significant main effect on time (f1,29 = 12.392, p = 0.001) and no effect on stimulation rm - anovas separately computed for both stimulation protocols separately showed a significant main effect on time course in the pas - group (f5,25 = 3.963, p = 0.002) but not in the tdcs - group (f5,25 = 1.408, p = 0.225). to analyse the general excitability changes following both stimulation types, a mean value of all poststimulation time points was included into an additional rm - anova analysis, which showed a significant main effect on time for both anodal tdcs (f1,29 = 4.534, p = 0.042) and pas (f1,29 = 16.041, p 2.13, all p 100%, > 110%, and 150% relative to the individual baseline (figures 3 and 4). chi - square (chi) tests were computed to compare the stimulation protocol and the respective individual response pattern. these analyses revealed trend - level differences between anodal and pas responders at > 110% (p = 0.052) and > 150% (p = 0.058) cut - off ranges but not at > 100% (0.243) in favour of the pas stimulation. defining a decrease of sici and an increase in icf following ltp - protocols as response, we again defined three different cut - off ranges : > 100%, > 110%, and > 150% increase of the respective relative mean values (post / pre : sici(2 - 3 ms) ; icf(912 ms)). chi tests were used to compare the distribution of responders between both experiments. for sici decrease no significant difference in the distribution of responders was found (> 100% : p = 1.000 ; > 110% : p = 0.795 ; > 150% : p = 1.000). in comparison, the analysis for icf increase revealed a significant difference in the distribution of responders in all of the three ranges (> 100% : p = 0.009 ; > 110% : p = 0.002 ; > 150% : p = 0.005) in favour of anodal tdcs. in order to explore whether gender affected the mep increase following stimulation, chi tests were obtained from both experiments comparing distribution of response and gender. for all cut - off ranges, this analysis did not reveal any significant differences between gender and anodal tdcs (100% : p = 0.796 ; 110% : p = 0.491 ; 150% : p = 0.273) or pas (100% : p = 0.855 ; 110% : p = 0.855 ; 150% : p = 0.261). pearson correlation coefficients were used to examine the relationship between relative baseline values (age ; standard deviation of meps ; sici 2 ms, sici 3 ms, icf 7 ms, icf 9 ms, and icf 12 ms) and the relative mean mep values following stimulation in both experiments. for pas these analyses revealed a positive trend - level correlation between age and relative mean poststimulation meps (r = 0.345, p = 0.062), which was not observed after anodal tdcs (r = 0.010, p = 0.959). in addition, we observed for anodal tdcs a positive correlation between the relative icf values at baseline (12 ms isi) and the relative mean poststimulation mep values (r = 0.557, p = 0.001). concerning all other variables no significant correlations to further investigate the impact of the observed icf - correlation in the anodal experiments, we compared the relative baseline icf values (12 ms) between responders and nonresponders in the anodal condition. these analyses revealed a trend - level difference in the case of the > 100% cut - off range (t1,28 = 1.87, p = 0.072) but significantly higher relative baseline 12 ms icf values for both > 110% (t1,28 = 2.15, p = 0.041) and > 150% (t1,28 = 3.55, p = 0.0014) in responders compared to nonresponders. the present results reveal a differential response pattern following two well - established ltp - protocols in a large sample of healthy controls. both ltp - protocols (anodal tdcs and pas25) induced a significant increase of meps for the observation period of 30 minutes. in the pas25 experiments this mep increase could be observed for nearly all poststimulation time points, whereas in the anodal tdcs experiments the increase of meps could only be shown when all time points were averaged. the likelihood to develop a meaningful mep response was higher in the pas25 compared to the anodal tdcs experiments, but the likelihood for a response in terms of an icf - modulation showed the opposite pattern. in the anodal tdcs experiments, the baseline values for icf at 12 ms showed a positive correlation with the increase of meps after stimulation and this value differed significantly between responders and nonresponders. in summary, our results indicate a sufficient increase of cortical excitability following anodal tdcs and pas25 in terms but also demonstrate less individual variability than reported in previous studies. considering the particular importance of interindividual response differences surprisingly limited data comparing nibs protocols with different modes of action is available. one study compared the efficacy of three different ltp - protocols (intermittent theta - burst stimulation (tbs), anodal tdcs, and pas25) in 56 healthy controls and the authors were not able to show significant effects on excitatory or inhibitory circuits when all subjects were analysed as a group. this response pattern resembles the results of another study conducted on 18 subjects showing in the group - level analyses no increase in meps following intermittent tbs and pas25 but a decrease in mep amplitudes following continuous tbs. for tdcs, a recently published study could not observe a modulation of mep amplitudes following anodal or cathodal tdcs in 53 healthy subjects. the fact that this study used an intensity of 2 ma for tdcs whereas most tdcs studies used 1 ma [7, 25 ] should be taken into account. recent evidence indicates that the increase in the tdcs intensity is not related to the efficacy of stimulation and that homeostatic mechanisms could counteract the efficacy of high stimulation intensity. for tbs, one study showed in 56 healthy subjects that neither excitatory nor inhibitory tbs resulted in a change in mep sizes after stimulation and that only 25% of all subjects showed the expected responses. the lacking group - level response following different tbs protocols has now been reported from different groups (e.g., [2730 ]). for pas25, similar results with lacking increase in mep amplitudes and a response rate in 14 out of 27 subjects were shown in one study. this high response variability following standard pas protocols was confirmed in other studies with limited sample sizes [31, 32 ]. the reason most frequently discussed for not being able to induce a general change in motor - cortical excitability in the presented studies with sufficient sample sizes is the high response variability across subjects [2, 4, 5 ]. our findings deviate from the aforementioned reports. in our study, both plasticity protocols were effective on a group - level analysis and our results are in the range of the initial reports for pas and tdcs [10, 11, 17 ]. furthermore, the likelihood to develop a mep response was higher in the pas25 experiments. remarkably, only 23% responded to anodal tdcs, but 47% responded to pas using the 150% cut - off. comparing the mean mep amplitudes after stimulation, a numeric but not statistical significant difference between the pas25 and tdcs experiments could be observed. thus, it may be assumed that pas25 was more effective to increase mep amplitudes. on the other hand, furthermore, baseline icf correlated positively with an increase in mep amplitudes and mep responders had significantly higher icf baseline values compared to the nonresponders in the anodal experiment. it should be noted that a decrease in sici and an increase in icf have been reported following anodal tdcs but not following pas25 (for review see [1, 16 ]). therefore, paired - pulse measures may not be suitable as outcome parameters for pas25 but may be helpful to detect responders to anodal tdcs. in one study baseline sici correlated with the pas25 response and another study showed that the pas25 response correlated with sici measured with a threshold tracking method. differences between these studies and our work may be the timing of the paired - pulse assessment and the configuration of the conditioning pulse. our novel observation of an icf - associated efficacy of anodal tdcs may allow hypothesizing that the after - effects of anodal tdcs appear to be located in facilitatory interneuron networks and may be dependent on synaptic modulation. the reservation must be made that our design does not allow a mechanistic explanation of results due to the lack of pharmacological interventions. we aimed to identify further baseline characteristics (other paired - pulse measures, age, gender, and variability in baseline meps expressed by the standard deviation) that may predict the response to anodal tdcs or pas25, but no other factors were detected. we found a trend for a positive correlation between age and the mep changes following pas25. this is in contrast to previous reports of a negative correlation between age and the response to pas. however, our age range is outside the age range of an expected age - dependent decrease in cortical plasticity. we report the plasticity effects following nibs in a single - session design and thus can not rule out that repetitive sessions (as used in the clinical context) would have resulted in another distribution of plasticity. furthermore, we focussed on two established ltp - protocols and as it is possible to modulate various parameters using tdcs (e.g., current intensity, current density) and pas (e.g., isi, individualised pas, and target peripheral nerve) it may be possible that other configurations would have resulted in different response patterns. regarding the paired - pulse measures, the lacking assessment of a paired - pulse response curve at different time points limits the generalizability of our sici / icf discussion. furthermore, we did not readjust the test pulse intensity after the intervention in the paired - pulse paradigms. on the one hand evidence is available that the intensity of the test pulse affects the percent sici / icf, but on the other hand this is not found to be the case in the range of mep sizes presented in our experiments [36, 37 ]. the mep sizes following the test pulse of the paired - pulse paradigms were 1.04 0.31 before and 1.23 0.76 after anodal tdcs and, respectively, 1.11 0.43 before and 1.64 0.86 after pas25. further limitations are the lacking sham condition in our experiments and the fact that we did not use randomized ordered session of anodal tdcs and pas25. thus, we can not rule out that the order of sessions had an impact on our results. for pas, we used the ulnar nerve for our peripheral nerve stimulation and the fdi as target muscle. most published pas studies stimulated the median nerve and used the abductor pollicis brevis muscle as target (for review see). however, different studies reported comparable changes in meps following both ulnar and median nerve stimulation, in the context of pas protocols (for review see). one important confounding factor could be attention. in our pas experiment we asked the subjects to count the tms pulse and the reported values are within a range (179.5 1.5) [22, 23 ] indicating a sufficient level of attention in our experiments. during anodal tdcs no count of stimuli is conducted, possibly leading to different attention states compared with those in the pas setup. thus, the reported higher efficacy of pas25 could also be led back to attention rather than to physiological differences between the protocols. despite our large sample, thus, replication studies with larger sample sizes are needed to confirm some of our findings. however, in line with previous research, our sample also comprised a certain degree of nonresponders. the likelihood to be a nonresponder was dependent on the kind of stimulation protocol, on the defined thresholds and on the used target items. our new observation that subject had a higher likelihood to be a responder using the high 150% mep threshold in the pas25 protocol may be explained by the fact that this protocol was more individualised (electrical and motor thresholds) and controlled for attention compared to anodal tdcs. moreover, we were for the first time able to identify a new baseline parameter (icf at 12 ms) that may predict the response to anodal tdcs. future prospective studies need to independently confirm this parameter before it can be used as individual response predictor. it is reassuring that our response rates using the lowest threshold were much higher than those reported in other trials, but the response rates using the highest threshold are less optimistic. | interindividual response variability to various motor - cortex stimulation protocols has been recently reported. comparative data of stimulation protocols with different modes of action is lacking. we aimed to compare the efficacy and response variability of two ltp - inducing stimulation protocols in the human motor cortex : anodal transcranial direct current stimulation (a - tdcs) and paired - associative stimulation (pas25). in two experiments 30 subjects received 1ma a - tdcs and pas25. data analysis focused on motor - cortex excitability change and response defined as increase in mep applying different cut - offs. furthermore, the predictive pattern of baseline characteristics was explored. both protocols induced a significant increase in motor - cortical excitability. in the pas25 experiments the likelihood to develop a mep response was higher compared to a - tdcs, whereas for intracortical facilitation (icf) the likelihood for a response was higher in the a - tdcs experiments. baseline icf (12 ms) correlated positively with an increase in meps only following a - tdcs and responders had significantly higher icf baseline values. contrary to recent studies, we showed significant group - level efficacy following both stimulation protocols confirming older studies. however, we also observed a remarkable amount of nonresponders. our findings highlight the need to define sufficient physiological read - outs for a given plasticity protocol and to develop predictive markers for targeted stimulation. |
. different types of human cells express cl channels in the cell membrane for various physiological purposes. in the last several decades, ion channels that conduct cations, such as sodium (na), potassium (k) or calcium (ca) channels, nonetheless, cl channels are as abundant as cation channels, and they also participate in many important physiological tasks, including the maintainence of normal cellular excitability, the control of neurotransmitter release, and the transport of ions across epithelial cells, to name a few. the aim of this paper is to provide an up - to - date overview of the mechanism and the consequence of the disruption of cl channel function. we will focus on the physiology and pathophysiology of a cl channel critical for the function of skeletal muscles, the clc-1 cl channel. the extracellular concentration of cl is significantly higher than its intracellular counterpart, resulting in a negative cl equilibrium potential (ecl) that is exquisitely determined by an intracellular cl concentration. two secondary active transport systems contribute the most to the regulation of the cytoplasmic cl level. the na - k - cl cotransporter (nkcc) normally accumulates cl in the cell, whereas the k - cl co - transporter (kcc) usually transports cl out of the cell. most epithelial cells express predominantly nkcc and display an ecl positive to the resting potential [3, 4 ]. in contrast, the majority of mature neurons have an enhanced expression of kcc, and therefore manifest a quite negative ecl sometimes even more negative than the resting potential [3, 5 ]. in skeletal muscle, despite the presence of both nkcc and kcc, the contribution of secondary active transporters to ecl is rather small, mainly due to the presence of an extraordinarily high cl permeability that is virtually impossible to be counteracted by active transporters [69 ]. the ecl in skeletal muscle is thus mainly set by passive electrochemical equilibrium of cl according to the resting membrane potential which is primarily determined by k equilibrium potential (ek). recent evidence, however, supports the idea that the secondary active transporter nkcc may modulate the membrane potential of skeletal muscle via its cl import function [1012 ]. indeed, the muscle resting potential is never the same as the value of ek while the ecl has been shown to be slightly more positive than the resting membrane potential. furthermore, the value of the intracellular cl activity has been shown to be slightly higher than would be expected for a passive cl distribution. these observations underscore the contribution of the chloride conductance in determining the resting membrane potential of skeletal muscles. because of a large membrane cl conductance, up to 80% of the resting sarcolemmal conductance [1416 ], a relatively negative ecl explains the physiological role of cl channels in the cell membrane of skeletal muscles (sarcolemma). for example, activation of cl channels is essential for ensuring the electrical stability of skeletal muscle by resetting its membrane excitability to the resting state after firing an action potential. furthermore, a significant cl conductance is also located in the transverse - tubule system [15, 1719 ], indicating that the presence of an effective cl homeostasis system is crucial for the generation and propagation of action potential in both the sarcolemmal and the transverse - tubule system. finally, emerging evidence suggests that disruptions of the balance of ion channel functions in sarcolemma may contribute to skeletal muscle fatigue [1921 ]. during intensive firing of muscle action potentials, k ions tend to accumulate in the extracellular space up to 10 mm as the extracellular volume of skeletal muscles is limited. the increase of extracellular k concentration results in depolarization of membrane potential, and, consequently, a partial inactivation of voltage - gated na channels. if the na channels that remain active fail to generate a sufficient na inward current to overcome the shunting currents mediated by the resting sarcolemmal cl conductance, the firing of action potential is not possible, thereby leading to muscle fatigue. although various types of cl channels are expressed in skeletal muscles, the most abundant cl channel in the sarcolemma is clc-1 [4, 22 ], which is a member of the clc - channel / transporter family. the mammalian clc family consists of nine members : clc-1, clc-2, clc-3, clc-4, clc-5, clc-6, clc-7, clc - ka, and clc - kb [2224 ]. among these members, clc-1, clc-2, clc - ka, and clc - kb are cl channels, predominantly residing in the plasma membrane. the rest of the clc members (clc-3 to clc-7) are thought to be transporters, mostly located in intracellular organelles. like bacterial clc proteins, these mammalian clc transporters are thought to mediate the counter transport of h and cl ; that is, they are cl / h antiporters [26, 27 ]. among the four plasma membrane clc - channels, clc - ka and clc - kb channels are involved in transepithelial transport in the kidney and the inner ear [4, 28 ]. clc-2 channels can be activated by hyperpolarization, cell swelling, and extracellular acidification [29, 30 ]. northern analysis indicates that brain, kidney, and intestine express relatively high levels of clc-2 channels, although these channel are broadly expressed in various tissues as well. in contrast, clc-1 channels are most abundantly expressed in the skeletal muscle. a very low level of clc-1 expression, however, has been reported in kidney, heart, smooth muscle, and, more recently, glial cells [32, 33 ]. since the clc-1 channel is the major sarcolemmal cl conductance, mutations of the gene encoding this cl channel lead to a significant muscle hyperexcitability in humans, mice, and other animals [3438 ], a situation known as therefore, this disease can be caused either by the gain of function of na channels or a loss of function of cl channels in the sarcolemma of skeletal muscles. in the following sections we will focus on the defect of clc-1, starting with the clc-1 's molecular properties. clc-1 is a voltage - gated channel, and the open probability of clc-1 channels increases with membrane depolarization. the functional study of clc-1 at the single - channel level is challenging due to the small single - channel conductance of this channel. therefore, many functional properties of clc-1 are inferred from those found in its fish homologue, the torpedo clc-0 cl channel. one unique functional feature in clc - channels is that the channel opens to two current levels separated by equidistance in the single - channel recording trace (figure 1). double - barreled channel opening, first found in clc-0 in early 1980s [40, 41 ]. later single - channel recordings confirmed that the opening of clc-1 channels also fluctuates between three different conductance levels (figure 1(a)), corresponding to the three functional states : two pores closed ; one open and one closed ; and, finally, both pores open. these functional recordings of clc-0 and clc-1 channels foretold the recent structural findings from bacterial clc proteins in which two identical cl - transport pathways were found in one clc functional unit [43, 44 ]. the opening and closure of the two pores in clc-0 and clc-1 channels are controlled by two distinct gating mechanisms. one of these gating mechanisms controls the opening and closure of two pores simultaneously, and is therefore called common gate. in addition, each pore is also controlled by a fast gate that operates independently from the partner fast - gate. thus, the activation of the cl conducting pathway of clc-1 channels requires the opening of both the common gate and the fast gate. the open - close transition of the fast gate operates at a time scale of milliseconds at negative membrane potentials. at the peak of the action potential, thus, the opening of clc-1 's fast - gate can counteract the depolarization generated by the opening of na channels during an action potential. this gating mechanism is thus important for clc-1 channels to control the action potential in skeletal muscles. mutations that reverse the voltage dependence of clc-1 channels result in certain forms of myotonia (see below) because these mutant channels are unable to open after membrane depolarization. in addition to the control by membrane potentials, the fast - gating is also regulated by cl and h [46, 47 ]. the regulation of clc-1 and clc-0 channels by cl and h is thought to bear an evolutional relationship to the cl / h counter transport function of their clc transporter counterparts, although the exact link between the channel - gating mechanism and the cl / h - antiporter mechanism is not known. interestingly, a recent crystallographic study of a prokaryotic clc protein provided a potential mechanism for the exchange stoichiometry of 2 cl for 1 h. the voltage dependence of the fast gating is similar to that found in voltage - gated cation channels ; namely, the open probability (po) is higher at more depolarized membrane potentials [40, 41, 45, 50, 51 ]. the voltage - dependent activation of the fast gate of clc-0 and clc-1 is likely to arise from the coupling of cl transport with the gating process [45, 46, 53 ]. this gating - permeation coupling mechanism was first proposed by pusch and his colleague, who demonstrated that the po - v curve of the fast gating of clc-0 channels was shifted toward a more depolarized membrane potential by reducing the extracellular cl concentration. at a constant voltage, therefore, reducing the extracellular cl concentration inhibits the opening of the fast gate. more detailed experiments at the single - channel level (figure 1(b)) further showed that extracellular cl increases the open probability of the fast - gate by increasing the opening rate of the fast gate. later experiments also revealed the same dependent fast gating mechanism for clc-1 channels. to explain this gating effect, investigators have proposed a model in which the binding of cl to the channel pore opens the fast gate and the movement of cl across membrane electric field constitutes the fundamental mechanism for the observed voltage dependence. later structural information from crystallographic studies of bacterial clc proteins revealed that the transport pathway of clc molecules appear to be obstructed by the negatively charged side chain of a glutamate residue, and cl in the pore may compete with this glutamate side chain [43, 44 ]. the gene of the human clc-1 channel encodes a transmembrane protein consisting of 991 amino acids (aa). the protein can be roughly divided into two parts, the amino (n)-terminal transmembrane portion (up to ~590 aa.) and the carboxyl (c)-terminal cytoplasmic portion (figure 2). although the molecular structure of clc-1 has not been solved, recent breakthroughs in obtaining the crystal structure of bacteria clc proteins [43, 44 ] and the crystal structures of the c - terminal cytoplasmic domain of several vertebrate clc molecules, such as clc-0, clc-5 and clc - k, have provided insightful structural information for other homologous clc molecules. the clc protein from e. coli (clc - ec1) consists of only 460 aa, which form a structure corresponding to the n - terminal transmembrane portion of clc-1 (figure 2(a), upper panel). this part of the channel protein is composed of eighteen -helices (helices 1 to 18, or helices a to r), seventeen of which being membrane associated (helix a is not inserted into the membrane). moreover, many of these helices do not span the entire width of the lipid membrane (figure 2(a), upper panel). the most interesting feature of the transmembrane portion of clc molecules is that a glutamate residue located at the beginning of helix n (helix 14) protrudes its negatively charged side chain into the cl - permeation pathway (figure 2(a), red residues in the upper panel). with the glutamate side chain blocking the cl - permeation pore, cl permeation is not possible. mutation of this glutamate residue to a neutral amino acid in clc - channels results in channels that appear to have a fully open pore. the side chain of this glutamate residue is therefore thought to be the gate that controls each individual protopore. it is also thought that the competition of cl with this glutamate side - chain may underlie the aforementioned gating permeation mechanism thoroughly characterized for clc-0 and clc-1 channels [23, 5759 ]. the c - terminal half of clc-1 (from aa 591 to the c - terminus) is believed to be entirely located in the cytoplasmic side of the membrane (figure 2(a), lower panel). this structure of the c - terminal cytoplasmic domain was initially solved in several mammalian clc molecules independent of the transmembrane domain. a most recent crystallographic study revealed the structure of cmclc, a clc protein from thermophilic alga that consists of a transmembrane region and a c - terminal cytoplasmic domain. the transmembrane and cytoplasmic domains of the cmclc structure are similar to those solved previously in other clc proteins, including the extensive helical architecture in the transmembrane region and the characteristic cystathionine -synthase (cbs) domains in the cytoplasmic region (figure 2(b)). thus, it is very likely that the c - terminal cytoplasmic domain of clc-1, like those in other mammalian clc molecules, also contains two tandem cbs domains that are folded into a potential atp - binding site. it has been shown that cytoplasmic atp can inhibit the current of clc-1 channels in acidic ph conditions [6062 ], and the crystal structure of the c - terminal region of the clc-5 protein revealed an atp molecule bound to the predicted atp - binding site formed by the two tandem cbs domains (figure 2(a), lower panel). the inhibition of clc-1 channels by atp is therefore thought to be due to a direct atp binding to the c - terminus of protonated clc-1 channels. experimental evidence shows that the effect of intracellular atp is to make the opening of the common gate more difficult. the mechanism of common gating of clc - channels is not clear, but it has been proposed that this gating mechanism may involve the relative motion of the two channel subunits, including the movement of the c - terminal cytoplasmic domain. the inhibition of the common gating by cytoplasmic atp is consistent with the structural feature that the atp - binding site is located in the c - terminal cytoplasmic region of clc-1 channels. during vigorous muscle activities, atp level in fast - twitch muscle fibers is significantly lowered, which in turn reduces atp inhibition of clc-1 channels. this enhanced activation of clc-1 channels is expected to decrease muscle excitability, a potential cell protection mechanism during metabolic stress that may contribute to the development of muscle fatigue. as discussed above, muscle fatigue may also be caused by partial na channel inactivation as a result of the accumulation of extracellular k ions after multiple action potentials. moreover, intensive exercise leads to muscle acidosis [66, 67 ], which in the presence of atp, may result in clc-1 channel inhibition. this down regulation of membrane cl conductance will notably reduce the input conductance of sarcolemma and consequently increase the likelihood of spike induction for the na channels that remain active, and may therefore serve as a physiological response to prevent the development of muscle fatigue. in humans, mutations in the skeletal muscle clc-1 gene (clcn1) on chromosome 7 have been linked to a hereditary muscle disease, myotonia congenita. myotonia can be defined as a hyperexcitability of the plasma membrane of skeletal muscle fibers. myotonia is due to an electrical instability of the muscle membrane itself, leading to repetitive action potentials with a single stimulus (myotonic runs). myotonia congenita was one of the first human diseases proven to be caused by an ion - channel defect (channelopathy). this discovery was based on studies in goats with hereditary myotonia that closely resembled myotonia congenita in humans [6971 ]. subsequent studies also demonstrated that there was indeed a reduced cl conductance in goat and human myotonic muscle fibers and that normal muscle fibers exhibited myotonic features when cl was replaced with an impermeant anion [14, 72 ]. this myotonia - like phenomenon induced by low concentrations of cl can be accounted for by the aforementioned cl - dependent gating mechanism for clc-1 channels. human myotonia congenita can be inherited in an autosomal recessive (becker type) or autosomal dominant (thomsen type) manner. by now, more than 100 different mutations in the clcn1 gene have been identified in patients with myotonia congenita [7476 ]. myotonia - causing mutations are scattered over the entire sequence of the channel protein, both in the transmembrane region and in the cytosolic n - terminal and c - terminal parts. they include nonsense, splice - site, and frameshift mutations that truncate the channel protein. truncation mutations are always associated with recessive myotonia, except when they are very close to the c - terminus. mutations with dominant inheritance are less frequent. with the exception of truncations very close to the c - terminus of clc-1 channels, all dominant mutations are missense mutations. recessive mutations are more diverse ; they can be associated with truncations, insertions, splice defects, missense, or nonsense / stop errors. therefore, it is not possible to predict on the basis of the mutation location or the mutation type whether the inheritance will be dominant or recessive. for the autosomal dominant form of myotonia, patients are expected to carry the heterozygous clcn1 genotype : one copy each of the wild - type and the mutant allele. regarding the molecular mechanism of myotonia congenita, a loss - of - function phenotype of the mutant clcn1 gene certainly supports haploinsufficiency as a reasonable mechanism causing the malfunction of muscles. for many other cases of disease - related mutations, however, a total loss of functional clc-1 channels on only one allele does not lead to myotonia [32, 36 ]. it has been suggested that dominant myotonia is due to dominant - negative effects of the mutant subunit on the wild - type subunit coexpressed in the muscles of heterozygous patients. on the other hand, lots of clcn1 gene mutations result in recessive myotonia, and the mutant proteins do not have dominant negative effects. a likely reason for a lack of dominant negative effects for these recessive mutants is the inability of truncated proteins to associate with the wild - type subunit. therefore, a current working hypothesis on the molecular basis for the inheritance of myotonia congenita is that the inheritance pattern of a mutation is predominantly determined by the functional consequence of the mutation on the gating of clc-1 channels : those mutations that affect the common gate lead to an autosomal - dominant inheritance pattern, whereas those affecting individual protopores only result in a recessive pattern [42, 77 ]. as described above, a functional clc-1 channel is a homo - dimer. with the exception of truncations very close to the c - terminus of clc-1 channels, almost all these mutations shift the voltage - dependence of gating of the channel towards positive voltages so that the activity of the mutant channels is insufficient to cause membrane repolarization. the dominant - negative effect of these mutations on the hetero - dimeric channel is due to the fact that the common - gate controlling both protopores is affected by the mutation in the mutant subunit. indeed, many, but not all, mutations in dominant myotonia are due to mutations of residues close to the subunit interface [74, 75, 78 ]. consistent with this observation, site - directed mutagenesis of residues lining subunit interface affects the common gate of clc-1 [79, 80 ]. on the other hand, as the ion - conducting pore of clc-1 is entirely contained within each subunit of the dimer [43, 81 ], mutations affecting the function of one protopore are unlikely to affect the conductance of the second subunit in wild - type / mutant hetero dimeric channels and therefore will generally lack dominantnegative effects. for example, the equivalent residue of clc-1 's m485 in bacterial clc proteins is located in the ion - transport pathway. in heterologous expression systems, the mutation m485 v in clc-1 drastically changed the single - channel conductance and the voltage - dependent gating of homodimeric mutant clc-1 channels. as both alleles are mutated in patients with recessive myotonia, a total loss of clc-1 channel function may ensue. in contrast, by assuming equal association affinity for both wild - type and mutant subunits in the dimeric channel architecture, at least 25% of wild - type currents will still remain in heterozygous patients carrying dominant - negative mutations. accordingly, recessive myotonia is clinically more severe than the dominant thomsen form. in addition to faulty channel gating, other mechanisms may also contribute to the pathophysiology of myotonia congenita. for example, several recessive clcn1 mutations (e.g., y150c, v165 g, f167l, v236l, y261c, v327i, and f413c) have been shown to yield functional clc-1 channels with biophysical properties either only slightly different or virtually indistinguishable from those of wild - type channels. similarly, some dominant clcn1 mutations (e.g., r338q, f428s, and t550 m) have been shown to display no detectable gating defects upon forming heterodimers with their wild - type counterparts [84, 85 ]. by no means these examples clearly demonstrate that the effect of myotonia - related mutations can not be simply attributed to the disruption of the gating of clc-1 channels. several novel mutations in the clcn1 gene have recently been identified in taiwanese patients suffering from myotonia congenita [86, 87 ]. interestingly, one of the detected mutations, fs793x, was found in a taiwanese family with dominant inheritance pattern this is only one of the several examples showing that the same mutations are associated with recessive myotonia in some families, but with dominant myotonia in others [77, 89, 90 ]. this dual inheritance pattern again demonstrates the inadequacy of the gating hypothesis and further highlights the importance of other pathophysiological mechanisms of myotonia congenita. it is likely that some myotonia congenita - related mutations may (i) result in aberrant biogenesis and subunit assembly and/or (ii) lead to a defective membrane targeting subcellular localization patterns of clc-1 channels. indeed, three myotonia - related mutations in the distal c - terminus of clc-1 channels have been shown to have a reduction of protein expression in the surface membrane. thus, the underlying mechanisms of myotonia due to clc-1 channelopathy are likely to be quite diverse. myotonia is characterized by the impaired relaxation of skeletal muscle following sudden voluntary contraction. as discussed above, clc-1 conductance contributes up to 80% of the resting membrane conductance in normal skeletal muscle. myotonia - causing mutations in the clcn1 gene therefore lead to a significant reduction in resting membrane conductance, thereby increasing the input resistance of skeletal muscle [72, 91 ]. consequently, a smaller membrane depolarization (threshold potential) will be sufficient to trigger an action potential, that is, muscle excitability will be enhanced. this scenario explains why a single nerve stimulus elicited a train of action potentials in muscle fibers from myotonic goats ; in contrast, the same stimulus only induced a single action potential in normal muscle fibers. another important role of clc-1 conductance in muscle is to counteract the depolarizing effect of tubular k accumulation during intensive firing of action potentials. as the extracellular volume in the transverse - tubule system of skeletal muscles is limited, k ions tend to accumulate in the extracellular space during intensive firing of muscle action potentials. this increase in extracellular k normally has little effect on the membrane potential due to the presence of high clc-1 conductance. in myotonic muscle, however, a small accumulation of tubular k will result in a significant membrane depolarization. in the presence of rapid successions of action potentials, summation of these k accumulation - induced membrane depolarization may trigger spontaneous muscle action potentials, thereby manifesting myotonia symptoms such as muscle stiffness after voluntary contraction. hence, the medication of choice for myotonic patients usually involves drugs that suppress muscle excitability via inhibition of voltage - gated na channels. the muscle stiffness of myotonia can gradually be relieved by exercise (the so - called warm - up phenomenon). one plausible mechanism of the warm - up is the enhanced activity of the muscle na / k - atpase induced by exercise, which facilitates the clearance of extracellular k from transverse - tubules. a recent study in myotonic patients, however, failed to support this hypothesis, indicating that the precise mechanism of warm - up is still unclear. also elusive for example, the recessive myotonia is usually more common in men than in women, and for female patients of dominant myotonia, the symptoms become worse during pregnancy. it has been suggested that the observed gender difference may arise from the modulation of clc-1 channel function by sex hormones. in addition, recessive but not dominant myotonia is often associated with transient muscle weakness on the initiation of movement [75, 96 ], a defect that is not predicted by enhanced muscle excitability. obviously, a combination of biophysical and cell biological studies in both in vitro and in vivo models will be required for better understanding of the clinical symptoms of myotonia congenita. clc-1 channels play a crucial role in setting membrane excitability in skeletal muscle. despite of the numerous documentations of the association between clcn1 mutations and myotonia congenita, elucidation of the mechanistic link between genetic defects and pathogenesis is still at the primitive stage. one major limitation to our better understanding of this issue lies in the fact that protein biosynthetic pathways as well as subcellular localization patterns of clc-1 channels in situ remain obscure. for example, even though a significant cl conductance has been identified in the transverse - tubule system, it remains inconclusive whether clc-1 channels are actually expressed in the transverse - tubule system. in the adr (arrested development of righting response) mouse that has been used as a model for recessive myotonia [34, 69 ], immuonhistochemistry of muscle cryosection located clc-1 channels primarily in the outer, sarcolemmal membrane, but not in the transverse - tubule of skeletal muscle. a similar conclusion on sarcolemmal localization of clc-1 channels was recently reported in flexor digitorum brevis muscle fibers of wild - type mice as well. biophysical and pharmacological studies in a skinned rat skeletal muscle, however, demonstrated that the transverse - tubule cl channel conductance was blocked by 9-ac, low intracellular ph, and protein kinase c activators [18, 19, 96 ], all of which are known to affect the properties of clc-1 channels observed in the heterologous expression system [32, 60, 61, 99 ]. as has been previously proposed [19, 100 ], this apparent discrepancy may arise from the possibility that the transverse - tubule system expresses certain splice variants of clc-1 channels that lack the epitope for the antibody used in the immunofluorescence study, or that the surrounding microenvironment in the transverse - tubule system prevents the antibody from properly recognizing the epitope in clc-1 channels in situ. the field thus requires more extensive studies on not only the gating mechanisms but also the biosynthetic process and subcellular localization of clc-1 channels. myotonia congenita, therefore, is still in lack of a standard, effective treatment. the field thus begs for further research efforts in multiple directions. at the molecular level, the mechanistic principles underlying the operation of clc-1 need to be further examined. at the cellular level, the protein biosynthesis mechanisms of clc-1 (protein biogenesis, membrane trafficking, as well as subcellular localization patterns in situ), although drawing much research attention recently, remain obscure and need more in - depth investigations. at the clinical level, many myotonia - associated symptoms require better understanding of their pathophysiological mechanisms. through elucidations of the physiological roles of clc-1 and the pathophysiological mechanisms of the clc-1 channelopathy, the therapeutic strategies for myotonia congenita will eventually be illuminated. | the clc-1 chloride channel, a member of the clc - channel / transporter family, plays important roles for the physiological functions of skeletal muscles. the opening of this chloride channel is voltage dependent and is also regulated by protons and chloride ions. mutations of the gene encoding clc-1 result in a genetic disease, myotonia congenita, which can be inherited as an autosmal dominant (thomsen type) or an autosomal recessive (becker type) pattern. these mutations are scattered throughout the entire protein sequence, and no clear relationship exists between the inheritance pattern of the mutation and the location of the mutation in the channel protein. the inheritance pattern of some but not all myotonia mutants can be explained by a working hypothesis that these mutations may exert a dominant negative effect on the gating function of the channel. however, other mutations may be due to different pathophysiological mechanisms, such as the defect of protein trafficking to membranes. thus, the underlying mechanisms of myotonia are likely to be quite diverse, and elucidating the pathophysiology of myotonia mutations will require the understanding of multiple molecular / cellular mechanisms of clc-1 channels in skeletal muscles, including molecular operation, protein synthesis, and membrane trafficking mechanisms. |
decompressive craniectomy, which is performed worldwide for the treatment of severe traumatic brain injury (tbi), is a surgical procedure in which part of the skull is removed to allow the brain to swell without being squeezed.1 although there is still controversy about the efficacy of the procedure in improving patient outcome, it is still widely used as a last resort in those patients with uncontrollable intracranial pressure (icp). several retrospective and prospective studies have suggested the efficacy of decompressive craniectomy in decreasing icp and improving prognosis in patients with refractory intracranial hypertension after tbi.2 - 8 presently, the european brain injury consortium and brain trauma foundation guidelines for severe tbis refers to decompressive craniectomy as a second - tier therapy for refractory intracranial hypertension that does not respond to conventional therapeutic measures.9, 10 to further determine the risks and benefits of this procedure and to define the role of decompressive craniectomy in the management of patients with severe tbi, several prospective randomized trials are underway. as early as 1901, kocher was the first surgeon to promote surgical decompression in post - traumatic brain swelling.11 there are currently various decompressive craniectomy methods and technical improvements that have progressed the treatment of tbi. in this article, the technical changes in decompressive craniectomy in the treatment of severe tbi are reviewed. different methods of decompressive craniectomy have been developed for, or applied to, decompression of the brain at risk for the sequelae of traumatically elevated icp. these include subtemporal decompression,12 - 14 circular decompression,15 fronto- or temporoparietal decompressive craniectomy,8, 16 large fronto - temporoparietal decompressive craniectomy, hemisphere craniectomy, and bifrontal decompressive craniectomy.7 - 10, 17 circular decompression was introduced decades ago. however, for patients who develop refractory intracranial hypertension, it is unable to take effect, because of the limited space.15 the procedure of subtemporal craniectomy, which was introduced by cushing,11 involves removing the part of the skull beneath the temporal muscle by opening the dura. this was an important surgical method for the treatment of severe tbi with refractory intracranial hypertension for a time, and was shown to produce good results by some investigators.12 - 14 although it is still used in many centers, similar to circular decompression, the area of the skull removed is small and the room that it can provide for the expansion of the brain is restricted ; furthermore, this procedure may lead to temporal lobe herniation and necrosis.18 a study performed by alexander. demonstrated that the calculated additional space provided by subtemporal decompression ranged from 26 to 33 cm.12 generally, this space is inadequate when a patient develops diffuse cerebral swelling. by removing part of the skull, decompressive craniectomy seeks to prevent herniation and to reconstruct cerebral blood perfusion to improve patient outcome. the decompressive effect depends primarily on the size of the part of the skull removed. a small craniectomy may be helpful for preventing herniation ; however, considering its limited effect on refractory intracranial hypertension, the aim of reconstructing cerebral blood perfusion is almost impossible. at present, the more widely used methods are large unilateral fronto - temporoparietal craniectomy / hemisphere craniectomy for lesions or swelling confined to one cerebral hemisphere, and bifrontal craniectomy from the floor of the anterior cranial fossa to the coronal suture to the pterion for diffuse swelling. munch. found that large fronto - temporoparietal craniectomy could provide as much as 92.6 cm additional space (median, 73.6 cm).14 large decompressive craniectomies, including fronto - temporoparietal / hemisphere craniectomy and bifrontal craniectomy, seemed to lead to better outcomes in patients with severe tbi compared with other varieties of surgical decompression in previous literature.7, 8, 18 the most direct proof was provided by jiang : a prospective, randomized, multi - center trial suggested that large fronto - temporoparietal decompressive craniectomy (standard trauma craniectomy) significantly improved the outcome in severe tbi patients with refractory intracranial hypertension, compared with routine temporoparietal craniectomy, and had a better effect in terms of decreasing icp.8 consequently, large decompressive craniectomy has been recommended by most authors, and prospective studies that are underway to further determine the role of surgical decompression in the management of tbi have adopted it as a standard procedure. decompressive craniectomy is sometimes combined with a simultaneous lobectomy.19, 20 in our opinion, this should be performed with caution because excessive excavation of brain tissue may lead to poor results, though the icp could be reduced rapidly.19 normally, decompressive craniectomy is performed together with dura opening, and it was believed that this could maximize brain expansion after removal of part of the skull. however, opening the dura with no protection for the underlying brain tissue may increase the risk of several secondary surgical complications, such as brain herniation through the craniectomy defect,21, 22 epilepsy,23, 24 intracranial infection,4 and cerebrospinal fluid (csf) leakage through the scalp incision16 or contralateral intracranial lesion.25 currently, decompressive craniectomy combined with augmentative duraplasty is widely performed and is recommended by most authors.11, 26 the temporary removal of a piece of skull followed by loose closure of the dura and skin layers presumably allows for expansion of the edematous brain into a durotomy bag under the loosely closed scalp without restriction by the hard skull ; the dura would also protect the underlying brain tissue with prevention from over - cephalocele. yang. found that the patients who underwent decompressive craniectomy combined with initially augmentative duraplasty had better outcomes and lower incidences of secondary surgical complications (such as hydrocephalus, subdural effusion, and epilepsy) compared with those who only underwent surgical decompression, leaving the dura open.16 at present, large decompressive craniectomy combined with enlargement of the dura by duraplasty is used by most research groups and seems to have the most favorable results. several prospective studies have agreed that the procedure of decompressive craniectomy with simultaneous augmentative duraplasty would also be able to control refractory intracranial hypertension and play a beneficial role in patients with severe tbi. coplin. performed a prospective trial on the feasibility of craniectomy with duraplasty versus traditional craniotomy as a control group in patients who developed brain swelling, and found that despite more severe head trauma, the patients in the study group had similar outcomes to the control group.27 ruf. performed decompressive craniectomy and simultaneous dural augmentation with duraplasty in six children whose elevated icps could not be controlled with maximally intensified conservative therapies. subsequently, the icp normalized, with improved outcomes after the procedure.4 figaji. reported prospective studies on 12 patients who had undergone decompressive craniectomy with augmentative duraplasty. in this case series, the mean icp reduction was 53.3% and clinical improvement as well as reversion of radiographic data was attained in most patients (11/12) ; all 11 survivors had good outcomes (gos 4 or 5).28 additionally, several other pathological indices improved after this combined procedure, including cerebral blood perfusion and cerebral oxygen supply.29, 30 these results showed that large decompressive craniectomy combined with augmentative duraplasty has favorable decompressive effects in the treatment of traumatic refractory intracranial hypertension compared with surgical decompression with dura opening. however, no well - planned study has compared the two methods, and in many centers, decompressive craniectomy with complete dura opening is still performed routinely. technical improvements have been made to this surgical procedure. as mentioned above, whether it is combined with augmentative duraplasty or dura opening, decompressive craniectomy is recommended to be performed as a large craniectomy for severe tbi, including large fronto - temporoparietal / hemisphere craniectomy and bifrontal craniectomy.5, 8, 10, 17 in decompressive craniectomy, preserving the inferior temporal lobe venous return requires that the craniectomy comes down to the floor of the middle cranial fossa, at the root of the zygoma ; this ensures adequate lateral decompression of the temporal lobe, allowing it to fall out of its usual calvarial boundaries. moreover, the following discussion about technical improvements is based on the procedure of large decompressive craniectomy. two main methods are used for dural augmentation with duraplasty : the dura is enlarged with the patient 's own tissue, such as temporal fascia, temporal muscle, or galea aponeurotica,16, 18, 31 or this is performed with artificial or xenogeneic tissue, such as artificial dura substitute or bovine pericardium.27, 28 in our institute, dural augmentation was performed with temporal fascia or artificial meninges. the method using temporal fascia is similar to the one introduced by yu.32 they separated the temporal deep fascia from the temporal muscle to the zygomatic arch, and then cut the fascia from the base backwards along the zygoma but left the fascia base 1 - 2 cm long for the blood supply. finally, they turned the temporal fascia beneath the temporal muscle and sutured it to the dura. generally, temporal deep fascia is large enough for the enlargement of dura in during decompressive craniectomy, and forms a pedicle of temporal fascia that maintains the blood supply. brain herniation via the craniectomy defect may lead to compression of vessels and result in ischemic necrosis of the portion of the herniated brain. coskay. introduced an interesting method called the vascular tunnel to avoid this complication.33 following removal of part of the skull, they performed dural incisions in a stellate fashion. in this step, it is important that entrance points of major vessels are close to the midpoint between the angles of the dural opening. the most significant step involves constructing small supporting pillars on the bilateral sides of the vessels as they pass the edge of the dural window (the pillars were made of hemostastic sponge wrapped by absorbable thread), and then the superficial vessels supporting the portion of brain run in the artificial vascular tunnel between the brain tissue and dura., they performed this new technique with decompressive craniectomy in 21 patients, and the vascular tunnel method seemed to improve patient outcome compared with a control group consisting of 20 patients who underwent ordinary large decompressive craniectomy.34 another method, lattice duraplasty, was also introduced by mitchell.35 to avoid herniation of the brain through the cranial defect. after conventional craniotomy, they made a series of dural incisions, each 2 cm long and with 1-cm intervals. the process was repeated in parallel rows of incisions so that each incision in one row was adjacent to an intact dural bridge in the rows on either side. the same course was then performed, but in a direction vertical to the initial incision. this method was believed to be able to increase the tractility of the dura and to allow it to stretch and expand. they performed decompressive craniectomy combined with this technical improvement in six patients, and found that icp was reduced, by 20 - 30 mmhg. after decompressive craniectomy, patients are typically without a cranial flap for several months before cranioplasty, which places them at theoretical risk of injury to the unprotected brain. moreover, with the skin flap concavity, the hydrodynamic disturbance of csf circulation and the decrease in cortical perfusion after decompressive craniectomy may also hinder patient recovery.36 - 37 a method called the tucci flap was suggested by claudia. to resolve this problem.39 after craniotomy, removal of the intracranial lesion, and duraplasty, the bone flap was replaced and one side of the flap was attached to the cranium by plates. the plates act as a hinge that allows the unattached portion of the bone flap to float out with bone swelling. a similar technique was introduced by kathryn., but was called an in situ hinge craniectomy.40 their series consisted of 16 patients, and icp was controlled to normal levels in all patients with this method, sometimes combined with csf drainage, and no severe surgical complication occurred. obviously, except for the prevention of potential injury after surgical decompression as mentioned above, this variation of the traditional decompressive craniectomy eliminates the need for a second major cranioplasty, or at least facilitates the process of cranioplasty. in consecutive procedures, most of the patients could undergo cranioplasty under local anesthesia. however, the replaced bone flap would account for a certain amount of space, and the efficacy of decompression would thus be weakened. introduced a method to prevent peridural fibrosis after decompressive craniectomy.41 for the survivors of decompressive craniectomy, development of multiple adhesions among the dura, temporal muscle, and galea would be a problem during subsequent cranioplasty, and would also be a potentially deleterious factor for patient recovery. to prevent adhesions, the authors placed a dural substitute between the dural anasynthesis flap and galea aponeurotica after augmentative duraplasty with temporal muscle. they performed this method in 23 patients who underwent decompressive craniectomy. compared with a control group consisting of 29 patients who underwent ordinary large decompressive craniectomy, they found that cranioplasty in the patients in their study group was easier, lacked severe secondary complications, required a shorter cranioplasty operating time, and resulted in less intraoperative blood loss. to increase the space of decompressive craniectomy, zhang. suggested a method of surgical decompression combined with removal of part of the temporal muscle.42 they resected the temporal muscle above the inferior edge of the bone window formed by the craniectomy. on average, additional space, as large as 26.5 cm, was obtained. in their retrospective series, the patients who underwent surgical decompression combined with removal of part of the temporal muscle seemed to have a lower mortality than those who underwent ordinary large decompressive craniectomy. the effect of bifrontal decompressive craniectomy with preservation or removal of the bone above the superior sagittal sinus is still undetermined,3, 17, 43, 44 though it seems that the procedure combined with removal of this bone is being accepted by more institutes. to increase the decompressive effect, simultaneous division of the falx at the floor of the anterior cranial fossa has also been recommended by some authors.3 moreover, except for the technical considerations of this operation, timely decompressive craniectomy before the development of irreversible changes in the injured brain would be equally important for patient outcome.4, 45 - 48 with the exception of icp and clinical signs, ptio2 monitoring may be another important tool when a timely craniectomy is indicated.49, 50 several types of decompressive craniectomy have been performed for the management of traumatic refractory intracranial hypertension, and the variations in results between studies may be explained by the different methods of surgical decompression. presently, unilateral fronto - temporoparietal craniectomy / hemisphere craniectomy for lesions or swelling confined to one cerebral hemisphere, and bifrontal craniectomy for diffuse swelling, are recommended for the management of traumatic refractory intracranial hypertension. different technical improvements in decompressive craniectomy, based on large decompression, have been introduced to increase the decompressive effect, avoid surgical complications, and facilitate subsequent operations and management. although all of these methods are tentative and experiential, and in most reports the involved patient populations are small, these experiences are valuable. at present, in the absence of definite proof of the efficacy of decompressive craniectomy in the treatment of tbi, such as from multicenter, prospective, randomized, controlled trials, these technical improvements to increase the decompressive effect or avoid potential surgical complications should be considered. | refractory intracranial hypertension is a leading cause of poor neurological outcomes in patients with severe traumatic brain injury. decompressive craniectomy has been used in the management of refractory intracranial hypertension for about a century, and is presently one of the most important methods for its control. however, there is still a lack of conclusive evidence for its efficacy in terms of patient outcome. in this article, we focus on the technical aspects of decompressive craniectomy and review different methods for this procedure. moreover, we review technical improvements in large decompressive craniectomy, which is currently recommended by most authors and is aimed at increasing the decompressive effect, avoiding surgical complications, and facilitating subsequent management. at present, in the absence of prospective randomized controlled trials to prove the role of decompressive craniectomy in the treatment of traumatic brain injury, these technical improvements are valuable. |
marathon running became a mass fitness phenomenon in the 1980s.1 recent studies reported that master runners increased participation and improved performance in flat city marathon running, such as in the new york city marathon.2,3 master runners were defined as athletes typically older than 35 years of age and systematically training for and competing in organized forms of sport specifically designed for older adults.4 an age - related decrease in the number of finishers in master sports has been reported.5 however, the community of master runners is still growing quickly in marathons;3 conversely, the number of younger participants increased at a lower rate.2 older master athletes are able to achieve exceptional performances. for example, the canadian marathoner ed whitlock achieved, at the age of 80 years, a marathon race time of 3 hours, 15 minutes, and 54 seconds at the toronto marathon held in 2011.6 in 2009, an 86-year - old man became a double champion in the european championship for road running. he won the 10 km road run with a time of 58 minutes and 1 second, setting a new european record for men aged 85 years and older. two days later, he became a european champion in the same age group for the half - marathon, with a time of 2 hours and 17 minutes.7 several studies investigated participation and performance trends in master ultramarathoners where participation increased and performance improved.8,9 in marathon running, a few studies focused on the number of finishers and the performance in master marathoners competing in flat city marathons.2,3,10 the number of finishers in master runners increased at a higher rate than the number of younger marathoners,3 and their performances improved over time.2,3 lepers and cattagni3 showed an increase in performance for men older than 64 years and for women older than 44 years, competing between 1980 and 2009 in the new york city marathon. participation and performance trends for master runners in a city marathon, such as the new york city marathon, have been investigated,2,3 but are not known for master runners competing in a mountain marathon. apart from city marathon running,11 mountain marathon running is increasing in popularity.12 we intended to investigate whether the number and the performance of master runners would be similar in a mountain marathon when compared to a flat city marathon. because of the selection bias (ie, starting places not being freely available for everyone in some of the major marathons, such as the new york city marathon), we intended to compare a mountain marathon (jungfrau marathon) with a flat city marathon (lausanne marathon) with no limitation on the number of starters, and which were held in the same country (switzerland) between 2000 and 2011, regarding changes in participation and performance trends in master runners. we hypothesized for both races that : (1) the number of master runners would increase ; and (2) the performance of master runners would improve over the years. race times and ages of all finishers in the jungfrau marathon and the lausanne marathon between 2000 and 2011 were analyzed. the data were obtained from the race websites of the jungfrau marathon and the lausanne marathon.13,14 the jungfrau marathon was selected as the mountain marathon since this race was held in 2007 and 2012 as the official world championship in mountain running. the study was approved by the institutional review board of st gallen, switzerland, with a waiver of the requirement for informed consent, given that the study involved the analysis of publicly available data. the jungfrau marathon in switzerland was established in 1993 and is one of the most popular mountain marathons in the world.13 the race is held annually with the start in interlaken (565 meters (m) above sea level) and the finish at the kleine scheidegg (2095 m above sea level). it covers an overall ascent of 1830 m and an overall descent of 305 m. the first quarter of the race is mostly flat and in the first half of the race the athletes had no more ascent than 300 m in the half - marathon distance (figure 1). the lausanne marathon was established in 1992 and is the second most important swiss city marathon following the zrich marathon.14 the race is held annually in autumn in lausanne on the border of lake lman with 36 m of altitude change (figure 1). data from 43,636 runners (including 7567 [17.3% ] women and 36,069 [82.7% ] men) who finished the jungfrau marathon between 2000 and 2011, and 20,464 runners (including 3104 [15.2% ] women and 17,360 [84.8% ] men) who finished the lausanne marathon between 2000 and 2011 were available. to analyze the performance in age groups, all athletes were divided in 10-year age groups : 1524 years, 2534 years, 3544 years, 4554 years, 5564 years, 6574 years, and 7584 years. to calculate the performance ratio and sex differences from each age group, the annual top ten women and men were determined. only those age groups with at least ten finishers in both sexes in at least eleven out of the twelve analyzed years were included. due to the low number of finishers per age group, only athletes in the 2534-year and 5564-year age groups the performance ratio for both sexes and the sex differences in performance were calculated per age group and year, and these were subsequently analyzed regarding their change over time. the performance ratio was calculated using the equation : the performance ratio expresses the performance of the top ten athletes of an age group as a percentage of the performance of the overall top ten athletes and is a good indicator of the age - related decline in performance.3 the sex difference in performance was calculated using the equation : where the sex difference was calculated for every pairing of equally placed athletes (eg, between female and male first place, between female and male second place, and so on) before calculating the mean value and standard deviation of all the pairings. to facilitate reading, all sex differences were transformed into absolute values before analyzing. to increase the reliability of the data analyses, each set of data was tested for normal distribution as well as for the homogeneity of variances in advance of the statistical analyses. normal distribution was tested using the dagostino pearson omnibus normality test, and the homogeneity of variances was tested using levene s test. to find significant changes in the development of a variable across years, linear regression was used. to find significant differences between two groups in case of normal distributed data, a student s t - test was used with welch s correction in case of significant different variances between the two compared groups. in case of statistical analyses were performed using the ibm statistical package for the social sciences version 19 (spss ; ibm corporation, armonk, ny, usa) and graphpad prism version 5 (graphpad software inc, la jolla, ca, usa). significance was accepted at p 34 years increased in contrast to female finishers aged 34 years increased in contrast to female finishers aged < 35 years (figure 4a), while the number of male finishers was constant in all age groups (figure 4b). in the city marathon, the number of female finishers was constant while the number of male finishers in the age groups of 2534 and 3544 years decreased. for the top ten women and the top ten men in the jungfrau marathon (the mountain marathon), the overall running speed remained stable. in the lausanne marathon (the city marathon), the overall top ten women maintained their running speed. however, the overall top ten men became significantly slower as their running time increased by 8%, from 139.8 minutes 2.4 minutes (2000) to 151.1 minutes 6.4 minutes (2011). figure 5 presents the changes in performance ratio for age group runners. in female marathoners, performance improved in athletes aged 3544 years and 5564 years in the city marathon (lausanne marathon). male marathoners race times improved in the 4554-year age group in both the city marathon (lausanne marathon) and in the mountain marathon (jungfrau marathon). the analysis of the interaction between the type of competition and age group showed a significant interaction for women (f = 5.7 ; p < 0.0001), where the type of competition accounted for 35.3% (f = 1232.5, p < 0.0001) and age group accounted for 58.4% (f = 224.9, p < 0.0001) of the total variance. for men, the type of competition and age group showed a significant interaction (f = 9.3 ; p < 0.0001), where the type of competition accounted for 52.4% (f = 2028.7, p < 0.0001) and age group for 41.2% (f = 178.4, p < 0.0001) of the total variance. female runners reduced sex differences in performance in the 4554-year age group in both competitions and in the 3544-year age group in the mountain marathon (jungfrau marathon). in the mountain marathon (jungfrau marathon), the sex difference in the performance of the 4554-year age group decreased from 23.4% 1.9% (2000) to 15.9% 6.1% (2011) in the mountain marathon and from 34.7% 4.6% to 11.8% 6.2% in the city marathon (lausanne marathon). in the mountain marathon, the sex difference of the 3544-year age group decreased from 19.1% 4.7% (2000) to 16.6% 1.9% (2011). the interaction analysis between the type of competition and age group on running speed showed significant interaction in terms of sex differences (f = 8.64 ; p < 0.0001), where the type of competition and age group accounted for 71.8% of the total variance, and age group alone accounted for 71.7% (f = 72.90 ; p < 0.0001) of the total variance. the type of competition accounted for less than 0.01% of the total variance (f = 0.02 ; p = 0.90) and was insignificant. this study intended to compare participation and performance trends in runners of various age groups competing in a mountain marathon and a flat city marathon in the same country where the race director set no limit in the number of starters (in contrast to other marathons where the field is limited). we hypothesized for both races that : (1) the number of master runners would increase ; and (2) the performance of master runners would improve over the years. in the mountain marathon, the number of female finishers increased in every age group of master runners ; the number of male finishers, however, remained constant. eichenberger reported similar findings for mountain ultramarathoners, showing that the number of female finishers increased from 2000 to 2011 in the swiss alpine marathon, whereas the number of male finishers remained unchanged. only the number of master runners increased while the number of younger finishers (ie, < 35 years old) remained constant. however, in the city marathon, the number of younger finishers (ie, < 45 years old) decreased while the number of older male finishers was constant. a possible explanation might be that since the beginning of the lausanne marathon in 1992, an abundance of newer and larger city marathons has been offered in switzerland, including the zrich marathon and others that have taken place abroad ; therefore, runners now have a wider spectrum of competitions to choose from.11 considering the performance of athletes based on age group, an important finding was that there was an increase in the performance ratio for female master runners aged 3544 years and 5564 years in the city marathon and for male master runners aged 4554 years in both the city and the mountain marathons. marathoners in younger age groups, however, showed no improvements in performance in either marathon. therefore, it seemed that female athletes in the mountain marathon reached their peak running speed and their performance may not improve anymore in the near future. conversely, in the city marathon, women improved in the 3544 and 5564 age groups. jokl reported an improvement in running speed for master runners at a faster rate than younger athletes in the new york city marathon from 19831999, which is consistent with our findings in the city marathon for men. a possible explanation for the improvement of male master runners in the city marathon might be that the top ten men became significantly slower over the years. therefore, even maintenance of running speed in master runners might have resulted in a relative improvement among the top ten runners in their respective marathon years. the finding that female master runners exhibited improved performances in city marathon running was consistent with the findings of lepers and cattagni,3 who reported a significant increase in running speed in women older than 45 years. while men between 45 and 54 years of age could improve their running speed in both a mountain and a city marathon, age - matched women could not. women were able to improve race times in the city marathon in age groups 3544 years and 5564 years. women seemed to have reached their peak running speed in mountain marathon running, but this was increasingly true for the younger (ie, < 44 years old) runners than for older runners. in the mountain marathon, the sex difference in the of 2529-year age group was 15.4% 1.7%, while the difference in the 6064-year age group was 20.4% 2.1%, which was consistent with the findings in the study by hunter and stevens,16 where the authors noted that the sex differences of running speed increased with advancing age in the new york city marathon. no changes in sex difference for running times were found between the top ten women and the top ten men in both races. nevertheless, significant changes in the sex differences in running times in male athletes in the 4554-year age group were found for both races. additionally, the sex difference decreased in the 3544-year age group in runners from the mountain marathon. these findings suggest that female master runners older than 35 years reduced the sex difference in performance observed in both mountain and city marathon running. studies concerning the sex differences in running exist for elite athletes and for recreational runners.15,1720 the sex difference in endurance performance (ie, running speed) was a frequently discussed topic,21,22 and it was found to be existent in different sports disciplines.23 twenty years ago, whipp and ward22 hypothesized that women would achieve the performance of men depending upon the distance. existing findings show that women are unlikely to be able to outrun men in the near future, as the average difference in running speed between men and women decreased for a long time but leveled in recent years.24 cheuvront reported a sex difference of 8%14% for running distances from 1500 m to 42 km, whereas the sex difference in running speed was on average about 11% in other competitions.18,21 lepers and cattagni3 showed relatively stable sex differences in marathon running times across the different age groups for the last decade in the new york city marathon. considering the sex difference in performance, the interaction between the type of competition and running time was insignificant, and the sex difference in running speed was therefore independent from the type of competition. the time difference between sexes was constant over the years, while the sex difference was smaller between the mountain marathon runners compared to the city marathon runners. the fastest female runner was about 16% slower in the mountain marathon and approximately 18% slower in the city marathon compared to the top ten women in the mountain marathon, with approximately 19% difference in running speed and approximately 22% in the city marathon. cheuvront similarly found that the sex difference in performance was constant but smaller at around 8%14% in competitions ranging from 1500 m to the marathon distance.24 in longer distances, coast reported a mean sex difference of 12.4% over distances ranging from 100 m to 200 km. the difference in running speed between winners and the top ten runners can be partly explained by the lower number of female finishers and, therefore, the faster decline in performance in women. we found a highly significant interaction between the type of competition and the age of the top ten runners. to the best of our knowledge, there was never a direct comparison between a mountain and a city marathon in terms of running times and age. nevertheless, other studies suggested that the type of competition and the age of the top ten runners were directly related. eichenberger found that there was a mean age of approximately 35 years for the top ten runners over the time span of 14 years at the swiss alpine marathon held in davos, switzerland.15 conversely, in city marathon running, the average age of runners was reported to be at around 30 years for both women and men.18,26 since these two types of competitions were not directly compared, our results can not be definitively supported by these findings. this study is limited since variables such as physiological parameters,27 anthropometric characteristics,20,28,29 training characteristics,20,28,30,31 previous experience,32 nutrition,33 and weather were not considered.34 it would be of interest to compare the same women and men competing in both the city and the mountain marathon. female marathoners with lower body mass and lower body mass index compared to male marathoners might hold an advantage and achieve relatively faster race times.30,31 this study is limited since variables such as physiological parameters,27 anthropometric characteristics,20,28,29 training characteristics,20,28,30,31 previous experience,32 nutrition,33 and weather were not considered.34 it would be of interest to compare the same women and men competing in both the city and the mountain marathon. female marathoners with lower body mass and lower body mass index compared to male marathoners might hold an advantage and achieve relatively faster race times.30,31 to summarize, the number of female master runners increased in the mountain marathon. the sex difference in performance decreased in the 3544-year age group in the mountain marathon. in runners aged 4554 years, the sex difference decreased in the mountain marathon and in the city marathon. these findings suggest that female master runners reduced the sex difference in performance in both mountain and city marathon running. | backgroundthe performance in master marathoners has been investigated in flat city marathons but not in mountain marathons. this study examined changes in the sex differences in performance across time in female and male master runners competing in a mountain marathon compared to a flat city marathon.methodsthe association between age and performance of finishers in the jungfrau marathon, switzerland, with 1830 meter changes in altitude and a flat city marathon (lausanne marathon), switzerland, were analyzed from 2000 to 2011.resultsin both events, athletes in the 3544 years age group showed the highest number of finishers. in the mountain marathon, the number of female master runners aged > 35 years increased in contrast to female finishers aged < 35 years, while the number of male finishers was unchanged in all age groups. in the city marathon, the number of female finishers was unchanged while the number of male finishers in the age groups for 2534-year - olds and 3544-year - olds decreased. in female marathoners, performance improved in athletes aged 3544 and 5564 years in the city marathon. male marathoners improved race time in age group 4554 years in both the city marathon and the mountain marathon. female master runners reduced the sex difference in performance in the 4554-year age group in both competitions and in the 3544-year age group in the mountain marathon. the sex difference in performance decreased in the 3544-year age group from 19.1% 4.7% to 16.6% 1.9% in the mountain marathon (r2 = 0.39, p = 0.03). in age groups 4554 years, the sex difference decreased from 23.4% 1.9% to 15.9% 6.1% in the mountain marathon (r2 = 0.39, p < 0.01) and from 34.7% 4.6% to 11.8% 6.2% in the city marathon (r2 = 0.39, p < 0.01).conclusionthese findings suggest that female master runners aged 3554 years reduced sex differences in their performance in both mountain and city marathon running. |
management of neglected perilunate dislocations is controversial. the various procedures such as open reduction and internal fixation (orif), proximal row carpectomy, lunate excision, and wrist arthrodesis have been advocated. the aim of our study was to evaluate the functional outcome of neglected perilunate dislocations managed by orif. over a period of 10 years (1996 to 2006), 14 patients with neglected perilunate dislocations (undiagnosed or untreated for 6 weeks or more) were managed by orif. six patients had dorsal trans - scaphoid perilunate dislocation, 6 patients had volar lunate dislocation while the remaining two had a dorsal perilunate dislocation the results were evaluated by clinical scoring system of cooney. of the four patients operated after 5 months, two had a fair result while two had a poor outcome. chondral damage to the capitate was noted intraoperatively in both the cases with poor outcomes. the two patients were found to have avascular necrosis (avn) of the lunate ; however, functional outcome was fair in both, and both were able to return to their profession. we observed favorable functional results of orif in neglected perilunate dislocations up to 5 months after injury. the development of avn or midcarpal arthritis was not a major disabling factor as long as stability of wrist has been restored. beyond 5 months, an alternative surgical procedure such as proximal row carpectomy should be contemplated as results of orif have not been good uniformly. perilunate injuries are high energy injuries and encountered in young adults.1 up to 25% are diagnosed late, either due to delay in presentation, poor interpretation of radiographs or due to associated injuries that require more urgent attention.13 patients who present within 6 weeks of injury are managed in a manner similar to acute injuries.34 the treatment in such cases is accurate reduction, ligament reconstruction, and stable fixation till the construct is healed.56 however, in neglected cases there is no consensus on the most appropriate treatment method.5 the alternative procedures such as proximal row carpectomy,78 lunate excision,910 and wrist arthrodesis are described.11 some have even reported long - term good results with an unreduced dislocation.12 we present a retrospective analysis of functional outcome of perilunate dislocation managed with orif. the cases were classified as neglected if these were undiagnosed or untreated for 6 weeks or more. out of 14 patients, the diagnosis was made subsequently when an attempt was made to mobilize the patient with crutches and he complained of pain in both wrists. the average age of these patients was 34.6 years (range 21 - 48 years).the age with a predominance of males (12 males, 2 females). the dominant hand was involved in 11 patients, non - dominant side in 2 patients, and 1 patient had bilateral involvement. the treatment delay is ranged from 6 weeks to 1.5 years [figure 1 ]. anteroposterior and lateral views of wrist showing dorsal transscaphoid perilunate dislocation out of 14 cases, 6 patients had a dorsal trans - scaphoid perilunate dislocation, 2 patients had a dorsal perilunate dislocation, and 6 patients had a seven volar lunate dislocation with one patient having bilateral volar lunate dislocation. four patients with volar lunate dislocation had symptoms of chronic median nerve compression ; one patient with bilateral volar lunate dislocation had symptoms of median nerve dysfunction in one hand and ulnar nerve dysfunction in the other. open reduction was performed through the dorsal approach in eight patients (six with dorsal trans - scaphoid perilunate dislocation and two with dorsal perilunate dislocation). the dense fibrous tissue from the carpal joint spaces using a fine bone nibbler was removed. a blunt small curved periosteum elevator was used to carefully shoe - horn or lever the capitate into the lunate fossa and reduce the luno - capitate joint. in two patients with dorsal perilunate dislocations, two 1.5 mm k - wires were used as joysticks in the scaphoid and lunate. the lunate was flexed and the scaphoid extended, while an assistant drove k - wires across scapho - lunate, luno - triquetrum, and capito - lunate articulations. the scaphoid fractures in the six patients with dorsal trans - scaphoid perilunate dislocations were fixed using herbert screws. bone grafting was done in all six cases with graft taken from the distal radius. combined volar and dorsal approach was used in the six patients with seven volar lunate dislocations. the volar approach enabled decompression of the median nerve and facilitated clearing of the lunate fossa and subsequent lunate reduction. k - wires were used to stabilize the scapho - lunate, luno - triquetrum, and capito - lunate articulations. postoperatively, the wrist was immobilized in the neutral position, using a below elbow plaster of paris (pop) cast. the pop was changed at 4 weeks, and discontinued after 8 weeks post - surgery, when k - wires were removed. a wrist brace was continued for another 4 weeks along with wrist mobilization exercises. in patients (n=6) with scaphoid fracture, serial wrist radiographs were done routinely at 6 weeks, 12 weeks, 6 months and at last followup. the patients were evaluated according to the clinical scoring system described by cooney.13 [table 1 ]. clinical scoring chart (cooney, 1987)13 the patients were followed - up for an average period of 4.1 years (2 - 12 years). among the six patients with dorsal trans - scaphoid perilunate dislocation, four patients had a good outcome score [table 2 ]. there was one fair and one poor outcome. among the six patients with volar lunate dislocation among the two cases with dorsal perilunate dislocation, one patient had a good result and the second patient presenting 68 weeks after the injury had a poor result. the patient with dorsal perilunate dislocation presenting at 68 weeks developed mid - carpal arthritis clearly seen at 2 year followup visit [figure 2 ]. two patients (including the patient with bilateral involvement) with volar lunate dislocation presenting more than 5 months after injury eventually developed avascular necrosis (avn) of the lunate and mid - carpal arthritis of all the involved wrist joints [figures 3 and 4 ]. over all 5 wrist (3 volar dislocation, 1 trans - scaphoid and one dorsal dislocation were operated after 5 monhs had poor (n=2), fair (n=3) result. summary of the patients (a) preoperative x - ray picture, lateral view, of a 1.5-year - old showing unreduced perilunate dislocation. (b and c) anteroposterior and lateral view of same case after open reduction and internal fixation with k - wires. (d) follow - up x - ray at 2 years x - ray photographs. ap and lateral views of both wrists showing bilateral volar lunate dislocation clinical outcome of same case (as in figure 3) at one year post surgery showing fair result x - ray results of both sides, showing evidence of avn, collapse, and mid - carpal arthritis all patients except two returned to pre - injury work at an average time period of 25 weeks (2036 weeks). the four patients (3 median n + one ulnar n) with pre - operative neurological deficit improved gradually over a period of 10 to 18 weeks postoperatively (average 13.5 weeks). perilunate dislocations represent approximately 10% of all wrist injuries and are diagnosed late in 25% of cases.5 this percentage may be even higher in developing countries where lack of awareness and inadequate penetration of medical facilities in rural areas compounds the problem. late diagnosed perilunate dislocation (pld) presents with many issues ; principal among these are the anticipated complications at surgery due to extensive fibrosis and scarring, uncertainty of return of full function after reduction, and possibility of developing avn of reduced lunate postoperatively. furthermore, numerous treatment options have been advocated. these range from orif,1415 proximal row carpectomy,78 lunate excision,910 and wrist arthrodesis.11 there is no consensus about the upper time limit till when open reduction of perilunate dislocations could be attempted without significant complications. komurcu.16 performed orif in six cases with trans - scaphoid perilunate dislocation up to 40 days post - injury (average 26 days) and reported favorable results. seigert.18 reported good results of chronic perilunate dislocations reduced as late as 35 weeks after injury ; nevertheless, the incidence of good results reduces significantly with delays more than 8 - 12 weeks post - injury. in our series, of the four patients (5 wrist) operated after 5 months, two had a fair result while three wrist had a poor outcome. our findings are similar to those of kailu.5 who have reported a favorable outcome in cases delayed up to 25 weeks. kailu.5 have also noted that poor results correlate with not only duration of injury but with also the presence of chondral damage. this is also borne out by our study as significant chondral damage to the capitate was noted intra - operatively in both the cases with poor results. dimitriou.19 have noted that avascular collapse of lunate does not always leads to significant functional disability. both our patients with avn of the lunate had a fair outcome and were able to return to their professions. kailu.5 have emphasized repair of scapho - lunate and lunotriquetral ligaments in neglected perilunate dislocations. seigert18 performed ligament repair in one out of six patients with chronic perilunate dislocation. in our experience with 14 cases, stabilization of the reduced carpus with k - wires across the scapho - lunate, luno - capitate, and luno - triquetral joints we believe that with extensive fibrosis and scarring in chronic cases and the extensive dissection required to reduce the dislocation ; attempting to repair the retracted ligament ends is not worthwhile. both kailu.5 and siegert.18 furthermore, it may be suggested to use a wrist distracter intra - operatively or if possible, a few days preoperatively to help overcome the extensive fibrosis and scarring and to facilitate the clearing of the lunate fossa. arthrodesis of wrist is reported to give painless and stable joint, it may not be acceptable to most patients. macausland9 and russell10 reported satisfactory results after excision of the lunate in cases with lunate dislocations. later on, seiegert.18 and inoue.20 reported that excision of lunate alone may lead to irreversible changes due to the development of radioscaphoid arthritis. seigert.18 and rettig8 have reported favorable results with proximal row carpectomy in 2 and 12 cases, respectively. this study indicates that the functional results of orif in neglected perilunate dislocations up to 5 months after injury are favorable and even the development of avn or midcarpal arthritis may not be a major disabling factor, as the benefits of a stable wrist could outweigh the disadvantages. however, beyond 5 months, an alternative surgical procedure such as proximal row carpectomy may be kept in mind. | introduction : management of neglected perilunate dislocations is controversial. the various procedures such as open reduction and internal fixation (orif), proximal row carpectomy, lunate excision, and wrist arthrodesis have been advocated. the aim of our study was to evaluate the functional outcome of neglected perilunate dislocations managed by orif.materials and methods : over a period of 10 years (1996 to 2006), 14 patients with neglected perilunate dislocations (undiagnosed or untreated for 6 weeks or more) were managed by orif. six patients had dorsal trans - scaphoid perilunate dislocation, 6 patients had volar lunate dislocation while the remaining two had a dorsal perilunate dislocation the results were evaluated by clinical scoring system of cooney.results:the average followup was 4.1 years (range 2 - 12 years). all except one of the patients operated earlier than 5 months had good results. of the four patients operated after 5 months, two had a fair result while two had a poor outcome. chondral damage to the capitate was noted intraoperatively in both the cases with poor outcomes. the two patients were found to have avascular necrosis (avn) of the lunate ; however, functional outcome was fair in both, and both were able to return to their profession.conclusion:we observed favorable functional results of orif in neglected perilunate dislocations up to 5 months after injury. the development of avn or midcarpal arthritis was not a major disabling factor as long as stability of wrist has been restored. beyond 5 months, an alternative surgical procedure such as proximal row carpectomy should be contemplated as results of orif have not been good uniformly. |
limitations of the study include small sample size, and only subjective assessment of the scar has been taken into consideration to assess the outcome. scar formation is an inevitable result of surgery and trauma that results in full thickness epidermal loss. acne and other inflammatory, infectious conditions such as varicella, odontogenic sinus, surgery and trauma can result in atrophic scars over the face. scars over the face and other exposed parts can be cosmetically, psychologically and socially disturbing. various techniques such as subcision, microneedling, fillers, peels, autologous fat transplant, dermal graft and laser resurfacing are being practiced in the management of atrophic scars. an ideal technique which is free of allergic reaction or irritation, economical, less time - consuming and easily available, which gives a permanent correction with no rejection or resorption, is still very far from reality. this study was undertaken to evaluate the effectiveness and safety of dermal grafting technique in the management of atrophic facial scars. fifteen patients with atrophic facial scars of varied aetiology such as acne, varicella, traumatic or surgical linear scars, who had not responded to minor procedures such as subcision and microneedling and were willing for surgery, were considered for dermal grafting. proper counselling regarding the procedure, possible outcome, side effects and alternate modes of treatment was done. donor area was dermabraded with motorised dermabraders using dental burrs till there was pinpoint bleeding which ensured complete removal of epidermis [figure 1a ]. depending on the type of scar, dermal grafts were harvested. for linear scars, a linear strip of appropriate length and breadth of dermal graft [figure 1c and d ] was obtained and wound closed using continuous sutures with 3 - 0 vicryl. for irregular and circular scars, dermal grafts were obtained using 6 mm punches [figure 1b ] and wound closed with simple sutures and dressed. the grafts so obtained were washed in normal saline and transferred to a petri dish containing trypsin and incubated at 37 c for 45 min. then, the grafts were again washed with normal saline and the action of trypsin neutralised with patients serum. linear and circular graft harvesting from retroauricular area (a) retro auricular area dermabraded till there is pinpoint bleeding (b) circular grafts taken with 6 mm punches (c) a linear dermal grafts taken from retro auricular area (d) linear dermal graft obtained in the recipient area, for circular or irregular scar, grafts were placed below the scar using a pocket technique [figure 2 ]. for linear scar, grafts were inserted using railroading technique [figure 3a d ]. in pocket technique a small nick was made on either side of the needle [figure 2 ]. tunnelling was done beneath the scar using 18-g needle [figure 3a d ]. a small nick on either side of needle was put to create an entry wound. from the bevelled edge, a suture was passed through the needle, the other end of which was tied to the one end of the linear graft previously prepared. then, the needle was slowly withdrawn ; at the same time, traction was given to the graft by pulling the suture and pushing the graft into the tunnel till it reached the other end of the tunnel. patients were reviewed after 3 day for donor area, dressing and suture removal of recipient area was done on the 5 day. patients were followed up again at 6 months, and results were assessed using visual analogue scale ranging from 1 (least satisfied) to 10 (most satisfied). pocket technique of graft insertion railroad technique of graft insertion (a) a needle inserted just beneath the linear scar (b) a suture thread tied to the graft is made to pass through the bevel of the needle till it comes out of the hub (c) slow traction being given to the thread simultaneously pushing the graft below the scar (d) graft completely placed below the scar mean age of patients was 35 years. out of them, eight scars were secondary to trauma, two were post to varicella scar, three post acne scars, one due to branding and one due to healed odontogenic sinus scar. five were linear scars with width ranging between 3 and 5 mm, length 13 cm, seven were circular with diameter ranging between 413 mm and three were irregular scars. patient 's satisfaction was analysed using visual analogue scale which showed an average value of 8.4 [table 1 ]. scar due to pilonidal sinus showed moderate improvement due to skin tethering [figure 9 ]. however, two patients did not appreciate any difference in the scar due to altered skin texture over the scars though there was elevation of the scar. they were further subjected to q - switched nd - yag laser therapy to improve surface irregularities. tip necrosis [figure 11 ] which healed with hyperpigmentation was observed in one patient [figure 10 ]. patient satisfaction on visual analogue scale linear scar due to branding on the forehead (a) after dermal grafting with hyperpigmentation at entry points (b) traumatic scar on left upper cheek (a) and after (b) dermal grafting (a and b) varicella scar on the left cheek (a and b) varicella scar in the right cheek traumatic scar on the forehead (a) and after (b) dermal grafting healed odontogenic sinus scar on the right cheek (a) with partial improvement with dermal grafting (b) atrophic acne scar on left cheek (a) after dermal grafting (b) tip necrosis seen on the right after dermal grafting in a linear scar an effective, permanent therapy of broad, depressed scar has posed a real challenge for surgeons treating atrophic scars of the face. an ideal technique which is free of allergic reaction or irritation, economical, less time - consuming and easily available and which gives a permanent correction with no rejection or resorption, is still very far from reality., surgeons have focussed on their use in ophthalmology and correction of defects in other organ systems. previous problems encountered with these grafts include persistence of the epithelium, cyst formation and unpredictable behaviour. however, with improved surgical technique, complications with dermal grafts have reduced. in our study, removal of epidermis by dermabrasion has prevented the formation of epidermal cyst as seen in earlier studies. fournier has utilised solid bits of dermis and fat, for implantations into facial rhytides. dermal grafting is the implantation of appropriately dissected deep dermis into corresponding recipient areas such as atrophic scars or other soft tissue defects. any acne scar which is prominent and soft, at least 45 mm across, can be considered for dermal grafting. at the same time, patients should also be counselled for the need for other procedures such as dermabrasion, peels or laser if they have irregular or pigmented surface. as the results may not be evident in scars with surface irregularities as in two of our case, choosing patients with normal skin texture is important while selecting the patient for dermal graft. the subcision releases fibrous anchoring of dermis and also produces trauma at microscopic level within scar tissues. newer matrix and collagen tissue are laid down and establish a well - vascularised bed of granulation tissue to accept the grafts once they are inserted one and half to 2 weeks after the undermining. therefore, all the patients were advised to undergo a procedure of undermining or subcision 2 weeks before dermal graft insertion. a commonly selected and convenient donor site is the crease behind one or both ears in an area devoid of appendages. depending on the scar shape and size, grafts are obtained and implanted as explained above. one is conventional technique and the other is enzymatic technique. in conventional technique, the donor tissue is harvested using any conventional dermatomes or using biopsy punches from the post - auricular site. alternatively, dermal tissue can also be harvested from a dermabraded area where the whole of epidermis is completely removed. the punch grafts or narrow strip of dermis is transferred to saline and then inserted into the recipient area. in enzymatic technique, similarly obtained dermal tissue is transferred into a petri dish containing 0.25% of trypsin in ethylenediaminetetraacetic acid solution. this technique makes dermal graft soft, flexible and easily mouldable as compared to grafts obtained via conventional technique. after preparing the graft, advantages of dermal grafts are it is readily available, there are no allergic or hypersensitivity reactions, its inexpensive, not susceptible to infections, can be accurately tailored for different types of atrophic scars and acts as a permanent spacer between the skin and underlying fibrous band of tissue. however, the drawbacks of dermal graft is that it may not be an ideal solution for large depressed scars where multiple sittings may be required and in scars with significant skin texture alteration where it may have to be combined with resurfacing techniques. the advantages and disadvantages of dermal graft in comparison with other modalities such as lasers, fillers and autologous fat transfer have been tabulated in table 2. limitations of the study include small sample size, and subjective assessment of the scar to assess the outcome. to conclude dermal graft can serve as natural, permanent and inexpensive filler in the management of facial scars such as acne scars, varicella scars and linear scars of varied aetiology. however, large - scale studies are required to confirm the same. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. | background : scars over the face are cosmetically and psychologically disturbing. various techniques have been described and are being practiced in the management of these scars.aims and objectives : this study was undertaken to study the safety, effectiveness of using dermal grafts as fillers in the management of facial scars due to acne, chickenpox, trauma or any others.materials and methods : fifteen patients with atrophic facial scars of varied aetiology and willing for surgery were considered for dermal graft technique. after pre - operative workup, subcision was done 2 weeks before planned surgery. depending on the type of scar, grafts were inserted using pocket or road railing techniques. scar improvement was assessed based on patient satisfaction.results:linear scars showed excellent improvement. acne, varicella and traumatic scars also showed good improvement. however, two patients did not appreciate improvement due to marked surface irregularities as the scars were elevated. they were further subjected to laser and chemical peel resurfacing.conclusion:dermal grafting can be used in the management of any round to oval facial scar which is soft, prominent and at least 45 mm across ; linear scars at least 23 mm across and 34 cm in length. however, scars with prominent surface irregularities need further resurfacing techniques along with dermal grafting.limitations:limitations of the study include small sample size, and only subjective assessment of the scar has been taken into consideration to assess the outcome. |
although the majority of thyroid nodules are benign, a large number undergo cytology / histology to rule out malignancy. initially thyroid nodule characteristics were studied individually and their association with malignancy has been reported. subsequently, characteristics were grouped to determine if by having more than one characteristic this association changed. currently most authors divide thyroid nodules into benign, follicular lesions, and malignant nodules based on ultrasound (us)appearance. recently horvath., created a thyroid imaging reporting and data system (tirads) after evaluating the different characteristics that allow for a better selection of nodules submitted for fine - needle aspiration cytology (fnac) ; while park., proposed an equation to predict the probability of malignancy in thyroid nodules based on 12 characteristics. however, different us criteria are now being used to predict the nature of thyroid nodules.[78922 ] this is because performing fnac of all thyroid nodules is a costly venture with a low yield in identifying the small proportion of nodules that actually represent malignant disease. there is no universal agreement about the best way to use us in the management of thyroid nodules. this paper evaluated the use of easily adaptable index score based on us characteristics that have a higher correlation with benign nature of a thyroid nodule. the objective of this study was to describe a reliable ultrasound based index scoring system based on ultraound characteristics to identify benign thyroid nodules and avoid unnecessary fine needle aspiration cytology. the study received approval by the research and ethics committee of the aga khan university hospital, nairobi. from november 2005 we started to recruit patients referred for us - guided fnac of thyroid nodules at the radiology department in aga khan university hospital, nairobi. all patients underwent ultrasound examination of the thyroid which was performed by one of two radiologists each with greater than 5 years experience in thyroid ultrasound. we used a logiq 9 (ge healthcare) scanner equipped with a 10 - -14 mhz linear matrix transducer with color and power doppler capability. all solid or partly solid focal nodules in the thyroid gland were included in the study. when a patient had multiple nodules, the most dominant nodule / s were included. this decision to choose the dominant nodule was left to the discretion of the person performing the ultrasound examination. we evaluated four characteristics of each nodule, i.e., border characteristics (margins), echo texture, presence or absence of microcalcification, and vascularity. distinct nodule borders exhibiting a complete halo were called regular whereas indistinct, poorly defined borders with less than 30% circumferential demarcation were defined as irregular [figures 1 and 2 ]. gray scale image of a benign nodule in a patient with thyrotoxicosis (within calipers). this nodule has a regular margin (0) and is heterogeneous (1) with no calcification (0). this was described as either homogenous or heterogeneous based on comparison to the surrounding thyroid tissue [figures 1, 3 and 4 ]. illustrates a thyroid nodule in longitudinal and transverse planes within calipers that has a homogeneous echogenicity is also isoechoic to the surrounding thyroid gland parenchyma. this was assessed by color doppler and vascularity was compared with the surrounding thyroid gland. it was classified as centrally increased, peripherally increased or normal [figures 5 and 6 ]. illustrates a thyroid nodule with central increased blood flow. illustrates a thyroid nodule with peripheral increased blood flow. if a nodule had both microcalcification and macrocalcification it was classified under microcalcification [figures 7 and 8 ]. illustrates a thyroid nodule with macrocalcifications. illustrates a thyroid nodule (within calipers) with microcalcifications. we then graded the nodules by giving them an index score of one to four using the four major us characteristics in table 1. those with scores of 0 and 1 were labeled as benign [figure 1 ]. scores of 2, 3, or 4 were labeled suspicious [figure 9a and b ]. in the interpretation of the us features both radiologists arrived at a consensus diagnosis, i.e., benign or suspicious. (a) gray scale image of a malignant nodule with heterogeneous echogenicity and microcalcifications. (b) color doppler image of the same nodule demonstrates increased central blood flow. this nodule has a regular margin (0), is heterogeneous (1) with microcalcification (1), and has increased central blood flow (1). superficial nodules : multiple passes were made using a 25 gauge needle (without any suction).deeper nodules : multiple passes through the nodule with a 21/23 gauge needle and suction with a syringe. superficial nodules : multiple passes were made using a 25 gauge needle (without any suction). deeper nodules : multiple passes through the nodule with a 21/23 gauge needle and suction with a syringe. a cytologist then analyzed them at the same sitting to reduce the number of inadequate samples. two pathologists in consensus classified the cytological diagnosis as benign, malignant or follicular nodule. some authors have used a vacuum gun to aid suction of small nodules that are located deep within the thyroid gland. the nature of a follicular nodule can not be determined by fnac ; hence histology is imperative for a final diagnosis to be arrived at. in our study specificity of us in the characterization of benign thyroid nodules using the major characteristics was then calculated. all characteristics were tabulated to calculate their level of association with malignancy by determining the percentage of each in the benign and suspicious categories respectively. distinct nodule borders exhibiting a complete halo were called regular whereas indistinct, poorly defined borders with less than 30% circumferential demarcation were defined as irregular [figures 1 and 2 ]. gray scale image of a benign nodule in a patient with thyrotoxicosis (within calipers). this nodule has a regular margin (0) and is heterogeneous (1) with no calcification (0). this was described as either homogenous or heterogeneous based on comparison to the surrounding thyroid tissue [figures 1, 3 and 4 ]. illustrates a thyroid nodule in longitudinal and transverse planes within calipers that has a homogeneous echogenicity is also isoechoic to the surrounding thyroid gland parenchyma. this was assessed by color doppler and vascularity was compared with the surrounding thyroid gland. it was classified as centrally increased, peripherally increased or normal [figures 5 and 6 ]. illustrates a thyroid nodule with central increased blood flow. illustrates a thyroid nodule with peripheral increased blood flow. if a nodule had both microcalcification and macrocalcification it was classified under microcalcification [figures 7 and 8 ]. illustrates a thyroid nodule with macrocalcifications. illustrates a thyroid nodule (within calipers) with microcalcifications. we then graded the nodules by giving them an index score of one to four using the four major us characteristics in table 1. those with scores of 0 and 1 were labeled as benign [figure 1 ]. scores of 2, 3, or 4 were labeled suspicious [figure 9a and b ]. in the interpretation of the us features both radiologists arrived at a consensus diagnosis, i.e., benign or suspicious. illustrates a suspicious thyroid nodule. (a) gray scale image of a malignant nodule with heterogeneous echogenicity and microcalcifications. (b) color doppler image of the same nodule demonstrates increased central blood flow. this nodule has a regular margin (0), is heterogeneous (1) with microcalcification (1), and has increased central blood flow (1). superficial nodules : multiple passes were made using a 25 gauge needle (without any suction).deeper nodules : multiple passes through the nodule with a 21/23 gauge needle and suction with a syringe. superficial nodules : multiple passes were made using a 25 gauge needle (without any suction). deeper nodules : multiple passes through the nodule with a 21/23 gauge needle and suction with a syringe. a cytologist then analyzed them at the same sitting to reduce the number of inadequate samples. two pathologists in consensus classified the cytological diagnosis as benign, malignant or follicular nodule. some authors have used a vacuum gun to aid suction of small nodules that are located deep within the thyroid gland. the nature of a follicular nodule can not be determined by fnac ; hence histology is imperative for a final diagnosis to be arrived at. in our study specificity of us in the characterization of benign thyroid nodules using the major characteristics was then calculated. all characteristics were tabulated to calculate their level of association with malignancy by determining the percentage of each in the benign and suspicious categories respectively. the patient selection was from a pool of consecutive referrals to aga khan university hospital 's radiology department in nairobi. the nodule size ranged from 3 mm to 28 mm (anteroposterior), 10 mm to 20 mm (transverse), and 3 mm to 12 mm (length). a total of 234 nodules were characterized as benign on us, all of which were benign on fnac. there were 50 suspicious nodules on us of which 20 turned out to be malignant [table 2 ]. us and fnac correlation of the ultrasound characteristics analyzed margins, vascularity, and calcification were found to have significant p - values [table 3 ]. the widespread use of us in the evaluation of thyroid nodules has created an overwhelming need to establish scientifically sound, straight - forward, and easily adaptable protocols that minimize costs related to nodule management and maximize the benefits of us. our aim was to suggest an us index score that has the characteristics of such a protocol. we assessed the reliability of our us criteria in labeling a thyroid nodule as benign. ninety - three percent of the thyroid nodules referred for us - guided fnac were benign and 7% were malignant. all of the 234 nodules that were characterized as benign on us (0 - 1 category) were confirmed to be benign on cytology / histology. based on these findings, if us classifies a nodule as benign fnac can be deferred., which have shown that most malignant nodules have more than two malignant us characteristics. these include border characteristics (margins), echogenicity, calcifications, vascularity, size, shape, orientation, and acoustic transmission. we only evaluated four of these characteristics in each nodule, i.e., border characteristics (margins), echogenicity, presence or absence of microcalcification, and vascularity. these features were selected because they have been shown to be the most widely looked for, as they have the highest correlation with malignancy when studied in combination. they are also similar to those used in a study by kovacevic. in two studies on the same patient population,, demonstrated how combining highly sensitive us characteristics of malignancy with more specific fna cytology can yield a accuracy similar to that using a set of more specific us characteristics to diagnose malignancy. we did not assess size and shape in order to determine to what extent they may be linked to the benign nature of a thyroid nodule. size and shape of the nodule have been shown to be less sensitive and specific indicators of thyroid malignancy. we did not assess nodule orientation or acoustic transmission because they have not been used as frequently as the characteristics we chose to analyze. other sonographic variables not measured in the study that could have incremental predictive value, include ultrasound - directed qualitative intranodular vascular distribution and quantitative analysis of tumor vascularity (tumor vascular resistive index). these are complex and not easily adaptable in routine us imaging of the thyroid gland. table 4 summarizes already published operating characteristics of described methods for using us features of thyroid nodules as predictors of malignancy. summary of previously published studies for predicting thyroid nodule malignancy with an index scoring system using the us features it has been shown to have the highest association with malignancy. based on our scoring system we had a very high specificity to diagnose a benign nodule [table 4 ]. our high pick up rate of benign nodules may be partly due to the specific characteristics we used, but we must acknowledge the high prevalence of benign nodules regardless of the effectiveness of our index score. our specificity is high compared with kwak, stacul, koike etal., and more recently horvath., [table 4 ] kim., had the lowest specificity which may be because they adapted the older method of using just one us feature to assess malignancy, rather than using a combination of us features [table 4 ]. we used an index score consisting of four out of several characteristics that have been shown to be features significantly associated with malignancy. while the most recent publications have moved on to stratify, categorize, and create reporting and data systems, we chose to take a simpler and more adaptable yet scientifically sound approach similar to koike. of the four major us characteristics that were used, margins, calcification, and vascularity were most significant. a small percentage of benign nodules had an irregular margin but they did not have increased central blood flow and no calcification was seen. these findings are reiterated by moon and seya. if a nodule was classified as malignant it most likely had an irregular margin and increased central vascularity. echo texture and ancillary characteristics such as size and shape did not have significant p - values. this may be because of the sample size and a larger study for further evaluation of these characteristics would be of value because these features may be used as an additional features to evaluate malignancy. presence of microcalcification is most significant in predicting malignancy the use of us adds the additional advantage of fna guidance which is particularly beneficial in patients with nonpalpable, multiple, or heterogeneous nodules for preferentially aspirating a specific segment of the nodule (large or partially cystic nodule) or when nodule palpation is difficult (patients with diffuse glandular disease) or obesity. in the diagnostic management of thyroid nodules, fnac is still the gold standard despite the growing experience in the use of high resolution us. it can not differentiate a follicular adenoma from a follicular carcinoma. therefore, for these lesions a corresponding histological analysis was taken to be the final diagnosis. fnac can also be limited by inadequate sampling. in our paper, an attempt to reduce inadequate sampling was made by using us guidance and by having the samples analyzed by a pathologist at the same sitting before the patient left the examination room. the actual effectiveness of different us criteria is still in question and currently being reconsidered and modified. techniques that combine us features and fnac are most effective and most accurate for predicting malignancy rather than us alone. many studies agree that with regard to thyroid nodule management a multidisciplinary approach is best, including clinical examination, laboratory work up, us, fnac, and surgical excision with biopsy where necessary. a consensus conference statement by the society of radiologists in us highlighted six us characteristics that are associated with malignancy., the most specific of which were analyzed in this paper the authors recognize various limitations of the study. as such operator bias could have played a role in the us results. in the interpretation of thyroid nodules, the presence or absence of abnormal neck lymph nodes was not considered. elastography is a technique that can also help identify thyroid nodules that are likely to be malignant. we did not analyze elastography but focused on an index score that can reliably identify benign nodules. a combination of us features with other investigations such as, serum thyroid stimulating hormone concentration, galectin-3 expression analysis, and fdg / pet scan would be useful in avoiding the higher costs of thyroid surgical procedures. one of the most significant weaknesses of this paper is the small sample size with few malignant nodules compared with recent publications with almost similar objectives but more complex sonographic pattern recognition methods. however we do believe that this is outweighed by the fact that the simple and straight - forward index score used to classify nodules did not need a larger sample size as have recent papers like horvath. in 2002 and later 2007 a paper by kim and kovacevic. finally the purpose of this paper is unique to what has already been done ; the structure is sound, methodology is straight - forward (justifying the small sample size), and its findings can be applied during routine imaging without significant cost implications. our preliminary results show that us characterization of a thyroid nodule can accurately infer its benign nature. we have suggested the use of an us index score to avoid unnecessary fnac in patients with thyroid nodules. however as fnac remains the gold standard in the characterization of a thyroid nodule, both fnac and us should be used in combination to manage suspicious thyroid nodules. this preliminary work can be used as a guide to the evolving management protocol of thyroid nodules. | objective : the objective of this study was to describe a reliable ultrasound based index scoring system based on ultraound characteristics to identify benign thyroid nodules and avoid unnecessary fine needle aspiration cytology.materials and methods : patients undergoing ultrasound - guided fine - needle aspiration cytology (fnac) for thyroid nodules were evaluated prospectively. a total of 284 patients were evaluated from november 2005 to november 2011. there were 284 nodules. any solid or partly solid focal nodule in the thyroid gland was included in the study. cysts with no solid component were excluded. we used logiq 9 (ge healthcare) scanner equipped with a 10 - -14 mhz linear matrix transducer with color and power doppler capability. four us characteristics were evaluated, i.e., nodule margins, echo texture, vascularity, and calcification. fine needle aspiration (fna) was performed on all nodules. the nodules were labeled benign or suspicious using an ultrasound index score and the results compared with fnac. follicular neoplasms on fine - needle aspiration cytology were further assessed by excision biopsy and histology. cytology / histology was used as the final diagnosis.results:in total 284 nodules were analyzed. all the 234 nodules in us labeled benign category were proven to be benign on cytology / histology. therefore the specificity of ultrasound in labeling a nodule benign was 100%. twenty of the 50 nodules that were suspicious on us were malignant. the most significant us differentiating characteristics were nodule margins, vascularity, and microcalcification.conclusion:our results show that us can accurately characterize benign thyroid nodules using an index scoring system and therefore preclude fnac in these patients. |
recent studies reported the prevalence of diabetes in china soared from 1.9 to 11.6% between 1993 and 2010 [1, 2 ]. the prevalence of prediabetes is rising which is an important risk factor for the development of overt diabetes and cardiovascular disease. china has to face the major public health problem and economic burden of potential diabetic patients. thus, clarifying its etiology and looking for modifiable risk factors are of paramount importance for diabetes control and prevention. iron is an important mineral in normal physiological processes, and ferritin is a specialized iron storage protein, which reflects iron stores in the body. serum ferritin (sf) has been found to be a reliable tool, providing that confounding effects by inflammatory, hepatic, or neoplastic diseases are excluded. it has been used as a surrogate variable to reflect body iron stores in healthy individuals. previous studies have demonstrated an association between increased sf levels and higher risks of diabetes [5, 6 ]. however, the exact mechanism through which elevated sf promotes the development of type 2 diabetes is unknown. obesity has become a major global health problem and is associated with the risk of type 2 diabetes and insulin resistance. in recent years, a number of studies have investigated the association between sf levels and various types of adiposity. is serum ferritin associated with insulin resistance or islet cell function when the interference factor of obesity has been ruled out ? therefore, in the present study, we aimed to investigate the changes of ferritin metabolism in nonobese han adults with different status of glucose tolerance and the relationship between serum ferritin (sf) and insulin resistance. the 96 (male / female, 62/34) (aged 49.8 11.9 years) subjects were recruited from the first hospital of qinhuangdao for health examinations that bmi was normal and undiagnosed diabetes in qinhuangdao, hebei province during 2011. the inclusion criteria included the following : (1) subjects were clinically stable with no previous medical history of diabetes, hypertension, dyslipidemia, coronary artery diseases, or cerebral stroke ; (2) subjects were without clinical evidence of endocrinopathy ; (3) subjects were not taking medications known to affect glucose and lipid metabolism, such as statins, glucocorticoids, thyroid hormones, and thiazide diuretics ; (4) subjects were not neoplasia and liver disease ; (5) female subjects were postmenopausal. the exclusion criteria included the following : (1) subjects with hepatic or renal dysfunction (> 1.5-fold elevation of alanine aminotransferase, aspartate aminotransferase, or serum creatinine > 115 mol / l) and (2) subjects with anemia, blood transfusion, and the recent use of iron, who smokers, consuming alcohol, and having acute and chronic inflammation. anthropometric measurements, including height, weight, waist circumference (wc), and blood pressure, were obtained while the subjects were in light clothing and not wearing shoes. body mass index (bmi) was calculated by dividing weight (kg) by height squared (m). blood pressure was measured twice with a mercury sphygmomanometer after 10 min of rest while the subjects were seated, and the average of the two measurements was used for analysis. after an overnight fast of 8 h, blood samples were drawn from an antecubital vein in each subject into vacutainer tubes. all subjects underwent oral glucose tolerance test (ogtt) with 75 g of oral anhydrous glucose at 8:00 am after 8 h of fasting. peripheral venous blood samples were taken at 0, 1, 2, and 3 hours after glucose loading. fasting plasma glucose (fpg) concentration and 2 h plasma glucose (2-hpg) of ogtt concentration were measured using the glucose oxidase method, and serum lipid levels were measured using enzymatic assays with an autoanalyzer (hitachi, tokyo, japan). plasma concentrations of fasting true insulin (fti) and 2 h insulin of ogtt were measured by enzyme linked immunosorbent assay (elisa) with model 680 microplate reader (bio - rad, america). the elisa kits were purchased from uscnlife company, america (intra - assay 0.05). diastolic blood pressure (dbp), systolic blood pressure (sbp), fpg, 2-hpg, triglycerides (tg), sf, and homa - ir were all significantly higher and high density lipoprotein cholesterol (hdl - c) was significantly lower in the dm subjects than igr and ngt subjects (p < 0.05). fti was decreased in the dm subjects than igr subjects (p < 0.05). fpg, 2-hpg, fti, tg, sf, and homa - ir were all significantly higher in the igr subjects than ngt subjects (p < 0.05). homa-, 2 h insulin were decreased and wc was increased in the dm and igr subjects than ngt subjects (p < 0.05). after adjustment for age and gender of the partial correlation analysis showed that sf positively correlated with fpg (r = 0.451, p = 0.000), fti (r = 0.455, p = 0.000), tg (r = 0.383, p = 0.003), and homa - ir (r = 0.482, p = 0.000) (table 2). when homa - ir was considered as the dependent variables in a multiple regression analysis with age, sex, wc, sbp, dbp, 2-hpg, 2 h insulin, tg, hdl - c, and sf as independent variables, sf (= 12.13, p = 0.023) and tg (= 0.102, p = 0.041) maintained independent association with homa - ir (table 3). when homa- was considered as the dependent variables in a multiple regression analysis with age, sex, wc, sbp, dbp, 2-hpg, 2 h insulin, tg, hdl - c, and sf as independent variables, 2-hpg (= 0.101, p = 0.013) maintained independent association with homa- (table 4). in the present study, we found that the sf levels significantly increased in nonobese adults of china when the glucose metabolic disorder was deteriorated. our results showed that, in different glucose metabolism, the increased sf levels were associated with the increase of fpg, blood pressure, triglycerides, and homa - ir. however, compared with increased sf levels, hdl - c level was lower in different glucose metabolism in nonobese adults. it is well known that obesity, hyperglycemia, hypertension, and dyslipidemia are the main components of the metabolic syndrome. our results further illustrated that abnormal glucose metabolism, hypertension, dyslipidemia, insulin resistance, and high sf levels were synchronous when the interference factors of obesity were avoided. in our study, there was positive correlation between fpg, fti, tg, homa - ir, and sf levels. in multiple linear regression analysis showed that elevated sf levels and tg were significant independent predictors for homa - ir. however, 2 h plasma glucose was significant independent predictor for homa-. our findings provided us with new evidence of sf being regarded as a biomarker for insulin resistance but not relevant with beta cell function. several studies showed the association between sf and diabetes, and most of them were based on caucasian samples [1214 ]. however, the observation in north indians was in sharp contrast to the earlier studies published from the west stressing that sf was increased in obesity and diabetes. they conclude that sf may not be a strong risk factor in the pathogenesis of obesity and diabetes. in 2014, a cross - sectional survey of 8,235 participants in china reported that elevated sf levels were associated with higher risks of diabetes, higher levels of hba1c, and homa - ir independent of several confounders. recent studies reported higher sf levels were associated with diabetes incidence in an elderly chinese population and korean men. of course the exact mechanism of the association between sf and diabetic disorder remains to be clarified. so far, several possible biological pathways might be proposed to explain the observed findings. firstly, sf is regarded as a biomarker of body iron store, whose catalytic effects could induce lipid peroxidation. secondly, excess body iron may be directly involved in insulin signaling and is able to form highly reactive free radicals, which can lead to disturbed glucose metabolism and subsequent hyperglycemia. finally, there are some evidences of a relevant relationship between sf levels and inflammation. in addition, hepcidin, a peptide made in the liver, is elevated in response to hypoxia or inflammation and is correlated with increases in ferritin. it has been suggested that leptin seems to induce the expression of hepcidin via the jak2/stat3 pathway [23, 24 ]. admittedly, our study had some limitations that deserved to be considered when interpreting the results.. we can not determine the causal relationship between sf and glucose metabolism in nonobese han adults. experimental and prospective studies are warranted to elucidate the role of sf in glucose metabolism. many of the research conclusion showed that gender might modify the effects of sf on diabetes and insulin resistance [5, 16, 2527 ]. this might be merely statistical interaction, which does not mean biological interaction between gender and ferritin. therefore, the longitudinal relationship study between sf levels and glucose metabolism in nonobese han adults needs to be confirmed. in conclusion, ferritin concentration in igr and dm subjects of nonobese already significantly increased when compared with ngt subjects of nonobesity. elevated sf levels are associated with insulin resistance and may be not associated with the decline of insulin beta cells in different status of glucose tolerance in nonobese han adults. | the exact mechanism through which elevated serum ferritin promotes the development of type 2 diabetes is unknown. this study showed that ferritin concentration in impaired glucose regulation and newly diagnosed diabetes mellitus subjects of nonobesity already significantly increased when compared with normal glucose tolerant subjects of nonobesity. elevated serum ferritin levels are associated with insulin resistance and may be not associated with the decline of insulin beta cells in different status of glucose tolerance in nonobese han adults. |
the hematopoietic system is a complex hierarchical structure that produces several different types of specialized blood cells, most of which are short - lived and thereby require continuous replenishment with hematopoietic stem / progenitor cells (hspcs). autologous or allogeneic transplantation of hspcs is widely used to reconstitute functional hematopoiesis in patients with hematological diseases (cavazzana - calvo., 2013,, 2014, jenq and van den brink, 2010, mohty., 2014, naldini, 2011, williams, 2013). despite the well - established clinical use of hspcs, their short- and long - term fate after transplantation and the clonal dynamics of hematopoietic reconstitution in humans remain poorly understood. over the past few years, a series of phenotypic and functional characterization studies have identified various hspc subpopulations within cells expressing the cd34 antigen, including hematopoietic stem cells (hscs), which are the most undifferentiated stem cell type, and multipotent progenitors (mpps), which are downstream of the differentiation hierarchy but still capable of multilineage output (doulatov., 2012). different cell hierarchies of human hematopoiesis have been proposed, including the early branching of myeloid and lymphoid lineages (akashi., 2000, kondo., 1997) or the ontological proximity of lymphoid lineages to myeloid compartments due to the existence of a myeloid - primed lymphoid progenitor that is distinct from hsc (ema., 2014, data on hspc activity have been collected mainly through in vitro assays or using humanized, wild - type animal models (babovic and eaves, 2014, benveniste., 2010, cheung., 2013, nolta., 1996, barcoded vector libraries and retroviral integration sites (iss) have been used to track hspcs upon transplantation in small animal models and in non - human primates (dykstra and bystrykh, 2014, gerrits., 2010, kim., 2014, naik., 2013, peri., 2014, wu., 2014). additionally, recent mouse studies marking hspcs in vivo suggest that unperturbed hematopoiesis may be driven more substantially by mpps rather than by hscs (sun., 2014). ideally, hematopoietic clonal dynamics should be studied by tracking the fate of individual clones in humans, revealing the rate and extent of hematopoietic recovery after transplant, and evaluating the possibility of long - term exhaustion due to in vitro cell manipulation. such a study would have highly relevant implications for the broad clinical use of hspcs and the long - term prognosis of treated patients. ex vivo gene therapy (gt), based on the permanent gene correction of human hspcs through the transfer of a therapeutic gene using retroviral (rv) or lentiviral (lv) vectors, has recently provided preliminary evidence of safety and efficacy for the treatment of various blood - borne genetic disorders (aiuti., 2009, aiuti., 2013, biffi., 2013, candotti., 2011, hacein - bey abina., 2015, hacein - bey - abina., 2010, naldini, 2011, naldini, 2015, williams, 2013). following gt, each vector - marked cell is univocally barcoded by a vector is, providing an ideal setting for the study of human hematopoiesis (naldini, 2015). we and others have already shown that is - based tracking can be exploited to study the clonal composition of engineered cells and to assess the safety of gene transfer as well as the in vivo engraftment of marked hspcs (aiuti., 2007, aiuti., 2013, in the present study, we used is - based clonal tracking on individually purified lineages to examine early and late human hematopoiesis up to 4 years after transplant in the context of lv gt for wiskott - aldrich syndrome (was), an inherited disorder characterized by thrombocytopenia, bleeding episodes, eczema, and immunodeficiency (aiuti., 2013). we measured, at qualitative and quantitative levels, the contribution of progenitors to an extensively engineered hematopoietic system and assessed over time the in vivo clonal relationships among blood cells, providing crucial information on human hematopoietic dynamics. during a 3- to 4-year follow - up period, we studied the clonal dynamics and relationships of gene - corrected cells in four was patients treated with lv hspc gt (aiuti. the patients received an average cell dose of 10.8 million cd34 cells / kg, with gene - correction efficiency ranging from 88% to 100%. all patients were alive and well after gt, with no reports of eczema or major bleeding episodes. patients showed multilineage reconstitution of engineered cells, and no sign of severe adverse events related to treatment (aiuti. we collected is from eight distinct peripheral blood (pb) and seven distinct bone marrow (bm) lineages, as well as from whole pb, whole bm, and mononuclear cell samples using a combination of linear - amplification - mediated (lam)-pcr and next - generation sequencing (ngs) technologies. this yielded 28,601,017 sequence reads, which were mapped to 89,594 individual iss (tables 1 and 2). sequence reads belonging to each is were used as surrogate markers of relative clonal size. we first estimated the evolution of the clonal repertoire of gene - corrected cells over time by calculating the diversity index for each sample and time point on the basis of richness (number of unique iss marking individual clones) and evenness (relative clonal contribution in terms of sequence reads associated to each is). the diversity index of pre - infusion samples was consistent among patients, ranging between 5.6 and 6.2 (figure 1a), and represented the highest average level of polyclonality observed, as expected from a heterogeneous population containing a large number of committed non - engrafting progenitors. after intravenous infusion in patients, we found that the diversity of the clonal repertoire of genetically engineered pb cells was lower in the early phases of hematopoietic reconstitution. it then stabilized in all patients after the first 69 months and remained steady until the last follow - up at 4 years after gt (diversity index ranging from 3.6 to 5.9 ; figure 1a). in particular, when analyzing individual lineages, including bm samples, we observed fluctuation of the diversity index during the first 3 months after gt (figures 1b and s1). lymphoid cells displayed lower diversity in the early months after gt compared to myeloid lineages, in concordance with previously observed delayed lymphoid reconstitution (aiuti. conversely, myeloid cells better mirror the early clonal dynamics of bm cd34 progenitors when compared to b and t lymphocytes (figure s1). since the differences in diversity might be affected by an uneven collection of iss over time, we compared diversity on randomized subsamples of identical amounts of iss, confirming that in both myeloid and lymphoid lineages, the highest diversity in vivo was observed at the last time points, irrespective of the is sample size (supplemental experimental procedures). to evaluate whether clonal relationships among lineages and time points also changed over time, we calculated pairwise positive associations on the basis of the sharing of identical iss between two cell types (supplemental experimental procedures). the most stable sharing of identical iss was observed over a period ranging from 36 to 48 months post - gt (figure s2). this outcome was not influenced by potential background detection of is contaminants associated with a low number of sequence reads, as these results were confirmed even after stringent data filtering to progressively remove poorly represented iss from the datasets (supplemental experimental procedures). although population size estimates have been performed in animal clonal tracking studies (kim., 2014), there is currently no information available on the number of clones that make up different cell compartments derived from transplanted hspcs in humans in steady - state hematopoiesis. in order to comprehensively address this point, we first calculated the probability of recapturing identical iss within the same lineages over time. we observed a general increase in the probability of recapturing identical clones over time, which reached a stable level at 12 months after gt (supplemental experimental procedures). on the basis of these results, we then estimated, using markov processes enclosed on an open population estimator, the number of clones making up different pb lineages isolated after 12 months (supplemental experimental procedures). as shown in figure 1c, the estimated population size of differentiated pb gene - corrected clones was constant over a period of 23 years in all patients, ranging between 1,600 and 4,300 clones. the estimated total number of clones differed between lineages and was greater in the lymphoid compartment than in the myeloid one (figure 1d). this result is consistent with the longer survival potential of lymphoid cells and with the early effects of selective advantage for gene - corrected lymphocytes expressing was protein (aiuti., 2013, the number of clones was higher in the early post - gt phase and decreased over the following months to a smaller steady - state population composed of 1,200 clones (supplemental experimental procedures). in order to study the clonal output of transduced progenitors to differentiated lineages, we evaluated the level of is sharing between bm cd34 and myeloid or lymphoid cells over time. as shown in figure 2a, the percentage of iss shared between cd34 cells and myeloid or lymphoid lineages was much lower in early versus late time points, the lowest being at 3 months after gt. the nature of the output measured at later time points was predominantly bi - potent (myeloid and lymphoid), reflecting the activity of multipotent progenitors. although we applied stringent filters before performing this analysis to account for potential cross - contamination, a similar trend was observed even when analyzing the entire dataset (supplemental experimental procedures). this suggests that the observed increase in shared integrations reflects an underlying biological phenomenon and is not simply due to technical artifacts of potential contamination among purified subpopulations, which would not be expected to change owing to the time of collection. we then expanded the analysis of cd34 cell output to all lineages isolated from the bm and pb of was patients over time. area of the plots in figure 2b shows the is percentage shared between bm cd34 cells and each of the purified cell subtypes. during the first 3 months, we observed a shrinkage in output toward all lineages analyzed for each patient. starting at 6 months, the level of is sharing increased, and progenitor output was highly distributed to all lineages. this substantial multipotent output was consistently maintained up to 3 years after gt. to formally validate is sharing as being representative of progenitor activity, we isolated iss from colony - forming cells (cfcs) generated in vitro from the same cd34 cells analyzed above at the last follow - up when patient hematopoiesis was steady state. these represented highly purified samples, in which at the end of clonogenic assay, contamination with mature cells from the original harvest was virtually absent. the average vector copy number (vcn) of vector - positive cfcs, at the latest follow - up available, ranged from 1.2 to 1.7. as shown in table s1, we observed a substantial percentage of is retrieved from cfcs in each patient analyzed, identical to those detected in myeloid and/or lymphoid cells isolated in vivo at the same time point. to gain additional information on hspc activity, we then studied the datasets from the opposite perspective, evaluating the input level that each lineage received from cd34 cells at different time points. figure 2c shows on a heatmap the proportion of iss within each lineage and time point shared with cd34 progenitors over time. in line with the data reported above, the greatest is similarities between different cell types and bm cd34 cells unsupervised clustering for lineages and sources showed that pb lymphoid cells, myeloid cells, and megakaryocte - erythroid progenitors clustered separately from each other on the basis of their relationships with bm cd34 precursors. cd56 natural killer (nk) cells isolated from bm or pb were found to be co - clustered with myeloid cells purified from pb and not with lymphoid t cells that were rather grouped independently. previous studies using xenotransplantation assays have identified the human lin / cd34/cd38/cd90/cd45ra fraction as being endowed with long - term repopulation potential (doulatov., 2012, laurenti and dick, 2012, laurenti., 2013, majeti., 2007). recent studies on mice have questioned, however, whether hscs and/or mpps are responsible for the steady - state maintenance of blood cell production in humans (sun., 2014). to address this point, we used fluorescence - activated cell sorting (facs)-sorted hsc (defined as lin / cd34/cd38/cd90/cd45ra) and mpp (defined as lin / cd34/cd38/cd90/cd45ra) progenitor subpopulations from cd34 cells isolated from the bm of two was patients at 36 months after gt, and we collected iss from each subtype (supplemental experimental procedures). using is analysis, we backtracked the activity of 51 hsc and 10 mpp genetically engineered clones in the two patients. the heatmap in figure 3a, at 36 months after gt, shows that 15 out of 51 and 8 out of 10 iss isolated from hscs or mpps, respectively, were detected in at least one other lineage and time point. the majority of iss collected from hscs and mpps could be traced back over multiple lineages isolated at different time points, but their activity appeared more consistent after the first 36 months following gt. to evaluate the real - time output of these clones on the bm and pb of was patients, we quantified the contribution in terms of the sequence reads of these is on whole bm, whole pb, and mononuclear cell samples collected at 36 months after gt (figure 3b). in line with their predicted biological behavior from xenotransplantation studies, only a fraction of the hscs appeared to be actively contributing to the hematopoietic output at the time of sampling, while almost all mpps were doing so. nonetheless, hsc clones displayed a higher contribution to the pb and bm samples of the same time point compared to mpp clones. we also quantified the output of hscs and mpps over all time points by calculating sharing scores, i.e., the level of identical iss detected in hscs or mpps and various myeloid and lymphoid lineages over time (supplemental experimental procedures). as a result, we found that both hsc and mpp clones isolated at 36 months after gt had actively participated in myeloid and lymphoid production for a period of 2.5 years, starting from 3 to 6 months after infusion of gene - corrected cd34 cells (figure 3c). the level of detail achieved by our is - based clonal tracking might allow assessment of the hierarchical relationships among engineered blood cell types in humans. to test the validity of different models of hematopoietic hierarchy, we first evaluated the overall biological consistency of four different parameters of molecular tracking in steady - state hematopoiesis (figure 4a). the percentage of shared integrations was higher in bm cd34 cells, consistent with the hierarchical level of these precursors compared to other subtypes, while it was lower in the lymphoid compartment. conversely, the number of unique iss, the diversity index, and the vcn were generally higher in lymphoid cells, in agreement with the selective growth advantage effect of gene - corrected clones belonging to this lineage. in addition, the lower number of iss and the lower diversity of bm- versus pb - derived myeloid progenitor and mature cells might reflect the effect of sampling from a localized tissue site versus the pb, which should more homogeneously represent overall output. on the basis of these results, we studied is similarities among lineages purified from the first three was patients at the last bm and pb collection to infer and test hematopoietic cell hierarchies by combining conditional probability distributions and graphical models of dependencies (figure 4b ; supplemental experimental procedures). in model 1, we assumed that the observation of a specific is in a myeloid progenitor only conditions the probability for the same is to be observed in a mature myeloid cell. these constraints were designed to recapitulate at best, with our given set of data, a model where myeloid and lymphoid cells are segregated early in the hematopoietic hierarchy and should be marked by a significantly distinct set of iss. in model 2, we assumed that the observation of a specific is in a myeloid progenitor conditions the probability for the same is to be observed in both myeloid and lymphoid cells. this model was designed to test the existence of a higher clonal relationship between myeloid and lymphoid cells as compared to model 1, due to a late segregation of myeloid and lymphoid compartment downstream of the hematopoietic hierarchy. given these underlining structures, we tested our is data collected from was gt patients and measured which model best fit the observed distribution of shared iss along the lineages by means of the bayesian information criterion (bic) (supplemental experimental procedures). as a result, the best - scoring model, based on is tracking data, was model 2, which suggests the existence of a significant clonal relationship between myeloid and lymphoid lineages, i.e., we found that the probability of detecting an is in a pb lymphoid lineage was significantly dependent on having observed the same is in a bm myeloid precursor. we then added a dynamic component to the analysis of clonal relationships, making use of sequence reads as surrogate markers of clonal dimensions. this method is based on the assumption that at time 0, transduced bm cd34 cells re - infused into patients have been unequivocally marked by is coordinates. each individual cell fate is determined by a stochastic sequence of events of three different types : duplication, death, and differentiation into more committed cell types. rates governing this dynamic evolution are assumed to be constant over time, shared among cells belonging to the same lineage but different across them. the result is that each cell behaves independently, and the collections of observed clone dynamics correspond to trajectories of the same underlying stochastic process. on the basis of these assumptions, it is possible to simultaneously impose branching structures and make inferences about rates (figure 4c, left schematic representation ; supplemental experimental procedures). in an exploratory setting, we only constrained the differentiation process according to three levels of hierarchy, where we assumed that bm cd34 cells can differentiate into any other cell type in the bm and pb, bm can be connected to any cell type at the bm and pb level, and pb lineages can not differentiate. the output of the procedure was a matrix of rate estimates (supplemental experimental procedures) on which we performed principal - component analysis (pca) to calculate the clonal proximity of different lineages (figure 4c, right pca plot). in the resulting graph, the closer two or more lineages, the higher their similarity based on estimated duplication, death, and differentiation rates. in line with their differentiation potential and in concordance with the long - term preservation of engrafted progenitors, bm cd34 cells (in green) were distinct from the other lineages and displayed positive duplication - death rates (supplemental experimental procedures). importantly, as expected from their different biological activity, the bm progenitors and pb mature cells were clustered separately according to the three estimated parameters of duplication, death, and differentiation used as input for the pca analysis. another important validation of the analysis relied on the observation that the duplication - death rates were negative in all pb lineages (supplemental experimental procedures), confirming that these populations require a clonal supply from the upstream progenitors. the biological consistency of these results allowed interrogating the pca analysis on more refined questions, as clustering pb populations according to similar population rates. within the pb cells, the algorithm clustered together lymphoid t and b cells, most likely due to their common capacity of long - term survival and clonal supply from shared lymphoid progenitors. notably, these estimates again revealed a proximity between nk and myeloid cells, suggesting a parallelism in population rates that might derive from a potential common origin of these two lineages. this dynamic model also allowed the investigation of candidate branching structures to confirm the validity of those findings obtained with the bayesian approach, as shown in figure 4b. to achieve this, as reported in the supplemental experimental procedures, we imposed a set of constraints to test which of the models proposed in figure 4b was more supported by the experimental data. the results suggest again that the empirical data appear to support a structure implying late branching of myeloid and lymphoid lineages. the permanent molecular marking achieved by vector integration has the inherent potential to induce clonal skewing in vivo due to insertional mutagenesis (biasco., 2012). we thus assessed whether major clonal imbalances could be observed over time in the pb of our patients, which might affect the interpretation of our is data. as reported in figure s3, none of the four gt - treated patients showed overrepresented clones (composing > 20% of analyzed whole blood), and we could not detect any evidence of is - driven proto - oncogene perturbations leading to clonal dominance up to 48 months after gt. moreover, the profile of genes neighboring vector iss (figure s4) was in line with known lv insertional preferences and was still comparable with that shown for the early follow - up of was gt patients (aiuti., 2013). we herein described a detailed clonal tracking of hematopoietic reconstitution dynamics and hspc activity in humans at the early and late stages after autologous transplantation. the number of tracked clones, homogeneously contributing to hematopoiesis in a highly polyclonal fashion, and the multiple cell types analyzed permitted comprehensive and detailed observation of the fate of human blood cells. furthermore, as long - term monitoring using is analyses, peripheral blood tcr vbeta analyses, multiple bm evaluations, karyotypic analyses, and clinical observation continues to show a lack of evidence for genotoxicity (naldini, 2015), we can consider lv genome marking to be mostly neutral, thus providing a reliable tool for studying human hematopoiesis in vivo. to address all the potential limitations of our analytical methods, we used multiple approaches and stringent filtering criteria. we exploited the statistical methodologies used in ecology, which are specifically designed to account for sampling variability. we also introduced customized data filtering to reduce the confounding effects of sample impurity after sorting, and we assessed and limited the impact of cross - contamination during processing. to reinforce our results, we applied additional filters and modeling constraints to account for pcr - related biases affecting sequence reads and assessed the accuracy of is identification and quantification using dedicated validation assays (see supplemental experimental procedures). we analyzed several parameters at the individual lineage level and unveiled the presence of two phases of human hematopoietic reconstitution, and we provide an estimate of the number of engrafted clones actively contributing to long - term hematopoiesis after transplantation. we showed that the reconstitution of human hematopoiesis early after autologous transplantation is characterized by fluctuating phases and that steady - state hematopoiesis is reached at 612 months. the clonal repertoire diversity of each population in vivo was consistent with the longer time needed to achieve lymphoid reconstitution and with the presence of unevenly active clones in the initial reconstitution phases after gt. our clonal population estimates revealed that only a few thousand clones appear responsible for the maintenance of the whole engineered blood system in steady state. in our gt trial, we infused 80230 million cd34 hspcs per patient (aiuti. considering that the gene - correction frequency of infused cd34 cells was above 88%, our estimates suggest that about 1 in 1010 gene - corrected hspcs had the potential to engraft long - term. despite the fact that we could not measure the actual number of infused hscs and the potential biases related to clones bearing more than one integrant, this estimate would fall in the upper range of our predictions, according to the marking level of vector - positive cd34 cells before infusion, indicating that cell culture and transduction did not induce a substantial loss of harvested hscs. the estimated higher clonal abundance of bm cd34 cells in early versus steady - state phases of hematopoietic reconstitution might suggest that the first wave of short - term precursors involves a larger population compared to that composed of long - term engrafting hspcs, which takes over hematopoiesis only after 36 months. these results confirm and expand the information previously generated from clonal tracking in non - human hspcs (dykstra and bystrykh, 2014, gerrits., 2014, wu., 2014). unlike previous studies, our clonal tracking was performed not only on pb mature populations but also on bm progenitors purified at different time points, allowing real - time analysis of progenitor output. our data suggest that the first phases of hematopoietic reconstitution are most likely sustained by lineage - committed progenitors that are possibly primed during in vitro manipulation and are more numerous in the graft upon infusion. we were able to identify a switch 6 months after gt when we observed exhaustion of the first wave of clonal reconstitution, reduction in the total number of cd34 clones, and progressive takeover of long - term hscs, generating a stable output up to the last follow - up 3 years after gt. there was little evidence of lineage output from long - term hscs during the first 6 months post - gt, indicating a sharp segregation of tasks among the engrafting progenitors, with cells contributing to early hematopoietic recovery being short - lived and mostly of restricted lineage potency, and long - term multi - potent hscs apparently entering quiescence within this time. we considered that potential uneven distribution of early engrafting clones in the bm niches might affect the detection of hscs active in early versus late phases. however, the tracking of pb cells, and in particular of pb myeloid populations (a recognized surrogate readout for progenitor activity), also confirmed the independent clustering of two distinct clonal waves in pb lineages that are, by definition, much less affected by sampling biases than topologically localized bm hscs (figure s2). our clonal characterization of bona fide hscs and mpps isolated from patients at 3 years after gt showed that at least a fraction of bm - resident hscs actively contributes to the hematopoietic output in real time at the time of analysis (figure 3b). the relative fraction of hsc clones involved in hematopoietic production was lower compared to mpps (30% versus 80%), indicating that a substantial proportion of hscs is dormant for a prolonged time. nonetheless, we achieved formal proof of the ability of individual human hsc clones to constantly self - renew and differentiate in vivo over a period of up to 3 years. the absolute number of clones identifiable over time (15 versus 8) and the extent of overall multilineage output (figure 3c) were greater for hscs than for sampled mpps. intriguingly, these data appear to partially differ from what was reported in a recent work, where the authors suggest that native steady - state hematopoiesis might be more actively supported by mpps than by hscs (sun., 2014). one remarkable result of our analysis was that both progenitor subtypes isolated at steady - state hematopoiesis contained clones whose activity could be tracked back to 36 months after gt, but not earlier. although obviously present in the engrafted pool of hspcs, these clones could not be identified as being active in the first months after gt. this suggests that hsc clones were, for the most part, maintained quiescent until the first active set of committed progenitors reached exhaustion and potentially made space in the bm for the activation and expansion of long - term hsc clones and their differentiation inside committed progenitor niches (morrison and scadden, 2014). in this context, one could postulate that the mpp clones isolated at 3 years, and showing peripheral output well before, had an hsc phenotype at previous time points. it is still possible, however, that mpps, contained in the infused sample of transduced cd34 cells, engrafted and preserved their phenotype and might thus be endowed with long - term self - renewing potential like hscs. additional investigations are underway based on the prospective tracking of different subsets of human hspcs. our results on is - based tracking were consistent with the current understanding of the biology of the hematopoietic system and showed important parallelisms with data derived from the tracking of normal hematopoiesis in animal studies. in particular, our proposed model of human hematopoietic reconstitution is in agreement with the nature of blood cell repopulation reported in wild - type rhesus macaques after transplant with genetically modified hspcs (kim., these similarities include (1) the observed timing of exhaustion of the first wave of short - term progenitors, (2) the stable contribution of multipotent progenitors with a balanced myelolymphoid potential at steady state, and (3) the estimated relative small fraction of stem cell clones actually contributing to the long - term clonal output. our findings constitute a comparative platform to test the validity of animal studies in recapitulating human hematopoiesis and could be of significant help on refining and reducing the use of animals in future preclinical xeno - transplantation studies. importantly, these observations strongly suggest that although clonal tracking studies in humans can be conducted, by definition, only in the context of clinical trials based on the genetic correction of a diseased background, hematopoiesis in our was gt patients was, for the most part, restored with physiological reconstitution dynamics to normal levels. indeed, hematological and clinical parameters of the patients (including bm and pb cell counts, immune phenotype, morphology, and karyotype as well as the number of cd34 progenitor cells), with the exception of platelet counts, are all comparable to those of healthy untreated age - matched individuals (unpublished data). given the initial lymphopenic environment and the fludarabine conditioning, the dynamics of lymphoid reconstitution observed in the peripheral blood of was patients during the early phases after gt could partially differ from other allogeneic hspc transplantation settings (alho., 2016, moratto., 2011, pai., 2006, importantly, in was patients showing normalization of lymphocytes content after allogeneic hspc transplantation, t cell counts reached a plateau at 12 months after transplant (pai., 2006), a result in agreement with our data on lymphocyte recovery dynamics. it will be also important, in future studies, to compare the pattern of reconstitution in our patients with those observed in other gt trials using myeloablative conditioning and in disease contexts where no selective advantage for gene - corrected lymphocytes is expected (biffi., 2013, cartier., 2009). still, the nature of hematopoietic reconstitution in was patients does not suggest that there is an original defect in the progenitor niches of the lymphoid compartment. actually, most of the selective advantages for gene - corrected lymphocytes occur at later stages of maturation, indicating that, upon correction of the genetic defect, the normally engrafting progenitors became able to fully overcome the cell - intrinsic differentiation defect (aiuti., 2013, as all patients reached a normal and stable hematopoietic output at 12 months after gt, we reasoned that this clinical setting represents a valid model to interrogate steady - state blood cell production in humans. with the application of model - driven statistical approaches, we showed that the probability of observing an is in a mature lymphoid cell was statistically dependent on observing the same is in a myeloid progenitor (figure 4b ; supplemental experimental procedures). these data support the recently proposed myeloid - based model of hematopoiesis, envisaging the existence of common myelolymphoid progenitors distinct from the hsc (kawamoto., 2010b). the dynamic framework developed for this study, employing individual clonal sizes to estimate death, duplication, and differentiation rates, was coherent with the accepted biology of the hematopoietic system and allowed unsupervised clustering of bm and pb lineages. within the bm compartment, cd3 and cd14 cells were distinct from the other bm lin cells. this might be due to the fact that some or most of these cells re - circulated from other sites to the bm at the time of collection, therefore being genealogically distinct from the locally sampled bm precursors. with regard to pb cell types, both our statistical model and the unsupervised clustering of clonal relationships with cd34 cells shown in figure 2c support the notion that nk cd56 cells might have a distinct origin compared to other lymphoid cells and are possibly more closely related to the myeloid lineage. these results match the observations recently made in non - human - primate clonal tracking studies, on the basis of which wu. model, in which human nk cells are able to differentiate from myeloid progenitors (grzywacz., overall, we believe that the statistical and mathematical models developed for this study represent valid instruments to investigate complex biological processes, such as the shape of hematopoietic differentiation in vivo in humans using is analysis. future refinement of these tools might increase the resolution and precision of the assessment of clonal relationship and behavior. no progressive clonal expansion was detected in any of the studied patients, and we can reasonably assume that the proportion and impact of clones representing > 5% of the population on our analysis of clonal dynamics is negligible (7 putative overrepresented clones out of 89,594 tracked clones, or 0.008% of the analyzed population ; figure s3). these data strongly suggest that our tracking system was not substantially affected by vector - related aberrant clonal skewing. we herein provide a comprehensive clonal tracking of hematopoietic reconstitution after hspc transplantation in humans. the information collected in our study validates some long - standing models regarding human hematopoiesis and sheds light on the clonal dynamics of blood cells in vivo at early and late stages, as well as on hspc activity in steady - state hematopoiesis in humans. in addition, our results further establish the potential of the safe and extensive engineering of human hematopoiesis with ex vivo lv gene transfer. these data provide a crucial reference for the follow - up of ongoing hspc gt clinical trials and will be critical in designing novel approaches for the treatment of a wide spectrum of hematological disorders. four male was patients (age range, 1.15.9 years) for whom no human leukocyte antigen (hla)-identical sibling donor or suitable matched unrelated donor was available, underwent lv gt at a median age of 2.75 years after a reduced - conditioning regimen protocol (aiuti., 2013, castiello., 2015, cicalese and aiuti, 2015) (http://www.clinicaltrials.gov, # nct01515462). cd34 cells were isolated from the bm of all patients (for patient 1, a proportion of cd34 cells were also isolated from granulocyte colony - stimulating factor [g - csf ] mobilized pb), transduced ex vivo with the lv w1.6w vector, and reinfused at a similar dose ranging from 8.9 to 14.1 cd34 cells / kg. clinical protocol, cd34 transduction conditions, methods to calculate transduction efficiency, vcn of infused cells, and measurement of clinical endpoints have been reported elsewhere (aiuti., 2013). all patients treated with lv gt in this study are alive and clinically well at the time of submission of this report. patients recovered from transient neutropenia following chemotherapy, showed gradual reduction in the frequency and severity of infection and bleeding, and became independent from platelet transfusion. no clinical manifestations of autoimmunity were observed after year 1 of follow - up, and no adverse event associated with vector integration has been reported to date (unpublished data). biological samples were obtained from was patients, with the approval of the san raffaele scientific institute s ethics committee, together with consent from patients or parents. cd3, cd4, cd8, cd14, cd15, cd19, and cd56 cells were purified from mononuclear cells (mncs) from pb. cd3, cd14, cd15, cd19, cd34, cd56, cd61, and glycophorin (glyco) cells were purified from bm - derived mncs using positive selection with immunomagnetic beads (average purity, 94.2%) according to the manufacturer s specifications (miltenyi biotec). whole pb, peripheral blood mononuclear cells (pbmcs), whole bm, and bm mncs were also collected. a cfc assay was performed on ex vivo bm cd34 cells according to the manufacturer s specifications in methocult medium (stemcell technologies). at day 14, colonies were collected and genomic dna was extracted for is retrieval. bone marrow mnc from was - gt patients were isolated using ficoll - hypaque gradient separation (lymphoprep, fresenius), and enriched for cd34 + cells with the human anti - cd34 microbeads isolation kit (miltenyi biotec) according to the manufacturer s specifications. to isolate hscs and mpps, cd34 cells were labeled with anti - human lin cocktail (anti - cd3/cd14/cd16/cd19/cd20/cd56), anti - cd15/cd34/cd38/cd45ra (biolegend), and anti - cd90 (bd biosciences) fluorescent antibodies and facs purified with the moflo - xdp cell sorter (beckman coulter), achieving purity ranging between 92% and 99%. in total, we collected 3,150 hscs and 2,300 mpps from patient 2 and 600 hscs and 155 mpps from patient 3 (see supplemental experimental procedures). iss were collected from bead - isolated or facs - sorted blood cell types through lam - pcr and high - throughput sequencing as previously described (aiuti., 2013). genomic dna from isolated cell types was extracted (qiaamp dna blood mini kit or micro kit, qiagen), and whole - genome amplification was performed (repli - g mini kit, qiagen) only on facs - sorted hsc and mpp populations as previously described (biasco., 2015). raw is datasets underwent a series of different filtering procedures, according to the type of analysis required (see supplemental experimental procedures). the methods, as well as the mathematical and statistical tools used for all analyses, are described in detail in supplemental experimental procedures. designed and performed is analyses, supervised the project, and wrote the manuscript ; d.p. designed and applied dynamic mathematical models of hematopoiesis ; s. scala and l.b.r. performed hspc progenitor purification and is retrieval from hscs and mpps ; f.d. and c.b. performed lam - pcr for all bm and pb patient samples and additional molecular testing for vcn estimation ; l.l. performed validation assays for is contaminations and quantifications ; s. scaramuzza and s.g. performed isolation of patient cell lineages ; f.f. and m.p.c provided was patients bm and pb samples and clinical data ; v.n. and d.j.d. provided technical support for the is collection from pt13 at early time points after gt ; m.s. and c.v.k. provided sequencing platform and technical support for pt2 collection of is at 4, 5, and 5.5 months after gt ; m.g.r. and f.c. contributed as principal investigators (pis) of the tiget - was clinical trial by interpreting clinical data ; p.v. designed and tested the networks of hematopoietic hierarchy ; c.d.s. and e.w. supervised the model design and the statistical analyses ; l.n. contributed to data interpretation and discussion ; a.a. contributed as pi by interpreting clinical data, supervised the project, and wrote the manuscript. l.n. is the inventor of various patents on lentiviral vector technology that are owned by the salk institute and cell genesis and licensed to lentigen. is entitled to receive royalties from one of these patents (us patent number 6,013,516 with salk institute). l.n. is a founder of, owns equity in, and chairs the scientific advisory board of genenta science, a biotechnology startup aiming to develop alpha - ifn gene therapy of certain tumor types using tumor - infiltrating monocytes. in 2010, telethon and osr, through tiget, entered a strategic alliance with gsk for the development, up to marketing authorization, of hematopoietic stem cell gene therapy for various rare diseases. whereas tiget remains responsible for the pre - clinical development and early clinical testing of such therapies, gsk has option rights once clinical proof of concept is achieved. in 2014, the gene therapies of metachromatic leukodystrophy (mld) and was were licensed to gsk, and gsk became the financial sponsor of the trials. | summaryhematopoietic stem / progenitor cells (hspcs) are capable of supporting the lifelong production of blood cells exerting a wide spectrum of functions. lentiviral vector hspc gene therapy generates a human hematopoietic system stably marked at the clonal level by vector integration sites (iss). using is analysis, we longitudinally tracked > 89,000 clones from 15 distinct bone marrow and peripheral blood lineages purified up to 4 years after transplant in four wiskott - aldrich syndrome patients treated with hspc gene therapy. we measured at the clonal level repopulating waves, populations ' sizes and dynamics, activity of distinct hspc subtypes, contribution of various progenitor classes during the early and late post - transplant phases, and hierarchical relationships among lineages. we discovered that in - vitro - manipulated hspcs retain the ability to return to latency after transplant and can be physiologically reactivated, sustaining a stable hematopoietic output. this study constitutes in vivo comprehensive tracking in humans of hematopoietic clonal dynamics during the early and late post - transplant phases. |
cold - induced panniculitis, with subsequent atrophy is a well - known phenomenon in both children and adults [13 ]. based upon observations of fat susceptibility to cold injury and a case report of popsicle panniculitis, researchers studied and developed controlled cryolipolysis ; the controlled application of cooling to non - invasively reduce subcutaneous fat. that study demonstrated fat reduction via examination by ultrasound and histopathologic evaluation ; safety data were collected in this animal model by demonstrating no skin injury and a lack of change in serum lipid levels following treatment. since then, there have been follow - up porcine and human clinical studies showing safe and effective cryolipolysis in a number of treatment areas including the abdomen, flanks, and thighs [713 ]. the safety of cryolipolysis treatments has also been demonstrated in clinical studies of cryolipolysis where serum lipid levels and liver function tests were performed, as well as peripheral nerve studies, all demonstrating no abnormalities following treatment. food and drug administration (fda) clearance for fat reduction of the flanks in 2010, for abdominal fat reduction in 2012, and for fat reduction of the thighs in 2014. studies have also demonstrated safety and effectiveness for treatment of undesirable fat in the back, arms, and chest [1619 ]. long - term persistence of fat reduction has been demonstrated in subjects treated to a single flank, to control for fluctuations in weight, for up to five years following a single treatment session. since flanks are perhaps the most commonly treated of all cryolipolysis sites, this study was intended to investigate improvements to flank treatment efficacy using a new cryolipolysis handpiece. previously, a moderately - contoured applicator (coolcurve, ez app 6.2, zeltiq aesthetics, inc., pleasanton, ca) was used for flank treatments. a new applicator with a sharply contoured vacuum cup and curved cooling panels (coolcurve+, zeltiq aesthetics, inc.) design changes were intended to provide improved patient fit and tissue draw for sharply contoured treatment sites such as flanks. this study investigates the safety and efficacy of two overlapping treatment cycles to the flanks using a sharply - contoured cryolipolysis vacuum applicator. this institutional review board (irb)-approved clinical study investigated the safety and efficacy of treatment with two cycles per flank, administered in two separate treatment sessions utilizing a new, sharply - contoured vacuum applicator (coolcurve+ applicator, zeltiq aesthetics, inc.) in treating unwanted flank fat on 20 treatment sites in 10 subjects. two cycles were delivered to each flank in a bilateral treatment protocol in a single office visit. investigator measurements show the previous generation contoured applicator (coolcurve) and the applicator evaluated in this study (coolcurve+) treat approximately the same volume of tissue. while the cooling plate sizes are similar, the new applicator has a curved edge to better fit a patient 's contour. the new applicator cup has approximately 1.6 cm longer ears (lateral edges) and an approximately 6 increased angle to better accommodate contoured treatment areas, such as flanks. subjects ranged from 33 to 56 years of age, averaging 42.2 years old and were all females. subjects selected for the study had clearly visible fat on their flanks, and a body mass index (bmi) of up to 30. bmi was measured after measuring a subject 's height and weight ; these values were entered into an online bmi calculator (bmi calculator, tim o 's studios, llc, austin, tx). for the duration of the study, subjects were instructed to avoid implementing major diet or lifestyle changes in order to maintain their weight within 5 lbs of baseline measurement. cryolipolysis treatment was delivered at a cooling intensity factor 41.6, corresponding to an average energy extraction rate of 72.9 mw / cm. the flank fat was drawn by moderate vacuum suction between cooled plates in the applicator. at the conclusion of each 60 minute cycle, the treatment area was vigorously massaged by hand for 5 minutes ; then the remaining flank fat was treated using the same protocol. thus, 4 cycles (2 per flank) were administered on the treatment day, treating both flanks with 2 cycles each, overlapping 50%. treatment efficacy was determined by blinded - expert analysis of clinical photographs viewed in pairs. at the baseline pre - treatment visit and 12-week follow - up visits, photographs were acquired using a standardized photography set - up using a professional digital camera with a 60 mm lens (d300 camera, nikon inc., melville, ny) with floor - standing, external, bilaterally - symmetrical strobe lighting, with 1,000 w heads and soft - boxes (dynalite, inc., subjects were photographed with their feet separated at a fixed distance using a foot positioning guide and arms in a fixed, standard position. at the completion of the study, clinical photographs were reviewed by four blinded, independent physicians to choose which photographs were pre- versus post - treatment photographs. the pre- and post - treatment photograph pairs for each subject were randomized and presented to the blinded, independent reviewers, then the reviewers were asked to determine which image was captured prior to treatment. the degree of improvement was quantified by three of the independent physician reviewers who graded each pair of photographs from 0 (none) to 10 (complete) removal of flank fat. for any photographs that were incorrectly identified as baseline images by a reviewer for example, an incorrectly identified baseline image that was scored an improvement score of 3 was scored as 3 in the data analysis. subjects ranged from 33 to 56 years of age, averaging 42.2 years old and were all females. subjects selected for the study had clearly visible fat on their flanks, and a body mass index (bmi) of up to 30. bmi was measured after measuring a subject 's height and weight ; these values were entered into an online bmi calculator (bmi calculator, tim o 's studios, llc, austin, tx). for the duration of the study, subjects were instructed to avoid implementing major diet or lifestyle changes in order to maintain their weight within 5 lbs of baseline measurement. cryolipolysis treatment was delivered at a cooling intensity factor 41.6, corresponding to an average energy extraction rate of 72.9 mw / cm. the flank fat was drawn by moderate vacuum suction between cooled plates in the applicator. at the conclusion of each 60 minute cycle, the treatment area was vigorously massaged by hand for 5 minutes ; then the remaining flank fat was treated using the same protocol. thus, 4 cycles (2 per flank) were administered on the treatment day, treating both flanks with 2 cycles each, overlapping 50%. treatment efficacy was determined by blinded - expert analysis of clinical photographs viewed in pairs. at the baseline pre - treatment visit and 12-week follow - up visits, photographs were acquired using a standardized photography set - up using a professional digital camera with a 60 mm lens (d300 camera, nikon inc., melville, ny) with floor - standing, external, bilaterally - symmetrical strobe lighting, with 1,000 w heads and soft - boxes (dynalite, inc., subjects were photographed with their feet separated at a fixed distance using a foot positioning guide and arms in a fixed, standard position. at the completion of the study, clinical photographs were reviewed by four blinded, independent physicians to choose which photographs were pre- versus post - treatment photographs. the pre- and post - treatment photograph pairs for each subject were randomized and presented to the blinded, independent reviewers, then the reviewers were asked to determine which image was captured prior to treatment. the degree of improvement was quantified by three of the independent physician reviewers who graded each pair of photographs from 0 (none) to 10 (complete) removal of flank fat. for any photographs that were incorrectly identified as baseline images by a reviewer, for example, an incorrectly identified baseline image that was scored an improvement score of 3 was scored as 3 in the data analysis. (mean 142.1 lbs.) with their bmi ranging from 21.1 to 28.1 (mean 24.3). of their initial baseline weights by the end of the study period (table1). subject weight and bmi data at the treatment visit, all subjects had bmi < 29 and agreed to maintain weight over the course of the study by avoiding diet and exercise changes. at 12-week follow - up, all subjects maintained weight within 5 lbs. of baseline. the photographic review attempting to identify which photographs were taken before and after treatment demonstrated 94% correct identification of baseline images by four blinded, independent physician reviewers. two reviewers correctly identified all baseline photographs and two reviewers each scored one incorrectly, thus 34 of 36 before and after pairs were correctly identified (table2). the 0 (none) to 10 (complete) mean improvement score as rated by three blinded physician reviewers was 4.3 1.4 (mean sem ; table2 ; figs. 1 and 2). independent photographic review and improvement score data four blinded, independent physicians correctly identified 94% of baseline images ; 34 of 36 correct. three physicians assigned improvement scores from 0 (none) to 10 (complete), resulting in a mean improvement score of 4.3 + 1.4 (mean + sem). clinical photographs show flank fat reduction between baseline (a, c) and 12 weeks post - treatment (b, d). this subject had a weight gain of only 2.6 lbs. from her initial visit until the end of the study. clinical photographs show flank fat reduction between baseline (a, c) and 12 weeks post - treatment (b, d). this subject lost only 0.9 lbs. from her baseline visit to her final photographic evaluation, 12 weeks later. side - effects were mild and were limited to erythema, edema, bruising, numbness, and tingling at the treatment site. all of the side effects resolved without intervention prior to the 12-week follow - up visit. this study demonstrates that the new cryolipolysis applicator with a more sharply contoured vacuum cup and curved cooling panels is both safe and effective for administering cryolipolysis treatments to the flanks. this study assessed treatment efficacy at 3 months ; whereas, other clinical studies evaluated patients at 4 and 6 months, thus the subjects presented in this study may attain some additional fat reduction with longer follow - up, or multiple treatment sessions as shown by brightman and geronemus. the newly - designed applicator was developed to increase tissue draw and improve fit for curved surfaces like the flanks, and should allow treatment of patients who may otherwise not be able to be treated with the conventional applicator, due to the inability to gain sufficient suction and fit to keep the applicator in place. improvement after a single treatment incorporating 2 cycles per side was a score of 4.3 on a scale of 0 (none) to 10 (complete). the mean 94% correct identification of baseline images by four blinded, independent physicians for this study was similar to the results shown by kaminer in a much larger study, and greater than that shown by garibyan. treated 11 subjects unilaterally on one flank and reported that blinded evaluators correctly identified the treated side in 79% of subjects. kaminer. showed a 92% correct identification of baseline photographs by blinded, independent reviewers that evaluated fifty subjects treated on the flanks. mayoral. treated 20 subjects to their lower abdomens and demonstrated an 86% correct identification of pre - treatment images. this study utilized conventional 2d photography to assess treatment efficacy, and was shown to produce visible improvement that was statistically significant when evaluated by blinded physician rating of digital images. fat reduction can also be objectively quantified by methods such as ultrasound and 3d vectra imaging, and these methods may have more sensitivity to measure more subtle differences. in this current study, it was fortunate that the simpler, and less expensive, method of photography demonstrated statistically significant improvement. future studies should employ multiple methods of evaluating fat reduction, to enable better comparison between different protocols. efficacy assessment by clinical photographs may be affected by patient weight change, but this is unlikely for the current study since the subjects had an average 1.5 lb. the weight loss is likely due to increased awareness of diet and exercise while in the study, rather than fat reduction from cryolipolysis, since small volumes of fat are removed during cryolipolysis. this modest weight loss is not expected to affect the clinical efficacy as evaluated by blinded photographic review, and likely falls within the resolution limits of daily variations in weight and scale accuracy. cryolipolysis has also been shown to be effective in treating areas not on the abdomen as well. administered treatments to the lateral thigh in 40 subjects and showed 87% correct identification of pre - treatment photos. munavalli treated 18 male subjects for pseudogynecomastia and that study demonstrated an 80% correct identification of baseline photographs. the significant efficacy of the sharply contoured vacuum cup applicator in the current study is consistent with other studies of cryolipolysis reported in the medical literature, as is the very low side - effect profile. future studies incorporating a series of treatment sessions to the same area should further the amount of improvement seen in the current study. treating even more sharply contoured areas such as this study demonstrated the safety and efficacy of a new, sharply contoured vacuum cup applicator administered for a single treatment using two overlapping cycles on two flanks. enhanced cryolipolysis clinical outcomes can be attained by selecting the appropriate applicator to maximize tissue draw for the intended treatment area and by delivering a sufficient number of cycles to adequately address the subcutaneous fat volume. the cryolipolysis treatment protocol should be customized to the individual in order to ensure high efficacy and patient satisfaction. | background and objectivesa sharply contoured cryolipolysis vacuum applicator was developed to improve fit and tissue draw in the abdomen and flanks to better accommodate a range of body types and a variety of treatment sites. this study was carried out to evaluate the safety and efficacy of the new applicator for treatment of flank fat (love handles).study design / materials and methodsa cryolipolysis vacuum applicator with a sharply contoured cup and curved cooling plates was used to treat 20 flanks. two treatment cycles were delivered sequentially to each flank (60-minute cycle at a cooling intensity factor of 41.6). efficacy was evaluated 12 weeks post - treatment by physicians performing blinded, independent review of clinical photographs. safety was assessed by the treating physician monitoring subjects for side effects and adverse events.resultsfour blinded, independent physician reviewers properly identified the pre- and post - treatment photographs 94.4% of the time. improvement was scored from 0 (none) to 10 (complete) and showed an average 4.3 point (43%) improvement. side - effects were limited to erythema, edema, bruising, and numbness or tingling at the treatment site, and resolved without treatment.conclusionsmultiple treatment cycles from a new improved - fit cryolipolysis applicator are safe and effective for reduction of flank fat bulges. a high degree of improvement was reported by blinded, physician evaluation of standardized photographs. laser surg. med. 46:731735, 2014. 2014 the authors. lasers in surgery and medicine published by wiley periodicals, inc. |
the size of the environmental legacy of tropical deforestation is dependent on both the magnitude and timing of past land cover changes, rather than the snapshot of forest cover that is directly observable today. we used a validated regional data - constrained spatial model of tropical deforestation to backcast deforestation from 2009 to 1950 in the three main tropical regions (figure s1) : the amazon, the congo basin, and southeast (se) asia, which was further divided into six sub - regional models (see supplemental experimental procedures and data s1). our model provided estimates of deforestation rates for the 1980s, 1990s, and 2000s that fell within the ranges reported previously for all three tropical regions (table s1). we estimate through our model that rates of tropical deforestation were very low in the 1950s and then accelerated first in the amazon in the 1970s, then in se asia in the 1990s and most recently in the congo basin (figure 1). this pattern is in line with accepted histories for the regions [7, 8 ], as is the slowdown in deforestation in the amazon after 2004 that our model also captured. combining potential vegetation carbon maps with our simulated historical deforestation maps, we estimated that the modern era of tropical deforestation resulted in cumulative emissions of 49.93 petagrams (pg) of vegetation carbon (1.99 pg, 95% confidence interval [ci ]) between 1950 and 2009. annual emissions from gross tropical deforestation rose sharply over the modern period to 2.30 pg of vegetation carbon per year (0.06 pg, 95% ci) by 2009 (figure 2a). even if deforestation had stopped completely in 2010, the vegetation carbon emissions debt of modern tropical deforestation ensured there was 8.6 pgc (2.24 pg, 95% ci) of committed emissions still to be released, equivalent to roughly 510 years of global deforestation. the legacy is highest in the amazon, where we estimated 3.72 pgc (1.10 pg, 95% ci) was still to be released. in se asia and the congo basin, we estimated the legacies to be 3.54 pgc (1.50 pg, 95% ci) and 1.34 pgc (0.34 pg, 95% ci), respectively, with the se asian legacy concentrated in the present - day deforestation hotspots of sumatra and southern borneo (figure 3). the amazon is the largest remaining continuous tropical forest and accounts for 49% of total tropical forest carbon stock, with the remainder shared roughly evenly between se asia (26%) and the congo basin (25%). over time, 28%66% of the gross emissions came from the amazon, an estimated 25%62% from se asia, and a much lower share of 9%14% from the congo basin (supplemental experimental procedures and figure s2). in each of the three tropical regions, committed gross emissions by 2009 accounted for 60% of the carbon emissions in that year. we estimated that modern gross deforestation has led to an extinction debt of 144 forest - specific vertebrate species (14, 95% ci) (figure 2b), which is a number 20% larger than the total number of extinctions known to have occurred in vertebrate groups since 1900 (n = 124). while se asia was responsible for the majority of this debt until the 1980s (50%70% ; figure s3), from the 1990s onward this legacy has been dominated by land cover changes that have occurred in the amazon (> 50%). the congo basin still represents a low share (5%) due to the slower rates of deforestation in this region. of the 4,125 forest - specific tropical vertebrate species (mammals, birds, and amphibians), 52% were found in the amazon, 38% in se asia, and 10% in the congo basin (supplemental experimental procedures). we estimated that a total of 41 vertebrate species (4, 95% ci) have already been driven irreversibly extinct, with the amazon being the region with the highest number of species lost by 2009 : 28 (2, 95% ci), compared to 15 (3, 95% ci) in se asia and only 1 (0, 95% ci) in the congo basin. our model predicted that 1.1% of tropical vertebrate forest - specific species would have gone extinct by 2010, similar to the 1.2% of forest - specific species that are classified as extinct by the iucn, indicating our model is accurately recreating the pan - tropical patterns of extinction threat to forest - specific vertebrate species. we found that within each tropical region, environmental legacies of past deforestation are not evenly distributed across space (figure 3). in the amazon, environmental legacies are broadly concentrated in the heavily deforested regions of the arc of deforestation along the southeastern rim of the amazon, whereas in the congo basin these are mainly concentrated in the south and eastern parts of the basin, where agricultural activity has been most intense. in se asia, there are large differences in the size of both environmental legacies among different island groups. for example, intensive deforestation in mainland indochina and in the philippines mostly occurred earlier than elsewhere, meaning that more of the debt has already been paid compared to other areas, such as the islands of sumatra and borneo, where much of the deforestation has occurred more recently. furthermore, we found that carbon and extinction debts are poorly correlated in all regions (figure 4), despite both being created by the same historical patterns of deforestation. this occurs because the time delays in carbon emissions are shorter than those involved in species extinction, meaning that patterns of extinction debt reflect deforestation from earlier periods than the patterns of carbon emissions debt. this same variation in time delays ensures that the proportional magnitude of the deforestation legacy is higher for biodiversity than it is for carbon (figure 2). carbon dioxide emissions from tropical deforestation are already impacting the earth s atmosphere and climate and account for 10%20% of annual anthropogenic emissions. furthermore, widespread habitat loss has already caused significant species losses globally, with important impacts on ecosystems. here we have shown that the carbon debt is equivalent to almost one - fifth of all historical gross emissions from tropical deforestation over the 60-year period we modeled, and to the emissions of 510 years of global deforestation. the extinction debt of vertebrate species, on the other hand, if paid, will increase the number of known extinctions in these groups since 1900 by 120%. in both cases these are substantial, and previously unquantified, debts that must be paid unless specific actions, including habitat restoration and targeted interventions for threatened species, are put in practice. to generate these estimates, we have utilized a model that has been validated on the basis of accurately simulating the time course of deforestation over time in tropical regions. uncertainty was propagated throughout our study (supplemental experimental procedures) : in the relationship between deforestation and its drivers (allowing parameter values to vary), when estimating carbon emissions (both in the biomass maps and in the carbon bookkeeping parameters), and in the extinction debt estimates (allowing both z and k values to vary). as a result of rigorously validating our model against multiple different datasets and accounting for multiple different sources of uncertainty, we believe we have produced the best current estimates of the environmental legacy of modern - day tropical deforestation. our results show that reaching national and global emissions targets may, in practice, be more difficult than expected. the carbon debt means that emissions in any one year are a function of deforestation over previous years. for instance, the carbon debt in the amazon in 2010 is equivalent to the total carbon emissions from 3.5 years of deforestation at the average rate observed in the 2000s. thus, changes in annual deforestation rates will initially have a smaller than expected effect on annual emission rates. this time lag means, for example, that the 30% reduction in deforestation rates seen in the brazilian amazon between 2005 and 2010 has so far resulted in a reduction of just 10% of actual carbon emissions over the same time period. at the cancun conference of the parties of the united nations framework convention on climate change in 2010, several tropical countries, where emissions from land use and land cover change often exceed those from the energy sector, voluntarily committed to reduce their carbon emissions : brazil aims to reduce its total greenhouse gases emissions by 36%39% from its business as usual levels by 2020, and indonesia aims to reduce its emissions by at least 41% between 2009 and 2020. recently, at the united nations sustainable development summit 2015 in new york, brazilian president dilma rousseff committed to a further intended reduction of brazil s emissions of 43% by 2030. reducing deforestation is the most immediate method available to meet these stringent targets, which is partially why, at the 2009 conference of the parties in copenhagen, brazil committed to reduce amazon deforestation rates by 80% relative to the 19952005 baseline. however, our results demonstrate clearly that reductions in actual emissions will lag many years behind reductions in deforestation rate. we necessarily assumed that the variables found to be driving deforestation in the 2000s also drove deforestation in previous decades (owing to the lack of data for previous decades), but this does not seem to have caused substantial bias in our results. this appears to be because deforestation resulting from different causes (e.g., conversion to agricultural land or fires following timber extraction) tends to generate similar spatial patterns of forest loss (e.g., occurring primarily along road networks). this consistency in the deforestation patterns arising from different root causes, and our explicit approach of modeling the spatial expansion of deforestation directly, means that our simulations about the spatial and temporal patterns of deforestation history are relatively robust to uncertainty about the underlying processes. deforestation activities evolved over time from small - scale slash - and - burn agriculture to large - scale industrial agriculture, which impacted the fractions of carbon immediately lost versus left to decay over time. however, there are no spatial high - resolution datasets available with the full history of land use change in the tropics to take this into account. our gross vegetation carbon emissions estimates are larger than those reported in other studies for all three tropical regions (supplemental experimental procedures). in part, this can be explained by the fact that we used a potential vegetation carbon map, which included belowground carbon stored in roots, not just aboveground stems and leaves. this map ignores the fact that some of the forests covered in our study could have an initial carbon stock lower than the potential carbon, for example as a result of harvesting or fire events. however, an important reason for the differences between our estimates and other recent regional estimates is that we included the additional time - delayed emissions of carbon, which in recent decades represent a substantial proportion of annual emissions. initially, in the early years of deforestation (i.e., 19501970), our estimates are similar to those in the literature (supplemental experimental procedures). however, as the size of the carbon debt gradually increases through time, an increasing amount of emissions in a given year are contributed by legacy emissions (figure 2). importantly, our estimates for 20092010 (0.51 0.04 pgc / year) are comparable to independent measurements made in the amazon (0.48 0.18 pgc / year, for 20092011) by sampling greenhouse gases in the lower troposphere, indicating that our model provides an accurate representation of deforestation - related carbon emissions. the most commonly employed action to prevent species extinctions is to protect habitat, but that approach alone will do little to avoid paying an extinction debt that has already accumulated from historical habitat loss. under aichi target 12 of the convention on biodiversity, 78 countries, 9 of which lie within the geographic bounds of this study, have made voluntary agreements at the national level to prevent the extinction of known threatened species and improve their conservation status by 2020. our results suggest, however, that tropical nations with large extinction debts will be unlikely to succeed in preventing the further loss of species without substantial investment in habitat restoration, as well as targeted conservation interventions for threatened species. our estimates for species losses and extinction debt in the amazon are slightly higher than those previously estimated, but this is because our analysis encompasses the whole amazon basin, not just the brazilian amazon. we are not aware of any other previous studies that have estimated extinction debt across all tropical forests with which to compare our results. the total extinction debt, across all taxonomic groups present in these highly biodiverse tropical regions, is likely to be orders of magnitude larger than our estimate, which is based solely on three well - studied vertebrate groups. nonetheless, species movements, adaptation, and mitigation strategies, which we did not consider in our study, would contribute to lower this debt. previous analyses have demonstrated a poor correlation between stocks of carbon and biodiversity, leading to calls for developing combined carbon - biodiversity conservation strategies, which better resolve trade - offs between the two conservation aims [19, 20 ]. we have confirmed not only that is this true, but also that carbon and extinction debts are poorly correlated in space. however, time delays in carbon emissions and extinctions create a potential window for habitat restoration and conservation actions to alleviate or even avoid having to pay the committed debts. just as strategies to simultaneously preserve stocks of carbon and biodiversity can be optimized through careful planning [19, 20 ], the ideal locations for habitat restoration actions to reverse the combined carbon - biodiversity debts will require detailed spatial planning to find cost - effective solutions. frameworks for making these decisions, including the incorporation of time lags, exist and have demonstrated the counterintuitive result that it can be more cost - effective for conservation strategies to forego a sole focus on habitat protection in favor of restoring degraded areas. these decision - making frameworks now need to be applied if we are to avoid paying the full cost of the environmental legacy of tropical deforestation. we collected data from a variety of freely available sources, including annual global land cover maps from 2001 through 2010 derived from modis satellite imagery, and variables that could impact deforestation. these included the location of roads, protected areas, and rivers ; population density ; altitude ; and climate. we then used a data - constrained and validated spatial model of tropical deforestation to backcast at 1 km resolution both the rates and spatial patterns of deforestation from 2009 to 1950 in the three main tropical regions : the amazon, the congo basin, and se asia (supplemental experimental procedures). for each region modeled, we combined our deforestation estimates with spatially explicit maps of potential living vegetation carbon and a modified carbon bookkeeping model to calculate the carbon emissions debt (supplemental experimental procedures ; figures 2a, 3a3c, and s2). we applied the exponential decay rates provided by houghton. at each annual time step and used bookkeeping to calculate the emissions released in a given year, as well as carried over into the subsequent year. unlike previous studies, our bookkeeping model allowed for uncertainty in the parameter determining the proportion of emissions release immediately following a deforestation event. we obtained geographic range data [23, 24 ] for forest - specific mammal, bird, and amphibian species (table s2) and combined these with our spatially explicit trajectories of historical forest cover (figure s1) to estimate species losses and extinction debt in each region (supplemental experimental procedures ; figures 2b, 3d3f, and s3), following wearn.. the model uses the species - area relationship (sar) to predict the equilibrial species richness expected under habitat loss but extends the sar to include a time - delayed community relaxation to equilibrium. by explicitly incorporating time, this model allowed for estimation of species loss and extinction debt at any point between 1950 and 2009. appropriate parameter values for the model were obtained using past studies, with uncertainty in these parameters accounted for using monte carlo simulations. for the coarser regional - scale analysis, we aggregated all of our input data at the scale of eight broad regions (amazon, congo basin, and the six sub - regions of se asia), treating each region as a single cell. we then used the temporal trajectories of forest cover simulated by our deforestation model to determine losses and extinction debt of forest - specific species in each unit. the fine - scale analysis was done within 10 10 km cells. we used cell - specific trajectories of past forest loss (figure s1) to estimate the impact of modern deforestation on the levels of local species loss and extinction debt in each cell (figures 3d3f). i.m.d.r. assisted with formulation of the research question, generated code, conducted all the analyses and interpretation of results, and wrote the manuscript. m.j.s. obtained the potential carbon maps, helped with outputs interpretation, and provided critical manuscript revisions. o.r.w. helped run the extinction debt model and interpret its results, and assisted with valuable reviews of the manuscript. r.m.e. assisted with formulation of the research question, assisted in results interpretation, and provided critical revision of the manuscript. | summarytropical deforestation has caused a significant share of carbon emissions and species losses, but historical patterns have rarely been explicitly considered when estimating these impacts [1 ]. a deforestation event today leads to a time - delayed future release of carbon, from the eventual decay either of forest products or of slash left at the site [2 ]. similarly, deforestation often does not result in the immediate loss of species, and communities may exhibit a process of relaxation to their new equilibrium over time [3 ]. we used a spatially explicit land cover change model [4 ] to reconstruct the annual rates and spatial patterns of tropical deforestation that occurred between 1950 and 2009 in the amazon, in the congo basin, and across southeast asia. using these patterns, we estimated the resulting gross vegetation carbon emissions [2, 5 ] and species losses over time [6 ]. importantly, we accounted for the time lags inherent in both the release of carbon and the extinction of species. we show that even if deforestation had completely halted in 2010, time lags ensured there would still be a carbon emissions debt of at least 8.6 petagrams, equivalent to 510 years of global deforestation, and an extinction debt of more than 140 bird, mammal, and amphibian forest - specific species, which if paid, would increase the number of 20th - century extinctions in these groups by 120%. given the magnitude of these debts, commitments to reduce emissions and biodiversity loss are unlikely to be realized without specific actions that directly address this damaging environmental legacy. |
hearing loss (hl) is one of the most frequent clinical manifestations of patients with multi - systemic genetic disorders. the syndromic form of hl and hl in association with other physical stigmata accounts for 30% of the cases of hereditary hl. leopard syndrome (ls) is one of the hereditary disorders that underlie syndromic hl and it is caused by a mutation in the ptpn11 gene. the acronym leopard stands for the major features of the disorder : l, lentigines ; e, electrocardiographic (ecg) conduction abnormalities ; o, ocular hypertelorism ; p, pulmonary stenosis ; a, abnormalities of the genitalia ; r, retardation of growth ; and d, deafness (sensorineural). the disease is inherited in an autosomal dominant manner with variable penetrance and expressivity. the diagnosis of ls is made based on clinical grounds, and molecular genetic analysis to detect disease - causing mutations is needed to confirm the diagnosis. the ptpn11 and raf1 genes are the only genes currently known to be associated with ls, and a mutation in either gene is identified in more than 90% of the patients with ls [3 - 5 ]. noonan syndrome (ns) is an allelic disorder of ls, and the clinical manifestations of ns significantly overlap with those of ls. in this report, we present our experience of cochlear implantation (ci) in a girl with ls. the diagnosis of ls was confirmed by the identification of a heterozygous missense mutation ala461thr in the ptpn11 gene. she was born at 32 weeks of gestation with a birth weight of 2,100 g via a vaginal delivery. on the newborn hearing screening test, she was diagnosed as having bilateral hearing loss. at 9 months of age, she had an operation for pulmonary stenosis. in the first year of life, dysorexia with feeding difficulty developed, which was caused by oromotor trouble, and this added to the development of ambulation disorder. finally, she was diagnosed as having cerebral palsy and she has been maintained on rehabilitation therapy since then. physical examination revealed hypertelorism, a plane occiput and low - set ears (fig. she also had numerous symmetrically distributed dark brown macules involving the face, scalp, upper extremity, axilla and trunk. a transthoracic ecg for preoperative evaluation showed slightly increased left ventricular (lv) wall thickness with normal lv contractility. the auditory steady - state response showed responses with 120 decibel (db) at 1 khz and 115 db at 2 khz on the left side, and 125 db at 4 khz on the right side. based on the audiological evaluation as described above, she was diagnosed with bilateral profound hearing loss. bilateral enlarged vestibular aqueducts (eva) were identified on the computed tomography (ct) of the temporal bone and magnetic resonance imaging (mri) of the internal auditory canal, but both the internal auditory canal were observed to be of normal size, as well as the cochlea and the semicircular canals, which were normally filled with fluid on both sides (fig. 2). to investigate the etiology of the hearing loss and the other physical abnormalities of the patient, molecular study for the ptpn11 gene all the coding exons and intron - exon boundary sequences of the ptpn11 gene were bidirectionally sequenced using the big dye terminator abi prism sequencing kit (applied biosystems, foster city, ca, usa) and the abi prism 3100 genetic analyser (applied biosystems). as a result, the patient was found to be heterozygous for a missense mutation in exon 12. this mutation was a g - to - a transition at nucleotide position 1,381 and it was predicted to substitute the 461st residue alanine to threonine (c.1381g > a, p.ala461thr) (fig. 3). the family study revealed that neither of the asymptomatic parents was carrying the mutation, indicating the de novo occurrence of the mutation. the electrode was completely inserted in the scala tympani, and neural response telemetry (nrt) during the operation showed good results. the patient was able to respond to loud sound, but she still could not deliver meaningful communication on her last follow - up visit 1 year after ci, and her score on the cap scale conformed to category 1. ' leopard ' syndrome was first introduced in 1969 to describe the spotted appearance from lentiginosis. the diagnostic criteria include multiple lentigines plus 2 other recognized features or a first - degree relative with multiple lentigines plus 3 other features in the proband. some of the clinical manifestations of ls, such as facial anomalies, distinct congenital heart defects, pectus deformities, hearing loss and growth retardation, are also observed in ns, which is a disorder that is genetically related to ls. although skin pigmentary changes have been described in both disorders [3,7 - 9 ], the patients with ns are unlikely to have the profusion of pigmentary lesions, lentigines and caf - au - lait patches or to be deaf. the diagnosis of ls was made in our patient based on her clinical manifestations, including multiple lentigines, ocular hypertelorism, pulmonary stenosis and deafness. lentigines are brown to black macules that are dispersed mostly on the face, neck and upper part of the trunk. multiple lentigines are distinctive features of ls, although they may be absent in young patients. the patient in our case had numerous dark brown macules on the face and upper trunk, and this was compatible with multiple lentigines. ecg abnormalities, including progressive conduction anomalies, are the most common cardiac defects [10 - 12 ]. the patient 's echocardiogram showed increased lv wall thickness, although there were no conduction abnormalities. hypertrophic cardiomyopathy (hcm) is the most serious anomaly in patients with ls, and this can cause potentially life - threatening events and sudden death. hcm may progress and appear later in life ; thus, cardiologic assessment at regular intervals was recommended to her parents due to the concern for the possibility of the progression of her lv wall thickness to hcm. sensorineural deafness is the least common feature, which occurs in about 15%-25% of the patients with ls. deafness (or hl) can be detected at birth, as in our patient, or during childhood ; however, hl can also develop later in life. mutations in the ptpn11 gene are the genetic backgrounds of both ls and ns (ptpn11-related disorders). it contains two src homology 2 (sh2) domains and a protein tyrosine phosphatase (ptp) domain. it is known that ptpn11 mutations causing ls / ns are gain - of - function mutations and they are most commonly in the form of missense (amino acid - changing) mutations. the mutated amino acid in this patient, ala461, was located in close proximity to gly464 and thr468 in exon 12, which is the tyrosine - specific protein phosphatase 's active site (amino acids 457 - 469 [vhcsagigrtgtf ]). the residue is necessary for ptp activity and this is a recurrent site of mutation in patients with ls, and particularly in association with hcm. early ci during the first year of life is important to achieve the best possible level of language acquisition in prelingual hl patients, given the establishment of a diagnosis and the proper indications. in general, a 5-year - old congenitally deaf child usually shows marked change in their behavior regarding sound detection within the first 6 months of implant use. however, word recognition may not develop for at least another 6 - 12 months of implant use. but the benefit of ci in our patient has been minimal until post ci 1 year. it is possible that she concomitantly acquired cerebral palsy, which limits her ability to acquire language. before ci, the status of mastoid pneumatization and any associated inner ear anomalies should be evaluated with high resolution imaging modalities because structural anomalies of the inner ear and petrous bone have occasionally been reported in ns, which is a disorder that is genetically related to ls. we describe here our experience of ci in a patient with ls from a ptpn11 mutation, and this is the first such report in the medical literature. identification of the mutation in the ptpn11 gene would confirm the diagnosis of patients who are clinically suspected of having ls or ns. for a patient with ls combined with sensorineural hearing loss, audiologic tests should be performed at regular intervals, and hearing aids or performing ci should be considered in a timely manner. | hearing loss (hl) is one of the most frequent clinical manifestations of patients who suffer with multi - systemic genetic disorders. hl in association with other physical stigmata is referred to as a syndromic form of hl. leopard syndrome (ls) is one of the disorders with syndromic hl and it is caused by a mutation in the ptpn11 or raf1 gene. in general, 5 year old children who undergo cochlear implantation usually show a marked change in behavior regarding sound detection within the first 6 months of implant use, but word identification may not be exhibited for at least another 6 - 12 months of implant use. we herein report on a 5-year - old girl with ls. her clinical manifestations including bilateral sensorineural hl, which indicated the diagnosis of ls. we confirmed the diagnosis by identifying a disease - causing mutation in the ptpn11 gene, which was a heterozygous missense mutation ala461thr (c.1381g > a). she underwent cochlear implantation (ci) without complications and she is currently on regular follow - up at postoperative 1 year. this is the first reported case of ci in a patient with ls in the medical literature. |
chronic hepatitis b virus (hbv) infection causing chronic hepatitis, cirrhosis, and hepatocellular carcinoma affects more than 350 million people worldwide [1, 2 ]. antiviral therapies that contain interferon and nucleos(t)ide analogues are used in patients who are infected with hbv and are at a higher risk of developing cirrhosis and hepatocellular carcinoma [1, 3, 4 ]. the purpose of the treatment is to suppress hbv replication and to prevent mortality associated with disease progression to end - stage liver disease and major complications [4, 5 ]. currently, 5 oral nucleos(t)ide analogues are approved for the treatment of liver disease related to chronic hbv infection in europe and usa, although only 3 nucleos(t)ide analogues, namely, lamivudine (lam), entecavir (etv), and adefovir dipivoxil (adv), are approved for use in japan. lam, the first approved nucleoside analogue for chronic hbv infection - related liver disease, suppresses hbv replication and improves hepatic inflammation in most patients. however, more than 60% of patients with chronic hbv infection who receive long - term lam therapy become resistant to the agent within 4 years of starting the therapy. for patients with lam resistance, virological breakthrough due to development of adv - resistant mutations occurred in 21% of 14 patients within 18 months after changing to adv monotherapy ; etv - resistant mutations were found in 8% of 151 patients 2 years after changing to etv monotherapy (1 mg once per day). therefore, lam monotherapy has not been used for patients with chronic hbv infection since etv was approved. in patients with lam resistance, tenofovir (tdf, not yet approved for use in japan) or adv therapy is advised. the appearance of virological and biochemical breakthroughs during combination therapy with adv and lam is very rare in patients with lam resistance ; therefore, combination therapy is recommended in such cases [11, 12 ]. at present, combination therapy with adv and lam must be continued for a long period of time, even though long - term use of adv is associated with a slight risk of renal toxicity [13, 14 ]. although adv has a favorable risk / benefit profile with little or no evidence of renal toxicity after 48 weeks of low - dose treatment (10 mg per day) [15, 16 ], some studies have reported development of severe osteomalacia caused by renal tubular dysfunction (fanconi syndrome) after long - term use of adv [17, 18 ]. therefore, establishment of a protocol is required for early identification of osteomalacia caused by renal tubular dysfunction during the administration of adv. serum bone - specific alkaline phosphatase (bap) is the most commonly used bone disease marker in hemodialyzed patients. serum bap levels increase gradually in osteomalacia secondary to the administration of adv, without increase in serum creatinine concentration [17, 18 ]. therefore, serum bap concentration may be a potentially useful marker for early detection of osteomalacia caused by renal impairment secondary to the administration of adv. to determine the significance of these indicators for the management of patients receiving long - term adv plus lam therapy, we evaluated bone metabolism markers, including serum and urinary phosphate concentrations and serum bap, in chronic hepatitis b (chb) patients receiving nucleos(t)ide analogues. this study complies with the standards of the 1975 declaration of helsinki and current ethical guidelines ; written informed consent was obtained from each patient. between august 2003 and january 2012, 168 consecutive patients positive for hepatitis b surface antigen (hbsag), who presented to the division of gastroenterology and hepatology of our institution, received nucleos(t)ide analogue therapy. among them, 144 consecutive patients who received adv or the other nucleoside analogues (lam or etv) for more than 1 year were enrolled. most patients had hbv genotype b or c, as seen in a previous japanese study. of these, 20 patients had received a combination of 100 mg of lam plus 10 mg of adv per day (adv group), and 124 patients had received either 100 mg of lam per day or 0.5 mg of etv (non - adv group). patients in the adv group received additional adv because of increase in serum hbv dna levels (1 log10 copies / ml) during lam monotherapy. the non - adv group included 34 patients who started lam therapy (100 mg per day) but had been subsequently switched to etv therapy (0.5 mg per day) to avoid the appearance of lam - refractory hbv. this group also included 90 patients who had received 0.5 mg of etv per day as a first - line therapy. exclusion criteria were as follows : presence of antibodies to hepatitis c virus or hiv ; a current alcohol consumption of > 20 g / day ; and presence of hepatocellular carcinoma, other liver diseases, progressive decompensated liver cirrhosis, or renal dysfunction at the time of starting nucleos(t)ide analogue therapy (serum creatinine : male, > 1.3 mg / dl ; female, > 1.1 mg / dl). patients who had hypertension and/or diabetes mellitus were also excluded from this study owing to the risk of renal impairment. in addition, patients who were receiving vitamin d were excluded from this study because this therapy may affect bone turnover. all blood samples were obtained from patients after fasting. to reduce the confounding effects of covariates, we used propensity scores [22, 23 ] to match the adv group to the non - adv group during nucleos(t)ide analogue therapy based on the stage of liver disease at the time of enrollment and renal function at the time of receiving the nucleos(t)ide analogue. variables that may have influenced the treatment outcomes, including age, sex, the duration of nucleos(t)ide analogue therapy, platelet count, serum alanine aminotransferase (alt), serum albumin at the time of enrollment (nucleos(t)ide analogue therapy for > 1 year), and serum creatinine level at the time of receiving nucleos(t)ide analogues, were used to generate a propensity score ranging from 0 to 1 by logistic regression. the nearest available match on the estimated propensity score was used to select participants in the adv group and find participants in the non - adv group with the closest propensity scores. nineteen well - matched pairs of patients in the adv and non - adv groups were obtained. hbsag in patients ' sera was tested by enzyme immunoassay using commercially available kits (dainabott, tokyo, japan). the serum hbv dna concentration was monitored using a polymerase chain reaction assay (cobas amplicor hbv monitor test, roche diagnostics k. k., tokyo, japan ; lower limit of detection, 2.6 log copies / ml) before november 2007 and by another polymerase chain reaction assay (cobas ampliprep - cobas taqman hbv test, roche diagnostics k. k. ; lower limit of detection, 2.1 log copies / ml) after december 2007. ymdd mutations were detected using a line probe assay (inno - lipa hbv dr assay, innogenetics nv). serum bap was measured at the time of enrollment and before nucleos(t)ide analogue administration using a commercially available polyacrylamide - gel (pag) disk electrophoresis kit designed for use in humans (alkphor system, jokoh co. ltd, tokyo, japan) using serum stored at 30c. serum levels of intact parathyroid hormone (pth) were measured using an electrochemiluminescence immunoassay (roche diagnostics k. k.), and urinary cross - linked n - telopeptide of type i collagen (ntx) was measured using an elisa (osteomark, inverness medical innovations inc., waltham, ma, usa) at the time of enrollment. bap, a sensitive marker reflecting the changes in bone metabolism, was calculated as follows : serum bap concentration at the time of enrollment minus serum bap concentration before administration of nucleos(t)ide analogues. levels of phosphate and creatinine were examined at the time of enrollment and before nucleos(t)ide analogue administration using serum stored at 30c. the mann - whitney u test and wilcoxon rank - sum test were used to analyze continuous variables. all tests of significance were two tailed, and a p value of < 0.05 was considered significant. all statistical analyses were performed using statistica for windows version 6 (statsoft, oklahoma, usa). the baseline characteristics of the 144 patients enrolled in the study are summarized in table 1. there were no significant differences with respect to age, sex, duration of nucleos(t)ide analogue therapy, platelet count, serum alt, serum albumin, total bilirubin at the time of enrollment, and serum creatinine level at the time of nucleos(t)ide analogue administration between the adv and non - adv groups (table 2). there was no difference in serum creatinine concentration between the adv and non - adv groups at the time of enrollment. serum phosphate concentration tended to be lower in the adv group, although the difference was not statistically significant. in contrast, urinary phosphate concentration was significantly higher in the adv group than in the non - adv group (p = 0.0424). there was no significant difference between the adv and non - adv groups in the concentration of serum alkaline phosphatase (alp) isoenzyme 2, which is liver specific ; however, serum bap concentration was significantly higher in the adv group than in the non - adv group (p = 0.0228) (figure 1). there were no significant differences in serum intact pth, 25-hydroxyvitamin d, and urinary ntx concentrations between the adv and non - adv groups (figure 2). there were no significant changes in serum creatinine or serum phosphate concentration with the administration of adv or the other nucleoside analogues (lam or etv) (figure 3). serum alp2 concentrations were significantly lower at the time of enrollment than before drug administration in both adv group (p = 0.0126) and non - adv group (p = 0.0025). serum bap was significantly higher at the time of enrollment than before nucleos(t)ide analogue administration in the adv group (p = 0.0001). there was no significant change in serum bap concentration in the non - adv group (figure 4). although there was no correlation between the length of nucleoside analogue therapy and bap in the non - adv group, there was a significant positive correlation between the period of adv therapy and bap in the adv group (r = 0.2959 ; p = 0.0160, r : correlation coefficient) (figure 5). in the present study, we found that serum bap concentration was significantly elevated after the administration of adv for more than 1 year. this finding was not observed after the administration of the other nucleoside analogues. because serum bap concentration reflects bone metabolism and is increased in osteomalacia, this finding suggests a tendency for subclinical osteomalacia in patients using adv. however, we did not observe significant differences between the adv and non - adv treatment groups with respect to intact serum pth concentration, 25-hydroxyvitamin d, and urinary ntx concentration, which are important markers of hyperparathyroidism, osteomalacia, and osteoporosis, respectively. this result may have been obtained because these bone turnover markers were examined in patients who did not develop symptomatic renal impairment or osteomalacia related to adv treatment in this study. a study evaluating long - term adv therapy reported that 5% of the patients who received therapy up to 5 years had a slight elevation in serum creatinine concentration. although renal impairment is one of the most important side effects of adv, we did not find a significant elevation in serum creatinine concentration among patients in that treatment group. however, we did observe that serum phosphate concentration tended to be lower and urinary phosphate concentration was significantly higher at the time of enrollment (1 year after starting adv therapy) than before starting nucleos(t)ide analogue therapy. therefore, it was difficult to detect potential renal dysfunction on the basis of elevation in serum creatinine concentration alone. according to a recent report, the maximal reabsorption of phosphate in the renal tubules and serum phosphate concentration were low in several patients receiving adv ; however, after changing therapy to etv, serum phosphate concentration improved. in the present study, urinary phosphate concentration was significantly higher in the adv group than in the non - adv group, although there was no significant difference in serum phosphate concentration. these findings may be attributed to the increase in urinary phosphate that occurs before a decrease in serum phosphate. therefore, monitoring for an increase in urinary phosphate may be critical for earlier detection of osteomalacia caused by renal tubular impairment. given that bap is a bone turnover marker, we examined change in serum bap concentration to determine the potential risks of osteomalacia caused by renal tubular impairment. therefore, osteomalacia caused by renal tubular impairment may be a unique side effect of adv, especially after long - term use of adv. adv plus lam combination therapy is very useful in patients with lam - resistant chronic hbv infection, and it is recommended as the first - line therapy for lam - resistant disease in japan. however, because the criteria for discontinuation of nucleos(t)ide analogue therapy are not clear, long - term adv plus lam combination therapy is required in these patients to avoid risk of relapse. long - term adv plus lam combination therapy carries a potential risk of renal impairment and development of fanconi syndrome. however, in the present study, patients did not present with symptoms of fanconi syndrome ; this finding may indicate that adv plus lam combination therapy is fairly safe for almost all patients if appropriate monitoring is provided for adverse effects of adv. our results suggest that compared to serum creatinine and/or phosphate concentration, increases in concentrations of urinary phosphate and serum bap are more useful indicators for early identification of renal tubular impairment. further, serum bap concentration increased before serum phosphate decreased ; this finding may indicate that serum phosphate was being released from the bones, even though it was being lost through the kidneys. in addition, bap, a sensitive maker for detecting bone metabolism abnormalities, increased with the duration of adv plus lam therapy. therefore, the risk of osteomalacia may increase with long - term use of adv. a previous report suggested that dose reduction of adv to 10 mg every other day leads to improvement of renal function without compromising treatment efficacy. in our experience, serum creatinine concentration increased from 0.9 mg / dl to 1.3 mg / dl after the addition of adv (10 mg / day) to lam monotherapy (100 mg / day) in 1 patient ; subsequently, after 3 months of reducing the dose of adv to 10 mg every other day, serum creatinine concentration improved to 1.0 mg / dl. however, because there is no obvious standard procedure for dose reduction, further studies are required to establish when and how to reduce adv dose for patients whose serum alp and/or urinary phosphate concentrations increase after long - term administration of adv. furthermore, 2 adult patients with acquired immunodeficiency syndrome presented with severe bone pain associated with tdf, which is also used for the treatment of chronic hbv infection - related liver disease in japan and is associated with an increase in serum alp. although the relatively high rate of etv resistance is a concern, therapy with 1.0 mg of etv per day may be considered when adv and tdf are contraindicated in patients with lam resistance because of treatment - induced renal impairment and osteomalacia. nucleos(t)ide analogue therapies are very useful for the treatment of chronic hbv infection - related liver disease, have few adverse effects with subjective symptoms, and are often used in long - term treatment. however, patients receiving these therapies should be supervised and monitored carefully for the early detection of adverse effects. periodic measurement of serum bap may be helpful in the early detection of osteomalacia in the absence of elevation of serum creatinine concentration. in conclusion, examination of serum bap concentration is useful for predicting osteomalacia caused by renal impairment in the absence of subjective symptoms and is essential for the establishment of adequate measures for determining the continuation of nucleos(t)ide analogue therapy for chronic hbv infection - related liver disease. | of 168 patients with chronic hepatitis b virus (hbv) infection - related liver disease, 20 patients who had received 100 mg of lamivudine plus 10 mg / day of adefovir dipivoxil (adv) (adv group) and 124 patients who had received 0.5 mg / day of entecavir or 100 mg / day of lamivudine (non - adv group) for > 1 year were enrolled. for comparative analyses, 19 well - matched pairs were obtained from the groups by propensity scores. at the time of enrollment, serum creatinine and phosphate concentrations were similar between the adv and non - adv groups ; however, urinary phosphate (p = 0.0424) and serum bone - specific alkaline phosphatase (bap) (p = 0.0228) concentrations were significantly higher in the adv group than in the non - adv group. serum bap was significantly higher at the time of enrollment than before adv administration in the adv group (p = 0.0001), although there was no significant change in serum bap concentration in the non - adv group. there was a significant positive correlation between the period of adv therapy and bap (r 2 = 0.2959, p = 0.0160). serum bap concentration increased before increase in serum creatinine concentration and was useful for early detection of adverse events and for developing adequate measures for continuing adv for chronic hbv infection - related liver disease. |
the increased interest in setting up ion facilities for cancer treatment around the world is the result of the positive clinical experience based on continuous experimental, clinical and fundamental research. the encouraging results from the most experienced ion therapy centres in heidelberg (germany), chiba and hyogo (japan) support the potential of carbon ions in terms of physical dose distributions and increased radiobiological effectiveness [1, 2 ]. carbon ion beams are characterized by well - defined range, narrow penumbra and pronounced bragg peak that generally result in an improved target conformity and better sparing of normal tissues compared to electron, photon and proton beams. in addition to good physical properties, carbon ion beams also have an increased relative biological effectiveness (rbe) in the tumor compared to conventional photon and proton beams. the rbe varies with the linear energy transfer (let) of the ions and this has to be taken into account when optimizing ion treatments. the oxygen effect of radiation is also highly dependent on let. in photon radiation therapy, tumor hypoxia is a common cause for treatment failure, since photons generally have a very low let and are inefficient in killing hypoxic cells [3, 4 ]. for high let radiation the direct action is dominant [5, 6 ]. furthermore, radical scavenger experiments have shown that the contribution of indirect action under hypoxic conditions is lower than that under oxic conditions. therefore light ion radiation therapy has a greater effect on hypoxic tumors than photon therapy. the clinical benefit of using carbon ions when treating hypoxic tumors has been shown recently in a clinical study by nakano.. the increased biological effect in the presence of oxygen is usually quantified as the oxygen enhancement ratio (oer), the ratio of the doses required to achieve the same survival under hypoxic and oxic irradiation conditions. the dependence of oer on let has been studied in vitro for different ion types [913 ]. (2000), revised in 2012, presented a systematic investigation of cell survival for several ion types, cell lines, lets and dose levels in both oxic and hypoxic conditions. they found that for carbon ions with low let, oer is about 2.53, which is comparable to oer of photons. at very high lets, beyond 200 kev/m, the influence of oxygen becomes almost negligible and hence oer decreases to 1. the physical and radiobiological properties of ion beams has led to the current practice in which the treatment is delivered in only a few relatively large fractions of radiation. therefore, in order to accurately predict the response to ion therapy, a mathematical model able to describe the survival of cells over a large range of doses and let is required. the current models used in heidelberg (germany), chiba or hyogo (japan) are mainly based on the linear quadratic (lq) cell survival model, which is rather accurate for doses per fraction employed in the conventional treatment schedules for low let radiotherapy, but might be less accurate in reproducing the shape of the survival curve at higher doses where it becomes almost exponential. furthermore, the lq model is not able to describe the response in cases of low - dose hypersensitivity without slight modifications. in order to overcome these possible limitations, lind and co - the rcr model was further developed by taking into account not only the dose but also the let dependence of cell survival [4, 16 ]. the let parameterized rcr model was able to accurately fit the cell survival data reported by furusawa. for hsg, v79 and t1 cells irradiated with carbon ion beams under oxic conditions. in order to model the response of tumors with both oxic and hypoxic sub - compartments irradiated with carbon ion beams of different lets, a further development of the current model is required to explicitly account for the oxygen effect dependence on let. this model will therefore open the possibility of selecting the optimum let to overcome the tumor resistance caused by hypoxia, thus allowing the biological optimization of particle therapy based on individual measurements of tumor oxygenation. it is the aim of this present paper to describe a parameterized rcr model that can describe cell survival for oxic as well as hypoxic cells at different lets, and to determine the relationship between hypoxic radioresistance and let. the resulting model was tested by its ability to fit the comprehensive experimental data set reported by furusawa. the rcr damage model [4, 15 ] is a cell survival model that specifically takes into account repair processes and distinguishes between potentially and conditionally repairable damage. the surviving fraction of cells after a dose d is given by : (1) the first term in equation 1 gives the fraction of cells that have not been hit or damaged and therefore survive. the parameter a is therefore related to the hit cross - section and the initial mean number of damage events per unit dose. the second term corresponds to the fraction of cells that have been damaged and subsequently been correctly repaired. the parameter b specifically describes the maximum amount of damage that can be repaired per unit dose. all a, b and c parameters are given in units of effect per gy. being the sum of two exponentials as a dual poisson process, the equation is flexible enough to accurately describe both the low dose hypersensitivity, the shoulder of the survival curve and the exponential part of the cell survival curve at high doses. brahme, who derived expressions for the dependence of the parameters a, b and c on let for cells irradiated under oxic conditions. the generalized equation giving the surviving fraction of oxic cells after a dose d is : (2) where the let dependence of aox, box and cox are given by : (3) (4) (5) (6) equations 36 accurately describe the let dependence of the rbe. the parameters a0, a1,,,, and in the above equations are free parameters depending on both the intrinsic radiosensitivity of the cells and the ion type. the variation of the survival with the oxygenation status of the cells is a further development of the rcr model. the decreased cell kill under anoxic conditions can similarly be described by an anoxic version of equation 2 : (7) where the anoxic parameters in the first approximation are given by : and is a dose modification factor closely related to oer. the oxygen - mediated cell kill decreases with increasing let due to a decreasing radical dependent cell kill and an increased direct effect. the let dependence of is assumed to be similar to that analytically derived by brahme for oer and is given by : (8) where min, max are the limit values at high and low let and is the let where is reduced to 37% of its maximum value. the minimum value for corresponds to the minimum oxygen enhancement ratio at very high lets and it generally approaches unity (1.0), while the maximum value for is similar to the oxygen enhancement ratio corresponding to irradiation under anoxic conditions with low let electrons and x - rays. the model described by equations 2 and 7 was tested by fitting cell survival data for chinese hamster v-79 cells irradiated with lets in the range of 30500 kev/m. the available 23 oxic and 23 hypoxic datasets were obtained by irradiating the cells with c in vitro at an average of five dose levels, ranging from 125 gy. the parameters in equations 36 and 8 were obtained by the simultaneous fit of the oxic and hypoxic datasets with equations 2 and 7. the validity of the proposed model with the parameters resulting from the fitting of the data described above was tested by comparing the predicted cell survival fraction with the actual experimentally - derived data points for two let values which were not used in the fitting. the experimental data on which the model was tested belong to the same dataset used by furusawa. and correspond to chinese hamster cells, v79, irradiated in aerobic and hypoxic conditions with c ions with dose - averaged let of 88 kev/m and 151.5 kev/m. the model parameters were determined by minimizing the square of the error between the experimental data and the analytical survival curves on a logarithmic scale. several constraints related to the radiobiological interpretation of the rcr parameters were imposed, as originally suggested by lind.. c(l) since the total amount of damage has to be larger than the amount of potentially repairable damage. it was also assumed that for doses around 2 gy the hypersensitivity is no longer evident and thus the constraint a c at any let. however, the difference between parameters a and c should decrease with increasing let due to the fact that with increasing let there is an increased probability that the cells that are hit are also inactivated. this also relates to the b parameter, which describes the amount of repairable damage at increasing let values. the equation proposed for b reflects the fact that with increasing let the dna damage becomes more severe and it is more difficult for the cell to repair. consequently, the parameter b decreases with increasing let, which also leads to better reproducing the almost exponential shape of the cell survival curve at high let. the parameterization of the rcr model presented in this paper also accounts for the variation with let of cell survival depending on oxygenation status of the cells at the time of irradiation. by analogy with the well known concept of oer, used for quantifying the effect of oxygen on cell survival compared to irradiation performed in hypoxic conditions, a dose modifying factor,, for the parameters describing the cell survival for hypoxic cells was introduced. the model was found to fit quite accurately both the oxic and the hypoxic experimental cell survival data over a broad range of lets. the derived parameters appear to be little influenced by the approach used to derive them. the resulting model is therefore expected to accurately predict the cell survival of mixed populations of oxic and hypoxic cells irradiated with c beams in the clinically relevant range of lets. the relationship between and let was determined by fitting a multi - parameter function to the largest available experimental dataset resulting from c irradiation of cells in vitro, as found in the literature. the relationship is representative for the cell line under investigation, v79, assuming that the systematic uncertainties of the underlying experiments were negligible. however, it should be mentioned that the original cell survival experiment indicated a similar relationship between oer and let for both v79 and hsg cells. hence, the relationship between and let could possibly be extended to describe cell lines other than v79. however, differences in the shape of cell survival curves between different cell lines should be taken into account. another aspect that has to be considered regarding the extrapolation of these results to cells irradiated in vivo comes from the survival data used in this study that was obtained with cells irradiated in monolayers. however, it should be mentioned that data exist for spheroids irradiated with carbon ions of different energies. thus, staab. used v79 spheroids and reported oer values similar to those of monolayer cells irradiated in glass dishes for different lets. thus, it appears that oer, defined as a ratio of isosurvival doses, is only weakly dependent on the system used to derive it. however, there might still be small differences between the absolute responses of the systems used to determine oer. the model presented in this paper is therefore expected to accurately predict the biological response for mixed populations of oxic and hypoxic cells irradiated with c beams in the clinically relevant range of lets. this is an important aspect for developing successful ion treatments, since it has been shown that tumors contain subpopulations of hypoxic cells and that their presence has been associated with poor outcome for treatments with low let radiation [1719 ]. reduced hypoxic protection from an oer of around 3.0 to about 1.62.0 for high let radiation could therefore be used for a more accurate description of the effects of tumor hypoxia. an important factor to take into account for predictions of clinical tumor response is that therapeutic high let beams often contain a mixture of high and low let component. thus, for optimal results one would have to consider both the distribution of lets in the incident beam and its variation with depth in tissue as well as the distribution of hypoxia. treatment optimization under such conditions would require accurate models explicitly describing the relationship between cell survival, tumor cure, dose and effective let for both the oxic and hypoxic compartments of the clinical tumors. the parameterized cell survival model addresses all these issues and could therefore be used for let optimization of light ion therapy of hypoxic tumors [2022 ]. has recently presented an analysis of dose- and let - painting with particle therapy, taking into account the variation of the lets along the ion track and assuming a fixed oer calculated at 10% survival as a dose - modifying factor for each let in the distribution. in a very recent paper brahme presented not only the possibility of determining the optimal let with respect to cell killing for tumors with different degrees of oxygenation but also the ion type and even the optimal combination of low, medium and high let radiation. the let parameterized rcr model including the (l) as presented in this study can thus be used for the accurate selection of let and the dose required in the optimization of light ion therapy with respect to cell killing in realistic tumors presenting oxic and hypoxic regions. | light - ion radiation therapy against hypoxic tumors is highly curative due to reduced dependence on the presence of oxygen in the tumor at elevated linear energy transfer (let) towards the bragg peak. clinical ion beams using spread - out bragg peak (sobp) are characterized by a wide spectrum of let values. accurate treatment optimization requires a method that can account for influence of the variation in response for a broad range of tumor hypoxia, absorbed doses and lets. this paper presents a parameterization of the repairable conditionally - repairable (rcr) cell survival model that can describe the survival of oxic and hypoxic cells over a wide range of let values, and investigates the relationship between hypoxic radiation resistance and let. the biological response model was tested by fitting cell survival data under oxic and anoxic conditions for v79 cells irradiated with lets within the range of 30500 kev/m. the model provides good agreement with experimental cell survival data for the range of let investigated, confirming the robustness of the parameterization method. this new version of the rcr model is suitable for describing the biological response of mixed populations of oxic and hypoxic cells and at the same time taking into account the distribution of doses and lets in the incident beam and its variation with depth in tissue. the model offers a versatile tool for the selection of let and dose required in the optimization of the therapeutic effect, without severely affecting normal tissue in realistic tumors presenting highly heterogeneous oxic and hypoxic regions. |
obsessive - compulsive disorder (ocd) is a highly disablitating psychiatric disorder characterized by obsessions and compulsions. obsessions are egodystonic, unwanted thoughts, images, or impulses that repeatedly enter one s mind. compulsions are repetitive, time - consuming behaviors or mental acts often performed to neutralize the anxiety provoked by obsessions. the prevalence of ocd in the general population is estimated at 1% to 3%, and the disorder is associated with impaired functioning and decreased quality of life [2, 3 ]. the general treatment of ocd is a serotonin reuptake inhibitor at an adequate dose, cognitive - behavioral therapy, or a combination of the two. however, up to 40% of patients fail to respond satisfactorily to these generally adequate treatment options, and 10% can not be helped at all [1, 4 ]. with use of repetitive transcranial magnetic stimulation (rtms), it has become possible to modulate local neural activity by inducing a depolarizing magnetic field pulse. because ocd may be related to increased neural activity in prefrontal subcortical circuits, the inhibitory effect of rtms was hypothesized to be beneficial in ocd treatment. in 1997, greenberg. earlier, rtms had been shown to have a positive effect on mood disorders with stimulation of the prefrontal cortex. greenberg. hypothesized that inhibition of the prefrontal activity with rtms might reduce obsessive - compulsive symptoms. they applied rtms (80% motor threshold, 20 hz for 2 s / min) for 20 min to 12 patients with ocd and found significantly decreased compulsive urges for 8 h after stimulation. since then, rtms has been investigated in ocd, targeting several brain areas within the corticostriatal network. in this article, the mechanism of action is discussed first, then the efficacy and side effects of rtms at various brain targets, and finally implications for the future. in the early-1980s, the transcranial magnetic stimulation (tms) device was developed by barker and colleagues. it uses a strong pulse of electrical current that is sent through a coil to induce a magnetic field pulse in the area under the coil. this pulse has the capacity to depolarize superficial local neurons. to create a longer lasting effect of the depolarized neurons, application of rtms is needed. the magnitude and direction of rtms - induced neuronal modulation depend on extrinsic factors such as motor threshold, frequency, and total number of stimuli, and intrinsic factors such as the functional state of the cortex. for example, it appears that low - frequency rtms (05 hz) results in decreased neural excitability and regional cerebral blood flow, as opposed to high - frequency rtms (520 hz), which increases both. because knowledge of involvement of specific brain circuits in ocd is advancing, rtms has been applied to several brain targets (table 1). the rationale for the first rtms studies in ocd was based on functional neuroimaging studies of ocd that demonstrated abnormalities in the orbitofrontal subcortical circuits, especially in the orbital frontal gyri and medial caudate nuclei. this circuitry may be manipulated with rtms by 1) stimulation of the dorsolateral prefrontal cortex (dlpfc), 2) inhibition of the orbitofrontal cortex (ofc) directly, or 3) inhibition of the supplementary motor area (sma). the sma was chosen as a useful target for rtms because it has extensive connections with regions implicated in cognitive processes and motor control [14, 15 ]. table 1summary of studies of repetitive transcranial magnetic stimulation in treatment of obsessive - compulsive disorderstudy (year)targetndiagnosismedication continuationinterventiontimemean score (sd) on y - bocs pre - rtmsmean score (sd) on y - bocs post - rtmsmean score on mood scale pre - rtmsmean score on mood scale post - rtmsinterventiongreenberg. treatment)20 hz/2 s / min (80% of motor threshold)1 session of 20 min ; measurement after 8 h compulsions decreased right pfc (p = 0.02) (left pfc p = 0.05)no significant mood improvementcontrolmidoccipital12ocd20 hz/2 s / min (80% of motor threshold)1 session of 20 min ; measurement after 8 h compulsions decreased (midoccipital p = 0.07)no significant mood improvementinterventionsachdev. (2001)right pfc6treatment - resistant ocdyes, n = 10 (stable sri, benzodiazepine, neuroleptic treatment)10 hz (110% motor threshold)10 sessions of 2.5 min in 2 week ; measurement 4 week after last session27.2 (9.0)12.0 (3.9)23.2 (12.5) on bdi11.6 (14.6) on bdicontrolleft pfc6treatment - resistant ocd10 hz (110% motor threshold)10 sessions of 2.5 min in 2 week ; measurement 4 week after last session22.5 (6.3)16.5 (8.3)19.7 (12.5) on bdi10.8 (7.9) on bdiinterventionalonso. (2001)right dlpfc10ocdyes, n = 7 (stable sri, tca treatment)1 hz (110% of motor threshold)18 sessions of 20 min in 10 week ; measurement after 10 week24.0 (5.3)20.6 (9.1)11.1 (5.1) on ham - d10.8 (4.8) on ham - dcontrolright dlpfc8ocdyes, n = 6 (stable sri, tca treatment)sham condition18 sessions of 20 min in 10 week ; measurement after 10 week25.6 (6.1)25.3 (8.3)11.7 (2.7) on ham - d12.0 (3.0) on ham - dinterventionmantovani. (2006)sma10ocd / tsyes, n = 10 (stable sri, benzodiazepine, neuroleptic treatment)1 hz (100% of motor threshold)10 sessions of 20 min in 2 week ; measurement 2 week after last stimulation36.4 (7.5)26.0 (10.5)20.7 (11.4) on ham - d10.8 (10.7) on ham - dcontrolinterventionprasko. (2006)left dlpfc15sri - resistant ocdyes, n = 15 (stable sri treatment)1 hz (110% of motor threshold)10 sessions of 30 min in 2 week ; measurement 2 week after last stimulation29.8 (5.8)21.4 (9.2)controlleft dlpfc15sri - resistant ocdyes, n = 15 (stable sri treatment)sham condition10 sessions of 30 min in 2 week ; measurement 2 week after last stimulation23.4 (5.0)16.9 (5.9)interventionsachdev. (2007)left dlpfc10ocdyes, n = 9 (unknown treatment)10 hz (110% of motor threshold)10 sessions of 2.5 min in 2 week ; measurement directly after last stimulation26.020.0symptoms improved over time but no difference between groupscontrolleft dlpfc8ocdyes, n = 4 (unknown treatment)sham condition10 sessions of 2.5 min in 2 week ; measurement directly after last stimulation24.019.0symptoms improved over time but no difference between groupsinterventionruffini. (2009)left ofc16drug - resistant ocdyes, n = 23 (stable sri, neuroleptic, antiepileptic, benzodiazepine treatment)1 hz (80% of motor threshold)15 sessions of 10 min in 3 week ; measurement 12 week after last session32.1 (6.0)27.3 (9.4)no mood improvement over timecontrolleft ofc7drug - resistant ocdsham condition15 sessions of 10 min in 3 week ; measurement 12 week after last session31.4 (6.9)29.6 (6.7)no mood improvement over timeinterventionkang. [17 ] (2009)right dlpfc and sma10treatment - resistant ocdyes, n = 10 (stable sri, benzodiazepine treatment)1 hz (110% of motor threshold)14 sessions of 10 min in 2 week ; measurement 2 week after last session26.5 (5.6)23.6 (7.4)18.1 (6.6) on bdi17.2 (10.9) on bdicontrolright dlpfc and sma10treatment - resistant ocdyes, n = 10 (stable sri, benzodiazepine treatment)sham condition14 sessions of 10 min in 2 week ; measurement 2 week after last session26.3 (4.1)22.9 (6.2)16.7 (10.0) on bdi15.8 (14.4) on bdiinterventionmantovani. [18 ] (2010)sma9ocdyes, n = 13 (stable sri treatment)1 hz (100% of motor threshold)20 sessions of 20 min in 4 week ; measurement directly after last stimulation26.0 (5.4)19.4 (5.6)15.3 (10.6) on ham - d12.1 (11.4) on ham - dcontrolsma9ocdsham condition20 sessions of 20 min in 4 week ; measurement directly after last stimulation26.7 (5.5)23.5 (9.0)14.8 (6.9) on ham - d14.1 (8.8) on ham - dinterventionsarkhel. (2010)right dlpfc21ocdyes, n = 21 (tca, sri treatment)10 hz (110% of motor threshold)10 sessions in 2 week ; measurement 2 week after last session25.7 (3.9)change in score, 5.0 (2.3)12.5 (2.2) on ham - dchange in score, 3.8 (1.6) on ham - dcontrolright dlpfc21ocdyes, n = 21 (tca, sri treatment)sham condition10 sessions in 2 week ; measurement 2 week after last session23.6 (3.7)change in score, 4.2 (1.8)12.1 (2.7) on ham - dchange in score, 3.2 (1.0) on ham - dsame 12 individuals as investigated in the intervention groupbdi beck depression inventory, dlpfc dorsolateral prefrontal cortex, ham - d hamilton depression rating scale, ocd obsessive - compulsive disorder, ofc orbitofrontal cortex, pfc prefrontal cortex, rtms repetitive transcranial magnetic stimulation, sma supplementary motor area, sri serotonin reuptake inhibitor, tca tricyclic antidepressant, ts tourette s syndrome, y - bocs yale - brown obsessive compulsive scale summary of studies of repetitive transcranial magnetic stimulation in treatment of obsessive - compulsive disorder same 12 individuals as investigated in the intervention group bdi beck depression inventory, dlpfc dorsolateral prefrontal cortex, ham - d hamilton depression rating scale, ocd obsessive - compulsive disorder, ofc orbitofrontal cortex, pfc prefrontal cortex, rtms repetitive transcranial magnetic stimulation, sma supplementary motor area, sri serotonin reuptake inhibitor, tca tricyclic antidepressant, ts tourette s syndrome, y - bocs yale - brown obsessive compulsive scale a total of 110 ocd patients in 10 studies have been treated with rtms, targeting the dlpfc, the ofc, or the sma. four studies investigated the efficacy of rtms in ocd in a double - blind, randomized, sham - controlled design [12, 16, 18, 19 ] ; three studies in a sham - controlled design, although not double - blind [13, 17, 20 ] ; and three case studies in an open fashion [7, 14, 21 ]. the dlpfc has been the most investigated target for rtms in ocd. in 1997, greenberg. treated 12 ocd patients with rtms to the right dlpfc, the left dlpfc, and lastly the midoccipital cortex as a control condition. rtms was randomly applied to these targets in an open fashion on separate days, at 80% threshold, 20 hz for 2 s / min for 20 min. compulsions, as measured by the yale - brown obsessive compulsive scale (y - bocs), decreased significantly with 34.8% immediately after right dlpfc stimulation (p 0.04). a total of 76.2% of those receiving real rtms were partial responders (25% reduction in ham - d scores from baseline), compared with 66.7% in the sham group. the authors concluded that right dlpfc rtms has no effect on ocd but is modestly effective in the treatment of comorbid depressive symptoms. in conclusion, in open - label studies, high - frequency rtms of the right and/or left dlpfc appears to be effective in reducing obsessive - compulsive symptoms. however, this could not be replicated in double - blind, sham - controlled studies. in those studies, neither low nor high rtms and neither rtms to the left nor to ruffini and colleagues examined the ofc as a new target for rtms in drug - resistant ocd patients. the participants received 10 min of 1-hz rtms at 80% motor threshold for 15 sessions to the left ofc ; however, the coil was placed parallel (active, n = 16) or perpendicular (sham, n = 7) to the scalp. they found significant reduction of y - bocs scores comparing active versus sham treatment for 10 weeks after the end of rtms (p 0.04). a total of 76.2% of those receiving real rtms were partial responders (25% reduction in ham - d scores from baseline), compared with 66.7% in the sham group. the authors concluded that right dlpfc rtms has no effect on ocd but is modestly effective in the treatment of comorbid depressive symptoms. in conclusion, in open - label studies, high - frequency rtms of the right and/or left dlpfc appears to be effective in reducing obsessive - compulsive symptoms. however, this could not be replicated in double - blind, sham - controlled studies. in those studies, neither low nor high rtms and neither rtms to the left nor to the right dlpfc appeared to be more effective than sham rtms. in 2009, ruffini and colleagues examined the ofc as a new target for rtms in drug - resistant ocd patients. the participants received 10 min of 1-hz rtms at 80% motor threshold for 15 sessions to the left ofc ; however, the coil was placed parallel (active, n = 16) or perpendicular (sham, n = 7) to the scalp. they found significant reduction of y - bocs scores comparing active versus sham treatment for 10 weeks after the end of rtms (p < 0.02), with loss of significance after 12 weeks (p < 0.06). y - bocs reduction was 19.7% immediately after rtms and 14.7% after 12 weeks of follow - up, but only 6.7% and 5.7%, respectively, for the sham condition. there was also a benefit in terms of depressive and anxiety symptoms, but not at a significant level in the two groups. similar to findings for dlpfc rtms, this study suggests that low - frequency rtms of the ofc may only acutely improve obsessive - compulsive symptoms. two groups investigated the efficacy of low rtms to the sma in addition to ongoing pharmacotherapy. in 2006, mantovani. conducted an open - label study of 10 patients with ocd, tourette s syndrome, or both. individuals were treated with active rtms to the sma for 10 daily sessions at 1 hz, 100% motor threshold. after 2 weeks of daily rtms, the y - bocs reduction (28.6%) and ham - d reduction (47.8%) were both significant, and they remained stable after 3 months follow - up in the ocd as well as in the ocd / tourette s syndrome group. in 2010, the same group examined rtms (at 1 hz and 100% motor threshold) to the sma bilaterally in a randomized, sham - controlled, double - blind design. after 4 weeks of stimulation, the y - bocs decreased significantly (p < 0.001) in the active group (6 points, 25.4%) and the sham group (3.2 points, 12.0%) without significant differences between the two treatment conditions. finally, an open, sham - controlled study investigated the possible therapeutic effects and safety of sequentially combined low - frequency (1 hz, 110% threshold) rtms to the right dlpfc and the sma in 10 patients with treatment - resistant ocd. similar improvements in obsessive - compulsive and depressive symptoms were observed for sham and real rtms at 2 weeks after the last of 14 sessions. the y - bocs reductions were 2.9 points (10.9%) and 3.4 points (12.9%) for real and sham rtms, respectively. rtms was a safe method, and there was no significant change in cognitive functioning after stimulation. similar to dlpfc and ofc stimulation, rtms to the sma was a safe method to immediately improve obsessive - compulsive symptoms ; however, improvement did not linger on over time. in conclusion, efficacy of low- and high - frequency rtms to the left or right dlpfc, the ofc, or the sma has been investigated in a total of 110 obsessive - compulsive patients over the past decade. although open studies have initially demonstrated beneficial effects of rtms on obsessive - compulsive and depressive symptoms during the first hours after stimulation, these effects disappeared during follow - up and, more importantly, rtms did not show any advantages over sham stimulation in double - blind, sham - controlled studies. although extremely rare, the most severe acute adverse effect related to rtms is the induction of epileptic seizures. the chance of getting a seizure during high - frequency rtms is greater than during low - frequency rtms. other side effects that have been reported are induction of hypomania, local pain, headache, paresthesia, hearing changes, and thyroid - stimulating hormone and blood lactate level changes. the two latter have only been reported in high rtms. in the studies of rtms in ocd patients, low - frequency rtms study patients occasionally reported headache or localized scalp pain [14, 16, 17 ], whereas in the high - frequency rtms patients, side effects were more often noted. the most common complaint in those studies was headache, followed by localized scalp pain, facial nerve stimulation, fainting, and weepiness [12, 20, 21 ]. none of the side effects held on longer than 4 weeks after stimulation, and neither serious adverse events such as seizures and memory problems nor cognition problems were disclosed. since 1997, rtms has been applied as an experimental treatment in cases of refractory ocd. local induction of a depolarizing magnetic field pulse may decrease obsessive - compulsive symptoms by normalizing hypermetabolism in orbitofrontal - striatal circuits. the technique is noninvasive and yields no side effects or mild side effects, of which headache is the most common. because of the lack of studies with comparable stimulation or treatment parameters and with reliable designs, it is difficult to draw clear conclusions ; this corresponds with a cochrane review from 2003 about tms treatment in ocd. explorations of rtms to the dlpfc, ofc, or sma in a total of 10 studies have demonstrated only acute efficacy for obsessive - compulsive symptoms of rtms and no differences with sham treatment. to generalize the results of these studies, careful consideration of target regions and stimulation parameters, longer follow - up, and the use of a double - blind, sham - controlled design may allow us to draw founded conclusions in the future. besides, as the efficacy of rtms is often time limited, the necessity of a second rtms after several weeks should be investigated. moreover, functional mri studies of rtms in ocd are needed to clarify the specific stimulation region of rtms. nevertheless, rtms may play an important role in research settings. for example, rtms could be used to modulate obsessive - compulsive symptoms and brain activity in functional mri and receptor - binding studies. otherwise, as the improvement of symptoms is often noted in sham settings, it would be interesting to investigate the neural underpinnings of the placebo effect caused by sham rtms. finally, a novel stimulation paradigm was recently designed : theta - burst stimulation, a low - intensity burst of rtms at 50 hz as a safer, more consistent, and longer lasting rtms. the results of the first case study with this paradigm in ocd and depression are promising and warrant further exploration [25 ]. | obsessive - compulsive disorder (ocd) is a chronic, disabling disorder. ten percent of patients remain treatment refractory despite several treatments. for these severe, treatment - refractory patients, repetitive transcranial magnetic stimulation (rtms) has been suggested as a treatment option. since 1997, in published trials, a total of 110 ocd patients have been treated with rtms. this review aims to provide an update on rtms treatment in patients with ocd. first, the mechanism of action is discussed, followed by the efficacy and side effects of rtms at various brain targets, and finally implications for the future. due to the lack of studies with comparable stimulation or treatment parameters and with reliable designs, it is difficult to draw clear conclusions. in general, rtms appears to be effective in open - label studies ; however, this has not yet been replicated in randomized, sham - controlled trials. |
preparing for the possibility of suicide and having a pre - established sop for postvention ready is critical to helping individuals cope in the aftermath of a suicide. although every fire department s sop may need to be modified to remain in compliance with existing departmental policy, the following protocol was designed to serve as a general guide for suicide postvention within fire service. this first document is intended to be a how - to sop, and it is supported by an educational document with do s and donts, suicide myths, and online resources. the goals and objectives for suicide postvention for department members include the following : ease the trauma and related effects of the lossprevent the onset of adverse grief / complicated grief, defined as feelings of loss that are debilitating and do not improve over timereduce stigma and social isolation that can result from suicide lossminimize the risk of new suicidal behavior ease the trauma and related effects of the loss prevent the onset of adverse grief / complicated grief, defined as feelings of loss that are debilitating and do not improve over time reduce stigma and social isolation that can result from suicide loss minimize the risk of new suicidal behavior notification procedure the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd).there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information.with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials).the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help.determine protocol regarding social media. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. determine who will be involved designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service.physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop.designate a department liaison for responding to the families.designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. responding after a suicide : response to suicide will depend on where the suicide took place and the characteristics of the member involved. for example, although it happens rarely, the procedures will be very different if the suicide took place in quarters by an active member than if they took place out of quarters by an active member or a retiree. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. responding to the family financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). responding to department members short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months they go once a week or every 2 weeks to do outreach. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support.establish methods of follow - up after the suicide. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it.prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. concluding the postventionafter several weeks (or as determined by the department), phase out the postvention process.set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future.if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide.reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time.have postvention coordinator continue to record and track any follow - up services to the family provided by the department. notification procedure the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd).there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information.with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials).the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help.determine protocol regarding social media. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd). there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information. with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials). the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. determine who will be involved designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service.physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop.designate a department liaison for responding to the families.designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service. physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop. designate a department liaison for responding to the families. designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. responding after a suicide : response to suicide will depend on where the suicide took place and the characteristics of the member involved. for example, although it happens rarely, the procedures will be very different if the suicide took place in quarters by an active member than if they took place out of quarters by an active member or a retiree. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. responding to the family financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). responding to department members short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months they go once a week or every 2 weeks to do outreach. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support.establish methods of follow - up after the suicide. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it.prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months they go once a week or every 2 weeks to do outreach. there may be a critical time period between 24 months when clinical symptoms develop. short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months. there may be a critical time period between 24 months when clinical symptoms develop. match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it. prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness frustration / lack of understanding self - medicating behaviors belief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. there are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. concluding the postventionafter several weeks (or as determined by the department), phase out the postvention process.set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future.if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide.reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time.have postvention coordinator continue to record and track any follow - up services to the family provided by the department. after several weeks (or as determined by the department), phase out the postvention process. set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future. if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide. reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time. have postvention coordinator continue to record and track any follow - up services to the family provided by the department. preparing for the possibility of suicide and having a pre - established sop for postvention ready is critical to helping individuals cope in the aftermath of a suicide. although every fire department s sop may need to be modified to remain in compliance with existing departmental policy, the following protocol was designed to serve as a general guide for suicide postvention within fire service. this first document is intended to be a how - to sop, and it is supported by an educational document with do s and donts, suicide myths, and online resources. the goals and objectives for suicide postvention for department members include the following : ease the trauma and related effects of the lossprevent the onset of adverse grief / complicated grief, defined as feelings of loss that are debilitating and do not improve over timereduce stigma and social isolation that can result from suicide lossminimize the risk of new suicidal behavior ease the trauma and related effects of the loss prevent the onset of adverse grief / complicated grief, defined as feelings of loss that are debilitating and do not improve over time reduce stigma and social isolation that can result from suicide loss minimize the risk of new suicidal behavior notification procedure the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd).there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information.with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials).the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help.determine protocol regarding social media. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. determine who will be involved designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service.physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop.designate a department liaison for responding to the families.designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. responding after a suicide : response to suicide will depend on where the suicide took place and the characteristics of the member involved. for example, although it happens rarely, the procedures will be very different if the suicide took place in quarters by an active member than if they took place out of quarters by an active member or a retiree. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. responding to the family financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). responding to department members short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support.establish methods of follow - up after the suicide. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it.prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. concluding the postventionafter several weeks (or as determined by the department), phase out the postvention process.set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future.if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide.reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time.have postvention coordinator continue to record and track any follow - up services to the family provided by the department. notification procedure the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd).there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information.with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials).the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help.determine protocol regarding social media. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd). there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information. with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials). the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. determine who will be involved designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service.physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop.designate a department liaison for responding to the families.designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service. physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop. designate a department liaison for responding to the families. designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. responding after a suicide : response to suicide will depend on where the suicide took place and the characteristics of the member involved. for example, although it happens rarely, the procedures will be very different if the suicide took place in quarters by an active member than if they took place out of quarters by an active member or a retiree. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. responding to the family financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). responding to department members short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months they go once a week or every 2 weeks to do outreach. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support.establish methods of follow - up after the suicide. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it.prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months they go once a week or every 2 weeks to do outreach. there may be a critical time period between 24 months when clinical symptoms develop. short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months. there may be a critical time period between 24 months when clinical symptoms develop. match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases it is essential to maintain a connection with firefighters after suicide loss. the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it. prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness frustration / lack of understanding self - medicating behaviors belief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. there are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. concluding the postventionafter several weeks (or as determined by the department), phase out the postvention process.set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future.if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide.reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time.have postvention coordinator continue to record and track any follow - up services to the family provided by the department. after several weeks (or as determined by the department), phase out the postvention process. set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future. if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide. reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time. have postvention coordinator continue to record and track any follow - up services to the family provided by the department. notification procedure the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd).there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information.with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials).the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help.determine protocol regarding social media. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. determine who will be involved designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service.physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop.designate a department liaison for responding to the families.designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. responding after a suicide : response to suicide will depend on where the suicide took place and the characteristics of the member involved. for example, although it happens rarely, the procedures will be very different if the suicide took place in quarters by an active member than if they took place out of quarters by an active member or a retiree. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. responding to the family financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). responding to department members short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months they go once a week or every 2 weeks to do outreach. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support.establish methods of follow - up after the suicide. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it.prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. concluding the postventionafter several weeks (or as determined by the department), phase out the postvention process.set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future.if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide.reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time.have postvention coordinator continue to record and track any follow - up services to the family provided by the department. notification procedure the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd).there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information.with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials).the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help.determine protocol regarding social media. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. the notification procedure should follow existing chain - of - command and have protocol instructions for who is required to be involved. the suicide death should be precisely in keeping with any other death in fire service, and notification procedures would follow existing policies (reference policy # _ _ _, lodd). there are no universal rules for who should do what, as each department will differ with respect to what types of individuals are available and willing to be involved in the postvention process. it is recommended that a company meeting be called as soon as possible (within 24 hours, certainly) where firefighters can be briefed and provided resources, referrals, directions as to how they can help family members and fellow co - workers, and time to process the information. with the permission of the family, the facts of the suicide should be stated as clearly as possible so as to limit the incidence of rumors ; however, this information should be provided in a respectful and unglorified manner (see do s and donts in educational materials). the announcement to the department should be accompanied with a phone number or helpline for firefighters to call for help. decide what is acceptable for the department to post and what is acceptable for individual firefighters to post. determine who will be involved designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service.physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop.designate a department liaison for responding to the families.designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. designate a team leader to coordinate the response to the suicide in the fire department, perhaps someone with counseling experience or a long history in fire service. physicians, counseling units, employee assistance programs, chaplains, officers, police, union officials, safety, and other key departmental teams should be assigned specific roles and given directions for what activities they should be involved with as part of the development of each specific department s sop. designate a department liaison for responding to the families. designate a team of support or peer counselors for liaisons and firefighters where they can get help if needed. responding after a suicide : response to suicide will depend on where the suicide took place and the characteristics of the member involved. for example, although it happens rarely, the procedures will be very different if the suicide took place in quarters by an active member than if they took place out of quarters by an active member or a retiree. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. in quarters response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. response to suicide death in quarters will be treated similarly to response to any other type of emergency situation. firefighters will call 911, assess vitals, and attempt resuscitation if possible. out of quarters response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. response to an out of quarter s suicide death will involve notification procedures and protocols for response at the department, hospital or victim s home. responding to the family financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). financial questions the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. the identified liaison person should have a document prepared that outlines benefits the family will receive after the death of their loved one. insurance and line of duty benefits are often a source of stress after a suicide and having clear information at hand will help to dispel anxiety and provide family members with clear expectations.because suicide is not consistently ruled a lodd, certain benefits may be limited. funeral details turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. turnout following a suicide death would ideally be no different than other types of death for firefighters. however, the funeral is an extremely critical time for grieving both for the family and for members of the department, and special care to respect the feelings of family needs to be taken. although isolation for the grief stricken is ill advised, care must be taken to ensure that vulnerable grieving family members are not intruded upon. if possible, provide ceremonial options to the family that they can choose from and encourage members of the department to attend. departmental help the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). the protocol established at fdny following 9/11 was to assign one or two members to be liaisons or contacts for grieving families to help meet the needs of the family from the department. this wisdom led to better adaptation to loss for both family and brother / sister firefighters. departments including this in an sop should set boundaries and expectations so the liaisons can maintain balance in their own lives and establish protocols to deal with any difficult interactions (e.g., when and where to recommend that family members seek mental health treatment if they are having a particularly difficult time adjusting to the loss). responding to department members short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support.establish methods of follow - up after the suicide. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases it is essential to maintain a connection with firefighters after suicide loss. the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it.prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. short term vs. long term support short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months they go once a week or every 2 weeks to do outreach. there may be a critical time period between 24 months when clinical symptoms develop. short term officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. officers go out to the firehouse with a chaplain, ceremonial officer, and peer counselors and do an umbrella overview of what is going to transpire over the next couple of days and check in with the members and captain. longer term match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months. there may be a critical time period between 24 months when clinical symptoms develop. match a peer counselor to the firehouse. during the first week the peer checks in with the members of the firehouse regularly, in an attempt to touch base with as many affected members as possible. over the next several months. there may be a critical time period between 24 months when clinical symptoms develop. determine the family tree within the department the network of those who were closest to the firefighter who died of suicide. establishing this list will aid in connecting those who may be the most vulnerable following the suicide with resources and support. there are several means that can be used to check - in with firefighters following a suicide in order to evaluate how they are doing. using self - assessment handouts, leaving business cards for peer counselors at the firehouse, displaying resources for emergency hotlines or telephone therapy or websites for online help can all be useful. if the results of any questionnaires or assessments indicate a potential behavioral health problem, there must be the appropriate support in place for connecting that firefighter to treatment. in all cases the more that peer counselors and other mental health support staff engage with firefighters after a suicide, the more likely it is that the affected firefighters will get help if they need it. prepare for and address potential emotions, behaviors, and beliefs that may arise after a suicide (all of the following are normal and to be anticipated) : anger and shamefrustration / lack of understandingguiltgriefself - medicating behaviorsbelief that suicide is a sign of weakness frustration / lack of understanding self - medicating behaviors belief that suicide is a sign of weakness responding to firefighters at - riskthere are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. there are times when the signs of a behavioral health problem after a suicide are more difficult to handle. for example, a positive drug screen, an act of aggression, alcohol abuse, or demonstrating poor work performance all suggest that a firefighter may be having difficulty coping with the loss. responding in these situations with the knowledge that such behaviors could be related to the firefighter s difficulty coping with the loss can potentially deter unnecessary disciplinary action and instead connect a firefighter to treatment that he or she may desperately need. concluding the postventionafter several weeks (or as determined by the department), phase out the postvention process.set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future.if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide.reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time.have postvention coordinator continue to record and track any follow - up services to the family provided by the department. after several weeks (or as determined by the department), phase out the postvention process. set up meetings with firefighters and family members to have a closing discussion and provide resources if they need help in the future. if desired by firehouse or family, plan future check - in times by peer counselors or team leaders on a periodic or monthly basis between 6 months and a year after the suicide. reinforce the fact that grief following suicide can take a longer time to process, and help will be available at any time. have postvention coordinator continue to record and track any follow - up services to the family provided by the department. | abstractthis project aimed to develop a standard operating procedure (sop) for suicide postvention in fire service. first, an existing sop was refined through expert review. next, focus groups were conducted with fire departments lacking a peer suicide postvention sop ; feedback obtained guided revisions. the current article describes the iterative process used to evaluate and revise a suicide postvention sop into a postvention guideline that is available for implementation and evaluation. postventions assist survivors in grief and bereavement and attempt to prevent additional negative outcomes. the implementation of suicide postvention guidelines will increase behavioral wellness within fire service. |
it is estimated that by 2020, depression will be the second leading cause of morbidity after ischemic heart disease. lifetime prevalence of depression estimates varied widely, 8.6% in europe, 16.9% in the us, and 3% in japan. furthermore, about 14% of the global burden of disease has been attributed to neuropsychiatric disorders. the prevalence of major depression is approximately 2 times higher in women than in men. furthermore, the increased rates of depressive symptoms are observed in women after the birth of a child (postpartum depression), in the unemployed, in older people and after cardiovascular and neurological disturbances. at the ages over 65-year - old, depression is the most common mental health problem and probably the most frequent cause of emotional suffering in late life. the aging of the world population results in the increasing prevalence of depression in the elderly and is estimated to affect one in seven people. moreover, the prevalence of major depression in higher age groups is estimated to be 14% in the community and of subsyndromal depression (includes depressive syndromes such as dysthymia, bereavement, adjustment disorder with depressed mood, and minor depression) 1530%. however, depression is not a natural part of aging and with appropriate treatment it is often reversible. untreated, depression poses a critical impact on well - being and the quality of life of the elderly leading to serious functional impairment, reduced quality of life, high rates of suicide attempts, increased health care utilization and health expenditures. despite the fact that persons with depression often seek help in primary care, they are not recognized as having depressive symptoms by the general practitioner. consequently, depression is under - detected and under - treated in primary health care. it has been noticed that only 11% (in china) to 61% (in belgium) of patients with severe mood disorders received any care in the year before. among the elderly, the major risk factors for depression are the female gender, co - morbidity where the prevalence of depression range from 10% to 43%, social network losses, low social support, cognitive deficits, and negative life events. in greece, the prevalence of depression in people over 60-year - old shows high variability, ranging from 6% to 70% depending on study design and studied population groups. the aim of the present study was to estimate a possible under - detection of depression in members of the daycare centers for older people (kapi) in the municipality of patras and tripolis in greece. further objectives were to estimate the prevalence of depressive symptoms in older people, to investigate the possible risk factors and to compare with other findings for greece. a cross - sectional study was conducted among the registered and active members of the four kapi in the municipality of patras and tripolis, west - greece, and peloponnese, respectively, in the time period from march 2011 to october 2012. the choice of age (60 years and over) was made according to the age limit of registration for the kapi. an anonymous questionnaire was developed to collect basic demographic, medical, and socioeconomic data including three questions from the european health interview survey (ehis) regarding self - reported and/or by a physician - diagnosed depression, in the last 12 months or during the lifetime course (hs.4, hs.5, hs.6). none of the participants suffer from cognitive deficits according to their medical records and prescribed medications. all of the participants who state suffering from depression in the last 12 months or during a lifetime period were confirmed according to their medical history data and their prescribed medications for depression. moreover, to all participants the greek validated version of the geriatric depression scale-15 (gds-15) was applied, to screen for depressive symptoms. the scores of the gds-15 were compared to the corresponding answers of the ehis questions. associations between the gds-15 score and various recorded basic parameters were made. during the study period, the same researcher visited either in the morning or in the afternoon, one of the four centers, and distributed the questionnaires to the members. in the most cases, a face to face interview about 400 persons (active members) visit daily one of the kapi, of whom 378 agreed to participate in the study. the majority of the nonactive members do not visit the centers for several reasons such as serious health problems or moving to another area. the gds-15 was first developed by yesavage., (1982) has been tested and used extensively in many countries to assess depressive symptoms in elderly, in community, in acute, and in long - term care settings. it is a brief questionnaire, in which participants are asked to response to the 15 closed questions by answering yes or no, in reference to how they felt on the day of administration. the gds-15 has been standardized and adapted in a greek elderly population and was found to have a 92% sensitivity and a 95% specificity. scores 05 are considered normal, 610 indicate moderate depression, and 1115 indicate severe depression. the study was approved by the plenary meeting of the medical school of patras and the ethics committee of the university of patras, greece. participants were informed about the aims and procedures of the study and provided written informed consent for participation. moreover, the board of both kapi at the municipality of patras and tripolis approved the research protocol and the conduction of the study. statistical analysis was performed with statistical analysis was performed using spss for windows (version 17.0, spss, chicago, il, usa). the chi - square test was used to test the difference between categorical variables. a p 10), while 54% and 70% scored above the depression cut - off of five, respectively. a recent study in four kapi of municipality in attica indicates an overall prevalence rate of 30.3%, more detailed 22.2% for moderate, and 8.1% for severe depressive symptoms, measured with gds-15., conducted in a health center in northern greece, where the prevalence of mild to moderate depression in women and men was estimated to be 29.9% and 19.6%, respectively, according to geriatric depression screening scale. in the study of papadopoulos., which was conducted in a rural area in central greece, the prevalence of depressive symptoms was 39%, 27% of mild (gds-15 > 6), and 12% of severe type (gds-15 > 10). a study conducted in uk with the largest community sample of people aged 75 years and higher showed lower rates of moderate and severe depressive symptoms (gds - score 3 = 34.6%, 6 = 8.0%, 8 = 3.1%) than the present study. however, it must be noted that different thresholds were used as compared to our study. except the high prevalence of depressive symptoms, the present study reveals that a remarkable percentage of the study population is not aware of having depression and was never been diagnosed with this condition. the low self - reported percentage of diagnosed depression in contrary to the results obtained by the gds-15 screening, suggests a substantial under - detection in the specific population group. as other studies had shown, depression seems to be the most under - diagnosed disease in primary health care and especially patients in early stages of disease are less likely to be detected. it is estimated that only 3555% are recognized by primary care physicians, although it is known, that depression is one of the most common disorders in older adults who are seeking help in primary health care. our findings come to support these high rates of under - diagnosis since one in two of the participants screened with depressive symptoms, is not recognized and does not receive the appropriate medication. moreover, it has been observed that depressive disorders are not only under - recognized but also under - treated and often not in line with current medical standards. other studies reveal that only 19% of patients are receiving appropriate anti - depressive treatment, or that 43% of patients who have been diagnosed with depression by their general practitioner were prescribed an antidepressant, 34% are not being treated appropriate and 41% remain without treatment. several reasons are described in the literature for under - diagnosis and under - treatment of depression in older adults. the study of bartels pointed out that elderly people with depressive symptoms are less likely to use special mental health care but prefer to access the general health care system. however, general practitioners are more likely to under - detect depression due to lack of experience, lack of continuous training in mental health, or due to their attitude regarding depression as a natural consequence of ageing and as accessory symptom of a physical disease. last but not least, stigmatization of depressed individuals may lead to low recognition, treatment discontinuation and nonadherence of therapy in older patients. depression, even the most severe forms, is one of the diseases with high treatment effectiveness if diagnosed at an early stage. studies have shown, that various interventions, combining enhanced strategies of physicians and patient education, specialist services support, as well as monitoring of medication compliance have a positive effect on recognition, management, and outcome of the disease. consequently, it is wishful to train primary care physicians, as well as nurses and social workers to raise the awareness of recognizing depression, especially in older adults. the application of the short and user - friendly gds-15 by general practitioners would increase the ability to detect and treat depression in the elderly population, as shown in this study. the present study revealed women having higher rates of depression than men, a result, which is in agreement with other studies conducted in greece and other countries. other aggravating factors for depression in the present study, as well as in several other studies, are the low education level, being not married, including being widowed or divorced and in patients with chronic diseases, which is confirmed by previous studies. the limitations of the present study derive from the fact that, the prevalence of depression depends on the cut - off scores are used to distinguish between no depression, moderate and severe form of depression, and the validity of this threshold against the clinical diagnosis. the observed variations in the mentioned studies, may be attributed to different characteristics of the rural, urban, and island populations ; the cut - off score and the tools that have been used to estimate depression or to other parameters that were not measured. even though the prevalence of depression seems to be high in the studied population, if the registered members of kapi who do not visit the day care centers due to various reasons would have been included, very possibly the prevalence of depressive symptoms would be higher. however, the study was conducted in a specific population, that is, the members of daycare centers for older people and thus our findings can not be generalized for the whole older population. depression in the older population shows a high prevalence is associated with specific demographic and socioeconomic characteristics and appears to be an under - diagnosed disease. to respond to this problem and to focus on prevention and early detection of depression in older adults, it is necessary to create a strong supportive network and simultaneously to strengthen the already existing programs, institutions and services in the community, and primary health care. | objective : the objective of this study was to estimate the prevalence and probable under - diagnosis of depressive symptoms in elderly of an urban and semi - urban area in greece.materials and methods : a cross - sectional study was conducted among the members of 4 days care centers for older people (kapi), three in the municipality of patras, west - greece, and in one in tripolis, peloponnese, greece. a total of 378 individuals took part in the study, aged > 60 years. a questionnaire was developed to collect basic demographic data, including three questions from the european health interview survey, regarding self - reported or by a physician - diagnosed depression. moreover, to all participants the greek validated version of the geriatric depression scale-15 (gds-15) was applied, to screen for depressive symptoms.results:according to gds-15, 48.1% of the studied population screened positive for depressive symptoms (38.6% moderate, 9.5% severe), whereas having ever been affected with chronic depression reported 19.0% by themselves. in 162 members of kapi of patras and in 106 of tripolis, who never reported have been affected by depression and depressive symptoms were observed in 27.7% and 44.7%, respectively. in 28 individuals from patras, who reported not to know if they have depression and in 10 from tripolis, depressive symptoms were observed in 60.7% and 90%, respectively, applying the gds-15.conclusion:except the high prevalence, the present study reveals a remarkable under - detection of depressive symptoms in older adults. various interventions in primary care are necessary so as to increase detection rates of depression among the elderly. |
pemphigus has been treated with dexamethasone cyclophosphamide pulse (dcp) therapy since 1981 with several studies having reported its efficacy. the occurrence of premature ovarian failure (pof)/amenorrhoea / azoospermia leading to sterility with the administration of pulse cyclophosphamide dose led to the search for a safer regimen to circumvent this side effect. one recommendation was to withhold the monthly cyclophosphamide pulse while allowing the daily oral cyclophosphamide 50 mg to be continued for the phases i, ii and iii. alternatively dexamethasone azathioprine (dap) therapy consisting of conventional dexamethasone pulses in phases i, ii and daily oral azathioprine 50 mg in phases i, ii and iii was recommended for patients in the reproductive age group and those who had not completed their families as azathioprine has no effect on gonads. some patients showed a poor response to conventional dcp and had a prolonged phase i. in these patients an alternative immunosuppressant was given. methotrexate 7.5 mg orally weekly was given for the first three phases along with dexamethasone pulses in first two phases (dmp). however prior to 2004 dcp regimen used was the basic one in which the duration of phase ii was 6 months and that of phase iii was 12 months. this retrospective and prospective study was carried out on native kashmiri patients of pemphigus from october 2004 to october 2010. the diagnosis of pemphigus was made on clinical grounds with confirmation being done by submitting the skin or mucosal biopsy for histopathology and direct immunoflourescence. due to non availability of facilities, indirect immunoflourescence of serum for antibody levels could not be done. the approval of the ethics committee of government medical college srinagar was sought for the study. a complete demographic profile of the patients was taken including age, sex, occupation, marital status (especially if family has been completed) as also family history of pemphigus, menstrual history (in case of females) and any co morbid illness. the variant of pemphigus diagnosed in each case was noted and the duration of disease prior to diagnosis was recorded. the extent of skin involvement, presence and extent of mucosal involvement, presence of nikolsky 's sign was noted in each case. exclusion criteria for pulse therapy were pregnancy, lactation, and age less than 18 years, uncontrolled diabetes, hypertension or any severe systemic disease where large dose steroids are contra indicated. all patients were admitted in the inpatient wing of the department. after taking informed consent, baseline investigations were done. these included a complete haemogram, renal and liver function tests, blood sugar estimation, skiagram chest, electrocardiogram, mantoux test and serum amylase. depending upon the individual patient situation bacterial culture sensitivity from infected cutaneous lesions was taken. all patients were put on daily condys baths, rexidin gargles and sterile vaseline gauze dressings. antibiotics and antifungal were given in individual cases depending upon the presence of cutaneous or mucosal infection. then the patients were put on three regimens depending upon the situation : conventional dcp, dap for patients in the reproductive age group and dmp in those in whom phase i on dcp was more than 12 months. for this study only those patients with pemphigus who had completed phases i, ii and iii on dcp, phases i and ii on dap and all those put on dmp were included to simplify the results. all diabetics were administered 10u of insulin in the dextrose 5% along with the pulse. depending upon individual response adp or daily steroids were given in phase i. the monitoring included monthly hemogram, urine analysis, renal and liver function tests and six monthly skiagram chest for dcp, weekly hemogram for first two weeks for methotrexate, then monthly and monthly renal and liver function monitoring, weekly hemogram and liver function for azathioprine for first month and then monthly. all patients were routinely administered daily calcium vitamin d supplements and weekly bisfosfonates. the number of treatment dropouts and mortality if any was noted. after completion of phase iii, the patients were put on monthly follow - up. of the 50 consecutive patients, the total number of patients included in the present study were 47. one patient with a clinical (hypopyon sign positive) and histopathological diagnosis of ig a pemphigus was not put on pulse therapy. two other female patients who were married and had one offspring each were put on dp plus daily cyclophosphamide therapy in view of the very severe disease in them. incidentally one of these developed secondary amenorrhoea which on investigation was secondary to premature ovarian failure. there were 11 males and 36 females patients included in the present study (m : f ratio being approximately 1:3). the age ranged from 18 to 70 years with an average age at presentation of disease being 40 years in males [table 1 ]. a significant number of female patients were in early twenties to late teens indicating an earlier onset in females in our cohort of patients. the age distribution of all patients the patients in the reproductive age group and those yet to complete their families were nine females and three males. socio economic conditions ranged from affluent in four, middleclass in 25 and poor in 18. the variants of pemphigus seen were vulgaris (41), vegetans (4), foliaceous (2). no case of erythematosus, drug - induced or paraneoplastic pemphigus were seen in the present study. the extent of skin involvement by blistering and denudation at the time of presentation ranged from 0% to more than 90% body surface area. the duration from eruption till the time of seeking medical attention was ranging from three days to seven months with mucosal lesions being referred and diagnosed later than skin lesions. cerebriform tongue (premalathas sign) was seen in our female patients with p vegetans. palmoplantar and nail involvement was seen in one young female patient with a severe disease who subsequently succumbed to the disease. one elderly male patient with prolonged phase i on dcp therapy presented with dyshidrosiform lesions of pemphigus. one patients male aged 35 years presented with acral lesions predominantly and he showed a prolonged phase i. eight patients had a positive bacterial swab needing antibiotics and five had mucosal candidiasis (oral in 5, vaginal in 3, esophageal in 2) needing antifungal at the time of admission. 30 patients were put on dcp, 12 on dap therapy and 5 on dmp therapy [table 2 ]. patients with disease presenting in or localised to oral mucosae were more likely to have a longer duration of disease prior to diagnosis due to lack of referral or misdiagnosis. p vegetans was present in two females, p foliaceous in two males while all others had p. vulgaris and the extent of involvement varied [tables 3 and 4 ]. the variants of pemphigus on dcp therapy the extent of involvement in patients on dcp therapy mucosal involvement was seen in all except two with foliaceous. the duration of phase i was as short as one month in one patient [table 5 ]. the duration of phase 1 on dcp on an average six months would suffice, it was as prolonged as 20 months in one patient (a young male with p.foliaceous who was not coming at fixed 28 day periods) but as the diseases activity remained mild therapy was continued. one of these was not regular in taking treatment and relapsed in phase iv (male with severe mucosal involvement). daily steroid therapy was given in 10 patients for 4 - 7 months. 1 patient developed haemorrhagic cystitis while on dcp while rbcs in urine were seen in 5 patients. both were young patients with a severe disease who had also taken daily oral steroids in their phase ii. further treatment in these patients was challenging as disease and treatment side effects had to be weighed. 12 patients with pemphigus who had completed phase i and ii of dap therapy were considered for the present discussion. these included 3 males and 9 females. one female had extensive orogenital lesions. 1 patient had concomitant diabetes and none had hypertension. 9 patients had 10 - 30% involvement of bsa and 3 had 30 - 70% involvement. duration of phase i was less than 6 months in 1,6 - 12 months in 4 and greater than 12 months in 7 patients [table 6 ]. duration of phase i on dap five patients needed adp (for 3 - 6 months) and these five needed daily steroids also (4 - 6 months). in phase ii, one patient developed disease activity in the third month itself. this patient subsequently died in spite of adp and daily steroids due to a very active disease leading to septicaemia. the number of relapses on dap in phase iii five patients relapsed at 5 - 9 months. in phase four patients had pemphigus vulgaris and one (female, 45yrs old) had pemphigus vegetans. none of the patients in this category had diabetes while two had hypertension and were on calcium channel blockers for the same. one patient had been on dcp since the last thirteen months while all others had been on dcp since 9 - 12 months. adp had been administered in two patients and daily steroids were given to all five while on dcp. all five patients had mucosal involvement but severe orogenital and conjunctival lesions were seen in one female patient only (variant vegetans). severity of disease on the basis of bsa was 10 - 30% in 1 and 30 - 70% in four. all patients had completed their families. only one patient of these completed the first three phases of dmp therapy [table 8 ]. of the others disease activity was poorly controlled and hence one patient defaulted and in three others dmp was discontinued as patient response was poor. the course of disease on dmp poor healing of lesions and an increased requirement for concomitant antibiotic and anti fungal therapy was felt in all five patients. the criteria for confirmation of diagnosis did not include iif as facilities for same are not available. the levels of anti desmoglein 1 antibodies by elisa and anti desmoglein 3 antibodies by elisa have been found to corelate with the severity of cutaneous and mucosal involvement respectively. this led to a grey area as regards the definition of severity of disease at the time of diagnosis by a reproducible and non biased criteria with no possibility of inter observer error. this criteria however remains controversial as a few other studies have shown that correlation of severity with antibody levels is not foolproof. recently a clinical set of criteria for disease severity on the basis of mucosal involvement and body surface area denuded was suggested. the same was however not available to us in the study. individualised treatment on the basis of severity was not given. hence whether the disease was mild or severe same megadoses of steroids and immunosuppressants were given. a paradoxical worsening of disease seen after first few pulses in patients with mild disease at presentation was seen and had a bearing on patient compliance. the younger age of patients and an increased female proportion of patients were similar as in studies from iran. in view of these two factors marital status and whether family was completed assumed greater importance in our cohort of patients. dap would be recommended as a safer regimen as cases of pof was seen even with dp plus daily cyclophosphamide regimen. this corroborates the apprehensions raised in previous study that even daily cyclophosphamide 50 mg during three phases gives a high cumulative dose in grams which can have a disastrous effect on gonads even if monthly megadose has been withheld. shortest duration of phase i, quickest onset of response even in more extensive disease and lowest relapse rates were seen with conventional dcp regimen. however noteworthy side effects were seen here these included premature ovarian failure (seen prior to 2005 when dap was not used), haemorrhagic cystitis and avascular necrosis head of femur. pertinently only one case of unmasking of tuberculosis is in contrast to the increased incidence of tuberculosis seen in a parallel study on systemic sclerosis patients who were on dexamethasone pulsed therapy. even though dexamethasone methotrexate pulse was given in poor responders it was seen that phase i was still the longest in this group. this may be indicative of the more severe disease per se but poor healing of lesions with methotrexate may also contribute. one way of circumventing this problem would be to give a higher dose of methotrexate in poor responders and to administer daily steroids on the basis of body weight. hence only if situation so demanded was antibiotic (quinolones for 7 - 10 days) or anti candidial treatment (fluconazole daily for 7 - 21 days) given. duration of phase i and relapses were seen more with azathioprine regimen as compared to dcp regimen suggesting that perhaps the present dap regimen needs modification - individualise the azathioprine dose rather than sticking to 50 mg daily in all cases. a major grey area is the duration of phase ii and iii being fixed at 9months. the decision should ideally include the elicitation of dry, wet or microscopic nikolskys sign, dif findings and antibody levels by iif at the end of phase i, ii and iii. limitations of the study : indirect immunoflourescence of the patients serum for anti desmoglein antibodies was not done due to non availability of facilities for same. the major limitation of this study was that a randomised controlled trial was not done as the disease is a serious one and immediate treatment is needed. | background : pemphigus has been treated with dexamethasone cyclophosphamide pulse (dcp) therapy since 1981. various modifications have been suggested in the original regimen. these include dexamethasone azathioprine pulse (dap) and dexamethasone methotrexate pulse (dmp) therapies.aims:to report our experience on the noncomparative study of various pulse regimens dcp, dap and dmp therapies in patients with pemphigus.materials and methods : the patients were put on three regimens depending upon the situation - conventional dcp, dap in the reproductive age group, dmp in patients who showed prolonged phase i more than 12 months while on dcp.results:30 patients were put on dcp therapy. the duration of phase i was on an average six months. relapse was seen in 3 patients in phase iv. 12 patients on dap therapy were considered. in phase iii 5 patients relapsed in phase iv four patients relapsed. five patients were put on the dmp. disease activity was poorly controlled and in three dmp was discontinued.conclusion:dcp remains the most effective regimen with quickest onset of remission and continuance of remission. in dap therapy fixation of dose of azathioprine at 50 mgs daily may be counterproductive. dmp does not fulfil the promise of a viable treatment option in recalcitrant pemphigus and this lacunae needs to be plugged. |
the genus pluteus, typified by p. cervinus, includes saprobic agaricoid fungi characterized by free lamellae, no universal veil (a partial veil may be present in a few species), pinkish spore - print, inverse hymenophoral trama, and inamyloid, cyanophilic spores (vellinga & schreurs 1985, orton 1986, singer 1986, vellinga 1990, heilmann - clausen 2012). it belongs to the pluteoid clade as circumscribed by several authors on the basis of molecular data (moncalvo. the infrageneric taxonomy is based primarily on the characteristics of the hymenial cystidia and pileipellis. historically, three sections based on morphological features are widely accepted (homola 1975, horak & heinemann 1978, orton 1986, singer 1986, citrin & eyssartier 1998, malysheva. pluteus, with thick - walled (metuloid) pleurocystidia, usually with apical hooks, and pileipellis as a cutis ; sect. hispidoderma with non - metuloid pleurocystidia, and a pileipellis consisting of elongated, filamentous elements organized either as a cutis, a hymeniderm or a trichoderm ; and sect. celluloderma with non - metuloid pleurocystidia and a pileipellis composed of swollen clavate or spheropedunculate elements organized in a hymeniderm, with transitions to an epithelium. singer (1956, 1958, 1986) sometimes also recognized two subsections in section celluloderma : mixtini and eucellulodermini, differing respectively in the presence or absence of elongated cystidium - like elements in the pileipellis. finally, vellinga & schreurs (1985) proposed an infrageneric classification for pluteus differing from singer s classificatory scheme only with respect to the placement of species with non - metuloid cystidia and a filamentous pileipellis : they reduced sect. hispidoderma to a subsection of celluloderma, including only species with a hymenodermal or trichodermal pileipellis, and established sect. this system has not been widely accepted by later authors (e.g. banerjee 1992, banerjee & sundberg 1993, citrin & eyssartier 1998, rodrguez & guzmn - dvalos 2001). justo. (2011a, b) showed a general agreement between the morphological subdivision of pluteus and the molecular phylogeny they obtained, even though : (1) some species with non - metuloid pleurocystidia and a pileipellis which was a differentiated cutis (formerly sect. celluloderma, together with the species characterized by a hymenidermal pileipellis, or in sect. celluloderma into subsections mixtini and eucellulodermini was not supported by the phylogenetic analyses of the molecular data ; species with a mixture of vesiculose - clavate and elongate elements in the pileipellis were not monophyletic and were distributed over sections celluloderma and hispidoderma. here we fully describe, based on recent italian collections, the rarely reported pluteus variabilicolor, which was originally assigned to subsect. a phylogenetic analysis of its sequences was performed to : (1) provide molecular insights on its status and taxonomic placement within pluteus ; and (2) assess whether this species, with a mixture of elongated and short elements in the pileipellis, was phylogenetically closer to species in sect. the its sequence of the isotype collection was also obtained to confirm our identifications of the recent collections. the optical microscope used was a nikon eclipse e400 trinocular with plan - achromatic objectives. the primary mounting media used were : distilled water for the observation of the pigments, and ammoniacal congo red for the other structures. spore measurements were based on 90 elements in ammoniacal congo red and randomly selected from three collections. the following abbreviations are used : l = number of lamellulae between each pair of entire lamellae ; and q = the length divided by width of the spores in side view, qm being the average quotient. descriptive terms used in the descriptions follow vellinga (1988), and collection acronyms follow index herbariorum except that tl and vm refer to the personal reference collections of tomaso lezzi and vincenzo migliozzi. genomic dna was isolated from 1 mg per specimen of four dried specimens (tm20130521 - 01, vm20111105 - 01, vm20130504 - 01 and bp - fn 56936) using the dneasy plant mini kit (qiagen, milan, italy). amplification reactions were performed in a pe9700 thermal cycler (perkin - elmer, applied biosystems) in a 25 l reaction mixture using the following final concentrations or total amounts : 10 ng dna, 1pcr buffer (20 mm tris / hcl ph 8.4, 50 mm kcl), 0.4 m of each primer, 2.5 mm mgcl2, 0.25 mm of each dntp, 0.5 units of taq polymerase (promega). the pcr program was as follows : 3 min at 95 c for one cycle ; 30 s at 94 c, 45 s at 50 c, 2 min at 72 c for 35 cycles, and 10 min at 72 c for one cycle. pcr products were resolved on a 1.0 % agarose gel and visualized after staining with ethidium bromide. the pcr products were purified with the ampure xp kit (beckman) and sequenced by macrogen (seoul, republic of korea). sequence assembly and editing were performed using geneious v. 5.3 (drummond. 2010). the sequences are deposited in genbank (www.ncbi.nlm.nih.gov/) under the accession numbers given in fig. the sequences obtained in this study were combined with published pluteus its rdna sequences selected from genbank and unite (http://unite.ut.ee) databases on the basis of the greatest similarity based on blastsearch, outcomes of recent phylogenetic studies focused on pluteus (justo. 2011a, b, pradeep. 2012), and subsequent phylogenetic analysis (preliminary trees not shown) the sequence alignments were then imported into mega v. 5.10 (tamura. 2011) for manual adjustment. pluteus diettrichii (hm562143) and pluteus seticeps (hm562199) were used as outgroup taxa following justo. best - fit models were estimated by both the akaike information criterion (aic) and the bayesian information criterion (bic) with jmodeltest v. 0.1.1 (posada 2008) to provide a substitution model for the alignment. phylogenetic analyses were performed using the bayesian inference (bi) and maximum likelihood (ml) approaches. the bi was performed with mrbayes v. 3.1.2 (huelsenbeck & ronquist 2001) with four incrementally heated simultaneous monte carlo markov chains (mcmc) run over 10 million generations, under the gtr+ evolutionary model. trees were sampled every 1 000 generations resulting in an overall sampling of 10 001 trees ; the first 2 500 trees were discarded as burn - in (25 %). for the remaining trees, a majority rule consensus tree showing all compatible partitions was computed to obtain estimates for bayesian posterior probabilities (bpp). ml estimation was performed through raxml v. 7.3.2 (stamatakis 2006) with 1 000 bootstrap replicates (felsenstein 1985) using the gtrgamma algorithm to perform a tree inference and search for a good topology. support values from bootstrapping runs (mlb) were mapped on the globally best tree using the -f a option of raxml and -x 12345 as a random seed to invoke the novel rapid bootstrapping algorithm. only bpp values over 0.70 and mlb over 50 % are reported in the resulting tree (fig. (2012) ; pairwise % identity values of its sequences were calculated using mega 5.10 (tamura. 2011). the optical microscope used was a nikon eclipse e400 trinocular with plan - achromatic objectives. the primary mounting media used were : distilled water for the observation of the pigments, and ammoniacal congo red for the other structures. spore measurements were based on 90 elements in ammoniacal congo red and randomly selected from three collections. the following abbreviations are used : l = number of lamellulae between each pair of entire lamellae ; and q = the length divided by width of the spores in side view, qm being the average quotient. descriptive terms used in the descriptions follow vellinga (1988), and collection acronyms follow index herbariorum except that tl and vm refer to the personal reference collections of tomaso lezzi and vincenzo migliozzi. genomic dna was isolated from 1 mg per specimen of four dried specimens (tm20130521 - 01, vm20111105 - 01, vm20130504 - 01 and bp - fn 56936) using the dneasy plant mini kit (qiagen, milan, italy). universal primers its1f / its4 were used for the its region amplification (white. amplification reactions were performed in a pe9700 thermal cycler (perkin - elmer, applied biosystems) in a 25 l reaction mixture using the following final concentrations or total amounts : 10 ng dna, 1pcr buffer (20 mm tris / hcl ph 8.4, 50 mm kcl), 0.4 m of each primer, 2.5 mm mgcl2, 0.25 mm of each dntp, 0.5 units of taq polymerase (promega). the pcr program was as follows : 3 min at 95 c for one cycle ; 30 s at 94 c, 45 s at 50 c, 2 min at 72 c for 35 cycles, and 10 min at 72 c for one cycle. pcr products were resolved on a 1.0 % agarose gel and visualized after staining with ethidium bromide. the pcr products were purified with the ampure xp kit (beckman) and sequenced by macrogen (seoul, republic of korea). the sequences are deposited in genbank (www.ncbi.nlm.nih.gov/) under the accession numbers given in fig. 1. the sequences obtained in this study were combined with published pluteus its rdna sequences selected from genbank and unite (http://unite.ut.ee) databases on the basis of the greatest similarity based on blastsearch, outcomes of recent phylogenetic studies focused on pluteus (justo. 2011a, b, pradeep. 2012), and subsequent phylogenetic analysis (preliminary trees not shown) the sequence alignments were then imported into mega v. 5.10 (tamura. 2011) for manual adjustment. pluteus diettrichii (hm562143) and pluteus seticeps (hm562199) were used as outgroup taxa following justo. best - fit models were estimated by both the akaike information criterion (aic) and the bayesian information criterion (bic) with jmodeltest v. 0.1.1 (posada 2008) to provide a substitution model for the alignment. phylogenetic analyses were performed using the bayesian inference (bi) and maximum likelihood (ml) approaches. the bi was performed with mrbayes v. 3.1.2 (huelsenbeck & ronquist 2001) with four incrementally heated simultaneous monte carlo markov chains (mcmc) run over 10 million generations, under the gtr+ evolutionary model. trees were sampled every 1 000 generations resulting in an overall sampling of 10 001 trees ; the first 2 500 trees were discarded as burn - in (25 %). for the remaining trees, a majority rule consensus tree showing all compatible partitions was computed to obtain estimates for bayesian posterior probabilities (bpp). ml estimation was performed through raxml v. 7.3.2 (stamatakis 2006) with 1 000 bootstrap replicates (felsenstein 1985) using the gtrgamma algorithm to perform a tree inference and search for a good topology. support values from bootstrapping runs (mlb) were mapped on the globally best tree using the -f a option of raxml and -x 12345 as a random seed to invoke the novel rapid bootstrapping algorithm. only bpp values over 0.70 and mlb over 50 % are reported in the resulting tree (fig. (2012) ; pairwise % identity values of its sequences were calculated using mega 5.10 (tamura. 2011). both bayesian and maximum likelihood analyses produced the same topology ; therefore, only the bayesian tree with both bpp and mlb values is shown (fig. the its data matrix comprised 46 sequences (including 38 from genbank and 4 from unite). the three italian collections of p. variabilicolor and the isotype collection cluster with the three collections of p. castri (holotype included) forming a well - supported clade (/variabilicolor ; bpp = 1, mlb = 100 %) within the pluteus leoninus clade of sect. the clade is in sister position to /chrysaegis (bpp = 1, mlb = 100 %). the clade consisting of /variabilicolor and /chrysaegis is sister (bpp = 1, mlb = 100 %) to /leoninus (= the p. leoninus complex). the p. leoninus complex includes collections identified as p. leoninus, p. roseipes, p. flavofuligineus, and two provisionally undescribed taxa (pluteus aff. 10 : 470 (2011). selected descriptions : babos (1978 : 193195) ; lohmeyer. (1994 : 9698) ; migliozzi (2011 : 47) ; justo. (1998 : 96, 127) ; albert (2011, two unnumbered figs) ; migliozzi (2011 : 4, 8) ; justo. pileus medium - sized, 3080 mm broad, smooth, lined up to middle, colour distinctly yellow - orange, with central darker umbo, often radially rugulose - veined, especially in mature specimens, hygrophanous, clearly striate or not at margin. lamellae free, quite crowded, ventricose, first white then pink, with the presence of lamellulae (l = 02), with concolorous or whitish, flocculose edge. stipe 3070 412 mm, cylindrical, slightly enlarged at the base, streaked - fibrillose over the entire length, yellow, with reddish tinges at the base in mature specimens. context white - yellowish, yellowish orange under the pileus surface, without distinctive smell and taste. basidiospores 5.57.0 4.55.5(6.0) m, on average 6.0 4.9 m, q = 1.101.35 ; qm = 1.22, broadly ellipsoid to subglobose, thin - walled. cheilocystidia fusiform to lageniform, 5090 2530 m, hyaline, thin - walled, frequently with short, wide appendix at the apex (mucronate). pileipellis a hymeniderm consisting of clavate, rounded terminal elements and cylindrical, elongated cells 40200 the hymeniderm with short cells is strongly predominant ; in other parts the elongated cells are strongly predominant. often the two types of elements are mixed independently from whether they are found : in the centre or in the margin of the pileus. caulocystidia present over the whole length of the stipe, 1370 315 m, cylindrical to claviform, fusiform, sometimes mucronate, usually grouped in clusters. habitat : on decaying wood of quercus cerris and branches of castanea sativa on the ground. specimens examined (of p. variabilicolor) : italy : lazio : manziana (rm), on decaying wood of quercus cerris, 21 may 2013, t. lezzi (tl20130521 - 01) ; loc., 26 july 2013, l. perrone (tl20130726 - 01) ; lombardia : parco di monza (mi), on decaying wood of castanea sativa, 30 may 2013, m. biraghi (tl20130530 - 01) ; lazio : manziana (rm) on decaying wood of quercus cerris, 5 nov. 2011, v. migliozzi (vm20111105 - 01) ; loc. hungary : near szrliget, on a pile of sawdust, 06 july 1977, m. babos & a. friesz (bp - fn 56936 isotype) ; budakeszi, on a pile of sawdust, 27 july 1980, l. babos (bp - fn 65137) ; vallis lepence, near visegrd, on a pile of sawdust, 31 july 1981, m. babos (bp - fn 72875) ; com. specimens examined (of p. castri) : japan : fukuoka prefecture : kyushu, on piled wood chips, 5 may 2007, m. shintani & s. takehashi (tnsf 17602 holotype) ; ibaraki prefecture : honshu, tsukuba, 25 oct. russia : central russia, moscow region, prioksko - terrasny state reserve, on decaying wood of populus tremula, 15 aug. 1991, g. e. levitskaya (le 216873) ; samara region, near pribrezhny, on decaying wood of deciduous tree, 1 july 2007, e. f. malysheva (le 212090). 1) the four sequenced collections of pluteus variabilicolor (isotype included) and the three of p. castri retrieved from genbank (holotype included) are conspecific. pluteus variabilicolor was originally described from hungary and primarily characterized by a pileus which was at first yellowish orange and then becoming chrome - yellow (hence the epithet variabilicolor), rugose - veined at the centre, and a pileipellis consisting of dimorphic elements, viz. a mixture of spheropeduncolate - vesiculose and elongated, more or less cystidioid elements, the presence of caulocystidia, and growth on decaying sawdust (babos 1978). apart from hungary, where it was found several times after the first report (e.g. babos 1981, 1989, 1991, rimczi & vetter 1990, lukcs 2010, albert 2011), p. variabilicolor is reported only from austria (lohmeyer. 1998, migliozzi 2011), romania (bres 2012), slovenia (jogan. pluteus variabilicolor is mainly reported from sawdust deposits, even though our finds and those of migliozzi (2011) and musumeci (pers. comm.) are on branches and rotten wood of fagaceae (mainly quercus species). as suggested by babos (1978, 1981) and courtecuisse (2006), the species may not be native to europe and could have been introduced through timber import. in support of this hypothesis, all the nations in which the species was found are geographically related. on the other hand, natural habitats, so it may very well be a native eurasian species that is just not common. our description, based on italian specimens, fits quite well with the protologue, with the morphologic features reported by later authors (lohmeyer. 1998, migliozzi 2011), and the hungarian collections we have checked (isotype included). 2011a) based on collections from japan (on piled wood chips, holotype) and central russia (on decaying wood of deciduous trees). the main difference with respect to the original description of p. variabilicolor and the italian collections found was in the structure of the pileipellis. in p. castri we did not observe the elongated elements (to 200 m long) found in other collections of p. variabilicolor. however, molecular data indicate that all collections of p. castri should be considered to represent p. variabilicolor. in the phylogenetic analysis (fig. 1) p. variabilicolor, in spite of the presence of both vesiculose - clavate and elongate elements in the pileipellis, clustered into the leoninus clade of sect. (2012), where it is sister to p. chrysaegis and very close to the p. leoninus complex. most species of the leoninus clade are characterized by yellowish tinges on the pileus surface. africanus) resembles p. variabilicolor in the general structure of the pileipellis and the yellow colouring of the basidiome, the veined pileus surface, and the presence of caulocystidia (pradeep & vrinda 1996, pradeep. however, it differs in the even shorter elements of the pileipellis (to 40 m long), and the non - mucronate, slightly thick - walled cheilocystidia (horak & heinemann 1978, pradeep. 2012). the species in the p. leoninus complex (i.e. p. leoninus, p. roseipes, p. flavofuligineus, p. aff. leoninus ii) all have a pileipellis made up exclusively of narrowly fusiform elements to 230 m long (justo. 2011a) and, with the exception of p. aff. | based on several collections from italy, a detailed description (including also macrophotographs, microphotographs, and drawings) of the morphological characters of the poorly known pluteus variabilicolor, originally described from hungary, is provided. the analysis of the its sequences placed this species within the p. leoninus clade of sect. hispidoderma, in spite of the presence of clavate elements in the pileipellis. according to the molecular comparison of the type collections, pluteus castri, a species recently described on the basis of material collected in japan and central russia, is reduced to a synonym of p. variabilicolor. |
minimal change nephrotic syndrome (mcns) is one of the most important histopathological characteristics in patients with idiopathic nephrotic syndrome (ins), and long - term outcome of most of the patients with this disease is favorable. some investigations suggested that genetic factors might play a key role in the pathomechanism of mcns [25 ]. the angiotensin - converting enzyme (ace) insertion / deletion (i / d) gene polymorphism, correlating with circulating and cellular ace concentration, might take part in the etiology of mcns and have been investigated in numerous epidemiologic studies at present. however, the available evidence reported to date is weak, due to sparseness of data or disagreements among studies. there is rare meta - analysis to explore the association of ace i / d gene polymorphism with mcns risk. we performed this meta - analysis to investigate the association between ace i / d gene polymorphism and mcns susceptibility, with the intention to provide a much more reliable finding on the significance of the association. the relevant studies were screened from the search engines of pubmed, cochrane library, and cbm - disc (china biological medicine database) on september 1, 2010. (minimal change nephrotic syndrome or mcns) and (angiotensin converting enzyme or ace) was used in pubmed, cochrane library, and cbm - disc. we also extended search spectrum to the related articles and the bibliographies of all retrieved studies. if multiple publications from the same study group occurred, we only recruited the most complete paper for analysis. (1) a case - control study, (2) the outcome had to be mcns, and (3) there had to be at least two comparison groups (mcns group versus control group). (1) review articles ; (2) case reports ; (3) articles did not provide the detail genotype data ; (4) investigated the association of other genes with mcns. the following information was extracted from each study independently by at least 2 investigators : first author 's surname, year of publication, ethnicity of study population, and the number of cases and controls for ace genotypes. frequencies of alleles were calculated for case group and control group, from the corresponding genotype distribution. available data was entered into cochrane review manager (revman, version 5) and analyzed. the pooled statistic was counted using the fixed effects model, but a random effects model was conducted when the p value of heterogeneity test was less than.1. results were expressed with odds ratios (or) for dichotomous data, and 95% confidence intervals (ci) were also calculated. the search yielded 46 references, 38 in pubmed, 0 from cochrane library and 7 in cbm - disc, and one study was included from the related articles and the bibliographies of all retrieved studies. according to the inclusion and exclusion criteria, six studies [611 ] were identified for the meta - analysis of the association between ace i / d gene polymorphism and mcns susceptibility in our final review. four studies [811 ] were conducted in asians, one investigation for caucasians and one in africans. the data of our interest were extracted : first author 's surname, year of publication, ethnicity of study population, and the number of cases and controls for ace genotypes (table 1). the average distribution frequency of ace d allele in asian patients with mcns was 53.91%, and the frequency in controls was 47.65%. the average distribution of d allele frequency in caucasians was 64.71% in cases and 52.01% for controls. furthermore, the average distribution frequency of d allele in africans with mcns was 50.00%, and the frequency in control group was 54.00%. the ratio of cases / controls for average distribution frequency of d allele in caucasians was slightly elevated when compared with those in asians and africans (asians : mcns / control = 1.13 ; caucasians : mcns / control = 1.24 ; africans : mcns / control = 0.93). in this meta - analysis, we found there was a significant association between d allele or dd genotype and risk of mcns in overall populations (p =.007, p =.04 ; table 2). the fixed effects or estimated for the mcns susceptibility was 1.39 in d allele patients when compared with patients carrying i allele (95% ci : 1.091.76), with evidence of between - study heterogeneity (p =.64 ; table 2). furthermore, the fixed effect or estimated for the risk of developing mcns was 1.46 in dd homozygous patients compared with both other genes combined (95% ci : 1.012.11), for the reason that the p value of heterogeneity test was.45. we also documented there was notable association between the ii genotype and the risk of mcns relative to both other genotypes combined (or = 0.65, 95% ci : 0.440.96, p =.03, table 2). in our study, we found that the average frequency of d allele in control group of africans was a little elevation when compared with those in asians and caucasians (africans : 54.00% ; asians : 47.65% ; caucasians : 52.01%). true race - specific genetic effects might affect the results of our analysis for the association of ace i / d gene polymorphism with the onset of mcns. in order to evaluate the race - specific effect, we divided the population by ethnicity. in asians, we found that the association of d allele or dd genotype with mcns susceptibility was positively significant (p =.01 and p =.02, resp.) (table 2, figures 1 and 2). however, the ii genotype seemed not to play a protective role against mcns risk for asians (or = 0.73, 95% ci : 0.491.09 ; p =.12) (table 2, figure 3). interestingly, there was also no significant association between ace i / d gene polymorphism and mcns susceptibility in caucasian population and africans (caucasian : d : p =.16 ; dd : p =.98 ; ii : p =.09 ; africans : d : p =.81 ; dd : p =.49 ; ii : p =.76) (table 2). there is increasing evidence suggesting that the rennin - angiotensin system (ras) has been a well - documented participation in the pathogenesis of renal disease. genetic markers, in particular ace i / d gene polymorphism, might offer some benefits to better predict the outcome of renal diseases. the level of plasma ace, constitutively expressed in several types of somatic cells, is linked to an i / d gene polymorphism of 287 bp in intron 16 of the ace gene [7, 12 ]. the d allele and dd genotype has been reported to be associated with higher plasma ace level. ace is a key enzyme of ras that can convert inactive angiotensin i into a vasoactive and aldosterone - stimulating peptide angiotensin ii [14, 15 ]. the elevation of ace protein expression might be responsible for the elevation of plasma angiotensin ii level. increased angiotensin ii level makes deleterious actions on renal hemodynamics and induces the protein expression of some other growth factors, leading to glomerulosclerosis [17, 18 ]. mcns, an important histopathological characteristic of ins, is one of the most common acquired renal diseases. data on the risk factors for poor prognosis and the pathogenesis of mcns are insufficient. furthermore, findings on the association of ace i / d gene polymorphism with mcns susceptibility have been controversial since the first investigation was reported. in order to draw a more convincing conclusion, this meta - analysis was performed to explore the association between ace i / d gene polymorphism and mcns risk. in this investigation, six studies were recruited into our meta - analysis, four studies in asians, one investigation for caucasian population and one in africans. in order to achieve a satisfactory power, meta - analysis of multiple studies clearly has a role in offering an association with such potentials. in our meta - analysis for overall populations, we found the association between d allele or dd homozygous and the risk of mcns was statistically significant, and the ii genotype seemed to play a protective factor against mcns risk. however, the disequilibrium of gene distributions among asians, caucasians, and africans in healthy controls was observed in our study, which might affect the credibility of the conclusion. the average frequency of d allele in control group for african population was a little elevation when compared with that in asians or caucasians, suggesting a discrepant role of continental differences in gene background and living environment. the results of overall population might be less powerful and it was difficult to draw a convincing conclusion. therefore, the subgroup analysis was very important in this meta - analysis. in our subgroup analysis, we found that d allele or dd genotype was associated with mcns susceptibility in asians, but not for caucasians and african population. furthermore, ii genotype seemed not to play a positive role against mcns onset for three races. we speculated that d allele or dd homozygous might sensitively affect mcns susceptibility in asians, but not other two races. in the included investigations, some studies found the ace i / d gene polymorphism might not be associated with mcns susceptibility. in asians, lee. found that the distribution of ace genotypes in korean patients with mcns was similar to that in control, and the dd genotype was more frequent in focal segmental glomerulosclerosis (fsgs) than in mcns. performed an investigation in javanese - indonesian patients and found the ace genotype frequencies of mcns patients were consistent with those of the controls, and d - allele tended to exist more frequently in fsgs patients than in the mcns patients and controls. in caucasians, found there was no significant correlation between ace genotype and histology of fsgs or mcns. furthermore, in africans, saber - ayad. also performed a study on egyptian children with ins and did not find an association between the ace i / d gene polymorphism and histological findings (including mcns and fsgs). the results in those studies mentioned above were consistent with ours for caucasians and african population, but our conclusions were inconsistent with those of asians above. however, in the other studies for asian population, the study of al - eisa. suggested an association of the d - allele of the ace gene i / d polymorphism with the clinical manifestation of ins in kuwaiti arab children, but they had not calculated the associations of ace i / d gene polymorphism with mcns risk between the controls and case group, and serdaroglu. found that d allele frequency was higher in ins group than control group in turks and the d allele frequency had no statistically significant difference between mcns group and fsgs group. we speculated that the d allele frequency in mcns group in the investigation of serdaroglu. the sample number of the study from serdaroglu. was much larger than that in other investigations. the conclusion of serdaroglu. might be more stable when compared with that of others. interestingly, in our investigation, we found the distributions of d allele frequency in control group among four asian studies were disequilibrium, ranged from 24.26% to 75.00%. the investigated countries for those studies were from east asian to west asian. in the past years, some studies found that living environment might influence the gene expression [1922 ]. we speculated that the living environment might affect the d allele frequency in controls. on the other hand, the sample sizes for some studies were small, which might affect the result for the d allele frequency in controls. in order to draw a more stable conclusion for asians, some investigations following larger sample sizes are needed in the future. for caucasians, the ratio of cases / controls for average distribution frequency of d allele in caucasians was 1.24, which is slightly elevated when compared with those in asians and africans. however, the ace i / d gene polymorphism were not associated with the risk of mcns in caucasians (the analysis for caucasians only including one study). more investigations are required to investigate this relationship for caucasian population in the future. the same as that, more studies investigating the association between ace i / d gene polymorphism and mcns susceptibility for african population are required in the future study. there were some meta - analyses to explore the relationship between ace i / d gene polymorphism and the susceptibility of some diseases in the past years. zhang. conducted a meta - analysis to investigate the association of ace i / d gene polymorphism with asthma risk and found there was an association between d allele or dd homozygote and the onset of asthma in asians but not for caucasian population. ji. performed a meta - analysis to explore the relation between ace i / d gene polymorphism and risk of hypertension in asian population and found that dd genotype was associated with the onset of hypertension., respectively, took a meta - analysis for the association of ace i / d gene polymorphism with susceptibility of immunoglobulin a nephropathy (igan) and observed that the dd homozygous was associated with an increased risk of igan in asians, but not for caucasian population. however, there is rarely a meta - analysis for african population at present. the conclusions of our investigation were similar to those in the meta - analyses mentioned above and also found ace d allele or dd homozygote was more sensitive for asians when compared with other ethnic groups. first, an important threat to any literature - based review and meta - analysis is that of reporting bias (we only searched the published literatures in english or chinese). last but not the least, the genotype distributions of the control population in two included studies [6, 11 ] did not conform to hardy - weinberg equilibrium test and it might cause bias in our study in conclusion, the results in our study supported that dd genotype or d allele was associated with mcns susceptibility in asians and overall populations, but the association was not found in caucasians and africans. the ii homozygous seemed to play a protective role against mcns risk in overall populations, but the associations in asians, caucasian population and africans were not observed. however, more case - control association investigations on larger, stratified populations are required to further clarify the role of this ace i / d gene polymorphism in mcns susceptibility. | aim. this meta - analysis was performed to evaluate the association between ace i / d gene polymorphism and mcns susceptibility. method. a predefined literature search and selection of eligible relevant studies were performed to collect the data from electronic databases. results. six articles were identified for the analysis of association between ace i / d gene polymorphism and mcns risk, including 4 for asians, one in caucasian population and one for africans. there was a markedly positive association between d allele or dd genotype and mcns susceptibility in asians (d : p =.01, dd : p =.02), but not for caucasians and africans (caucasians : d : p =.16, dd : p =.98 ; africans : d : p =.81, dd : p =.49). furthermore, the ii genotype seemed not to play a protective role against mcns risk for asians, caucasians and africans (p =.12, p =.09, p =.76, resp.). interestingly, there was also significant association between ace i / d gene polymorphism and mcns susceptibility in overall populations (d : p =.007, dd : p =.04, ii : p =.03). conclusion. d allele or dd genotype might be a significant genetic molecular marker for mcns susceptibility in asians and overall populations, but not for caucasians and africans. more larger and rigorous genetic epidemiological investigations are required to further explore this association. |
postoperative visual loss after general anesthesia for non - ocular surgery is not common, but this devastating complication occurs in about 0.2% to 4.5% of cases depending on the type of surgery (1). to our knowledge, there were a few reports using diffusion weighted image (dwi) for postoperative ischemic optic neuropathy (2). a 57-year - old woman underwent a multilevel laminectomy with posterior lumbar interbody fusion for herniation of nucleus pulposus and spinal stenosis. she did not have a history of diabetes, hypertension, or any cardiac problem. for more than 11 hours of surgery in the prone position, a large blood transfusion (more than 16 units of packed red cells) the woman also underwent orbital mr imaging including dwi at five days after surgery. a t2 weighted image (repetition time [tr ] = 3000, echo time [te ] = 100) showed subtle high signal intensity on bilateral optic nerves. after contrast injection, an axial t1 weighted image (tr = 500, te = 12) shows enhancement along the bilateral optic nerve sheath. moreover, the axial dwi (tr = 4338.2, te = 46.7, b = 1000, section thickness = 3 mm, matrix = 128 126, field of view = 24 cm) showed high signal intensity on bilateral optic nerves and restricted diffusion on an apparent diffusion coefficient (adc) map (fig. mm / s in the right optic nerve, 0.420 10 mm / s in the left optic nerve, 0.656 10 mm / s in the right temporal lobe, and 0.785 10 mm / s in the left temporal lobe. one month later, the woman still experienced bilateral visual loss, except for a response to light on one eye. postoperative ischemic optic neuropathy is one of the severe complications that can develop after various surgeries such as cardiac surgery, spine surgery, head and neck surgery, prostatectomy, liver transplantation, major vascular surgery, liposuction, and so on (3). according to a previous report, the american society of anesthesiologists, postoperative visual loss registry, ischemic optic neuropathy was most frequently developed after spine surgery (4). several reports described the important etiologies of postoperative ischemic optic neuropathy (3 - 8). although there is still controversy for the most important etiology of postoperative ischemic optic neuropathy, a large amount of blood loss producing hypotension and anemia with prolonged operative time in the prone position may play an important role in postoperative visual loss (4 - 6), as in our case. considering the fact that many other surgeries can cause large amounts of blood loss producing hypotension and anemia, the increased orbital pressure secondary to the prone position or trendelenburg position or jugular vein ligation with prolonged operative time may be the most important etiology (1, 4, 5). therefore several recommendations have been suggested to help avoid or minimize this severe complication as followings : information about visual impairment prior to surgery, avoidance of direct pressure to the eyeball, avoidance of perioperative hypotension or anemia, and so on (1, 3, 5, 8). in addition, because ischemic optic neuropathy may be reversible in its early stages, regardless of etiologies or type of surgery, it is important to diagnose postoperative ischemic neuropathy in a timely and precise manner, as well as to provide early treatment (8). however, there exists no specific treatment strategies for perioperative ischemic optic neuropathy (3). conventional t1- and t2-weighted images as well as contrast - enhanced images were insufficient for the diagnosis of ischemic optic neuropathy. optic nerve enhancement, including optic nerve itself as well as optic nerve sheath, is possible (9). optic nerve enhancement may be caused by blood - brain barrier disruption secondary to various causes including ischemia, tumor, infection, trauma and so on, as other cranial nerves (10). however, this enhancement may be one of the findings showing ischemic optic neuropathy under restricted diffusion and specific clinical features. and, as observed in recent infarctions in the brain, restricted diffusion due to cytotoxic edema can be a specific finding for ischemic optic neuropathy on dwi. to date, there were several reports using dwi for diagnosing an acute optic nerve infarction or acute ischemic optic neuropathy after infection, surgery or noninflammatory disease (2, 11, 12). our case also shows that dwi can play an important role in the precise diagnosis of postoperative acute ischemic optic neuropathy. besides acute ischemia, lymphomatous optic neuropathy, traumatic optic neuropathy, or atypical optic neuritis can cause restricted diffusion in the optic nerves (13 - 15). in conclusion, restricted diffusion on dwi and an adc map may be a specific finding associated with postoperative acute ischemic optic neuropathy regardless of type of surgery. in addition, t2 high signal intensity and optic nerve sheath enhancement may be an additional and useful findings for the detection of postoperative acute ischemic optic neuropathy. | a 57-year - old woman experienced bilateral acute ischemic optic neuropathy after spine surgery. routine mr imaging sequence, t2-weighted image, showed subtle high signal intensity on bilateral optic nerves. a contrast - enhanced t1 weighted image showed enhancement along the bilateral optic nerve sheath. moreover, diffusion - weighted image (dwi) and an apparent diffusion coefficient map showed markedly restricted diffusion on bilateral optic nerves. although mr findings of t2-weighted and contrast enhanced t1-weighted images may be nonspecific, the dwi finding of cytotoxic edema of bilateral optic nerves will be helpful for the diagnosis of acute ischemic optic neuropathy after spine surgery. |
lesions of the anterior interosseous nerve are rare and comprise less than 1% of all upper extremity nerve palsies. traumatic causes include blunt trauma, forearm fractures, penetrating injury and local pressure from a plaster cast, but has never before been described in association with crutch use. this is the first reported case of the use of elbow crutches causing symptomatic anterior interosseous nerve compression. this case describes a 30-year - old male who developed an inability to pinch with his left hand following the use of elbow crutches for a foot injury. on examination a diagnosis of anterior interosseous palsy was made and the patient was treated conservatively and crutch use was ceased. at six weeks follow - up the patient made a complete recovery with full function of his left hand. this report highlights the importance of adequate education in the safe use of elbow crutches for all patients. the side effects of inappropriate use should be carefully examined for during follow - up care. lesions of the anterior interosseous nerve [ain ] are rare and comprise less than 1% of upper limb palsies. it is an exclusively motor branch of the median nerve and provides innervation to flexor pollicis longus, the medial part of flexor digitorum profundus involving the index and sometimes the middle finger, and to pronator quadratus. entrapment of the nerve results in a characteristic appearance on pinching, which may be mistaken for a tendon rupture. we present a case of a patient who developed ain palsy following the use of elbow crutches. a 30-year - old fit and healthy male presented to fracture clinic four days after suffering a stubbing injury to his left big toe and superficial abrasion to his left heel. x - rays reviewed an undisplaced fracture of the base of the left little toe distal phalanx. he was given elbow crutches with instructions for partial weight bearing on the affected leg and discharged with a fracture clinic appointment. in clinic, the patient complained of a gradual onset of difficulty in pinching and gripping objects with his left hand since the injury. [figures 1 and 2 ] movements of the left index and middle fingers were normal and there were no areas of paraesthesia. since there was no history of trauma or predisposing conditions, we believe the patient developed an anterior interosseous nerve palsy following the inappropriate use of elbow crutches over four days. he was subsequently placed in a plaster cast boot and was advised to fully weight bear without the use of crutches. however, by the time he came to a six - week follow - up clinic after the injury, he had made a complete clinical recovery in hand movement and function. many causes for ain palsy have subsequently been described in literature, and can be divided into traumatic and non - traumatic / spontaneous. traumatic causes range from blunt trauma, local pressure from sleeping on the affected arm or poorly applied cast, excessive exercise, penetrating injury, forearm fractures and open reduction and internal fixation. to our knowledge ain palsy can be described as complete, where flexor digitorum profundus and flexor pollicis longus are both affected, or incomplete, where only one muscle is affected. it differs from other lesions of the median nerve in that sensory complaints are essentially absent. as a result of these factors, ain palsy can often mimic single tendon lesions, leading to difficulties with diagnosis. in the literature, there are cases of ain entrapment with unnecessary surgical exploration of fpl tendon. o with the thumb and index finger, and the loss of ability to perform fine tasks despite an intact sensory innervation. spontaneous ruptures of flexor pollicis longus tendon are rare and are generally associated with distinct underlying pathologies, such as rheumatoid arthritis. several clinical tests have been described to distinguish between palsy of fpl and rupture of this tendon[810 ]. electrodiagnosis with nerve - conduction study or electromyography is the investigation of choice to differentiate between nerve palsy and tendon rupture. in the present case, however, the patient made a full recovery before electrodiagnostic studies could be carried out, thereby ruling out the possibility of rupture of flexor pollicis longus. conservative management includes removal of precipitating causes such as crutches and casts, immobilisation and anti - inflammatory medication. we believe all patient should be taught safe and effective usage of elbow crutches when they initially receive them. the side effects of inappropriate use should be carefully examined for during follow - up care. | context : lesions of the anterior interosseous nerve are rare and comprise less than 1% of all upper extremity nerve palsies. traumatic causes include blunt trauma, forearm fractures, penetrating injury and local pressure from a plaster cast, but has never before been described in association with crutch use. this is the first reported case of the use of elbow crutches causing symptomatic anterior interosseous nerve compression.case report : this case describes a 30-year - old male who developed an inability to pinch with his left hand following the use of elbow crutches for a foot injury. on examination he was unable to flex the interphalangeal joint of his left thumb. a diagnosis of anterior interosseous palsy was made and the patient was treated conservatively and crutch use was ceased. at six weeks follow - up the patient made a complete recovery with full function of his left hand.conclusion:this report highlights the importance of adequate education in the safe use of elbow crutches for all patients. the side effects of inappropriate use should be carefully examined for during follow - up care. |
lead encephalopathy was induced in developing long - evans rats by adding lead carbonate (4% w / w) to the diet of nursing mother immediately after delivery. the morphological and biochemical features of cerebral ontogenesis were studied in 30-day - old rats. by the 30th postnatal day, the overall effect of lead intoxication was retardation of brain growth. the mass of both the cerebral gray and white matter was appreciably reduced in the lead rats without any reduction in cell populations. while the neuronal population was preserved, the growth of neurons was reduced and their maturation retarded. the retarded neuronal growth was characterized by the limited proliferation of processes in the neuropil and by the reduction in the number of synapses per neuron. however, synaptogenesis was neither delayed nor perturbed but reduced by the limited development of neuronal dendritic fields. the myelination was altered and its cerebral content significantly reduced. the effect of lead on myelination was one of hypomyelination. the hypomyelination appears to be primarily related to retarded growth and maturation of the neuron and is not a reflection of a defect in the myelinating glia or a delay in the initiation of myelination. imagesfigure 1. |
|
the purpose of establishing a pediatric intensive care unit (picu) is to upgrade the quality of services and obtaining the best results and better outcomes for the severely ill children. one of the ways to achieve that goal is to predict the mortality risk of the patients admitted to the picu to provide them with the best care available. there are some scoring systems designed to predict the patients mortality risk. using these systems, one is able to assess the severity of the disease, planning for triage, treatment options, clinical progress and the outcome of patients. these are also considered to measure the quality control criteria and cost analysis [14 ]. from 1980 onwards, the systems have been used including the gcs (glasgow coma scale), mpm (mortality prediction model), prism (pediatric risk of mortality) and pim (pediatric index of mortality)[511 ]. in the recent two decades, the american rating system prism and the european system pim are known as the two successful indices in many countries. but they are not readily available for many health - care systems due to their high cost or large amount of information needed to be supplied. normally, the guidelines of providing cares in the picu are designed upon the possibilities and limitations in each country so that there are many reconstructed criteria extracted through similar studies[12, 13 ]. thus, we decided to make validation of pim2 score according to the current available facilities to use instead in a way that the new scoring index could be accessible and as such functional and valuable. this study was conducted on patients admitted to picu of bahrami children 's hospital affiliated to tehran university of medical sciences from may 2007 to november 2008. the inclusion criteria were : any child admitted to picu aged 1 month to 16 years. the exclusion criteria were : admitted patients died within first 24 hours after admission to picu and patients transferred, for any reason, to other hospitals. patients data was recorded in a questionnaire including demographic information, main diagnosis in picu (defined as the primary cause of admission in picu), outcome (death or discharge or transfer to another department), and variables of pim2. based on the pim2 point system, the disease was considered as high risk or low risk disease. the high - risk diseases were cardiac arrest before admission to picu, after first induction of chemotherapy in leukemia or lymphoma, spontaneous cerebral hemorrhage, cardiomyopathy or myocarditis, hypoplastic left heart syndrome, hiv infection and liver failure. neurodegenerative diseases, asthma, bronchiolitis, croup, obstructive sleep apnea and diabetic ketoacidosis were included in the low - risk group. the data collected based on the patient 's medical history, physical examination and laboratory findings which were recorded by the physician during first visit (immediately after admission to picu). the completed questionnaire was then evaluated and possible defects were eliminated. in order to calculate the predicted risk of death for each patient, logit was calculated by multiplying fixed coefficients of the logistic regression (table 1) by variables (x 1, x 2,.x 10) and adding them to the pre - determined constant values which gives : logit = constant + ax1 + bx2 + cx3 + thus for the quantitative variables, absolute values and for the qualitative variables (dichotomy), either number zero or 1 was used, and the formula calculated. for example, if the infant had a systolic blood pressure of 70 mmhg, 50 was multiplied by the related constant ratio of 0.01395, or if there was no pupillary light reflex, 1 was multiplied by the related constant ratio of 3.0791. coefficient of variables and constant value for pediatric index of mortality-2 formula in order to calculate the possibility of death, the logit value was obtained from the formula : p = e /(1 + e), where e=2.7183 the collected information was complied with related database and pim2 was analyzed using chi - square, logistic regression and hosmer - lemeshow test. to calculate smr (standardized mortality ratio), the probability of death for each child was determined based on pim2 model and total amount of probability of death in the studied population was obtained. since logistic regression is the main method for statistical analysis, 15 samples were chosen for each variable. overall, because 15 variables were studied, at least 225 (1515) of cases were considered. the use of persons data has been handled in accordance with the rules of the ethical review board of tehran university of medical sciences. we obtained prior informed written consent from the patients parents and patient anonymity is preserved. 240 patients were studied. among them 150 were (62.5%) boys and 90 (37.5%) girls. characteristics of patients under study when admitted to pediatric intensive care unit sd : standard deviation 230 (95.8%) patients had normal pupillary light reflex and 24 (10%) required mechanical ventilation in the first hour. only 2 (0.8%) patients were hospitalized electively and 25 (10.4%) were admitted to picu following surgery. only one (0.4%) patient was hospitalized in picu following cardiac bypass. in this study 39 (16.3%) high risk patients and 36 (15%) low risk patients were admitted to picu, and others did not have any high or low risk diseases (based on pim2 definition). first, the effect of variables was analyzed individually by the univariate logistic regression method (table 3). results of univariate analysis of studied variables then hosmer - lemeshow test was done for the desired variables in pim2 and the results showed that this is an appropriate variable - based model (p value=0.2 and chi - square=0.741). there was no statistical significant difference between occurred death and expected death based on the model built with pim2 variables. in the next step to assess the probability of death based on pim2 index, roc curve analysis was performed (fig 1). area under the curve (auc) of 0.795 was achieved with a confidence interval of 95% (0.715 - 0.875). regarding 36 deaths in 240 cases studied, the average probability of death and its confidence interval of 95% was 0.15 (0.1073 - 0.2016). we expected 20 cases of death based on pim2 model which would make an average of 0.083 (0.052 - 0.126) for probability of death and its 0.95% confidence interval. finally, by dividing the assigned number of deaths to the expected number of deaths based on pim2 model, standardized mortality ratio (smr) and its confidence interval of 0.95% was obtained to be 1.8 (1.28 - 2.46). therefore, death occurs 1.8 times more in comparison to what was expected with pim2 model. using the variables which had p - value < 2 we tried to plan the conclusive model through forward stepwise method. using the multivariate analysis through forward stepwise method revealed that high - risk group diagnosis, the length of picu stay and pupillary light reflex have significant association with pediatric mortality. in order to determine the goodness of fit, the hosmer and lemeshow showed that the above model (final model) is the appropriate model. in other words according to this model there is no difference between the number of death outcome and the expected cases of death (p - value=0.482 ; chi - square=5.494). various studies have suggested that pediatric index of mortality having eight variables is an appropriate measure to estimate the probability of death of patients in picu [3, 14 ]. a newer edition of this index called pim2 has been proposed which utilizes 10 variables. we had 36 (15%) deaths among 240 studied patients, and expected using pim2 a mortality rate of 20 (8.3%). there was no significant difference between occurred and expected death in the built model (p - value=0.7, =5.161). calculating probability of death, we obtained the auc=0.795 with the confidence interval of 95% (0.71 - 0.87) by roc curve analysis. there was also a standardized mortality ratio 1.8 (1.28 - 2.46) with the confidence interval of 95%. therefore considering the proximity of the area under the roc curve to 0.8 and obtained smr, this model can be an appropriate one. shann and colleagues in australia obtained the following amounts for the area under the curve of pim model in eight studied hospitals : 0.80, 0.85, 0.86, 0.89, 0.91, 0.92, and 0.92. also in australia, slater and colleagues calculated an area under the roc curve of 0.90 (0.89 - 0.92). in comparison to our study that focused on length of picu stay, pupillary light reflex and the risk level category (high risk or low risk) on admission, the bains hs and kumar soni study demonstrates temperature, oxygen saturation and respiratory rate to be significantly associated with mortality. hooman n, focused on the plasma level of an indicator (uric acid) as a mortality predictor of picu patients. in 2002 through a cohort study, gemke and colleagues revealed that 20 patients out of 303 (6.6%) died. the expected mortality rate after 24 hours using the prism index was 6.95% and smr was 0.95 (0.67 - 1.22). expected mortality rate using pim2 index was 7.5% and calculated smr was 0.88 (0.55 - 1.20). the level under roc curve was 0.78 (0.67 - 0.89) for prism index while it was 0.74 (0.63 - 0.85) for pim2. among all reported experiments about the usage of mortality prediction systems in iran, kadivar and colleagues study they studied 205 patients in the picu of children 's medical center in tehran using the primary prism (14 variables) during a six month period. the mortality rate was 21.5% among hospitalized patients and prism could predict most of the deaths. thus, the relative frequency of death in our study was 6.5% less than that. so far, the relative frequency of mortality in our study is different from that of the others ; therefore, we found it useful for practical comparing of expected death and smr index. the expected mortality in our study was 8.3%, which was 6.7% lower than the observed death and smr was 1.8 (1.28 - 2.465) which was 80% higher. these findings are suitable markers for the authorities of bahrami children 's hospital to make a further review on this issue. in our study, pupillary light reflex and length of admission have significant association with the probability of death. it can be concluded that the evaluated pim2 index is an appropriate method of proper estimation for the probability of death for hospitalized patients in picu and is applicable in our children 's hospitals. thus patients who need any kind of neurosurgical care were not admitted to the hospital and not included in the study. | objectivea study to validate and calibrate pediatric index of mortality-2 (pim2) in children admitted to our pediatric intensive care unit (picu).methodsthis is a prospective cohort study performed in bahrami children 's hospital affiliated to tehran university of medical sciences. we studied the patients admitted to picu from may 2007 to november 2008. clinical measures were identified upon arrival in picu. we used pim2 score and logistic regression analysis to compare expected mortality risk with observed mortality rate. receiver operating characteristics (roc) curve analysis was done and standardized mortality ratio was calculated. pim2 index assessment was performed by use of hosmer and lemeshow goodness - of - fit test.findings240 patients were included in this study. the model fit was achieved adequately (p value=0.741). the area under the roc curve was 0.795 (0.715 - 0.875 for 95% confidence interval) and standardized mortality ratio was 1.8 (1.28 - 2.465 for 95% confidence interval) high - risk group diagnosis with adjusted odds ratio (aor)=14.75, pupil reaction to light (aor=0.13) and duration of stay in picu (aor=1.03) had significant statistical association to pediatric mortality.conclusionpim2 is a good index for prediction of mortality in our pediatric intensive care unit. this study revealed that there is significant statistical association between the children mortality and the length of hspita;ization, pupillary light reflex and the risk level category on admission. |
osteoporosis is a deficiency of bone mineral density that increases fracture risk. because the number of elderly people in the population is currently increasing the age - specific prevalence of osteoporosis is less than 2% in women younger than 50 years. between the ages of 20 and 40 years our case provides a perspective on the diagnosis of postpartum osteoporosis and complications such as compression fracture. one month earlier, she had a tertiary cesarean section and a left ovarian cystectomy. during the cesarean section, there were no other complications. she had no past surgical or family histories, nor had trauma. on physical examination, she had diffuse back pain. the pain was so severe that she had difficulty in getting up for 7 days. the lumbar spine anteroposterior (ap) and lateral revealed recent compression fractures of t12, l1, and l3. a bone scan also revealed increased bone uptake, perfusion, and multiple recent compression fractures of t12-s1 (fig. bone marrow density determined using dual energy x - ray absorptiometry (dxa) revealed that the t - scores for the lumbar vertebrae l1-l4, femoral neck, and femoral total were significantly low in the patient (fig. 2). she was given calcium 500 mg daily and a chest brace for non - weight bearing. osteoporosis is a skeletal disease involving decreased density of the mineral portion of the bone. the causes of osteoporosis are most commonly age, menopause, hormone imbalance involving the thyroid or parathyroid, and alcohol intake. osteoporosis is diagnosed according to the 2007 international society for clinical densitometry (iscd) official positions or world health organization (who) criteria. we previously differentiated the two criteria and revealed that the who criteria are more tolerant than the iscd official positions. because osteoporosis is related to fractures, a fracture - risk assessment tool (frax) using clinical risk factors combined with femoral neck bone mineral density (bmd) can predict the 10-year fracture risk. we previously reviewed the korean frax model with the general population and recommended that physicians use the korean frax model in the general female population to predict fracture risk. we already found that serum (25-[oh]d3) concentrations were significantly correlated with age (p=0.001), duration of menopause (p=0.005), and osteoporosis (p=0.044). also, erythrocyte levels of n-3 polyunsaturated fatty acid (pufa) and intake of fish were positively correlated with bmd of the femoral neck. however, vitamin d and diet are not included as fracture risk factors. in our analysis of the bmd and previous obstetric history, another study also revealed that postmenopausal women had a correlation between risk factors for osteopenia or osteoporosis and obstetric history including previous gravity. a possible mechanism of postpartum osteoporosis involves ligament laxity due to endocrine changes such as parathyroid hormone (pth)-like peptide, magnesium sulfate management, prolonged bed rest for preterm labor, and stress or fatigue fractures during delivery. the fetus takes 30 g of calcium from the mother, and hypoestrogenemia during breast - feeding leads to bone mineral loss in women. as the gestational age proceeds, because of their increased number of pregnancies, they have a longer duration of breast - feeding. therefore, correlations between the severity of bmd and breast - feeding duration with osteoporosis are unclear. the most common symptom is severe back pain in the lower thoracic, lumbar region. the most common site in pregnancy- and lactation - associated osteoporosis is the vertebrae, as in our case. in particular, more than 1 standard deviation (sd) of bone loss was found. we should recognize the potential risk of postpartum osteoporosis and carefully differentiate back pain after delivery to prevent osteoporotic fractures. | osteoporosis is mainly a problem in postmenopausal women. however, we had a case of postpartum compression fracture associated with osteoporosis. a 42-year - old multiparous woman had undergone tertiary cesarean section without complications 1 month before. she was breast - feeding her baby and had no other bone - related complication history. she did not exercise on a regular basis. she experienced back pain abruptly and was diagnosed with a recent compression fracture of t12, l1, and l3. we evaluated this rare case of postpartum osteoporosis and compression fracture. |
morphological imaging using magnetic resonance imaging (mri) is the most commonly used method for obtaining tumor information. gd - enhanced t1-weighted mri provides anatomical imaging with hyperintense neovascularization enclosed in a hypointense region of central necrosis. in addition, fluid - attenuated ir (flair) detects the surrounding edema associated with infiltrating tumor cells. the use of positron emission tomography (pet), an imaging modality providing metabolic and molecular information, can improve diagnostic procedures in malignant brain tumors. 2-deoxy-2-[f ] fluoro - d - glucose (fdg), a commonly used tracer for neoplasm detection, exhibits limited utility in brain tumor imaging, because the uptake is nonspecific and can occur in any region with increased metabolic activity. in addition, fdg - pet is a marker of glycolytic metabolism and not cellular proliferation. l - methyl - c - methionine (met) is a well - established pet radiotracer for brain tumor detection and tumor delineation [6, 7 ]. amino acids, including met, readily cross the intact blood - brain barrier (bbb) through neutral amino acid transporters and are incorporated into the area with active tumor. it has been shown that met uptake in gliomas significantly correlates with the who tumor grade and cell proliferation determined by ki-67 index [4, 911 ]. however, increased met uptake in nonneoplastic lesions including inflammation, infarction, and hemorrhage may result in false positives [12, 13 ]. also, the short half - life of c (20 min) and rapid in vivo degradation make met - pet less useful for routine clinical use. a fluorinated thymidine analog, 3-deoxy-3-[f ] fluorothymidine (flt), has emerged as a promising pet tracer for evaluating tumor - proliferating activity in various malignant brain tumors [3, 14, 15 ]. (tk1), a principle enzyme in the salvage pathway of dna synthesis, and trapped inside the cells. the application of flt phosphorylation as a marker of cell proliferation is based on the assumption that cellular flt trapping is a representation of thymidine incorporation into dna [16, 17 ]. since flt uptake in the normal brain tissue is very low, flt - pet provides a low - background brain image, making it an ideal pet tracer for the imaging of brain tumors. in addition, flt - pet has been utilized in the prognostic assessment and evaluation of treatment response in malignant gliomas. despite the superior features met and flt offer as glioma cell tracers, the cut - off value of normal versus tumor cell infiltration is difficult to determine. therefore, the purpose of this prospective study was to clarify the individual and combined roles of fdg - pet, met - pet, and flt - pet in tumor detection, noninvasive grading, and assessment of cellular proliferation rate in 54 newly diagnosed histologically verified gliomas of different grades. from april 2006 through october 2011, 54 patients with newly diagnosed gliomas (23 men and 31 women ; mean age : 52.0 18.1 y ; range : 2286 y) were enrolled in this study (table 1). the use of fdg, met, and flt as a pet tracer was approved by the kagawa university school of medicine human subjects ethics committee, and informed written consent was obtained from all patients who participated in this study. all tumors were graded by the world health organization (who) grading system (malignancy scale) for cns tumors. tumor types and grades were distributed as follows and listed in table 1 : who grade ii diffuse astrocytoma (n = 9), who grade ii oligoastrocytoma (n = 2), who grade ii oligodendroglioma (n = 1), who grade iii anaplastic astrocytoma (n = 11), anaplastic oligoastrocytoma (n = 3), who grade iii anaplastic oligodendroglioma (n = 1), who grade iv glioblastoma multiforme (n = 26), who grade iv gliosarcoma (n = 1). hematoxylin - and - eosin - stained specimens were checked to determine the histological tumor type. the cellular proliferation activity of the tumor was determined by measuring the ki-67 proliferation index obtained by immunohistochemical staining with anti - ki-67/mib-1 antibody (dako, tokyo, japan). the percentage of tumor cells which stained positively for ki-67 antigen was measured in the area containing the largest number of positive tumor cells and was regarded as representative of the tumor proliferation activity. pet studies were performed using an ecat exact hr + scanner and a biograph mct 64 (siemens / cti, knoxville, tn, usa) in three - dimensional acquisition mode. the image system enabled the simultaneous acquisition of 51 transverses per field of view (fov), with intersection spacing of 3 mm, for a total axial fov of 15 cm. the in - plane (transverse) reconstructed resolution was 4.7 mm full - width at half - maximum (fwhm) in the brain fov. images were reconstructed using the filtered backprojection method with a hanning filter (kernel fwhm 10 mm, cutoff frequency 0.4 cycle / projection element) to generate 128 128 matrices. pet radiotracers were produced using the hm-18 cyclotron (sumitomo heavy industries, tokyo, japan). the resultant co2 was reduced to c - methanol by lithium aluminum hydride and subsequently converted to c - ch3i by the addition of hydrogen iodide following the modified method described by ishiwata.. each patient received the fdg, met, and flt one by one for a continuous 3-day course before the surgery. for the fdg - pet study, enteral and parental sources of glucose were withheld for at least 6 h before the examination. no special dietary instructions were given to the patients before the met and flt - pet examination. images were acquired with patients in the supine position, resting, with their eyes closed. using ge rod sources rotating around the head, transmission images of the brain were obtained for 5 min for fdg - pet, 3 min for met - pet, and 5 min for flt - pet. transmission scan with ge rod can be replaced to ct attenuation correction in mct64 system. a dose of 147295 mbq (mean dose : 208 39 mbq) of f - fdg, 113389 mbq (mean dose : 211 65 mbq) of c - met, or 129236 mbq (mean dose : 161 25 mbq) of f - flt was injected intravenously. regional emission images of the brain were obtained for 5 min, beginning 45 min after the f - fdg injection ; for 5 min, beginning 10 min after the c - met injection ; for 10 min, beginning 40 min after the f - flt injection. fdg, met, and flt uptake in the brain tumor were semiquantitatively assessed by evaluating the standardized uptake value (suv). a region of interest (roi) was set manually by an observer around the hottest area of each lesion. the maximum value of suv (suv max) was regarded as the representative value of each tumor. to calculate the tumor - to - normal tissue count density (t / n) ratios, the roi was set on the normal brain parenchyma (usually contralateral normal cerebral tissue excluding ventricles) and the mean value of suv (suv mean) was calculated. the t / n ratio was determined by dividing the suv max of the tumor by the suv mean of the normal brain tissue. co - registration of fdg - pet / met - pet / flt - pet / mri was undertaken on the workstation with a commercial software package (dr. the software allowed an operator to perform manual intervention ; however, required adjustment for co - registration was minimal. the measured suv max and t / n ratios of fdg, met and flt were compared with the histological diagnoses obtained by biopsy or resection. the relationships between the ki-67 index and suv max or t / n ratio of fdg, met and flt were evaluated. the relationship between fdg and met or flt and met uptake were evaluated. regarding the area with a high - intensity signal on the mri (flair) of each patient, based on a predetermined roi, the mean suvs of fdg, met and flt were used to compare the values between fdg and met, between flt and met, and between fdg and flt. the mann - whitney u test was used to assess the statistical significance in mean volumes across modalities. among the 54 glioma cases, the met accumulation was observed in 51 cases (94.4%) in the met - pet study and the flt accumulation was observed in 50 cases (92.6%) in the flt - pet study. regarding the 3 cases without the met accumulation and the 4 cases without the flt accumulation, they were grade ii gliomas. all malignant gliomas (grades iii and iv) showed accumulation in both studies. among the cases with t / n ratios higher than 1 in the fdg - pet study, there were 2 cases (16.7%) of the grade ii gliomas, 8 cases (53.3%) of the grade iii gliomas, and 17 cases (63.0%) of the grade iv gliomas (table 1). in fdg - pet study, it is possible to differentiate gliomas by the who grade with the sensitivity of 53.3%, the specificity of 55.6%, the false positive of 44.4%, and the false negative of 46.7%. in met - pet study, it is possible to differentiate gliomas by who grade with the sensitivity of 95.3%, the specificity of 9.1%, the false positive of 90.9%, and the false negative of 4.7%. in met - pet study, it is possible to differentiate gliomas by who grade with the sensitivity of 93.9%, the specificity of 20%, the false positive of 80%, and the false negative of 6.1%. there were no significant differences in the suv and t / n ratio among each group of the different who grades in the fdg - pet study (figures 1(a) and 1(d)). suv of the normal brain in the met - pet study was 1.52 0.36 (0.922.62). regarding the tumors in the met - pet study, mean suv max was 3.04 1.56 for the grade ii gliomas, 5.22 2.09 for the grade iii gliomas and 5.12 2.44 for the grade iv gliomas (figure 1(b)). t / n ratio was 2.03 1.02 for the grade ii gliomas, 3.67 1.38 for the grade iii gliomas and 3.76 1.78 for the grade iv gliomas (figure 1(e)). the mean suv max and t / n ratio of the grade iv gliomas were significantly higher than that of the grade ii gliomas, while there were no significant differences between the grade ii gliomas and grade iii gliomas. in the present study, there were some oligodendroglioma cases, which were in grade ii, but their suv max were high and ranged from 4.0 to 6.8. suv of the normal brain in the flt - pet study was 0.20 0.05 (0.130.28). regarding the tumors in the flt - pet study, mean suv max was 0.36 0.23 for the grade ii gliomas, 0.96 0.58 for the grade iii gliomas, and 2.38 1.07 for the grade iv gliomas (figure 1(c)). the mean t / n ratio was 1.99 1.37 for the grade ii gliomas, 4.43 2.61 for the grade iii gliomas and 11.54 6.86 for the grade iv gliomas (figure 1(f)). there were significant differences in both suv max and t / n ratio between the grade iii gliomas and the grade iv gliomas, but, similar to the met study, there were no significant differences between the grade ii gliomas and the grade iii gliomas. when the accumulation of met or flt within the tumor and the ki-67 index (an index for proliferation ability of tumor) were compared, linear regression analysis revealed a significant correlation between the ki-67 index and met suv max (r = 0.32, p = 0.02) (figure 2(b)) or met t / n ratio (r = 0.39, p < 0.01) (figure 2(e)), as well as flt suv max (r = 0.73, p < 0.001) (figure 2(c)) or flt t / n ratio (r = 0.63, p < 0.001) (figure 2(f)). flt, compared to met, demonstrates a significantly strong correlation with the proliferation ability. in fdg - pet study, linear regression analysis revealed no correlation between the ki-67 index and suv max (r = 0.16, p = 0.24) (figure 2(a)) or t / n ratio (r = 0.33, p = 0.02) (figure 2(d)). regarding the area with a high intensity signal on the mri (flair) of each patient, based on a predetermined roi, t / n ratio of fdg, met and flt were used to compare the values between fdg and met, between flt and met and between fdg and flt. between fdg and met, the t / n ratio of the met tended to be high without correlating with increased t / n ratio of the fdg because the oligodendroglioma components were included in the grade ii or grade iii gliomas (figures 3(a) and 3(b)). t / n ratio of the fdg tended to be high with correlating with low t / n ratio of the met showing a tendency toward the focus of the epileptic changes (figures 3(a) and 3(b) black circle). a significant but weak correlation is observed between the individual t / n ratio of fdg and met in the grade iv gliomas (r = 0.57, p = 0.03) (figure 3(c)). between flt and met, the t / n ratio of the met tended to be high without correlating with increased t / n ratio of the flt because the oligodendroglioma components were included in the grade ii or grade iii gliomas (figures 3(d) and 3(e)). we observed the same findings on the correlation between fdg and met. on the other hand, no significant correlation is observed between the individual t / n ratio of flt and met in the grade iv gliomas (r = 0.13, p = 0.61) (figure 3(f)). linear regression analysis showed a significant correlation between flt and met (r = 0.21, p = 0.008) in most areas and these areas appeared as astrocytic tumors (figure 3(f), red circle). the t / n ratio of the met tended to be high without correlating with increased t / n ratio of the flt (r = 0.53, p = 0.014), because the oligodendroglioma components were included in the grade iv gliomas (figure 3(f), blue circle). the t / n ratio of the met tended to be low without correlating with increased t / n ratio of the flt (r = 0.12, p = 0.11) because the necrotic components were included in the grade iv gliomas (figure 3(f), green circle). a significant correlation is observed between the individual t / n ratio of fdg and flt in the grade iv gliomas (r = 0.54, p = 0.05). between fdg and flt, t / n ratio of the fdg tended to be high with correlating with low t / n ratio of the flt showing a tendency toward the focus of the epileptic changes (figures 3(g) and 3(h) black circle). the t / n ratio of the fdg tended to be low without correlating with increased t / n ratio of the flt, because the necrotic components were included in the grade iv gliomas (figure 3(i), green circle). figures 4 and 5, respectively, show representative cases of fdg, met, and flt - pet studies in anaplastic astrocytoma and glioblastoma. flair showed a high - intensity lesion (figure 4(a)), and gd - enhanced mri showed slightly enhanced lesion in the right frontal lobe (figure 4(b)). fdg - pet demonstrated increased fdg uptake within the tumor (figure 4(c)). met - pet demonstrated increased met uptake within the tumor (figure 4(d)). flt - pet demonstrated increased flt uptake within the tumor (figure 4(e)). areas of different enhancement and uptake between fdg, met and flt are projected on the tumor, in order to perform histological sampling for further correlation during the resection (figure 4 yellow arrow, red arrow). yellow arrow demonstrates anaplastic astrocytoma (figure 4(f)) within t / n ratio of fdg - pet (2.85), met - pet (4.57) and flt - pet (9.65). ki-67 index from the specimen indicated by yellow arrow was 20% (figure 4(g)). red arrow demonstrates diffuse astrocytoma area (figure 4(h)) within t / n ratio of fdg - pet (0.76), met - pet (2.08) and flt - pet (4.65). ki-67 index from the specimen indicated by red arrow was 8% (figure 4(i)). he experienced an onset of aphasia and gerstmann 's syndrome and developed glioblastoma which was recognized with a ring - like contrast in the left temporo - occipital lobe on the gd - enhanced mri (figure 5(a)). the mri study did not show a uniformed contrast, and some areas had high - intensity signal while others did not. similar to the mri study results, the accumulation was not uniform in met - pet and flt - pet studies. this relationship between met and flt is divided into three parts, similar to the observation described in figure 3(f). in the blue arrow area, the contrast by mri was not strong, but the t / n ratio of met was 4.31 and the t / n ratio of flt was 3.24 with a significant accumulation of met. in the green arrow area, the contrast by mri was strong, the t / n ratio of met was 1.60, and the t / n ratio of flt was 5.72 with a significant accumulation of flt. in the red arrow area, the contrast by mri was recognized, but the t / n ratios of met and flt were both high (3.27 and 5.28 ; resp., figures 5(b) and 5(c)). the diagnosis revealed the blue arrow area mostly with a histological picture of oligodendroglioma (figure 5(d)) with a ki-67 index of 30% (figure 5(e)) and the green arrow area mainly with a histological picture of necrotic tissues (figure 5(f)) with a ki-67 index of less than 10% (figure 5(g)). as for the red arrow area displaying high accumulation of both met and flt, this area showed a strong nuclear atypia with megakaryocytes with a high ki-67 index of 70% (figures 5(h) and 5(i)). taken together, increased accumulation of both tracers (met and flt) appears to indicate high - grade malignancy. accurate tissue diagnosis of glioma is important in order to determine appropriate therapeutic strategy and predict prognosis. final diagnosis of the grade of malignancy is carried out by surgical histopathological diagnosis. however, due to the diverse nature of gliomas within tumors, some glioma cases tend to be diagnosed less stringent than actual grade of malignancy through pathological diagnosis of a specimen taken from the tumor. the image analysis using pet has an advantage of spatial evaluation of diverse malignant gliomas [8, 21, 22 ]. fdg has been widely used as a pet tracer for diagnosis of malignant brain tumors. the accumulation of fdg increases in highly malignant tumors, and this method is highly specific as an image analysis and useful for predicting prognosis. however, fdg uptake is high in the normal brain cortex where glucose metabolism is active, and the difference between the normal accumulation and brain tumors may not be detected. in addition, fdg uptake is low in low - grade tumors, and fdg has limitations for detecting the localization of small tumors or accurately identifying tumor area [5, 24, 25 ]. mixed neuronal and glial tumors and gliomas which easily cause convulsions had decreased accumulation of fdg until now [26, 27 ]. in our case, accumulation of fdg was high in low - grade glioma which is frequently associated with convulsions. it seems that additional attention is necessary regarding the convulsive cases and accumulation of fdg. flt is a tracer of labeled thymidine for evaluating dna synthesis, and its accumulation is considered to reflect tumor cell proliferation activity [9, 28, 29 ]. in the present study, there were significant differences between the grade ii gliomas and the grade iv gliomas and no significant differences between the grade ii gliomas and grade iii gliomas in the met - pet study. however, the presence of tumor cells was confirmed in the area with increased accumulation of met but poorly depicted on mri scan and no increased accumulation of tracers in the fdg - pet and flt - pet studies, indicating its usefulness as a testing modality to determine the presence of tumor. on the other hand, the correlation of met uptake in the microvessel density and blood volume in tumor or with expression of vascular endothelial cells, which are amino acid transporters (lat1) in tumor cells is suggested, and the use of met by itself seems difficult for making diagnosis since additional factors other than proliferation activity are involved [8, 30 ]. also, it has been reported that the accumulation of met is high in oligodendroglioma due to the high cell density, and special attention is required for its differentiation. in the flt - pet study, there were significant differences between the grade ii gliomas and the grade iv gliomas and between the grade iii gliomas and grade iv gliomas. in addition, there was a significant correlation between the ki-67 index and the flt accumulation. there is a correlation between the ki-67 index and the met accumulation, but the correlation with flt is more significant. hence, we considered that flt - pet was a more ideal and attractive pet tracer for glioma imaging than met - pet. furthermore, the uptake of flt in normal brain tissue was lower than that of met (suv max, 0.20 0.05 versus 1.52 0.36). one of the reasons for low uptake of flt in normal brain tissue is that flt allows the direct measurement of cellular tk1 activity, which has been proportional to the proliferation activity. since, met accumulation provides an indirect measure of lat1 expression in the vascular endothelial cells and proliferation status as amino acid uptake, met - pet exhibits higher background than flt - pet in normal brain tissue however, flt - pet had some weak points. in our series of who grade ii glioma, uptake of flt was lower than that of met (suv max, 0.36 0.23 versus 3.04 1.56) and the uptake ratios for tumor to normal brain were same (t / n ratio, 1.99 1.37 versus 2.03 1.02). who grade ii gliomas had no contrast enhancement on gd - enhanced mri. flt uptake was similar to the low levels observed in no enhanced lesions of mri. flt may be less useful in assessing proliferation in noncontrast - enhancing tumors regardless of the histopathology grading. low - tracer access to the tumor tissue may limit the metabolic trapping of flt after the phosphorylation even in proliferative tumors. the leakage of flt was observed in the area with radiation necrosis and disrupted blood - brain barrier (bbb) that result in the increased accumulation [5, 24, 27 ]. we will continue the analysis of flt with more patients as flt can be quantified by kinetic analysis. specifically, the kinetic analysis of flt - pet may clarify whether the transport effect or metabolic trapping largely contribute to the increased accumulation of flt in the tumor. as shown in figure 5, there were differences in the accumulation of each tracer within the same tumor due to the characteristics of each tracer, which may reflect the differences in tissues by site. in other words, we can predict that there are many oligodendroglioma components in the area with high met accumulation and low flt accumulation, and it is likely that the area is necrotic when met accumulation is low, but flt accumulation is high. when both tracer accumulations are high, the area is highly malignant as a tumor site and has high proliferative ability. however, it is difficult to make differential diagnosis, determine the recurrence of tumor, and determine the presence or absence of radiation necrosis using only one type of pet studies [31, 32 ]. our study indicated that the combinational uses of fdg, met, and flt - pet help us evaluate the differences in malignancy grade of the tissues and predict the evaluation of histopathological components. we can predict that there are many oligodendroglioma components in the area with high met accumulation and low flt accumulation, and it is likely that the area is necrotic when met accumulation is low but flt accumulation is high. when both met and flt tracer accumulations are high, the area is highly malignant as a tumor site and has high proliferative ability. pet study is a noninvasive examination method, and the use of these tracers in addition to widely used fdg - pet is highly useful for accurate preoperative diagnosis of tumors and identification of tumor area for removal. we will continue these tracer analyses to elucidate the correlation with pathological diagnosis and radiological diagnosis. | the use of positron imaging agents such as fdg, met, and flt is expected to lead the way for novel applications toward efficient malignancy grading and treatment of gliomas. in this study, the usefulness of fdg, met and flt - pet images was retrospectively reviewed by comparing their histopathological findings. fdg, met, and flt - pet were performed in 27 patients with who grade iv, 15 patients with who grade iii, and 12 patients with who grade ii during 5.5 years. the resulting pet images were compared by measuring suvs and t / n ratios (tumor to normal tissue ratios). although there were no significant differences in fdg - pet, there were significant differences in the t / n ratios in the met - pet between who grades ii and iv and in the flt - pet between the who grades iii and iv. in glioblastoma patients, the suvs of the areas depicted by mri in the met - pet were different from those suvs in the flt - pet. importantly, the areas with high suvs in both met - pet and flt - pet were also high in ki-67 index and were histologically highly malignant. pet imaging is a noninvasive modality that is useful in determining a tumor area for removal as well as improving preoperative diagnosis for gliomas. |
quiet standing postural balance is an indispensable factor for performing routine activities of daily living1. the maintenance of a quiet stance is a complicated task that requires the integration of vestibular, visual and somatosensory inputs from the whole body, for the assessment of the motion and position of the body in space, and the ability to generate forces to adjust body position2. disorders in these postural control systems often result in falls, and falls are a potential risk, limiting activities of daily living of patients with parkinson s disease3. patients with parkinson s disease have problems maintaining balance and coordinating goal directed movements4. in particular, the contributions of proprioceptive feedback information to static position and movement perception processing are decreased in patients with parkinson s disease5. therefore, parkinsonian patients have smaller than normal limits of stability when asked to perform quiet standing6. since the center of pressure (cop) and ground reaction force (grf) are very important variables for the maintenance of postural control, we need to evaluate the cop sway and grf as a clinical method of functional assessment7, 8. also, because movement disability is the main symptom of patients with parkinson s disease, exercise training is very important, and a recommended intervention in terms of exercise that helps functional rehabilitation and decreases the side - effects of medications for parkinson s disease9, 10. however, it is difficult to develop a specific therapeutic exercise for these symptoms which include hypokinesia, tremor, and muscular rigidity11. recently, various devices and exercise interventions have been developed to replace the loss of self - motion information due to disease, injury or aging. among these, the application of vibration has been widely used to improve the function of proprioception12. however, ross.14 reported that vibration applied to young healthy individuals did not affect their static balance. some studies have reported that vibration improved the postural balance of patients with neurological injury, whereas the others have reported no difference. the purpose of this study was to investigate if the application of vibration to the lower extremities affects the quiet standing postural balance of patients with parkinson s disease. the subjects had an average age of 61.82 5.57, an average height of 155.36 3.71 cm, and an average weight of 60.15 4.38 kg. approval for the study was received from the institutional review board of national evidence - based healthcare collaborating agency (pirb11 - 015 - 1), and written informed consent was obtained from each patient before the start of the study. eight vibrators (10 g, diameter of 1 cm) were made especially for this study. they were attached to the muscle bellies of the tibialis anterior, gastrocnemius, biceps femoris, and rectus femoris on both sides of the lower extremities of the subjects. the subjects wore short pants to minimize external stimuli, and were barefoot. to identify the effects of vibration stimuli on static postural balance, subjects asked to stand on a force platform and measurement were made with and without vibration applied to both of the lower extremities. the force platform (amti, newton, ma, usa) measured the center of pressure (cop) sway and ground reaction forces (grf) during quiet standing. the amplified force platform signals were sampled on - line at a rate of 1,000 hz for 1 second and cop data (path length, path area) and grf (fx, fy, fz) were calculated using bioanalysis (amti, watertown, ma, usa). the independent t - test was used to identify the significance of differences in the length and area of cop sway and grf (medial / lateral, anterior / posterior, vertical force) between with and without vibration stimuli. the length of cop sway of the parkinson s disease patients was not significantly different between with and without vibration (p>0.05), but the area of cop sway with vibration was significantly smaller than that without vibration (p<0.05) (table 1table 1. comparison of center of pressure sway between with and without vibrationvariablewithout vibrationwith vibrationpath length (mm)1,419.36 (276.04)1,425.31 (262.08)path area (m)266.66 (139.71)122.19 (60.14)significant difference between with and without vibration (p<0.05)). for grf, the medial - lateral maximum force (fy) with vibration was significantly higher than that with no vibration (p<0.05), but the antero - posterior force (fx) and vertical force (fz) showed no significant differences (table 2table 2. comparison of ground reaction forces between with and without vibrationvariablewithout vibrationwith vibrationanterior - posterior (% bm)0.00290 (0.00207)0.00391 (0.00215)medial - lateral (% bm)0.00338 (0.00257)0.00604 (0.00234)vertical (% bm)1.03674 (0.07680)1.03694 (0.07649)significant difference between with and without vibration (p<0.05)). significant difference between with and without vibration (p<0.05) significant difference between with and without vibration (p<0.05) parkinson s disease is characterized by tremor, postural reflex disorder, and rigidity, which increase the risk of falls15. the symptoms of parkinson s disease have been implicated in several aspects of the postural control and locomotor systems including the integration of sensory information relevant for balance16. this study demonstrated the effects of vibration on the postural balance of parkinson s disease patients in quiet standing. patients with parkinson s disease often have larger than normal center of mass displacements in response to external perturbations17, and they have problems integrating proprioceptive information for posture - movement coordination4. vibratory stimulation increases the afferent signals generated by the muscle spindles creating a proprioceptive illusion18. vibration can also evoke postural adaptation enhancing postural performance and reducing the likelihood of imbalance19. in our study of parkinson s disease patients, the area of cop sway with vibration was significantly smaller and the medial - lateral force (fy) with vibration was significantly higher than that of the no vibration condition. these results are similar to those of previous studies which have reported that vibration can affect postural reactions and creat postural kinesthetic illusions in standing subjects20, 21. we believe that the decrease of the area of cop sway and the increase of medial - lateral force induced by vibration indicates a more rapid reaction to posture perturbation. in conclusion, our results suggest that the application of vibration stimuli to the lower extremities can help parkinson s disease patients to control postural balance during quiet standing. | [purpose ] the purpose of this study was to investigate the effect of muscle vibration applied to the lower extremities on static postural balance of patients with parkinson s disease (pd). [subjects ] seven subjects with parkinson s disease participated in this study. [methods ] the oscillators of vibration were attached to the muscle bellies of the tibialis anterior, gastrocnemius, biceps femoris, and rectus femoris on both sides of the lower extremities with adhesive tape. a vibration frequency of 60 hz was used to induce static postural reactions. subjects center of pressure (cop) sway and peak ground reaction force (grf) were measured with their eyes open with and without vibration. cop sway and peak grf (fx, fy, fz) were measured using a force plate (amti, newton, usa), which provides x, y and z coordinates of body movement. [results ] the area of cop sway with vibration was significantly smaller than that with no vibration, but the length of cop sway showed no difference between two conditions. peak medial - lateral maximum force (fy) with vibration was significantly higher than that with no vibration, but peak anterior - posterior force (fx) and peak vertical force (fz) showed no differences. [conclusion ] these results suggest that vibration applied to the lower extremities can help pd patients control postural balance during quiet standing. |
the leukemic cell population in acute lymphoblastic leukemia (all) and acute myeloblastic leukemia (aml) results from clonal proliferation by successive divisions from a single abnormal stem or progenitor cell. the accumulation of these cells results in the replacement of the normal hematopoietic precursor cells of the bone marrow, ultimately leading to bone marrow failure. the great majority of cases of both all and aml appear to arise sporadically, and no precipitating factors can be identified. however, epidemiological studies have identified a number of congenital syndromes and environmental factors which appear to predispose toward the development of acute leukemia (al). it is now proposed that aml occurs as a result of acquisition within hematopoietic stem / progenitor cells of mutations in two distinct classes. class i mutations result in an abnormal proliferative signal and typically occur as mutations of genes in receptor tyrosine kinases such as flt3 or the ras oncogene. class ii mutations result in a block in differentiation of leukemic progenitors and are typically caused by non - random chromosomal translocations that result in the generation of mutated transcription factors and the inhibition of hematopoietic gene expression. oral manifestations are frequently the initial signs of leukemia, particularly in the acute forms, prompting the patient to consult the dentist first. the oral cavity, and especially the gingival tissue, is one site commonly involved either by leukemic infiltration or by inflammatory reactive hyperplasia causing gingival enlargement. it is therefore imperative that the dentist recognize these leukemic lesions as early as possible because of the danger, in some instances, of oral surgical interference and also the necessity of medical attention. for the diagnosis of leukemic infiltration, since patients with al are likely to develop bleeding and infection due to pancytopenia, surgical biopsies should be carried out with extreme caution. as an alternative procedure, fine needle aspiration cytology (fnac) has been advocated for the diagnosis of such lesions in al patients in different body organs such as testes, skin, lymph nodes and breast. it has been proved to be an effective, safe and simple technique.[912 ] early recognition of clinical findings in the oral cavity by an astute clinician and investigation into potential systemic causes may uncover an underlying systemic disease and lead to its timely diagnosis and management. therefore, gingival fnac was performed as a diagnostic procedure with an aim to assess its diagnostic value in detecting leukemic gingival infiltration in al patients presenting with or without gingival enlargement. fifty al patients (32 males and 18 females ; age range 1155 years) received a clinical and cytological examination of gingiva by the use of fnac. before the procedure the al cases confirmed by bone marrow aspiration findings were included in the study. the absence or presence of intraoral findings then, the site for fnac was selected in the gingiva. for patients with generalized or localized enlargement, the site with maximum enlargement was selected. in patients with no gingival enlargement, the sites, 10% xylocaine spray was applied to anesthetize the surface and the selected area was rubbed with a piece of cotton to remove tissue debris. two cubic centimeter of air was left before the aspiration procedure, to be used later to express the aspirated materials. the selected site was quickly punctured by needle tip, with its bevel directed away from the mucosal side. while the needle was introduced inside the gingiva with the negative pressure maintained, a slight rotation of the needle was done for proper tissue aspiration. when the material was aspirated, the plunger was released to the starting mark (2 cm), the needle was quickly withdrawn from the tissue, and the material a peripheral blood film was prepared for each patient at the time of the aspiration procedure. to exclude the possibility of contamination of the aspirated material by blood, each aspirated sample was compared with the peripheral blood and the following points were used for comparison : a) differences in the degree of gingival infiltration and the wbc in the peripheral blood and b) the difference between the type of cells in the aspirate and that in the peripheral blood. prior to aspiration, 10% xylocaine spray was applied to anesthetize the surface and the selected area was rubbed with a piece of cotton to remove tissue debris. a 5 ml syringe with 24 two cubic centimeter of air was left before the aspiration procedure, to be used later to express the aspirated materials. the selected site was quickly punctured by needle tip, with its bevel directed away from the mucosal side. while the needle was introduced inside the gingiva with the negative pressure maintained, a slight rotation of the needle was done for proper tissue aspiration. when the material was aspirated, the plunger was released to the starting mark (2 cm), the needle was quickly withdrawn from the tissue, and the material a peripheral blood film was prepared for each patient at the time of the aspiration procedure. to exclude the possibility of contamination of the aspirated material by blood, each aspirated sample was compared with the peripheral blood and the following points were used for comparison : a) differences in the degree of gingival infiltration and the wbc in the peripheral blood and b) the difference between the type of cells in the aspirate and that in the peripheral blood. in the present study, 50 patients of al received clinical and cytological examination of gingiva by the use of fnac. all the cases were diagnosed based on bone marrow aspiration findings and classified according to the french american british (fab) criteria. the maximum number of patients (54%) was in the age group of 1120 years. the number of patients gradually declined toward higher age group. regarding the sex distribution, male patients (64%) outnumbered female patients (36%). table 1 indicates the distribution of the cases of al according to fab classification. when comparing the distribution of all and aml among the selected 50 cases, it was observed that 28 patients (56%) were of all and 22 patients (44%) were of aml. among the 28 cases of all, 26 were of l2 subtype, and l1 and l3 subtypes had 1 patient each. among the 22 cases of aml, 11 cases were of m2 subtype, 7 were of m5 and 4 were of m4 subtype. distribution of cases showing gingival leukemic infiltration according to french american british (fab) classification in the 50 cases studied, 14 were positive for gingival infiltration by leukemic cells : 8 (28.57%) of all and 6 (27.27%) of aml. in terms of leukemic gingival infiltration, among aml subtypes, m4 (2 cases) subtype [figure 1a ] was less commonly involved than m5 (4 cases) subtype [figure 1b ]. among all subtypes, l2 subtype (8 cases) [figure 2 ] was the only type to be involved [table 1 ]. the type of cells in aml and all cases showing positive gingival infiltration was compared with that of their respective peripheral blood film picture. gingival aspirate from aml (m4 subtype) showing infiltration by blast cells (leishman 's stain, 1000) gingival aspirate from aml (m5 subtype) showing infiltration by monoblasts (leishman 's stain, 400) gingival aspirate from all (l2 subtype) showing infiltration by lymphoblasts (leishman 's stain, 400) among the 28 cases of all, gingival bleeding was seen in 2 cases (7.14%), while gingival enlargement with prominent deposits of plaque / calculus was seen in 2 cases (7.14%). twenty - four cases (85.71%) lacked characteristic oral findings. among the 22 cases of aml, gingival bleeding as the only oral manifestation was seen in 4 cases (18.18%), while gingival bleeding with gingival enlargement was seen in 6 cases (27.27%). twelve cases (54.55%) lacked characteristic oral findings [table 2 ]. in the present study findings in the oral cavity in all and aml cases among the patients with positive leukemic infiltration in gingiva (8 in all and 6 in aml), all the 6 patients (100%) of aml manifested gingival bleeding with gingival enlargement as oral findings [figures 3a and 3b ], whereas all the 8 cases of all that were positive for leukemic gingival infiltration showed no clinical evidence of gingival enlargement [table 3 ]. leukemic gingival enlargement in patient with m4 subtype (aml) leukemic gingival enlargement in patient with m5 subtype (aml) gingival findings in acute leukemic patients with gingival infiltration two cases of l2 subtype showed gingival enlargement due to local factors like plaque / calculus rather than due to leukemic infiltration and the aspirate showed sheets of epithelial cells. leukemia is characterized by an abnormal proliferation of immature leukocytes and their precursors in bone marrow. the leukemic cell population also has the propensity to invade extramedullary tissues and its presence as leukemic infiltrates has been reported in the kidneys, lungs, bowels, breasts, testes, eyes, meninges, lymph nodes, liver, prostate, skin, and oral cavity. gingival tissues are considered more susceptible to leukemic cell infiltration because of their microanatomy and expression of endothelial adhesion molecules which enhance infiltration of leukocytes. oral lesions may be the presenting feature of als, and are therefore important diagnostic indicators of the disease. the most common oral findings include gingival enlargement, local abnormal color or gingival hemorrhage, petechiae, ecchymosis, mucosal ulceration and oral infections. in rare cases, atypical features like chin numbness and tooth pain gingival overgrowth has several causes, including poor oral hygiene, drugs, systemic illnesses and neoplastic conditions. the gingiva shows slow growth rate and appears pink with a firm consistency and minimal inflammatory component when it is genetically induced. in case of blood dyscrasias bleeding diathesis, gingival hyperplasia and extramedullary leukemic infiltration are more frequently seen in the context of acute rather than chronic leukemia. in al, monocytic (m5), myelomonocytic (m4), and myelocytic (m1, m2) subtypes have been reported with gingival hyperplasia in 66.7%, 18.5%, and 3.75% of cases, respectively. despite its frequency, the present study was carried out with an objective to assess if fnac is of diagnostic value in detecting gingival leukemic infiltration in patients with al. in the present study, the maximum number of patients (54%) was in the age group of 1120 years, as the study included only al cases that are commoner in younger age group. male patients outnumbered female patients and this predominance of al in males is in agreement with the reports of abdullah., and sinrod. the predominance of all over aml cases is in agreement with one of the previous studies conducted by advani. such findings are in contrast with those of abdullah., and appel. which showed gingival infiltration to be more common in aml than all such findings are in agreement with a study done by forkner, who stated that the oral manifestation of marked swelling, particularly in gingiva, can usually be regarded a characteristic typical of acute monocytic leukemia and is usually absent in al of the myelogenous or lymphatic varieties, while shepard reported that the monocytic type produces the most severe oral complications, followed by myeloblastic and lymphoblastic leukemia in the descending order of severity. barrett stated that oral bruising and/or frank bleeding were observed more commonly in aml than in all. further, several case reports have stressed the role of oral cavity as a diagnostic indicator in leukemia. gingival enlargement together with gingival bleeding as an initial manifestation of aml cases has been reported in the dental literature.[1516182628 ] in the present study, all the eight cases of all that were positive for leukemic gingival infiltration showed no clinical evidence of gingival enlargement. this is in agreement with the finding of white who reported leukemic infiltration in autopsy material of gingival tissue in a child with all with no gingival enlargement., of the cases with no clinical evidence of gingival enlargement seen, cytological examination showed four cases with definitive gingival infiltration. concerning the aml subtypes, m5 was more commonly involved than m4 subtype in terms of leukemic gingival infiltration. among the all subtypes, l2 was the one involved in leukemic gingival infiltration. this is in agreement with the findings of abdullah., who concluded that m5 and m4 subtypes are considered the most common subtypes of al, causing gingival infiltration. fnac was shown to be simple, safe and effective diagnostic procedure in studying gingival changes in patients with al. thus, in a patient reporting with gingival bleeding and/or gingival enlargement without commensurate presence of deposits and relevant history, al could be suspected and the patient should be referred for hematological opinion as the importance of this disease to the dentist can not be overemphasized, since he is in an ideal position to detect it relatively early in its course. | background : oral manifestations are frequently the initial signs of acute leukemia, prompting the patient to consult the dentist first. the gingival tissue is one site commonly involved either by leukemic infiltration or by inflammatory reactive hyperplasia, causing gingival enlargement. the gingival infiltration may also be present without gingival enlargement. early recognition of clinical findings in the oral cavity leads to its timely diagnosis and management. since biopsy is highly contraindicated, gingival fine needle aspiration cytology was performed to assess its diagnostic value in detecting gingival infiltration in acute leukemia patients.materials and methods : fifty patients of acute leukemia received clinical and gingival cytological examination. the cases were diagnosed based on bone marrow aspiration findings and classified according to the french american british criteria. the absence or presence of intraoral findings was recorded. site for gingival fine needle aspiration cytology was selected.results:leukemic gingival infiltration was found to be more common in acute lymphoblastic leukemia, while the characteristic oral findings were seen more commonly in acute myeloblastic leukemia. all the eight cases of acute lymphoblastic leukemia that were positive for leukemic gingival infiltration showed no clinical evidence of gingival enlargement. in terms of leukemic gingival infiltration, l2 subtype was the only subtype involved, while m5 was more commonly involved than m4 subtype. two cases of l2 subtype showed gingival enlargement due to local factors like plaque / calculus rather than due to leukemic infiltration.conclusion:the technique was found to be safe and of definitive diagnostic value in detecting gingival infiltration in acute leukemia patients. |
ivermectin (mectizan) is a semi - synthetic lactone drug that exhibits broad anti - helminthic specificity. mectizan has become the drug of choice for mass chemotherapy campaigns to eliminate onchocerciasis as a public health problem. in general, a notable exception occurs in some areas where the agent of onchocerciasis, onchocerca volvulus, is sympatric with loa loa, the causative agent of another filarial infection of humans. over the past several years, severe adverse reactions to mectizan treatment have been reported in individuals residing in onchocerciasis endemic areas that are also endemic for l. loa [3 - 5 ]. these adverse reactions are characterized by severe neurological complications, including incontinence, coma, and in some cases, death of the patient. interestingly, a large majority of the individuals suffering from such severe adverse reactions have resided in southern cameroon [6 - 8 ]. the development of severe reactions to mectizan in l. loa infected individuals has had a negative impact on the design and implementation of mectizan distribution campaigns to control onchocerciasis in areas where o. volvulus and l. loa are co - endemic. parasitological examinations of patients who developed post - mectizan encephalopathy showed a correlation between the risk of developing such reactions and the l. loa microfilarial load. however, the finding that the vast majority of such severe reactions occurred in a localized geographic area also suggested that the parasites endemic to this area might represent a genetically distinct population that is particularly capable of inducing adverse reactions in the host upon being exposed to mectizan. if the parasites from southern cameroon represent a genetically distinct population, it would follow that genetic exchange with other parasite populations would be expected to be limited or non - existent. such reproductively isolated populations often suffer from a genetic founder effect, resulting in a population in which the level of genetic heterogeneity is severely limited, and in which the distribution of alleles in the isolated population is often strikingly different from that seen in non - reproductively isolated populations. furthermore, prolonged reproductive isolation of a population will result in the accumulation of population specific genetic polymorphisms. if this occurs, phylogenic analyses based upon data collected from isolates from within and outside of the isolated population should result in a phylogeny in which the isolates from within the isolated population are grouped together. very little is known concerning the degree of genetic diversity among different populations of l. loa and the role that such genetic polymorphisms may play in the adverse responses to mectizan treatment. simian and human strains of l. loa, which differ in the length of the microfilariae and their periodicity in the host have long been recognized. despite these differences, human and simian l. loa are believed to be the same species, as experimental studies have shown that parasites from these two primate hosts can hybridize. because parasites from the two hosts differ in periodicity and are transmitted by different species of the chrysops genus, it has been proposed that the human and simian parasites " are at an early stage of radiative evolution ". whether hybridization of the simian and human strains is a co - factor in the development of post - mectizan encephalopathy is unknown. some biochemical variation has also been reported among different populations of human l. loa, although these differences have not been explored at the genetic level. perhaps the most well documented case of the importance of genetic factors in the pathogenesis of a human filarial infection is in onchocerciasis. human onchocerciasis exhibits two distinct clinical and epidemiologic disease patterns in the rain forest and savanna bioclimes of west africa. studies have revealed a strong correlation between the classification based upon the epidemiological disease pattern and the pattern of hybridization to strain specific dna sequences derived from a repeated sequence encoded in the nuclear genome of o. volvulus. subsequent studies have demonstrated that variation within this repeat population could be used as a tool for biogeographic studies. in ascaris suum, ostertagia osteragi and haemonchus contortus mitochondrially encoded sequences have proven to contain useful polymorphisms for population based studies. similarly, the internal transcribed spacer (its) of the ribosomal rna gene cluster has been used to develop markers capable of distinguishing different populations of haemonchus contortus. to test the hypothesis that l. loa endemic to southern cameroon represents a distinct population, these parasites consisted of infective larvae obtained from four individual wild caught l. loa infected chrysops dimidiata vector flies collected in the village of ngat (325'n, 1133'e), located approximately 50 km south of the capital of yaound. individual isolates were also obtained from blood collected from l. loa infected expatriate former residents of nigeria, gabon and the democratic republic of the congo at the laboratory of parasitic diseases at the national institutes of health in bethesda, md, usa. dna was extracted from the parasite preparations, following previously described methods. these dna samples were then used as templates in pcr amplification reactions targeting three gene sequences : the mitochondrial 16s rrna gene, the its2 domain of the nuclear rrna gene cluster, and the 15r3 polyprotein gene in l. loa. the 15r3 gene has previously been shown to be polymorphic and useful in the development of a dna based diagnostic assay for this parasite. these gene sequences were chosen for study because, as discussed above, homologues (or related sequences) have previously been shown to be informative population based markers in studies of other parasitic nematodes. pcr amplicons resulting from these reactions were subjected to direct dna sequence analysis to identify sequence polymorphisms. all of the dna templates were successfully amplified with the primer set derived from the mitochondrial 16s rrna gene. however, no polymorphisms were noted in the amplification products analyzed (data not shown). amplification products were also obtained from all of the samples targeting the 15r3 polyprotein gene. interestingly, sequences derived from dna extracted from the blood of l. loa infected individuals from gabon, nigeria and the democratic republic of the congo were identical (figure 1, panel a). one of the isolates from southern cameroon also contained a 15r3 sequence which was identical to that found in the parasite isolates from the other countries. however, the remaining three isolates from southern cameroon contained between 3 and 7 polymorphic sites when compared to the canonical sequence found in the other parasites (figure 1, panel a). these data suggest that the 15r3 gene sequences from parasites obtained from southern cameroon were at least as polymorphic as those from other l. loa foci in sub - saharan africa. none of the polymorphisms were consistently found among the isolates from southern cameroon, suggesting that these polymorphisms probably did not arise from evolution in a genetically homogeneous, reproductively isolated population (data not shown). analysis of polymorphisms in the 15r3 and its2 gene sequences of l. loa : panel a : pairwise differences in 15r3 amplicon sequences among l. loa isolates. the 15r3 gene fragment was amplified from l. loa genomic dna (2.5 l per reaction) using primers with the sequences 5 ' ggcacaaaacactgcagcagtcct 3 ' and 5 ' cagctgtctcaaatcgaagattct 3 '. a total of 2.5 units of taq polymerase (roche applied biochemicals, indianapolis, usa) was used in each 50 l amplification reaction, together with the reaction buffer supplied by the manufacturer. amplification conditions consisted of an initial denaturation of 5 minutes at 94c, followed by 40 cycles consisting of 1 minute at 94c, 1 minute at 49c, and 2 minutes at 72c. the its2 gene fragment was amplified from l. loa genomic dna (2.5 l per reaction) using primers with the sequences 5 ' taacaatgaagataaagcga 3 ' and 5 ' ttagtttcttttcctccgct 3 '. a total of 2.5 units of taq polymerase (roche applied biochemicals, indianapolis, usa) was used in each 50 l amplification reaction, together with the reaction buffer supplied by the manufacturer. amplification conditions consisted of an initial denaturation of 5 minutes at 94c, followed by 40 cycles consisting of 1 minute at 94c, 1 minute at 50c, and 2 minutes at 72c. the phylogeny was developed using parsimony methods, performing an exhaustive search of the data with the parsimony routines in the paup program package (v4.0, release 10). the robustness of the phylogeny was tested by running 1000 synthetic datasets with the bootstrap method in the paup program package. as indicated on the figure, the division of the four sequences into the two clades shown was supported 70% of the time in the bootstrap analysis. amplification of the its2 locus was successful from l. loa dna samples from nigeria, gabon and two of four samples from southern cameroon. again, several polymorphisms were noted among the four samples examined (figure 1, panel b). however, none of these polymorphisms were specific to and conserved in the two isolates from southern cameroon. thus, an analysis of the sequence data using parsimony methods did not support a phylogeny that grouped the two isolates from southern cameroon (figure 1, panel c). the data presented above are preliminary, and involve the analysis of a limited number of sequences from a small number of parasite isolates. first, it appears that genetic variation in parasites from the focus in southern cameroon is at least as frequent as in parasites from other locations. second, no polymorphisms were noted which were unique to the parasites from southern cameroon and also shared among the isolates examined from this focus. together, these observations argue against the hypothesis that the parasites found in southern cameroon represent a distinct, reproductively isolated population. this study revealed a considerable amount of sequence variation in the two nuclearly encoded genes examined. if this level of sequence heterogeneity is representative of the rest of the nuclear genome, this suggests that the l. loa population from southern cameroon is fairly genetically heterogeneous. it is therefore possible that a proportion of the parasites from southern cameroon contain allelic variants of genes that result in enhanced virulence and/or pathogenicity in the face of mectizan treatment. this might explain the fact that severe adverse reactions in response to mectizan treatment are confined to a small proportion of the treated population. to test this hypothesis, it will be necessary to obtain parasites from individuals who exhibit the preliminary symptoms of a severe adverse reaction shortly following mectizan distribution, when l. loa microfilariae are still likely to be present in the circulation. tbh was responsible for carrying out the laboratory experiments described in the manuscript, including dna isolation, pcr amplification and dna sequence analysis. ak and mb were involved in the experimental planning and conducted the field work involved in obtaining the samples. he was responsible for obtaining grant support for the project, for assisting in the experimental design, data analysis and for preparation of the manuscript. m. demanou, who assisted with collection of chrysops from which loa loa infective larvae were isolated, and dr. this investigation received financial support from the undp / world bank / who special programme for research and training in tropical diseases (tdr), project # 991105. | ivermectin (or mectizan) is widely used by onchocerciasis and lymphatic filariasis control programs worldwide. generally, mectizan is both safe and well tolerated. an exception to this general pattern is in some areas co - endemic for onchocerca volvulus and loa loa, where a number of severe adverse reactions to mectizan have been noted in l. loa infected individuals. the vast majority of these severe adverse events have occurred in southern cameroon. this suggested the hypothesis that the parasites endemic to southern cameroon might form a distinct population that exhibited a phenotype of eliciting severe adverse reactions in loa - infected individuals upon mectizan exposure. to test this hypothesis, the dna sequences of three potentially polymorphic loci were compared among l. loa parasites from southern cameroon and other endemic foci in sub - saharan africa. analysis of these data suggested that parasites from southern cameroon were at least as genetically diverse as those from other foci. furthermore, no polymorphisms were noted that were unique to and shared among the parasite isolates from southern cameroon. although a limited number of parasite isolates were tested, these results do not appear to support the hypothesis that l. loa parasites from southern cameroon represent a unique, genetically isolated population. |
scientific knowledge has increasingly become important in the development of prevention and health promotion interventions and legitimising the decisions on which interventions are considered relevant for public health policy [13, 26 ]. and in the last decades, the scientific knowledge used has also become more and more sophisticated (cf.). with the growing knowledge about diseases and chronic illnesses, more became known about health determinants, health behaviours, risk factors and their distribution among populations. as the public health field uses and produces this kind of knowledge, it has contributed to this increasing sophistication. with its features being among others the collection and use of epidemiological data, population surveillance and other forms of empirical quantitative assessment, there is an increasing understanding of complex health determinants and emphasis on establishing the effectiveness of a broad range of interventions (see e.g., [4, 5, 7, 28 ]). tools that are often used for these purposes are screening methods and risk profile assessments. the screening methods and risk profile assessments function as technologies of trust (cf.), as the numerical outcomes they produce have become associated with objectivity and legitimisation [1, 26 ]. however, these tools or instruments are more than just measuring tools ; they are components in the interventions like behavioural counselling or health education. in other words, screening methods and risk profile assessment are not neutral. whereas these instruments create effects, they also reduce the target population and thereby decrease the effects. as they are used to screen and select risk groups for prevention and health promotion programmes, they legitimise medical intervention or treatment to be undertaken (cf.) as they objectify the health status of individuals and remove it from all subjective interpretation and personal discretion. as these instruments are being used to screen and select individuals, eligible for intervention, they exclude individuals that do not match the criteria and reduce the target population thereby decreasing possible effects. sociologists have critiqued the emphasis on objectivity in medicine in general and in public health in particular. according to their arguments, the use of epidemiological knowledge and tools such as screening methods and risk profile assessments in medicine and public health define a matter of individual responsibility and control and therefore stigmatises and victimises selected individuals for having a disadvantaged or deviant health status [3, 12, 1820 ]. in other words, with health to be considered a matter of one s self - control, individuals are summoned to live healthy lives, as it is the morally right thing to do. in fact, it is implied that one is to blame for one s future illnesses provided that one uses the epidemiological knowledge that is provided and one alters one s lifestyles accordingly. as lupton has argued, such an approach to health assumes that people are passive patients that need to be made aware or better educated of the prospective threats that are associated with their lifestyle choices and need to be assisted in altering their lifestyles [1820 ]. in addition, horstman and houtepen have argued that this view, which has been dominant in critiques about public health, is itself criticised as it does not do justice to individual preferences and choice. in fact, it suggests that people do not have agency and are victimised and stigmatised by prevention and health promotion programmes and their instruments, whereas health care professionals and participants in fact do have agency and voice. in this paper, in addition to lupton and others we focus on the functioning of screenings instruments and risk profile assessments and the role they fulfil in prevention and health promotion programmes, with that difference that we focus on the active role patients fulfil in the interpretation of such instruments and the outcomes and labels they produce. questions we explore in this paper are : how do these instruments construct a target population for prevention and health promotion programmes as well as construct the health risks that should be targeted ? how is the actual intervention shaped by the individuals that are detected by means of these instruments ? answers to these questions might relativise lupton s argument, that patients are victimised by the instruments used in prevention and health promotion interventions. the meaning and definitions patients give to instruments and the outcomes and labels they produce, have to be taken into account in order to come to understand the concept of effectiveness of prevention and health promotion interventions. the emphasis on establishing effectiveness in prevention and health promotion is the result of its rationalised character (cf. [14, 23 ]), which underscores a univocal significance of effectiveness of interventions. in a rationalistic approach, the effectiveness or better the success of interventions is reflected by the impact these interventions have on improving the health status of their participants. in successful interventions the well - aimed stimuli of health educational advice, are considered to result in behavioural change in participants in a linear way leading to the improvement of their health status. wellbeing is according to participants are considered less or not important and subsequently become invisible, as these do not fit the parameters of the screening methods and risk profile assessments used in establishing the effectiveness of interventions. however, numerous interventions have shown no or minimal effects [17, 21, 22, 33 ]. and often this lack of effectiveness is classified as a problem of performance (see e.g., [2, 10, 27 ] in). whereas lupton and others have placed themselves in opposition to medicine in general and public health in particular, in this paper we do not look at prevention and health promotion from a normative point of view nor do we look at it as a problem of performance. we try to overcome these aforementioned approaches and engage with prevention and health promotion by taking the internal dynamics and logics of medicine in practice seriously (cf.). in order to take both the problems of effectiveness and performance seriously the screening methods and risk profile assessments need to be followed. the data presented here comes from an ethnographic study that paralleled the quattro study, which was a pragmatic randomised controlled trial on the effectiveness of multidisciplinary patient care teams in primary care for the secondary prevention of cardiovascular diseases (cvd) administered in primary health care centres in deprived neighbourhoods or rotterdam and the hague, the netherlands. the intervention consisted of the formation of a quattro - care team in general practice composed of a general practitioner (gp), a gp assistant, a practice nurse and a peer health educator for the provision of intensified preventive care to high - risk patients. this intensified preventive care consisted of patient - tailored health education about the risk factors associated with cvd, such as hypertension, diabetes mellitus, hypercholesterolemia, smoking and obesity provided by the practice nurse and/or peer health educator. structural cvd risk profile assessments, containing physical examinations of weight, height and blood pressure and blood tests on cholesterol and glucose levels, were used to assess the intervention participants risk profiles. and multidisciplinary team meetings, to be organised by the quattro - care team professionals, functioned as a manner for jointly establishing treatment plans for intervention participants and monitor the reduction in their risk profiles based on the particular knowledge and abilities of each professional. in order to evaluate the effectiveness of multidisciplinary patient care teams in primary care, the intervention followed the procedures of a pragmatic randomised controlled trial (rct), which aimed to measure the effectiveness of the intervention under natural non - experimental conditions. for this programme, the trial researchers selected patients from the centres electronic patient records with a modifiable part of the absolute 10-year risk on cardiovascular diseases (cvd) of at least 20%. people eligible for the quattro study (1) had to live in deprived neighbourhoods, as defined by the dutch national association of general practitioners (lhv) ; (2) were to be aged between 18 and 70 years of age ; (3) have a medical history of one or more risk factors for cardiovascular diseases (cvd) (e.g., smoking ; obesity) ; (4) a first degree relative with a history of cvd before his / her 60th birthday ; hypertension ; hypercholesterolemia ; diabetes mellitus type ii ; myocardial infarction ; angina pectoris ; peripheral arterial disease, heart failure, cva or tia. ; and (5) having an absolute 10-year risk for cvd, higher than 20% after blood tests and physical examinations at baseline (document selection criteria addendum 2). patients in the intervention group obtained quattro - care and three monthly assessments of their risk profile for cvd. patients from the first control group (a) received usual gp care and three monthly risk assessments and the gp as well as the patient were informed about the results of these measurements. it was thought to be ethically and practically unacceptable to assess a risk profile and not to inform the patient and gp about the results. however, this approach of assessing risk and informing patients and gp was thought to interfere with daily practice and bias the results. therefore, a second blinded control group (b) was needed to quantify the effect of the risk assessments. this group received usual gp care and was measured once at the end of the study. the research team assessed the effectiveness of the multidisciplinary collaboration with the returned patient monitoring data by comparing patients from the intervention group with those from the first control group after 1-year follow - up with regard to the reduction achieved in the 10-year absolute risk of developing cvd. the second control group, aimed to quantify the effect of structured risk profile assessments performed in the first control group, was compared with the first control group. in order to analyse how this prevention programme was shaped in practice, we observed how the practice nurses provided the patient - tailored health education and performed the structural cvd risk profile assessments and how these facilitated the patients in achieving lifestyle modifications. by means of participant observations [6, 29 ], we observed four out of seven practice nurses assigned to the project in their daily work, each for five workdays each, from april 2003 till december 2004. one practice nurse refused cooperation ; one practice nurse was on maternity leave and one was not yet in function. during the observations no notes were made, because note taking was felt to intrude on the interactions between the practice nurses and their patients and colleagues. during these observations a total of 63 patient consultations were attended. because of the recurrent nature of the programme s follow - up, the observations also contain succeeding follow - up consultations of patients. fieldnotes were made immediately after leaving the health care centres. throughout each observation it was possible to ask questions or to request clarification. in addition, a total of five interviews were held with the practice nurses : two non - audio - taped semi - structured face - to - face interviews due to objections to audio - taping and three audio - taped semi - structured face - to - face interviews. the interviews were held at the health care centres and lasted approximately one and a halve hour. in all interviews, the practice nurses were asked about their experiences with the quattro programme, their dealings with patients in the programme and their activities in the primary health care centres. the patients in the observed consultations were invited to take part in the quattro programme, as they were all at high risk for developing cvd and not yet properly managed for hypertension, hypercholesterolemia and/or diabetes mellitus type ii. all patients were registered at the health care centres and were living in the deprived neighbourhoods the health care centres provided their services to. during the patients consultations observations were made about how both the practice nurses and patients participated in this health promotion programme. whenever possible, informal conversations with the patients took place about the possibility and difficulties incorporating the recommended lifestyle adjustments into their lives. with three patients audio - taped semi - structured face - to - face interviews were held to go more in - depth into their motives for participating in prevention programmes and the difficulties participation may portray. the interviews were transcribed immediately after the interviews. in this study the process of analysis took place in a cyclic manner. emerging insights and themes were jotted down, and were taken into account during succeeding observations, interviews and final analysis. during the final analysis, all transcripts, written we analysed all information thematically, establishing overarching categories through identifying and coding all pieces of information. by means of developing overarching categories (taxonomy) overall descriptions of the information the data presented here comes from an ethnographic study that paralleled the quattro study, which was a pragmatic randomised controlled trial on the effectiveness of multidisciplinary patient care teams in primary care for the secondary prevention of cardiovascular diseases (cvd) administered in primary health care centres in deprived neighbourhoods or rotterdam and the hague, the netherlands. the intervention consisted of the formation of a quattro - care team in general practice composed of a general practitioner (gp), a gp assistant, a practice nurse and a peer health educator for the provision of intensified preventive care to high - risk patients. this intensified preventive care consisted of patient - tailored health education about the risk factors associated with cvd, such as hypertension, diabetes mellitus, hypercholesterolemia, smoking and obesity provided by the practice nurse and/or peer health educator. structural cvd risk profile assessments, containing physical examinations of weight, height and blood pressure and blood tests on cholesterol and glucose levels, were used to assess the intervention participants risk profiles. and multidisciplinary team meetings, to be organised by the quattro - care team professionals, functioned as a manner for jointly establishing treatment plans for intervention participants and monitor the reduction in their risk profiles based on the particular knowledge and abilities of each professional. in order to evaluate the effectiveness of multidisciplinary patient care teams in primary care, the intervention followed the procedures of a pragmatic randomised controlled trial (rct), which aimed to measure the effectiveness of the intervention under natural non - experimental conditions. for this programme, the trial researchers selected patients from the centres electronic patient records with a modifiable part of the absolute 10-year risk on cardiovascular diseases (cvd) of at least 20%. people eligible for the quattro study (1) had to live in deprived neighbourhoods, as defined by the dutch national association of general practitioners (lhv) ; (2) were to be aged between 18 and 70 years of age ; (3) have a medical history of one or more risk factors for cardiovascular diseases (cvd) (e.g., smoking ; obesity) ; (4) a first degree relative with a history of cvd before his / her 60th birthday ; hypertension ; hypercholesterolemia ; diabetes mellitus type ii ; myocardial infarction ; angina pectoris ; peripheral arterial disease, heart failure, cva or tia. ; and (5) having an absolute 10-year risk for cvd, higher than 20% after blood tests and physical examinations at baseline (document selection criteria addendum 2). patients in the intervention group obtained quattro - care and three monthly assessments of their risk profile for cvd. patients from the first control group (a) received usual gp care and three monthly risk assessments and the gp as well as the patient were informed about the results of these measurements. it was thought to be ethically and practically unacceptable to assess a risk profile and not to inform the patient and gp about the results. however, this approach of assessing risk and informing patients and gp was thought to interfere with daily practice and bias the results. therefore, a second blinded control group (b) was needed to quantify the effect of the risk assessments. this group received usual gp care and was measured once at the end of the study. the research team assessed the effectiveness of the multidisciplinary collaboration with the returned patient monitoring data by comparing patients from the intervention group with those from the first control group after 1-year follow - up with regard to the reduction achieved in the 10-year absolute risk of developing cvd. the second control group, aimed to quantify the effect of structured risk profile assessments performed in the first control group, was compared with the first control group. in order to analyse how this prevention programme was shaped in practice, we observed how the practice nurses provided the patient - tailored health education and performed the structural cvd risk profile assessments and how these facilitated the patients in achieving lifestyle modifications. by means of participant observations [6, 29 ], we observed four out of seven practice nurses assigned to the project in their daily work, each for five workdays each, from april 2003 till december 2004. one practice nurse refused cooperation ; one practice nurse was on maternity leave and one was not yet in function. during the observations no notes were made, because note taking was felt to intrude on the interactions between the practice nurses and their patients and colleagues. during these observations a total of 63 patient consultations were attended. because of the recurrent nature of the programme s follow - up, the observations also contain succeeding follow - up consultations of patients. fieldnotes were made immediately after leaving the health care centres. throughout each observation it was possible to ask questions or to request clarification. in addition, a total of five interviews were held with the practice nurses : two non - audio - taped semi - structured face - to - face interviews due to objections to audio - taping and three audio - taped semi - structured face - to - face interviews. the interviews were held at the health care centres and lasted approximately one and a halve hour. in all interviews, the practice nurses were asked about their experiences with the quattro programme, their dealings with patients in the programme and their activities in the primary health care centres. the patients in the observed consultations were invited to take part in the quattro programme, as they were all at high risk for developing cvd and not yet properly managed for hypertension, hypercholesterolemia and/or diabetes mellitus type ii. all patients were registered at the health care centres and were living in the deprived neighbourhoods the health care centres provided their services to. during the patients consultations observations were made about how both the practice nurses and patients participated in this health promotion programme. whenever possible, informal conversations with the patients took place about the possibility and difficulties incorporating the recommended lifestyle adjustments into their lives. with three patients audio - taped semi - structured face - to - face interviews were held to go more in - depth into their motives for participating in prevention programmes and the difficulties participation may portray. the interviews were transcribed immediately after the interviews. in this study the process of analysis took place in a cyclic manner. emerging insights and themes were jotted down, and were taken into account during succeeding observations, interviews and final analysis. during the final analysis, all transcripts, written records, and personal jot notes were analysed more in - depth. we analysed all information thematically, establishing overarching categories through identifying and coding all pieces of information. by means of developing overarching categories (taxonomy) overall descriptions of the information we start our analysis of the role of screening methods and risk profile assessments by looking at the selection of people eligible for prevention interventions. screening methods and risk profile assessments are not neutral. what we saw in our ethnographic study was interaction between the inclusion criteria as example of such instruments and selected individuals. the selected individuals were seen to have an active role in the selection and enrolment of the intervention and therewith they related to the inclusion criteria. the inclusion criteria were part of the individuals legitimisation to enrol or to reject their participation. enrolment or rejection of participation thus was more than just the projection of the individuals opinion on the outcomes of the inclusion criteria ; enrolment or rejection of participation was the resultant of the individuals opinion that was formed in interaction with the inclusion criteria. for the selection of people eligible for the quattro intervention, the inclusion criteria were important as they explicated the risk to cvd people had and indicated the danger of having a cvd event in future. the inclusion criteria enrolled only those individuals who were identified with the risk to cvd. what we saw was that people actively negotiated the identity of patienthood the inclusion criteria ascribed them.what does a 15% risk for cvd matter when i am feeling well. [] the patients with diabetes [] they clearly have diabetes ; a high sugar level, that is more concrete to deal with (interview practice nurse 27 - 01 - 2006)in fact, the inclusion criteria legitimatised the decision to enrol into the prevention programmes or not. the inclusion criteria thus created effects, as people enrolled into the intervention, and at the same time they reduced the group of eligible people thereby decreasing the ultimate effect. in the quattro programme people enrolled as they thought that their gp had registered them for the study ; that they were screened by their gp. they found it was important to take part, as they thought they had a high risk the fact that these people had become selected for the quattro programme suggested that their enrolment was important as they were at risk. the individuals who enrolled, identified themselves with the danger to their health these inclusion criteria portrayed, as well as identified themselves with the classification of patienthood the inclusion criteria ascribed them. what does a 15% risk for cvd matter when i am feeling well. [] the patients with diabetes [] they clearly have diabetes ; a high sugar level, that is more concrete to deal with (interview practice nurse 27 - 01 - 2006) on the other hand, the inclusion criteria also obstructed individuals to take part in the intervention. in fact, the individuals who felt they were defined as people they felt they were not declined their enrolment. for example, one of the people selected to take part in the trial refused to participate in the trial, because he refused being defined as ill. the man, in his mid thirties and hardly home from work at four oclock p.m., explained, while sitting on his couch smoking his hand - rolled tobacco, he had taken blood pressure lowering medication in a very stressful period of his life in which he had to deal with losing his job that caused the rise of his blood pressure levels. but now i do nt take these pills anymore, because that stressful period is over. others refused to participate in the programme, as a nurse explained, because they fiercely objected to the fact they were assumed to live in deprived neighbourhoods. (observation data manager 28 - 02 - 2006).the south of rotterdam indeed has some bad neighbourhoods, but would you define this neighbourhood in which the houses sell for up to 400.000 euros a deprived neighbourhood ? that s why i do nt agree seeing the south of rotterdam as a deprived neighbourhood (interview patient 14 - 03 - 2006)the enrolment of eligible individuals into interventions can thus be understood as the result of individuals actively accepting or rejecting the definition of patienthood and/or as living in deprived neighbourhoods that these inclusion criteria ascribe to them. the use of inclusion criteria as a method for selecting and enrolling individuals in prevention programmes legitimises the decision to enrol into prevention programmes. on the one hand, the inclusion criteria create effects, as they objectify the individual risk to health individuals have by explicating the conditions that make up that risk, like their genetic make - up and/or physical condition and the neighbourhoods with its related lifestyles people live in. yet, the inclusion criteria reduce the group of eligible people and thus decrease the possible effect of the intervention. the inclusion criteria do not select and enrol all individual who are considered eligible based upon the health risks they have, they only select those individuals at risk that identify with the construction made and are open to adapting their lifestyles to the requirements of the prevention programmes. people thus demonstrate their agency and voice, as they actively decide whether to enrol into prevention programmes or not. and the south of rotterdam indeed has some bad neighbourhoods, but would you define this neighbourhood in which the houses sell for up to 400.000 euros a deprived neighbourhood ? that s why i do nt agree seeing the south of rotterdam as a deprived neighbourhood (interview patient 14 - 03 - 2006) in the course of prevention programmes, the same movement of creating effects and at the same time decreasing possible effects can be seen for structural risk profile assessments. the structural risk profile assessment did not determine how the patients participated and adapted their lifestyle behaviours or not. also during the course of the prevention intervention patients were seen to have an active role and therewith they related to the structural risk profile assessments. in fact, the structural risk profile assessments were part of the legitimisation to adapt treatment to the personal circumstances of patients or for patients to adopt the recommended lifestyle behaviours or not. actual treatment and behavioural change was the resultant of the opinion that were formed in interaction with the inclusion criteria. in the quattro study, the three - monthly structural cvd risk profile assessments (re)established the anticipated chance of having a cvd event in future. through measuring a patient s weight, length and blood pressure and issuing blood tests on cholesterol and glucose levels, the risk for cvd is defined as the conglomerate of various characteristics of the individual s biology and lifestyle that are to be considered traits or advantages to health. as a practice nursed explained : risk factors become more and more important. [] when a patient has a blood pressure over 160 mmhg, you not only look at the height of his blood pressure, you also have to look at other risk factors, like e.g. age, weight, length, smoking and cholesterol. [first you have to gather all the data before you can calculate the absolute risk profile of patients (observation researcher 09 - 03 - 2004)the cvd risk profile also defines which parts of the risk for cvd are changeable through lifestyle modifications and which are not. for example : a patient s age and gender [] are not modifiable ; they are fixed variables in the risk for cvd (interview researcher 26 - 01 - 2006). whereas the individual s biology is genetically determined, the other variables in the risk for cvd a person s weight, blood pressure, cholesterol and glucose levels are modifiable through diet, physical exercise and smoking cessation. lifestyle, however, does not let itself modify that easy as it involves the continuous abandonment of habits and lifestyle patterns that have been there for long. in other words, with the structural risk profile assessments explicating the unique constellation of a patient s risk for cvd, these assessments drive an individualised management of risk. the personal problems participants have to deal with on a daily basis determine the extent of the improvements in their health. as a practice nurse illuminated : the practice nurse is the person for that inventory. [] a gp does nt see the real problems patients deal with ; he only sees e.g. a high blood pressure and not the patients daily personal problems. to be able to supervise these patients, a practice nurse needs to understand these problems patients deal with (observation intervention progress meeting 20 - 04 - 2004)the structural assessment of participants risk profiles created effects as they visualised the risk behaviours that made up participants risk profiles. and at the same time, as the structural risk profile assessments measured the effect of the individualised management of risk on the reduction of the cvd risk in participants, they reduced the possible impact of the intervention as they allowed for the adaptation of the treatment plans depending upon the outcomes of the measurements. although this was not intended in the original design of the intervention, the risk profile assessments allowed the practice nurses to create a hierarchy in risk factors in individual participants, as they believed not all risk factors could be tackled all at once. in fact, the risk profile assessments made it possible to change those risk behaviours that made up participants risk profile in which reductions in cvd risk could be achieved with minimal efforts. in other words, the practice nurses negotiated the original purpose of the risk profile assessments as this was not workable in daily practice. risk factors become more and more important. [] when a patient has a blood pressure over 160 mmhg, you not only look at the height of his blood pressure, you also have to look at other risk factors, like e.g. age, weight, length, smoking and cholesterol. [] registering is here of utmost importance. first you have to gather all the data before you can calculate the absolute risk profile of patients (observation researcher 09 - 03 - 2004) the practice nurse is the person for that inventory. [] a gp does nt see the real problems patients deal with ; he only sees e.g. a high blood pressure and not the patients daily personal problems. to be able to supervise these patients, a practice nurse needs to understand these problems patients deal with (observation intervention progress meeting 20 - 04 - 2004) what we saw in participants was that, as these assessments visualised the progress participants were able to make in reducing their cvd risk and improving their health status, they functioned as a motivator for achieving the recommended lifestyle changes. in other words, these assessments created effects as they monitored the effects of the patients lifestyle choices. for example : the practice nurse puts on the cuff and starts taking the patient s blood pressure. when she is finished, she takes off the cuff and writes the results on a piece of paper. the practice nurse nods her head and says it looks fine (observation patient consultation 04 - 11 - 2004)and as a patient tells one of the practice nurses about loosing weight:indeed, you have lost almost three kilos in two weeks time. how do you keep up? the female patient tells she does follow a diet since two weeks now [] good, and your kids? they get their own food. the female patient twinkles when she is telling the practice nurse. my clothes do fit much better already. and she lifts up her dress by the shoulder seams [] (observation patient consultation 14 - 07 - 2004)yet, we also saw that these structural risk profile assessments reduced the groups of patients adopting new lifestyle behaviours and thereby decreasing the ultimate effect of the intervention. in fact, the patients negotiated the lifestyle modifications that the structural risk profile assessments envisaged in order to reduce the risk of cardiovascular diseases. as the structural risk profile assessments visualised their cvd risk profile as a conglomerate of risk factors, these assessments enabled them to make choices in the behavioural changes they were recommended to make and in what order. for example as illustrated in a fragment : i regularly walk the dog now and take my medication when i m supposed to, but i still eat my usual mash. so, the risk profile assessments as they objectify the risk to cvd have effects and construct the behaviour of patients. these assessments thus prove to be a constructive force. on the one hand, they motivate patients to continuously achieve improvements in their health. on the other hand, they decrease the ultimate effect of prevention interventions as these assessments give patients agency and voice, as they are facilitated to actively decide upon the lifestyle changes they want to incorporate into their lives. the practice nurse puts on the cuff and starts taking the patient s blood pressure. when she is finished, she takes off the cuff and writes the results on a piece of paper. the practice nurse nods her head and says it looks fine (observation patient consultation 04 - 11 - 2004) indeed, you have lost almost three kilos in two weeks time. how do you keep up? the female patient tells she does follow a diet since two weeks now [] good, and your kids? they get their own food. the female patient twinkles when she is telling the practice nurse. my clothes do fit much better already. and she lifts up her dress by the shoulder seams [] (observation patient consultation 14 - 07 - 2004) we start our analysis of the role of screening methods and risk profile assessments by looking at the selection of people eligible for prevention interventions. screening methods and risk profile assessments are not neutral. what we saw in our ethnographic study was interaction between the inclusion criteria as example of such instruments and selected individuals. the selected individuals were seen to have an active role in the selection and enrolment of the intervention and therewith they related to the inclusion criteria. the inclusion criteria were part of the individuals legitimisation to enrol or to reject their participation. enrolment or rejection of participation thus was more than just the projection of the individuals opinion on the outcomes of the inclusion criteria ; enrolment or rejection of participation was the resultant of the individuals opinion that was formed in interaction with the inclusion criteria. for the selection of people eligible for the quattro intervention, the inclusion criteria were important as they explicated the risk to cvd people had and indicated the danger of having a cvd event in future. the inclusion criteria enrolled only those individuals who were identified with the risk to cvd. what we saw was that people actively negotiated the identity of patienthood the inclusion criteria ascribed them.what does a 15% risk for cvd matter when i am feeling well. [] the patients with diabetes [] they clearly have diabetes ; a high sugar level, that is more concrete to deal with (interview practice nurse 27 - 01 - 2006)in fact, the inclusion criteria legitimatised the decision to enrol into the prevention programmes or not. the inclusion criteria thus created effects, as people enrolled into the intervention, and at the same time they reduced the group of eligible people thereby decreasing the ultimate effect. in the quattro programme people enrolled as they thought that their gp had registered them for the study ; that they were screened by their gp. they found it was important to take part, as they thought they had a high risk the fact that these people had become selected for the quattro programme suggested that their enrolment was important as they were at risk. the individuals who enrolled, identified themselves with the danger to their health these inclusion criteria portrayed, as well as identified themselves with the classification of patienthood the inclusion criteria ascribed them. what does a 15% risk for cvd matter when i am feeling well. [] the patients with diabetes [] they clearly have diabetes ; a high sugar level, that is more concrete to deal with (interview practice nurse 27 - 01 - 2006) on the other hand, the inclusion criteria also obstructed individuals to take part in the intervention. in fact, the individuals who felt they were defined as people they felt they were not declined their enrolment. for example, one of the people selected to take part in the trial refused to participate in the trial, because he refused being defined as ill. the man, in his mid thirties and hardly home from work at four oclock p.m., explained, while sitting on his couch smoking his hand - rolled tobacco, he had taken blood pressure lowering medication in a very stressful period of his life in which he had to deal with losing his job that caused the rise of his blood pressure levels. but now i do nt take these pills anymore, because that stressful period is over. others refused to participate in the programme, as a nurse explained, because they fiercely objected to the fact they were assumed to live in deprived neighbourhoods. (observation data manager 28 - 02 - 2006).the south of rotterdam indeed has some bad neighbourhoods, but would you define this neighbourhood in which the houses sell for up to 400.000 euros a deprived neighbourhood ? that s why i do nt agree seeing the south of rotterdam as a deprived neighbourhood (interview patient 14 - 03 - 2006)the enrolment of eligible individuals into interventions can thus be understood as the result of individuals actively accepting or rejecting the definition of patienthood and/or as living in deprived neighbourhoods that these inclusion criteria ascribe to them. the use of inclusion criteria as a method for selecting and enrolling individuals in prevention programmes legitimises the decision to enrol into prevention programmes. on the one hand, the inclusion criteria create effects, as they objectify the individual risk to health individuals have by explicating the conditions that make up that risk, like their genetic make - up and/or physical condition and the neighbourhoods with its related lifestyles people live in. yet, the inclusion criteria reduce the group of eligible people and thus decrease the possible effect of the intervention. the inclusion criteria do not select and enrol all individual who are considered eligible based upon the health risks they have, they only select those individuals at risk that identify with the construction made and are open to adapting their lifestyles to the requirements of the prevention programmes. people thus demonstrate their agency and voice, as they actively decide whether to enrol into prevention programmes or not. and the south of rotterdam indeed has some bad neighbourhoods, but would you define this neighbourhood in which the houses sell for up to 400.000 euros a deprived neighbourhood ? that s why i do nt agree seeing the south of rotterdam as a deprived neighbourhood (interview patient 14 - 03 - 2006) in the course of prevention programmes, the same movement of creating effects and at the same time decreasing possible effects can be seen for structural risk profile assessments. the structural risk profile assessment did not determine how the patients participated and adapted their lifestyle behaviours or not. also during the course of the prevention intervention patients were seen to have an active role and therewith they related to the structural risk profile assessments. in fact, the structural risk profile assessments were part of the legitimisation to adapt treatment to the personal circumstances of patients or for patients to adopt the recommended lifestyle behaviours or not. actual treatment and behavioural change was the resultant of the opinion that were formed in interaction with the inclusion criteria. in the quattro study, the three - monthly structural cvd risk profile assessments (re)established the anticipated chance of having a cvd event in future. through measuring a patient s weight, length and blood pressure and issuing blood tests on cholesterol and glucose levels, the risk for cvd is defined as the conglomerate of various characteristics of the individual s biology and lifestyle that are to be considered traits or advantages to health. as a practice nursed explained : risk factors become more and more important. [] when a patient has a blood pressure over 160 mmhg, you not only look at the height of his blood pressure, you also have to look at other risk factors, like e.g. age, weight, length, smoking and cholesterol. [] registering is here of utmost importance. first you have to gather all the data before you can calculate the absolute risk profile of patients (observation researcher 09 - 03 - 2004)the cvd risk profile also defines which parts of the risk for cvd are changeable through lifestyle modifications and which are not. for example : a patient s age and gender [] are not modifiable ; they are fixed variables in the risk for cvd (interview researcher 26 - 01 - 2006). whereas the individual s biology is genetically determined, the other variables in the risk for cvd a person s weight, blood pressure, cholesterol and glucose levels are modifiable through diet, physical exercise and smoking cessation. lifestyle, however, does not let itself modify that easy as it involves the continuous abandonment of habits and lifestyle patterns that have been there for long. in other words, with the structural risk profile assessments explicating the unique constellation of a patient s risk for cvd, these assessments drive an individualised management of risk. the personal problems participants have to deal with on a daily basis determine the extent of the improvements in their health. as a practice nurse illuminated : the practice nurse is the person for that inventory. [] a gp does nt see the real problems patients deal with ; he only sees e.g. a high blood pressure and not the patients daily personal problems. to be able to supervise these patients, a practice nurse needs to understand these problems patients deal with (observation intervention progress meeting 20 - 04 - 2004)the structural assessment of participants risk profiles created effects as they visualised the risk behaviours that made up participants risk profiles. and at the same time, as the structural risk profile assessments measured the effect of the individualised management of risk on the reduction of the cvd risk in participants, they reduced the possible impact of the intervention as they allowed for the adaptation of the treatment plans depending upon the outcomes of the measurements. although this was not intended in the original design of the intervention, the risk profile assessments allowed the practice nurses to create a hierarchy in risk factors in individual participants, as they believed not all risk factors could be tackled all at once. in fact, the risk profile assessments made it possible to change those risk behaviours that made up participants risk profile in which reductions in cvd risk could be achieved with minimal efforts. in other words, the practice nurses negotiated the original purpose of the risk profile assessments as this was not workable in daily practice. risk factors become more and more important. [] when a patient has a blood pressure over 160 mmhg, you not only look at the height of his blood pressure, you also have to look at other risk factors, like e.g. age, weight, length, smoking and cholesterol. first you have to gather all the data before you can calculate the absolute risk profile of patients (observation researcher 09 - 03 - 2004) the practice nurse is the person for that inventory. [] a gp does nt see the real problems patients deal with ; he only sees e.g. a high blood pressure and not the patients daily personal problems. to be able to supervise these patients, a practice nurse needs to understand these problems patients deal with (observation intervention progress meeting 20 - 04 - 2004) what we saw in participants was that, as these assessments visualised the progress participants were able to make in reducing their cvd risk and improving their health status, they functioned as a motivator for achieving the recommended lifestyle changes. in other words, these assessments created effects as they monitored the effects of the patients lifestyle choices. for example : the practice nurse puts on the cuff and starts taking the patient s blood pressure. when she is finished, she takes off the cuff and writes the results on a piece of paper. the practice nurse nods her head and says it looks fine (observation patient consultation 04 - 11 - 2004)and as a patient tells one of the practice nurses about loosing weight:indeed, you have lost almost three kilos in two weeks time. how do you keep up? the female patient tells she does follow a diet since two weeks now [] good, and your kids? they get their own food. the female patient twinkles when she is telling the practice nurse. my clothes do fit much better already. and she lifts up her dress by the shoulder seams [] (observation patient consultation 14 - 07 - 2004)yet, we also saw that these structural risk profile assessments reduced the groups of patients adopting new lifestyle behaviours and thereby decreasing the ultimate effect of the intervention. in fact, the patients negotiated the lifestyle modifications that the structural risk profile assessments envisaged in order to reduce the risk of cardiovascular diseases. as the structural risk profile assessments visualised their cvd risk profile as a conglomerate of risk factors, these assessments enabled them to make choices in the behavioural changes they were recommended to make and in what order. i regularly walk the dog now and take my medication when i m supposed to, but i still eat my usual mash. so, the risk profile assessments as they objectify the risk to cvd have effects and construct the behaviour of patients. these assessments thus prove to be a constructive force. on the one hand, they motivate patients to continuously achieve improvements in their health. on the other hand, they decrease the ultimate effect of prevention interventions as these assessments give patients agency and voice, as they are facilitated to actively decide upon the lifestyle changes they want to incorporate into their lives. the practice nurse puts on the cuff and starts taking the patient s blood pressure. when she is finished, she takes off the cuff and writes the results on a piece of paper. the practice nurse nods her head and says it looks fine (observation patient consultation 04 - 11 - 2004) indeed, you have lost almost three kilos in two weeks time. how do you keep up? the female patient tells she does follow a diet since two weeks now [] good, and your kids? they get their own food. the female patient twinkles when she is telling the practice nurse. my clothes do fit much better already. and she lifts up her dress by the shoulder seams [] (observation patient consultation 14 - 07 - 2004) in this paper, we analysed the role screening methods and risk profile assessments fulfil as part of a prevention and health promotion programme in the selection, enrolment and participation of participants. our analysis showed, that screening methods and risk profile assessments create effects as they objectify health risks and/or the health status of individuals, i.e., they select the individuals at risk and indicate the lifestyle modifications these people are required to make in order to improve their health. yet, these instruments also reduce the group of participants thereby decreasing the possible effect of interventions, as they provide the legitimisation for people to make choices to whether they enrol or not and what lifestyle changes they incorporate into their lives. the outcomes of the risk profile assessments function as a tool for participants for making these choices. the assessment of participants risk profiles present the risk to health as a collection of smaller parts, from which participants are enabled to choose the changes to their lifestyles. in other words, these instruments present a space of interaction, in which agency is distributed across the practice nurses, the participants and the risk profile assessments. decisions were not just made upon the projection of the outcomes of these instruments ; decisions that were made by both the patients and practice nurses were the resultant of their opinions on these outcomes that were formed in interaction with the instruments. firstly, prevention and health promotion programmes have a more limited outreach than is assumed when interventions are developed. in addition to howson, who argued that screening methods and risk profile assessment are instruments of inclusion and exclusion, screening methods and risk profile assessments only include those people that identify with the construction of patienthood that is made. those people who do not identify with the construction secondly, the effects of screening methods and risk profile assessments generated in prevention and health promotion programmes should be considered as effects of such interventions. the use of scientific knowledge and method feeds the notion that improvement in health can be rationalised and numerically established and is the only objective proof of the interventions effectiveness, as the effectiveness is evaluated through comparing the new interventions and/or treatments versus regular care. subsequently, this leaves no room for other effects i.e., the positive effects of risk profile assessments on health improvement in prevention interventions [8, 9]that are found in interventions, as they simply do not count as genuine effects. these effects are considered merely part of regular care of which the effectiveness is not evaluated. result of such a narrow focus on effectiveness is that the aforementioned effects thus remain invisible, as they are considered outside of the scope of the evaluations. we therefore argue, in concordance with horstman and houtepen, that in order to establish the effectiveness of interventions pragmatic forms of evaluation should be applied. pragmatic evaluations provide the opportunity to broaden up the scope of effectiveness in evaluations in which all effects of interventions can be incorporated and can be classified as effects of the interventions. pragmatic evaluations allow for the incorporating of multiple evaluation methods [25, 32 ] that allow for the incorporation of the ongoing dynamics in interventions when performed in practice, as interventions will always be localised and contextualised in practice [16, 32 ]. the way in which screening methods and risk profile assessments construct behaviour thus can than also be evaluated as genuine effects of prevention and health promotion interventions. in conclusion, it is our contention that there should be more attention and appreciation for the role screening methods and risk profile assessments fulfil in generating health effects. therefore, a broader notion of effectiveness should be obtained in prevention and health promotion. moreover, screening methods and risk profile assessments fulfil an important role in the empowerment of patients, as these instruments legitimise decisions on enrolment, participation and behavioural change and facilitate them to make autonomous decisions about their care. | in prevention and health promotion interventions, screening methods and risk profile assessments are often used as tools for establishing the interventions effectiveness, for the selection and determination of the health status of participants. the role these instruments fulfil in the creation of effectiveness and the effects these instruments have themselves remain unexplored. in this paper, we have analysed the role screening methods and risk profile assessments fulfil as part of prevention and health promotion programmes in the selection, enrolment and participation of participants. our analysis showed, that screening methods and health risk assessments create effects as they objectify health risks and/or the health status of individuals, i.e., they select the individuals at risk and indicate the lifestyle modifications these people are required to make in order to improve their health. yet, these instruments also reduce the group of participants thereby decreasing the possible effect of interventions, as they provide the legitimisation for people to make choices to whether they enrol or not and what lifestyle changes they incorporate into their lives. in other words, they present a space of interaction, in which agency is distributed across the practice nurses, the participants and the instruments. decisions were not just made upon the projection of the outcomes of these instruments ; decisions that were made by both the patients and practice nurses were the resultant of their opinions on these outcomes that were formed in interaction with the instruments. |
the prevalence of obesity has tripled in the united states over the past three decades. as a result, the burden of obesity - related morbidity has increased dramatically, generating an urgent need to understand the mechanisms that promote metabolic disease. substantial evidence supports the contribution of obesity - induced inflammation (metainflammation) to diseases such as diabetes and cardiovascular disease via the pro - inflammatory activation of leukocytes in mice [24 ] and humans [57 ]. in humans and animal models, obesity is associated with a pro - inflammatory activation profile of macrophages in a wide variety of tissues that include the liver, adipose tissue, skeletal muscle, pancreatic islets, and the hypothalamus. a major site of leukocyte activation is visceral adipose tissue where a pro - inflammatory population of cd11c adipose tissue macrophages (atms) accumulates with progressive obesity [810 ]. cd11c atms secrete pro - inflammatory cytokines and promote an m1-like activation profile in adipose tissue that contributes to adipocyte dysfunction and insulin resistance. activated macrophages have also been implicated in metabolic dysfunction in the liver, pancreas, and central nervous system. numerous studies in mice have shown that suppression of this macrophage activation can uncouple obesity from metabolic disease and the development of insulin resistance [1618 ]. the processes that govern the accumulation of pro - inflammatory macrophages in diverse tissues in response to obesity are not fully understood. obesity - induced atm accumulation is dependent on the trafficking of monocytes to adipose tissue where they are differentiate into macrophages and surround dead and dying adipocytes [1923 ]. consistent with this, obesity triggers an expansion of the pool of circulating classical blood monocytes (ccr2 ly6c) in mice. similar observations are seen in obese humans as an increase in the frequency of circulating neutrophils and cd14 cd16 monocytes is seen in obese insulin resistant patients and is suppressed with weight loss. these observations suggest that myeloid cell production and activation may be an important regulated step in generating metainflammation and a biomarker of obesity - induced inflammation. while atherosclerosis prone mice have been shown to harbor a reservoir of ly6c monocytes within the spleen, the primary site of monocyte production is the bone marrow (bm) compartment where they are generated from hematopoietic stem cells (hscs). hscs are active participants in peripheral inflammatory responses and can alter their cellular output depending on environmental cues. in sepsis, lipopolysaccharide (lps) can push hscs to increase production of myeloid cells by direct and indirect action on hscs in order to potentiate peripheral immune responses. consistent with this, clinical studies have identified an increase in circulating hematopoietic progenitors in obese patients suggesting that obesogenic cues can trigger the activation of hscs. diabetes associated hyperglycemia has been identified as one potential signal that increases myeloid cell production from the bm. many studies have supported a role for myd88 and tlr signaling in the development of obesity - associated metainflammation. activation of these pathways within adipose tissue have been implicated in potentiating hsc activation toward myelopoiesis. these pathways have also been implicated in the activation of myelopoiesis in other inflammatory settings. it remains unclear how tlr / myd88 on hematopoietic stem cells may contribute to high fat diet - induced inflammation. based on these observations, we examined the hypothesis that myeloid cell production by hscs is potentiated by high fat diet induced obesity and plays a crucial role in the generation of pro - inflammatory tissue macrophages. using mouse models of obesity, we found that obesity induces qualitative and quantitative changes in myeloid bm progenitors that amplify the generation of cd11c atms. serial transplantation experiments demonstrate that long term self - renewing hscs (lt - hsc) retain this property in a cell autonomous fashion. competitive reconstitution experiments demonstrate that the capacity of hscs to activate myelopoiesis is dependent on myd88 for the generation of cd11c atms in visceral adipose depots. mice used in these experiments were male c57bl/6j, cd45.1 cd57 bl/6j mice (b6.sjl-ptprca pepcb / boyj), tlr4 and myd88 (jackson laboratories). mice were fed ad lib either a control normal diet (nd) consisting of 4.5% fat (5001 ; labdiet) or a high fat diet (hfd) of 60% of calories from fat (research diets, inc., d12492) starting at 68 weeks of age for 16 weeks unless specified. in all experiments animals were age matched by purchase or less then one week apart in date of birth. animals were housed in a specific pathogen - free facility with a 12 h light/12 h dark cycle and given free access to food and water. all animal use was in compliance with the institute of laboratory animal research guide for the care and use of laboratory animals and approved by the university committee on use and care of animals at the university of michigan (animal welfare assurance number a3114 - 01). peritoneal macrophages were elicited by 2 ml of 3% thioglycollate injection as previously described. after rbc lysis, cells were plated at 1.5 10 cells / ml prior to differentiation into bm derived macrophages (bmmp, 20% l929 conditioned media) or bm derived dendritic cells (bmdc, gm - csf) for 6 days as previously described. differentiation was confirmed by demonstrating cd11c and mhcii expression in bmdc by flow cytometry. cells were then placed in 10% serum media for 24 h prior to treatment with lps (10100 ng / ml) for 1824 h. cells were sorted by fluorescent activated cell sorting in the university of michigan core facility for cd11c live bmdc or bmmp. rt reactions were performed and real - time pcr analysis was performed normalized to gapdh (sybr green, abi prism 7200 sequence detection system ; applied biosystems). relative expression was assessed by the comparative ct method correcting for amplification efficiency of the primers and performed in duplicate as previously described. rna was amplified and rna prepared as previously described before hybridization to mouse affymetrix 430 2.0 gene strip array. after quality control assessments probe sets with unadjusted p - value of 0.05 or less were identified. genes with significant differences from lean and obese cells were analyzed using david and conceptgen. analysis was performed through the university of michigan microarray core using affy, limma, and affy plm packages of bioconductor implemented in the r statistical environment. whole adipose tissue was digested in collagenase (1 mg / ml) and svf fraction pelleted. after red blood cell lysis cells were stained with cd64 pe, cd45.1 pecy7, cd45.2 e450, f4/80-apc, cd11b - apc - cy7, and cd11c - pe - cy7 (ebioscience). macrophages were identified as f4/80 cd11b or cd64 cells in the cd45 gate and then differentiated based on cd11c expression as shown in supplementary figure 1. bm from one femur was flushed with pbs, made into single cell suspension with a syringe, and centrifuged. pellet with then treated with rbc lysis solution for 5 min. after re - suspension in pbs and washing cells were stained with lineage markers on apc (cd4, cd5, cd8, cd11b, b220 (cd45r), gr1, ter119, cd41) (ebioscience), cd117 apccy7 (ebioscience), sca 1 pecy7 (ebioscience), cd150 pe (biolegend), endoglin pacific blue (biolegend), cd16/32 percp5.5 (ebioscience) and gating as described by pronk.. initial gating identified lineage (cd4, cd5, cd8, cd11b, b220, gr1, ter119, cd41) negative singlet cells. cells were classified as lin sca kit (lsk) or lin kit (lk). lsk cells were further subdivided between endoglin cd150 multipotent progenitors (mpp) or endoglin cd150 long term hematopoietic stem cells (lt - hsc). lk cells were further subdivided between cd16/32 cd150 granulocyte macrophage progenitors (gmp) or cd16/32 cd150endoglin pre - granulocyte macrophage (pre - gm) cells. in competitive bmts cd45.1 and cd45.2 stains were used for determining donors in the blood and svf. within the bm compartment and hsc staining cd45.2 staining cells were then re - suspended in methocult media and plated at 10,000 cells per plate per protocol (stem cell technology). bm cells were isolated from donor groups and injected retro - orbitally into lethally irradiated (900 rad) 6 week old recipient mice (10 million cells / mouse). lsk bmts were performed with 4000 sorted lsk cells with 0.5 10 whole bm from a cd45 1.2 mouse. competitive bmts were performed with 5 million cells from each donor mouse (cd45.1 and cd45.2) per recipient. animals were treated with antibiotics (polymyxin and neomycin) for 4 weeks post bm transplantation. blood flow analysis was performed to assess reconstitution two weeks after bone marrow transplantation. following two weeks of normal chow diet, glucose tolerance testing was performed as described after 6 h of fasting with intraperitoneal injection of 0.7 statistical analyses were conducted using a 2-sample student 's t - test, with significance set at p - value < 0.05. for competitive bmt experiments the ratio from donor groups was compared to 1 using one - sample t - test. results with multiple groups were first assessed with one - way or two - way anova as appropriate followed by confirmatory analysis. the activation profile of macrophages is the result of a combination of the tissue microenvironment and the potential of myeloid progenitors and monocytes from which they are derived. to examine the hypothesis that obesity modifies the profile of bm derived myeloid cells, bm dendritic cells (bmdc) were generated from c57bl/6 mice fed a normal (nd) or 60% high fat diet (hfd) for 12 weeks. these cells were chosen given the similarities between bmdcs and obesity - associated atms in terms of the induction of cd11c and apc function. after 7 days of ex vivo differentiation in gm - csf, unstimulated bmdcs from hfd mice had significantly higher tnf, il6, and nos2 gene expression compared to bmdc from nd mice (figure 1a). with lps stimulation, bmdcs from obese mice had a higher induction of il6 and nos2 compared to bmdcs from lean mice (figure 1b). similar, gene expression changes were seen in bm derived macrophages from lean and obese mice. flow cytometry analysis showed that bm from obese mice produced more mature mhcii cd11c bmdcs compared to lean mice, suggesting that bm cells from obese mice have a propensity toward a mature dc profile independent of stimulation (figure 1c and d). gene expression microarray analysis of unstimulated bmdcs derived from lean and obese mice identified 520 genes with increased expression in obese bmdcs and 84 genes with decreased expression in obese bmdcs compared to lean bmdcs. pathway analysis identified regulation of cell proliferation and immune system development as gene sets that were most significantly increased in hfd derived bmdcs (supplementary tables 1 and 2, figure 1e). these observations demonstrate that diet induced obesity (dio) promotes a pro - inflammatory profile in bm derived myeloid cells that persists even after removal from the obesogenic environment. to assess whether obesity primes bm - derived myeloid cells for a pro - inflammatory response in vivo, we examined macrophage activation in a competitive mixed chimera model. nd (cd45.1) and hfd (cd45.2) bm was mixed in a 1:1 ratio prior to injected into lethally irradiated lean mice (cd45.1) (figure 2a). after reconstitution, animals were injected ip with pbs or thioglycollate (thio) to induce peritoneal macrophage (pm) accumulation (figure 2b). pms were collected by lavage and cd45 chimerism assessed by flow cytometry to evaluate the differential contribution of bm precursors from nd and hfd mice to pms (figure 2c). pms from control pbs injected mice had a cd45.2/cd45.1 ratio of hfd to nd derived cells significantly less than 1 that was similar to blood leukocyte chimerism (figure 2d). this represents the baseline reconstitution of the myeloid compartment in this experimental paradigm. with thio administration the cd45.2/cd45.1 ratio of pms was significantly increased demonstrating the preferential accumulation of macrophages derived from the hfd bm in the peritoneum with this inflammatory stimulus (figure 2d). this is in contrast to the peritoneal neutrophils (pmns) in the peritoneum where there was no change in the hfd / nd ratio indicating equal contributions of pmns in the thio treatment group. to examine the properties of the pms derived from the different bm progenitors, hfd and nd derived pms cd45.2 pms derived from hfd donors produced more tnf after lps stimulation compared to cd45.1 pms from nd donors (figure 2e). in summary, these observations support the in vitro studies and suggest that bm progenitors from obese mice are primed to generate macrophages with an increased capacity to traffic to inflammatory sites and maintain a proinflammatory profile. flow cytometry was used to quantify stem cell progenitors in the bm in mice fed either a nd chow or long - term hfd (816 weeks). hfd - fed animals had more fat mass, were glucose intolerant, and had increased ly6c blood monocytes and cd11c atms in perigonadal adipose tissue (supplementary figure 2a d). compared to nd controls, hfd increased the number of long term repopulating (lt) hsc (lsk cd150) as well as all myeloid progenitor populations (mpp, gmp, pre - gm) in the bm (figure 3a e). consistent with this result bm from hfd mice generated more granulocyte and macrophage cfu (figure 3f). we did not observe a significant increase in the lt - hscs or gmp populations in the spleen of hfd fed mice (figure 3 g). this demonstrates that hfd promotes the quantitative expansion of hscs and generation of myeloid progenitors in the bm compartment. our previous experiments suggest that hfd leads to sustained changes in the production of myeloid cells from bm precursors. to examine this longitudinally, hfd fed mice (12 weeks) were switched off of hfd chow to nd chow for 8 weeks to induce weight loss. this diet switch led to a significant decrease in body weight to match those of age - matched nd controls (supplementary figure 2e) and a normalization of glycemic control based on glucose tolerance tests (supplementary figure 2f). in the bm, while the number of lt - hscs normalized, the quantity of pre - gms and lin cells remained elevated in the bm despite weight loss and normalization of glucose tolerance (figure 3h). this suggests that while the expansion of lt - hsc by dio may be reversible, an increase in the production of some myeloid progenitors persists after removal of obesogenic stimuli. to examine the effect of short term hfd feeding on bm hscs one week of hfd feeding did not lead to significant differences in body weight (nd 30.35 2.9 g and 1 week hfd 30.04 3.9 g) but a rapid expansion of fat pad weight (nd 0.27 0.11 g vs 1 week 0.70 0.12 g, p < 0.0001). gmp and pre - gm myeloid progenitors in the bm declined after one - week of hfd exposure and then increased by 4 weeks (figure 3i). this suggests that rapid fat expansion with short term hfd exposure triggers a transient depletion of lt - hscs followed by a later increase in the generation of myeloid bm progenitors. to compare the myeloid cell output between hscs from lean and obese mice, bm from nd and hfd mouse donors (cd45.2) consistent with a continued myeloid bias after bmt, colony forming unit (cfu) assays from the chimeras showed that bm from h n mice generated more granulocyte and myeloid colonies (cfu - g / m / gm) compared to mice reconstituted with nd donors n evaluation of atms demonstrated that h n mice had an increased number of cd11c atms in visceral fat compared to n n controls (figure 4c). hfd increase the number of atms in gonadal fat to a similar degree in both donor groups. however, mice receiving hfd donor bm (h h) had a higher percentage of cd11c atms in visceral adipose tissue compared to those receiving bm from nd fed donors (n h). this generated an overall increase in the ratio of cd11c to cd11c atms in h h mice. evaluation of adipose tissue t cells showed an increase in cd8 t cells in fat with obesity, but no differences were seen between donor groups (figure 4d). cd4 t cells in fat were induced with obesity but were decreased in h h compared to n h. analysis of adipose tissue regulatory t cells (treg ; cd4 foxp3) showed a marginally significant decrease in tregs in mice that received hfd bm. hfd challenged mice reconstituted with hfd bm were more insulin resistant than those receiving nd marrow based on elevated fasting insulin levels (figure 4e) and glucose tolerance testing primarily during phase 2 (figure 4f). no differences in glucose tolerance were seen between donor groups in lean nd fed mice. to confirm that the effects were due to differences at the level of hscs, another bmt experiment was performed using equal numbers (4000) of facs sorted donor lsk cells from nd and hfd mice. 4 weeks after bmt, animals reconstituted with hfd lsk cells had more monocytes and more ly6c monocytes in circulation (figure 4 g). after hfd feeding, cfu assays from bm cells demonstrated a significant increase in cfu - g / m / gm in hfd chimeras compared to nd chimeras (figure 4 g). to perform the most stringent test for obesity - induced alterations in lt - hsc function, a serial bmt experiment was performed starting with hfd and nd bm donor cells (figure 5a). after the first transplant, recipient mice were maintained on a nd for 16 weeks prior to a second round of bmt using these mice as donors. no differences in body weight or adipose tissue weight were seen based on donor origin (figure 5b and supplementary figure 3a). after the second transplant, lean mice did not show any significant differences in the quantity of hscs, myeloid progenitors, or atms based on the original donor source (data not shown). compared to mice derived from nd bm (n h), obese mice that originally received hfd bm (h h) had similar numbers of lt - hscs, but had more bm lin and lsk cells as well as an increase in pre - gm and mpp myeloid progenitors (figure 5c). h h mice demonstrated an increase in cd11c bm cells as well as total atms, and cd11c atms in visceral adipose tissue (figure 5d). consistent with this, immunofluorescence imaging of the adipose tissue demonstrated in increase in the number of crown - like structures (cls) that correlate with inflammatory atm accumulation (figure 5e). t - cells (cd3 total and cd4 and cd8 positive sub - sets) were not different in the spleen and adipose tissue amongst all groups. glucose tolerance testing did not demonstrate any significant differences in fasting glucose or glucose tolerance after serial bmt by donor (figure 5 g). as anticipated, obese mice did have higher glucose levels compared to lean mice. lean mice derived from hfd bm (h n) had higher fasting insulin levels (figure 5f). obese mice derived from hfd donors (h h) demonstrated elevated fed insulin levels compared to those derived from a nd donor. gene expression analysis showed that inflammatory gene expression did not differ based on donor source, however adiponectin expression was lower in h h mice compared to n h (supplementary figure 3b). this data show that sustained changes in lt - hscs induced by hfd can potentiate myeloid output, the generation of cd11c atms, and influence adipokine signaling. since tlr / myd88 signals have been implicated in hsc activation in response to microbial infection, we examined the contribution of these pathways to hfd induced myeloid cell production in a long - term competitive reconstitution model. donor bm from myd88 (cd45.2) and wt (cd45.1) mice were mixed in a 1:1 ratio prior to injection into irradiated wt recipients. chimeras were fed a hfd for 16 weeks prior to analysis of the ratio of myd88 (cd45.2) to wt (cd45.1) cells. bm was stained and progenitors were analyzed by gating lineage negative cells for lsk, gmp, and hsc populations as shown in figure 6a. myd88 and wt donors contributed similarly to lt - hscs suggesting that myd88 is not required for the reconstitution or maintenance of lt - hscs. however, compared to wt cells, fewer myd88 cells contributed to either lin progenitors or gmps (cd45.2/cd45.1 ratio < 1) consistent with impairment in myelopoiesis in cells lacking myd88 (figure 6b). the preferential contribution of wt donors relative to myd88 donors (cd45.2/cd45.1 ratio < 1) was observed in blood monocytes and total atms from visceral adipose tissue. stratification of atms based on cd11c expression demonstrated the preferential accumulation of wt cd11c atms over myd88 cd11c atms, without a significant difference in the donor contributions to cd11c resident atms. these results suggest that myd88 regulates the generation activated cd11c atms with obesogenic stimuli at the level of myeloid progenitor production. to examine if tlr4 contributes to the same process, a similar long - term reconstitution model was performed with chimeras generated from donor bm from an equal ratio of tlr4 (cd45.2) and wt (cd45.1) bm fed a hfd for 16 weeks (figure 6c). in contrast to myd88 chimeras, there was a decrease in tlr4 lt - hscs relative to wt demonstrating that tlr4 hscs have a competitive disadvantage in reconstitution compared to wt cells. tlr4 derived cells contributed more to gmps suggesting that tlr4 may inhibit the generation of myeloid precursors in the bm after long - term hfd. overall, our results suggest the myd88 is required for maximal myeloid production in the setting of hfd and while tlr4 is required for lt - hsc expansion it is not required for the increased myeloid cell production. an increase in peripheral leukocytes of the myeloid lineage (monocytes and neutrophils) is a common feature of obesity in children and adults. more importantly, leukocytosis is a biomarker for risk of obesity - associated diseases such as diabetes and atherosclerosis. this study demonstrates that high fat diet induced obesity leads to alterations in the bm pool of hscs that contributes to 1) quantitative expansion of the hsc pool in the bm, 2) increased production of myeloid precursors from hscs, and 3) qualitative changes at the level of bm progenitors that potentiate the generation of pro - inflammatory macrophages. however, the increased capacity for obese hscs to generate activated myeloid cells is sustained and amplified by hfd in mouse bmt models. myd88 in hscs contributes to myelopoiesis with hfd that ultimately impairs the generation of cd11c atms. our results support the growing evidence that hscs are not passive bystanders in inflammatory responses and can alter their output in response to a range of inflammatory and nutritional stimuli. dio has been shown to increase hematopoiesis and lymphopoiesis in mice but progenitors were not examined in this study. hscs from diabetic db / db mice demonstrate markers of inflammatory activation and upregulation of adhesion molecules suggesting that leptin signaling may play a role in hsc regulation. cholesterol metabolism is also critical to the proper maintenance of hsc proliferation and production of myeloid cells from committed progenitors. the atherosclerosis - prone phenotype of apoe deficient mice is directly linked to defective cholesterol efflux in hscs that amplifies myeloid cell production and activation and promotes atherosclerosis. recent studies have found a suppression of b cell lymphopoiesis after hfd, which is consistent with our findings of myeloid activation which could lead to such lymphoid differentiation. our findings that myd88 is critical for atm accumulation and development is consistent with the recent findings that myd88 in mature macrophages and endothelial cells is important for obesity - induced inflammation. given recent studies showing the contribution of committed myeloid progenitors in the spleen to the production of ly6c monocytes in atherogenesis we investigated this and found that with high fat diet induced there was no significant quantitative induction of splenic progenitors. a consistent finding in several of our bm chimera experiments is an increased generation of cd11c atms generated from hscs from obese mouse donors. this matches our in vitro observations of a potentiation of inflammatory capacity of bm derived macrophages from obese mice. this may also relate to alterations in atm proliferation and differentiation into cd11c atms. however, the weight of evidence still supports an important role of monocyte trafficking to adipose tissue as the mechanism of obesity - induced cd11c atm accumulation. overall, our serial bm transplant studies support the concept that obesity can durably reprogram the output of bm progenitors and that this is taking place at the level of long term repopulating (lt) hscs. we hypothesize that obesity - induced epigenetic changes may play a role in generating this phenotype as this has been shown to influence macrophage activation states after chronic and acute inflammatory stimuli. the preferential accumulation of cd11c atms and crown - like structures was not associated with any significant derangements in glucose metabolism in lean or obese conditions in the serial transplant. this may be due to physiologic changes related to the conditioning irradiation known to influence weight gain after bmt. it may also relate to compensatory protective changes in other adipose tissue leukocyte populations such as regulator t cells that we have found to be radio - resistant to standard conditioning regimens. our results have implication for interpretation of bm chimeras in the study of obesity - induced inflammation. most of these have focused primarily on mature macrophage responses and have not taken into account the important role innate immune signals such as tlrs and nlrs play in hsc function and myeloid progenitor from the bm pool. our studies suggest that myd88 in hscs controls the generation of myeloid progenitors in the setting of hfd while tlr4 itself is not required for this process. the competitive advantage wt cells have over myd88ko cells extends outside of the bm compartment and extends toward the generation of cd11c atms. this study suggests that obesity may have life - long effects on inflammatory responses by altering hsc function. this view is supported by epidemiologic data linking rapid early growth to an increase in leukocyte counts that tracks throughout childhood and into adulthood. it is also consistent with the importance of the duration of obesity on diabetes risk and the observation that adults who were obese as children retain an increased risk of insulin resistance. our observations may explain the data that adipose tissue inflammation and fibrosis are not resolved even after returning to normal weight after weight loss. this has implications not only towards effects of childhood obesity, but also toward the impact of obesity on other obesity - associated diseases with an inflammatory component that includes cancer, kidney disease, and liver disease [6365 ]. our studies demonstrate that obesity - induces changes at the level of hscs and early bm myeloid progenitors that expand myeloid cell production and potentiate the production of pro - inflammatory macrophages. myd88 dependent generation of myeloid precursors contributes to the generation of cd11c adipose tissue macrophages. | obesity is associated with an activated macrophage phenotype in multiple tissues that contributes to tissue inflammation and metabolic disease. to evaluate the mechanisms by which obesity potentiates myeloid activation, we evaluated the hypothesis that obesity activates myeloid cell production from bone marrow progenitors to potentiate inflammatory responses in metabolic tissues. high fat diet - induced obesity generated both quantitative increases in myeloid progenitors as well as a potentiation of inflammation in macrophages derived from these progenitors. in vivo, hematopoietic stem cells from obese mice demonstrated the sustained capacity to preferentially generate inflammatory cd11c+ adipose tissue macrophages after serial bone marrow transplantation. we identified that hematopoietic myd88 was important for the accumulation of cd11c+ adipose tissue macrophage accumulation by regulating the generation of myeloid progenitors from hscs. these findings demonstrate that obesity and metabolic signals potentiate leukocyte production and that dietary priming of hematopoietic progenitors contributes to adipose tissue inflammation. |
toxoplasmosis is a zoonotic parasitic disease prevalent all over the world and its causal agent is an intracellular protozoon called toxoplasma gondii. the protozoa was first discovered by nicolle and manceaux (1908) as ctenodactylus gundi and later named as t. gondii (1909) (1). up to one third of the world s population most infections among humans occur by eating undercooked or raw meat containing tissue cysts or by exposure to oocysts through ingestion of contaminated foods and drinks with cat faeces (3). it is also transmitted transplacentally (4). in the vast majority of immunocompetent human host, t. gondii ensue a latent infection characterized by the persistence of the organism primarily in brain, skeletal muscle, and heart tissues without causing clinical symptoms (5). however, in chronically infected individuals with impaired cell - mediated immunity symptomatic disease more likely occurs as a result of reactivation of latent infection (6, 7). in this group of immunodeficient people, toxoplasmosis causes a large range of manifestations such as, fever, lympaphadenitis and fatal encephalitis (8). moreover, toxoplasmosis has a great public health importance in pregnant women as it can lead to transplacental transmission and involvement of the fetus with pathological effects which even results in uterine death (9, 10). when hiv infected pregnant women are exposed to t. gondii its severity will be doubled both in woman and the fetus (9, 10). accordingly screening of pregnant women for t. gondii infection has been practiced in developed nations. however, serological screening of pregnant women for t. gondii antibodies is not part of routine clinical practices in sub saharan countries including ethiopia, in spite of high prevalence of the infection in this country (8, 11 - 16). data on seroprevalence of t. gondii during pregnancy with hiv co - infection is lacking. this study aimed to determine the magnitude of anti- t. gondii antibody reactivity and associated risk factors of toxoplasmosis among hiv positive and hiv negative pregnant women in northwest of ethiopia. this cross sectional study was conducted among consecutive pregnant women attending antenatal clinic (anc) from may 2010 to october 2011 at the gondar university teaching hospital, northwest ethiopia. structured, pre - tested questionnaire was used to collect socio - demographic characteristics and risk factors associated with t. gondii infection. five milliliter (ml) of blood was collected from each pregnant woman and serum was separated. sera were tested in duplicate for anti - toxoplasma antibody using the rapid latex agglutination test kit (biochcek, inc, ca, spain) following manufacturer s instructions. positive and negative control tests were done for each batch of test run to ensure kits are working properly and technical procedures are carried out correctly. the serum was also tested for the presence of hiv-1/2 antibodies using rapid hiv diagnostic kit following manufacturer s instructions. results were interpreted following the current algorithm of ethiopia adopted from who for screening of hiv-1/2 antibodies. briefly, the sera were tested using khb hiv-1/2 (shangai kehua bio - engineering co - ltd, shangai, china), when the sera were non - reactive it was reported as negative. when the serum was reactive, it was tested for the second time using stat pak (chembio hiv1/2, medford, new york, usa). if the serum was reactive for khb hiv-1/2 it was reported as positive. if not a tiebreaker, uni - gold recombigen hiv (trinity biotech plc, bray, ireland), was used as a third and final test to determine the sero - status of the study participants. association between independent variables and sero - positivity was analyzed by bivariate and multivariate logistic regression. the strength of association was calculated using odds ratio at 95% confidence interval (ci). ethical clearance was obtained from university of gondar research and community service core process office. informed written consent was also obtained from each pregnant woman prior to involvement in the study. this cross sectional study was conducted among consecutive pregnant women attending antenatal clinic (anc) from may 2010 to october 2011 at the gondar university teaching hospital, northwest ethiopia. structured, pre - tested questionnaire was used to collect socio - demographic characteristics and risk factors associated with t. gondii infection. five milliliter (ml) of blood was collected from each pregnant woman and serum was separated. sera were tested in duplicate for anti - toxoplasma antibody using the rapid latex agglutination test kit (biochcek, inc, ca, spain) following manufacturer s instructions. positive and negative control tests were done for each batch of test run to ensure kits are working properly and technical procedures are carried out correctly. the serum was also tested for the presence of hiv-1/2 antibodies using rapid hiv diagnostic kit following manufacturer s instructions. results were interpreted following the current algorithm of ethiopia adopted from who for screening of hiv-1/2 antibodies. briefly, the sera were tested using khb hiv-1/2 (shangai kehua bio - engineering co - ltd, shangai, china), when the sera were non - reactive it was reported as negative. when the serum was reactive, it was tested for the second time using stat pak (chembio hiv1/2, medford, new york, usa). if the serum was reactive for khb hiv-1/2 it was reported as positive. if not a tiebreaker, uni - gold recombigen hiv (trinity biotech plc, bray, ireland), was used as a third and final test to determine the sero - status of the study participants. association between independent variables and sero - positivity was analyzed by bivariate and multivariate logistic regression. the strength of association was calculated using odds ratio at 95% confidence interval (ci). ethical clearance was obtained from university of gondar research and community service core process office. informed written consent was also obtained from each pregnant woman prior to involvement in the study. three hundred and eighty five pregnant women who were attending anc of the gondar university teaching hospital were participated in the study. the majority of the study participants (81.6%) were aged between 20 - 30 years. almost all, 383 (99.4%) had no any information about the disease toxoplasmosis and its transmission ways. other sociodemographic characteristics of the study participants are presented in table 1. among the 385 study participants, 43 (11.2%) were hiv positive, of whom 38 (88.4%) were also positive for toxoplasmosis (table 2). of the 385 pregnant women tested, 341(88.6%) were positive for anti - antibodies of anti - t. pregnant women who kept cats in house had 5 times more risk of toxoplasmosis than those did not (p=0.00 ; aor = 5.01 95% ci [1.50 - 14.11 ] (table 2). pregnant women who were in their second or third trimester were almost three times risk of t. gondii infection than those who were on the first trimester (p<0.05 for all) (table 2). however, there was no statistically significant association between seropositivity of t. gondii infection and sero - status of hiv, educational status, age, antiretroviral therapy (art), residence, religion or occupation and others. having an experience of stillbirth also did nt show any statistically significant association with the presence of anti - t. the prevalence of t. gondii infection among pregnant women in this study was high (88.6%) irrespective of hiv infection. the prevalence of t. gondii in this study is inconsistent with previous reports from different countries such as italy (23.6%) (17), sweden (ranged 14% to 25.7%) (18), where sero - prevalence of t. gondii is low. low prevalence of toxoplasma infection during pregnancy was also reported from study conducted in korean and sudanese pregnant women of 0.8% and 34.1%, respectively (19, 20). the 88.6% of sero - positivity of t. gondii among pregnant women were comparable to the previous studies conducted among pregnant women in different parts of ethiopia, nazaret (60%)(21), jimma (83.6%) (14), debrezeit, and ambo (81.4%) (12). these finding shows t. gondii infection is not decreasing among pregnant women, this might be due to less emphasis to this infection and inadequate monitoring and evaluation health system. the low level of awareness about its transmission might also contribute to the high prevalence of t. gondii infection. among the risk factors assessed, keeping cats in house this finding is similar with study conducted in czech republic, where cats in the household to be a significant risk factor (21, 22). this study also revealed that, about 88.6 % of hiv patients were sero - positive for t. gondii infection. however, seroprevalence of toxoplasma ranged 4 - 90% were reported from different studies conducted in europe, latin america and africa (23 - 31). in asia, the seroprevalence of toxoplasmosis varies from 10 - 50% (29 - 32). the present finding with high prevalence of toxoplasma antibodies suggests the need of measuring anti - t. gondii antibodies as a screening test in all hiv / aids patients to reduce the risk of toxoplasma complications including encephalitis is needed in ethiopia. the demonstration that experience of stillbirth showed no significant association with toxoplasmosis among the pregnant women is in agreement with the report of jamshidi makiani. (34) from iran, and these findings substantiated earlier reports that stillbirth is not common in pregnant women who are with toxoplasmosis (33, 34). furthermore, pregnant women who were in their second/ third trimester had almost three times risk of t. gondii infection than those who were on the first trimester. it seems that the difference comes from the level of prenatal cares between the two countries. we guess that attending of the ethiopian pregnant women to antenatal clinics in the first trimester is less than the second and third trimesters, which could be a cause for low frequency of the subjects in the first trimester in our study. furthermore, it is possible that the women attending to the clinics in the first trimester are in higher socioeconomic situation as compared to those attended in the clinic in the 2 and 3 trimesters, thus they are at lower risk of soil and meat transmitted infections. however, further comparative follow - up study is needed to get strong evidence on this issue. keeping cats was the possible risk factors for toxoplasmosis. almost none of the pregnant women know about the disease toxoplasmosis and its transmission ways. therefore, health education should be given for the pregnant women about toxoplasmosis and further researches are recommended to see its transmission dynamics and effect on newborns. | backgroundtoxoplasmosis is a major public health problem among immuno - compromised individuals. this study aimed to determine the seroprevalence and associated risk factors of toxoplasma gondii infection among pregnant women with and out hiv infections.methodsthis cross sectional study was conducted among consecutive 385 pregnant women attended antenatal clinic from may 2010 to october 2011 at the gondar university teaching hospital, northwest ethiopia. venous blood was collected from each pregnant woman for testing hiv-1/2 and anti- toxoplasma antibodies using rapid test kits. data were entered and analyzed using spss version 20 statistical package.resultsthe overall magnitude of t. gondii and hiv was 88.6% (341/385) and 11.2% (43/385), respectively. the seroprevalence of t. gondii was not different among hiv infected and non - infected pregnant women (88.4%, 38/ 43 vs 88.6%, 303/342). keeping cats in house showed statistically significant association with seropositivity of toxoplasmosis (p<0.05).conclusionirrespective of hiv infection, high rate of t. gondii was detected among pregnant women. these high prevalences indicate the need for an intensified public health awareness to reduce both infections. |
chronic obstructive pulmonary disease (copd) is a heterogeneous disorder characterized by chronic inflammation in airway walls and lung tissue, dysfunctional repair and defense mechanisms, excessive mucus production, and changes in the small peripheral airways.1,2 these changes include thickening of small airway walls, loss of elasticity, airway obstruction, and accompanying emphysema.35 a recent study found that loss of functional small airways may precede the development of emphysema in copd and thus the small airways may constitute an appropriate target for treatment.6,7 consensus practice guidelines for copd recommend the use of inhaled corticosteroids (ics) together with inhaled long - acting bronchodilators for patients at high risk of exacerbations, ie, with either forced expiratory volume in 1 second (fev1) 450 primary care practices throughout the uk subscribing to the general practice research database (now in the clinical practice research datalink)17 and approximately 300 practices subscribing to the optimum patient care research database.18 these two large electronic datasets, described in detail elsewhere,1721 are frequently used for observational research. patient characteristics were cross - referenced between the two datasets to avoid duplication of individuals. the two analyses examined patients prescribed their first ics treatment (initiation sample) and those prescribed an increase in ics dose (step - up sample) for copd as either extrafine beclomethasone (qvar ; teva pharmaceuticals, petach tikva, israel) or a commonly prescribed large - particle ics, fluticasone (flixotide ; glaxosmithkline plc, london, uk), by pressurized metered - dose inhaler. we included male and female patients, 40 years old at the time of the index study prescription (index date), who had : 1) a diagnostic code for copd, and 2) two or more prescriptions for copd at different time points during the preceding year (baseline). the baseline year copd prescriptions could be for any combination of the following : short - acting 2-agonist (saba), long - acting 2-agonist (laba), short - acting muscarinic antagonist (sama), long - acting muscarinic antagonist (lama), theophylline, and, for patients in the step - up sample only, including an ics. the diagnostic code for copd could be recorded at any time relative to the index date ics prescription. eligible patients had to be registered at the same general practice for at least 3 consecutive years, including 1 year before (baseline year) and 2 years after the index date (outcome period). in practice copd can be associated with or misdiagnosed as asthma ; therefore, eligible patients could also have had an asthma diagnostic code but only if recorded for the first time after 40 years of age. patients were excluded if they had a coded diagnosis pre-40-years for asthma or at any time for any chronic respiratory disease other than copd (exclusions listed in table s1). in addition, during the matching process (see below), we excluded non - smokers and patients without spirometric evidence of copd (ie, without post - bronchodilator ratio of fev1 to forced vital capacity [fvc ] [fev1/fvc ] 500 g / day). finally, we matched on smoking status ; confirmation of copd ever via post - bronchodilator fev1/fvc ratio 450 primary care practices throughout the uk subscribing to the general practice research database (now in the clinical practice research datalink)17 and approximately 300 practices subscribing to the optimum patient care research database.18 these two large electronic datasets, described in detail elsewhere,1721 are frequently used for observational research. patient characteristics were cross - referenced between the two datasets to avoid duplication of individuals. the two analyses examined patients prescribed their first ics treatment (initiation sample) and those prescribed an increase in ics dose (step - up sample) for copd as either extrafine beclomethasone (qvar ; teva pharmaceuticals, petach tikva, israel) or a commonly prescribed large - particle ics, fluticasone (flixotide ; glaxosmithkline plc, london, uk), by pressurized metered - dose inhaler. we included male and female patients, 40 years old at the time of the index study prescription (index date), who had : 1) a diagnostic code for copd, and 2) two or more prescriptions for copd at different time points during the preceding year (baseline). the baseline year copd prescriptions could be for any combination of the following : short - acting 2-agonist (saba), long - acting 2-agonist (laba), short - acting muscarinic antagonist (sama), long - acting muscarinic antagonist (lama), theophylline, and, for patients in the step - up sample only, including an ics. the diagnostic code for copd could be recorded at any time relative to the index date ics prescription. eligible patients had to be registered at the same general practice for at least 3 consecutive years, including 1 year before (baseline year) and 2 years after the index date (outcome period). in practice copd can be associated with or misdiagnosed as asthma ; therefore, eligible patients could also have had an asthma diagnostic code but only if recorded for the first time after 40 years of age. patients were excluded if they had a coded diagnosis pre-40-years for asthma or at any time for any chronic respiratory disease other than copd (exclusions listed in table s1). in addition, during the matching process (see below), we excluded non - smokers and patients without spirometric evidence of copd (ie, without post - bronchodilator ratio of fev1 to forced vital capacity [fvc ] [fev1/fvc ] 500 g / day). finally, we matched on smoking status ; confirmation of copd ever via post - bronchodilator fev1/fvc ratio < 0.7 ; and age at first asthma diagnosis (< 40 years old or 40 years old / no asthma diagnosis) as a means of subsequently excluding without losing matched groupings all non - smokers, patients without confirmed copd, and patients with asthma diagnosed before age 40. summary statistics were produced for all baseline and outcome variables. for patients with available fev1 values, the global initiative for obstructive lung disease (gold) grade of severity of airflow limitation was determined.22 we compared baseline characteristics and unadjusted outcome variables for matched cohorts using conditional logistic regression, categorizing heavily skewed data. the list of potential confounders considered for the adjusted analyses included those differing between treatment cohorts at baseline (p<0.10) and variables predictive (p<0.05) of each outcome variable in multivariate analyses (table s2). pearson and spearman correlation coefficients were applied, together with clinical interpretation, to eliminate variables presenting collinearity issues in the regression modeling of outcomes. we used a conditional poisson regression model to calculate adjusted relative rates of exacerbations and of oral candidiasis. the adjusted odds of achieving copd treatment success and treatment stability, and of having a treatment change, were compared between cohorts using conditional binary logistic regression models. a cox proportional hazards model, adjusted for baseline confounders, was used to examine the time to first exacerbation and post - study mortality. (patients had to be alive during the full 2 year outcome period to be eligible for the study). to account for multiple comparisons, we controlled for false discovery rate if more than one of the co - primary endpoints were significant. the composite outcome measures and analyses were prespecified according to standard operating procedures of the research group.23 all analyses were carried out using ibm spss statistics version 19 (ibm corporation, armonk, ny, usa), sas version 9.2 (sas institute inc., cary, nc, usa), and microsoft excel 2007 (microsoft corporation, redmond, wa, usa). patient identification in the datasets and subsequent matching of 384 patients in each initiation cohort, and 189 patients in each step - up cohort, are depicted in figures s1 and s2. at baseline, the clinical characteristics of patients in extrafine beclomethasone and fluticasone cohorts were similar (tables 1 and s3). there were several significant differences between cohorts (eg, in index prescription date, cardiac disease diagnosis, and use of some drugs), but these differences were small and not clinically meaningful. most patients were gold grade 2 or 3.22 prescribed index date doses of extrafine beclomethasone were significantly lower than those of fluticasone (median interquartile range [iqr ], 200 [200400 ] versus 500 [5001,000 ] g / d ; p<0.001 ; figure 1). there were no significant differences between cohorts in the unadjusted or adjusted coprimary outcome measures (table 2). exacerbation rates fell during the 2 year outcome period relative to baseline in both cohorts (figure 2 and table 3) ; one third of patients in each cohort experienced copd treatment success (no copd exacerbation during the 2 outcome years). the adjusted odds of treatment stability (no exacerbation or treatment change) were significantly better for extrafine beclomethasone (adjusted odds ratio [or ], 2.50 ; 95% confidence interval [ci ], 1.324.73), mainly driven by significantly lower odds of treatment change in that cohort (table 2). an increase in ics dose by 50% was significantly more frequent in the extrafine beclomethasone cohort, while additional therapy was significantly more frequent in the fluticasone cohort (table 2). the mean daily ics dose exposure during outcome was significantly lower in the extrafine beclomethasone cohort (table 2 and figure 4). a higher percentage of patients in the extrafine beclomethasone cohort had two or more lower respiratory tract infections requiring antibiotic therapy (p=0.020), while hospitalizations for copd and lower respiratory conditions were infrequent in both cohorts (table 2). a total of seven (2.1%) and four (1.2%) patients in extrafine beclomethasone and fluticasone cohorts had a recorded diagnosis of pneumonia (p=0.37) ; we considered the diagnosis confirmed for three (0.9%) patients in each cohort. there was no difference between cohorts in the adjusted odds of developing oral candidiasis, experienced by roughly one in ten patients (table 2). the extrafine beclomethasone and fluticasone cohorts were similar at baseline, with mean age of 67 years and 57% male (tables 1 and s3). a significant difference between cohorts in index date was small and not clinically meaningful (2003.3 versus 2002.7 ; p<0.001). the stepped - up ics dose prescribed at the index date was significantly lower for extrafine beclomethasone than fluticasone (median [iqr ] 400 [400400 ] versus 1,000 [5001,000 ] g / d ; p<0.001 ; figure 1). unadjusted and adjusted results for effectiveness measures were comparable for the two step - up cohorts during the 2 year outcome period (tables 3 and 4). as for the initiation sample, fewer patients in both cohorts experienced 2 exacerbations / year relative to baseline (figure 2). adjusted odds of treatment stability and treatment change were similar in the two cohorts (table 4 and figure 3). mean daily ics dose exposure was significantly lower for extrafine beclomethasone (table 4 and figure 4). the percentages of patients with lower respiratory tract infection requiring antibiotic therapy were similar in the two cohorts (table 4) ; pneumonia was confirmed for two (1.1%) patients in each cohort. baseline patient characteristics were broadly similar for the matched and full unmatched patient cohorts (table s4), and the unmatched results supported those for the matched cohorts (see supplementary material). in post hoc sensitivity analyses, relative ics doses and exacerbation rates among unmatched patients without a treatment change during the outcome period were similar to findings in the main analyses (tables s5 and s6). there was no significant difference between the two treatment cohorts of initiation or step - up samples in all - cause mortality after the outcome period (table s7). at baseline, the clinical characteristics of patients in extrafine beclomethasone and fluticasone cohorts were similar (tables 1 and s3). there were several significant differences between cohorts (eg, in index prescription date, cardiac disease diagnosis, and use of some drugs), but these differences were small and not clinically meaningful. most patients were gold grade 2 or 3.22 prescribed index date doses of extrafine beclomethasone were significantly lower than those of fluticasone (median interquartile range [iqr ], 200 [200400 ] versus 500 [5001,000 ] g / d ; p<0.001 ; figure 1). there were no significant differences between cohorts in the unadjusted or adjusted coprimary outcome measures (table 2). exacerbation rates fell during the 2 year outcome period relative to baseline in both cohorts (figure 2 and table 3) ; one third of patients in each cohort experienced copd treatment success (no copd exacerbation during the 2 outcome years). the adjusted odds of treatment stability (no exacerbation or treatment change) were significantly better for extrafine beclomethasone (adjusted odds ratio [or ], 2.50 ; 95% confidence interval [ci ], 1.324.73), mainly driven by significantly lower odds of treatment change in that cohort (table 2). an increase in ics dose by 50% was significantly more frequent in the extrafine beclomethasone cohort, while additional therapy was significantly more frequent in the fluticasone cohort (table 2). the mean daily ics dose exposure during outcome was significantly lower in the extrafine beclomethasone cohort (table 2 and figure 4). a higher percentage of patients in the extrafine beclomethasone cohort had two or more lower respiratory tract infections requiring antibiotic therapy (p=0.020), while hospitalizations for copd and lower respiratory conditions were infrequent in both cohorts (table 2). a total of seven (2.1%) and four (1.2%) patients in extrafine beclomethasone and fluticasone cohorts had a recorded diagnosis of pneumonia (p=0.37) ; we considered the diagnosis confirmed for three (0.9%) patients in each cohort. there was no difference between cohorts in the adjusted odds of developing oral candidiasis, experienced by roughly one in ten patients (table 2). the extrafine beclomethasone and fluticasone cohorts were similar at baseline, with mean age of 67 years and 57% male (tables 1 and s3). a significant difference between cohorts in index date was small and not clinically meaningful (2003.3 versus 2002.7 ; p<0.001). the stepped - up ics dose prescribed at the index date was significantly lower for extrafine beclomethasone than fluticasone (median [iqr ] 400 [400400 ] versus 1,000 [5001,000 ] g / d ; p<0.001 ; figure 1). unadjusted and adjusted results for effectiveness measures were comparable for the two step - up cohorts during the 2 year outcome period (tables 3 and 4). as for the initiation sample, fewer patients in both cohorts experienced 2 exacerbations / year relative to baseline (figure 2). adjusted odds of treatment stability and treatment change were similar in the two cohorts (table 4 and figure 3). mean daily ics dose exposure was significantly lower for extrafine beclomethasone (table 4 and figure 4). the percentages of patients with lower respiratory tract infection requiring antibiotic therapy were similar in the two cohorts (table 4) ; pneumonia was confirmed for two (1.1%) patients in each cohort. baseline patient characteristics were broadly similar for the matched and full unmatched patient cohorts (table s4), and the unmatched results supported those for the matched cohorts (see supplementary material). in post hoc sensitivity analyses, relative ics doses and exacerbation rates among unmatched patients without a treatment change during the outcome period were similar to findings in the main analyses (tables s5 and s6). there was no significant difference between the two treatment cohorts of initiation or step - up samples in all - cause mortality after the outcome period (table s7). we observed that copd exacerbation rates in both initiation and step - up samples during the 2 year outcome period were comparable between matched cohorts prescribed extrafine beclomethasone or larger - particle fluticasone in this retrospective analysis. for patients initiating ics for copd, those prescribed extrafine beclomethasone had over twice the odds of treatment stability (no copd exacerbation or treatment change) and half the odds of a treatment change. index date prescribed doses of extrafine beclomethasone were significantly lower than doses of fluticasone, and the ics dose exposure during the outcome period was significantly lower for both the initiation and step - up extrafine beclomethasone cohorts. the percentages of patients in each cohort who experienced 2 exacerbations / year fell substantially during the outcome period. relative to the baseline year, 11%13% fewer patients in each initiation cohort, and 9%16% fewer in each step - up cohort, experienced 2 exacerbations / year. this finding suggests that pharmacotherapy was effective, as the experience of frequent copd exacerbations (2/year) is reportedly a relatively stable patient phenotype.24 these findings suggest, moreover, that increasing the dose of ics can improve outcomes for some patients. nonetheless, 25%28% of patients in the extrafine beclomethasone cohorts and 18%31% in fluticasone cohorts experienced 4 exacerbations during the 2 year outcome period. although ics are not recommended in copd other than in fixed - dose combination with laba, several studies have demonstrated some efficacy of ics with regard to clinical outcomes,25 and practice surveys in developed countries indicate that prescribing of ics outside of fixed - dose combinations is not infrequent in usual care.1113 (moreover, fluticasone is licensed in some countries, including the netherlands, for copd). in this study, from 40%49% of patients in initiation cohorts and from 33%35% in step - up cohorts remained on ics monotherapy at the end of the 2 year outcome period, not an ideal situation according to guideline recommendations but a reality of clinical practice and perhaps a reflection of earlier copd treatment guidelines. two studies have compared combination ics / laba products.26,27 in a 12 week double - blind study of 18 patients with lung hyperinflation, the combination of extrafine beclomethasone / formoterol, but not larger - particle - size fluticasone / salmeterol, was effective in reducing air trapping and dyspnea.26 this concurs with our findings that the cohort initiating extrafine - particle ics was less frequently prescribed a treatment change than the cohort initiating larger - particle - size ics. in another study, clinical outcomes for 232 patients prescribed beclomethasone / formoterol were similar to those for 238 patients prescribed larger - particle budesonide / formoterol with regard to copd questionnaires and overall low exacerbation rates, while fvc improved more in those prescribed beclomethasone / formoterol.27 the fvc results observed, and those of the prior study,26 could perhaps be explained by better distribution of extrafine particles to the small peripheral airways, an important site of inflammation in copd.4,15,16 further investigations and mechanistic studies are needed to explore the comparative effects of differing ics particle sizes for treating copd, including prospective pragmatic trials of ics administered concomitantly with long - acting bronchodilators. the identification of surrogate markers of small airway inflammation evaluable in both smokers and ex - smokers would aid this process. recent work suggests that alveolar nitric oxide (no) is not a useful marker for monitoring response to copd therapy.28 our composite exacerbation definition included lower respiratory tract antibiotic therapy (or an oral corticosteroid course or unscheduled hospitalization or ed visit). at least one antibiotic prescription for lower respiratory tract infection was prescribed during the 2 year follow - up for 47% of patients initiating extrafine beclomethasone and 40% initiating fluticasone, a statistically significant difference, which may need further study to assess whether this is a real observation. of note, we found the opposite direction of effect in the step - up cohorts (although the difference was not statistically significant), as 49% and 56% of extrafine beclomethasone and fluticasone patients, respectively, received one or more antibiotic prescriptions. the fact of the results being in opposite directions could potentially be explained by the distribution of outliers during the baseline year, as patients with a higher number of baseline antibiotic prescriptions may be more likely to need antibiotic therapy during the outcome period : namely, in the initiation sample during baseline, 13 patients in the extrafine beclomethasone cohort versus five in the fluticasone cohort received from 48 courses of antibiotics ; and in the step - up sample during baseline, three versus ten, respectively, received from 47 courses of antibiotics. in addition to effectiveness of ics it is important to assess side effects.1 confirmed pneumonia was infrequent and comparable with both ics treatments, recorded for three patients in each initiation cohort and one in each step - up cohort. however, the incidence of pneumonia may have been underestimated in this study, as some cases of pneumonia may have been coded as lower respiratory tract infection and treated in the home setting. moreover, it is possible that some hospitalizations for pneumonia were not captured in the database. for instance, although extrafine beclomethasone is not approved for use in copd, this analysis shows that it is widely prescribed for patients with copd in general practice. the effectiveness and safety information provided in this analysis for patients with copd prescribed extrafine beclomethasone is a novel and valuable addition to the literature. observational research also enables the study of heterogeneous patient populations in real - life clinical care conditions, providing relevant information to complement that from tightly controlled and selective randomized clinical trials.29,30 this matched cohort study included a broad range of patients who were prescribed copd therapy under usual conditions of care in uk general practice. the fact that baseline patient characteristics were broadly similar for matched and unmatched patient groups suggests that studied patients were representative of the general uk copd population. the inclusive patient population enhances external validity of findings and their generalizability to real - life practice. in addition, we followed patients for 2 years, allowing us to describe the course of therapy over this time period. a high percentage of patients in this study, 55% in each treatment cohort, also had a diagnosis of asthma recorded in the database (after the age of 40, per inclusion criteria). this may reflect the fact that a subgroup of patients with asthma develops persistent airway obstruction over time, particularly when they smoke.31 we believe that the copd diagnosis was valid for most patients under study for several reasons : 1) all patients had a recorded post - bronchodilator fev1/fvc ratio of < 0.7 ; 2) all were smokers or ex - smokers ; 3) the mean age was 67 years, and the cohorts included a preponderance of men (60%) ; 4) among those with an fev1 reading at baseline (87% of the full population studied), the mean % predicted fev1 in the four cohorts ranged from 52% to 55% (depending on cohort) ; and from 60% to 69% of patients in each cohort had a % predicted fev1 of < 60% ; 5) moreover, of the patients with an asthma codiagnosis, most also had substantial fev1 impairment (mean fev1 % predicted, 53% ; data not shown) ; 6) finally, the copd diagnosis was recorded at or close to the time of the asthma diagnosis for most patients, and, importantly, the copd diagnosis was confirmed (via fev1/fvc ratio < 0.7) for most patients after the asthma diagnosis was recorded (figure s3). this suggests that the asthma codiagnosis was often an initial misdiagnosis that was later superseded by a diagnosis of copd. all included patients had a database - recorded post - bronchodilator fev1/fvc < 0.7 ; however, we were unable to track lung function during the outcome period because spirometry is not performed routinely in primary care. moreover, not all potential matching criteria were available for all patients at baseline, including the fev1 value (hence gold grade) and scores for the modified medical research council or copd assessment test, which would have enabled patient categorization according to recent gold guidelines.1 nonetheless, patients appeared to be well - matched for physical characteristics and disease severity, and the analyses incorporated adjustments for residual confounding (although we can not rule out unidentified confounding factors). finally, the percentages of patients in each cohort who quit smoking during the outcome period would have been of interest, since the effects of ics can be less in smokers with copd. this study has enabled us to describe the use of ics for patients with copd in uk primary care. we observed that ics are prescribed, both as monotherapy and in combination with long - acting bronchodilators, for treating copd and can result in improved exacerbation rates as in our copd patients with predominantly gold grade 2 and 3 severity of airflow limitation. our observations that small - particle ics at significantly lower doses had the same effects as larger - particle ics at higher doses and that small - particle ics use was associated with greater odds of treatment stability and lower odds of treatment change during the 2 year follow - up could be explained by greater lung deposition, especially to the small airways. future pragmatic trials are needed to prospectively evaluate the effectiveness of ics of differing particle sizes in copd, administered concomitantly with long - acting bronchodilators. for the unmatched patients : prescribed inhaled corticosteroids doses were significantly lower for extrafine beclomethasone in both initiation sample : median interquartile range [iqr ], 200 [200400 ] versus fluticasone 500 [5001000 ] g / d ; p<0.001, and step - up sample : median [iqr ], 400 [400400 ] versus fluticasone 1,000 [5001,000 ] g / d ; p<0.001. initiation sample : median interquartile range [iqr ], 200 [200400 ] versus fluticasone 500 [5001000 ] g / d ; p<0.001, and step - up sample : median [iqr ], 400 [400400 ] versus fluticasone 1,000 [5001,000 ] g / d ; p<0.001. for the unmatched patients : primary outcome measures showed no significant difference between cohorts in copd exacerbation rate during outcome, with adjusted rate ratio for initiation sample : 1.04 (95% confidence interval [ci ], 0.891.22) for extrafine beclomethasone relative to fluticasone step - up sample : 0.94 (95% ci, 0.801.10) for extrafine beclomethasone. for initiation sample : 1.04 (95% confidence interval [ci ], 0.891.22) for extrafine beclomethasone relative to fluticasone step - up sample : 0.94 (95% ci, 0.801.10) for extrafine beclomethasone. for the unmatched patients : there was no significant difference between cohorts in odds of copd treatment success during outcome, with adjusted odds ratio for initiation sample : 0.99 (95% ci, 0.771.29) for extrafine beclomethasone relative to fluticasone step - up sample : odds ratio 1.20 (95% ci, 0.831.72) for extrafine beclomethasone. for initiation sample : 0.99 (95% ci, 0.771.29) for extrafine beclomethasone relative to fluticasone step - up sample : odds ratio 1.20 (95% ci, 0.831.72) for extrafine beclomethasone. note : patients in the two treatment cohorts were matched on clinically and demographically significant characteristics. abbreviations : bai, breath - actuated inhaler ; copd, chronic obstructive pulmonary disease ; dpi, dry powder inhaler ; fdc, fixed - dose combination ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity ; gprd, general practice research database ; ics, inhaled corticosteroid ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; opcrd, optimum patient care research database ; rx, therapy ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist. abbreviations : bai, breath - actuated inhaler ; copd, chronic obstructive pulmonary disease ; dpi, dry powder inhaler ; fdc, fixed - dose combination ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity ; gprd, general practice research database ; ics, inhaled corticosteroid ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; opcrd, optimum patient care research database ; rx, therapy ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist. time plots of the copd diagnosis showing (a) the time of the copd diagnosis relative to time of first asthma diagnosis for the full unmatched population who also had a recorded asthma diagnosis, and (b) the time of the copd confirmation (by fev1/fvc ratio < 0.7) relative to time of the asthma diagnosis for these patients. abbreviations : copd, chronic obstructive pulmonary disease ; dx, diagnosis ; sd, standard deviation ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity. chronic respiratory diseases and database codes that were cause for study exclusion abbreviations : nhs, national health service ; nos, not otherwise specified ; os, otherwise stated. list of potential confounding variables considered for this study abbreviations : copd, chronic obstructive pulmonary disease ; ics, inhaled corticosteroid ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; nsaid, nonsteroidal anti - inflammatory drug ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist. additional baseline patient characteristics by matched treatment cohort matched cohorts were compared using conditional logistic regression recorded bmi data were available for 331 (99%) and 328 (98%) patients in extrafine beclomethasone and fluticasone initiation cohorts, respectively, and for 185 (98%) and 184 (97%) patients in extrafine beclomethasone and fluticasone step - up cohorts, respectively. abbreviations : bdp, beclomethasone dipropionate ; bmi, body mass index ; copd, chronic obstructive pulmonary disease ; iqr, interquartile range ; n / a, not applicable ; nsaid, nonsteroidal anti - inflammatory drug ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist ; yr, years ; mo, months. baseline characteristics of unmatched cohorts matching variable (age matching was 5 years and index prescription date 1 year for the initiation population and 2 years for the step - up population) the doses of ics were standardized to equivalence with extrafine beclomethasone and fluticasone ; thus, baseline doses of large - particle beclomethasone and budesonide were halved. the daily dose was calculated as the number of days supply divided by number of prescription days. abbreviations : bdp, beclomethasone dipropionate ; bmi, body mass index ; copd, chronic obstructive pulmonary disease ; diagnosis / rx, coded diagnosis or therapy for same ; fev1, forced expiratory volume in 1 second ; gerd, gastroesophageal reflux disease ; gold, global initiative for chronic obstructive lung disease ; ics, inhaled corticosteroid ; iqr, interquartile range ; n / a, not applicable ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; nsaid, nonsteroidal anti - inflammatory drug ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist ; sd, standard deviation. results during the 2 year outcome period for the initiation sample, unmatched cohorts, no treatment change notes : data are n (%) unless otherwise indicated antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), prescriptions for theophylline (yes / no) and time between first coded diagnosis at practice and the index date (categorized) adjusted for : age, rhinitis diagnosis (yes / no), antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), acute use of oral steroids (categorized), number of lower respiratory - related consultations (categorized), beta blockers (yes / no), prescriptions for theophylline (yes / no) and year of first coded diagnosis at practice (categorized) adjusted for : age, antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), number of copd consultations (categorized), prescriptions for theophylline (yes / no) and inpatient admissions for copd (yes / no). abbreviations : hr, hazard ratio ; or, odds ratio ; rr, rate ratio ; bdp, beclomethasone dipropionate ; ci, confidence interval ; copd, chronic obstructive pulmonary disease ; ics, inhaled corticosteroid ; iqr, interquartile range ; laba, long - acting 2-agonist ; rx, treatment ; saba, short - acting 2-agonist. unadjusted and adjusted results during the 2 year outcome period for the step - up sample, unmatched cohorts, no treatment change notes : data are n (%) unless otherwise indicated. conditional logistic regression. adjusted for baseline adjusted for : asthma diagnosis (yes / no), gerd diagnosis and/or therapy (yes / no), cardiac disease diagnosis and/or therapy (yes / no), acute use of oral steroids (categorized), number of primary care consultations (categorized), prior laba use (yes / no) and time between first coded diagnosis at practice and the index date (categorized) adjusted for : antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), acute use of oral steroids (categorized), number of copd consultations (categorized), average daily ics dose (categorized), prescriptions for paracetamol (yes / no), prior laba use (yes / no) and time between first coded diagnosis at practice and ipd (categorized) adjusted for : gerd diagnosis and/or therapy (yes / no), antibiotics use (with a lower respiratory read code within a 5 day window) (categorized 01/2 + to meet proportional hazards requirement), acute use of oral steroids (categorized 01/2 + to meet proportional hazards requirement), prior laba use (yes / no) and number of primary care consultations (categorized). abbreviations : hr, hazard ratio ; or, odds ratio ; rr, rate ratio ; bdp, beclomethasone dipropionate ; ci, confidence interval ; copd, chronic obstructive pulmonary disease ; gerd, gastroesophageal reflux disease ; ics, inhaled corticosteroid ; iqr, interquartile range ; laba, long - acting 2-agonist ; rx, treatment ; saba, short - acting 2-agonist. post - study mortality rates notes : the study was not designed to evaluate mortality rates during treatment, as patients had to be alive throughout the 2 year outcome period to be eligible for the study. follow - up time from index date until censored or the end of the study period (end of 2010). cox proportional hazards model adjusted for charlson comorbidity index score and smoking status adjusted for age and cardiac disease diagnosis or therapy. abbreviations : bdp, beclomethasone dipropionate ; ci, confidence interval ; hr, hazard ratio ; sd, standard deviation. for the unmatched patients : prescribed inhaled corticosteroids doses were significantly lower for extrafine beclomethasone in both initiation sample : median interquartile range [iqr ], 200 [200400 ] versus fluticasone 500 [5001000 ] g / d ; p<0.001, and step - up sample : median [iqr ], 400 [400400 ] versus fluticasone 1,000 [5001,000 ] g / d ; p<0.001. initiation sample : median interquartile range [iqr ], 200 [200400 ] versus fluticasone 500 [5001000 ] g / d ; p<0.001, and step - up sample : median [iqr ], 400 [400400 ] versus fluticasone 1,000 [5001,000 ] g / d ; p<0.001. for the unmatched patients : primary outcome measures showed no significant difference between cohorts in copd exacerbation rate during outcome, with adjusted rate ratio for initiation sample : 1.04 (95% confidence interval [ci ], 0.891.22) for extrafine beclomethasone relative to fluticasone step - up sample : 0.94 (95% ci, 0.801.10) for extrafine beclomethasone. for initiation sample : 1.04 (95% confidence interval [ci ], 0.891.22) for extrafine beclomethasone relative to fluticasone step - up sample : 0.94 (95% ci, 0.801.10) for extrafine beclomethasone. for the unmatched patients : there was no significant difference between cohorts in odds of copd treatment success during outcome, with adjusted odds ratio for initiation sample : 0.99 (95% ci, 0.771.29) for extrafine beclomethasone relative to fluticasone step - up sample : odds ratio 1.20 (95% ci, 0.831.72) for extrafine beclomethasone. for initiation sample : 0.99 (95% ci, 0.771.29) for extrafine beclomethasone relative to fluticasone step - up sample : odds ratio 1.20 (95% ci, 0.831.72) for extrafine beclomethasone. note : patients in the two treatment cohorts were matched on clinically and demographically significant characteristics. abbreviations : bai, breath - actuated inhaler ; copd, chronic obstructive pulmonary disease ; dpi, dry powder inhaler ; fdc, fixed - dose combination ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity ; gprd, general practice research database ; ics, inhaled corticosteroid ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; opcrd, optimum patient care research database ; rx, therapy ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist. abbreviations : bai, breath - actuated inhaler ; copd, chronic obstructive pulmonary disease ; dpi, dry powder inhaler ; fdc, fixed - dose combination ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity ; gprd, general practice research database ; ics, inhaled corticosteroid ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; opcrd, optimum patient care research database ; rx, therapy ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist. time plots of the copd diagnosis showing (a) the time of the copd diagnosis relative to time of first asthma diagnosis for the full unmatched population who also had a recorded asthma diagnosis, and (b) the time of the copd confirmation (by fev1/fvc ratio < 0.7) relative to time of the asthma diagnosis for these patients. abbreviations : copd, chronic obstructive pulmonary disease ; dx, diagnosis ; sd, standard deviation ; fev1, forced expiratory volume in 1 second ; fvc, forced vital capacity. chronic respiratory diseases and database codes that were cause for study exclusion abbreviations : nhs, national health service ; nos, not otherwise specified ; os, otherwise stated. list of potential confounding variables considered for this study abbreviations : copd, chronic obstructive pulmonary disease ; ics, inhaled corticosteroid ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; nsaid, nonsteroidal anti - inflammatory drug ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist. additional baseline patient characteristics by matched treatment cohort matched cohorts were compared using conditional logistic regression recorded bmi data were available for 331 (99%) and 328 (98%) patients in extrafine beclomethasone and fluticasone initiation cohorts, respectively, and for 185 (98%) and 184 (97%) patients in extrafine beclomethasone and fluticasone step - up cohorts, respectively. abbreviations : bdp, beclomethasone dipropionate ; bmi, body mass index ; copd, chronic obstructive pulmonary disease ; iqr, interquartile range ; n / a, not applicable ; nsaid, nonsteroidal anti - inflammatory drug ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist ; yr, years ; mo, months. baseline characteristics of unmatched cohorts matching variable (age matching was 5 years and index prescription date 1 year for the initiation population and 2 years for the step - up population) the doses of ics were standardized to equivalence with extrafine beclomethasone and fluticasone ; thus, baseline doses of large - particle beclomethasone and budesonide were halved. the daily dose was calculated as the number of days supply divided by number of prescription days. abbreviations : bdp, beclomethasone dipropionate ; bmi, body mass index ; copd, chronic obstructive pulmonary disease ; diagnosis / rx, coded diagnosis or therapy for same ; fev1, forced expiratory volume in 1 second ; gerd, gastroesophageal reflux disease ; gold, global initiative for chronic obstructive lung disease ; ics, inhaled corticosteroid ; iqr, interquartile range ; n / a, not applicable ; laba, long - acting 2-agonist ; lama, long - acting muscarinic antagonist ; nsaid, nonsteroidal anti - inflammatory drug ; saba, short - acting 2-agonist ; sama, short - acting muscarinic antagonist ; sd, standard deviation. results during the 2 year outcome period for the initiation sample, unmatched cohorts, no treatment change notes : data are n (%) unless otherwise indicated antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), prescriptions for theophylline (yes / no) and time between first coded diagnosis at practice and the index date (categorized) adjusted for : age, rhinitis diagnosis (yes / no), antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), acute use of oral steroids (categorized), number of lower respiratory - related consultations (categorized), beta blockers (yes / no), prescriptions for theophylline (yes / no) and year of first coded diagnosis at practice (categorized) adjusted for : age, antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), number of copd consultations (categorized), prescriptions for theophylline (yes / no) and inpatient admissions for copd (yes / no). abbreviations : hr, hazard ratio ; or, odds ratio ; rr, rate ratio ; bdp, beclomethasone dipropionate ; ci, confidence interval ; copd, chronic obstructive pulmonary disease ; ics, inhaled corticosteroid ; iqr, interquartile range ; laba, long - acting 2-agonist ; rx, treatment ; saba, short - acting 2-agonist. unadjusted and adjusted results during the 2 year outcome period for the step - up sample, unmatched cohorts, no treatment change notes : data are n (%) unless otherwise indicated. conditional logistic regression. adjusted for baseline adjusted for : asthma diagnosis (yes / no), gerd diagnosis and/or therapy (yes / no), cardiac disease diagnosis and/or therapy (yes / no), acute use of oral steroids (categorized), number of primary care consultations (categorized), prior laba use (yes / no) and time between first coded diagnosis at practice and the index date (categorized) adjusted for : antibiotics use (with a lower respiratory read code within a 5 day window) (categorized), acute use of oral steroids (categorized), number of copd consultations (categorized), average daily ics dose (categorized), prescriptions for paracetamol (yes / no), prior laba use (yes / no) and time between first coded diagnosis at practice and ipd (categorized) adjusted for : gerd diagnosis and/or therapy (yes / no), antibiotics use (with a lower respiratory read code within a 5 day window) (categorized 01/2 + to meet proportional hazards requirement), acute use of oral steroids (categorized 01/2 + to meet proportional hazards requirement), prior laba use (yes / no) and number of primary care consultations (categorized). abbreviations : hr, hazard ratio ; or, odds ratio ; rr, rate ratio ; bdp, beclomethasone dipropionate ; ci, confidence interval ; copd, chronic obstructive pulmonary disease ; gerd, gastroesophageal reflux disease ; ics, inhaled corticosteroid ; iqr, interquartile range ; laba, long - acting 2-agonist ; rx, treatment ; saba, short - acting 2-agonist. post - study mortality rates notes : the study was not designed to evaluate mortality rates during treatment, as patients had to be alive throughout the 2 year outcome period to be eligible for the study. follow - up time from index date until censored or the end of the study period (end of 2010). cox proportional hazards model adjusted for charlson comorbidity index score and smoking status adjusted for age and cardiac disease diagnosis or therapy. abbreviations : bdp, beclomethasone dipropionate ; ci, confidence interval ; hr, hazard ratio ; sd, standard deviation. | purposesmall airway changes and dysfunction contribute importantly to airway obstruction in chronic obstructive pulmonary disease (copd), which is currently treated with inhaled corticosteroids (ics) and long - acting bronchodilators at global initiative for obstructive lung disease (gold) grades 24. this retrospective matched cohort analysis compared effectiveness of a representative small - particle ics (extrafine beclomethasone) and larger - particle ics (fluticasone) in primary care patients with copd.patients and methodssmokers and ex - smokers with copd 40 years old initiating or stepping - up their dose of extrafine beclomethasone or fluticasone were matched 1:1 for demographic characteristics, index prescription year, concomitant therapies, and disease severity during 1 baseline year. during 2 subsequent years, we evaluated treatment change and copd exacerbations, defined as emergency care / hospitalization for copd, acute oral corticosteroids, or antibiotics for lower respiratory tract infection.resultsmean patient age was 67 years, 57%60% being male. for both initiation (n=334:334) and step - up (n=189:189) patients, exacerbation rates were comparable between extrafine beclomethasone and fluticasone cohorts during the 2 year outcome period. odds of treatment stability (no exacerbation or treatment change) were significantly greater for patients initiating extrafine beclomethasone compared with fluticasone (adjusted odds ratio 2.50 ; 95% confidence interval, 1.324.73). median ics dose exposure during 2 outcome years was significantly lower (p<0.001) for extrafine beclomethasone than fluticasone cohorts (315 g / day versus 436 g / day for initiation, 438 g / day versus 534 g / day for step - up patients).conclusionwe observed that small - particle ics at significantly lower doses had comparable effects on exacerbation rates as larger - particle ics at higher doses, whereas initiation of small - particle ics was associated with better odds of treatment stability during 2-years follow - up. |
in the past 15 years, directed evolution has developed into a broadly applicable strategy for generating new biomolecules with desirable properties, for probing protein structure and function, and for addressing fundamental questions in molecular evolution. in this approach, random mutagenesis is used to produce a large and diverse library of nucleic acid sequences, which is subsequently interrogated for rare, improved variants. myriad protocols have been developed to produce the necessary molecular diversity (13). however, our ability to generate and screen randomized libraries is dwarfed by the amount of molecular diversity contained in protein sequence space. even for a small, 100-residue protein, there are more potential amino acid sequences than there are atoms in the observable universe (4). increasingly, it is recognized that high - quality libraries are critical to the success of directed evolution experiments (5,6). previously, we argued that the likelihood of finding a variant with a desired function in a randomized library is maximized when the library is maximally diverse (7). to the experimentalist, this corresponds to a library containing as few redundant sequences (including copies of the unmutated parental gene) and as many full - length sequences (lacking premature termination codons) as possible. to aid in the design of maximally diverse libraries, we developed a suite of user - friendly programmes for estimating the completeness and diversity that they contain (4,8). these programmes were limited to estimating library diversity at the nucleic acid level, and provided no explicit information regarding the translated products of the randomized genes. in this article, we describe an expanded web server, which enables the analysis of protein diversity in randomized libraries that have been generated by site - saturation mutagenesis and error - prone pcr (eppcr). the nucleotide programmes glue (for randomization techniques where all dna sequence variants are equally likely), pedel (programme for estimating diversity in error - prone pcr libraries) and driver (diversity resulting from in vitro recombination) are still maintained on the website, and have been described previously (4,8). one of our previous programmes, glue, is broadly applicable to any protocol where all gene variants have an equal probability of occurring in a library. the most commonly used example is site - saturation mutagenesis (also referred to as oligonucleotide - directed randomization), in which randomized bases are incorporated into one or more of the primers in a pcr, allowing the generation of diversity at specific sites in an amplified gene. other techniques that result in equally probable daughter variants (at the dna level) include max randomization (9) and versions of dna shuffling that utilize designed oligonucleotides (1012). glue is also a useful estimator of the diversity in libraries generated by incremental truncation strategies, such as expression of soluble proteins by random incremental truncation (esprit) (13), in which variants are close to being equally probable (14). we now introduce glue - including translation (glue - it), which outputs the expected amino acid level diversity in any site - saturation mutagenesis library with up to six variable codons. the user specifies the fully or partly randomized scheme used for each of the variable codons, and the size of the library that they have constructed (or, more often, the number of clones that they plan to screen). we provide two tools (codoncalculator and aa - calculator) to assist in choosing an appropriate randomization scheme for library construction. on specifying a fully or partly randomized codon, xyz, codoncalculator will output the possible amino acid variants and the number of times that each is encoded. aa - calculator performs the opposite function : the user can specify a desired set of amino acids, and aa - calculator will find the degenerate codon(s) that are optimal for encoding them. up to 50 degenerate codons are listed, ranked according to the fraction of the xyz - specified codons that code for the desired amino acids. aa - calculator therefore offers a user - friendly alternative to downloading and executing the libdesign algorithm (15), and provides users with a replacement for the combinatorial codons programme (16), which (as far as we are aware) is no longer available online. on entering the randomization scheme and library size, glue - it will output a summary of statistics, including the number of possible dna and amino acid variants that are encoded by each randomized codon and the total number of possible amino acid variants in the library. the probability of a particular variant vi being present in the library is 1 (1 pi), where pi is the probability of any particular variant in the library being vi, and l is the library size. in the case of six fully randomized (nnn) codons, there are 20 = 6.4 10 possible variants. to quickly calculate the expected number of distinct variants in the library,, variants are grouped according to the number of ways in which they can be encoded. each individual amino acid can be encoded by between one and six equiprobable codons, so for six randomized codons there are at most just 6 = 46 656 different pi values to calculate. for convenience, variants that encode stop codons are assumed to be non - functional and are omitted from the final total, c. consider an example in which two libraries are constructed, each containing two codons that have been targeted for randomization. this is the starting point for the combinatorial active site saturation test (casting), in which small, focussed libraries are produced by randomizing several sets of 23 amino acid positions around an enzyme active site (5,1720). in our example, suppose that the first library contains one codon randomized according to the nnk scheme (n = g / a / t / c ; k = g / t), while we use ndt (d = g / a / t) in the second position. codoncalculator tells us that all 20 amino acids (plus one stop codon, tag) are encoded in the nnk scheme. ndt specifies a more limited set of 12 amino acids (c, d, f, g, h, i, l, n, r, s, v and y ; one codon each). there are 32 12 = 384 possible codon variants in the resulting library, encoding 20 12 = 240 possible amino acid variants (the output of glue - it includes these calculations). suppose that the second library is constructed using an nnb codon (b = g / t / c) and an nay codon (y = t / c). this library is equally diverse at the dna level (48 8 = 384 variants), but less diverse when it is translated (20 4 = 80 amino acid variants). because the number of dna variants is the same in each of the two libraries, glue treats each library identically. the output suggests that approximately 1500 clones from each library should be screened, to ensure 98% coverage (table 1). by considering amino acid diversity, now it becomes clear that a much smaller screening effort would be justified for the nnb + nay library : sampling just 500 clones would ensure that 98% of the translated library had been interrogated. table 1.completeness and diversity statistics for two hypothetical site - saturation mutagenesis libraries, in which two codons have been randomized according to different schemes (nnk + ndt or nnb + nay)libraryno. of clones sampledglueglue - itno. of distinct dna variantsdna completenessno. of distinct amino acid variantsamino acid completenessnnk + ndt100880.23770.325002800.731960.8210003560.932290.9515003760.982370.99nnb + nay100880.23530.665002800.73780.9810003560.93801.0015003760.98801.00the fraction of all possible dna sequence variants (384 for each library) that are represented in the sample.not including variants with stop codons.the fraction of all possible amino acid variants (240 for library 1 ; 80 for library 2) that are sampled. completeness and diversity statistics for two hypothetical site - saturation mutagenesis libraries, in which two codons have been randomized according to different schemes (nnk + ndt or nnb + nay) the fraction of all possible dna sequence variants (384 for each library) that are represented in the sample. the fraction of all possible amino acid variants (240 for library 1 ; 80 for library 2) that are sampled. glue - it also calculates the probability that a given library contains all possible amino acid variants, which is a related but distinct statistic (4). using this, it is possible to determine empirically the number of clones to screen in order to achieve a fixed probability of sampling all variants. for example, approximately 1150 clones from the nnb + nay library should be screened to give a 95% chance that every possible sequence variant is sampled at least once. while there is a growing emphasis on targeting diversity in well - sampled, focussed libraries (5,6), eppcr remains a common means of generating random diversity at any position in a gene. indeed, a number of commercial vendors now sell eppcr kits, usually designed to overcome the well - documented biases in nucleotide misincorporation by taq polymerase (21). in eppcr, the potential for generating mutations at any position in a gene ensures that the number of possible variants is usually much larger than that which can be screened experimentally. therefore, it becomes more informative to assess the number of distinct sequences that are present in the library. this is in contrast to site - saturation mutagenesis, where glue - it can inform strategies for sampling all or most of the possible sequence variants. previously, we described pedel, which calculates the expected number of distinct dna variants in an eppcr library, given the library size, the mean mutation rate and the length of the template sequence (4,8). the underlying algorithm divides the library into sub - libraries, each of which contains variants with exactly x mutations. the original implementation of pedel assumed that the number of mutations per daughter sequence (estimated by sequencing a handful of library members) follows a poisson distribution. the web server now also includes the option to use the pcr distribution (22), which is the preferred option provided the appropriate data from the eppcr are known. in addition to the mean mutation rate, calculations using the pcr distribution require the user to input the number of pcr thermal cycles, n, and also the pcr efficiency (i.e. the probability that any particular sequence is duplicated in a given pcr cycle ; eff). in turn, estimating eff requires the experimentalist to note the initial amount of template dna and the final yield of pcr product, so that the number of doublings in the pcr, d, can be calculated : the pcr efficiency is then given by : for convenience, we have included a tool for calculating eff, given d and n. as with site - saturation mutagenesis, it is ultimately more useful to estimate the protein sequence diversity in an eppcr library, rather than the dna sequence diversity. addressing this problem is not trivial, as the degeneracy of the genetic code ensures that amino acid sequence variants are not equiprobable. many substitutions are translationally silent, and > 1 substitution in a single codon is rare in eppcr, reducing the number of accessible amino acid variants. assessing the protein - level diversity in an eppcr library therefore requires consideration of the template sequence, the overall (dna) mutation rate, the total size of the library and the nucleotide mutation matrix. this final parameter is an estimate of the relative frequencies of all 12 possible point mutations. it can be estimated from previous libraries [such as the one described by shafikhani. (21) ] or, for greater accuracy, it can be obtained by sequencing randomly chosen members of one 's own library. volles and lansbury (23) previously described a monte carlo simulation programme that uses these inputs to randomly simulate every individual sequence in a library, and also produce some analytic statistics. while this powerful approach allows a variety of library statistics to be estimated, it is cpu - intensive. therefore, we have developed and added to our web server an amino acid version of pedel (pedel - aa) that combines the sub - library analyses of pedel with these new inputs to determine protein sequence diversity. a very brief description of the pedel - aa algorithm follows ; further details are given in the notes on the website. the number of nucleotide substitutions per variant is assumed to follow the pcr distribution p(xnt). the distribution of truncated variants is then calculated and subtracted from p(xnt). next, p(xnt) is converted to the amino acid distribution, p(xaa), by assuming that, for each xnt, the number of non - synonymous amino acid substitutions resulting from exactly xnt nucleotide substitutions follows a binomial distribution, b(xnt, f), where f is the mean number of non - synonymous amino acid substitutions per nucleotide substitution. the input library is conceptually divided into sub - libraries lx (x = 0, 1, 2,) where the sub - library lx comprises all variants in the library with exactly x amino acid substitutions. the total number of possible variants with exactly x amino acid substitutions is represented by vx. vx1 is an estimate of the number of easy - to - reach variants ; that is, those variants where each substituted amino acid is accessible by just a single nucleotide substitution in the respective codon. although most variants in a sub - library will be of type vx1, variants of type vx2 may contribute significantly to the total number of distinct variants, cx, when the sub - library size lx is large compared with the number of variants vx1. when lx < < vx then cx lx (i.e. nearly all variants in lx are distinct). for pedel - aa, we use this approximation when lx < 0.1 vx1. this is usually the case for x 3 and almost always the case for x 4. for x = 0, 1 and 2, we calculate the expected number of distinct variants, cx, analytically. in the rare cases where the cx lx approximation can not be used for all x 3, a rough approximation is used for the remaining cx values. the approximations used in pedel - aa have minimal effect for ordinary mutations rates, library sizes and eppcr template lengths. table 2 provides an illustrative example, in which the characteristics of an -synuclein eppcr library, as estimated by pedel - aa and by the monte carlo simulations of volles and lansbury (23), are compared. table 2.characteristics of an -synuclein eppcr library, estimated by pedel - aa and by a previously - described monte carlo library diversity algorithm (23)propertypedel - aaref. (23)prematurely truncated variants (proportion of total library)16%15%number of full - length clones3.2 103.1 10protein mutation frequency per amino acid0.0160.016mean number of mutations per protein2.12.1unmutated (wild - type) sequences (proportion of total library)14%14%number of unique proteins in the library1.3 101.3 10number of different point mutations in the library19891990number of unique single - mutation variants in the library16181566the eppcr library was constructed by volles and lansbury (23), and consisted of 3.77 10 clones with an average of 3.2 nucleotide mutations per clone. the template for randomization was 399 bp in length (coding for amino acids 8140 of the -synuclein protein). table 1 of volles and lansbury (23) was used for the nucleotide mutation matrix. characteristics of an -synuclein eppcr library, estimated by pedel - aa and by a previously - described monte carlo library diversity algorithm (23) the eppcr library was constructed by volles and lansbury (23), and consisted of 3.77 10 clones with an average of 3.2 nucleotide mutations per clone. the template for randomization was 399 bp in length (coding for amino acids 8140 of the -synuclein protein). table 1 of volles and lansbury (23) was used for the nucleotide mutation matrix. perhaps the most useful feature of pedel - aa is its ability to quickly estimate the total number of unique proteins in an eppcr library. unlike pedel, pedel - aa is able to calculate and subtract indel - containing sequences, prematurely truncated variants and dna sequences with synonymous substitutions from the overall estimate of useful diversity. for example, we recently performed eppcr on the 1515 bp purf gene from escherichia coli (24). the resulting library contained 6.4 10 transformants and the mean mutation rate was 15.5 mutations per (dna) sequence. pedel suggested that this high mutation rate was optimal ; that is, at the dna level, almost every sequence variant was unique. reanalyzing the data with pedel - aa demonstrates that the very high mutation rate has produced a large number of variants with premature stop codons. in this example, the library of 6.4 10 unique dna sequences only encodes 3.9 10 full - length, non - wild - type proteins. comparing the pedel and pedel - aa outputs for a range of mutation rates suggests that lowering the mutation rate to approximately eight mutations per sequence would have yielded a maximally diverse library, containing 4.3 10 useful sequence variants (figure 1). this could have been achieved by lowering the concentration of mn ions and/or by decreasing the number of cycles in the eppcr. figure 1.the estimated numbers of unique dna sequence variants (cdna, dashed line) and protein sequence variants (cprotein, solid line) in a purf eppcr library (24), plotted as a function of the dna mutation rate,. the eppcr comprised 30 thermal cycles, with eff = 0.41. a total of 7549 bp of dna sequence was obtained from randomly chosen library members, and 77 substitutions plus one single - nucleotide deletion were observed. the library used for genetic selection experiments contained = 15.5 mutations per sequence ; the estimated sequence diversity it contains is indicated by the vertical arrow on the right. note that, after peaking, the number of unique amino acid (but not nucleotide) variants decreases with increasing, due to an increasing number of truncated sequences. the estimated numbers of unique dna sequence variants (cdna, dashed line) and protein sequence variants (cprotein, solid line) in a purf eppcr library (24), plotted as a function of the dna mutation rate,. the eppcr comprised 30 thermal cycles, with eff = 0.41. a total of 7549 bp of dna sequence was obtained from randomly chosen library members, and 77 substitutions plus one single - nucleotide deletion were observed. the library used for genetic selection experiments contained = 15.5 mutations per sequence ; the estimated sequence diversity it contains is indicated by the vertical arrow on the right. note that, after peaking, the number of unique amino acid (but not nucleotide) variants decreases with increasing, due to an increasing number of truncated sequences. in addition to a variety of overall library characteristics, a link from the pedel - aa output screen provides the user with an estimate of the amino acid sequence diversity contained in each sub - library (i.e. all of those variants containing exactly x mutations ; 0 x 20). this data includes the fraction of the library containing no mutations (the x = 0 sub - library), and also offers an overview of the range of mutations that the experimentalist should expect to observe in their library variants. the first plots the cumulative probability that a given variant is free of stop codons, up to amino acid x. the second plots the length distribution of variants with premature stop codons. these give an instant graphical overview of regions of the template that are particularly prone to yielding truncated variants. previously, we developed glue, pedel and driver to aid in designing and analyzing randomized libraries of nucleic acid sequences (4,8). here, we have introduced glue - it and pedel - aa. by estimating protein - level statistics, these programmes offer new insights into the usable diversity of translated site - saturation and eppcr libraries. our algorithms make use of some simplifying assumptions that can be avoided by using monte carlo simulation approaches (23). however, these assumptions have only minor effects under experimental conditions that are usually encountered in library construction. our analytic approach is much quicker than the monte carlo simulation approach (especially for large library sizes), making it more amenable for use via a web server and enabling experimentalists to obtain rapid estimates of library statistics. | there are many methods for introducing random mutations into nucleic acid sequences. previously, we described a suite of programmes for estimating the completeness and diversity of randomized dna libraries generated by a number of these protocols. our programmes suggested some empirical guidelines for library design ; however, no information was provided regarding library diversity at the protein (rather than dna) level. we have now updated our web server, enabling analysis of translated libraries constructed by site - saturation mutagenesis and error - prone pcr (eppcr). we introduce glue - including translation (glue - it), which finds the expected amino acid completeness of libraries in which up to six codons have been independently varied (according to any user - specified randomization scheme). we provide two tools for assisting with experimental design : codoncalculator, for assessing amino acids corresponding to given randomized codons ; and aa - calculator, for finding degenerate codons that encode user - specified sets of amino acids. we also present pedel - aa, which calculates amino acid statistics for libraries generated by eppcr. input includes the parent sequence, overall mutation rate, library size, indel rates and a nucleotide mutation matrix. output includes amino acid completeness and diversity statistics, and the number and length distribution of sequences truncated by premature termination codons. the web interfaces are available at http://guinevere.otago.ac.nz/stats.html. |
recent studies have shown that food production and consumption are responsible for 1030% of an individual s total environmental impact. a considerable amount of the total food intake by mass (30%) is represented by fruits and vegetables, which constitute the largest food group consumed worldwide. the effects of their production are revealed in different categories of environmental impacts, like climate change, impacts of land and water use, human- and eco - toxicological effects, eutrophication, acidification, soil fertility degradation, and landscape changes. policy makers and private companies in various countries have recognized the need to quantify these environmental impacts and, on this basis, to identify measures for impact reduction. for instance, a new law in france and a recommendation of the swiss federal office for the environment encourage the labeling of food products with their carbon / environmental footprints. private companies, such as tesco and walmart, calculate the carbon footprint of some of their products and communicate these to their customers, while others use such environmental information for internal decision making regarding products and supply chain management. finally, water footprint studies have gained high interest in the area of food production, revealing the amounts of water consumption and the related impacts. the international organization for standardization (iso) is therefore currently considering a standard on water footprint to allow consistent analysis and reporting for product labeling. despite these initiatives for instance, while several life cycle assessment (lca) studies on a variety of fruits and vegetables have been published, the comparability of these studies is compromised by differences in system boundaries and background data. in contrast to process - based lca studies, input - output lca studies provide data on total food consumption without having cut - offs in the supply chain, leading to a large gap in the overall impacts. such studies help to identify relevant food groups, but the data are given on an industrial - sector resolution and hence do not allow for identifying improvement potentials within sectors. moreover, international trade is not well captured due to inconsistencies in the underlying statistical data. thus, in addition to these studies, detailed, process - based lca data are needed to support decisions regarding adequate sourcing of food products, means of transportation, agricultural management, and, finally, choices between different food commodities. the goals of the present study were (a) to elaborate a consistent and up - to - date life cycle inventory (lci) of a large range of fruits and vegetables from different origins, (b) to show selected life cycle impact assessment (lcia) results and derive general decision guidelines for producers, retailers, policy makers and consumers on how to improve the environmental impacts of fruit and vegetable consumption, and (c) to illustrate and discuss the implementation of these guidelines for a specific case of purchasing decision and environmental supply chain management of a main swiss retailer. the functional unit (fu) was defined as 1 kg of product at the point of sale. the lca study includes the following fruits and vegetables : apple, avocado, banana, broccoli, cabbage for conserves, carrots, cauliflower, celery root, citrus fruits, cucumbers, eggplant, fennel, grape, green asparagus, bell pepper, iceberg lettuce, kiwi, lettuce, melon, onion, vine tomatoes, papaya, pear, pineapple, potatoes (lci adapted from ecoinvent), radish, red cabbage, round carrots, spinach, strawberries, tomatoes, white asparagus, white cabbage, and zucchini. these products cover more than 80% of the fruits and vegetables sold by one of the two major retailers in switzerland in 2007, for which the study was originally undertaken. the products were either produced locally or transported to switzerland from 29 different countries. the lci were compiled by extrapolating from a basic set of data for one product to the same product from other origins by varying parameters, such as transport means and distances, irrigation, heating energy for greenhouse production, and cooling energy for storage. inputs and outputs from packaging and the operation of the store were excluded from the analysis as these were shown to be relatively low compared to the overall impact (supporting information (si), section 1) and equal for all fruits and vegetables. vegetables, apples, pears and strawberries were modeled using the swiss agricultural standard production scheme called integrated production as described elsewhere. the other fruits were produced according to the so - called conventional production. tables with agricultural production means for cost calculations were used to set up the inventory of vegetables, apples and pears, whereas for tropical fruit production additional data were obtained from literature and leaflets of agricultural extension services (si, section 2). good agricultural practice (gap) was assumed for all agricultural activities, irrespective of the production site, assuming common global standards throughout the supply chain. this assumption was in accordance with the commissioner of the study, but may need to be revised in cases in which retailers do not make sure that gap is applied. next, a short outline of every parameter considered in the lci is given ; detailed information can be found in the si, section 2. it was assumed that the land occupied is arable and that it had been used for agriculture for a long time. land occupation was calculated based on yield and cultivation time per kg of product (si, section 3). one of the upstream processes of vegetable growing is the production of seedlings, which are young plants to be bedded out. we assumed an average size of 20 cm per pot with an estimated weight of 20 g. based on the yield and number of seedlings planted per ha, the amount of peat and the transported weight per kg of product from the mining site were calculated. seedling production in switzerland or further north is generally assumed to take place in heated greenhouses over five weeks. for heating oil consumption, the data for eggplants were assumed for all vegetable seedlings because of similar temperature requirements. the nutrients, extracted by the plants, eroded and leached to water, have to be replaced by soil fertilization. here we considered effective fertilization with macronutrients using the ecoinvent processes ammonium nitrate, single superphosphate as p2o5 and potassium sulphate (si, section 5). individual pesticide production data were not available. in such cases, the generic pesticide process field emissions of pesticides are often farm - specific and models like in can be used to estimate such emissions accurately. the ecoinvent data set fertilizing by broadcaster with middle intensive fuel consumption was used as a proxy for horticultural machinery. data on the number of machinery operations and the working hours for running the machines were used to quantify the amount of machinery input per kg of crop (si, section 8). greenhouse production implies electricity use, for example, for lighting and irrigation pumps. the electricity demand was estimated using information from swiss cost calculation sheets assuming a price of 0.15 chf / kwh for industrial companies. the average european electricity mix (entso - e, former ucte) of low voltage was used for all crops except those originating from the americas, to which the u.s.- mix was applied. to be independent from outdoor temperature, greenhouses are built to provide the appropriate climate. to show the variability of fuel consumption related to seasonality, a time - dependent heating energy model for greenhouse production was developed and applied. this model considers the type of greenhouse (heat transmission properties), the building dimensions, the difference in outside and inside temperature required by the specific crop, solar irradiation and the yield. for details if the sourcing season was unknown, an annual average amount of heating oil (fossil fuel) per crop was used for one growing period. all productions in switzerland and further north were modeled as heated and nonheated to approximate a winter and a summer production respectively. irrigation is needed in regions where rainfall is less than the amount of water required to grow a specific crop, where rainfall is seasonally unevenly distributed or if crops are cultivated in greenhouses. the amount of water irrigated depends on the culture as well as on soil and different climate parameters like temperature, wind and rainfall. the different amounts of irrigation water for all the crops grown in switzerland are available from elsewhere. short - term crops (like lettuce and radish) and open field crops use 400800 m / ha / growing cycle, long - term greenhouse crops use 30006000 m / ha / growing cycle. the irrigation inventory for imported crops was calculated according to pfister. as only the country of origin was known, a production weighted average amount was used, taking into account the geographical distribution of each crop within a country. domestic production covers 40% and 49% of the fruit and vegetable consumption respectively, whereas the rest is imported. the most important production sites in a country were identified for each product and the most evident transportation routes and means were chosen according to the scheme in table s4 (si, section 11). it was assumed that trucks from industrial countries are euro 4 or 5 standard with cargo weight > 32 t, except for distribution in switzerland, which was modeled with a specific fleet average truck of > 28 t. truck - transportation in emerging economies was simulated with an euro 3 standard for cargo weight > 32 t. by sea route the products are transported by freight ship and in the air by an intercontinental freight aircraft. the corresponding ecoinvent processes were employed and distances were measured with online tools (si, section 11). crops need to be cooled in order to avoid decay before arriving at the point of sale and to elongate the storage life. transportation was assumed to take place in fully loaded iso - containers with independent cooling aggregates. according to wild one teu (= twenty - foot equivalent unit) is the size of a little standardized container with an average load of 10 t. furthermore, the transportation time (si, section 12) was needed to model the consumed cooling energy with the ecoinvent data set diesel electric generating set. several crops (asparagus, bananas, carrots, celery root, cucumbers, iceberg lettuce, lettuce, radish, spinach, and zucchini) need to be cleaned after harvesting. it was assumed that 0.4 l of tap water is used per kg of crop, except for bananas which use 4.4 l per kg. energy consumption depends on storage time, outside temperature, ideal storage temperature (crop specific) ranging from 2 to 13 c and packing density, which is generally assumed to be 300 kg / m. nitrate and phosphorus - emissions into different compartments were modeled generically, because no site - specific values of the productions sites (slope, soil, machine type, weather etc.) is emitted into the air as ammonia (nh3), 1.7% as nitric oxide (no) and the same amount as nitrous oxide (n2o) into the air as well, whereas 35% is estimated to be leached as nitrate (no3) into the soil. constant values of phosphate emission into groundwater (0.07 kg phosphate / ha / a) and of phosphorus emission into surface water (0.245 kg phosphorus / ha / a) were assumed. assumptions and data about mulch film application and flame treatment are documented in the si, section 6 and 7. the elaborated lci data can be coupled with any lcia method. in this paper, we show selected results for the impact categories climate change and water stress. results in terms of a lcia method using multiple impact categories were calculated with recipe and are shown in the si, section 14. human toxicity impacts due to pesticide use, if applied properly, were shown to be relatively small in relation to other impacts like gwp and were excluded in this study. in order to efficiently identify improvement potentials, crops were first ranked according to the impact caused by the total sales volume of a crop (isc, total in eq 1):1where isc, i, j is the specific impact score per kg of crop c from origin i and produced with mode of production / transportation j, and mc, i, j is the respective mass of crop c sold by the retailer. in addition to the total impact, the sales - amount weighted average impact per kg of product and the variation in specific impact across different origins, production techniques and mode of transportation were also taken into consideration. priority crops for an in - depth investigation were selected by quantifying the maximal (not necessarily realistic) improvement potential per crop according to eq 2:2where ic is the maximal improvement potential for crop c (in % of total current impact), mc total is the total mass of crop c sold, isc, average is the sales - amount weighted impact score per kg of crop c and isc, min the minimal specific impact for crop c found in the considered origins and mode of production / transportation. those crops for which the sum of the improvement potentials was larger than one - third of the current co2-footprint were selected for in - depth analysis. figure 2 shows the co2-footprint of fruit and vegetable sales, calculated according to eq 1 (figure 2a) and the specific co2-footprint with its variation (figure 2b). asparagus, lettuce and cucumbers were selected for in depth investigation, to derive high - leverage recommendations for a reduction in environmental impact. switching to the respective production alternative with minimal impact for these three crops would achieve a reduction of more than one - third of the current overall co2-footprint caused by the sale of all crops considered (table 1). other crops like bananas, pears, apples, citrus fruits, and potatoes also cause a relatively large total co2-footprint because of large amounts sold, but due to their small specific impact the potential for improvement is limited. relative global warming potential (gwp) in % of the total gwp generated by all considered fruits and vegetables sold in 2007 (ordered from top to bottom, 2a) and sales - amount weighted impact per kg of product (2b). the error bars denote the minimum and maximum specific impact over all options assessed (varying origin, means of transportation, production modes, etc.). asparagus was clearly the most important crop to be analyzed according to the ranking scheme applied. figure 3 shows that the main load of the gwp originates from air transport from mexico and peru. the carbon footprint of different origins and transportation options differs by a factor of 1619, respectively, from the lowest (produced locally in switzerland) to the highest (imported by airplane from mexico (green asparagus) and peru (white asparagus)). therefore, a recommendation to reduce air transport and to encourage seasonal production from near regions was derived. gwp of green and white asparagus imported to switzerland from different countries of origin. for the remaining crops, classified as high priority to reduce the carbon footprint, the main driver of impact was greenhouse heating with fossil fuels during production out of season. for example, a comparison between swiss cucumber production from unheated and heated greenhouses shows a gwp - difference by a factor of more than 10 (figure 4). a large difference between heated and nonheated production can also be observed for eggplants (factor of 6), tomatoes and peppers (both factor of 4) and lettuce (factor of 10). emissions including those from fossil fuel - heating are not evenly distributed over the whole season. the results of the gwp combined with the seasonal heating energy model are shown for a swiss lettuce production in figure 4. gwp of cucumbers grown either unheated or in (with an annual average amount of heating oil) fossil fuel heated greenhouses (a). gwp of lettuce at harvesting time produced in a greenhouse for a year - round production (b). energy demand for cool storage induces less gwp than import by ship from southern countries. for example comparing kiwis imported from italy and new zealand, import from italy is always less co2-eq. intensive, even when considering 36% higher yields, which have been reported for new zealand. different scenarios of the total gwp of the fruits and vegetables assessed reveal a reduction potential of 42% changing from the scenario with air - freighted oversea - asparagus and vegetables produced in heated greenhouses in northern europe to a supply without air transport and fossil fuel heated greenhouse productions. without air transport, asparagus alone bears a gwp - reduction potential of 20%. a similar reduction (22%) can potentially be achieved by avoiding vegetables from heated greenhouses and sourcing them from southern countries during winter and spring, or, even better, from heated greenhouses with waste heat from other industrial processes. in figure 5b, the water consumed during the production of selected fruits of different origins is weighted by the water stress index (wsi). differences in the environmental impact are mostly caused by water scarcity of a specific region and the ratio of irrigated water consumed to the yield. the impact is clearly visible for the asparagus and avocado production (figure 5b), whereas for the other fruits and vegetables it is not. in some cases, a good water performance can be in contradiction to a good gwp performance, as in the case of citrus fruits from israel (si, section 15). in other cases, both indicators are in accordance, such as in the case of seasonal production of fruits and vegetables from switzerland, which have a low impact with respect to both indicators. fraction of water stress (in % and ordered from top to bottom) caused by the sales volume in 2007 normalized by the sum of water stress of all crops (5a) and sales - amount weighted water stress (irrigation water (m)wsi) per kg of (5b). several measures have been implemented to reduce the large impact due to air transport. products transported by air freight are declared with a label by air and the emissions are fully compensated through offsetting schemes. through efficient logistics and improved storage techniques the amount of white asparagus transported from overseas by ship was increased from 5090% from 2007 to 2009. however, green asparagus is still not transported by ship from overseas due to substantial losses. to lower the impact of the green asparagus imported by air - freight the retailer decided not to sell this product at discount prices anymore since spring 2009. with this measure it was possible to reduce the emissions from air - transported asparagus by 75% from 2008 to 2009. in addition, a new production site in taroudant, morocco is being established to avoid air transport dependency. furthermore, the results of the study were communicated to the purchasing staff (in the forms of a report, a leaflet and a calculation tool) to enable an environmentally informed supply chain management for all products. airplane transport dominated the carbon footprint of fruits and vegetables, that is, asparagus and papaya. a decision recommendation for consumers could be, for instance, that seasonal consumption of local foods is to be preferred over out - of - season fruits and vegetables that are imported by plane. for retailers it is recommended to avoid long - distance transports or to prefer transport by ship whenever possible. these results are in accordance with the studies of jungbluth. or sim., but differ from weber., who conclude that foodmiles in the u.s. another general result is that greenhouse heating may be a key process for vegetables that are grown out of season in colder climates. in many cases, heating greenhouses with fossil fuels was more important than ground transport, even if distances were long (e.g., south spain to switzerland). thus, during winter and spring it is often better to purchase vegetables that are grown in greenhouses from southern countries, where no heating is needed, while during summer or fall, local production is often better than imports. however, there is often a trade - off between the relatively low carbon footprint of winter and spring production in southern countries and the water stress induced in these countries, a situation that needs to be carefully assessed case by case. the use of heating systems with nonfossil energy and particularly waste heat could be a solution which may reduce both carbon footprint and water stress impacts. some greenhouses functioning with waste heat are already in operation, for example, the greenhouse attached to a municipal solid waste incineration in hinwil, and the tropical centers in frutigen and wolhusen, switzerland, which are heated with geothermal heat (warm water effluent from a tunnel) and waste heat from a gas concentration unit respectively. the decision recommendation for food producers would thus be to search for such alternative heat energy sources or to avoid heating as much as possible. the latter is already standard practice for organic producers in switzerland, as heating is only permitted to avoid harvest losses from freezing temperatures according to the standards of bio suisse. emissions by sourcing their greenhouse - grown products locally during the season. in winter and spring they should look for imports from warmer locations, provided that there are no adverse effects such as water stress (and further impacts not investigated here). retailers are suggested to use results from lca studies, to decide where to source each fruit and vegetable from, and which aspects to improve in collaboration with the producers in each case. they could also label best - practice products, although the communication of lca - results to consumers is a challenging task and consumer organizations already warn against too much and too complex information on products. finally, consumers should buy seasonal products or local products that can be stored over the season as much as possible to avoid both long - distance and air transport, as well as greenhouse heating. moreover, it is desirable that crops with low specific impact are consumed in large amounts, as is already the case for pear, grape, potato, melon, carrot, etc. to enable such decisions, policy makers should ensure that retailers label the origin, transportation, and mode of production of their products. storage energy is in some cases significant, and efficient cooling technologies are fairly important. nevertheless, local production combined with long storage tends to perform better than long - distance imports from countries like new zealand, which is for certain crops, such as kiwi and apple, a relevant country for imports into switzerland. our results are in accordance with blanke., but in contradiction withmil i canals, who considered 540% loss for apples which are stored for 410 months. the latter assumption is justified for apples consumed in european spring. in many purchasing decisions, retailers or consumers can generate significant savings in environmental impacts by following simple guidelines as outlined above. although the study has been made for a swiss retailer, the lci data are adaptable to assortments of other retailers worldwide. some key pieces of information about the supply chain like crop, origin, transportation mode, and sales numbers were provided by the retailer. the inventory data are based on this information and use generic data for the production processes, for example, swiss averages from the horticultural association, which produces according to gap. however, it should be noted that variability is large between regions and even between farms. for example, eutrophying emissions are a function of many parameters including climatic factors. thus, our average data is rather uncertain and may need to be revised particularly for countries without gap - tradition in the field of fertilization, yield and machinery use and in case the data is applied to retailers which do not make sure that gap is followed by all suppliers. the storage lives of the analyzed products vary from 10 days to half a year, something which has, among other factors, an influence on the amount of food losses. food losses may be significant and should be assessed, although we were not able to collect representative data within this study. data on food losses are specific for each retailer, supply chain and crop. thus, such data should be added to the inventory data when performing lca studies. in the particular case of the commissioner of this study, it was decided that the highest leverage decisions can be taken on the levels of purchasing decisions of the retailers and communication to producers. the rational was that only sustainable products should be offered (also for social standards which are not discussed in this paper), so that the consumers can buy any product without violating minimum standards and the vast majority of customers is covered. additionally, consumer information such as origin and mode of production of all fruits and vegetables are provided so that environmentally educated consumers have the chance to choose the environmentally friendliest product among those offered. the results of the implemented measures shows that the reduction potential identified by a lca - analysis and implemented into daily business can lower the overall impact without substantially compromising the company economically. it also demonstrates the opportunities of retailers for reducing environmental impacts of food consumption. food products are known to have significant environmental impacts other than climate change and water use impacts. those other potential impacts should be covered in a lca complementing the carbon and water evaluation to avoid problem shifting. further environmental effects of concerninclude impacts from land use, eutrophication and toxic effects. while for some of these impacts (e.g., ecotoxicity and eutrophication) standard assessment methods exist, methodological developments are needed for others (e.g., soil fertility, erosion, salinization, and biodiversity impacts). a complete lcia including these impact categories is also needed for a fair comparison between organic and intensive production systems. furthermore, the assessment could be expanded to an analysis from cradle to grave, including the use phase (transport from the store to where it is consumed, preparation like e.g. cooking, etc.) and especially the food losses over the whole chain. | food production and consumption is known to have significant environmental impacts. in the present work, the life cycle assessment methodology is used for the environmental assessment of an assortment of 34 fruits and vegetables of a large swiss retailer, with the aim of providing environmental decision - support to the retailer and establishing life cycle inventories (lci) also applicable to other case studies. the lci includes, among others, seedling production, farm machinery use, fuels for the heating of greenhouses, irrigation, fertilizers, pesticides, storage and transport to and within switzerland. the results show that the largest reduction of environmental impacts can be achieved by consuming seasonal fruits and vegetables, followed by reduction of transport by airplane. sourcing fruits and vegetables locally is only a good strategy to reduce the carbon footprint if no greenhouse heating with fossil fuels is involved. the impact of water consumption depends on the location of agricultural production. for some crops a trade - off between the carbon footprint and the induced water stress is observed. the results were used by the retailer to support the purchasing decisions and improve the supply chain management. |
binge eating disorder (bed) has been the subject of an increasing number of recent studies ; nevertheless, it is still awaiting official diagnostic recognition, and it is classified as a syndrome in need of further study in the most recent edition of the diagnostic and statistical manual of mental disorders (dsm - iv - tr). bed is characterized by recurrent episodes of binge eating (defined as the ingestion of a large quantity of food in a discrete period of time) accompanied by a subjective sense of loss of control over eating. other criteria are distress about binge episodes ; eating more rapidly than normal ; eating until uncomfortably full ; eating large amounts when not hungry ; eating alone because of embarrassment ; and feeling disgusted, depressed, or guilty about overeating. in a community survey, 5% of obese subjects met bed criteria, while 30% of patients participating in weight loss programs met bed criteria.1 it is probably the most frequent eating disorder,2 and it is associated with obesity and significant medical and psychiatric comorbidity (especially with regard to anger and personality issues).35 some psychotropic medications have also been found to be associated with the induction of binge eating.6 these features, together with its chronic nature and its greater prevalence than anorexia and bulimia nervosa, suggest that it should be considered a public health problem of no less importance than the other two more established eating disorders.2 despite a growing recognition of the consequences of bed on public health, substantive evidence on treatment approaches for the disorder is limited. a combination of pharmacological and behavioral strategies has been proposed.7 research on the pharmacological treatment of bed has focused mostly on selective serotonin reuptake inhibitors (ssris) because bed shares some clinical features with bulimia nervosa. however, a recent meta - analysis8 has concluded that currently available data are not sufficient to formally recommend antidepressants as a first - line therapy for bed. the search for novel pharmacological treatments for bed is now focusing on other classes of drugs, particularly sibutramine and topiramate.9 topiramate, which is approved for treatment of epilepsy and prophylaxis of migraine, has been shown consistently to reduce weight in several placebo - controlled obesity trials.10 it has also been shown to be effective in treating bulimia nervosa in a randomized controlled trial (rct).11 current knowledge about the mechanism by which topiramate reduces binge eating is not conclusive. topiramate might have a specific effect in reducing food intake mediated by its antagonism to glutamatergic transmission in the lateral hypothalamus.12 other possible mechanisms of action reviewed by mcelroy and colleagues13 include directly inducing weight loss by stimulating energy expenditure, decreasing binge eating by altering the rewarding properties of food, and reducing general impulsivity. the aim of this paper is to review available evidence on the efficacy / effectiveness and safety of topiramate in adults with bed. we conducted a systematic search using the following computerized literature databases : pubmed, medline, and psychinfo. search terms included topiramate and binge, binge eating, given the limited number of studies available, we reviewed rcts as well as case series and single case reports. the data presented can not be synthesized with a systematic approach because of the lack of homogeneity among the studies examined ; however, the breadth of the selection criteria allows for wide application of these data to different populations of patients with bed. we first consider studies involving rcts and then address those involving open labels. we included both kinds of studies in the belief that the effects of topiramate both under ideal conditions (efficacy studies such as rcts) and routine clinical situations (effectiveness trials such as those reporting on the effects of topiramate as an add - on to other psychopharmacologic treatments) can contribute to treatment of this disorder. a 14-week, double - blind, flexible dose (25 to 600 mg / day), placebo - controlled trial assessed the efficacy of topiramate in 61 obese [body mass index (bmi) > 30 ] outpatients with bed (53 women, 8 men).14 the study sample consisted of patients aged 18 to 60 years who met dsm - iv - tr criteria for bed and had a score of > 15 on the yale brown obsessive compulsive scale modified for binge eating (ybocs - be). topiramate was administered at a dose of 100 to 600mg / day depending on response to treatment. the primary efficacy measure was the number of binge eating episodes during the 7 days before each visit. secondary measures of efficacy were the number of days in which the patient had at least one binge during the 7 days before each visit, the clinical and global impression improvement (cgi - i) and severity (cgi - s) scales, the ybocs - be, and the hamilton depression rating scale (hdrs or ham - d). physical measures included bmi, waist - to - hip ratio, and percent total body fat (measured by bioelectrical impedance). the median dose of topiramate was 212mg / day (range 50 to 600). statistical analyses were performed both as intention to treat (with the last observation carried forward) and as completer analysis. fourteen of 30 patients in the topiramate group (46.7%) and 12 of 31 patients in the placebo group (38.7%) did not complete the 14 weeks of treatment. among the causes for withdrawing from the study were adverse events (topiramate, n = 6, placebo, n = 3 ; mainly headache, paresthesia, amenorrhea, leg cramps, and sedation), lack of efficacy (topiramate, n = 1, placebo, n = 2), nonadherence to the study protocol (topiramate, n = 6 ; placebo, n = 7), and exacerbation of a preexisting medical condition (topiramate, n = 1). patients receiving topiramate achieved greater reductions in binge frequency, which was the primary outcome measure, than those in the placebo group (94% vs 46%, respectively, p 50kg / m 2 were excluded to reduce the rate of discontinuation attributable to decreased impulse control and poor health. patients were randomized to receive topiramate (195 patients) or placebo (199 patients). secondary outcome measures included binge eating episodes per week, body weight, bmi, cgi score, ybocs - be score, barrat impulsiveness scale version 11 (bis-11), three - factor eating questionnaire (tfeq), hamilton anxiety scale (ham - a), and sheenan disability scale (sds). the median dose of topiramate was 300 mg (range 25 to 400 mg / day). patients treated with topiramate achieved a significantly greater rate of reduction in binge eating days per week than those receiving placebo (from 4.6 to 0.9 vs from 4.6 to 2.2 ; = 51, p 10% compared to those receiving placebo (33.3% vs 11.5% ; = 3.71, p = 0.05). no significant differences were found between treatment groups with regard to the rate of change in the number of binge days per week, the number of binge episodes per week, or bes scores. the rate of remission for binge eating in the intent - to - treat group was significantly higher among patients taking topiramate (83.8%) than among those taking placebo (61.1%). bdi scores were significantly reduced in both treatment groups but these changes did not reach statistical significance (p = 0.20). seventeen patients (23.3% of the sample) dropped out of treatment (7 in the topiramate group, 10 in the placebo group). only one patient in the topiramate group withdrew because of adverse events, which consisted of paresthesia and confusion, probably due to the patient taking the wrong dose of medication (the exact dose was not reported in the article). the adverse events most commonly reported by patients receiving topiramate were paresthesia (48.6%), taste disturbance (24.3%), dysuria (13.5%), and leg pain (10,8%). the authors highlight the efficacy of the combination of topiramate and cbt in producing weight reduction and significant remission in bingeing in obese patients with bed. appolinario and colleagues17 described the effects of topiramate on a woman diagnosed with bed in the absence of neuropsychiatric comorbidity. this woman had reported engaging in eight binge episodes each week and had previously been treated with amphetamine - like drugs, fluoxetine, and sibutramine without benefit. the initial topiramate dose was 25 mg bid for 2 weeks, followed by an increase of 25 mg every week until she reached the target dose of 75 mg bid, which was maintained for 4 months. after the first 2 weeks of treatment, weekly binge eating decreased from 8 to 1, and the episodes completely remitted within 30 days of the onset of treatment. her respective weight and bmi, which were 109 kg and 42.5 kg / m before starting treatment, decreased to 98.6 kg and 38.5 kg / m after 4 months of treatment. schmidt do prado - lima and bacaltchuck18 described the topiramate treatment of a patient with refractory unipolar depression and comorbid bed. topiramate was added to a drug regimen consisting of methylphenidate (20mg / day) and venlafaxine (150 mg / day), and was titrated upward until a dose of 300 mg / day was reached. the patient experienced a remission in binge eating and a significant improvement in mood. because this study used a single case characterized by comorbidity and polypharmacy appolinario and colleagues19 assessed the efficacy and tolerability of topiramate in a group of obese binge eaters with no neuropsychiatric comorbidity in a 16-week, open - label study. the study sample included eight female outpatients with a bmi > 30, a diagnosis of bed according to dsm - iv criteria, and at least moderately severe binge eating behavior, defined as a bes score of > 17. the dose of topiramate was gradually increased in weekly increments of 25 mg from 25 mg twice daily during the first 2 weeks to the target dosage of 75 mg twice daily at 2 months. outcome measures included the number of days per week containing binge eating episodes (dbes), bes scores, scores on the bdi, body weight, and adverse events. in reporting outcomes, of the eight patients enrolled in the study, 6 had attended all scheduled visits, 4 patients displayed a total remission of binge eating episodes, and 2 demonstrated a marked reduction in binge frequency. two patients discontinued the trial, 1 because of diurnal somnolence at visit two and 1 due to lack of efficacy at week 6. reported side effects were transient and included paresthesia (the most common, experienced by 4 patients), fatigue, somnolence, psychomotor slowing, impaired concentration, and nausea. all patients who completed the trial showed a reduction in binge eating (dbes were reduced from 4.3 1.7 to 1.1 2.4, p = 0.03 ; bes scores decreased from 31.8 7.5 to 15.3 9.2, p = 0.04) ; a statistically significant weight loss was observed (mean 4.1 kg, p = 0.04) and depressive symptoms decreased significantly (mean bdi scores declined from 25.3 7.5 to 15.8 5.7, p = 0.02). limitations of this study are its open - label design, small sample size, and the impossibility of distinguishing between response to treatment and placebo effects, which is known to be quite high in bed. zilberstein and colleagues20 reported on the use of topiramate for bed in 16 patients who stopped losing weight after adjustable gastric banding. the authors reported a mean increase in weight loss from 20.4% to 34.1% in 14 patients after 90 days, without the need for band readjustment. two patients were reported to have intolerance to topiramate ; no further details were provided about the kinds of symptoms experienced. other anecdotal observations on the use of topiramate in three patients who underwent bariatric surgery were reported by guerdjikova and colleagues.21 these patients gained weight and showed recurrent binge eating after initially successful bariatric surgery. they reported remission of binge eating and displayed significant weight loss (31.7 kg, 14.5 kg, and 2 kg in 17, 9, and 4 months, respectively). the first concern that emerges from analyzing studies on the use of topiramate for bed is the long - term effects of this treatment. obesity is known to be a chronic health problem, and long - term relapses after initial weight loss are known to be frequent ; nevertheless, only one of the controlled studies reviewed15 involved long - term follow - up (42 weeks). this suggests caution in interpreting data, as the effects of long - term treatment with topiramate have not been extensively investigated. a second limitation of the studies reviewed is the fairly high dropout rate of up to 30%. adverse events have been discussed as a cause of patient dropout, but other causes (eg, protocol nonadherence) have not been discussed extensively. the acceptability of drug treatment by bed patients probably depends on many factors, among which the expectations of patients and motivation to change are likely to play a major role. it is noteworthy that completion rates were higher in the study of claudino and colleagues16 in which cbt was part of the study design. appropriate strategies (counseling and psychotherapy) should be tested for their effectiveness in leading patients to more realistic weight loss goals and in sustaining motivation for drug adherence and lifestyle change. a third issue is in regard to the wide exclusion criteria used by most rcts. frequent comorbidity (such as severe depression, bipolar disorder, or personality disorders) may lower the likelihood of remission of binge eating in the broad population of binge eaters compared to that of the patients considered in the trials described here. on the other hand, comorbidity can also provide indications that are valuable for targeting the pharmacological treatment to the needs of the individual patient (eg, treating a patient having bipolar symptoms with a mood stabilizer instead of an antidepressant) and should therefore be addressed in clinical research. another element that creates some difficulty in the interpretation of available data is the lack of homogeneity in psychological testing for the assessment of binge eating. scales used in the studies reviewed include the eating disorder inventory, second edition (edi-2), bes, and ybocs - be. a consensus on which assessment tool should be used would add to the comparability of the published studies. note that two of the three rcts were sponsored by the manufacturer of topiramate ; these two studies reported better results for topiramate than placebo in reducing binge eating, whereas the third rct did not find a significant effect for this drug. these results should be replicated by other independent studies to provide further evidence for the use of topiramate in bed. some authors have contended that patients who feel a subjective sense of loss of control over eating might present with a level of distress and functional impairment that is comparable to that characteristic of eating disorders, even if they do not eat large amounts of food in a discrete period of time, as required by the dsm - iv - tr definition of a binge episode.22 this category of patients is probably subject to the same hazards to health and well - being as those who satisfy all the criteria for bed. although these patients constitute a large proportion of overweight patients who fail several diet regimens and attend visits with nutritionists and eating disorders centers, indications about the role of psychopharmacological treatment in this population are just beginning to emerge.23 in conclusion, topiramate appears to be a relatively safe and effective treatment for obese subjects with bed. the drug should probably be started at 25 mg / day and increased by 25 mg / day every 1 to 2 weeks, until reaching a dose of 150 to 200 mg / day. it could then be further increased up to a dose of 400 mg / day or more for selected patients in the absence of clinical response. graphic representations of responses shown in the most comprehensive studies revealed that clinically significant changes in binge eating days per week and binge eating episodes per week should be expected after about 4 weeks of treatment, whereas effects on weight might be expected after approximately 6 to 8 weeks. topiramate appears to have a weight loss effect greater than those of other effective and well studied treatments for this disorder such as cbt, interpersonal therapy, and ssris, and one comparable to that of sibutramine.13 as noted above, depressive symptoms are frequently associated with bed, but as yet no compelling evidence exists of the efficacy of topiramate on this symptom dimension. this is partly a consequence of excluding patients with severe comorbid psychopathology from bed trials. the presence of moderate to severe depressive symptoms might be an indication for antidepressant treatment for binge eating patients. some authors have raised doubts about the tolerability of topiramate, drawing on data from the epilepsy literature ; however, the dosages used in bed patients seem to lead to a somewhat milder adverse effect profile. the risk of kidney stones has been associated with this drug, but no cases of this adverse effect have been reported in obese patients with bed. this means that some animal studies have shown adverse effects ; no controlled studies in humans have been conducted, although some case reports of hypospadia in male infants whose mothers took topiramate during pregnancy have been reported. in this context, the use of topiramate in women with childbearing potential should be decided after weighing the potential benefits to the mother against the potential risks to the fetus. further research is required regarding the long - term effects and the optimal dosing in bed patients. it will also be relevant to perform direct comparisons of the benefits and adverse effects of topiramate with those of other drugs that have been shown to be effective in reducing both binge eating and body weight in controlled trials, such as sibutramine, zonisamide, and atomoxetine. future studies should focus on the indications for and effects of pharmacotherapy and evidence - based psychological treatments (such as cbt) for eating disorders as both separate and as combined interventions because the optimal management of bed can be achieved only with a multidisciplinary and multimodal treatment approach.24 one of the studies reviewed provides a model for this approach.16 | topiramate is an anticonvulsant drug used for the treatment of epilepsy and prophylaxis of migraine. some authors have proposed its use as a mood stabilizer and have reported its efficacy in reducing impulsiveness and improving mood regulation, possibly via its antagonism to glutamatergic transmission in the lateral hypothalamus, although this indication is still controversial. weight loss is a side effect consistently reported in the medical literature in patients treated with topiramate. given its potential role in stabilizing mood and reducing impulse control problems and weight, topiramate has been proposed as a treatment for obese patients with binge eating disorder (bed). the aim of this paper is to review published data on the efficacy and safety of topiramate for the treatment of obese subjects with bed. although the evidence is preliminary, topiramate appears to be a relatively safe and effective treatment for obese subjects with bed. limitations of the studies and future directions for research are discussed. |
nmr hyperpolarization can temporarily increase nuclear spin polarization by 48 orders of magnitude, translating into corresponding increases in nmr and mri detection sensitivity. the sensitivity gains improve the detection limit, which enables new imaging methodologies including hyperpolarized mri for molecular imaging of dilute metabolites and functional contrast agents such as hyperpolarized xe. parahydrogen - based hyperpolarization techniques are special in that they transform the spin order of the parahydrogen gas singlet state into observable nuclear spin polarization (up to order unity) of other molecules. conventional parahydrogen induced polarization (phip) has relied on the molecular addition of parahydrogen to an unsaturated molecular precursor across c = c or cc bonds. this technique was further advanced by preserving the high nuclear spin order of nascent parahydrogen pairs on c sites with long t1 relaxation times exceeding 1 min. recent advances in catalysis have also enabled phip hyperpolarization of c contrast agents in biologically compatible aqueous media in seconds with successful application in living organisms. one of the main fundamental limitations of conventional phip is the requirement for an unsaturated precursor for molecular addition of parahydrogen (p - h2). this limitation has been lifted by the introduction of the signal amplification by reversible exchange (sabre) hyperpolarization technique in 2009. as with conventional phip, sabre involves p - h2 and substrate exchange on metal complexes ; however, instead of hydrogenation, hyperpolarization of the substrate molecule is achieved by transfer of spin order originating from p - h2 during the lifetime of the transient complex. despite the rapid progress of this technique with an expanding list of substrate molecules amenable to sabre and recent demonstration of heterogeneous sabre (het - sabre, where the solubilized substrate exchanges on the metal complex tethered to solid - phase support), the chemistry and the mechanism of the sabre process are still not fully understood. moreover, despite promising efforts to mitigate the poor solubility of sabre catalysts in water, this method has not been demonstrated in pure aqueous media suitable for biomedical applications the work presented here takes advantage of in situ high - resolution nmr detection of sabre at 9.4 t, which unlike low - field in situ sabre detection offers an advantage of exquisite chemical shift dispersion and high - resolution for distinguishing chemical compounds and their sites. specifically, we demonstrate in situ detection of a hyperpolarized intermediate during activation steps of the most potent sabre catalyst, [ircl(cod)(imes) ] (imes = 1,3-bis(2,4,6-trimethyl - phenyl)imidazol-2-ylidene ; cod = cyclooctadiene). it is found that the sabre effect is activated only when the cod moiety is removed via its hydrogenation to cyclooctene and cyclooctane in agreement with previous studies. furthermore, such activation requires the presence of excess substrate in order to avoid side reactions that irreversibly deactivate the catalyst (likely involving catalyst oligomerization). in situ studies of high - field sabre with the activated catalyst are consistent with substrate enhancements resulting from cross - relaxation with hyperpolarized hydride spins in a manner akin to the spin - polarization induced nuclear overhauser effect (spinoe). finally, because of the catalyst s chemical changes that occur during activation, it is possible to solubilize the activated catalyst in aqueous media, which previously has not been demonstrated without the use of organic cosolvents. sabre hyperpolarization of nicotinamide (the amide of vitamin b3) in water is shown as a proof of principle for potential biological applications. long, 5 mm medium - wall (0.77 mm - thick) nmr tubes. the end of the nmr tube (3/4 in. wall thickness) to provide high - pressure connection to a wye (for " y " shape connection) 0.25 in. push - to - connect fitting (mcmaster carr, p / n 5779k44) (figure 1). long pieces of the same 0.25 in. od teflon tubing. on one end, a push - to - connect reducing connector (mcmaster carr, p / n 5779k352) was used to connect a 0.125 in. od teflon tubing line to provide an exhaust path for used p - h2 gas exiting the solution. on the other top end, connectors (mcmaster carr, p / n 9087k121 and western analytical, p / n u-51001) were used to allow 0.125 in. i d) tubing, connected via a short flangeless nut (western analytical, p / n xp-208x), to extend all the way through the length of 5 mm nmr tube to reach to the bottom of 5 mm nmr tube to deliver fresh p - h2 gas to the bottom of nmr tube for efficient bubbling through the entire content of the nmr tube. high - pressure experiments were conducted by attaching a safety valve (one - way, calibrated to the exact pressure rating) to the exhaust gas line to allow p - h2 pressure of up to 5.1 bar. all nmr experiments were conducted using a 9.4 t (400 mhz) bruker avance iii spectrometer. the iridium [ircl(cod)(imes) ] (ir - imes) catalyst was synthesized as described previously. all sabre studies of pyridine (py) at high magnetic field were conducted with the ir - imes catalyst dissolved in either methanol - d4, ethanol - d6, or deuterated water. for the methanol - d4-based solutions, the complex consisted of 8 mm ir - imes and 47 mm py in 1 ml of methanol - d4. the ethanol - d6-based solutions contained 8 mm ir - imes and 32 mm py in 1 ml of ethanol - d6. all nmr experiments with py were performed as high - field sabre experiments wherein p - h2 was bubbled through the solution and nmr detection was performed at 9.4 t. for in situ high - field sabre detection with py, the nmr tube was placed into the magnet similar to a typical solution nmr experiment. p - h2 gas (> 90% para - state prepared using previously described instrumentation) was bubbled through a given solution at a flow rate of 0.7 ml / s under atmospheric pressure for durations ranging from 30 to 60 s, depending upon the experiment. h nmr spectra were acquired immediately (3 2 s) after the bubbling was stopped. experiments with nicotinamide utilized a solution of 3.5 mm ir - imes combined with 35 mm nicotinamide in 0.7 ml of ethanol - d6, d2o, or a mixture of both. solutions of 33% and 50% d2o in ethanol - d6 were obtained by diluting the activated ir - imes / nicotinamide solution in ethanol - d6 (0.7 ml volume) with either one or two aliquots of d2o (0.35 ml each), respectively. all sabre experiments with nicotinamide were conventional (low - field) sabre, where p - h2 was bubbled in the fringe field of the 9.4 t magnet (the solution in the nmr tube experienced 6 4 mt sabre polarization field ; this field strength was measured using a portable gauss meter). once p - h2 bubbling was stopped, the sample was quickly transferred inside a 9.4 t nmr magnet for h spectra acquisition with only a 5 2 s delay between the end of p - h2 bubbling and the beginning of the nmr spectra acquisition. during activation, p - h2 bubbling was performed under atmospheric pressure with a flow rate of 0.7 ml / s. once the nicotinamide solution was fully activated, p - h2 bubbling occurred under 5.1 bar of pressure with a flow rate of 1.2 ml / s. the experiments conducted in situ (within an 9.4 t nmr magnet) utilized no active temperature control, with the room - temperature air supply providing temperature stabilization. experimental setup for sabre with controlled parahydrogen (p - h2) bubbling through a catalytic solution in a 5 mm nmr tube. the solution sits in a medium - wall nmr tube where p - h2 is delivered via 1/16 in. a wye push - to - connect adapter allows parahydrogen to flow into the nmr tube, while allowing for the expended gas to leave the detection volume via the exhaust line. the exhaust line can be capped with a pressure - calibrated safety valve to conduct sabre at a higher p - h2 pressure. the sabre activation of ir - imes with pyridine (py) in methanol - d4 was investigated using high - resolution h nmr spectroscopy at 9.4 t (figure 2). the spectrum of the nonactivated catalytic ir complex (figure 2a) clearly displays the h chemical shift signatures of the ortho-, meta-, and para - protons of py, and the methanol solvent (4.8 ppm). upon hydrogenation by p - h2 bubbling (figure 2b), the formation of three resonances (at 12.3, 17.4, and 22.8 ppm) from hyperpolarized hydride species are observed, in addition to that from hyperpolarized orthohydrogen (o - h2) at 4.5 ppm. during catalyst activation the high - field sabre signal of py was monitored in situ. as the catalyst is subjected to additional p - h2 bubbling, the hydride intermediate is quickly depleted, leaving a single hyperpolarized hydride signal at 22.8 ppm (figure 2c). once the ir - imes - py complex is fully activated, high - field sabre signal enhancement is observed on the ortho - protons of pyridine (manifested by the large negative or emissive signals), o - h2 (manifested by positive or absorptive enhanced signals), and the hydride peaks. therefore, the introduction of p - h2 to the catalyst solution initiates the hydrogenation of the cod moiety followed by its complete removal as detected here by high - field sabre. this conclusion is further supported by the disappearance of cod proton nmr resonances in the spectra of the activated catalyst producing sabre effect (figures s1a, s1c - d, and 1d in ref (26)) a single intermediate hyperpolarized hydride species (seen as nmr resonances at 12.3 and 17.4 ppm) is likely to be short - lived (both chemically and hyperpolarization - wise with low h t1) and would be difficult to detect by performing the conventional sabre hyperpolarization procedure in low magnetic field followed by sample transfer to the high magnetic field in a high - resolution nmr spectrometer (as well as by conventional nmr without p - h2). indeed, figure 3b shows that after 12 min of p - h2 bubbling, all signatures of the hyperpolarized hydride intermediate species are absent from the h nmr spectrum. the hyperpolarized intermediate hydride species is likely the result of p - h2 pair being added in the axial and equatorial positions (vs both p - h2 exchanging in equatorial position only as shown in structure 3, figure 3a, of the fully activated ir catalyst complex). this observation is in agreement with pioneering work by bowers and weitekamp, who detected similar dispersive signatures with wilkinson s catalyst after addition of p - h2 in equatorial and axial positions of hexacoordinate rh(i) complex with similar geometry. moreover, the phase of these dispersive resonances uniquely reports on the sign of homonuclear j - coupling between two hydride protons in this intermediate species, and it is negative. series of h nmr spectra illustrating the hyperpolarization of the ir - imes - py complex in methanol - d4 by high - field sabre at 9.4 t. (a) thermally polarized spectrum of the catalytic complex and py before p - h2 is introduced to initiate high - field sabre. (b) spectrum recorded immediately after the introduction of p - h2 (first point in figure 3c) to the catalyst / py solution. note the dispersive peaks from the intermediate hydride species at 12.3 ppm and 17.4 ppm. (c) spectrum of the ir - imes - py reaction mixture after the catalyst has been completely activated through p - h2 bubbling. note that only one hydride species is seen, manifested by an absorptive peak at 22.8 ppm. additionally, the selective high - field sabre hyperpolarization of ortho - h - py protons is apparent with the opposite phase of these proton peaks. it should be pointed out that the high - field sabre of py ortho - protons effect correlates well with formation of hyperpolarized hydride at 22.8 ppm (estimated qualitatively through correlation of peak intensities of sabre enhancement of ortho - h - py peak with the rise of the ir dihydride peak), likely indicating that this species is responsible for the high - field sabre effect. the proposed mechanism for catalyst activation / formation is shown in figure 3a, where the catalyst proceeds through hydrogenation steps (intermediate ir hydride species corresponding to transient nmr resonances 1 and 2) before the fully activated species (3) is formed to yield high - field sabre hyperpolarization of py. additional evidence is provided by detection of cyclooctane / cyclooctene vs cyclooctadiene in the h nmr spectra before and after full catalyst activation, respectively (data not shown). the in situ high - field sabre may also be a potentially useful tool for studies related to identification and discrimination of classical and nonclassical hydrides in the context of sabre. we also note that while the enhancements of in situ high - field sabre described here and previously are relatively small, much larger enhancements can be observed with the application of appropriate pulse sequences. (a) schematic showing the tentative mechanisms underlying activation and sabre hyperpolarization with imes - ir catalyst and py. the hydrogenation of cod containing catalyst forms intermediate species corresponding to transient nmr resonances (1) and (2), before forming the hyperpolarized catalyst - pyridine complex corresponding to nmr resonance (3). additionally, without the presence of pyridine, the activation mechanism reverts to forming an inactive species, possibly a catalyst dimer (cat : cat)/oligomer, see supporting information) that does not hyperpolarize via sabre. (b) nmr spectra demonstrating transient dispersive nmr resonances (1 and 2) of intermediate hydride species during the activation process. (c) plot showing the decay (measured as the integrated nmr signal in magnitude mode) of the transient nmr resonances (1 and 2) ] and the rise of hyperpolarized ir the proper activation of ir - imes requires not only h2, but also the presence of sufficient substrate to form a fully coordinated ir hydride complex with sabre properties. in the absence of the ligating substrate (py), addition of h2 to the ir - imes catalyst likely results in (i) cod removal via hydrogenation and (ii) irreversible formation of inactive species (potentially dimer or trimer species). our attempts to observe sabre hyperpolarization with such catalyst states were unsuccessful even with subsequent additions of py and p - h2. additional evidence of possible dimer / trimer formation is provided in the supporting information. the potential oligomerization would be in agreement with previous observation of dimer formation of crabtree s catalyst (similar to the ir - imes catalyst used here) as well as observation of oligomerization in catalysts from the same family. from the perspective of practical consideration, deactivation of this catalyst occurs when the substrate (py or others) is either absent or present in insufficient concentrations, yielding a solution that remains yellow at the concentrations studied, while the properly activated system turns clear upon complete activation. in the high - field sabre effect, hyperpolarization occurred within the 9.4 t field of the high - resolution nmr spectrometer, and the following signal enhancements occur : ir hydride (at 22.8 ppm) and o - h2 (both with absorptive signals), and the selective (emissive) enhancement of the ortho - protons of pyridine (ortho - h - py) in free and catalyst - bound forms, figure 2c. here, the activated catalytic complex (3) was further probed to study chemical and polarization exchange in three hyperpolarized species by applying frequency selective rf irradiation during p - h2 bubbling (i.e., rf irradiation was applied throughout the entire 60 s - long bubbling step) during the build - up phase of the high - field sabre effect. application of a frequency - selective saturation rf pulse at the hyperpolarized hydride resonance frequency during sabre polarization (figure 4a) revealed that the hyperpolarized o - h2 signal (at 4.5 ppm) was suppressed along with the hydride signal (at 22.8 ppm) even with very soft (b1 7.5 hz) rf saturation. importantly, the ortho - h - py hyperpolarized signal intensities were suppressed such that the high - field sabre enhancements were significantly reduced under conditions of a relatively strong (b1 2.4 10 hz) rf saturation on the hydride spectral band (figure 4a, black trace). when rf saturation is applied at the o - h2 frequency (figure s1, supporting information), a similar trend is observed, with nearly full depletion of the hyperpolarized ir hydride peak, and partial depletion of ortho - h - py peaks as in figure 4a, black trace. shifting the rf saturation to the ortho - h - py (corresponding to free py in solution, h resonance at 8.55 ppm) resonances leads to a different trend (figure s1c, where only the ortho - h - py resonances of free py and exchangeable py (8.33 ppm) are clearly suppressed. rf saturation of free ortho - h - py has little observable effect on the hyperpolarization enhancements for ortho - h2, ir hydride, and catalyst - bound (nonexchangeable in cis- position) ortho - h - py. the one - h - phip mechanism is a potential candidate to explain the current and previous observation of high - field sabre effect, when at least one of the hydrogen atoms from p - h2 molecule is incorporated via hydrogen exchange. however, while such exchange is indeed present, and is concurrent with the sabre processes, it occurs on a much longer time scale of days and therefore can not explain high- or low - field sabre effects. on the basis of the rf saturation experimental results described above the following high - field sabre model is proposed (figure 4b). hyperpolarization of exchangeable and free ortho - h - py (the residence time of exchangeable py sites is on the order of 0.10.2 s) is induced by the hyperpolarization pool of o - h2 and ir hydride, but not the other way around. this model is in agreement with previously proposed spin polarization - induced nuclear overhauser effect (spinoe) : the catalyst s interaction with p - h2 produces high z - magnetization in the form of hyperpolarized hydride and o - h2. the close proximity of hyperpolarized hydride spins then drives the bound ortho - h - py spins out of thermal equilibrium via nuclear dipolar cross - relaxation (which then results in enhanced spectra of free ortho - h - py as well ; note that emissive enhancements would be consistent with expectation that the double - quantum term of the noe should dominate in the extreme - narrowing regime). on the other hand, reduction or destruction of the hydride / o - h2 consistent with the conclusion that p - h2 itself is not the direct source of spin order for high - field sabre. high - resolution proton nmr rf - saturation study via in situ detection of high - field sabre. (a) nmr spectra were recorded 3 2 s after p - h2 bubbling was stopped inside the 9.4 t magnet of the nmr spectrometer. the color - coded nmr spectra were recorded under conditions of variable rf - power saturation (soft (green trace) with b1 7.5 hz ; hard (black trace) with b1 2.4 10 hz ; and no (red trace) rf saturation pulses) applied at the ir hydride resonance frequency during in situ p - h2 bubbling. continuous rf irradiation on the hydride peak diminishes the polarization enhancements at both the o - h2 peak (4.5 ppm), and the ortho - h - py peaks (8.058.55 ppm) in addition to destroying the hydride hyperpolarized signal. the same trend is observed for rf - saturation at o - h2 (see supporting information) as depicted in the scheme shown in part b. however, rf saturation on the ortho - h - py has little observable effect on the polarization of ir hydride and o - h2 (see supporting information). frequency - selective rf saturation was applied during high - field sabre hyperpolarization (p - h2 bubbling for 60 s at 9.4 t). prior to activation, the ir - imes catalyst (with its cod ligand intact) is insoluble in water, even with the presence of sabre substrates such as py or nicotinamide added to the solution. therefore, organic solvents such as methanol - d4, ethanol - d6 or dmso are typically used to solubilize the ir - imes catalyst for sabre hyperpolarization. however, it was found that when the activated, hexacoordinate ir - imes complex generated in methanol or ethanol is dried, the resulting activated complex could be dissolved in pure water. this highly desirable characteristic is likely endowed by the chemical changes that accompany catalyst activation, including the loss of the hydrophobic cod moiety. motivated by the biomedical utility of hyperpolarization techniques, sabre hyperpolarization of nicotinamide in aqueous media was tested owing to the molecule s biological relevance (it belongs to the vitamin b group). here, ir - imes was activated with nicotinamide in ethanol - d6, achieving hyperpolarization on the four aromatic protons located on the pyridine ring via sabre at 6 4 mt detected at 9.4 t (figure 5a). the sabre polarization enhancements for free nicotinamide protons approach 100 and are shown in table 1. two sequential aliquots of d2o were added that resulted in reductions of sabre hyperpolarization enhancements (table 1) for all protons except for hd, which exhibited low polarization enhancements. a separately prepared (after full activation with h2 in ethanol) catalyst / nicotinamide sample was dried and then reconstituted in pure d2o. the structure of this complex is expected to be similar to that described by cowley and co - workers for this catalyst and pyridine. sabre polarization enhancements approaching 30 were observed for most nicotinamide aromatic proton peaks in 100% d2o (figure 5c). the preparation procedure for the solution corresponding to the spectrum shown in figure 5c was different from those reported earlier by zeng and co - workers, mewis and coworkers, and hvener and co - workers in that once the sabre catalyst activation is achieved in ethanol, the activated complex solution is dried on a rotovap first, and the catalyst / nicotinamide mixture is then reconstituted in 100% d2o. first, the water - insoluble cod and its hydrogenation products do not migrate into the aqueous phase. moreover, the use of 10% alcohol in previous works prevents potential in vivo injections, while 100% d2o solutions prepared using the method described here potentially allows for in vivo use of sabre hyperpolarized contrast agents via intravenous administration. the smaller polarization enhancements achieved in d2o versus the organic solvents can be largely attributed to the reduced solubility of hydrogen gas in water. previous studies have shown that h2 is up to 14 times more soluble by molar fraction in organic solvents than in water. the reduced solubility of h2 in aqueous media limited the effectiveness of p - h2 bubbling in our setup and hindered the ability of p - h2 to interact with the catalytic ir complex needed for sabre to occur. however, potential solutions such as increasing the partial p - h2 pressure may recover the enhancement reduction in water versus that observed in ethanol. moreover, the decrease in the sabre signal enhancements in water vs ethanol may be also caused by the difference in t1 relaxation times, which can be lower in aqueous media compared to that in organic solvent media. furthermore, the low - field sabre proton signal enhancements for nicotinamide in ethanol were significantly lower than sabre enhancements reported by other groups, when using more advanced specialized sabre equipment. the experimental limitations (including the lack of precise field control, introduction of p - h2 via bubbling and potentially longer nmr sample shuttling time) resulted in significantly reduced sabre signal enhancements in the presented study. therefore, the reported enhancements for nicotinamide in water can be potentially significantly improved using more advanced hyperpolarization hardware as well the optimization of temperature and p - h2 pressure, because these experimental variables are related to nicotinamide residency / sabre contact time on this ir - dihydride complex. conventional (low - field) sabre hyperpolarization of nicotinamide in ethanol - d6 (a) and in d2o (c) yields signal enhancement of four aromatic proton peaks of interest (ha, hb, hc, and hd), with the position of each proton labeled in the structure inset. the enhancement () values for sabre polarization of nicotinamide using the ir - imes catalyst can be found in table 1. the respective thermally polarized reference h nmr spectra of nicotinamide in ethanol - d6 and d2o are shown in parts b and d ; these thermal spectra are magnified by 20-fold relative to the corresponding hyperpolarized spectra. peak heights in thermal spectrum of aqueous sample vs thermal spectrum of the sample in ethanol - d6 is likely the result of partial sample reconstitution from the dried solid into aqueous medium. note that sabre was conducted conventionally at low field (6 4 mt), and it was detected by high - resolution proton nmr spectroscopy (at 9.4 t) using the activated ir - imes catalyst in ethanol - d6 and d2o. the activation and mechanism for hyperpolarization of the ir - imes catalyst in alcoholic and aqueous media was probed using in situ high - field sabre. introduction of p - h2 to the catalyst in the presence of pyridine substrate initiates a hydrogenation of the cod moiety, leading to intermediate species. sabre hyperpolarization of the activated catalytic complex results in the enhancement of ir hydride, o - h2, and ortho - h - py protons in free and catalyst - bound forms. rf saturation studies probing polarization and chemical exchange of the hyperpolarized species support the conclusion that substrate hyperpolarization at high field (9.4 t) arises from cross - relaxation with protons belonging to the hyperpolarized hydride / o - h2 spin bath. once activated and dried, the ir - imes catalyst was found to be soluble in aqueous media with either py and nicotinamide substrates incorporated into its hexacoordinate structure. sabre of nicotinamide substrate in d2o was conducted using conventional low - field sabre and detected at 9.4 t. the sabre enhancements achieved in aqueous media, while significant (30), were somewhat smaller than those in ethanol - d6 (table 1)which likely reflects the lower solubility of hydrogen gas in water versus ethanol. nevertheless, the sabre enhancements in water can be potentially increased through the use of higher p - h2 partial pressures (e.g., 10 bar) frequently used in conventional phip. furthermore, additional gains of aqueous sabre enhancements may be realized through better mixing of catalyst / substrate solution with p - h2, which has already been shown through the use of solution spray injection in p - h2 atmosphere, or hollow fiber membranes, and the optimization of other conditions (e.g., temperature and magnetic field). in any case, the ability to conduct sabre hyperpolarization with biologically relevant molecules in aqueous media significantly increases the value of sabre to generate hyperpolarized contrast agents for in vivo molecular imaging eliminating one of the major shortcomings of the sabre hyperpolarization method. furthermore, other substrates beyond those studied here can be potentially hyperpolarized in aqueous media, including recently reported tuberculosis drugs pyrazinamide and isoniazid. finally, it may be possible to combine aqueous sabre hyperpolarization with het - sabre, potentially allowing the preparation of pure aqueous hyperpolarized contrast agents with a recyclable catalyst. the latter can potentially enable not only clinical translation of this hyperpolarization technique, but also high - speed and high - throughput production of hyperpolarized contrast agents at relatively low cost. | activation of a catalyst [ircl(cod)(imes) ] (imes = 1,3-bis(2,4,6-trimethylphenyl)imidazol-2-ylidene ; cod = cyclooctadiene) ] for signal amplification by reversible exchange (sabre) was monitored by in situ hyperpolarized proton nmr at 9.4 t. during the catalyst - activation process, the cod moiety undergoes hydrogenation that leads to its complete removal from the ir complex. a transient hydride intermediate of the catalyst is observed via its hyperpolarized signatures, which could not be detected using conventional nonhyperpolarized solution nmr. sabre enhancement of the pyridine substrate can be fully rendered only after removal of the cod moiety ; failure to properly activate the catalyst in the presence of sufficient substrate can lead to irreversible deactivation consistent with oligomerization of the catalyst molecules. following catalyst activation, results from selective rf - saturation studies support the hypothesis that substrate polarization at high field arises from nuclear cross - relaxation with hyperpolarized 1h spins of the hydride / orthohydrogen spin bath. importantly, the chemical changes that accompanied the catalyst s full activation were also found to endow the catalyst with water solubility, here used to demonstrate sabre hyperpolarization of nicotinamide in water without the need for any organic cosolvent paving the way to various biomedical applications of sabre hyperpolarization methods. |
osteoid osteoma usually a symptomatic disease in the second or third decades of life, rarely found in patients over 40 years of age, and approximately twice as many men as women are affected (13). osteoid osteoma is also a relatively uncommon benign osteoblastic tumor, first described by jaffe in 1935. it consists of an area of variably calcified osteoid tissue commonly called a nidus within a stroma of relatively loose vascular connective tissue with a rim of sclerotic reactive bone, less than 1 cm in diameters, surroundings the lesion (4). the pain is more severe at night and often often relieved by nonsteroidal anti - inflammatory agents (nsaid). the second most common complaint is swelling, which often occurs in form of painless osteoid osteoma (46). (2, 8) between 19% and 31% of all osteoid osteoma present in the upper extremity, and of all cases of osteoid osteoma cases, lesions in the hand and wrist comprised 5 to 15% (2, 4, 5). records of the 25 patients (who had pathological reports of osteoid osteoma for hand and wrist) were reviewed. all patients underwent surgery by hand surgeon, in microsurgical unit of shafa yahyaian hospital between 1992 and 2011. all patient data including signs, symptoms, history of trauma, night pain, relief of pain by nsaids and duration from onset of symptoms to operation were recorded. the diagnosis was made using plain x - rays, three- phase technetium bone scans, ct and mri, and histological examinations confirmed the diagnosis in all cases. the means and standard deviations (sd) were also derived to analyze the measured data statistically. the means and standard deviations (sd) were also derived to analyze the measured data statistically. this paper reports on 25 cases of osteoid osteoma in the hand and wrist at 20 years period. there were twenty - one men and four women, with an average age of 25.2 7.6 (range : 16 - 46) years. twenty osteoid osteoma were in the right and five in the left side of hands. fifteen were in the finger phalanges (ten proximal and five distal phalanges), four in the metacarpals, five in the wrist (two in scaphoid, two in capitate and one in trapezium) and one in the styloid of radius. the pain was gradually increased and initially intermittent, but later became more constant and severe. the pain was unaffected by activity and twenty - one of these patients had night pain and in 17 patients partial pain relief obtained by aspirin (five patients had no relief and 3 were not investigated). blood analyses were normal for all patients, but a history of trauma prior to the onset of symptoms found in five patients. physical examination at presentation revealed local swelling and point tenderness. whenever the osteoid osteoma was close to a joint, restriction of motion and muscle along with atrophy were sometimes present. the physical findings varied with the site of the tumor. in the phalanges, osteoid osteoma induced marked fusiform soft tissue swelling. proximal phalanx involvement was characterized by a grossly enlarged phalanx with hypertrophy of the soft tissues, and distal phalanx involvement caused finger clubbing, with enlargement of the phalanx, and sometimes hypertrophy of the nail and obliteration of the normal angle between the base of the nail and the skin. the diagnosis was made using plain x - rays, three - phase technetium bone scans, ct and mri. only thirteen patients had the characteristic appearances of osteoid osteoma on x - ray and twelve non - specific appearances on initial x - rays. three - phase tc- 99 bone scans were done on twenty patients, showed an intense well - defined focal area increased activity during all the three - phase of the scan in eighteen patients. in two cases, eighteen ct scans were performed and showed the osteoid osteoma in every case as an obvious lytic lesion with a central granular opacity surrounded by a well - defined sclerotic margin. the mri was performed on fifteen cases, and clearly showed an intense soft tissue reaction around the lesion. the mean delay from the onset of symptoms to definitive treatment was 16.311.1 months (range, 3months to 4 years). twenty - one patients were treated surgically with excisional biopsy and four with curettage and bone grafting. gender, age, range and number of cases at the wrist and hand for 25 patients with osteoid osteoma. follow up 36.646.9 months (range, 3 months to 8 years), twenty patients had no pain or tenderness, and five had recurrence after first surgery in which three of them were initially operated in elsewhere. location of the primary osteoid osteoma at recurrence group consisted of one in the metacarpal bone, two in the distal and two in the proximal phalanx. all patients treated surgically by excisional biopsy (3 patients) or curettage plus bone grafting (2 patients), and patients at follow up of 31.211.2 month (recurrence group) were well and had no pain. osteoid osteomas usually turned into symptomatic disease in the second or third decades of life, and rarely occurred in patients with 40 years of age. approximately twice as many men as women are affected (3, 5, 9). the men to women ratio was 5.25 and right to left side hand ratio 4. all studied patients were in second, third or fourth decades and only in one case over 40 years of age. ghiam and bora described 3 carpal tumors in two patients and combined these in the literature to establish a series of 26 cases of carpal osteoid osteomas. the scaphoid was the most commonly involved bone, with the hamate second and the capitate the third most frequently involved carpal bone (10). marcuzzi & leti reports of 18 osteoid osteomas of the wrist and hand, two cases was in the scaphoid, two in lunate and one in capitate, and ambrosia & wold reported of 19 cases of osteoid osteomas in which included two in capitate, one in hamate and one in the triquetrum (11). we had only five cases in the carpal bone (two in the scaphoid, two in the capitate and one in the trapezium bone). the most common complaint was pain, often described as being more severe at night. healey reported improvement of pain after aspirin treatment (3). in the series presented by bender, 86% of patients with an osteoid osteoma of upper extremity also reported pain relief with aspirin use (2). we evaluated relief of pain with nsaid only in 21 patients and found relief of pain in 16 cases (76%). when the tumor was located near a joint, it may reduce range of motion and mimic primary arthritis. in the phalanges, typically a fusiform soft - tissue swelling existed with enlargement and clubbing of the phalanges. the mechanism that developed this feature was unclear, but it appeared to be in response to a presumably humoral substance produced by the tumor. this may directly induced proliferation of connective tissue, bone changes and dilation of blood vessels. furthermore the edema, produced by local hyperaemia and inflammatory factor release, increases the distance through which oxygen must diffuse before reaching the cells, possibly causing a localized hypoxaemia. this stagnant hypoxia can indirectly induce enlargement of the finger and clubbing of the distal phalanx (4). initial x - ray examinations were often normal, as was the case in 12 of our cases, but a three - phase technetium-99 m bone scan detected the lesion which was characterized by an intense well - defined focal area of increased uptake, and is readily apparent in all three phases and only in one patient diffuse increase in isotope uptake was seen. osteoid osteoma of trapezoid bone of 31 years old men with wrist pain since 18 month ago. c : ct scan shows nidus at trapezoid (incidental bone iland at triquetrum). d : the mri shows diffuse edema at wrist. when the bone scan was positive or equivocal with normal radiographs, computed tomograms employed this was superior to conventional radiography and mri, not only for diagnosis, but also for surgical planning and follow - up of osteoid osteoma of the small bones in hand. the wrist mri showed the tissue reaction around the tumor (1, 2, 11, 12). specialized imaging techniques may hasten the diagnosis, but only an accurate clinical history with a high index of suspicion allows one to arrange the appropriate investigations. treatment of osteoid osteoma consisted of curettage or en bloc excision of the tumor, which resulted in almost immediate relief of pain. pre - operative ct assessment of the lesion greatly assist the surgeon and increases the likelihood of an adequate surgical excision. packing the defect after curettage with cancellous bone chip may not be necessary, but incomplete removal may lead to recurrence or continuation of symptoms. nowadays the operative treatment is not the only modality recommended to the patients and their family but it is also an alternative choice. osteoid osteomas, relatively rare lesions in the hand and wrist that can be a persistent source of hand and wrist pain. relief of pain with oral nsaid, most notably aspirin, should suggest the possibility of osteoid osteoma. finally, if the nidus can not be clearly visualized by radiography and bone scan, a ct scan should be recommended. | backgroundthe hand and wrist bones are infrequent sites for osteoid osteoma, and its diagnosis can be difficult. this paper reports 25 cases of osteoid osteoma in the hand and wrist.methodsrecords of the 25 patients who had pathological conditions of osteoid osteoma of the hand and wrist were reviewed and analyzed.resultstwenty-five cases of osteoid osteoma of the hand and wrist were treated in 20 years period. the average age was 25.27.6 years (range, 16 to 46 years) with men to women and right to left side ratio of 5.25 and 4 respectively. the most common site was in the proximal phalanx (ten cases). the diagnosis was made using x - rays, three- phase technetium bone scans, ct, and mri and all the diagnoses were confirmed by histological examination. the average time from the onset of symptom to successful treatment was 16.311.1 months, and at a mean follow - up of 36.646.9 mouths. five recurrences of disease took place in which three of them were operated elsewhere. all five patients subsequently were treated and cured by reoperation.conclusionosteoid osteoma is relatively rare lesions in the hand and wrist that can be a persistent source of hand and wrist pain. patients under age of 40 who have otherwise unexplained pain should be evaluated. |
dura closure is a very important last step in the performance of the posterior fossa approach. primary dural closure is often technically difficult and requires use of substitutes either autologous materials (fat graft, pericranium) or dural sealant augmentation. various techniques and products are used to ensure watertight dural closure - failure of which lead to dire consequences. posterior fossa approaches are often accompanied with complications like cerebrospinal fluid (csf) leakage, surgical site infection, meningitis, pseudomeningocele formation and delayed hydrocephalus. treatment of csf leaks leads to profound morbidity with increased hospital stay and its cost has been estimated to be one and half times greater than uncomplicated cases. the two main techniques used in ensuring water tight dural closure in posterior fossa surgery are the use of autologous materials and dural substitutes with dural sealant augmentation. dural substitutes like bovine collagen matrix are accompanied with a rate of 50% complications, whereas in general the risk is about 22%. not only the differences in the material is described, but also the different suture techniques, which show no significant shift by comparison. sealants increase the water tightness of suture significantly with variations in water tightness capacities of different sealants. this study presents our experience with the sandwich technique of dural closure using a combination of autologous dura, dural substitute and fibrin glue. this is a retrospective technique study. in accordance to the chamber of medical doctors of north rhine westfalia, germany, no institutional review board (irb) the charts of patients > 18 years old (mean age : 60.7 years) were analyzed, which were operated in our department from 2009 - 2013. the female to male ratio was 1.08:1. the follow up period was 6 months (until the second postsurgical control visit). after removing the pathology in the posterior fossa, dural closure follows a sandwich closure with lyophilized dura, which is sutured on the dural edges, suturing the dura as tight as possible and placement of fibrin coated watertight sealant over the dura and under the edges of the craniotomy. in a next step the bone is replaced with polymethylmethacrylate, which is fixed as shown in figure 1a - f. in almost all cases we placed bur holes on the lower edge of the transverse sinus and figure 2 shows intraoperative images of the closure method and figure 3 illustrates pre- and postoperative images. after removing the pathology in the posterior fossa, dural closure follows a sandwich closure with lyophilized dura, which is sutured on the dural edges, suturing the dura as tight as possible and placement of fibrin coated watertight sealant over the dura and under the edges of the craniotomy. in a next step the bone is replaced with polymethylmethacrylate, which is fixed as shown in figure 1a - f. in almost all cases we placed bur holes on the lower edge of the transverse sinus and figure 2 shows intraoperative images of the closure method and figure 3 illustrates pre- and postoperative images. the patients were operated on variable pathologies with the greatest number representing astro-/oligodendroglial tumors (110), metastases (80), meningioma (30), glioblastoma (15) and acoustic neuroma (30). all other pathologies were represented by numbers < 10 (arteriovenous malformation, meningocele, cavernoma, abscess, ependymomy, medulloblastoma, lymphoma, cyst, ganglioma, teratoma, amyloid angiopathy, arnold - chiari malformation, bone tumor). the general health status (risk factors like hypertonia, adipose patients, etc.) of the individuals was not significantly different compared to the general population. only 3.8% of patients developed csf leakage and only 0.5% needed a second surgery for csf leakage closure. by csf leakage we mean a subcutaneous palpable mass, which is leaking outside the wound or not. two percent had a cerebellar bleeding with no need for re - operation and 3% had a wound infection treated with antibiotics. five patients developed a hydrocephalus and there was no significant difference between the csf leakage rate in these patients and patients without hydrocephalus although the number of patients was too small to allow a statistical comparison. there was also not a statistical difference between csf leakage and patients with extended opening of the arachnoid. there are different dural closure techniques in use ranging from meticulous primary dural closure using interrupted or continuous stitches, use of dural substitutes - autologous (fat graft, fascia, pericranium) and synthetic. many neurosurgeons use autologous materials or dural substitutes due to the associated lesser complication rates. complication rates following posterior fossa surgeries vary between 1 and 10%. various aspects of the surgical approach and closure technique contribute to the complication rate. csf leakages following posterior fossa surgery has remained an unsolved problem since the era of cushing and constitute a major post operative complication due to potentially life threatening sequelae and delay beginning of adjuvant therapy in oncologic cases. it occurs in 2 - 17% following posterior fossa surgery. in the present study the combination of those techniques, as it is in the sandwich technique, reduces the csf leakage complication rate to 3.8% (only 0.5% needed a surgical revision) which is low compared to the complication rate described in the literature. the 0.5% of patients needed a second surgery for csf leakage closure which is better compared to 3.7% in a similar study. the rest of the patients with csf leakage were managed by a lumbar drain for 5 - 7 days. the 2% of the patients had cerebellar bleeding with no need of re - operation and 3% had a wound infection treated with antibiotics to good effect. the sandwich wound closure we applied for posterior fossa surgery in our patients, correlates with a significant reduction of csf leaks compared to the literature and less need for surgical closure for the few who had csf leaks. | posterior fossa surgery is demanding and hides a significant number of obstacles starting from the approach to the wound closure. the risk of cerebrospinal fluid (csf) leakage in posterior fossa surgery given in the literature is around 8%. the present study aims to introduce a sandwich closure of the dura in posterior fossa surgery, which reduces significantly the number of csf leaks (3.8%) in the patients treated in our department. three hundred and ten patients treated in our hospital in the years 2009 - 2013 for posterior fossa pathologies were retrospectively evaluated. the dura closure method was as following : lyophilized dura put under the dura and sealed with fibrin glue and sutures, dura adapting stitches, tachosil (takeda pharma a / s, roskilde, denmark), gelfoam (pfizer inc., new york, ny, usa) and polymethylmethacrylate (osteoclastic craniotomy). the incidence of postsurgical complications associated with the dural closure like csf leakage, infections, bleeding is evaluated. only 3.8% of patients developed csf leakage and only 0.5% needed a second surgery for csf leakage closure. two percent had a cerebellar bleeding with no need for re - operation and 3% had a wound infection treated with antibiotics. the sandwich wound closure we are applying for posterior fossa surgery in our patients correlates with a significant reduction of csf leaks compared to the literature. |
if the purpose is to understand pathogenic mechanisms, the animal model should mimic as closely as possible the symptoms, neuropathology, and mechanisms of the disease. conversely, if the purpose is to demonstrate the potential efficacy of a drug, the animal model could be less complex, but should be easily available in large quantities and reasonably priced. on the basis of the clinical description of mci and other considerations, the ideal features of an mci animal model are listed in table i. the number of these features actually present in the models may vary according to the animal species used. cerebrovascular alterations should be present only in models reproducing mci occurring in patients affected by cerebrovascular diseases. in attempting to identify mci animal models, this problem parallels the situation facing the clinician having to distinguish between mci and the initial stages of ad. since a characteristic of ad is the degeneration of forebrain cholinergic neurons, animal models of ad were obtained by destroying the forebrain cholinergic nuclei, namely the nucleus basalis, in the rat through the use of neurotoxins. rats with small lesions in the nucleus basalis show only limited cognitive impairment associated with a modest cholinergic deficit and present at least two of the features listed in table i, namely subtle memory impairment and mild neuropathological lesions. they could reasonably be considered a model of mci or of the prodromal phase in ad. in an extensive review of animal models of the mnemonic impairment in ad, mcdonald and overmier conclude that those with a lesion in the medial septal nucleus show behavioral deficits that are most similar to the memory impairment observed in the earliest stage of ad. transgenic mice overexpressing -amyloid (a) and presenilin 1, and aging animals in general, including aging monkeys, are commonly used as animal models in ad research. in all these models, the discriminating criteria between mci and ad models are the severity of damage induced by the lesions, and the age at onset and severity of the cognitive impairment in the rats, monkeys, and transgenic mice under study. memory loss complaints are the first and most important symptom of mci and the most obvious expression of the cognitive impairment. cognitive impairment can be easily induced pharmacologically in animals by administering anticholinergic agents, such as scopolamine. however, according to sarter, this creates an indiscriminate model, since too many of the drugs tested on it gave positive results, but then failed to pass further, more specific testing. other pharmacological models of memory impairment can be created by blocking the glutamate n - methyl - d - aspartate (nmda)-type receptors, and by administering benzodiazepines. however, the animals showing drug - induced memory impairment can not be considered to be models of mci, as they only show one of the features listed in table i, ie, memory impairment. they are, however, useful tools in the investigation of cognitive mechanisms and their neurotransmitter systems, and for rapid and inexpensive screening of new molecules that are potentially active on cognitive deficits. animals with cognitive impairment resulting from lesions in the forebrain cholinergic system, induced by neurotoxin administration, will not be included in this overview either, since they are considered a model of ad, and their deficit in learning and memory is often too severe. aging rats have been used extensively for investigating age - dependent memory impairment, and the underlying neurochemical changes, and for studying drugs that are potentially active on the aging process. out of the extensive literature on the learning and memory impairment in aging rats, we can select studies comparing the cognitive behavior of rats of different ages (young, middle - aged, and old) and those in which middle - aged rats were used. after analyzing the collected data, an attempt has been made, in the following paragraph, to answer two questions : (i) to what extent can aging be considered a model of mci ; and (ii) what is the earliest age at which a decline in learning and memory can be detected in the rat ? in male wistar rats, pepeu demonstrated that a statistically significant impairment in the acquisition and retention of a passive avoidance conditioned response can be detected at 16 months of age, and the impairment severity gradually increases in the following months. in the same rat strain, a statistically significant impairment in object recognition was detected at 20 to 22 months of age, using a 6q - min intertrial time, while at 16 to 18 months there was only a slight reduction of the discrimination index in comparison with the 3-month - old rats. thus, it can be assumed that, if the intertrial time is longer, impairment could also be detected in younger rats. in a social memory / recognition task in which 3-, 15-, and 22-month - old fischer-344 rats were exposed to a novel female stimulus, a significant shortening in the exploration time had already occurred in the 15-month - old rats, in comparison with the 3-month - old ones, when a novel female stimulus was introduced, while the 22-month - old rats failed to investigate the stimulus. fuchs reported that 19-month - old rats from the emd : wi - af / han strain showed an impairment in the acquisition of a one - way avoidance task, but acquired a two - way avoidance task (shuttle - box) as well as 3-month - old rats ; 33-month - old rats showed a marked impairment in both tasks. middle - aged (14-month - old) long - evans rats took significantly longer than young (3-month - old) animals to retrieve their rewards and made significantly more errors in an eight - arm radial maze paradigm. in the morris water maze, a progressive decline in spatial learning was demonstrated between groups of 3-, 12-, 18-, 24-, and 30-month - old female sprague - dawley rats. if time and distance covered to find the platform were compared, an impairment in acquisition appeared in the 24-month - old rats, and was markedly increased in the 30-month - old rats. however, if the rats were divided into cognitively impaired and not impaired groups, using the value of 2 standard deviations from the mean performance of the 3-month - old rats as the criterion, 8% of the rats were already cognitively impaired at 12 months and 45% at 18 months of age. similarly, 50% of female dark agouti rats already showed a learning deficit at 14 months of age, using a complex maze task, and 71% of the rats were impaired at 26 months of age. however, dividing the rats into cognitively impaired and not impaired groups was too strict a criterion to identify mci rats, which presumably fall into the not impaired group. for instance, by testing fischer-344 male rats in the morris water maze, lindner were able to detect a difference in performance, evaluated as distance swam, between 2- and 16-month - old rats and observed that the aging rats had more impairment in the reference memory task, which was tested by keeping the target location in the same place, but using a longer intertrial interval than in the working memory task, in which the target location was changed, but the intertrial interval was short. increasing the retention time, ie, the interval between acquisition and testing, is a simple and effective procedure for unmasking memory deficits in aging rats. in a non - matching - to - sample task, 15- and 24-month - old sprague - dawley rats did not show any deficit if the delay between the sample and choice responses was 0 s, but an impairment was revealed when variable 0 to 24 s delay intervals were introduced. by increasing the delay, memory impairment was detected in 17-month - old rats performing a delayed alternation task. fourteen months is also the age at which a decline in memory ability, tested by an allocentric place determination task in a water maze, was detected in fisher-344 rats, individually followed throughout their life, as a decrease in accuracy. the decline progressed with age and could be reversed by inhibiting cholinesterase with physostigmine at the age of 22 to 23 months, but not at 26 to 27 months. an improvement in spatial learning was reported in navigation in a water maze, evaluated as time required to reach the platform, in 20-month - old lister hooded rats receiving 40 to 80 mg / day aspirin in their drinking water. the above data, some of which are also presented in table ii for an easier comparison, make it possible to answer the question regarding the age at which cognitive impairment can be detected in the rat. it appears that the possibility of detecting an initial cognitive impairment in animals, mimicking mci in humans, depends on many factors : the task that the animals are trained to acquire, the procedure used to train them to meet the criterion, the strain, and, most importantly, the interval between acquisition and recall. environmental influences also play a role, as demonstrated by the finding that long - evans aging rats kept in an enriched environment made fewer errors in a maze than rats of the same age kept in an impoverished environment. with appropriate tests, fisher-344 rats show cognitive impairment slightly earlier than other strains, but by 16 to 18 months of age some subtle deficits can be observed in both sexes of most strains. the strain differences in water maze acquisition and recall were extensively investigated by wyss comparing sprague - dawley, wistar - kyoto, and spontaneously hypertensive rats (shrs) in the morris water maze paradigm. sprague - dawley rats showed that spatial learning began to decline between 12 and 18 months of age and fell off precipitously between 18 and 24 months of age. both wistar - kyoto and shr strains already showed impairment at 12 months of age. in 14- to 19-month - old rats, many of the features that should characterize the mci animal model, listed in table i, are present : first, by definition, old age, then the subtle memory impairment and mild neuropathological changes. among the latter, astrogliosis has been described in aging wistar rats, a loss of cholinergic neurons has already been observed in cognitively impaired rats at 14 months of age, and a large decrease in acetylcholine (ach) release from the cerebral cortex, hippocampus, and striatum has been reported in 19-month - old wistar rats. moreover, in the age range of 14 to 19 months, the motor activity and feeding behavior of the rats are still similar to those of young adult rats. it should be mentioned that gallangher explicitly considers age - related cognitive decline in rats as a naturally occurring animal model of mci. aging rats have been widely used for testing drugs potentially useful for treating memory deficits and senile dementia. a few examples of drug - induced memory improvement, taken from the author 's experience, will be mentioned. a recovery of age - associated impairment in the acquisition of a passive avoidance response was observed in 18-month - old rats treated with phosphatidylserine intraperitoneally (ip) for 7 days. nerve growth factor (ngf), administered intracerebroventricularly (icv) for 14 days, restored age - impaired object recognition in 20-month - old rats. a single administration of aniracetam was able to restore object recognition in 22-month - old rats. drugs aimed to facilitate learning may have no effect in young rats, but improve the performance in aging rats and the size of the improvement is, to some extent, proportional to the severity of cognitive impairment. for instance, the effect of the ampakine bdp-12 in restoring retention to the level of young rats was larger in middle - aged rats with minimal experience in the maze than in those with extensive maze experience. the a-adrenoceptor agonist medetomidine, tested on a delayed alternation task, exerted no effect in young rats, a small effect at 7 to 11 months, and significant improvement in performance at 17 to 18 months of age. on the other hand, according to takefumi, physostigmine ameliorated the performance of a place navigation task in 22- to 23-month - old rats, but lost its effect in 26- to 27-month - old rats. to conclude this section, the middle - aged rat appears to be a useful and convenient model for mci, but with the caveat that the therapeutic efficacy of very few of the many candidate drugs tested on this model was later confirmed beyond doubt in clinical trials. false - positive drugs, ie, drugs very active in the animal tests, but with limited or no clinical efficacy. the correlation between hypertension and memory impairment is well known and has been repeatedly confirmed. shrs are considered a model of human hypertension and cardiovascular disease. in these animals, a learning impairment, expressed as more days needed to reach criterion and more errors made, can be observed in a radial maze test at 12 months of age, earlier than in normotensive rats of the same strain and other strains at the same age. less efficient learning, demonstrated by longer latencies in finding the hidden platform, with normal swim speed, was observed by comparing shrs with normotensive wistar - kyoto rats. the longer time needed for learning and remembering observed in the shr model is reminiscent of the slowing in cognitive performance, accompanied by relatively mild impairments of memory, that characterize vascular cognitive impairment in humans. shrs show hypertensive brain damage including astrogliosis, cytoskeletal breakdown, and hippocampal atrophy at an early age, and subtle cholinergic deficits. long - term treatment with angiotensin - converting enzyme (ace) inhibitors lowers blood pressure and prevents the cognitive impairment. however, the cognitive impairment in shrs can also be improved by cognition enhancer agents, such as oxiracetam. in conclusion, shrs show mild cognitive deficits and limited neuropathological lesions, including some damage to the cholinergic system. therefore, they mimic the initial phases of the vascular cognitive impairment, which may stabilize or progress toward vascular dementia with much severer cognitive impairments. models of this progression to vascular dementia, could include transient cerebral ischemia, bilateral middle artery occlusion, and global cerebral ischemia, which all induce extensive neuropathological changes associated with severe cognitive impairment. for a long time, mice have been less popular than rats for studying brain aging, mainly because much less neuroanatomical and neurochemical information was available on mice than on rats. in recent years, the generation of many types of transgenic mice, including those over - expressing amyloid precursor protein (app), have brought mice to the forefront of aging research since they present extensive a deposition and can be considered an animal model of ad. dean studied age - related behavioral differences in the c57bl mouse and observed that, in the passive avoidance test, the number of mice failing to avoid the dark chamber in which the mice had previously been shocked is higher at 9 than at 3 months of age. similarly, 10-month - old mice need a higher number of trials to criterion in a t - maze task than the 3-month - old mice. the cognitive impairment revealed by these tests becomes progressively more severe at 23 and 31 months of age. impairment in the acquisition and retention of the water maze task was detected in 18- to 19-month - old c57bl mice and was associated with a decrease in the volume of the septal cholinergic neurons. it has already been mentioned that mci can be considered to be a transitional state between normal aging and dementia. since transgenic mice presenting a deposits are considered to be a model of ad, it should be possible to detect a prodromal phase of the disease with the features of mci. the learning deficit related to age and a plaques was investigated by chen in pdapp transgenic mice and nontransgenic mice of different ages. age did not affect the object recognition test in transgenic or wild - type mice. conversely, in the morris maze test, an age - related impairment of spatial memory was evident in both groups of mice, but was clearly more profound in the transgenic mice, and a relationship was found between the a plaque burden and learning impairment. however, only in the group of young (9 months) transgenic mice was it possible to detect an impairment in learning the first platform location that was associated with a minimal plaque burden and could reasonably be considered as mci. retardation in initial learning and in learning a new escape location had also been previously observed in transgenic mice for app695 in which no amyloid deposition was detected. in contrast to these results, westerman demonstrated that, in tg 2576 mice overexpressing human app695 with the swedish mutation, spatial memory impairment, evaluated in the morris water maze, could be detected beginning from the age of 6 to 11 months and coincided with the appearance of the insoluble form of a. in testing a similar strain in a passive avoidance task, it was demonstrated that, in the transgenic mice, memory impairment appeared at about 8 months of age and progressed with aging. at 8 months, there were few senile plaques and an initial decrease in ach content in several brain regions including the cortex and the hippocampus. the present analysis was confined to the relatively few papers in which memory and learning were investigated in transgenic mice in the early stages of the disease development, omitting the large number of papers in which old mice with a marked cognitive impairment and extensive neuropathology were used. we believe that transgenic mice overexpressing mutated human app, in an early stage, around 8 to 10 months of age, and showing an initial cognitive impairment, few a deposits, and some cholinergic deficit could be considered a model of mci. these mice have been used for testing treatments, such as vaccination, aiming to prevent a deposition and subsequent memory loss. conversely, in 6-month - old tg 2576 mice, a 6-month treatment with ginkgo biloba did not prevent the plaque deposition and protein oxidation, but reduced the spatial memory impairment. these papers demonstrate that transgenic mice overexpressing a may be useful models for testing drugs potentially active in preventing or delaying the conversion from mci to ad. monkeys of different species have been widely used for studying the effect of age on memory, beginning from the classic papers by bartus. a review comparing the memory changes occurring in normal aging in humans, nonhuman primates, and rats was published in 2003 by erickson and barnes. given the similarities in cognitive aging between human and nonhuman primates, mci should also occur in the latter. however, in most papers in which the age - associated changes in cognitive processes have been investigated in monkeys, only two groups of monkeys, young and old, were compared. in rhesus monkeys, the species that is most commonly used, the age of young animals ranges between 3 and 10 years and that of the old between 23 and 30 years. within the latter age range, memory impaired and unimpaired monkeys can be recognized, but impairment also depends on the task that the animals are required to perform. for instance, aged monkeys were impaired in a delayed response test of visuospatial memory when the retention interval of the task was increased from 0 to 10 s. when trained in a delayed non - matching - to - sample test of visual object recognition memory, the aged animals took longer to learn the task, but were only minimally impaired if recognition memory was tested at retention intervals ranging from 10 s to 22 h. in contrast to their relatively intact performance in the object recognition task, the same monkeys were dramatically impaired in a second version of the test that required subjects to remember the temporal order in which objects were presented. in a comparison of four groups of monkeys aged 3 to 6, 14 to 17, 20 to 24, and 26 to 30 years, the only behavioral deficit in the 14- to 17-year - old group was detected using a difficult visuospatial orientation task. impairment in the delayed response task with long delay, assessing spatial memory, appeared in the 20- to 24-year - old monkeys, while object recognition was still preserved and was only impaired in the oldest group. from the above experiments, it appears that mci can be detected in middle - aged monkeys, presumably about 15 years old, if difficult visuospatial tasks are presented to them. conversely, since in old monkeys the cognitive processes are usually well preserved, we can induce a mci by a moderate increase in delay in the delayed non - matching - to - sample task or the delayed response spatial memory task. however, paradoxically, it could be claimed that since old monkeys never show the catastrophic loss of memory, massive degeneration of the cholinergic system, and extensive a plaque deposition occurring in ad, the memory impairment in the aging monkey could be considered a model of mci. the cognitive deficit in the old monkeys can be improved, with individual marked differences, by drug treatments. among the drugs tested are cholinesterase inhibitors, arginine vasopressin, dopamine d1 agonists, adrenergic agonists, and -amino-3-hydroxy-5-methyl-4-isoxazolepropionate (ampa) receptor allosteric modulators. however, like in the rat, few drugs shown to improve cognition in aging monkeys have become useful therapeutic agents in man. this survey of the literature on aging in laboratory animals reveals that there are several possible models of mci. if they are listed according to cost and availability, their order of preference would be middle - aged rats and mice, transgenic mice overexpressing a, at an early phase before extensive deposit formation, and aging monkeys. strain differences are not relevant while the selection of the behavioral task is very important for detecting the cognitive deficit at an early age. although the animal models described in this review have frequently been used to test potentially useful drugs for the treatment of the memory deficits, which is the main symptom of mci, a validation of the models through comparable therapeutic results in both animal and man has been rarely obtained. | mild cognitive impairment (mci) is an aspect of cognitive aging that is considered to be a transitional state between normal aging and the dementia into which it may convert. appropriate animal models are necessary in order to understand the pathogenic mechanisms of mci and develop drugs for its treatment. in this review, we identify the features that should characterize an animal model of mci, namely old age, subtle memory impairment, mild neuropathological changes, and changes in the cholinergic system, and the age at which these features can be detected in laboratory animals. these features should occur in aging animals with normal motor activity and feeding behavior. the animal models may be middle - aged rats and mice, rats with brain ischemia, transgenic mice overexpressing amyloid precursor protein and presenilin 1 (tested at an early stage), or aging monkeys. memory deficits can be detected by selecting appropriately difficult behavioral tasks, and the deficits can be associated with neuropathological alterations. the reviewed literature demonstrates that, under certain conditions, these animal species can be considered to be mci models, and that cognitive impairment in these models responds to drug treatment. |
cadmium chalcogenides (cdx, x = s, se, te) are ii vi semiconductors, which are used to devise solar energy harvesting solutions like thin - film photovoltaics, photoelectrochemistry, and photocatalysis. over the past decade, the interface of water and the cds nanocrystals is not well understood yet, which could be vital in deciphering the near - surface dynamics of water and its influence on surface catalysis. any theoretical modeling of this interface should include the key interaction motifs at the surface. some of these key surface motifs could be sought by exhaustively studying the molecular interaction of water on these surfaces, which forms the main focus of this study. experiments have observed an unusual ferromagnetic - like (fm) ordering in nanostructures of semiconductors and insulators, over a wide range of temperatures. this has been a subject of wide scientific interest (hfo2, in2o3, zno, cds). such an origin of magnetism in materials, having no magnetic host ions or possible magnetic impurities, is also known as d - magnetism. showed that the bulk counterparts for hfo2, in2o3, and tio2 are diamagnetic, and the fm ordering is characteristic for thin films. later, madhu. reported that the saturated fm ordering increases with the decrease in nanoparticle size, suggesting that surface effects may play a direct role in this phenomenon. similar speculation that the fm mass could be concentrated at the surface was made by studying the magnetization hysteresis loop per volume. in most of these studies, it was speculated that surface vacancies (cationic or anionic), or vacancy clusters, are the cause of this widely observed fm - like behavior. we did not find any direct experimental reports on water adsorption on cds surfaces. however, in the late 1960s arizumi. had already observed electron paramagnetic response (epr) signals from powdered cds single crystals. they also observed a strong interaction of h2o on magnetic centers of powdered cds single crystals, as they found that on exposing the paramagnetic crystals to air (water moisture) for 2 weeks, the epr signal vanished. this is found to be qualitatively reconsolidated in our molecular study of h2o adsorption (instead of water moisture), where we observe that a water molecule can indeed neutralize the spin polarization of a surface defect center by chemisorption. to make further comparisons with arizumi. we also adsorbed an o2 molecule at the same magnetic defect center. for a continuity in our exposition, we first discuss in full h2o adsorption on perfect and vacancy defected surfaces, which is then followed by simulation results of this special case of o2 adsorption and a discussion of its correspondence with experimental observations. theoretical dft calculations using local and semilocal exchange correlational functionals have discussed the possibility of these magnetic cationic vacancies to be responsible for the experimentally observed fm ordering. on inclusion of more accurate theoretical treatments, like hybrid functionals, occupation - dependent potentials, and other self - interaction schemes, it is seen that the coupling strength of such magnetic vacancies is too weak to explain the experimentally observed fm ordering. it is because they observed that the holes are more localized at the defect sites than predicted by the local and semilocal functionals. apart from vacancy defects as a possible cause, studies have also proposed that it could be undercoordinated polar surfaces that cause the surface magnetism. coey and co - workers recently made a radically different proposition, suggesting that the magnetic response of ceo2 nanoparticles could be due to giant orbital paramagnetism emerging from the collective response of electrons in the coherent domains due to its interaction with the zero - point fluctuations of the vacuum electromagnetic field. the validity of this theoretical model is yet to be confirmed by other experiments. clearly, the understanding regarding the underlying mechanism of this fm - like behavior had shown many twists and turns and is still awaiting new developments. in this study we do not focus on the macroscopic origin of magnetism but rather on the water - interface effects near these magnetic vacancies (which are often proposed to explain the fm - like behavior). however, we find that most of the magnetic cationic vacancies on the studied surfaces are energetically unfavorable in comparison to their nonmagnetic counterparts and may not solely be the cause of the poorly understood magnetic response of the nanostructures. previous theoretical studies investigating the effect on water adsorption at these magnetic vacancies did not find any case of chemisorption. ahuja and co - workers studied the water adsorption at te defected zno (1010) surface ; however, the prevalence of magnetic defect centers was not confirmed. they had found that the water molecules move away from the zn vacancies and adsorb in a similar manner to the clean surface. recently, catellani and co - workers found a stable magnetic vacancy on the cds (1010) surface ; however, its interaction with water or any other ligand was not the focus of that study. another adsorption study of h2o and o2 molecules on the clean w - cds (1010) surface was reported by the same group, which we have used to compare with our clean surface adsorption results. in the current study, we investigate all the stable and metastable vacancies on nonpolar wurtzite cds (w - cds) surfaces (1010) and (1120), using spin - polarized density functional theory with a semilocal exchange correlational functional. these w - cds surfaces are the most stable and abundantly formed crystal facets, owing to their in - plane net charge neutrality. then, we systematically study the adsorption of a water molecule on these surfaces, identifying the stable and metastable water adsorption sites. the adsorption geometries on the clean surfaces were tested by a van der waals (vdw) functional, thus giving a benchmark for differences between the two exchange - correlational functionals. finally, we focused on the effect of surface vacancies on the adsorption of a water molecule, highlighting the surface motifs which determine surface stability. from our study, we find that s - dimers and magnetic cationic defect centers are stabilizing surface motifs which could play a role in water adsorption ; on the other hand, anion vacancies do not significantly affect it. we do not find any case of spontaneous dissociative adsorption for the case of low coverage studied here. all the calculations were performed by means of density functional theory (dft) employing the projector augmented wave (paw) method as implemented in the vasp package. the equilibrium lattice parameters of the cds unit cell were determined using the total energy minimum for a range of unit cell volumes. for each of these fixed volumes, the atoms and the obtained lattice parameters (a = 4.205, c / a = 1.63, u = 0.376) are in agreement with previous theoretical studies and within 2% of the experimental value. the main exchange - correlation functional used in our study is the generalized gradient approximation (gga)-pbe, whereas for benchmarking tests of vdw interaction (on water adsorption) we used the vdw - optb88 functional. for ii vi semiconductors it is known that considering d - states in the valence band is important for a reasonable prediction of valence band properties. however, due to the localized nature of d - electrons, the standard dft can only erroneously predict their binding energies. to correct for this, we included the dft+u scheme by fitting the binding energies of the d - bands to the ultraviolet and x - ray photoelectron spectroscopy data. using this fit, we use ueff = 6.0 ev for the d - bands of cd (in cds) for the rest of the study. for the bulk supercells and surfaces the cutoff for the kinetic energy of the plane - wave basis was 400 ev, and for the augmentation charges, it was 580 ev. pack k - mesh with an electronic temperature of 0.05 ev for a gaussian smearing at the fermi level. vacancy - defected bulk calculations were performed in a 128-atom wurtzite supercell with a -centered k - point mesh of 27 irreducible k - points. we modeled the nonpolar (1010) and (1120) surfaces with 96-atom slabs and a vacuum spacing of 20. the k - point sampling for the (1010) and (1120) defected surfaces used 9 and 10 irreducible k - points, respectively. the (1010) surface was comprised of 4 3 unit cells, with a thickness of 4 bilayers (two bottom layers were fixed). the (1120) surface was comprised of 2 4 unit cells with a thickness of 6 atomic layers, out of which the bottom four layers were fixed. such a fixing of bottom layers is suitable to have a physical bulk - like termination. however, as the fixed layers are chemically noninert, this leads to undesired midgap states. for preventing these states, we passivated the fixed side of the slabs by pseudohydrogens. we used h (z = 1.5) and h (z = 0.5) pseudoatoms to passivate the fixed bottom layer of cd and s atoms, respectively. the cd h and s h bond lengths were determined by cdh41.5 and sh40.5 in a tetrahedral geometry. the relaxation of the surface atoms takes place in such a way that the surface anions relax outward and the cations relax inward, with respect to bulk. this is known to occur to facilitate the giving away of dangling bond electrons from surface cations to anions. we report and discuss the results in the following order : (a) vacancy defects (vcd and vs) in bulk - cds, (b) vacancies on nonpolar cds surfaces, (c) adsorption of a water molecule on clean surfaces, (d) water adsorption at the vacancy defects of the surfaces, and (e) oxygen molecule adsorption at a particular cation vacancy defect. depending on the growth conditions, charged and neutral defects occur in the semiconductor nanostructures. in this study, we restrict our focus to the neutral vacancy defects within spin - polarized calculations, since such an adsorption study on the charged defects would be numerically prohibitive. the w - cds cell has a lower point group symmetry than td, where one of the tetragonally coordinated cd s bonds (along c - axis) is longer than the other three equivalent bonds (by 0.007 for gga - pbe). for the calculations in bulk the most stable state of the cation vacancy has a local magnetic moment of 2 b, due to the localization of the holes at the neighboring s - sites. for this magnetic (m) configuration, the s - bond parallel to the c - axis is still longer than the other three equivalent s - bonds (by 0.004), having a c3v point group symmetry. moreover, we also identified a metastable configuration for the cation vacancy which is nonmagnetic (nm). in this nm case, all the four neighboring s atoms relax toward the defect such that they are equidistantly located around the defect site, into a td point group symmetry. such locally stable symmetric vacancy centers were also reported for cdte and zn - chalcogenides. the difference in the local structure of the cation vacancy leads to differences in the electronic structures of the neighboring s atoms, at which the hole states localize. this correlation could also be seen in the ldos of the neighboring s atoms, as shown in figure s1 of the supporting information (si). the occurrence of two such vcd possibilities can be explained with jahn teller relaxations, where the defect center with the lower symmetry (c3v, spin - polarized) is slightly more stable than the higher symmetry complex (td, nonspin - polarized). the magnetization energy of vcd and emag, i.e., the total energy difference between magnetic and nonmagnetic configurations, is just 85 mev. figure 1(a) and (b) shows the spin - resolved density of states (dos) of the two configurations, indicating that the c3v geometry has a net spin polarization at the fermi - level edge, whereas the td geometry has no net spin. figure 1(c) shows the net spin density localized at the s atoms, which is significantly spread through the crystal. it also shows the c3v nature of the spin - density symmetry and is in agreement with anisotropic spin density seen for analogous semiconductor wurtzite crystals. the semimetallic character seen in the dos of figure 1(a) and (b) has also been reported in other studies using local or semilocal exchange correlational functionals. indeed, later more accurate calculations have shown that the holes are more localized than the predictions by local or semilocal functionals ; however, the local magnetic moments of the vacancy defects are often retained. therefore, we study the adsorption on these defected surfaces within the semilocal, gga - pbe functional level. (a) and (b) spin - resolved density of states for the vcd in bulk cds and for the two cases of c3v and td configurations, respectively (m = magnetic, nm = nonmagnetic). in (c) the net spin density is shown for the c3v case, with an isosurface of 1 10e /. the cd atoms are plotted in magenta and s atoms in yellow. the sulfur vacancy in bulk cds is found to be nonmagnetic, where the neighboring cd atoms relax toward the defect site. the cd - bond parallel to the c - axis is 0.04 longer than the other three equivalent bonds, acquiring a c3v symmetry. after studying these vacancies in bulk, it is important to know whether they are relatively stable on the surfaces. the low magnetization energy emag for the cation vacancy in bulk - cds makes it interesting to study these defects on the nonpolar surfaces. further, as it is believed that the experimentally observed magnetism is a surface effect, we test whether magnetism at these defect sites also persists at the surfaces. vacancies were created on these surfaces by removing one cation / anion atom. like in bulk - cds, we find a variety of metastable magnetic and nonmagnetic vacancies on these surfaces. in our study, we test all possibilities by starting with different magnetic configurations as an initial condition for our calculations. apart from the magnetic and nonmagnetic defect possibilities, there are two types of cd and s atoms that can be accessed by an adsorbate (surface + subsurface). we thus study both such types of vacancies : the surface atoms, i.e., having coordination three are referred to as vcd1 and vs1, and the subsurface atoms with coordination of four are referred to as vcd2 and vs2. for the (1010) surface the only stable vcd1 configuration is found to exhibit a net local spin, with magnetic moment of 1.62 b. the net spin at this vcd site was also previously reported by giacopetti. in our study, this is the only cationic vacancy site where a corresponding nonmagnetic configuration is not found since around this defect site the relaxation of the neighboring s atoms is restricted by surface geometry. the net spin density of vcd1 is shown in figure 2(a). at the subsurface, the vcd2 converges to two locally stable configurations : a m solution (1.96 b, figure 2(a)) and a nm solution (figure 2(b)). figure 2(a) and (b) show that for m vcd1 and m vcd2 the surface relaxations near the defect sites are insignificant. on the other hand, the nm vcd2 is shown in figure 2(c), which is accompanied by the formation of s - dimers. our results repeatedly show that the surface relaxations of the neighboring anions lead to the formation of s - dimers and stabilize most of the vcd - defected surfaces, resulting into no net spin polarization at the defect site. such relaxations of the neighboring anions are known to cause rehybridization of the hole states, leading to redistribution of the net spin density. the vs1 and vs2 on this surface, just like in bulk - cds, are found to be nm. (a), (b), and (c) top views of the cation - defected (1010) surface (and subsurface) ; (d), (e), and (f) are the same for the (1120) surface. the colored isosurfaces are net spin densities with an isosurface of 1 10e / for the magnetic (m) cases. in the nonmagnetic (nm) cases, we can see the formation of s - dimers which stabilize the surface. the layer below (in white) is the atomic layer below the first subsurface. to understand the relative likelihood of formation of the above vacancies we have compared their total energies in figure 3(a). here, our objective is to compare the stability of defects within the same stoichiometry (i.e., vcd - type or vs - type). therefore, it should be clear that a comparison of the relative stability of a vcd with a vs is not made since that would require one to calculate chemical potentials of elemental crystals which are not reliable for dft+u calculations. in figure 3(a) the most stable vcd s and vs s for each of the surfaces are placed lowest. other vacancies (with the same stoichiometry) are placed in the same quadrant, with increasing energy difference from the most stable one. the m defect configurations are marked in green and the nm in black. in figure 3(a), we observe that the magnetic vcd2 is 0.59 ev less stable than its nm counterpart vcd2. moreover, this subsurface cd - vacancy (vcd2) is even more stable than the surface cd - vacancy (vcd1) by 85 mev, thus highlighting the stabilizing role of s - dimers formed on nonmagnetic vcd2. it should be noted that according to figure 3(a) vcd1 is the only magnetic defect site which is relatively stable on these surfaces. the vs1 on (1010) is easier to be formed by 0.6 ev than the subsurface vs2, which is in accordance with their coordination number. since vs does not occur in a variety of magnetic states and do not interact strongly with water, their surface geometries are discussed in their respective section of water adsorption. (a) and (b) summarize the relative stability for the vacancies with the same stoichiometry on the (1010) and (1120) surfaces. the most stable cd - type and s - type defects are placed lowest (set to zero on the vertical axis). magnetic vacancies are displayed in green and nonmagnetic vacancies in black. as the (1120) surface is more open for relaxations, it favors nm ground states for cation vacancies. the stable nm configurations are shown in figure 2(e) and (f) for vcd1 and vcd2. a magnetic vcd1 was also observed which is shown in figure 2(d), with its net spin - density (2 b). as shown in figure 2(e) and (f), in the case of nm vcd1 the dimer is formed with the surface s atoms, while for nm vcd2 it forms with the next subsurface atomic layer. these dimer - s states have ds s = 2.12, which is shorter in comparison to dcd a relative thermodynamical stability of these defects is shown in figure 3(b), where the m vcd1 is 0.57 ev less stable than nm vcd1. figure 3(b) shows that the likelihood of formation for vs s are again in accordance with their coordination number, where the vs1 is 0.79 ev more stable than vs2. in summary, we observed that magnetic vacancies do not form stable ground states on these nonpolar surfaces, except for vcd1 on the (1010) surface, which is relatively stable. this is because the neighboring anion relaxations are easier to occur for the nonpolar surfaces, leading to rehybridization of the orbitals localizing the defect states, and cause the vanishing of the local spin polarization. in the following section, we present results of water adsorption on all the vacancy defects at these surfaces to understand all the possible interactions with water. first, we focus on the adsorption at the clean surface, followed by adsorption at the vacancy - defected surfaces. we began by investigating possible adsorption sites of a single water molecule on the clean (1010) and (1120) surfaces. since these surfaces are nonpolar they have more than one adsorption motif. we report below the most stable and metastable adsorption configurations on the two surfaces. after spanning several initial geometries of h2o adsorption on this surface, four configurations were found to be (meta-)stable. among these, the most stable adsorption configuration is at the hollow site as shown in figure 4(a), with eads = 0.62 ev. when the input water geometry was altered by orienting the h o h planes parallel or perpendicular to the surface, the adsorbed molecule relaxed to the same geometry, within a difference of 5 mev in eads. at this site both possible bonding interactions (dcd o 2.4, ds h 2.3) took place. the inset shows the ldos for the h2o molecule, where the molecular orbitals of water have remained intact and the 1b1 o - states have become dispersed, indicating a physical adsorption at this surface. this adsorbed configuration was also seen in an earlier study ; however, their value of eads = 0.33 ev is significantly lower than in our calculations. this could be the result of small supercell sizes (2 1) used for their study. (a) charge difference density plot of the most stable h2o adsorption configuration on the clean (1010) surface and the (b) same for the (1120) surface. an isosurface of charge density of 4.7 10e / is used where the blue color indicates charge depletion and green indicates charge accumulation. the inset shows the ldos for the h2o molecule, which indicates the case of physical adsorption. the other three metastable adsorption configurations are shown in figure 5(a), (b), and (c). these locally converged configurations were obtained through a rotation of the h o h plane of the molecule, about the neighboring s atom. by doing this, the cd o bonding interaction increases only slightly (as shown by the charge difference density plots), leading to a difference in eads of 50 mev. this indicates that the potential energy surface for the (1010) is very flat around these geometries. the strength of the s h interactions in physisorption could be estimated to be 0.1 ev since the configuration (a) is bonded only through these interactions (2s h bonds). (a), (b), (c) are the charge density difference plots for metastable geometries of adsorption of the h2o molecule on (1010) surface, and (d) and (e) are the same for the (1120) surface. the insets in (a), (d), and (e) show the change in geometry upon relaxing with the vdw - optb88 functional ; (b) and (c) do not show any changes in their geometry. unlike the (1010) surface, the (1120) is ridged and far from being flat. the most stable adsorption configuration on this surface is also at the hollow position as shown in figure 4(b), with an eads = 0.53 ev. the inset shows the ldos for the adsorbed water molecule, indicating intact molecular orbitals of water and dispersed 1b1 levels of the o atom. other metastable configurations at this surface are shown with their charge difference density plots in figure 5(d) with eads = 0.40 ev and (e) with eads = 0.09 ev. owing to the ridged surface, the difference in their eads is also significant. since the h2o molecule and the nonpolar surfaces are likely to have dipole interactions, it is important to estimate the strength of vdw interactions. for this purpose, in addition to the gga - pbe functional, we also used the vdw - optb88 functional for all the adsorption geometries on the clean surface. to investigate the effect of vdw interaction on eads and relaxed geometries, we performed the vdw calculations on the same input geometries that were used for pbe calculations, keeping the dimensions of the cell constant (while allowing the relaxation of atoms that were also free to relax in the pbe calculations). table 1 shows the eads for the vdw and pbe functionals for the geometries shown in figure 4 and figure 5. we found that there is no significant change in geometry for the most stable configurations of both the surfaces, i.e., configurations figure 4(a) and (b). when vdw interactions are taken into account, the eads increases for both these cases by 0.17 ev. converged to the same geometry. on including dispersion interaction the configuration of figure 5(a) is not the least stable anymore, and it converges to the configuration of figure 5(c) (as indicated in the inset). as the other two metastable cases of the (1010) surface (figure 5(b) and (c)) do not show any significant change in the adsorption geometry, we can infer that the vdw effect on the (1010) surface increases the eads by 0.15 ev. for the ridged (1120) surface, inclusion of dispersion interaction can lead to relaxation of the h2o molecule toward the hollow site of the surface. in other words, for the configurations on this surface which were metastable with the pbe functional, the inclusion of vdw interaction can lead to adsorption which is nearly as strong as the most stable configuration of the (1120) surface, i.e., figure 4(b). this is also what we observe in our findings, where the final geometry upon vdw relaxation is shown in the insets of figure 5(d) and (e). the water molecule in figure 5(d) is altered in its geometry by a rotation of the h o h plane over the surface ridge to fall into the hollow site, leading to an enhanced bonding with the surface which explains a larger increase in the eads of 0.28 ev. the least stable configuration of figure 5(e) was also no longer locally stable and relaxed to its inset figure, which is similar to the vdw - converged case of the figure 5(d) configuration. this benchmarking gives an estimate of the possible effect on geometries and eads due to vdw remarkably interaction, indicating that for the ridged (1120) surface the metastable configurations converge to the most stable configurations. despite the substantial changes seen in the adsorption on the pristine (1120) surface, it should be noted that we have taken into account the vdw interaction for the clean surface adsorption only. this is because of the fact that most of the currently used vdw functionals consider only the total density (spin + spin) of the system and, in this way, are unsuitable for the treatment of spin - polarized systems. all the results on the defected surfaces discussed below were obtained for the pbe exchange correlational functional. one of the main objectives of this study is to investigate the effect of vacancies on the surface adsorption of h2o, which are discussed below for both the m and nm vacancies. in addition to this, we have also studied a case of o2 adsorption at one particularly stable magnetic vacancy site to compare with the observations of arizumi. the results and comparison of this set of calculations with experiments are reported in the last section of results and discussion, while we start with a discussion of the water molecule adsorption results. the three (meta-)stable magnetic cation vacancies were found for vcd1 and vcd2 on the (1010) surface and for vcd1 on the (1120) surface (figure 2(a), (b), (d)). we then initialized the adsorption calculation with the water molecule exactly above these defect sites. at this site we found two cases of h2o adsorption. the most interesting case was found for an initial guess of a nonmagnetic solution, where the water molecule is chemisorped as shown in figure 6. here, after relaxation the local magnetic moment of the surface eventually vanished, with significantly higher eads at 1.48 ev. figure 6 shows that the h2o molecule became a part of the surface, as a new o s bond was formed with bond length do s = 1.76, accompanied by an increase in the water do the sulfur monoxide bond in the same settings has a bond length of do s = 1.50, comparable to what we observe for the oh2o scds bond. the adsorbed h o h is 103, while the surface s cd s is 114.9. the top right inset of figure 6 shows this good match, where h2o fits well with the symmetry of the surface. the top left inset of figure 6 shows the ldos of h and o from the h2o molecule and of the surface - s bonded to the molecule. here, the 1b2 and 3a1 water molecular orbitals undergo splitting, thereby forming new o s bonds with these states. new 4a1-like o states are seen at the valence band edge and the conduction band edge, where they bond with the surface - s, clearly establishing new bonding patterns. the above configuration represents the interaction of water with the magnetic cation vacancy site leading to chemisorption (eads = 1.48 ev), where the water molecule becomes a part of the surface. chemisorption of h2o at the (1010) vcd1 site leads to neutralizing of the surface magnetic moment. the inset on the left shows the local dos of the adsorbed h2o and the surface - s site to which the molecule is bonded, which shows the splitting of h2o molecular orbitals (1b2 and 3a1) and forming of new o s bonds instead. the inset at the right shows a top view of the charge density difference plot (isosurface = 10e /), where it is seen that the symmetry of the surface assists the h2o to bond. it is interesting that the local spin polarization at the surface can be neutralized by a chemisorption process of a diamagnetic ligand (like water, in this case). this finding is in qualitative agreement with experimental reports of arizumi., where it was observed that long exposure to moisture in the air can diminish the epr signal from the paramagnetic centers of the cds single crystals., we performed additional simulations where an oxygen molecule was adsorbed over this relatively stable magnetic defect center (vcd1). an account of our results of o2 adsorption at this stable magnetic defect center are discussed in the last section of the results and discussion. our results are consistent with the epr reports by arizumi., where we observe that the adsorption strength of the paramagnetic oxygen molecule is lower (eadso2 = 0.47 ev, figure 9 in the last section) than that of the diamagnetic water molecule at the magnetic centers. however, we can not detailedly compare our specific case of water chemisorption to the experimental results since in the latter the interaction with water moisture (and not the gaseous phase) is considered. because of this difference, while we find a clear case of chemisorption of a water molecule, in experiments the epr signal gradually appeared on heating at 100 c, indicating lower adsorption energy of water moisture. this is reasonable since the liquid water phase would certainly have lower bonding strengths with the surface than the isolated chemisorped molecule case which we have studied. another metastable adsorption configuration at this site was found, whereby the net local spin at the defect site persists and allows a very weak adsorption of the water molecule (eads = 0.08 ev). apparently, for this metastable solution the interaction between the defect spin density and an overlying water molecule is repulsive since its eads is much smaller than the least stable adsorption configuration of the clean surfaces. to verify this, we rotated the orientation of the h o h plane away from the spin densities, where we indeed observed an increase in eads to 0.19 ev. such a low eads of the metastable solution, in comparison to the chemisorped geometry, ensures that the former would not be occurring in practice. the adsorption process at this magnetic site converges to a stable state (eads = 0.30 (1.04) ev) where the neighboring s atoms form dimer - s states with the subsurface layers, as shown in figure 7(a). the calculation of eads = 0.30 ev accounts only for the interaction strength where the eads is comparable with the clean surface. the value in the parentheses also includes the surface stabilization energy upon relaxation, at 1.04 ev. the difference in these two values is the surface stabilizing contribution of the stable nm surface in comparison to the initial metastable m configuration. in figure 7(a) h2o is seen to adsorb with the s - dimer states at the surface. it is to be noted that in the presence of water it does not converge to the nm vcd2, as observed earlier in figure 2(c), but to a new way of forming s - dimers with the subsurface layer, again neutralizing the locally polarized spin. this shows that the physical inclusion of water for adsorption induces relaxations at the surface, which drive the metastable m vcd2 to a new nm vcd2. (a) and (b) show the adsorption geometries for a water molecule on m and nm in the case of vcd2 on (1010). (c) and (d) show the same for nm cases of vcd1 and vcd2 of the (1120) surface. upon adsorption of a water molecule at this site, the only magnetic metastable site at the (1120) surface (figure 2(d)) relaxed to the nm case of vcd1 on (1120), analogous to figure 2(e). this will be discussed with the cases of nm defect adsorption in the following section. another metastable water adsorption solution at this site is observed where the local spin moment persists, leading to another case of very weak adsorption (eads = 0.12 ev). we also adsorbed a water molecule at nm vacancy sites on the two surfaces. for the vcd, these sites were figure 2(c), (e), and (f). their respective adsorption geometries are shown in figure 7(b), (c), and (d). for the ease of comparison between the two figures, we have also shown the m case of vcd2 of the (1010) surface in figure 7(a), which was already discussed in the previous section. in the open cage - like site of figure 2(b), the water molecule is trapped as shown in figure 7(b), where it is seen to adsorb slightly below the surface atomic layer. the high adsorption strength of this configuration is due to the interaction of h2o with three surface motifs two s - dimer sites and the subsurface s atom. figure 7(c) is the converged adsorption geometry for both the m case of figure 2(d) and the nm case of figure 2(e), with an eads = 0.20 (0.74) ev. again, 0.20 ev accounts for the actual adsorption strength, while the value in the parentheses accounts to stabilizing energy of the nm surface. figure 7(d), the adsorption case of figure 2(f), shows an adsorption strength of 0.43 ev, with h2o adsorping at the dimer - s site. the adsorbed geometries at the vs of the (1010) and (1120) surfaces are shown in figure 8(a, b) and (c, d), respectively. for vs1 on both the surfaces, in figure 8(a) and (c), the h2o moved away from the sulfur vacancy and converged close to the nearest cd atom or s atom for physical adsorption. the vs2 in figure 8(b) and (d) forms an open - ring structure where the h2o adsorps. overall, the eads at the vs sites are similar to those at the clean surfaces, indicating that the s - vacancy has almost no effect on the adsorption of water. (a), (b) h2o adsorption geometries on vs1 and vs2 defects of the (1010) surface, and (c) and (d) are the same for the (1120) surface. to make a comparative assessment with the h2o and o2 adsorption, as described in the experimental report of ref (9), we also studied the adsorption of an o2 molecule at the stable magnetic defect center (vcd1) of the (1010) surface. the same computational settings (gga - pbe, energy cutoff, k - points) were used as in the h2o adsorption calculations. the isolated o2 molecule (serving as a reference for calculating eads) was calculated in a cubic box of 20 in length. the o o bond length of the o2 molecule was 1.23, with a magnetic moment of 2 b. figure 9 briefly summarizes the observed metastable and stable adsorption configurations of the o2 molecule at the vcd1 site on the (1010) surface. the state in column (a) is paramagnetic where the oxygen molecule does not interact with the spin density at the defect site. the electronic levels of atoms o1 and o2 are unaffected by the surface, in the second row of column (a), leading to an eads of 0.01 ev. also, the net spin densities (shown in the third row of column (a)) are almost unchanged owing to very little interaction., the electronic states of the oxygen molecule (shown by atoms o1 and o2) and the s atom of the surface (bonded to the molecule) align with one another, resulting in a considerable interaction with eads = 0.28 ev. in this case, as both the local and overall spin polarizations are zero, the net spin density plot is not shown. column (c) of figure 9 shows the most stable of the oxygen adsorption geometries with eads = 0.47 ev, having the geometry very similar to case (b). the second row of column (c) shows that electronic levels of o1 and surface - s undergo splitting near the valence band and conduction band edges, leading to a stronger adsorption. the net spin density plot of geometry (c) indicates that the spin polarizations at the oxygen molecule and at the defect site are directed opposite to one another. the local magnetic moments at the molecule are m = 0.30 b and m = 0.46 b, while the surface s atoms have magnetic moments with values between 0.2 b and 0.0 b, resulting in a net moment of 0.29 b in the cell. columns (a), (b), and (c) represent the characteristics of the converged geometries that were obtained for the o2 molecule adsorption at the vcd1 magnetic site on the (1010) surface. the two o atoms of the oxygen molecule are referred to as o1 and o2 atoms of the molecule, as shown in geometry (a). the second row shows the spin - resolved ldos for the configurations, indicating the two o atoms and surface s atom which bonds to the molecule. the third row shows the net spin density for these configurations. in the nonmagnetic case of (b) the local and the spin densities are zero and these results of the most stable o2 molecule adsorption geometry on the vcd1 defect site (column (c)), along with the case of water chemisorption on the same site, are consistent with the experimental findings of ref (9). first, the surface adsorption of a h2o molecule at the magnetic defect center is 1 ev stronger than that of o2 adsorption. the experiments have shown that water moisture can replace the o2 molecule from surface adsorption. at least for the case of the isolated water molecule considered here, the difference in adsorption energy is significantly large and consistent with this finding. second, for both the cases (b) and (c), the o2 adsorption geometries result in a decrease of the local spin polarization of the magnetic defect center of the surface. for the most stable case of column (c), the overall magnetic moment of the cell reduced to 0.29 b (which was initially about 1.62 b for the surface vacancy, before adding o2). for both h2o and o2, adsorption at this vcd1 defect site third, the experiment observed a broadening in the magnetic resonance lines, which was shown to be a result of the dipolar interaction between the o2 molecule and the paramagnetic center on the surface. this scenario shown in column (c) in figure 9 fits well with this finding, as the ldos and net spin density plots show that the local spin polarizations are directed opposite to one another, leading to dipolar interactions. keeping in mind our prediction of thermodynamic stability leading to a predominance of nonmagnetic cationic vacancies on these surfaces, we would like to clearly state our inferences in relation to the experiments. although our results are recurrently consistent with some of the observations of arizumi., we do not claim that the vcd1 is the source of magnetic signal observed experimentally with powdered cds or the cds nanostructures (observed in the past decade). such a prediction of the magnetic origin can only be confirmed by a theoretical macroscopic prediction of correlated magnetism, which we have not covered here. however, we show that simple vacancies like vcd1 could prove to be a suitable testbed for studying localized adsorption interactions at d magnetic centers of the semiconductor surfaces. we have extensively studied water adsorption at the neutral vacancies of nonpolar w - cds surfaces, with all of their possible magnetic configurations. first, we have shown that most of the vacancies on these nonpolar surfaces are nonmagnetic. the net spin polarization is relatively unstable, owing to possible surface relaxations which result in stable anion dimers. this finding indicates that whenever the surface geometry is not structurally constrained and relaxations are likely to occur, the stable vacancy configurations would be nm. hence, most of the cationic vacancies (i.e., one out of four) on the nonpolar cds surfaces do not exhibit a thermodynamically stable magnetic moment, and therefore the vacancies from these surfaces may not solely be the cause of the experimentally observed fm behavior. second, we have shown that for one of the relatively stable vacancy sites, where the neighboring atom relaxations are structurally constrained, a relatively stable magnetic cationic vacancy is the only possibility. upon adsorption of a water molecule on such a stable magnetic site, we found a clear case of chemisorption. in this case, the water molecule strongly interacts with the surface, resulting in no net spin polarization. for comparison with an experimental report, we also adsorbed an o2 molecule at this interesting surface vacancy. the o2 adsorption resulted in a decrease in the local magnetic moment, although with lower adsorption energy in comparison to h2o. these relative adsorption strengths, diminishing of the magnetic signal, and the dipolar interaction of o2 adsorption are all consistent with the epr findings. for other nonmagnetic cationic vacancy cases, the surface motifs like s - dimers or the subsurface - s atoms can be the main interaction centers for the h2o molecule. for the interaction with the s - dimers, the adsorption energies are comparable to or lower than those of the clean surfaces. unlike the cation vacancies, the anion vacancies do not significantly affect the h2o adsorption in comparison to clean surface adsorption. | a detailed understanding of the water semiconductor interface is of major importance for elucidating the molecular interactions at the photocatalyst s surface. here, we studied the effect of vacancy defects on the adsorption of a water molecule on the (1010) and (1120) cds surfaces, using spin - polarized density functional theory. we observed that the local spin polarization did not persist for most of the cationic vacancies on the surfaces, unlike in bulk, owing to surface reconstructions caused by displaced s atoms. this result suggests that cationic vacancies on these surfaces may not be the leading cause of the experimentally observed magnetism in cds nanostructures. the surface vacancies are predominantly nonmagnetic except for one case, where a magnetic cationic vacancy is relatively stable due to constraints posed by the (1010) surface geometry. at this particular magnetic defect site, we found a very strong interaction with the h2o molecule leading to a case of chemisorption, where the local spin polarization vanishes concurrently. at the same defect site, adsorption of an o2 molecule was also simulated, and the results were found to be consistent with experimental electron paramagnetic resonance findings for powdered cds. the anion vacancies on these surfaces were always found to be nonmagnetic and did not affect the water adsorption at these surfaces. |
the following electronic databases were searched using the scopus abstract and citation database : the cochrane library (issue 1, 2010), medline, embase, science citation index expanded, social sciences citation index, conference proceedings citation index science, and psycinfo. additional sources were hand searched, including meeting abstracts of the european association for the study of diabetes, american diabetes association, diabetes uk ; psychosocial aspects of diabetes study group ; current controlled trials, clinicaltrials.gov, and u.k. clinical research network. the search terms used were antidepressant, antidepressants, impaired fasting glucose, impaired glucose tolerance, and diab. the reference lists of all included studies were searched manually, and experts in the field were contacted for details of additional relevant studies. the general principles recommended by the centre for reviews and dissemination were followed (8). eligible studies met the following criteria : adults 18 years of age who were prescribed antidepressants and assessed the incidence or prevalence of diabetes or measured blood glucose levels during the study. any study design was acceptable if comparative data on antidepressant use in the target group were reported in a peer - reviewed journal in the past 25 years. identified abstracts were examined for inclusion by all authors, with full text articles obtained and reviewed independently by all authors. a quality assessment for each included study was performed using tools appropriate to the study design based on the crombie criteria for assessment of cross - sectional studies (9) adapted by petticrew and roberts (10) and the critical appraisal skills program (casp) for cohort and longitudinal studies (11). quality was assessed independently by two investigators (k.b. and r.i.g.h.), who also extracted data independently by using a standardized data extraction table. a meta - analysis was not possible owing to study heterogeneity including differences in outcome measures. studies were, therefore, subjected to a narrative synthesis and critical appraisal (fig. the following electronic databases were searched using the scopus abstract and citation database : the cochrane library (issue 1, 2010), medline, embase, science citation index expanded, social sciences citation index, conference proceedings citation index science, and psycinfo. additional sources were hand searched, including meeting abstracts of the european association for the study of diabetes, american diabetes association, diabetes uk ; psychosocial aspects of diabetes study group ; current controlled trials, clinicaltrials.gov, and u.k. clinical research network. the search terms used were antidepressant, antidepressants, impaired fasting glucose, impaired glucose tolerance, and diab. the reference lists of all included studies were searched manually, and experts in the field were contacted for details of additional relevant studies. the general principles recommended by the centre for reviews and dissemination were followed (8). eligible studies met the following criteria : adults 18 years of age who were prescribed antidepressants and assessed the incidence or prevalence of diabetes or measured blood glucose levels during the study. any study design was acceptable if comparative data on antidepressant use in the target group were reported in a peer - reviewed journal in the past 25 years. identified abstracts were examined for inclusion by all authors, with full text articles obtained and reviewed independently by all authors. a quality assessment for each included study was performed using tools appropriate to the study design based on the crombie criteria for assessment of cross - sectional studies (9) adapted by petticrew and roberts (10) and the critical appraisal skills program (casp) for cohort and longitudinal studies (11). quality was assessed independently by two investigators (k.b. and r.i.g.h.), who also extracted data independently by using a standardized data extraction table. a meta - analysis was not possible owing to study heterogeneity including differences in outcome measures. studies were, therefore, subjected to a narrative synthesis and critical appraisal (fig. research designs included 1 case series and 21 observational studies comprising 4 cross - sectional, 5 case - control, and 12 cohort studies (table 1). data extraction from included articles a review of 17 case reports of hyperglycemia or hypoglycemia associated with the use of a variety of antidepressants included one patient with worsening hyperglycemia and three patients with incident diabetes including one with of diabetic ketoacidosis (5). the case patients were three women (24, 44, and 84 years of age) and one man (37 years of age) with previously normal glucose. the cases involved three different antidepressants : paroxetine, clomipramine, and mirtazapine (n = 2). hyperglycemia was found between 3 weeks and 5 months after antidepressant treatment initiation, and the highest recorded blood glucose was 459 mg / dl. the hyperglycemia resolved for all patients, most within a week of discontinuation of treatments. four cross - sectional studies have examined the association between antidepressant use and the risk of diabetes. although these studies confirm a relationship between diabetes and depression, this association was not explained by antidepressant use. two studies from the finnish ppp (prevalence, prediction and prevention of diabetes)-botnia program examined the relationship between depressive symptoms and glucose metabolism (12,13). in the first study, 4,419 individuals underwent an oral glucose tolerance test and self - reported depressive symptoms (12). although depressive symptoms were associated with insulin resistance, this association was neither augmented nor explained by antidepressant use. in the second study, which involved 4,967 adults selected at random from the population registry, diabetes was defined by medical history or results of a 75-g oral glucose tolerance test, and depressive symptoms were assessed by using the five - item mental health index (mhi-5) (13). depressive symptoms were associated with elevated 2-h blood glucose, but there was no association with antidepressant use. furthermore, although antidepressant users had more than 50% increased odds for having the metabolic syndrome, this association was no longer statistically significant (odds ratio [or ] 1.46 [95% ci 0.992.14 ], p = 0.054) after adjustment for confounders. however, antidepressant use was independently associated with increased triglycerides, waist circumference, and systolic blood pressure. rates of diabetes and components of the metabolic syndrome were examined in 461 people from the hordaland health survey, norway, taking ssris and compared with 25,315 participants not taking antidepressants (14). diabetes was diagnosed through self - report, treatment with a diabetes medication or random glucose above 200 mg / dl. they found 2.8% (n = 13) of those taking ssris had diabetes compared with 1.8% of those taking no psychotropic medication (adjusted or 1.43 [95% ci 0.732.80 ], p = 0.293). antidepressant use was associated with a higher prevalence of obesity and hypercholesterolemia (p 0.05). diabetes prevalence was 3.8% in people taking paroxetine, 2.1% in those taking citalopram, and 2.3% in those taking other ssris ; there was no statistical difference among the groups owing to the low numbers of individuals with diabetes. the population - based cross - sectional 2005 and 2007 national health and nutrition examination studies explored the association between clinically identified and undiagnosed prediabetes and type 2 diabetes with depression and antidepressants (15). the study found 8.8% (n = 419) had clinically identified diabetes, 3.5% (n = 126) had clinically identified prediabetes, 3.1% (n = 131) had undiagnosed type 2 diabetes, 38.7% (n = 1,213) had undiagnosed prediabetes, and the remaining 45.8% (n = 1,294) were normoglycemic. those with clinically identified diabetes reported a greater frequency of health care visits in the past year. clinically identified diabetes and prediabetes were associated with major depression, even after accounting for health behaviors (adjusted or 4.26 [95% ci 2.009.07 ], p 24 months) of antidepressants in moderate to high daily doses was associated with an increased risk of diabetes (incidence rate ratio 1.84 [95% ci 1.352.52 ]). the magnitude of the risk was similar for long - term use of tricyclic antidepressants (incidence rate ratio 1.77 [95% ci 1.212.59 ]) and ssris (incidence rate ratio 2.06 [95% ci 1.203.52 ]). antidepressant use was examined in 49,593 people with diabetes and a random sample of 154,441 people without diabetes included in a pharmacy database in the netherlands (17). antidepressant use was only increased 2 months before and 3 months after initiation of diabetes treatment, with the marked increase in the incidence of antidepressant use in the month after initiation of diabetes treatment, with incidence rate ratio of 2.4 (95% ci 2.03.0). a finnish occupational study compared 851 people who developed type 2 diabetes between 1 january 2001 and 31 december 2005 with 4,234 individuals who remained diabetes - free during the same period (18). each diabetes case subject was matched for age - group, sex, socioeconomic position, type of employer and employment contract, and geographic area. diabetes was defined by a physician - recorded elevated glucose in association with diabetes symptoms or two or more elevated glucose measurements. antidepressant use was associated with a doubling of diabetes risk in participants with no indication of severe depression (or 1.93 [95% ci 1.482.51 ]) as well as participants with severe depression (or 2.65 [95% ci 1.315.39 ]). there was a weaker association between severe depression and incident diabetes among nonusers of antidepressants (or 1.20 [95% ci 0.64 2.25 ]) and users of antidepressants (or 1.65 [95% ci 1.092.48 ]). these associations remained after adjustment for current physical illness. in a mutually adjusted model, the excess diabetes risk associated with antidepressant use was reduced by 21.0% when depression severity was included in the model. the excess diabetes risk associated with severe depression was attenuated by 68.4% when antidepressant use was included. in a further analysis of the finnish public sector study involving 493 individuals who developed type 2 diabetes and 2,450 matched participants without diabetes, antidepressant use was twofold higher among people who developed diabetes (adjusted or 2.00 [95% ci 1.572.55 ]) (19). antidepressant use was increased in the 4 years before and in the 4 years after diabetes diagnosis, although there was a temporary peak in antidepressant use during the year of the diabetes diagnosis (or 2.66 [95% ci 1.943.65 ]. after multivariate adjustment, the concurrent use of ssris and tricyclic antidepressants was associated with a significantly increased risk of type 2 diabetes compared with the use of tricyclic antidepressants alone (adjusted or 1.89 [95% ci 1.352.65 ]). by contrast, there was no difference in the risk of diabetes between those taking ssris alone and tricyclic antidepressants alone (adjusted or 1.05 [95% ci 0.861.28 ]). twelve cohort studies examining the relationship between antidepressants and diabetes have been published since 2008. in general, these show an increased risk of diabetes in those taking antidepressants, with hazard ratios (hrs) up to 3.5. not all of the studies show a statistically significant increased risk, however, and the most recent larger studies show smaller hrs of 24 months) of antidepressants in moderate to high daily doses was associated with an increased risk of diabetes (incidence rate ratio 1.84 [95% ci 1.352.52 ]). the magnitude of the risk was similar for long - term use of tricyclic antidepressants (incidence rate ratio 1.77 [95% ci 1.212.59 ]) and ssris (incidence rate ratio 2.06 [95% ci 1.203.52 ]). antidepressant use was examined in 49,593 people with diabetes and a random sample of 154,441 people without diabetes included in a pharmacy database in the netherlands (17). antidepressant use was only increased 2 months before and 3 months after initiation of diabetes treatment, with the marked increase in the incidence of antidepressant use in the month after initiation of diabetes treatment, with incidence rate ratio of 2.4 (95% ci 2.03.0). a finnish occupational study compared 851 people who developed type 2 diabetes between 1 january 2001 and 31 december 2005 with 4,234 individuals who remained diabetes - free during the same period (18). each diabetes case subject was matched for age - group, sex, socioeconomic position, type of employer and employment contract, and geographic area. diabetes was defined by a physician - recorded elevated glucose in association with diabetes symptoms or two or more elevated glucose measurements. antidepressant use was associated with a doubling of diabetes risk in participants with no indication of severe depression (or 1.93 [95% ci 1.482.51 ]) as well as participants with severe depression (or 2.65 [95% ci 1.315.39 ]). there was a weaker association between severe depression and incident diabetes among nonusers of antidepressants (or 1.20 [95% ci 0.64 2.25 ]) and users of antidepressants (or 1.65 [95% ci 1.092.48 ]). these associations remained after adjustment for current physical illness. in a mutually adjusted model, the excess diabetes risk associated with antidepressant use was reduced by 21.0% when depression severity was included in the model. the excess diabetes risk associated with severe depression was attenuated by 68.4% when antidepressant use was included. in a further analysis of the finnish public sector study involving 493 individuals who developed type 2 diabetes and 2,450 matched participants without diabetes, antidepressant use was twofold higher among people who developed diabetes (adjusted or 2.00 [95% ci 1.572.55 ]) (19). antidepressant use was increased in the 4 years before and in the 4 years after diabetes diagnosis, although there was a temporary peak in antidepressant use during the year of the diabetes diagnosis (or 2.66 [95% ci 1.943.65 ]. after multivariate adjustment, the concurrent use of ssris and tricyclic antidepressants was associated with a significantly increased risk of type 2 diabetes compared with the use of tricyclic antidepressants alone (adjusted or 1.89 [95% ci 1.352.65 ]). by contrast, there was no difference in the risk of diabetes between those taking ssris alone and tricyclic antidepressants alone (adjusted or 1.05 [95% ci 0.861.28 ]). twelve cohort studies examining the relationship between antidepressants and diabetes have been published since 2008. in general, these show an increased risk of diabetes in those taking antidepressants, with hazard ratios (hrs) up to 3.5. not all of the studies show a statistically significant increased risk, however, and the most recent larger studies show smaller hrs of 24 months) of antidepressants in moderate to high daily doses was associated with an increased risk of diabetes (incidence rate ratio 1.84 [95% ci 1.352.52 ]). the magnitude of the risk was similar for long - term use of tricyclic antidepressants (incidence rate ratio 1.77 [95% ci 1.212.59 ]) and ssris (incidence rate ratio 2.06 [95% ci 1.203.52 ]). antidepressant use was examined in 49,593 people with diabetes and a random sample of 154,441 people without diabetes included in a pharmacy database in the netherlands (17). antidepressant use was only increased 2 months before and 3 months after initiation of diabetes treatment, with the marked increase in the incidence of antidepressant use in the month after initiation of diabetes treatment, with incidence rate ratio of 2.4 (95% ci 2.03.0). a finnish occupational study compared 851 people who developed type 2 diabetes between 1 january 2001 and 31 december 2005 with 4,234 individuals who remained diabetes - free during the same period (18). each diabetes case subject was matched for age - group, sex, socioeconomic position, type of employer and employment contract, and geographic area. diabetes was defined by a physician - recorded elevated glucose in association with diabetes symptoms or two or more elevated glucose measurements. antidepressant use was associated with a doubling of diabetes risk in participants with no indication of severe depression (or 1.93 [95% ci 1.482.51 ]) as well as participants with severe depression (or 2.65 [95% ci 1.315.39 ]). there was a weaker association between severe depression and incident diabetes among nonusers of antidepressants (or 1.20 [95% ci 0.64 2.25 ]) and users of antidepressants (or 1.65 [95% ci 1.092.48 ]). these associations remained after adjustment for current physical illness. in a mutually adjusted model, the excess diabetes risk associated with antidepressant use was reduced by 21.0% when depression severity was included in the model. the excess diabetes risk associated with severe depression was attenuated by 68.4% when antidepressant use was included. in a further analysis of the finnish public sector study involving 493 individuals who developed type 2 diabetes and 2,450 matched participants without diabetes, antidepressant use was twofold higher among people who developed diabetes (adjusted or 2.00 [95% ci 1.572.55 ]) (19). antidepressant use was increased in the 4 years before and in the 4 years after diabetes diagnosis, although there was a temporary peak in antidepressant use during the year of the diabetes diagnosis (or 2.66 [95% ci 1.943.65 ]. the 2,391 participants had depression and were treated with antidepressant therapy (20). the 1,037 individuals who developed diabetes after multivariate adjustment, the concurrent use of ssris and tricyclic antidepressants was associated with a significantly increased risk of type 2 diabetes compared with the use of tricyclic antidepressants alone (adjusted or 1.89 [95% ci 1.352.65 ]). by contrast, there was no difference in the risk of diabetes between those taking ssris alone and tricyclic antidepressants alone (adjusted or 1.05 [95% ci 0.861.28 ]). twelve cohort studies examining the relationship between antidepressants and diabetes have been published since 2008. in general, these show an increased risk of diabetes in those taking antidepressants, with hazard ratios (hrs) up to 3.5. not all of the studies show a statistically significant increased risk, however, and the most recent larger studies show smaller hrs of < 1.6, indicating a weak association. the effect of antidepressants on the risk of diabetes was examined within the diabetes prevention program (dpp) and its epidemiological follow - up study, the diabetes prevention program outcomes study (dppos) (21,22). in brief, the dpp randomized 3,234 people at high diabetes risk to an intensive lifestyle intervention (ils), standard lifestyle advice, and metformin (met), 850 mg twice daily, or standard lifestyle advice plus a twice - daily met placebo (plb). at baseline, 3,187 participants completed the beck depression inventory, and those hospitalized in the previous 6 months with severe depression were excluded, as were those who had used bupropion or any other antidepressant in a daily dose greater than the minimum therapeutic dose for that agent. mixed - effects modeling compared differences in continuous variables, such as weight, by antidepressant use or depression symptoms. for categorical variables, such as sex, repeated - measures modeling was used to compare differences by antidepressant use or elevated depression symptoms. diabetes was diagnosed by an annual oral glucose tolerance test or fasting plasma glucose every 6 months using the 1997 american diabetes association criteria. at baseline, intermittent antidepressant use was reported for 7.2% of total person - years and continuous antidepressant use for 3.2% of total person - years. baseline antidepressant use was strongly associated with diabetes risk for participants in the plb (hr 2.25 [95% ci 1.383.66 ]) and ils (hr 3.48 [95% ci 1.936.28 ]) groups but not the met arm (21). continuous antidepressant use was also significantly associated with diabetes risk in the plb (hr 2.60 [95% ci 1.374.94 ] and ils arms (hr 3.39 [95% ci 1.617.13 ]). intermittent antidepressant use was only associated with increased diabetes risk in the ils arm (hr 2.07 [95% ci 1.183.62 ]). the increased risk did not appear confounded by indication, because elevated depression scores were not associated with increased diabetes risk. a total of 2,665 participants were subsequently enrolled into dppos and assessed for diabetes every 6 months for a median of 10.0 years (22). similar increased risks of diabetes were observed with continuous antidepressant use in the plb (hr 2.34 [95% ci 1.324.15 ]) and ils arms (hr 2.48 [95% ci 1.45 4.22 ]) but not in the met arm (hr 0.55 [95% ci 0.251.19 ]), where the risk was significantly lower. a representative sample of 1,000 noninstitutionalized australian people over 65 years of age living in melbourne between 1994 and 2004 were followed up biennially by telephone interview to determine diabetes risk (23). only 48 of the 110 participants (11%) classified as depressed at baseline were prescribed antidepressants. the psychogeriatric assessment scales depression scale was used to measure depressive symptoms, and incident diabetes was determined by self - report. during the 10-year follow - up, 20 people with depression (74.5 per 1,000 patient - years) and 135 without depression (34.1 per 1,000 patient - years) developed diabetes (hr 2.23 [95% ci 1.403.58 ]). antidepressant use was associated with a twofold increased diabetes risk (hr 2.02 [95% ci 1.033.97 ], p = 0.041), but after adjustment for significant demographic, lifestyle, functional health, and prevalent chronic disease predictors, including persistent depressive symptoms, the increased hr was no longer statistically significant (hr 1.80 [95% ci 0.913.57 ]). no attempt was made to assess differences between different types of antidepressant, but none of the participants were receiving ssris. a 5-year community - based prospective cohort study in zaragoza, spain, examined the relationship between baseline depressive symptoms, antidepressant use, and incident diabetes in 3,521 people aged 55 years (24). all participants had a psychiatric interview, and depression was assessed using the geriatric mental state schedule. 379 people (10.8%) had depression, and 64 (16.9%) were taking antidepressants. there were 163 new cases of diabetes, 25 (6.6%) in those with depression and 138 (4.4%) in those without, giving an overall incidence rate of 13.1 per 1,000 patient - years. the risk of developing diabetes was higher in those with depression (fully adjusted hr 1.65 [95% ci 1.022.66 ]). antidepressant use was not associated with an increased diabetes risk (hr 1.26 [95% ci 0.632.50 ]). the women s health initiative dataset was used to study the effect of elevated depressive symptoms and antidepressant use on the risk of diabetes in 161,808 postmenopausal women followed up for an average of 7.6 years (25). the women were studied annually, and incident diabetes was determined by self - report in the 152,250 women who did not have diabetes at baseline. depressive symptoms at baseline and year 3 were measured using the center for epidemiological studies depression scale (ces - d) six - item form. at baseline, 15.5% of the women were above the ces - d depression cutoff, and 6.9% reported using antidepressants. the cumulative incidence of self - reported diabetes was 6.7%, with an 8.6% rate in women with elevated depressive symptoms. the unadjusted hr for diabetes in women with elevated depressive symptoms was 1.38 (95% ci 1.321.45). after adjustment for potential confounders, including age, race / ethnicity, education, smoking status, bmi, recreational physical activity, alcohol intake, dietary energy intake, family history of diabetes, and hormone therapy use, the hr was reduced to 1.13 (95% ci 1.071.20). antidepressant use was associated with an increased risk of diabetes (1.18 [95% ci 1.101.28 ]). self - reported diabetes incidence rates were highest, at 9.6%, in women with high depressive symptoms and who were also taking antidepressants, compared with 6.3% for those not taking antidepressants and below the ces - d cutoff, 7.6% for those taking antidepressants and below the ces - d cutoff, and 8.4% for those above the ces - d cutoff and not taking antidepressants (p < 0.001). furthermore diabetes risk was higher in women who reported depressive symptoms and taking antidepressants at baseline and at the 3-year follow - up compared with those who reported depressive symptoms and antidepressant use at one time point. data from the health professionals study (19902006), the nurses health study (19962008), and nurses health survey ii (19932005) were pooled to assess the risk of diabetes associated with antidepressant use (26). these studies included 29,776 men and 138,659 women with a total of 1,644,679 person - years of follow - up. antidepressant use was assessed biennially, and in the latter parts of the study, the types of antidepressant were also recorded. the number of men receiving antidepressants (n = 365) was much lower than women (n = 12,747). a diagnosis of diabetes was considered confirmed if the participants reported one or more classic symptom plus fasting plasma glucose concentration of 140 mg / dl or random plasma glucose of 200 mg / dl, at least two elevated plasma glucose values on different occasions, or treatment with hypoglycemic medication. in june 1998, the fasting glucose threshold was lowered to 126 mg / dl in line with the change in diagnostic criteria. multivariate analysis included adjustment for age, ethnicity, marital and living status, smoking status, alcohol intake, physical activity, current multivitamin and aspirin use, a family history of diabetes, quintile of dietary score, and major comorbidities. in women, adjustment was also made for menopausal status and use of hormones such as oral contraceptives. there were 1,287 incident cases of type 2 diabetes during 16 years of follow - up in the health professionals study, a further 3,514 during the nurses health study, and 1,840 in the nurses health survey ii. although baseline antidepressant use did not predict the risk of diabetes, overall use was associated with an increased risk of diabetes in all three cohorts in age - adjusted models (pooled hr 1.68 [95% ci 1.272.23 ]), suggesting that recent antidepressant use might be more relevant to an elevated risk. the average absolute risk difference between women taking antidepressants and nonusers was 2.87 per 1,000 person - years. the association was attenuated after adjustment for diabetes risk factors and histories of high cholesterol and hypertension (unpooled hr 1.30 [95% ci 1.141.49 ]) and was further attenuated by controlling for updated bmi (hr 1.17 [95% ci 1.091.25 ]). the hrs were slightly attenuated with further adjustment for mhi-5 scores in the nurses health studies and became nonsignificant for the nurses health study i (hr 1.08 [95% ci 0.971.19 ]). ssris and other antidepressants (mainly tricyclic antidepressants) were both associated with an elevated diabetes risk compared with no antidepressant use, with pooled multivariate - adjusted hrs of 1.10 (95% ci 1.001.22) and 1.26 (95% ci 1.111.42), respectively, but the risk did not appear to differ between antidepressant type. a retrospective cohort analysis using the texas medicaid prescription claims database studied 35,552 adults receiving antidepressants and 9,163 treated with benzodiazepines between 1 january 2002 and 31 december 2009 (27). diabetes was diagnosed when an individual began treatment with antidiabetes medication, and 2,943 people (6.6%) developed type 2 diabetes. after adjustment for age, sex, medication adherence, medication persistence, number of diabetogenic medications, chronic disease score, and year of cohort entry, people receiving antidepressants had a 58% increased risk of developing diabetes (adjusted hr 1.558 [95% ci 1.4011.734 ]) compared with those receiving benzodiazepines. the association was seen with tricyclic antidepressants (hr 1.759 [95% ci 1.5172.040 ]), serotonin norepinephrine reuptake inhibitors (hr 1.566 [95% ci 1.3511.816 ]), ssris (hr 1.481 [95% ci 1.3181.665 ]), and other antidepressants (hr 1.376 [95% ci 1.1981.581 ]). all of the 9,197 antidepressant users, defined as 200 daily doses a year, from the primary retrospective analysis of an occupational cohort of 151,347 employees in finland were followed up prospectively for 1 year and compared with 45,658 control participants from the same database matched for age - group, sex, socioeconomic position, type of employment contract, type of employer, and geographic area (18). based on a mean follow - up of 4.75 years, the absolute risk of incident diabetes was 1.8% for antidepressant users and diabetes risk was higher in those who had taken more doses, supporting a dose - response association (200399 daily doses : 1.7%, 400 daily doses : 2.3%). compared with nonusers, diabetes risk was increased 53% in people taking 200399 daily doses (hr 1.53 [95% ci 1.251.87 ]) and doubled in those taking 400 daily doses (hr 2.00 [95% ci 1.512.66 ]), respectively. the relationship among antidepressant use, glucose levels, and diabetes status was explored in 5,978 civil servants in the whitehall ii study during an 18-year period (28). diabetes was recorded by self - report of a physician diagnosis, use of antidiabetes medication, or after a 75-g oral glucose tolerance test, which were undertaken approximately every 56 years. during the study, there were 294 incident cases of diabetes as a result of physician diagnosis and 346 screen - detected cases of diabetes. antidepressant use was self - reported in 94 individuals (1.6%) at baseline, and overall, 419 (7.0%) reported using antidepressants at some point in the study. a strong association between baseline antidepressant use and incident physician - diagnosed diabetes was observed (adjusted or 3.10 [95% ci 1.665.78 ]), but there was no association with incident study screen - detected diabetes (adjusted or 1.24 [95% ci 0.542.87 ], p = 0.62) with no sex differences. furthermore, after exclusion of those with physician - diagnosed diabetes, antidepressant use was not associated with a change in fasting or 2-h blood glucose. the study found evidence of reverse causality : among those who were not taking antidepressants at baseline, the proportion who began treatment with antidepressants was higher in those with physician - diagnosed diabetes (adjusted or 1.72 [95% ci 1.022.88 ]). in a dutch pharmacy database study, 60,516 individuals were followed up from their first prescription for an antidepressant or benzodiazepine until end of registration or a first prescription for an antidiabetes drug (29). although the crude diabetes incidence rate was increased in people taking antidepressants, after adjustment for age, sex, and chronic diseases, compared with people taking no psychotropic medication, the hrs for the development of diabetes were 1.05 (95% ci 0.881.26) for antidepressant users, 1.21 (95% ci 1.021.43) for benzodiazepine users, and 1.37 (95% ci 1.121.68) for users of antidepressants and benzodiazepine. a recently published meta - analysis of 66 experimental studies dating back to 1960 included 42 studies of people without diabetes (30). all included studies were assessed in terms of the specific pharmacodynamics properties of the antidepressants and the pathophysiological changes in depression and impaired glucose homeostasis. four studies explored unselective and irreversible monoamine oxidase inhibitors (maois), including isocarboxazid, iproniazid, and phenelzine. eight studies looked at unselective monoaminergic reuptake inhibitors (amitriptyline, imipramine), and one studied the effect of other predominantly or selective noradrenergic reuptake inhibitors (nortriptyline, maprotiline, mianserin). twelve studied the effect of serotonin - norepinephrine reuptake inhibitors (duloxetine, venlafaxine), with a further 11 exploring the effect of ssris, and five the effect of fluoxetine. the review concluded that antidepressants could be divided into three groups : hydrazine - type maois and ssris were associated with improved glycemic control, whereas noradrenergic substances and possibly also dual acting antidepressants were associated with worsened glycemic there is an uncertain effect with bupropion, mirtazapine, and other newer agents. in a second article, antidepressant effects on glucose - insulin homeostasis were reviewed and mechanisms of actions explored, with mixed results (31). preclinical and clinical investigations were both included ; however, only experimental clinical investigations are included here. the study populations were variable, with participant numbers being small in most studies (n = 6, 12, 13, 16, 33, 43, 48, 59, 143, 422 and 449 participants) and poorly defined baseline risk factors. serotonergic antidepressants, such as fluoxetine, reduced hyperglycemia, normalized glucose homeostasis, and increased insulin sensitivity, whereas some noradrenergic antidepressants, such as desipramine, exerted the opposite effects. dual - mechanism antidepressants, such as duloxetine and venlafaxine, did not appear to disrupt glucose homeostasis dynamics, whereas nonselective hydrazine maois, such as phenelzine, were associated with hypoglycemia and an increased glucose disposal rate. the heterogeneity of included populations may well have obscured any effect of antidepressants on glucose metabolism. (32) examined short- and long - term effects of duloxetine (20120 mg / day) on glycemic control in patients with diagnoses other than diabetic peripheral neuropathic pain. seven short - term studies (927 weeks) and two long - term (41 and 52 weeks) studies were included. in the short - term, no statistically significant differences were observed in baseline - to - end point changes in fasting plasma glucose or hba1c in duloxetine - treated patients compared with those treated with placebo. in the long - term, a statistically significant increase in hba1c was found in patients with chronic lower back pain treated with duloxetine in the 41-week open - label extension study, but this difference was not observed in the 52-week double - blind placebo - controlled study in patients with recurring major depressive disorder. the quality of studies was variable, with shortcomings including self - report of diabetes, lack of adjustment of traditional diabetes risk factors, and little account of confounding variables (table 2). comparison is further hindered across studies by different measures of depression diagnoses, different measures of diabetes diagnoses, participant numbers, and variable assessment time - points. this review has found evidence that some antidepressants affect glucose metabolism and that antidepressant use may be an independent risk factor for diabetes. however, the most recent studies that have included large numbers of people receiving antidepressants, such as the nurses health study, suggest that any risk is small. case reports have found that certain antidepressants have been associated with the development of diabetes, which returns to normal after treatment discontinuation. cross - sectional studies have not demonstrated an increase in diabetes prevalence, independent from depressive symptoms ; however, there are changes in metabolic and body composition measurements that are associated with diabetes. case - control studies have reported an approximate doubling of diabetes rates in those taking antidepressants, with higher rates seen with higher doses, longer duration, or as combinations. some cohort studies have also found an increase in the incidence of diabetes in those taking antidepressants, although the most recent larger studies have shown a much lower risk than in the first studies published in 2008. there is evidence of potential confounding, because rates of undiagnosed diabetes were not increased in the one study that compared diagnosed and undiagnosed diabetes. a further study provided evidence of a dose - response, with a higher rate in those taking higher doses. there was evidence of reverse causality in one study that reported that among those who were not taking antidepressants at baseline, the proportion that began treatment with antidepressants was higher in those with a physician diagnosis of diabetes. experimental studies have shown that different antidepressants affect glucose metabolism in different ways, but certainly some, including noradrenergic substances, have adverse effects. the evidence suggests a link between antidepressant use and diabetes, but causality is not established. the strength of association in the larger most recent cohort studies is weak, which increases the chance that the finding occurs through residual confounding. however, it is likely that most serious adverse drugs effects have weak association only because a high risk of a serious side effect would have prevented a drug reaching the market. there is inconsistency among findings from different study types regarding increased diabetes risk, although more consistency is found within the cohort and experimental studies that provide the strongest evidence. to conclude that diabetes is a consequence of antidepressant use, the drug must be prescribed before the onset of diabetes. although this occurs in the case histories, cohort, and experimental studies, in other studies, diabetes preceded antidepressant use, with evidence of reverse causality. there is evidence of a biological gradient (i.e., increasing exposure associated with increasing diabetes risk), because several studies have shown that diabetes is more common in those using antidepressants in a higher dose or for longer duration, or both. this may, however, be confounded with worse severity of depression, rather than antidepressants, increasing diabetes risk. there are several plausible reasons why antidepressants may be associated with an increased diabetes risk. several antidepressants are associated with significant weight gain, which in turn increases insulin resistance and the risk of diabetes (2,33). however, several studies still observed an increased risk of diabetes after adjustment for changes in body weight, implying that other mechanisms are involved. this is consistent with previous findings that other psychiatric drugs, for example, antipsychotics, may affect glucose metabolism by altering insulin resistance or secretion directly. increased antidepressant use is occurring concurrently with increasing diabetes prevalence ; thus, any cause - and - effect interpretation does not conflict with generally known facts of the natural history and biology of the disease. experimental studies provide some evidence of such a cause - and - effect relationship, but many of these are small, with differences between different drugs. these differences provide challenges for the interpretation of the many observational studies that do not separate antidepressant types. however, the observational studies that have attempted to differentiate between different drugs have not found consistent differences in risk. applying the bradford hill criteria (34) to determine causality, we find that some are fulfilled whereas others are not. the strength of association is weak and there is lack of consistency or specificity, but there is evidence for temporality for some cases of diabetes, a biological gradient, and a plausible explanation. furthermore, the causative link between antidepressants and diabetes is coherent with our understanding of diabetes, and there are analogies with other drugs. we therefore conclude that there may be a causative link between antidepressants and diabetes but that this risk is probably low and the majority of patients receiving antidepressants will not develop diabetes as a result of their medication. differing populations in age, baseline risk factors, and lifestyle, such as bmi and smoking status, prevent appropriate comparison. the nature of prescribed medications and patient exposure to them in duration, dose, and continuous versus intermittent use is further complicated by questions of adherence to medication regimens. although some studies have examined different classes of antidepressants and found that ssris and other antidepressant medications have a similar association with diabetes risk, it seems essential that epidemiological studies differentiate between antidepressants rather than considering them as a whole. for such an epidemiological study to be adequately powered, it would be necessarily large scale. an assessment of glucose metabolism should be included in any future randomized controlled trials of antidepressants with a minimum dataset for reporting adverse metabolic consequences of treatment. interactions with other drugs are also needed in view of the findings of the dpp study that antidepressant use with met reduced the risk of diabetes. in conclusion, from the evidence reviewed, there is a link between antidepressant use and diabetes, but causality is not established. long - term prospective studies are required to assess this relationship further, but in the interim, caution is advised and a heightened alertness to the potential risk of diabetes is necessary, not least because of the large numbers of antidepressants that are prescribed. | objectiveantidepressant use has risen sharply over recent years. recent concerns that antidepressants may adversely affect glucose metabolism require investigation. our aim was to assess the risk of type 2 diabetes associated with antidepressants through a systematic review.research design and methodsdata sources were medline, embase, psycinfo, the cochrane library, web of science, meeting abstracts of the european association for the study of diabetes, american diabetes association, and diabetes uk, current controlled trials, clinicaltrials.gov, u.k. clinical research network, scrutiny of bibliographies of retrieved articles, and contact with relevant experts. relevant studies of antidepressant effects were included. key outcomes were diabetes incidence and change in blood glucose (fasting and random).resultsthree systemic reviews and 22 studies met the inclusion criteria. research designs included 1 case series and 21 observational studies comprising 4 cross - sectional, 5 case - control, and 12 cohort studies. there was evidence that antidepressant use is associated with type 2 diabetes. causality is not established, but rather, the picture is confused, with some antidepressants linked to worsening glucose control, particularly with higher doses and longer duration, others linked with improved control, and yet more with mixed results. the more recent, larger studies, however, suggest a modest effect. study quality was variable.conclusionsalthough evidence exists that antidepressant use may be an independent risk factor for type 2 diabetes, long - term prospective studies of the effects of individual antidepressants rather than class effects are required. heightened alertness to potential risks is necessary until these are complete. |
adrenocortical carcinoma (acc) is an extremely rare neoplasm in children and adolescents with an annual incidence of 0.3 cases per million children younger than 15 years old.1) although the molecular pathogenesis of acc is poorly understood, it is strongly associated with inactivating mutation of the tumor suppressor gene p53 and alteration of the 11p15 locus leading to insulin - like growth factor 2 overexpression.2) acc is often associated with the li - fraumeni and beckwith - wiedemann syndromes.3) adrenocortical tumors in children and adolescents are frequently hormone - secreting tumors, and virilization alone or in combination with signs of overproduction of adrenocortical hormones is the most common endocrine syndrome.1) hormonally inactive accs, which are common in adults, usually induce abdominal discomfort or back pain caused by the mass effect of the large tumor. any virilizing symptoms that were resolved after surgical removal of the tumor could theoretically trigger true precocious puberty because of the maturation of the hypothalamic - pituitary - gonadal axis. therefore, we report a case of virilizing acc in an 8-year - old boy who subsequently developed central precocious puberty following surgery with reviews of the literature. an 8-year, 2-months - old boy presented to our pediatric clinic with early development of pubic hair and penile growth for the past 3 months. he was born after 40 weeks of gestation through vaginal delivery with a birth weight of 3,600 g. his past medical and surgical histories were unremarkable. none of his family members had endocrine tumors or genetic diseases. on physical examination, his height was 137.6 cm (95th percentile), and his body weight was 40.1 kg (95 - 97th percentile). he had no other abnormalities, such as hypertension, cushingoid symptoms, hyperpigmentation, or macroglossia. follicle - stimulating hormone (fsh) and luteinizing hormone (lh) levels were below the limit of detection (< 0.07 miu / ml). the levels of serum dehydroepiandrosterone sulfate (dheas, 584 g / dl), 17-ohp (4.05 ng / ml), testosterone (3.82 ng / ml), and urinary 17-ketosteroid (58.8 mg / d) were markedly elevated. the serum morning cortisol level (15.2 g / dl) was not elevated, and his adrenocorticotropic hormone level was within the normal range (7.89 pg / ml). meanwhile, in addition, his daily urinary free cortical excretion (106.9 g / d) was increased. his bone age was 9 to 10 years based on the greulich - pyle method. both abdominal ultrasonography and computed tomography (ct) demonstrated a large right suprarenal heterogeneous mass measuring 7.45.7 cm with poor enhancement (figure 1). the lungs, bone, and liver were free from metastases on magnetic resonance imaging or high - resolution ct. a provisional diagnosis of adrenocortical tumor was made, and resection of the right adrenal gland with the tumor mass was performed. grossly, there was no metastasis to regional lymph nodes or vessels detected during the operation. the adrenalectomy specimen was partially encapsulated and soft, measuring 7.86.14.0 cm and weighting 86 g. the cut section was bright brownish with areas of focal hemorrhage. the tumor cells were arranged in a nodular and diffuse architecture, and they had high mitotic activity (9/10 high - power fields). a histological diagnosis of acc was made (weiss score was 6 of 9). the staging of adrenocortical tumors in this patient (modified from sandrini.) was stage i.2) after the operation, serum dhea - s, 17-ohp, and testosterone levels rapidly decreased to the normal levels. however, penis enlargement and the presence of pubic hair persisted at the same level after surgery. two months after the operation, testicular enlargement and frequent penile erections were noticed by his mother. the volumes of both testes were increased to 5 ml, and his height velocity was increased (10.0 cm per year). the serum dhea - s level was not elevated, whereas fsh (1.8 miu / ml), lh (5.9 miu / ml), and testosterone (3.34 ng / ml) levels were elevated to pubertal levels. the peak values of fsh and lh based on a gonadotropin - releasing hormone (gnrh) stimulation test were at pubertal levels (basal fsh / lh, 2.3/4.4 miu / ml ; peak fsh / lh, 4.5/34.7 miu / ml), suggesting secondary central precocious puberty. treatment with a gnrh agonist was initiated, and his pubertal state did not progress further. although an exceptionally high incidence of acc has been reported for children in southern brazil and los angeles, ca, the worldwide incidence has been estimated at approximately 0.4 cases per million children younger than 4 years of age. acc has a peak incidence in children younger than 4 years.4) in addition, acc comprises approximately 0.2% of all childhood neoplasms in the united states according to surveillance epidemiology and end results data from the national cancer institute.1,4) a slight female preponderance and a bimodal age distribution have been noted.4) acc can arise as an either nonfunctional or functional tumor. non - functional acc is most common in adults, whereas more than 90% of childhood accs are functional.2) virilization alone or in combination with signs of overproduction is the most common presenting endocrine syndrome in pediatric patients.1) isolated cushing 's syndrome, the major symptom of adult acc, is extremely rare, as well as conn 's syndrome. our male patient presented with pubic hair, penile growth, and facial acne. his hormonal findings were characterized by the overproduction of androgens in serum and urine analysis. although his serum dhea - s levels had remarkably decreased to normal after the operation, the physical signs of precocious puberty were persistent and indicative of progression. in addition, the peaks of fsh and lh in gnrh stimulation testing were at pubertal levels, suggesting secondary central precocious puberty. several causes of peripheral precocious puberty have been recognized, including adrenal tumors.5) peripheral precocious puberty may result in the activation of pulsatile gnrh secretion and central precocious puberty. in addition, effective treatment of the primary disease causes the development of secondary central precocious puberty by activating the hypothalamic gnrh pulse generator via a feedback system, as observed in congenital adrenal hyperplasia and familial or sporadic male - limited precocious puberty.6) the period of development for secondary central precocious puberty is various, and other reports illustrated that central precocious puberty may develop as early as 1 month after the initiation of treatment for peripheral precocious puberty.7) gnrh agonists are indicated for the treatment of progressive central precocious puberty, and this therapy was initiated in our male patient to prevent pubertal progressions. all accs are highly malignant tumors, and hence, surgical intervention is the mainstay of treatment for acc. because of the friability of these tumors and the potential for tumor spillage, open adrenalectomy is recommended for children with acc. when metastatic disease can not be removed or a high risk of recurrence is identified, chemotherapy is often considered. however, the benefits and risks of chemotherapy for acc in children, including mitotane or other chemotherapeutic agents, have not yet been established.8) because of the tumor stage in our patient, he was only treated with surgery. in conclusion, we suggest that in functioning accs, clinical follow - up for potential secondary effects of excessive hormone secretion or recurrence after surgical removal is important, and hormonal marker or sexual maturity should be assessed at least every 1 or 2 months after surgery. | adrenocortical carcinoma (acc) in pediatric and adolescent patients is rare, and it is associated with various clinical symptoms. we introduce the case of an 8-year - old boy with acc who presented with peripheral precocious puberty at his first visit. he displayed penis enlargement with pubic hair and facial acne. his serum adrenal androgen levels were elevated, and abdominal computed tomography revealed a right suprarenal mass. after complete surgical resection, the histological diagnosis was acc. two months after surgical removal of the mass, he subsequently developed central precocious puberty. he was treated with a gonadotropin - releasing hormone agonist to delay further pubertal progression. in patients with functioning acc and surgical removal, clinical follow - up and hormonal marker examination for the secondary effects of excessive hormone secretion may be a useful option at least every 2 or 3 months after surgery. |
such molecules are found among screening hit lists, biological reagents, and even marketed drugs. these aggregates have the unusual property of nonspecifically inhibiting enzyme targets, leading to false positive hits in biochemical assays, a problem that is now well - recognized, particularly in high - throughput screening. still, exactly how aggregates cause inhibition remains poorly understood.(21) here we revisit the specific mechanism of nonspecific inhibition by investigating the structural changes that are induced in the enzyme upon binding to the aggregate. in 2003 mcgovern. observed three mechanistic features of small molecule aggregates that guided our investigation.(22) first, inhibition occurs via the direct binding of enzyme to aggregate, as shown by (1) the ability to sediment proteinaggregate complexes with centrifugation, (2) the punctate fluorescence observed by microscopy in mixtures of aggregates with green fluorescent protein (gfpa), aabbreviations : gfp, green fluorescent protein ; hdx ms, hydrogendeuterium exchange mass spectrometry ; esi lcms, electrospray ionization liquid chromatographymass spectrometry ; maldi, matrix - assisted laser desorption / ionization ; cac, critical aggregation concentration. and (3) the direct observation of proteinaggregate complexes by transmission electron microscopy. second, aggregate - based inhibition can be rapidly reversed by the addition of a nonionic detergent such as triton x-100, indicating that enzyme can quickly (within tens of seconds) regain activity from aggregate - based inhibition. last, several experiments appeared to be inconsistent with denaturation as a potential mechanism of action. for example, it seemed unlikely that enzyme could rapidly refold into its active state upon the addition of detergent if it were completely denatured when bound to the aggregate. it seemed equally unlikely that gfp could retain its fluorescence if it were completely denatured while bound to an aggregate. two other experiments suggested that inhibition was not due to denaturation : (1) additional denaturants such as guanidinium or urea did not increase inhibition by aggregates (if anything, inhibition was decreased) and (2) a destabilized mutant appeared to be no more sensitive to aggregate - based inhibition than its wild type counterpart. abbreviations : gfp, green fluorescent protein ; hdx ms, hydrogendeuterium exchange mass spectrometry ; esi lcms, electrospray ionization liquid chromatographymass spectrometry ; maldi, matrix - assisted laser desorption / ionization ; cac, critical aggregation concentration. as a result of mcgovern s work, we considered three possible mechanisms of action that might explain aggregate - based inhibition (figure 1). although we did not believe that there was large scale unfolding of the enzyme, it still seemed reasonable that there might be small - scale or local unfolding, which has also been proposed by ryan.(23) on the other hand, aggregate binding may have the opposite effect : instead of increasing flexibility, it may rigidify it, restricting those dynamic motions necessary for catalysis. finally, aggregates may physically sequester enzyme away from substrate. to explore these potential mechanisms, we chose to use hydrogendeuterium exchange mass spectrometry (hdx ms), a technique widely used to measure changes in solvent accessibility for processes such as enzyme unfolding or proteinprotein interactions. hdx ms relies on the different exchange rates of the backbone amide protons with a deuterated solvent, which are measured by the change in mass as deuterium replaces hydrogen. to investigate changes in solvent accessibility, we quantified deuterium exchange of ampc -lactamase over 8 h in the presence or absence of an aggregating inhibitor, rottlerin. the differences in solvent accessibility were not localized to specific regions (given the nonspecific nature of aggregate - based inhibition, we did not expect to see peptide - specific interactions) ; rather, we observed a general trend across all peptides. the differences in solvent accessibility that we observed by mass spectrometry suggested that we may also see differences in protease sensitivity, which we investigated by gel electrophoresis of tryptic digests of our model enzyme in the presence or absence of several known aggregating inhibitors. combined, these experiments suggest small scale enzyme unfolding as a molecular mechanism for aggregate - based inhibition. (c) the aggregate physically blocks the active site and sequesters enzyme away from substrate. to examine the structural changes that occur in an enzyme when bound to a small molecule aggregate, we began by measuring changes in solvent accessibility using hdx ms. the experiments were conducted with ampc -lactamase, which is perhaps the enzyme best characterized for aggregate - based inhibition. rottlerin was chosen as a model aggregator because of the large concentration range between its critical aggregation concentration (cac) and when it begins to precipitate and because of its relatively high potency as an aggregator (low micromolar ic50 vs ampc). -lactamase was incubated in deuterated mops buffer between 10 min and 8 h, in either the presence or absence of rottlerin. after exchange, the aggregates were disrupted with detergent and the exchange reaction was quenched by the addition of cold acid. these peptides were then separated and analyzed by electrospray ionization liquid chromatographymass spectrometry (esi lcms). two modifications were necessary to accommodate the presence of aggregates in the hdx ms experiment. first, aggregateenzyme complexes had to be exchanged in the deuterated buffer at a lower concentration and then concentrated before further sample preparation. aggregates are a phase between soluble, free small molecule and precipitant, the latter of which does not typically inhibit enzymes, so there is an upper limit to the concentration that we can take an aggregating inhibitor : the concentration when it ceases to form more aggregates and instead begins to precipitate. these hdx ms experiments required micromolar concentrations of protein, and if a corresponding concentration of inhibitor were used, we would need an inhibitor that was soluble at millimolar concentrations. as aggregation is a form of insolubility, there are very few examples of molecules that have such high solubility and these molecules are often weak aggregators and unsuitable for this analysis. since we did not have an aggregator that could be used at millimolar concentrations, we instead reduced the concentration of the enzyme so that it would be mostly inhibited by a preprecipitant colloidal form of the aggregator (100 m for rottlerin). we relied on the fact that aggregates and aggregate - bound enzyme can be pelleted and therefore concentrated by centrifugation. although incubation was performed at a lower concentration of enzyme, we could concentrate the enzymeaggregate complexes prior to analysis by collecting the pellet and removing the supernatant. this has the additional benefit of guaranteeing that predominantly aggregate - bound complexes would be analyzed, as free enzyme would not be pulled down by centrifugation and would be many - fold lower in concentration. it was necessary to add triton mainly to release bound enzyme from the aggregates so that the complexes were not pulled down again when centrifugation was used to remove the immobilized pepsin. this resulted in a delicate balance between using enough detergent to release the enzyme for analysis but not so much that the detergent signals overwhelmed the peptide signals in the mass spectra, where triton signals were both numerous and strong. to increase separation between the peptide and detergent signals, we used esi lcms rather than matrix - assisted laser desorption / ionization (maldi, which does not require peptide separation). as a result of the presence of aggregates, the inhibited samples generally showed much weaker signal intensities compared to uninhibited samples. often, the peptide signals were so weak that they could not be analyzed. the peptides that we reproducibly observed covered 41% of the -lactamase sequence (figure 2), representing several regions of the enzyme spanning both buried and exposed regions. although our results are not strong enough to determine whether specific areas experienced more exchange than others, it was also not our goal to do so. given that aggregates are nonspecific inhibitors, we were searching for a global effect, a mechanism that could explain inhibition of many enzymes and that was not restricted to specific residues or peptide sequences. the results suggested such a trend. across all of the peptides that we measured, enzymeaggregate samples showed deuterium incorporation greater than or equal to the deuterium incorporation of the enzyme alone (table 1). levels of deuteration were very low in both samples with and without inhibitor ; however, the trend of higher deuterium content in the aggregate - containing samples is consistent across all of the peptides. we suspect the low levels of incorporation are due to increased back exchange occurring during the protein concentration and chromatography steps. many peptides incorporated levels of deuterium that were not, in themselves, entirely convincing ; however, even here, each showed more deuterium exchange in the presence of aggregates than for the free enzyme. we never observed a peptide that had reduced deuterium exchange in the presence of aggregates. two peptides that did show significant exchange are shown in figure 3 (a complete list of peptides is available in the supporting information). again, we observed very low deuterium incorporation, but the time points repeatedly indicated a significant difference between samples with and without aggregates. the higher deuterium incorporation of aggregate - bound enzyme across all 10 peptides suggested that the enzyme may be unfolded when bound to the aggregate. amino acid sequence and structure of ampc -lactamase : (a) enzyme sequence showing the peptic fragments that could be quantified reproducibly in the mass spectrum both with and without the aggregator rottlerin ; (b) two orientations of the structure of ampc -lactamase indicating the location of the peptic fragments that were observed in the mass spectrum (fragments shown in purple, active site residues shown in yellow).(39) equal to number of amide bonds + 1, excluding prolines. deuterium incorporation is calculated by subtracting the mass of the control undeuterated centroid from the centroid of the deuterated sample. deuterium incorporation is calculated as the (deuterated mass charge charge) minus (undeuterated mass charge charge) with the standard deviation of three replicate measurements. average ratio of side chain surface area to random coil values per residue calculated using getarea.(38) greater than 50% is considered exposed, and less that 20% is considered buried. mass envelopes and corresponding deuterium incorporation plots for two fragments from the mass spectrum of -lactamase in the presence (dotted line) or absence (solid line) of the aggregator rottlerin. the spectra have been expanded to show the isotopic distribution of the ions of interest : (a) the peptide containing residues 132146 (monoisotopic m / z = 908.4, + 2 charge state) and (b) the peptide containing residues 291322 (monoisotopic m / z = 813.7, + 4 charge state). for each peptide, the isotopic distributions are shown for (i) the undeuterated sample, (ii) the sample that was deuterated for 4 h in the absence of rottlerin, and (iii) the sample that was deuterated for 4 h in the presence of rottlerin. if aggregates were unfolding bound enzyme, we might expect aggregate - bound enzyme to be more susceptible to proteolytic degradation than free, uninhibited enzyme. if an enzyme is even slightly unfolded, it should be measurably more sensitive to digestion by proteases (figure 4). given recent results showing the very slow off rate of enzyme from the aggregate and that the aggregate can be saturated with enzyme and so maintain a large excess of uninhibited protease, this experiment seemed feasible. we chose five known aggregators : rottlerin, congo red, eriochrome blue black b, nicardipine, and l-755,507. -lactamase was preincubated with or without aggregates before the addition of trypsin to avoid competition with trypsin for binding space on the aggregate. free or aggregate - bound enzyme was then incubated with trypsin between zero min and 4 h, and the digestion was monitored by gel electrophoresis. if the enzyme is unfolded on the aggregate, it should be more susceptible to proteolysis compared to enzyme in the absence of aggregates (a). if the enzyme is in its native state when bound to the aggregate, identical to unbound enzyme, it should be degraded at a comparable rate (b). although some trypsin may be bound to the aggregate, trypsin is used in excess to ensure that there is free, active trypsin in solution : (+) indicates that aggregates are present ; () indicates free enzyme. for all of the aggregators, the presence of aggregates had no effect on the band representing -lactamase in the absence of trypsin (figure 5, lanes 2 and 3 or 1 and 3). in contrast, when we added trypsin, we observed significant digestion in the presence of aggregates but not in the absence (figure 5). for example, in figure 5a, the -lactamase band is present in both the aggregate - inhibited and free enzyme samples at zero minutes (lanes 6 and 7), but as time progresses, the -lactamase band in the presence of rottlerin becomes weaker and weaker until it is completely gone by 4 h (lane 15). conversely, -lactamase in the absence of rottlerin appears almost as strong after 4 h with trypsin as it did after zero min (lane 14). for congo red and eriochrome, the -lactamase band is present in both samples at zero min of trypsin incubation (figure 5b, c, lanes 6 and 7), but after only 15 min the -lactamase band is gone in the presence of aggregates (lane 9). again, -lactamase in the absence of aggregates remains undigested by trypsin even after 4 h (lane 14). although the effect was less pronounced, two other aggregators, nicardipine and l-755,507, also increased sensitivity to trypsin (figure 5d, e). in many of these samples, it is also possible to observe the formation of a large degradation product of -lactamase running below the trypsin band (figure 5). intriguingly, trypsin also appears to experience more self - degradation in the presence of aggregators (figure 5a, c, lanes 4 and 5). sdspage and silver stain of tryptic digests of -lactamase in the presence (+) or absence () of aggregating inhibitors. the inhibitors are (a) 100 m rottlerin, the same inhibitor used in the hdx ms experiments, (b) 250 m congo red, (c) 250 m eriochrome blue black b, (d) 100 m l-755,507, and (e) 250 m nicardipine. for gels b, c, and e, lane 1 is a molecular weight ladder. for gels a and d, lane 2 is a molecular weight ladder. lanes 2 and 3 for gels b, c, and e or lanes 1 and 3 for gels a and d show -lactamase without trypsin, in the absence () or presence (+) of aggregator. lanes 4 and 5 contain trypsin (no -lactamase) in the absence and presence of aggregator, respectively. lanes 615 contain tryptic digests of -lactamase in the absence or presence of aggregator for digestion times of 0 min, 15 min, 30 min, 1 h, and 4 h (from left to right). trypsin was used at a concentration of 0.01 mg / ml for (a), 0.025 mg / ml for (b), (c), and (d), and 0.05 mg / ml for (e). a suspected degradation product of ampc is indicated with an arrow and labeled dp. the key result to emerge from this study is the mechanism by which association with colloidal aggregates leads to enzyme inhibition : partial protein denaturation. the increased hydrogendeuterium exchange of -lactamase when bound to rottlerin aggregates suggests that the enzyme s backbone amides are more exposed to solvent when bound to an aggregate, indicating at least partial enzyme denaturation (figure 3). consistent with this view is the increased susceptibility of the enzyme to trypsin degradation when bound to the characteristic aggregators rottlerin, congo red, eriochrome blue black b, nicardipine, and l-755,507 (figure 5). that proteins directly associate with aggregates has been established for some time and is supported by the precipitation of aggregate - bound protein on centrifugation, by the detection of aggregate binding with surface plasmon resonance,(20) and by imaging of aggregateprotein complexes by transmission electron microscopy and fluorescence microscopy.(22) what remained perplexing was why such association should lead to inhibition. proteins can be attached to solid supports, as in chromatography, without compromising their function, and so association, per se, seemed unlikely to lead to inhibition. an early hypothesis was that the aggregates were acting as denaturants, but several lines of evidence seemed to tilt against this. first, gfp retained fluorescence while bound to aggregate particles, which should not be true if gfp was substantially denatured on aggregate association. second, destabilized and up - stabilized mutants of the same enzyme were inhibited to the same extent by colloidal inhibitors, indicating that liability to denaturation did not increase susceptibility to aggregate - based inhibition. third, classical denaturants such as urea or guanidinium failed to potentiate aggregate - based inhibition ; rather, inhibition was actually reduced in the presence of these denaturants. finally, disruption of the aggregates by detergent returned enzyme activity within the dead time of the experiment, less than 15 s, suggesting that no substantial refolding was occurring. whereas none of these experiments were in themselves conclusive, taken together they alluded to another, unknown mechanism behind aggregate - based inhibition, and our understanding has remained at this point for the past 5 years. we can reconcile the earlier and present observations by noting that the previous study only seemed to exclude large scale protein denaturation. more local denaturation would not be expected to extinguish gfp fluorescence(36) nor would substantial refolding be necessary for the enzyme to regain activity upon aggregate disruption by detergent. as to the reduced inhibition observed in the presence of classical denaturants, we have since discovered that urea and guanidinium themselves disrupt colloidal aggregates, preventing any additive denaturant effect. finally, our ability to interpret the inhibitory effects of colloidal aggregates on destabilized and up - stabilized mutant enzymes was confounded by the cac of the colloidal particles and their unusually tight binding to proteins. neither of these phenomena were understood in 2003, but recent studies have shown that aggregates undergo a cac phase transition, above which their affinities for proteins are in the picomolar dissociation range or better. given micromolar cac values and picomolar kd values for the proteinaggregate interaction, one would not expect to see differential inhibition of the mutant enzymes that were more or less stabilized by no more than 5 kcal / mol. returning to our three models (figure 1), we have ruled out reduced dynamics and physical sequestration, as both would have resulted in reduced solvent accessibility (less deuterium exchange) and protection from proteolysis ; rather, the reverse is observed in both cases. taken together, our previous studies and current experiments suggest that on association with colloidal, promiscuous inhibitors, proteins undergo partial denaturation, which manifests itself as enzyme inhibition. in such a mechanism, hydrogendeuterium exchange would increase, as would proteolysis, but the enzyme would not be so denatured that it could not rapidly return to its active conformation or that gfp would not retain fluorescence. two important caveats to these conclusions are the weak peptide signals in the mass spectra and the low overall deuterium incorporation. the presence of the aggregates interfered with the hdx ms, reducing signal - to - noise and experimental reproducibility. we suspect that we were only partially successful at disrupting aggregateenzyme complexes, and so lost peptide during sample preparation. typically this problem would be addressed by the addition of further triton x-100, but this posed its own hazards for mass spectrometry because the detergent peaks easily overwhelmed our peptide signals. detergents better tolerated by mass spectrometry, such as -octaglucoside, were ineffective at disrupting the aggregates to free the peptides for analysis. the levels of deuterium incorporation in both the aggregate - inhibited and uninhibited samples were disconcertingly low, which we attribute to high back exchange. combined with the complicating factors of low peptide signal strength and overwhelming detergent signals, the chromatographic run time had to be increased to allow separation of the peptide and detergent peaks, thus leading to more back exchange. we suspect that the somewhat erratic incorporation of deuterium as a function of time is due to the low deuterium content (which is more subject to signal - to - noise interference). because of the low signal - to - noise and low deuterium incorporation, we draw no conclusions about which parts of the enzyme are more exposed to solvent upon aggregate binding, as would ordinarily be tempting to do with this technique. that admitted, every single peptide that we observed had greater hydrogendeuterium exchange in the aggregate - bound protein compared to the free protein. this suggests that whereas we can not resolve the specific parts of -lactamase that are more denatured, the enzyme is being partially denatured. inhibition by each of five different aggregators increased susceptibility of -lactamase to proteolysis to the point where degradation was apparent within 15 min of trypsin addition, whereas digestion of uninhibited enzyme took place over several hours (figure 5). partial protein denaturation on association with colloidal aggregates offers the first molecular mechanism for the inhibitory effects of these particles. this mechanism is attractive in that it is general, relying on no particular feature of enzyme or aggregate structure. all that would be required are the nonpolar, buried residues that all enzymes possess, which might be expected to associate with the nonpolar surfaces that the colloidal aggregates inevitably feature. it also suggests the opportunity for more detailed, biophysical studies of the sort that have long been used to characterize protein stability and hydrophobic binding. as an aside, we note that as denaturants, colloidal aggregates are peculiar. their denaturation - by - sequestration mechanism on large isolatable particles may be unique and may lend itself to pragmatic uses. these might include the ability to sequester proteins in a relatively concentrated, inactive form and from a medicinal chemistry perspective to affect the adsorption and distribution of drugs and reagents.(4) this would be an interesting twist for a species that until now, owing to its pervasiveness in early drug and reagent discovery, has been only a great and recurring problem. at this time, particle formation appears to be a common feature of organic molecules in aqueous buffer : it is ubiquitous in early drug discovery and particularly problematic in high - throughput screening. as has been known for some time, small molecule colloidal aggregates inhibit protein via direct binding, an association that we now believe is surprisingly tight, picomolar or better. the low dissociation constant results in little to no measurable exchange between aggregate - bound and free protein.(33) conversely, the aggregates themselves are in dynamic equilibrium with their monomer small molecule components and will rapidly dissociate when diluted below their threshold of formation, the cac.(35) as an aside, we note that the cac of an organic molecule in a particular buffer will be relatively invariant. whether this molecule, above its cac, will observably inhibit depends on other variables, including the stoichiometric ratio of the protein it is sequestering ; if unrecognized, this can lead to confusion in reconciling the behavior of a particular molecule from assay to assay. the aggregates appear to be solid, densely packed particles, the larger of which can bind on the order of 10 000 protein molecules. although we have yet to conclusively determine that protein is not absorbed within the aggregate, adsorption to the surface has been observed by microscopy(22) and our calculations indicate that the particle surface has more than sufficient binding capacity to accommodate all bound protein.(35) the final insight to this picture is the conclusion that we have drawn here : that the aggregateprotein interaction results in partial denaturation and subsequent inhibition. this model appears to be true for a number of aggregating molecules, suggesting it may be general, but it remains unclear whether there may be different subtypes of aggregates. evidence of differing detergent sensitivity, size, and binding strength suggest that there are aggregates that behave uncharacteristically and may operate by additional mechanisms. regardless, we now have a far clearer understanding of these so often perplexing particles. ampc -lactamase was expressed and purified as previously described.(37) rottlerin, congo red, eriochrome blue black b, nicardipine, trypsin from porcine pancreas, and trifluoroacetic acid were purchased from sigma - aldrich. ampc -lactamase (215 m stock in 50 mm kpi, ph 7.0) was delivered to the deuterated solvent (50 mm mops buffer in d2o, ph 7.0) to a final concentration of 16 m for uninhibited enzyme or 0.16 m for samples containing the inhibitor rottlerin. the total volume of samples without rottlerin (including the undeuterated and 100% deuterated controls) was 10 l, whereas the total volume for each sample with rottlerin was 1 ml. the concentration of rottlerin in these samples was 100 m (0.5% dmso) delivered from a 20 mm stock in dmso. the difference in -lactamase concentration and total volume was to accommodate for the limited solubility of rottlerin. after incubation in the deuterated solvent for 5 min or 1, 2, 4, or 8 h, the samples containing rottlerin were centrifuged for 5 min at 16000 g to pull down and concentrate aggregateenzyme complexes and the top 990 l amount was discarded. the bottom 10 l volume was considered the pellet and were treated identically to the 10 l samples without rottlerin from this point on. to disrupt the aggregates, 1 l of 3% triton x-100 in 50 mm deuterated mops buffer was added to every sample and the samples were mixed vigorously by pipetting. immediately after, the samples were quenched with 90 l of ice cold 0.1% trifluoroacetic acid in water, ph 2.5. samples were kept on ice with occasional mixing for 5 min, and then the pepsin beads were sedimented by centrifugation for 1 min at 16000 g at 4 c. the supernatant was collected and frozen with liquid nitrogen. the mass spectrometry data were acquired on an applied biosystems qstar pulsar hybrid lc / ms / ms system. chromatography was performed using an eldex micropro pump equipped with an in - house splitter capable of producing column flow rates of 0.31.0 l / min at pump flow rates of 5080 l / min. a phenomenex onyx monolithic column (0.100 mm 150 mm) samples were injected manually using a valco c2 - 1006 injection valve with a 1.0 l loop. solvent a was 0.1% formic acid in water, and solvent b was 0.1% formic acid in acetonitrile. the identities of the peptides formed by digestion with pepsin were determined by lc / ms / ms analysis using the following conditions : column flow rate was 0.4 l / min, and a gradient was run from 3% to 50% solvent b in 35 min. the data obtained were searched against a database consisting only of the ampc sequence using protein prospector. for analysis of deuterated peptide samples, the same chromatography system was used. to minimize back exchange, the column flow rate was raised to 1.0 l / min and the gradient used was from 0% to 70% solvent b in 5 min. furthermore, the injector, injection syringe, sample loop, column, and all transfer lines were maintained in an ice bath. all data analysis was performed with the standard analyst 1.1 software native to the qstar. the average number of deuterons incorporated for each peptide was determined from the mass spectra. the centroid of the isotopic peak cluster for the undeuterated control was subtracted from the centroid of the isotopic peak cluster for each deuterated sample. the experimental conditions were the same in each analysis, and only the difference in deuterium incorporation between identical peptides was measured, so it was not necessary to correct for back exchange. solvent accessible surface area was calculated using getarea (version 1.0 beta) available at http://curie.utmb.edu/getarea.html, using a radius of 1.4 and default atomic radii and atomic solvent parameters.(38) the average percent accessibility was calculated as the average of the ratios of each side chain surface area to the random coil value. a sample of ampc -lactamase (0.5 m) was incubated in 50 mm kpi, ph 7.0, for 1 h with or without each aggregating inhibitor : 100 m rottlerin, 250 m congo red, 250 m eriochrome blue black b, 250 m nicardipine, or 100 m l-755,507 (with a final concentration of 1% dmso in all samples, with or without inhibitor). samples of trypsin alone (0.01 or 0.025 mg / ml) were prepared with or without each of the inhibitors and incubated for 1 h at room temperature in 50 mm kpi, ph 7.0. tryptic digests of -lactamase were prepared by first adding 0.5 m of the enzyme to a solution with or without each inhibitor. after 5 min, trypsin was added to the solution and the digests were incubated at room temperature for 0 min, 15 min, 30 min, 1 h, or 4 h. the total volume of all samples was 25 l. to prepare the samples for sdspage, 5 l of loading buffer (containing 0.25% bromophenol blue, 0.25% xylene cyanol ff, 30% glycerol by volume, and 5 mm dithiothreitol) was added to each sample and the samples were boiled for 2 min. | one of the leading sources of false positives in early drug discovery is the formation of organic small molecule aggregates, which inhibit enzymes nonspecifically at micromolar concentrations in aqueous solution. the molecular basis for this widespread problem remains hazy. to investigate the mechanism of inhibition at a molecular level, we determined changes in solvent accessibility that occur when an enzyme binds to an aggregate using hydrogendeuterium exchange mass spectrometry. for ampc -lactamase, binding to aggregates of the small molecule rottlerin increased the deuterium exchange of all 10 reproducibly detectable peptides, which covered 41% of the sequence of -lactamase. this suggested a global increase in proton accessibility upon aggregate binding, consistent with denaturation. we then investigated whether enzymeaggregate complexes were more susceptible to proteolysis than uninhibited enzyme. for five aggregators, trypsin degradation of -lactamase increased substantially when -lactamase was inhibited by aggregates, whereas uninhibited enzyme was generally stable to digestion. combined, these results suggest that the mechanism of action of aggregate - based inhibitors proceeds via partial protein unfolding when bound to an aggregate particle. |
input data - occurrence data were accumulated from diverse sources, including all known triatomine collection records from the literature for all of north america (pubmed using the search words triatominae and mexico and the scientific names of each species known from mexico prior to 2014), publication references from reviews or publications not in pubmed prior to 2002, grey literature and government reports in mexico, entomological collections [biology institute / national autonomous university of mexico, national museum of american history / smithsonian institution, global biodiversity information facility (gbif.org) ] and personal collections (jmr). enms were developed for mexican species for which 10 unique collection data points were available in north america. twenty species met this criterion, but triatoma neotomae had 10 occurrence points divided between two distant regions, producing unsatisfactory models, so this species was not included. enms were calibrated using all occurrence points in north america because major portions of the species distributions for the lecticularia and protracta complexes fall outside mexican national boundaries (peterson. a total of 2,580 occurrence points were available for 38 species and subspecies : belminus (1 species), dipetalogaster (1 species), eratyrus (1 species), panstrongylus (1 species), paratriatoma (1 species) and triatoma (26 species and 7 additional subspecies). based on the range of known occurrences, species were classified according to biogeographic region as neotropical (16 species), nearctic (12 species + 7 subspecies) or both (3 species), using regionalisation layers defined by olson. a total of 2,519 occurrence points corresponded to the 19 species for which enms were developed. enms for t. protracta and t. rubida included occurrences of the type subspecies (t. p. protracta and t. r. rubida) ; the three hg of t. dimidiata (hg1, hg2 and hg3) were modelled separately (table i). table imexican triatominae, their biogeographic region, occurrence points and accuracy for ecological niche models (enms) of 19 speciesidspecies complexspeciessubspeciesregionpointsbackgroundp1lecticularia triatoma incrassata -nearctic5 - -2 triatoma indictiva -nearctic5 - -3 triatoma lecticularia -nearctic309,230,4646.01 4protracta triatoma barberi -nearctic / neotropical36910,069,5673.91 5 triatoma neotomae -nearctic10 - -6 triatoma nitida -neotropical7 - -7 triatoma peninsularis -nearctic109,230,4641.45 8 triatoma protracta t. p. protracta nearctic1779,230,4641.63 9 t. p. nahuatlae 10 t. p. woodi 11 t. p. zacatecensis 12 triatoma sinaloensis -nearctic5 - -13rubida triatoma rubida t. r. cochimiensis nearctic1219,283,9664.74 14 t. r. jaegeri 15 t. r. rubida 16 t. r. sonoriana 17 t. r. uhleri 18phyllosoma triatoma bassolsae -neotropical1 - -19 triatoma brailovskyi -neotropical11652,6556.68 20 triatoma bolivari -neotropical4 - -21 triatoma gerstaeckeri -nearctic1649,270,9871.88 22 triatoma longipennis -nearctic / neotropical23310,069,5671.14 23 triatoma mazzottii -neotropical80696,1399.36 24 triatoma mexicana -nearctic / neotropical27110,069,5675.96 25 triatoma pallidipennis -neotropical291690,7501.79 26 triatoma phyllosoma -neotropical40650,0954.11 27 triatoma picturata -neotropical16680,5672.87 28 triatoma recurva -nearctic339,275,3674.29 29dimidiata triatoma dimidiata hg 1-neotropical77650,0954.78 30 triatoma dimidiata hg 2-neotropical485701,5416.60 31 triatoma dimidiata hg 3-neotropical42650,0392.71 32 triatoma hegneri -neotropical6 - -33 belminus costaricensis -neotropical2 - -34 dipetalogaster maximus -nearctic6 - -35 eratyrus cuspidatus -neotropical13650,0951.44 36 panstrongylus rufotuberculatus -neotropical9 - -37 paratriatoma hirsuta -nearctic569,230,4646.69 38 triatoma gomeznunezi -neotropical1 - - total---2,580 - - trypanosoma cruzi -nearctic / neotropical66910,069,5674.48 an additional dataset was constructed for mexico and the usa for known t. cruzi occurrences using infections in reservoirs, triatomines and human cases georeferenced to communities across mexico from the institute for epidemiologic diagnosis and reference, national center for preventive programs and disease control, published reports and unpublished data of the first author, which totalled 669 records from 1936 - 2014. all occurrence data for triatominae and t. cruzi are available on dryad for open access and use by the broader community (doi : 10.5061/dryad.rq120). enms - ecological niches were calibrated using desktopgarp (genetic algorithm for rule set prediction) (nhm.ku.edu/desktopgarp/), an evolutionary computing software package available for public download (stockwell & peters 1999). specifically, garp relates the ecological characteristics of known occurrence points to those of points randomly sampled from the remaining calibration area, seeking to develop a set of decision rules that best summarise factors associated with the species presence (peterson. input occurrence data are divided into calibration (70%) and evaluation (30%) subsets (anderson. 2003). garp works in an iterative process of rule selection, evaluation, testing and incorporation or rejection. a method is chosen from a set of possibilities (i.e., logistic regression, bioclimatic rules), it is then applied to the calibration data and a rule is developed or evolved. rules may evolve by a number of means that mimic dna evolution : point mutations, deletions, crossing over etc. the change in predictive accuracy from one iteration to the next is used to evaluate whether a particular rule should be incorporated into the model and the algorithm runs either 1,000 iterations or until convergence. we used 13 data layers to characterise ecological landscapes : four layers summarising aspects of topography (elevation, slope, aspect and topographic index) from the us geological survey s hydro-1k data set (usgs.gov/) and nine climate variables from worldclim (bio 1, 4, 5, 6, 7, 12, 13, 14, 15) (worldclim.org/) selected based on low inter - correlations (r 10,000 inhabitants) categories, as reported in moo - llanes. triatomine species richness and t. cruzi vector - transmission - to estimate current triatomine species richness across mexico, the 19 triatomine enms were adjusted to include only the portion of the enm covered by 100-km buffers surrounding known occurrences (estimate of m) for each species, thereby eliminating areas that were likely unoccupied by species (olson. occurrence point buffers (100-km, based on appropriate environmental space models) were created for the remaining 12 species and seven additional subspecies of t. protracta and t. rubida and these buffers were overlain with the 19 adjusted enms. a t. cruzi vector transmission map was developed using the triatomine species richness model and the t. cruzi enm. the two binary models were combined (arithmetic sum of binary classification) using the map algebra function of the spatial analyst of arcgis v.10.0 to project the current exposure for t. cruzi vector transmission. data analyses - differences for enm mean breadth, mean elevation, modified and conserved land coverage, conserved / modified land cover index, rural / urban population index, rural population, land cover and conserved / modified land cover index among the biogeographic regions were evaluated using one - way anova (tukey s f for comparison of means) using r software v.2.15.1 (r-project.org/). enms - the binomial tests of the ability to predict known distributions were significant (p < 0.05) for all but three species : paratriatoma hirsuta, t. lecticularia and t. brailovskyi (table i). enms for the 19 triatomine species analysed are presented according to biogeographic region, with occurrence data points shown in figs 1 - 5. the species with the broadest geographic distributions in mexico were those from the nearctic region (nearctic 2) (fig. 4), with t. protracta s distribution being the largest (55.1% of the country) and t. peninsularis s (nearctic 1) (fig. 5) being the smallest (1.2%) (table iii). 1), followed by the principal neotropical group (neotropical 2) (fig. 3) ; the nearctic 2 region had a mean range size that was significantly higher than those of all other groups (table iv) (df = 3, f = 8.8, p = 0.0016). the potential distributions of nearctic 2 species covered the greatest proportion of the country (average 36.5%), whereas species in nearctic / neotropical cover an average 19% and the principal neotropical region 2, 12.4% of mexico (table iv). generally, all triatoma complexes had similar ranges : the protracta complex species covered between 1.2 - 55.1% of the country, the phyllosoma complex species covered between 1.7 - 43.8% and the dimidiata complex species covered between 3.2 - 20.1% of the country. 4:ecological niche models for mexican triatominae distributed in the nearctic region, subgroup 2. colour brown to blue for increasing best subset models, black dots are occurrence points. 5:ecological niche models for mexican triatominae distributed in the nearctic region, subgroup 1. colour brown to blue for increasing best subset models, black dots are occurrence points. table iiiniche breadth and elevation for ecological niche models of the 19 most abundant mexican triatomine speciesidspeciesbiogeographic regionbackground modelniche breadth mexicoenm mexico (%) elevation mean (m)elevation range (m) (min - max)1 triatoma peninsularis nearctic 19.23020,8921.2102(0 - 225)2 triatoma brailovskyi neotropical 10.65228,7351.7409(39 - 1,041)3 triatoma picturata 0.68039,4572.31,286(718 - 1,731)4 triatoma dimidiata hg 30.65055,3913.2658(88 - 1,395)5 eratyrus cuspidatus 0.65064,9123.8877(342 - 2,289)6 triatoma dimidiata hg 1neotropical 20.65099,9695.844(1 - 190)7 triatoma phyllosoma 0.650144,0828.4832(18 - 1,850)8 triatoma pallidipennis 0.690153,4148.91,210(622 - 1,781)9 triatoma mazzottii 0.696321,17018.7838(22 - 1,785)10 triatoma dimidiata hg 20.701344,14220.1259(10 - 1,045)11 triatoma mexicana nearctic/ neotropical10.069206,127121,371(113 - 2,107)12 triatoma longipennis 10.069338,87819.71,354(377 - 2,084)13 triatoma barberi 10.069435,23825.41,751(1,047 - 2,321)14 triatoma lecticularia nearctic 29.230166,8379.7433(92 - 975)15 triatoma recurva 9.275751,62043.8768(14 - 1,587)16 triatoma gerstaeckeri 9.270434,24225.3792(18 - 1,598)17 triatoma rubida 9.283832,34548.5607(1 - 1,325)18 triatoma protracta 9.230945,64355.1946(28 - 1,889)19 paratriatoma hirsuta 9.230625,62536.5896(48 - 1,642)- trypanosoma cruzi nearctic/ neotropical10.0691,565,39291.2786(10 - 1,900)background model expressed values in millions of pixels. colour brown to blue for increasing best subset models, black dots are occurrence points. 3:ecological niche models for mexican triatominae distributed in the neotropical region, subgroup 2. colour brown to blue for increasing best subset models, black dots are occurrence points. table ivniche breadth, elevation, population coverage and land use indices for biogeographic regions biogeographic region nearctic 1neotropical 1neotropical 2nearctic / neotropicalnearctic 2 species (n)14536fp mean breadth (km)20,89247,124 212,555 326,748 626,052 8.791.60 coverage for mexico (%) 1.22.7 12.4 19 36.5 8.781.60 mean elevation (m)102807 637 1,492 740 4.502.06 total range elevation (m)2251,317 1,196 1,658 1,469 0.685.78 rural population (n)330,2443,980,399 11,348,692 25,390,610 8,844,201 3.633.96 rural / urban population index0.091.31 0.75 0.48 0.37 5.669.40 rural communities (n)4,32021,326 55,614 116,848 64,329 10.976.00 urban communities (n)1683 251 640 236 20.580modified land cover (km)70318,725 85,670 127,948 126,098 5.001.18 conserved land cover (km)20,07828,399 126,671 193,957 501,454 10.208.00 conserved / modified index28.561.57 1.63 1.49 3.91 19.390 a, b : statistically different (p < 0.05). triatoma peninsularis (nearctic 1) is not included in analyses. the mean elevation for enms varied from 44 m (t. dimidiata hg1) to 1,751 m (t. barberi) (table iii). the highest mean elevation was observed for species located in both nearctic / neotropical regions, followed by the neotropical region which had lowest niche breadth (neotropical 1) ; mean elevation of the nearctic / neotropical regions was significantly higher than all others (table iv) (df = 3, f = 4.50, p = 0.021). species of both nearctic regions had the lowest mean elevations. the enms of nearctic 2 triatomine species had predominately conserved land cover (79.2%) (fig. 6), whereas other regions had equivalent proportions of conserved and modified land cover : 59.9%, 61.2% and 59.1% for conserved land cover in the nearctic / neotropical, neotropical 2 and 1 regions, respectively (fig. 7, table iv) (df = 3, f = 10.2, p = 0.0008). the conserved / modified land cover index for the nearctic 2 region was significantly different from that of the other three regions (df = 3, f = 19.4, p < 0.0001). the modified land cover area was similar between the nearctic 2 group and the nearctic / neotropical regions, both of which were slightly lower than that of the neotropical 2 group (df = 3, f = 5.0, p = 0.001). t. picturata had the smallest area of conserved land cover (0.80), whereas t. peninsularis, which is highly sylvatic and reduced to the baja california peninsula, had the highest conserved / modified land cover ratio (28.6). 6:composite binary map of all triatominae ecological niche models (enm) classified according to modified (red) or conserved (green) landscape cover. fig. 7:landscape cover types and conserved / modified index for mexican triatominae ecological niche models. triatomine exposure of the mexican population - t. cruzis enm was found to cover 91.2% of mexico (fig. the total mexican population with vector exposure for at least one bug species was 99,911,867 inhabitants, which is 88.9% of the current mexican population. this coverage was similar for rural (88.1%) and urban populations (89.4%) (table v). more than 90.1% of the communities in the country are located in potential vector distribution areas. vector transmission models were overlaid onto the 2010 census database to stratify exposure for all communities in the country (doi : 10.5061/dryad.rq120) : the exposed population was highest where triatomines covered both biogeographic regions (t. longipennis, t. mexicana and t. barberi), followed by regions where nearctic 2 and neotropical 2 species occur. the mean exposed populations were significantly different among biogeographic regions (table iv) (df = 3, f = 3.64, p = 0.04). fig. black dots are occurrence points for the species from bugs, humans and other mammals. table vurban and rural population and communities exposed to triatominae in mexicovectortotal population (n)urban population (n)rural populationrural / urban population indexurban communities (n)rural communities (n) triatoma peninsularis 3,9923,6610.3300.09164,320 triatoma brailovskyi 1,1320,3390.7922.33115,494 triatoma picturata 13,4998,5114.9880.5915223,997 triatoma dimidiata hg 312,5345,0187.5161.5011441,254 eratyrus cuspidatus 5,8023,1782.6230.835514,561 triatoma dimidiata hg 18,4154,8103.6040.757917,314 triatoma phyllosoma 16,6349,7836.8500.7015934,431 triatoma pallidipennis 29,21417,86011.3540.6429052,898 triatoma mazzottii 42,59824,63917.9580.7341287,962 triatoma dimidiata hg 234,71517,74016.9740.9631385,467 triatoma mexicana 67,00547,51419.4910.4149693,638 triatoma longipennis triatoma lecticularia 22,46016,2756.1840.3816843,740 triatoma recurva 29,86821,5318.3370.3923060,065 triatoma gerstaeckeri 38,04726,35011.6960.4427480,422 triatoma rubida 42,94231,60111.3400.3630179,886 triatoma protracta 37,46027,22610.2340.3826373,506 paratriatoma hirsuta 24,89619,6245.2710.2717748,355urban communities are classified as 10,000 inhabitants. population is expressed in millions of inhabitants. although the average exposed population in urban and rural areas as well as rural and urban communities was the highest for species occurring in both biogeographic regions, the group with the highest rural / urban index was the smaller of the neotropical groups (neotropical 1) (fig. more inhabitants from rural than urban communities were exposed (rural / urban index = 1.31). none of the other biogeographic groups had an index above 1, indicating that more inhabitants in urban communities were exposed to vector transmission than those in rural populations in these regions ; the rural / urban index was significantly different among biogeographic groups (table iv) (df = 3, f = 5.66, p = 0.009). the highest proportion of exposed urban population was found in the nearctic 2 region, followed by that from species covering both regions and the neotropical 2 group, which was similar to the trend for niche breadth. 2:ecological niche models for mexican triatominae distributed in the neotropical region, subgroup 1. colour brown to blue for increasing best subset models, black dots are occurrence points. triatomine species richness and t. cruzi transmission niche - species richness for mexican triatominae based on adjusted enms (for current and not potential distributions) was higher in the neotropical region than in the nearctic region (fig. the areas of the greatest species richness were the sierra madre oriental, the transverse neovolcanic belt, northern sonora, along the pacific coast and the sierra madre occidental, the balsas basin and the sierra madre del sur and oaxaca coast. the vector transmission map suggests that the greatest exposure of human populations to infected triatomine species occurs in nuevo leon, tamaulipas, sinaloa, durango, nayarit, jalisco, guanajuato, michoacan, oaxaca and chiapas (fig. all human communities in nine states (of 32), aguascalientes, coahuila, guanajuato, hidalgo, morelos, nayarit, quertaro, san luis potosi and tlaxcala, are at risk for the potential vector - borne transmission of t. cruzi by at least one infected bug species (doi : 10.5061/dryad.rq120). fig. colours green to red represent increasing number of ecological niche model best subsets. species distributions of triatomines have been modelled previously in several mexican states : guanajuato (lpez - crdenas. 2008), veracruz (sandoval - ruiz. 2012), aguascalientes, chiapas, guerrero, jalisco, michoacan and oaxaca (bentez - alva. 2012). however, most of these studies did not use representative occurrence datasets covering the complete range of the species modelled or they failed to specify background areas to calibrate their models, resulting in calibration bias (owens. the present study separately modelled the 19 most abundant and epidemiologically relevant triatomine vector species in mexico, providing individual species maps and exposure databases, which can be used by mexico s phs vector prevention and control program to stratify t. cruzi transmission. these maps and demographic exposure predictions reflect the potential geographic distributions for all epidemiologically relevant species and their interactions with t. cruzi and can be used to stratify vector transmission interventions if the political will exists and normative guidelines are followed. mexico is located in both the neotropical and nearctic regions, which have different topography, vegetation, climates and demography as well as high heterogeneity and landscape types (olson. we noted significant differences in distribution potential among species occurring in different biogeographic regions, with species in the semiarid and arid nearctic region having the broadest distributions. however, species richness was highest in the neotropical region, which has greater topographic complexity, particularly along the pacific coast. it is interesting that the broadest potential vector distributions in the nearctic region coincided with the higher conserved / modified land cover index values, probably owing to vast areas of arid vegetation with low population density, as evidenced by the inverse association with the rural / urban population index. recent studies on triatomines from the nearctic region of mexico report the domestication of vector species such as t. rubida and t. protracta in urban areas, which was almost unheard of two decades ago (pfeiller. it is clear that the geographic ranges of three principal triatomine species, t. longipennis, t. mexicana and t. barberi occur at higher elevation and expose more rural and urban communities to t. cruzi, even though the rural / urban population index in this region is the lowest. for these three species and for the most important species from the neotropical 2 region, these data suggest that the vectors have tolerated landscape modification and urban development and are not limited to rural populations. this urbanisation process, along with strong cultural ties to ancestral communities, may provide mechanisms for continuous human - assisted vector dispersal. most mexican vectors have tolerated landscape modification and as true opportunists, take advantage of alternative resources and refuges to maintain populations in human - modified habitats. because the phs vector - borne disease program in mexico is currently almost singularly focused on dengue, which is principally urban, a chagas disease prevention and control program, if it were to become effective in mexico, may not need to shift current personnel or their work areas. however, this strategy may broaden the gap between urban and rural phs coverage, thereby increasing current inequities in health services access in dispersed and marginalised rural areas where investment in prevention and control is minimal and will be far more costly to maintain. the present analysis provides an atlas of the current knowledge regarding potential distributions and hence the potential exposure of human populations to t. cruzi - infected vectors in mexico. this information can be used to engage communities regarding chagas disease and to analyse social, cultural and economic vulnerability components that contribute to vector transmission risk. we have related triatomine distribution patterns to the most recent demographic census in mexico to provide chagas state program coordinators with a blueprint with which to stratify, study and plan future activities. stratification should be conducted based on vector capacity, domesticity and the degree of habitat modification. current models can be improved via a concerted effort to generate distribution and abundance information in communities and in conserved areas. although information regarding wildlife reservoirs of t. cruzi is increasing and will assist in understanding the ecology of t. cruzi vector - borne transmission, the current information void (for the mexican population and professionals in phs) regarding the vectors and the parasite is the primary impediment to understanding vector transmission risk. the chagas disease transmission map developed herein was adjusted to reflect the current infected vector distributions and hence is immediately applicable to the unaddressed t. cruzi vector transmission problem in mexico. few areas in mexico do not have the potential for vector transmission exposure and vectors have already demonstrated the capacity to persist in human - modified habitats and communities, which in most nearctic and neotropical regions provide the greatest year - round resources. if this exposure hazard continues and human vulnerability remains unabated, the risk for vector transmission in mexico will continue to rise, affecting economic development and broadening the social inequities already affecting most of the population in both rural and urban areas (ramsey. this study has developed immediately usable products for the phs to study, plan and intervene against the vector - mediated transmission of t. cruzi. how many more mexicans must become infected before health agencies abide by their legal mandate to prevent, control and turn their attention to chagas disease in the country ? | chagas disease is one of the most important yet neglected parasitic diseases in mexico and is transmitted by triatominae. nineteen of the 31 mexican triatomine species have been consistently found to invade human houses and all have been found to be naturally infected with trypanosoma cruzi. the present paper aims to produce a state - of - knowledge atlas of mexican triatomines and analyse their geographic associations with t. cruzi, human demographics and landscape modification. ecological niche models (enms) were constructed for the 19 species with more than 10 records in north america, as well as for t. cruzi. the 2010 mexican national census and the 2007 national forestry inventory were used to analyse overlap patterns with enms. niche breadth was greatest in species from the semiarid nearctic region, whereas species richness was associated with topographic heterogeneity in the neotropical region, particularly along the pacific coast. three species, triatoma longipennis, triatoma mexicana and triatoma barberi, overlapped with the greatest numbers of human communities, but these communities had the lowest rural / urban population ratios. triatomine vectors have urbanised in most regions, demonstrating a high tolerance to human - modified habitats and broadened historical ranges, exposing more than 88% of the mexican population and leaving few areas in mexico without the potential for t. cruzi transmission. |
studies have indicated that with early use of cochlear implants, many children who are deaf have been able to develop language and literacy skills that are within normal limits (i.e., within one standard deviation of the mean) when compared to their peers with normal hearing.1,2,3,4) other studies have indicated that children with cochlear implant have weakness in phonological awareness skills.5,6) for those children who communicate using oral language, these improvements are often apparent before entry into elementary school.7,8) literacy studies are only beginning to emerge and have almost exclusively examined the reading skills of school - age children.4,5,9) thus, they evaluate the interaction between cochlear implant use and formal literacy instruction. it is well known, however, that children with normal hearing begin developing emergent literacy skills, such as phonological awareness, well before their formal literacy instruction begins.10,11,12,13) despite the importance of phonological awareness on later reading skills among young hearing children, little is known about the development of phonological awareness skills in children with cochlear implants. there are four related factors that indicate that the phonological awareness skills of young children with cochlear implants might be an area of special weakness and an area in great need of investigation. first, the primary goal of cochlear implantation is to provide children with an ability to perceive speech, thus allowing them to develop oral language and literacy abilities. however, cochlear implants can not fully normalize children 's auditory experiences, and children with cochlear implants typically demonstrate deficiencies in speech perception.14,15) indeed, the speech perception skills of children with cochlear implants have been documented as being equivalent to the speech perception skills of hearing aid users with severe hearing loss.8,16) second, children with cochlear implants typically remain delayed in the acquisition of speech and language skills. specifically, the speech production skills of children with cochlear implants are often significantly delayed, even after the children have had years of experience with their cochlear implant, and even when they are compared to younger children whose age is matched with the deaf children 's duration of cochlear implant experience.17,18) similarly, oral language is often not age - appropriate in young children with cochlear implants prior to school entry.7) third, among hearing preschoolers, these skills (speech perception, speech production, and oral language) are correlated with the phonological awareness abilities.19,20,21,22,23,24,25,26,27) additionally, recent studies have indicated that the phonological awareness abilities of school - age children with cochlear implants are delayed in comparison to those of their peers with normal hearing.5,6,28,29) taken together, these factors place children with cochlear implants at significant risk for educationally relevant delays in the development of phonological awareness skills. this study was designed to assess whether very early access to speech sounds provided by the early cochlear implantation would enable children to develop age - appropriate phonological awareness abilities in their preschool and school years. additionally, this study examined whether children with cochlear implantation before 18 months of age will develop better phonological awareness skills than children with cochlear implantation at 18 - 36 months of age. this study also examined whether some factors like the child 's age or sex would affect developing of age - appropriate phonological awareness abilities. the study group consisted of 30 children with normal hearing and 48 children with cochlear implant from both sexes equally. all of them were classified in three groups including preschool children (age : 60 to 71 months), children in first grade (age : 72 to 83 months) and children in second grade (age : 84 to 95 months). all of the cochlear implanted (ci group) children were collected from normal children schools. children were recruited for the study if they met the following criteria : 60 to 71 months of age for preschool, 72 to 83 months of age for first grade and 84 to 95 months of age for second grade, sensorineural hearing loss, utilization of a cochlear implant before age 3, no additional disabilities, and no home language other than farsi, having no treatment for phonological awareness. all the normal hearing children were assigned to the control group (nh group). all children in the nh group were reported as having passed a hearing screening or were screened for hearing loss. as with children in the ci group, participants in the nh group were 60 to 71 months of age for preschool, 72 to 83 months of age for first grade, and 84 to 95 months of age for second grade, had no additional disabilities, and lived in homes where the primary language was farsi. there were the same number of children per grade. for children in both groups, one or two testing sessions lasting a total of approximately 1 hour were conducted at their schools. we have used the phonological awareness test of " dastjerdi & soleimani ", which is the phonological awareness test that has been standardized in iran. this test consists of three subtests : phonemic awareness1, intra syllabic awareness2, and syllabic awareness3. before executing the phonological test, parents filled the acceptance form showing their approval of the procedure, afterwards we executed the phonological test. the phonological awareness test has three categories including phonemic awareness that has seven subtests, intra syllabic awareness that has two subtests, and syllabic awareness that has one subtest. before executing the test, we communicated with the children. for each age group we explained each subtest with some guiding words that were at the beginning of each subtest. if the child could answer each question, he / she would get a score of 1, but if he / she could not answer or his / her answer were wrong he / she would get a score of 0. although we did not help the child in giving the correct answers, we encouraged her / him to stay active throughout the entire test. the subtests consisted of syllable segmentation, alliteration recognition, rhyme recognition, synthesis of phonemes, recognizing words with similar beginning phoneme, recognizing words with similar ending phoneme, phoneme segmentation, recognizing the ending phoneme, deleting it and then uttering it, deleting middle phoneme, recognizing the beginning phoneme, deleting it and then uttering it. the study group consisted of 30 children with normal hearing and 48 children with cochlear implant from both sexes equally. all of them were classified in three groups including preschool children (age : 60 to 71 months), children in first grade (age : 72 to 83 months) and children in second grade (age : 84 to 95 months). all of the cochlear implanted (ci group) children were collected from normal children schools. children were recruited for the study if they met the following criteria : 60 to 71 months of age for preschool, 72 to 83 months of age for first grade and 84 to 95 months of age for second grade, sensorineural hearing loss, utilization of a cochlear implant before age 3, no additional disabilities, and no home language other than farsi, having no treatment for phonological awareness. all the normal hearing children were assigned to the control group (nh group). all children in the nh group were reported as having passed a hearing screening or were screened for hearing loss. as with children in the ci group, participants in the nh group were 60 to 71 months of age for preschool, 72 to 83 months of age for first grade, and 84 to 95 months of age for second grade, had no additional disabilities, and lived in homes where the primary language was farsi. for children in both groups, one or two testing sessions lasting a total of approximately 1 hour were conducted at their schools. we have used the phonological awareness test of " dastjerdi & soleimani ", which is the phonological awareness test that has been standardized in iran. this test consists of three subtests : phonemic awareness1, intra syllabic awareness2, and syllabic awareness3. before executing the phonological test, parents filled the acceptance form showing their approval of the procedure, afterwards we executed the phonological test. the phonological awareness test has three categories including phonemic awareness that has seven subtests, intra syllabic awareness that has two subtests, and syllabic awareness that has one subtest. we explained each subtest with some guiding words that were at the beginning of each subtest. if the child could answer each question, he / she would get a score of 1, but if he / she could not answer or his / her answer were wrong he / she would get a score of 0. although we did not help the child in giving the correct answers, we encouraged her / him to stay active throughout the entire test. the subtests consisted of syllable segmentation, alliteration recognition, rhyme recognition, synthesis of phonemes, recognizing words with similar beginning phoneme, recognizing words with similar ending phoneme, phoneme segmentation, recognizing the ending phoneme, deleting it and then uttering it, deleting middle phoneme, recognizing the beginning phoneme, deleting it and then uttering it. data collected from this study was analyzed with two nonparametric statistical methods : mann - whitney and kruskal - wallis to determine the relationship between phonological awareness and the child 's audition. the results showed that the mean of phonological awareness in children with cochlear implants had a statistically significant difference from normal children (p<0.05)(table 1). the comparison of results showed that sex had no significant effect, but age had a significant effect on phonological awareness scores. another important evaluated variable was the age of implantation. as shown in table 3, there was a relationship between the age of implantation and phonological awareness scores. the results show that the functions of the cochlear implanted children in phonological awareness skills are significantly lower than the normal hearing children. these results are similar to the previous studies.5,6,28,29) in these studies, cochlear implanted children also experienced some problems with phonological awareness skills. as shown above, there is a relationship between age of implantation and phonological awareness. children with lower age of implantation would get better results because of their fast development. in many countries all over the world, doctors try to implant these prostheses before 1-year - of - age. in our country (iran), we have some problems in achieving this goal. so we could find more children who got implantation before 18 months of age and we chose this criterion to divide children. these results are similar to previous findings.30) other studies also reported that early auditory experience has a better effect on linguistic skills.31,32) therefore, we can now emphasize the advantage of early usage of cochlear implantation on children 's language functions. as we mentioned above, the child 's age has significant effect on phonological awareness scores because this ability is related to literacy acquisition, therefore older children would gain higher scores. however, in this study, the difference between ages 5 and 7 years were more distinguishable in the cochlear implanted group. although in the cochlear implanted group of children, differences between these age groups are statistically significant (p=0.003), in the normal hearing group of children, differences were not statistically significant (p=0.09). although there were significant differences between the phonological awareness scores of the two groups (ci group, nh group), these results were statistically significant in only some of the subtests. the only subtest with significant difference was phoneme awareness. according to the present and prior results, cochlear implantation prostheses have some problems in facilitating the acquisition of the phonological awareness. however, by the increase in the child 's experience in utilizing this prostheses, better results are gained. since we know that phonological awareness is a significant skill for acquiring formal literacy skills, we should allocate some sessions to the treatment of these skills in our schedule. we conclude from this study that children with lower age of implantation got better scores in phonological awareness test than children with higher age of implantation. but they were outperformed by their normal hearing peers in this area, especially in phonemic awareness. we also conclude that phonological awareness skills would improve by child 's growth and females scores did not differ from males scores. | background and objectivesthe primary purpose of this study was to assess whether very early access to speech sounds provided by the cochlear implant enables children to develop age - appropriate phonological awareness abilities in their preschool and school years. a secondary purpose of this study was to examine whether children who had cochlear implantation before 18 months of age will develop better skills in phonological awareness than children who had cochlear implants in 18 - 36 months of age. a third purpose of this study was to examine whether some factors like the child 's age or sex would have any effects on developing of age - appropriate phonological awareness abilities.subjects and methods48 children with 70 to 95 months of age who had been utilizing their cochlear implant(s) before 36 months of age (ci group) and 30 normal hearing peers (nh group) were enrolled in this study.resultschild's age had a significant effect on phonological awareness, but sex had absolutely no effect in each group. children in the cochlear implanted group were outperformed by their normal hearing peers in the area of phonological awareness, especially in phonemic awareness. the age of implantation was another significant variable.conclusionsalthough children with a younger age at implantation got better scores in phonological awareness test, they were outperformed by their normal hearing peers in this area. |
premenstrual syndrome (pms) is characterized by a number of behavioral, psychological and physical symptoms recurring cyclically during the luteal phase of the menstrual cycle and they disappearing in the first days of menstruation (1). the most common symptoms of pms are irritability, mood swings, anxiety, depression, breast tenderness, bloating and headache (2, 3). due to the variety and severity of the symptoms, it is difficult to estimate the exact prevalence of pms, but previous studies have reported a 20 - 90% estimate (4). with the limited diagnostic criteria, the prevalence of pms reaches to 2 - 6% in reproductive age (1). sometimes premenstrual syndrome and related behavioral symptoms are legally important and are considered as a defense against criminal acts and sometimes they can lead to murder (57). a study reported that pms caused a 27.5% reduction in women 's work efficacy and 22% had problems in working relationship. this study also demonstrated that pms led to problems with husband (83%), problems with children (61%) and social relationships disorders (41.5%) (8). the etiology of pms is largely unclear and different theories have been suggested, including hormone imbalances, hypoglycemia, hyperprolactinaemia, psychological causes, reduced endorphins release, ovary infections, deficiency of essential fatty acids, dysfunction in acid and base balance, imbalances in prostaglandins, vitamin and mineral deficiencies (912). pathophysiology of pms is unknown and different therapeutic protocols have been suggested for its treatment. non - pharmacological treatments include changes in dietary habits, reduction in salt intake, reduction in animal fat consumption, exercise, stress reduction and availability of support systems. pharmacological treatments include gnrh analogues, spironolactone, danazol, alprazolam, mephenamic acid, gamalinoleaic acid, and fluoxetine (1315). in recent years, use of herbs has been considered in the treatment of premenstrual syndrome (1619). echinophora - platyloba (e. platyloba) and foeniculum vulgare (fennel) are herbs that are traditionally used for menstrual disorders. echinophora platyloba belongs to umbelliferae family and consists of four species including e. cinerea, e. platyloba, e. orientalis and e. sibthorpiana. e. platyloba species is known by different local names of khoshariz, tigh touragh, tigh masti, khoshandar, kouzang, tanghez or khousharouz. this plant is a pasture plant used for flavoring foods, cheese and yoghurt (20, 21). sadraei (20) reported that e. platyloba extract reduced the ileum contractions in rats. anti - fungal effects of e. platyloba has been depicted on a number of common dermatophytes (21). the anti - candida effects of this plant was compared with amphotericin by mahbobi. (22) and it was shown that this plant was effective in the treatment of candida albicans. fennel (foniculmn vulgare) has been shown to have anti - inflammatory, anti - spasmodic, analgesic, diuretic, laxative, carminative and expectorant effects. in addition, because of its antioxidative effects, it is also useful for digestive and nervous disorders (2325). torke zahrani, (26) reported that fennel extract reduced the severity of dysmenorrhea. the effects of fennel and mephenamic acid was studied on dysmenorrhea and it was demonstrated that both drugs reduced dysmenorrhea compared to placebo (27). fennel essence can reduce the frequency and intensity of contractions in rat uterus (28). to the best of our knowledge, the effects of echinophora - platyloba and fennel extracts on premenstrual syndrome (pms) has not been reported yet. the purpose of the present study was to compare the effects of echinophora - platyloba and fennel against placebo on premenstrual syndrome in the students of shahrekord university of medical sciences in iran. this single - blind randomized clinical trial study was done on 250 female university students aged 18 - 25 years in shahrekord university of medical sciences in iran. the ethics committee approved the study (no. 352.87 - 1 - 3 on 12.5.2008) and the study was registered at the iranian registry of clinical trials and the identifier being irct 138810263078n1. the participants were requested to fill the daily record of severity of problem (drsp) two cycles before the intervention and then the severity of premenstrual syndrome was evaluated for all subjects. the daily record of severity of problem form is a standard tool for detecting the intensity of pms and its validity and reliability have been approved by borenstein and (29). this form determines the severity of pms using five items, including : anxiety symptoms (tension, emotional changes, irritation, reduction in concentration and fear), depressive symptoms (depression, hopelessness, amnesia, crying, dizziness, mood disorders, sleep disorders, isolation and loss of interest to daily activities), emotional symptoms (headache, sweating, hot - flushes, increased appetite, heart palpitation, fatigue, reduced energy, and inability to do the daily activities), fluid and electrolyte retention symptoms (increases in weight, edema, breast tenderness, backache, abdominal cramps and pain in muscles and joints) and somatic symptoms (acne, urinary frequency, constipation and inflammation of nose) ] (29). based on the drsp form, scores ranging from 0 to 4 were allocated to evaluate the severity of symptoms as it follows : 0 : absence of symptoms, 1 : mild (the individual seldom has problems in daily activities), 2 : moderate (the individual has problems in maintaining daily activities, but can go to work or school), 3 : severe symptoms (the individual is not able to do daily activities) and 4 : very intense (the individual is confined to bed). considering the purpose of the present study, the students with moderate and severe pms were selected for the intervention. all the students were also asked about their menstrual patterns ; such as duration of menstruation, menstrual interval, dysmenorrhea, familial history of pms and use of drugs for the reduction of pms. students with pelvic inflammatory disease (pid), any chronic diseases, drug use or with any stressor factors were excluded from the study. finally, ninety students with the highest pms scores, were selected and they were randomly assigned into three equal groups. the first group received echinophora - platyloba extract, the second group received fennel extract and the placebo group received strile water. the amount of the given extracts and the placebo was 30 drops, every 8 hours, 3 days before until 3 days after the onset of menstrual bleeding. the subjects completed the drsp form at the end of their first and second menstrual cycles. data was analyzed by dunn, kruskal - wallis and pearson correlation tests, using spss and a p 0.05). comparison of pms scores in echinophora - platyloba, fennel and placebo groups the reason of difference in the reduction mean of premenstrual symptoms with the mean of symptoms before and after the intervention, is that, a number of participants did n't answer to some of questions after the intervention the findings of this study showed that echinophora - platyloba and fennel extracts, as well as placebo, reduced the intensity of premenstrual syndrome in students and the effects of the two extracts were more significant than these of placebo. echinophora - platyloba is one of the four species in iran (20) which is also used for food. anti - microbial and anti - fungal effects of echinophora sibthorpiana have been reported before (22, 23). in addition, sadraei. showed that echinophora sibthorpiana extract reduces the rat ileum contractions in vitro (20). a previous study which was carried out on the echinophora platyloba, revealed that this herb contains elements such as saponins, alkaloids and flavonoids. as far as we know, the effects of echinophora platyloba and fennel extracts on premenstrual syndrome have not been studied yet. previous findings from different medicinal plants have shown that use of herbs is effective in the luteal phase of the menstrual cycle and does not need to be used throughout the cycle (31). in the present study, the effects of echinophora platyloba and fennel extrats were investigated in the luteal phase too. our findings indicated that during the two cycles before the intervention, the severity of pms was similar in the three study groups, but after the intervention the differences were significant. it means that, echinophora platyloba had the highest and placebo had the lowest effects in the reduction of pms symptoms. considering the effects of age, bmi, age at menarch, and age at dysmenorrhea on premenstrual syndrome, since the participants were randomely allocated to each group and there was not a significant difference in these variables between the groups, and also the pearson correlation test did not show a significant correlation between premenstrual syndrome and these variables. among the five classifications of pms symptoms, which include anxiety, depression, emotional, fluid and electrolyte retention and somatic symptoms, aghajani and co - workers reported that the vit - agnus castus can reduce somatic and psychological symptoms (32). other studies reported that medicinal plants could reduce the severity of pms up to 45%- 70% (8, 32). in comparing the effects of echinophora platyloba and fennel extracts, we found that both plants had similar effects in reducing the intensity of pms. psychological effects of placebo have been reported by previous studies (33) and the effect attributed to placebo in our study may also be due to these effects. echinophora platyloba and fennel extracts, as well as placebo, reduced the severity of premenstural syndrome. the effects of echinophora platyloba and fennel were similar and both extracts were effective on symptoms of anxiety and depression. more studies with bigger sample sizes are needed for the use of echinophora platyloba and fennel essences, instead of their extracts, to be suggested for pms treatment. | introductionpremenstrual syndrome (pms) is a condition characterized by a number of behavioral, psychological and physical symptoms recurring cyclically during the luteal phase of the menstrual cycle. the uncertainty in the pathogenesis of pms has led to many treatment protocols being suggested as possible therapies. the present study was carried out to compare the effects of echinophora - platyloba and fennel extracts on the pms against placebo in students of shahrekord university of medical sciences in 2008.methodsin this single - blind randomized clinical trial, 90 students with moderate to severe pms enrolled in the study and were randomely divided into three equal groups. the first group received echinophora - platyloba extract, the second group received fennel extracts and the third group received placebo. the severity of pms was measured by daily record of severity of problems (drsp) questionnaire at the end of the first and second menstrual cycles before the intervention and the results were compared with them after the intervention. data was analyzed using dunn, kruskal wallis, and pearson correlation tests by spss (v. 11.5) and p 0.05), but the differences were significant after the intervention (49.723.2 in echinophora - platyloba group, 64.427.5 in fennel group and 79.128.1 in placebo group, respectively, p < 0.001). no significant differences were seen between the echinophora - platyloba and fennel groups.conclusionthe echinophora - platyloba and fennel extracts could reduce the severity of pms. the effects of echinophora - platyloba and fennel were similar and greater than the placebo. administration of the extracts of these herbs is suggested for relieving the signs and symptoms of pms. |
esophagopleural fistula (epf) is an uncommon condition despite the anatomical proximity of the trachea and esophagus. causes of epf include pneumonectomy for suppurative or tubercular disease and carcinoma of the lung and malignancy of the esophagus. non - malignant epf is due to trauma or infection. the most common infectious cause of epf is tuberculosis, the others being syphilis, mycotic disease, and crohn 's disease. perforation of the esophagus and subsequent fistula formation can occur as a result of foreign bodies, barrett 's ulcer, and more rarely boerhaave 's syndrome. spontaneous development of a fistula between the esophagus and pleura is rarely described in the literature. a 34-year - old male was admitted with a 1-month history of cough, breathlessness, regurgitation during feeding, and chest discomfort. he was a known case of bipolar mood disorder and was on antipsychotics for the last 7 years. general survey was unremarkable. on chest examination, an enlarged right hemithorax with decreased movement of the right chest and stony dull note over the right hemithorax from the fourth, eighth, and ninth intercostal spaces downward along the midclavicular, midaxillary, and scapular chest x - ray revealed right pleural effusion. on thoracocentesis, there was a dry tap. on ultrasonography of the thorax, there was minimal right pleural collection with internal echoes (not amenable for aspiration). on high - resolution computed tomography (hrct) of the thorax, an encysted collection (7.9 cm 8.5 cm 10 cm) was noted in the right pleural space showing air and food particles in it with a linear fistulous communication from the distal esophagus, and on oral contrast administration, the contrast medium was seen to enter into the collection [figures 1 and 2 ]. finally, the upper gastrointestinal (gi) endoscopy confirmed a large fisulous tract measuring 9 mm at the distal esophagus without any mucosal abnormality. with the definite diagnosis of epf, the patient was transferred to the department of cardiothoracic and vascular surgery (ctvs) where thoracotomy and closure of the fistula were performed. during the procedure, a number of possible causes for the development of epf following pneumonectomy for suppurative disease of the lung have been suggested. anatomically, the esophagus lies much closer to the right hemithorax than to the left, the left being separated from the pleural cavity by the aorta. the possibility of direct epf and extent of mediastinitis are determined by the anatomic relationship of the esophagus and the pleura, the amount of mediastinal fat, and intervening connective tissue. fistula related to empyema was the most commonly reported case in the preantibiotic era. nonetheless, there continues to be isolated reports of posttuberculous pyopneumothorax fistulas. erosion of an empyema into the esophagus and rupture of caseating lymph nodes into the esophagus are the possible mechanisms. in our case, the cause of epf was unclear. evidence of malignancy was undetectable from radiology and no specific infectious agent was isolated at the time of diagnosis and treatment. esophageal injury should be considered when a patient presents with retrosternal chest pain, fever, dysphagia, and dyspnea, especially when the patient gives antecedent history of instrumentation or surgery. the diagnosis of epf can be suspected clinically ; however, for confirmation, imaging is required. the imaging modalities include chest radiograph, ultrasound, barium swallow, contrast - enhanced computed tomography (ct), and magnetic resonance imaging (mri) with each modality having its advantages, and chest ct is a very useful modality. leaks of the esophagus are associated with high mortality and the need to be treated as soon as possible. therapeutic options include surgical repair or resection or conservative management with antibiotic therapy and cessation of oral intake. endoscopic treatment with fibrin glue, clip, suturing, and metallic stents has been described. to conclude, spontaneous development of epf is an unusual condition entity with nonspecific clinical presentation. ct of chest is a very useful modality for early diagnosis and management of epf. it should be performed in patients with pleural effusion presenting with nonspecific clinical symptoms before any intervention or drainage. | esophago - pleural fistula (epf) is an uncommon condition, despite of an anatomical proximity of these structures. causes of epf include pneumonectomy for suppurative or tubercular disease of lung and carcinoma lung, malignancy of esophagus. benign epf is rare and may be due to trauma or infection. the most common infectious cause is tuberculosis. spontaneous development of fistula between esophagus and pleura is rarely described in literature. we, hereby present a spontaneous case of such a rare entity in a middle - aged male. |
human papillomavirus (hpv) infection of the anogenital tract is the most prevalent viral sexually - transmitted infection in males and females, with a broad range of clinical manifestations and consequences varying from subclinical and self - limited to persistent and related with malignant progression (1, 2). persistent infection with hpv is a well - established cause of cervical cancer and there has been massive advancements in the characterization of the natural history of cervical hpv infection in females (3 - 10). however, there is a lack of knowledge with regard to the natural history of hpv infection in males, especially in developing countries (2). hpv infection is associated with several malignant disorders in males, including penile, anal, and oral cancers (11 - 14). moreover, hpv is responsible for the development of condylomata acuminata (genital warts) and other nonmalignant diseases such as recurrent respiratory papillomatosis and oral papillomas. most hpv - related cancers in males are associated with hpv16/18 and nearly all hpv - positive nonmalignant diseases are caused by hpv6/11 (15 - 18). recently, it has been revealed that hpv infection in males has been associated with the increased risk of human immunodeficiency virus (hiv) infection acquisition (19). taking into account that hpv is a sexually - transmitted virus, hpv infection in males may result in considerable diseases in females (2). therefore, hpv infection in males is a significant clinical matter. with the advent of effective prophylactic vaccines against oncogenic hpv genotypes, understanding of the burden of hpv infection and its genotype - specific prevalence in males the aim of this study was to assess the prevalence of genital hpv infection and its genotype distribution among iranian males which might be useful for designing public health policies and prevention measures, including vaccination. a total of 483 males, referred to iran university of medical sciences - affiliated sexually transmitted infections (sti) clinics for genital hpv testing and genotyping during march 2009 through april 2014, were enrolled in this cross - sectional study. the inclusion criteria included the presence of a genital lesion, no symptoms and having an hpv - positive partner, no symptoms and a desire to screening for sexually - transmitted infections. this investigation was approved by the ethical committee of tehran university of medical sciences and informed consents were obtained from all the participants. exfoliated epithelial cells were collected from the urethra, penile shaft, glans, scrotum and anus with sterilized brush or dacron swab (22). the samples were placed into standard transport medium and stored at -80c prior to hpv detection and genotyping. total dna was extracted using the qiaamp dna mini kit (qiagen, hilden, germany), following the manufacturer s instructions. hpv genotyping was carried out using the inno - lipa hpv genotyping extra assay (innogenetics nv, ghent, belgium), according to the manufacturer s instructions. the inno - lipa hpv assay is one of the most widely used hpv genotyping tests based on the concept of reverse hybridization, planned for the identification of 28 different genotypes of hpv including 15 hr genotypes (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 and 82), three probable hr (phr) genotypes (26, 53 and 66), seven lr genotypes (6, 11, 40, 43, 44, 54 and 70) and three genotypes (69, 71 and 74) which are not categorized as hr, phr or lr genotypes, based on munoz. (23). a 65 bp region of hpv l1 gene was amplified using consensus spf10 primers, followed by denaturation and hybridization of the resulting biotinylated amplicons, with specific oligonucleotide probes fixed on membrane strips (24). to control the specimen quality and dna extraction an additional primer pair targeting, after pcr amplification using the inno - lipa hpv genotyping extra amp, the amplified biotinylated product was denatured using an alkaline solution. thereafter, streptavidin - conjugated alkaline phosphatase was added, which binds to any biotinylated pcr product / probe hybrid previously formed. finally, the pcr product bound to a specific probe was detected by adding bcip / nbt chromogen. the association of hpv infection and age was evaluated using the logistic regression test. a p value < 0.05 was considered as statistically significance. 95% ci for prevalence estimations was performed using an online confidence intervals calculator (https://www.mccallum-layton.co.uk). a total of 483 males, referred to iran university of medical sciences - affiliated sexually transmitted infections (sti) clinics for genital hpv testing and genotyping during march 2009 through april 2014, were enrolled in this cross - sectional study. the inclusion criteria included the presence of a genital lesion, no symptoms and having an hpv - positive partner, no symptoms and a desire to screening for sexually - transmitted infections. this investigation was approved by the ethical committee of tehran university of medical sciences and informed consents were obtained from all the participants. exfoliated epithelial cells were collected from the urethra, penile shaft, glans, scrotum and anus with sterilized brush or dacron swab (22). the samples were placed into standard transport medium and stored at -80c prior to hpv detection and genotyping. total dna was extracted using the qiaamp dna mini kit (qiagen, hilden, germany), following the manufacturer s instructions. hpv genotyping was carried out using the inno - lipa hpv genotyping extra assay (innogenetics nv, ghent, belgium), according to the manufacturer s instructions. the inno - lipa hpv assay is one of the most widely used hpv genotyping tests based on the concept of reverse hybridization, planned for the identification of 28 different genotypes of hpv including 15 hr genotypes (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 and 82), three probable hr (phr) genotypes (26, 53 and 66), seven lr genotypes (6, 11, 40, 43, 44, 54 and 70) and three genotypes (69, 71 and 74) which are not categorized as hr, phr or lr genotypes, based on munoz. a 65 bp region of hpv l1 gene was amplified using consensus spf10 primers, followed by denaturation and hybridization of the resulting biotinylated amplicons, with specific oligonucleotide probes fixed on membrane strips (24). to control the specimen quality and dna extraction an additional primer pair targeting, after pcr amplification using the inno - lipa hpv genotyping extra amp, the amplified biotinylated product was denatured using an alkaline solution. thereafter, streptavidin - conjugated alkaline phosphatase was added, which binds to any biotinylated pcr product / probe hybrid previously formed. finally, the pcr product bound to a specific probe was detected by adding bcip / nbt chromogen. the association of hpv infection and age was evaluated using the logistic regression test. a p value < 0.05 was considered as statistically significance. 95% ci for prevalence estimations was performed using an online confidence intervals calculator (https://www.mccallum-layton.co.uk). the mean age of the participants was 34.4 8.5 (range : 15 - 76). table 1 shows the prevalence of hpv genotypes. totally, hpv dna was detected in 269 (55.7%, 95% ci : 51.2 - 60.1%) of the subjects. forty six (9.5%, 95% ci : 7.2 - 12.5%) males were positive for hr hpv genotypes. the most prevalent hr genotype was hpv16 (2.3%), followed by hpv18 (1.9%) and hpv52 (1.9%). lr hpv genotypes were detected in 268 (55.5%, 95% ci : 51.1 - 59.9%) subjects. the prevalence of infection with multiple hpv genotypes or coinfection determined by two or more hpv genotypes is shown is table 2. infection with multiple hpv genotypes was observed in 38 (7.9%, 95% ci : 5.8 - 10.6%) of the study participants (14.1% (95% ci : 10.5 - 18.8%) of hpv - positive cases). of those with multiple hpv genotypes infection, 31 (6.4%) had coinfection with two genotypes, 4 (0.8%) had coinfection with three genotypes, 2 (0.4%) had coinfection with four genotypes, and only 1 (0.2%) had coinfection with five genotypes. abbreviations : hpv, human papillomavirus ; hr, high - risk ; lr, low - risk. overall, 42 cases (8.7%, 95% ci : 6.5 - 11.5%) were infected with at least one hr hpv genotype and at least one lr hpv genotype was detected in 258 (53.4%) of the participants. multiple hr hpv genotypes and multiple lr hpv genotypes infections were found in 4 (0.8%, 95% ci : 0.3 - 2.1%) and 9 (1.9%, 95% ci : 0.1 - 3.5%) of the study samples, respectively. in particular, 20 (4.1%, 95% ci : 2.7 - 6.3%) cases were infected by hpv16 or hpv18. however, concomitant infection with both hpv16 and hpv18 was not observed. in 250 (51.8%, 95% ci : 47.3 - 56.2%) cases, infections with hpv6 or hpv11 were found, while coinfection with both hpv6 and hpv11 was observed in only 6 (1.2%, 95% ci : 0.6 - 2.7%) subjects. phr genotypes were detected in 4 (0.8%, 95% ci : 0.3 - 2.1%) cases and not - categorized genotypes were not found in any of the cases. the highest prevalence of hpv was detected in males aged between 30 - 39 years and the lowest prevalence was seen in those more than 59 years old. however, using logistic regression, there was no statistical association between hpv infection and age (p = 0.469). in addition, there was no significant correlation between age and hr hpv infection (p = 0.330) or lr hpv infection (p = 0.346). the identification of hpv infection and its genotyping description in males is a serious clinical issue due to the strong association of persistent hpv infection and several cancers in males. in addition, males have an important role in the transmission of hpv to females (1). the knowledge of hpv infection in males seems to be necessary for public health policies and males vaccination with hpv vaccine. however, data about the epidemiology of hpv infection in iranian males are considerably low. the present cross - sectional study described the prevalence of genital hpv infection and hpv genotype distribution in iranian males. to our knowledge, this was one of the largest epidemiological studies reporting the prevalence of hpv infection and its genotype distribution in males. in this study, the prevalence of hpv infection (any genotype) was relatively high (54.8%). this finding is in agreement with other published reports, which showed the prevalence of about 50% in sti clinic attendees (25, 26). the most prevalent hpv genotypes were hpv6 (46.2%) and hpv11 (8.1%), in line with previous reports (15, 27, 28). in agreement with several previous studies investigating the prevalence and genotype distribution of hpv in male genital warts (15, 27, 29 - 31), hpv16 was confirmed as the most common hr hpv genotype and the third most common hpv genotype detected after hpv6 and hpv11 in this study. therefore, it could be claimed that vaccine - targeted hpv genotypes (hpv6, hpv11, hpv16, and hpv18) were among the commonly detected hpv genotypes in our investigation. potentially, the availability of an effective vaccine against theses genotypes may allow us to prevent the most common hpv genotypes in iranian males. infection with multiple hpv genotypes which was found to associate with the increased risk of hpv persistence (33) was relatively low in the present study. this finding is in disagreement with several reports, showing the rate of infection with multiple hpv genotypes to be 33.8% (15), 56.7% (27) and 59.7% (32). this variation between the studies could be explained by differences in sampling approaches, the hpv detection protocols employed, and geographical variations in hpv genotypes distribution. while the prevalence of hpv infection was the highest among males aged 30 - 39 years, no significant association was identified between hpv infection and age in this investigation (p = 0.469). the absence of association between hpv infection and age was also reported by several studies (14, 32, 34 - 36). this study provided beneficial information about the epidemiology of genital hpv infection in iranian males, which should be applied for evaluating the efficiency of hpv vaccines for the prevention of vaccine - targeted hpv genotypes. however, this report should be interpreted with caution, due to the sti clinic setting of this investigation. therefore, this data could not be generalizable to the general population of iranian males. in conclusion, totally, 17 different hpv genotypes were detected and the most frequently detected genotypes were hpv6, hpv11, hpv16, hpv18 and hpv52, respectively. | background : human papillomavirus (hpv) is the most common viral sexually - transmitted infection. despite hpv infection is associated with several malignant disorders including penile and anal cancers, little is known about the epidemiology of hpv infection in males, particularly in developing countries.objectives:the aim of this study was to determine the prevalence of hpv infection and its genotype distribution among iranian males.patients and methods : between march 2009 and april 2014, a total number of 483 males, referred to iran university of medical sciences - affiliated sexually transmitted infections (sti) clinics, were enrolled in this study. following dna extraction, hpv detection and genotyping were performed using inno - lipa hpv genotyping extra assay. to analyze the association of hpv infection and age, the logistic regression was employed.results:no statistical association between hpv infection and age was observed (p = 0.469). furthermore, there was no statistically significant correlation between hr hpv infection and age (p = 0.330).conclusions : in this investigation, the prevalence of hpv infection was relatively substantial. totally, 17 different hpv genotypes were detected and the most frequently detected genotypes were hpv6, hpv11, hpv16, hpv18 and hpv52, respectively. the data from this study is essential for planning future public health strategies including hpv vaccination programs. |
however, reports of golf swing - related fractures include stress fracture of the ribs, ulnar diaphysis, vertebral body, sternum, and hook of hamate2,6,9,15,17). to our knowledge, only one case of multiple spinous process fractures of the upper thoracic spine in a beginning golfer has been reported14). we report a case of multiple cervical spinous process fractures in a novice golf player and discuss its pathomechanism. a 45-year - old female presented with intractable posterior neck pain that had lasted for 11 days. the severity of the pain had prevented sleep and rotation of the neck for 7 days. the patient had experienced a sharp and sudden pain on the posterior neck during a golf swing. the pain began when the club contacted the ground instead of the golf ball. under the impression of acute sprain, there was no notable history of medical illness, such as diabetes, hypertension and osteoporosis. on physical examination, the patient complained of severe tenderness over the lower mid - cervical area and, in particular, limited range of motion during flexion and extension. however, swelling and ecchymosis were not evident at the tender point. the findings of neurological symptoms and signs were normal. dynamic cervical radiographic findings were fractures in the spinous processes of c6 and c7 vertebrae without instability (fig. the patient underwent cervical magnetic resonance imaging (mri) with a suspicion of other occult trauma around c6 and c7. 2c) revealed high signal areas in interspinous and supraspinous ligaments between the c6 and c7 vertebra suggestive of an acute injury to cervical spine. under the diagnosis of stable c6 and c7 spinous process fractures, the patient was prescribed with pain medications and wearing a cervical collar was recommended for 6 weeks. after cervical bracing and medication, pain gradually improved. it requires a coordinated sequence of whole body muscle activity to efficiently transfer the power generated by the swing19). during the each phase of a golf swing there have been a number of reports of golf related injuries (table 1)2,6,7,9,14,15,17,18). but, only one report has described multiple spinous process fractures of the upper thoracic spine caused by golf swing itself14). but, the follow - up mri revealed the additional fracture in the spinous process of the second thoracic vertebra. the pathomechanism of this type injury remained ill - defined and was presumed to be similar to clay - shoveler 's fracture10). avulsion of spinous process or clay - shoveler 's fracture was first described in australia10). more recently, it has also been described during nintendo wii activity4), volleyball13), car accident1), power lifting12), and golf14). it occurs when the head and upper cervical segments are forced into flexion against the opposing action of the interspinous and supraspinous ligaments11). the injury takes its ' name from the fact that, during the throwing phase of shoveling, clay may stick to the shovel and jerk the trapezius and other muscles attached to lower cervical or upper thoracic spinous processes10). it can also occur with a whiplash injury, injuries that jerk the arms upwards, neck hyperflexion, or a direct blow to the spinous processes10). in our case the trapezius muscle originates from the medial one - third of the superior nuchal line and the external occipital protuberance of the occipital bone, from the spines of the seventh cervical and all thoracic verbetrae, and from the intervening supraspinal ligament20). it is relatively flat and thin, but its thickness increases in the lower cervical and upper thoracic region20). where its increased thickness is matched by a distinct diamond - shaped accumulation of tendinous fibers of origin20)(fig. the spinous process is relatively longer in the lower cervical than the upper cervical area. its fibers converge toward the bones of the shoulder20). during the back swing, the right upper and middle trapezius muscle contracts19)(fig. 3b, c). during the forward swing, the left middle trapezius muscle contracts19)(fig. 3d). so we can postulate that muscular contraction moves from right side to left side, like a bow. because of the pectoralis muscle, the force may be amplified during the acceleration phase (fig. when a right - handed golfer swings so the club contacts the ground prior to the ball, the energy accumulated during the back swing can not be transmitted to the ball (fig. 3f). there is a sudden change of muscle contraction from the right upper and middle trapezius to its attachment point (the spinous process). if enough force is transmitted through the trapezius tendon, spinous process fracture is possible. when the force is not strong enough to make fracture, if applied repeatedly, overuse or stress - type fracture may occur. atypically, this fracture may extend to the lamina, thereby involving the spinal canal with the potential of spinal cord injury11). if a patient complains of long lasting neck pain, the attending clinician should have further study (cervical spine radiographs, computed tomography scan or cervical mri) to rule out other occult fractures or injuries16). midline tenderness may be the clue for the presence of fracture. if the lower cervical spine and/or cervico - thoracic junction are not well visualized on cervical spine lateral radiographs, a swimmer 's view5) or ct scan15) should be obtained. so, warming up and stretching exercise before golf will reduce the risk of golf related injury8). lower cervical spinous process fractures, even minor stable fractures, can be associated with the golf swing. if a patient complains of long lasting neck pain and has a history of golf play, lower cervical spinous fracture should be suspected and ruled out. | avulsion of spinous process, also called clay - shoveler 's fracture, is most prevalent among those engaged in hard physical labor. to the best of the author 's knowledge, only one case of multiple spinous process fractures of the upper thoracic spine in a novice golfer has been reported. a 45-year - old female presented with intractable posterior neck pain. the patient experienced a sharp, sudden pain on the neck while swinging a golf club, immediately after the club head struck the ground. dynamic cervical radiographic findings were c6 and c7 spinous process fractures. magnetic resonance imaging revealed c6 and c7 spinous process fractures without spinal cord pathology. the patient was treated with pain medications and cervical bracing. the patient 's pain gradually improved. the injury mechanism was speculated to be similar to clay - shoveler 's fracture. lower cervical spinous process fractures can be associated with a golf swing. if the patient complains of long lasting neck pain and has a history of golf activity, further study should be conducted to rule out lower cervical spinous fracture. |
bile leakage is a well - known and dreaded complication of open or laparoscopic cholecystectomy (lc), major liver surgery, and blunt abdominal injury. with the advent of treatment by endoscopic sphincterotomy and drainage using either an endoprosthesis or nasobiliary catheter, surgery is now avoided in the majority of cases.[27 ] however, up to 10% of patients with biliary leaks after lc do not respond to initial endoscopic therapy. those with more severe ductal injury and large leaks are especially likely to require surgery. in the past few years, some alternatives to surgery have been used to control bile leakage, such as injection of fibrin and ethanol, but these have their own problems and complications. nbca is a tissue glue monomer that instantly polymerizes and solidifies upon contact with body fluids at neutral ph. this substance is routinely used in plastic surgery, radiology, neurosurgery, and general surgery and was first used for obliteration of bleeding gastric varices. nbca has recently been approved in europe for endoscopic hemostasis and sealing of fistulae (glubran 2, gem, viareggio, italy). in the literature, we would like to discuss one patient where we used nbca to seal a biliary leakage in a patient with a carcinoma of the papilla of vater who did not respond to standard endoscopic drainage methods. an 83-year - old male with a carcinoma of the papilla of vater was treated with a 10f polyethylene stenting (olympus, mt waverley, australia) of the main biliary duct during endoscopic retrograde cholangiopancreatography. when a stent release was attempted, it was not completely released and remained folded ; it was not possible to remove it endoscopically. so a percutaneous transhepatic cholangiogram was performed through the puncture of right intrahepatic biliary system. after several cholangiogram controls, stent positioned by endoscopists was removed and two new covered stents (9 80 mm) were deployed (smart, cordis ; miami lakes, fl). an internal drainage was maintained. the leakage probably originated from the posterior ducts, and it was caused from percutaneous puncture. conservative treatment was attempted, with maintenance of internal drainage for 15 days, but the leakage associated with a biloma persisted internally [figure 1 ]. the patient had pain, fever, and elevated inflammatory indices. using a different percutaneous access, through the right lobe itself, a superselective approach to the site of the leakage was obtained, using another biliary radicle, which was dilated enough. a 2.8f microcatheter (progreat ; terumo, tokyo, japan) was used using a 5f catheter (cobra, cordis, miami lakes, fl) and an hydrophilic guidewire (terumo, tokyo, japan). embolization was performed with three fibered 0.018-inch platinum micro - coils (vortx ; boston scientific) with nominal configured diameters of 2 mm 3 mm, pushed with saline solution injection. the microcatheter was preliminary flushed by a nonionic dextrose solution and then the tissue adhesive agent nbca (glubran 2, gem), mixed with iodized oil (lipiodol ; guebert, aulnay - sous - bois, france) in a ratio of 1:2 for opacification, was injected [figure 2 ]. a postprocedural cholangiogram confirmed the absence of any complication and the disappearance of the leakage [figure 3 ]. external biliary drain open, allowing bile drainage and permitting easy access for repeat radiologic follow - up. at the last follow - up visit (3 months after the procedure), the drainage was removed, and no evidence of recurrence was noticed [figure 4 ], and also biloma was reabsorbed. cholangiogram shows biliary leakage (arrows) after conservative treatment superselective embolization of biliary leakage with nbca (arrows) postprocedural cholangiogram shows the disappearance of the leakage (arrows) cholangiogram performed after 3 months shows the absence of recurrence. the drainage was removed informed consent was obtained before each procedure. before any percutaneous procedure, the patient receives intravenous antibiotic, 1.5 g cefuroxime (cefurex, salus researches s.p.a, italy), as a one - time dose. biliary leakage occurs most frequently after hepatobiliary surgery, especially open or lc, but is also seen after liver resection or liver transplantation, after endoscopic or interventional radiological maneuvers, or after severe hepatic trauma. many of these biliary tract injuries may go unrecognized at the time of surgery and have a delayed presentation. nonoperative management of these patients can be successful, and interventional radiology has a major role to play in delineating the anatomy of the injury and controlling ongoing bile duct injury. in the literature, there is a description of the use of fibrin glue for the treatment of communication between an abscess cavity and an aberrant posterior segment hepatic duct that was injured in a lc ; however, the bile discharge in that case was not reduced and the cavity and fistula could not be closed. there are three main materials that have been studied as potential sealants of the biliary tract : fibrin, ethanol, and nbca. matsumoto. reported a case in which multiple ethanol injections were performed to close a biliary - cutaneous fistula from an isolated small bile duct of the left caudate lobe after resection of the right caudate lobe for hepatocellular carcinoma. sadakari. described a case of intractable bile leakage after hepatectomy, which was successfully treated by percutaneous transhepatic portal embolization with ethanol. ethanol is not advised when there is communication with the remainder of the biliary tree as there may be seepage of the ethanol into the biliary tree, which could lead to irreversible damage. flushing, fever, leukocytosis, mild increases of aminotransferase levels, and systemic hypotension may occur with ethanol injection. ncba, a low - viscosity monomer used as tissue adhesive glue, is a promising solution to biliary chemical embolization. when in contact with organic fluids (i.e., bile), this substance undergoes rapid polymerization and solidification. it provides a permanent embolization and hence, due to an inflammatory tissue response, a long - term occlusion in vessels of various size resulting in vessel thrombosis or tissue atrophy. vu., based on their experience with six patients, suggested the placement of a coil at the neck of the fistula and subsequent administration of nbca from an external approach as the most effective way to prevent recurrence of biliary fistulas. described their experience of percutaneous embolization of bile duct fistulas with ethibloc (ethicon, somerville, nj) and isobutyl-2-cyanoacrylate in four patients. they observed unintentional spillage of isobutyl-2-cyanoacrylate in the bile duct in one of the four patients. they also reported that a coaxial catheter became glued to the bile duct wall in one patient after an isobutyl-2-cyanoacrylate embolization. if the patient is unable to undergo percutaneous embolization for the biliary leak, continued percutaneous drainage is also an option. bleeding episodes can occur after catheter removal and metabolic acidosis may develop secondary to continued bile loss from the drainage catheter. we could find only two reports in literature describing biliary leakage treated with percutaneous insertion of nbca : the series of patients (six patients) treated by vu. and a case report by lauterio. the success of the procedure in our patient is further evidence of the efficacy and safety of using percutaneous insertion of nbca glue in biliary injuries. further studies are needed to confirm the efficacy and safety of this approach and to determine whether it can reduce hospital stay and treatment costs. | biliary leakage is a known complication after biliary surgery. in this report, we describe an uncommon treatment of a common biliary complication, wherein we used percutaneous transhepatic injection of n - butyl cyanoacrylate (nbca) to treat a biliary leak in an 83-year - old patient. |
a 61-year - old woman visited our hospital for alleged colon polyps found during a colonoscopy examination as part of a routine health examination. abdominopelvic computed tomography (ct) showed an approximately 4-cm - sized, well - enhancing soft tissue lesion in the right perianal area (fig. 1a) and a well - enhancing enlarged lymph node in both inguinal areas, suggesting hypervascular tumor metastasis such as melanoma in those lymph nodes (fig., however, a widespread erythematous lichenified skin lesion, measuring 129.7 cm, was noted in the perianal and vulvar area (fig. 2a), which had developed over the previous 3 years according to the patient. she had no history of anal fissure, fistula, or change in bowel habit. skin biopsy was taken from the perianal and vulvar area, which showed infiltrating pagetoid cells and srcc cells. the preoperative carcinoembryonic antigen (cea) level was elevated to 39.75 ng / ml (reference, 0 to 5 ng / ml). inguinal lymph node dissection with an extended miles operation was performed ; traditional miles operation with extended resection around bilateral labium majora, followed by skin reconstruction with gluteal flap, was performed. the resected specimen was composed of the anal canal and rectum with skin and soft tissue of the perianal region and vulva (fig. upon sectioning, the anal canal showed an ulcerative firm mass measuring 4.03.02.7 cm, which invaded the perianal sphincter muscle and subcutaneous fat of the anal skin (fig. 2c). light microscopy showed that the anal canal was totally replaced by singly scattered intracytoplasmic mucin - containing signet ring cells and some extracellular mucin (fig. focally, well - formed glands were also found in less than 5% of the tumor. the erythematous skin around the anus and labium majora showed linear infiltration of pagetoid cells as well as infiltration of signet ring cells in the dermis and subcutis (fig. immunohistochemically, both signet ring cells and pagetoid cells were positive for cytokeratin (ck) 20, cea, moc-31, and ck19. paget s cells were positive for epidermal growth factor receptor and weakly positive for ck5/6. they were negative for ck7, human melanoma black 45, s-100 protein, caudal - related homeobox gene nuclear transcription factor (cdx2), p53, synaptophysin, chromogranin, and cd56. these results are shown in table 1. a mutation study of the kras gene (codon 12 and codon 13) was performed by means of the peptide nucleic acid - mediated real - time polymerase chain reaction clamping method using genomic dna isolated from formalin fixed paraffin - embedded tissue. microsatellite instability (msi) was tested using five bethesda markers (d2s123, d5s346, d17s250, bat25, and bat26). msi - high (msi - h) was defined if they differed in at least two of the five markers and msi - low was defined if they differed in only one of the five markers. the case was diagnosed as anal canal srcc with pagetoid spread in perianal and vulva skin, stage iiib according to the tnm staging system of the american joint committee on cancer. the patient was scheduled to undergo chemotherapy with mitomycin - c and 5-fluorouracil (5-fu) and subsequent radiotherapy. colorectal srcc is a rare histologic subtype of adenocarcinoma, accounting for 0.1% to 2.4% of all colorectal malignancies. anal canal srcc is even rarer ; only two cases of anal canal srccs have been reported in the english literature. seven additional cases have been retrieved from the japanese literature [3,7 - 12 ]. anal canal carcinoma is histologically and pathogenetically divided into squamous cell carcinoma, cloacogenic (basaloid or transitional cell) carcinoma and adenocarcinoma. anal canal squamous cell carcinoma originates from the non - keratinizing squamous epithelium below the dentate line of the anal canal, while anal canal adenocarcinoma is regarded as arising from the upper part lined by the columnar epithelium., anal canal adenocarcinomas are subclassified according to adenocarcinoma arising from anal mucosa and extramucosa, and adenocarcinoma arising from anorectal fistula or adenocarcinoma of anal glands. no description of in situ lesion was found in the previously reported cases of anal canal srccs. based on the findings of the overlying ulcerated anal surface mucosa, remnants of anal gland adenocarcinoma in situ without continuity to srcc portion, the present anal canal srcc belongs to extramucosal perianal adenocarcinoma with wide pagetoid spread along the perianal soft tissues and skin. similar to the current case, eight out of 10 anal canal srccs (80%) were accompanied by perianal or vulvar pagetoid spread [3 - 5,7 - 12 ]. extramammary perianal paget s disease is a rare and heterogeneous neoplasm, which is frequently combined with underlying hidden adenocarcinoma. immunohistochemical panels such as ck7, ck20, cea, gross cystic disease fluid protein-15 (gcdfp-15), muc1, muc2, muc5ac, and cdx2 have been used to distinguish primary from secondary paget s disease. in anal srccs with pagetoid spread, i.e., not primary extramammary paget s disease, the tumor cells were positive for ck20, muc1, or moc-31, while they were negative for gcdfp-15, and negative for ck7, whereas primary paget s disease is commonly positive for ck7. however, none of these were a specific and confirmative diagnostic clue ; further accumulative data may be needed. srcc is most commonly encountered in the stomach, but it can also arise in various organs, such as breast, urinary bladder, or colon. immunohistochemical profiles for ck7 and ck20 have also been used to differentiate the sites of origin for srccs ; ck20 is normally expressed in the gastrointestinal epithelium, urothelium, and in merkel s cells. while ck7 is uncommonly expressed in the lower gastrointestinal tract, it is commonly expressed in lung, ovary, endometrium, and breast. as the term signetring cells implies, the tumor cells have intracellular mucin vacuoles displacing the nucleus to one side of the cells scattered as single cells or in loose clusters. this is caused by disrupted cell - to - cell adhesion and diffuse spreading, and results in more frequent lymphovascular invasion and node metastasis of srcc as compared with other mucinous adenocarcinoma. in view of the clinical aspects, colorectal srcc has a very high mortality rate compared to mucinous carcinoma and nonmucinous colorectal adenocarcinomas. even a minor signet - ring cell component, i.e., 50% or less, in colorectal carcinomas was independently associated with a high mortality rate, regardless of molecular or other clinicopathological factors. anal canal srcc grows insidiously underneath the mucosa, and thus it may not be found before the late advanced stage. it is uncertain whether anal srccs have an adverse prognosis like that of colorectal srcc. inguinal nodes should be examined for anal cancer staging. in a review of 10 cases of anal canal srccs, the ages ranged from 46 to 87 years (mean, 63.4 years) [3 - 5,7 - 12 ]. srcc has a shorter patient survival. during the follow - up period, ranging from 4 to 25 months, death caused by lymphatic or peritoneal carcinomatosis or distant metastases occurred in 50% of cases (5/10). the five remaining cases were alive with a follow - up period ranging from 2 months to 6 years. for the past decade, molecular prognostic markers in colorectal carcinoma have been studied ; msi - h is a well - established reliable predictive marker for chemotherapeutic efficacy in colorectal carcinoma. however, contrary to colorectal srccs that take an aggressive course, colorectal mucinous carcinoma takes a favorable course, although both are associated with msi - h. data on anal canal srcc concerning msi - h as a predictive factor is lacking. due to the rarity of anal canal srccs, the msi status of anal canal srcc relating to prognosis has not been determined. traditional treatment of anal canal carcinoma is surgery including abdominopelvic resection with or without chemoradiotherapy. radiation therapy for anal canal carcinoma reaches a cure rate of up to 70% in selected low - stage patients. however, there is no general agreement regarding the treatment of anal canal srcc due to the extremely rare incidence and limited data on cancer treatment, as shown in table 2. in a case reported by yoshitani., a patient with distant metastatic foci achieved complete remission after chemotherapy using bevacizumab / mfolfox6, folfiri.. reported on a long - survived stage ii patient with no recurrent tumor who underwent chemoradiotherapy using 5-fu for a 6-year follow - up period. in summary, if there is perianal paget s disease raising the possibility of underlying hidden adenocarcinoma, careful evaluation is necessary for early diagnosis of anal canal srcc. | a 61-year - old woman was referred to surgery for incidentally found colonic polyps during a health examination. physical examination revealed widespread eczematous skin lesion without pruritus in the perianal and vulvar area. abdominopelvic computed tomography showed an approximately 4-cm - sized, soft tissue lesion in the right perianal area. inguinal lymph node dissection and mils operation extended to perianal and perivulvar skin was performed. histologically, the anal canal lesion was composed of mucin - containing signet ring cells, which were similar to those found in pagetoid skin lesions. it was diagnosed as an anal canal signet ring cell carcinoma (srcc) with perianal and vulvar pagetoid spread and bilateral inguinal lymph node metastasis. anal canal srcc is rare, and the current case is the third reported case in the english literature. seven additional cases were retrieved from the world literature. here, we describe this rare case of anal canal srcc with perianal pagetoid spread and provide a literature review. |
the purpose of this article is to describe the role of stress, here in the shape of the threat of unemployment, in making stroke (haemorrhagia and apoplexia cerebralis) a cause of death. based on danish data the actual development in the incidence of strokes in denmark within age groups of five years is discussed with special attention to the threat of the specific unemployment pattern faced by each separate age group. the article reveals how expected (feared) unemployment affects death from apoplexy over the business cycle years before unemployment is actually realized. the econometric problems in estimating that kind of model are briefly discussed. in the search for a model for the incidence of stroke over the business cycle an interesting pattern of the time lags including backlash is revealed. the study concludes that stress caused by (the fear of) expected unemployment kills. | backgroundthe purpose of this article is to describe the role of stress, here in the shape of the threat of unemployment, in making stroke (haemorrhagia and apoplexia cerebralis) a cause of death. this study is related to projects at the institute of public health.based on danish data the actual development in the incidence of strokes in denmark within age groups of five years is discussed with special attention to the threat of the specific unemployment pattern faced by each separate age group.results and discussionthe article reveals how expected (feared) unemployment affects death from apoplexy over the business cycle years before unemployment is actually realized. the econometric problems in estimating that kind of model are briefly discussed. in the search for a model for the incidence of stroke over the business cycle an interesting pattern of the time lags including backlash is revealed.conclusionthe study concludes that stress caused by (the fear of) expected unemployment kills. |
prevention of chronic diseases is a necessity in clinical sport and exercise medicine (1). avicenna, the great ancient iranian physician, in his masterpiece, the canon of medicine, introduced as an essential medical encyclopedia and divided to five books (2), described subjects about hygiene and health preservation and promotion and disease prevention. exercise which he called riazat has been described in the first book, third craft, second teaching and chapter one, pp229 - 234 of the arabic canon. according to his viewpoint if exercise is used correctly, intermediately and in an appropriate time, it can prevent from some diseases. exercise creates heat in body which helps defecating of wastes out of body and enriches digestion to digest food completely so it results in preventing from accumulation of accessory materials or undigested substances in body. in this chapter, avicenna also has described some diseases which can be produced because of physical inactivity (3). this study discusses about diseases which, according to avicenna s viewpoint, could be prevented by exercise but how exercise prevents from diseases is not the aim of this study. qualitative research, phenomenology type, was the method of study. according to study s aim, subjects about diseases, which may be prevented by exercise, were gathered from avicenna s book, the canon of medicine as sample of study. then, subjects were classified and read out repeatedly, so main themes were created. finally, content analysis in qualitative research is a perspective method to describe data as a code and then interpretation of codes as themes and finally, presentation of a comment from the text (4). a mizaj that means dystemperament, fever and soul impairment. based on teaching of avicenna, exercise could prevent from diseases which are created by some materials which he named them as materialistic diseases. in this group of diseases, one or more materials include accessory and defecating products (wastes and undigested substances) accumulate whether in whole or in a part of body and result in some difficulties. due to accumulation of defecating materials in body, five abnormal situations may occur : 1- imtela : it means filling. access materials can fill free spaces inside tissues and/or inside a duct ; for example, in vessels they may cause obstruction and result in infarction. such obstruction in other spaces may result in other difficulties such as a kind of epilepsy and also an especial form of stroke which appears due to filling of brain s ventricles with materials or wastes.2- oram : it means inflammation. if materials move in body and descend to another organ, they may cause inflammation. according to avicenna s viewpoint, inflammation is either soft or hard ; for example, a reason for swollen, erythematouse, painful and warm joint, may be a soft inflammation ; whereas a cancerous mass can be a hard inflammation ; however, there are some differences between cancerous inflammation and hard inflammation ; for example, in opposite to cancer, hard inflammation can decline the sensation of organ. sometimes, inflammation may be occurring in internal organs such as liver ; and sometimes it offers external organs such as joints.3- sui a mizaj : it means vulnerability of mizaj altered temperament which is called dystemperament (sui a mizaj) leads to several different types of diseases. sometimes it is caused by abnormal materials and waste products quality dominance. if matters temperament becomes warm or cold, bodies temperament will shift to be warmer or colder than normal. this condition in brain is too dangerous and may result in some psychotic states.4- fever : prolonged persistence of abnormal materials and waste products may produce an unnatural heat in body and creates infection and fever. some types of fevers causes after filling of spaces inside body either generally or locally, with waste so inactive physically individuals may suffer from fever because of two reasons : infection and imtela.5- soul impairment : receiving unhealthy vapour from the accumulated matters and waste products to soul, leads to soul impairment which may result in special diseases such as some psychotic states (3). access materials can fill free spaces inside tissues and/or inside a duct ; for example, in vessels they may cause obstruction and result in infarction. such obstruction in other spaces may result in other difficulties such as a kind of epilepsy and also an especial form of stroke which appears due to filling of brain s ventricles with materials or wastes. if materials move in body and descend to another organ, they may cause inflammation. according to avicenna s viewpoint, inflammation is either soft or hard ; for example, a reason for swollen, erythematouse, painful and warm joint, may be a soft inflammation ; whereas a cancerous mass can be a hard inflammation ; however, there are some differences between cancerous inflammation and hard inflammation ; for example, in opposite to cancer, hard inflammation can decline the sensation of organ. sometimes, inflammation may be occurring in internal organs such as liver ; and sometimes it offers external organs such as joints. vulnerability of mizaj altered temperament which is called dystemperament (sui a mizaj) leads to several different types of diseases if matters temperament becomes warm or cold, bodies temperament will shift to be warmer or colder than normal. this condition in brain is too dangerous and may result in some psychotic states. 4- fever : prolonged persistence of abnormal materials and waste products may produce an unnatural heat in body and creates infection and fever. some types of fevers causes after filling of spaces inside body either generally or locally, with waste so inactive physically individuals may suffer from fever because of two reasons : infection and imtela. 5- soul impairment : receiving unhealthy vapour from the accumulated matters and waste products to soul, leads to soul impairment which may result in special diseases such as some psychotic states (3). based on teaching of avicenna, exercise could prevent from diseases which are created by some materials which he named them as materialistic diseases. in this group of diseases, one or more materials include accessory and defecating products (wastes and undigested substances) accumulate whether in whole or in a part of body and result in some difficulties. due to accumulation of defecating materials in body, five abnormal situations may occur : 1- imtela : it means filling. access materials can fill free spaces inside tissues and/or inside a duct ; for example, in vessels they may cause obstruction and result in infarction. such obstruction in other spaces may result in other difficulties such as a kind of epilepsy and also an especial form of stroke which appears due to filling of brain s ventricles with materials or wastes.2- oram : it means inflammation. if materials move in body and descend to another organ, they may cause inflammation. according to avicenna s viewpoint, inflammation is either soft or hard ; for example, a reason for swollen, erythematouse, painful and warm joint, may be a soft inflammation ; whereas a cancerous mass can be a hard inflammation ; however, there are some differences between cancerous inflammation and hard inflammation ; for example, in opposite to cancer, hard inflammation can decline the sensation of organ. sometimes, inflammation may be occurring in internal organs such as liver ; and sometimes it offers external organs such as joints.3- sui a mizaj : it means dystemperament vulnerability of mizaj altered temperament which is called dystemperament (sui a mizaj) leads to several different types of diseases. if matters temperament becomes warm or cold, bodies temperament will shift to be warmer or colder than normal. this condition in brain is too dangerous and may result in some psychotic states.4- fever : prolonged persistence of abnormal materials and waste products may produce an unnatural heat in body and creates infection and fever. some types of fevers causes after filling of spaces inside body either generally or locally, with waste so inactive physically individuals may suffer from fever because of two reasons : infection and imtela.5- soul impairment : receiving unhealthy vapour from the accumulated matters and waste products to soul, leads to soul impairment which may result in special diseases such as some psychotic states (3). access materials can fill free spaces inside tissues and/or inside a duct ; for example, in vessels they may cause obstruction and result in infarction. such obstruction in other spaces may result in other difficulties such as a kind of epilepsy and also an especial form of stroke which appears due to filling of brain s ventricles with materials or wastes. 2- oram : it means inflammation. if materials move in body and descend to another organ, they may cause inflammation. according to avicenna s viewpoint, inflammation is either soft or hard ; for example, a reason for swollen, erythematouse, painful and warm joint, may be a soft inflammation ; whereas a cancerous mass can be a hard inflammation ; however, there are some differences between cancerous inflammation and hard inflammation ; for example, in opposite to cancer, hard inflammation can decline the sensation of organ. sometimes, inflammation may be occurring in internal organs such as liver ; and sometimes it offers external organs such as joints. vulnerability of mizaj altered temperament which is called dystemperament (sui a mizaj) leads to several different types of diseases. if matters temperament becomes warm or cold, bodies temperament will shift to be warmer or colder than normal. this condition in brain is too dangerous and may result in some psychotic states. 4- fever : prolonged persistence of abnormal materials and waste products may produce an unnatural heat in body and creates infection and fever. some types of fevers causes after filling of spaces inside body either generally or locally, with waste so inactive physically individuals may suffer from fever because of two reasons : infection and imtela. 5- soul impairment : receiving unhealthy vapour from the accumulated matters and waste products to soul, leads to soul impairment which may result in special diseases such as some psychotic states (3). study s data indicate that according to avicenna s teaching there are several diseases caused due to physical inactivity. approximately, there is a relation between all diseases that may be prevented by exercise and accumulation of abnormal materials. in modern medicine, various diseases which are prevented by exercise have been known as well, for example coronary heart disease, stroke, hypertension, metabolic syndrome and cancer (5). some of these problems are similar to avicenna s opinion such as coronary obstruction (6). of course, nowadays preventive role of exercise against breast cancer is well - known. exercise role to prevent from stroke has been known but which kind of stroke that may be prevented by exercise is not so clear (5) while this study tell us that strokes which are created due to imtela may be prevented by exercise. it is interesting that some abnormal conditions have been explained in canon of medicine which can be prevented by exercise while there was not enough similar evidence about them in modern investigations such as fever. there are some evidence about protective role of exercise against epilepsy (7) and hepatitis (8) but they recommend more investigations to be sure. according this study, if epilepsy occurs following of imtela and hepatitis introduces as an oram, exercise may prevent against both of them. there are some diseases which are not raised today such as various kinds of dystemperament and soul impairment ; both brain dystemperament and soul impairment may results in some psychotic states. today, it has been known that exercise could promote level of functions in schizophrenic patients (9). may regular exercise in childhood prevent from occurring of schizophrenia as brain dystemperament or soul impairment in teen years ? it is necessary to know that all five groups of diseases that were indicated in this study have been described in a specific chapter in canon of medicine exhaustively and each one includes numerous diseases either are today well - known such as stroke or modern medicine is not familiar with them such as soul impairment and fever due to imtela. imtela be introduced as a reason for fever with unknown origin (fuo) ? the presented remarkable examples of diseases which may be prevented by exercise in the canon of medicine tell us that ancient physicians such as avicenna were familiar with preventive role of exercise as well. some diseases, which in new medicine exercise plays an important protective role against them, have been described by avicenna theoretically without any paraclinical helps and only on the basis of principles of iranian traditional medicine. to use his theories, for example, it is possible, easy, safe and low - cost to get an exact observation from epileptic patients by a traditional medicine physician in order to find signs of imtela according to avicenna s viewpoint and separates patients who present that signs. the next step is study about efficacy of preventive role of exercise against seizure in detected group. investigations about other abnormal status from which exercise may prevent, according to avicenna s viewpoint, are suggested. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors. mizaj in iranian traditional medicine texts is a quality which is a consequence of mutual interaction of the four contradictory primary qualities (hot, cold, wet, dry). | in the modern medical era it has been known as well that physical activity and exercise are important factors to prevent from different chronic diseases. scientifically, there are numerous evidence based studies about protective role of exercise against chronic diseases such as cardio- respiratory diseases, diabetes, and hyperlipidemia etc, which have been completely explained. historically, ancient physicians such as avicenna had described this topic several hundred years ago. however, ancient principles of medicine are too different in comparison with modern medicine and description of diseases which avicenna has talked about them and their managements are too much different, yet reviewing the protective role of sports and physical activity in his masterpiece, the canon of medicine, reveals that avicenna has made a significant contribution to the evolution of following knowledge. the present review discusses avicenna s opinion about protective role of exercise against some diseases through a comparison with modern medical views and also emphasizes aspects that need further investigation for these opinions to be useful in clinic in the future. |
diffuse optical tomography (dot) is a functional imaging modality for medical applications that has the potential to provide three - dimensional images of the scattering and absorption parameter distributions in vivo, from which clinically relevant physiological parameters such as tissue and blood oxygenation states and state changes can be derived. applications include brain activation visualisation [1, 2 ], brain oxygenation monitoring in infants, and breast tumour detection. data acquisition systems consist of an infrared light delivery system that illuminates the tissue surface at different locations, and detectors that measure the transmitted light at a set of surface positions. measurements can be performed in continuous wave (cw) mode, in time - resolved mode using ultra - short input pulses and time - resolved detectors, or in frequency - domain mode, using modulated light sources and measuring the phase shift and modulation amplitude at the detector locations. due to the high level of scattering in most biological tissues, image reconstruction in dot is an ill - posed nonlinear problem whose solution generally requires the formulation of a forward model of light propagation in inhomogeneous scattering tissue. frequently utilised light transport models include stochastic models such as monte - carlo simulation, or deterministic models such as the radiative transfer equation (rte) or the diffusion equation (de). numerical solution approaches include finite difference, finite element, finite volume, or boundary element methods. the light transport model considered in this paper the finite element method (fem) for the solution of the diffusion equation. the reconstruction problem can be stated as a nonlinear optimisation problem, where an objective function, defined as a norm of the difference between measurement data and model data for a given set of optical parameters, is minimised, subject to a regularisation functional. reconstruction approaches include methods that require the availability of the forward model only, such as markov - chain monte - carlo methods, its first derivative, such as nonlinear conjugate gradient methods, and its second derivative, such as newton - type methods. iterative solvers require multiple evaluations of the forward model for calculating the objective function and its gradient. the forward model itself involves the solution of a large linear system with multiple right - hand sides. problems involving high - dimensional parameter spaces result in time - consuming evaluations of the forward model, which limits the applicability of the reconstruction methods in clinical practice. recent developments in computing hardware have offered the possibility to make use of parallel computation. traditionally, solutions have included central processing unit (cpu) based moderately parallel systems with shared memory access (multiprocessor and multicore implementation) and large - scale distributed parallel systems limited by data transfer between nodes (cluster cpu implementation). more recently, the parallel architecture of graphics processing units (gpu) has been utilised for the acceleration of general purpose computations, including gpu methods for the solution of dense [8, 9 ] or sparse [1014 ] linear systems. the latter are encountered in the implementation of the fem. in the context of diffuse optical tomography and related fields of optical imaging, gpu - accelerated computations have been successfully employed for implementing monte - carlo light transport models [1517 ], which compute independent photon trajectories and are well - suited for parallelisation due to the lack of interprocess communication. zhang. have applied gpu acceleration to finite element computations in bioluminescence tomography and compared to single and multithreaded cpu performance. they reported significant performance advantages of the gpu version but were limited to low mesh complexity due to memory limits. in optical projection tomography, gpu - based reconstruction methods have been employed by vinegoni.. watanabe and itagaki have used a gpu implementation for real - time visualisation in fourier - domain optical coherence tomography. in this paper, we are investigating the potential of a gpu implementation for the forward model in dot. we present a compute unified device architecture (cuda) version of the finite element forward solver presented previously [21, 22 ], using the cusp library for sparse linear system computation on the graphics processor. cuda is the computing architecture for nvidia graphics processors and can be addressed via an application - programming interface (api). we investigate the effect of single - precision computation on the accuracy of the forward model for different combinations of optical parameters. the evaluation of the forward model is the most time - consuming element of iterative inverse solvers, and any efficiency gains in the forward solver therefore directly translate into reduced overall runtimes for image reconstruction applications and are an important step towards making dot a viable imaging application in clinical practice. we consider the diffusion approximation to the radiative transfer equation [24, 25 ] in either steady - state, time, or frequency domain as the forward model for light transport in tissue. for steady - state problems, the stationary real - valued photon density inside the medium arising from a continuous - wave source is computed while for frequency - domain problems, the source is amplitude modulated, giving rise to a complex - valued solution of a photon density wave distribution. in time - domain problems, the source is considered a delta - pulse in time, and the measurement consists of the temporal dispersion of the transmitted signal. given a compact domain bounded by, the diffusion equation in time and frequency domain is given by (1)[(r)+a(r)+1ct](r, t)=0[(r)+a(r)+ic]^(r,)=0}r, respectively, where is the angular source modulation frequency, (r) and a(r) are the spatially varying diffusion and absorption coefficients, respectively, where = [3(a + s) ] with scattering coefficient s. c is the speed of light in the medium, and, and ^ are the real and complex - valued photon density fields. for simplicity in the following, we use to denote either the real or complex - valued properties as appropriate. a robin - type boundary condition applies at, (2)()+2(n)()=q(),, where q is a real or complex - valued source distribution as appropriate, (n) is a boundary reflectance term incorporating the refractive index n at the tissue - air interface, and is the surface normal at surface point. the boundary operator defining the exitance through is given by the dirichlet - to - neumann map (3)()=c()=c2(). the set of measurements yij from a source distribution qi is obtained by integrating over the measurement profiles mj() on the surface (4)yij=i()mj()d. for the time - domain problem, yij are the temporal dispersion profiles of the received signal intensities while, for the frequency - domain problem, yij are given by the complex exitance values, usually expressed by logarithmic amplitude lna and phase shift, (5)lnaij = re(lnyij), ij = im(lnyij). given the set of forward data y = { yij } of all measurements from all source distributions, (1) to (4) define the forward model f[, a ] = y which maps a parameter distribution, a to measurements for a given domain geometry, modulation frequency, source distributions, and measurement profiles. a division of domain into tetrahedral elements defined by n vertex nodes provides a piecewise polynomial basis for the parameters, a, and photon density. the approximate field (r) at any point r is given by interpolation of the nodal coefficients i using piecewise polynomial shape functions ui(r) (6)h(r)=i=1nui(r)i. piecewise polynomial approximations, a to the continuous parameters, defined by the nodal coefficients i, a, i are constructed in the same way. applying a galerkin approach transforms the continuous problem of (1) into an n - dimensional discrete problem of finding the nodal field values = { i } at all nodes i, given the set of nodal parameters x = { i, a, i}. for the frequency - domain problem, the resulting linear system is given by (7)s(x,)()=q(), where (8)s(x,)=k({i})+c({a, i})+a+ib, = c/2, k, c, a, b are symmetric sparse matrices given by (9)kij=k=1nkuk(r)ui(r)uj(r)dr, cij=k=1na, kuk(r)ui(r)uj(r)dr, aij=ui()uj()d,bij=1cui(r)uj(r)dr. and right - hand side q is given by (10)qi=k=1nqiui()d with qi the nodal coefficients of the basis expansion of q(). for the solution of the time - domain problem, the time derivative in (1) at time t is approximated by a finite difference (11)(r,t)t1t[(r,t+t)(r,t) ]. the temporal profile of is approximated at a set of discrete steps { tn } and evaluated by a finite difference approach, given by the iteration (12)[s+1t0b](t0)=1t0q0,[s+1tnb](tn)=[(1)s1tnb](tn1), n1, where s=k+c+a, time steps tn = tn1 + tn1, n 1, and 0 1 is a control parameter that can be used to select implicit (= 1), explicit (= 0), or intermediate schemes. the step lengths tn are governed by stability considerations of the finite difference scheme. for the unconditionally stable implicit scheme, the step length can be adjusted to the curvature of the temporal profile, allowing increased step length at the exponentially decaying tail of (t). the solution of the fem problem thus consists of (i) construction of the system matrices (9), (ii) solution of the complex - valued linear problem (7) or real - valued sequence of linear problems (12), and (iii) mapping to measurements (3) and (4). the main computational cost is the solution of the linear system, in particular in the time - domain problem, while the cost of matrix assembly time is typically only 110% of the time of a single linear solution. the linear system can be solved either with a direct method, such as cholesky decomposition for the real - valued time - domain problem or lu decomposition for the complex - valued frequency domain problem, or with iterative methods, such as conjugate gradients for the real - valued problem and biconjugate gradients for the complex - valued problem. direct methods become impractical for large - scale problems, due to memory storage requirements for the decomposition and increased computation time. for 3-d problems with high node density, iterative the bottleneck of the reconstruction problem is the solution of the linear systems in (7) or (12). accelerating the linear solver is therefore an effective method for improving the inverse solver performance. we have embedded a graphics processor - accelerated version of the fem forward solver into the existing toast software package for light transport and reconstruction presented previously. the gpu - accelerated code uses the cuda programming interface for nvidia graphics processor hardware. the implementation utilises the cusp library which offers a templated framework for sparse linear algebra and provides conjugate gradient (cg) and biconjugate gradient - stabilised (bicgstab) iterative solvers for sparse linear systems. there are alternative storage formats such as the coordinate, ellpack, or hybrid formats which can provide better parallel performance depending on the matrix fill structure, usually at the cost of less compact storage. however, the csr format constitutes a good compromise between performance and versatility and is well suited for the matrix fill distribution arising from unstructured fem meshes. for the solution of the complex - valued linear problem (7), we expand the complex n n system into a 2n 2n real system of the form (13)[sresimsimsre][reim]=[qreqim ]. the cusp cg and bicgstab solvers had to be modified to account for early termination of the iteration loop due to singularities in the intermediate results. early termination conditions occasionally do occur in practice in the problems considered in this paper, in particular due to single - precision round - off errors. the data flow between host and graphics device memory for a single solver step is shown in figure 1. the system matrix s is assembled in host memory for a given set of parameters, together with the source vectors qi, and copied to gpu device memory. the gpu solver is then invoked for all right - hand - sides, after which the projected solutions yij are copied back to host memory. for the finite - difference solution of the time - domain problem, the entire iteration (12) can be evaluated on the gpu with minimal communication between host and graphics system, consisting of initial copying the system matrices s and b to the gpu, and returning the computed temporal profiles yij(t) back to the host. the data flow diagram for the time - domain problem although gpu hardware with double - precision capability is emerging, typically only a fraction of the chip infrastructure is dedicated to double - precision operations, thus incurring a significant performance penalty. for optimising, it is therefore advantageous to use single - precision arithmetic where adequate. we have implemented the fem solver in both single and double precision for gpu as well as cpu platforms. when the system matrix is represented in single precision the global vertex contributions in the system matrix are the sum of the local element vertex values for all elements adjacent to the vertex. during the summation, loss of precision can occur if the magnitude difference between the summands is large compared to the mantissa precision of the floating point representation. for single precision arithmetic, this can be a problem in particular where vertices have a large number of adjacent elements, notably in 3-d meshes with tetrahedral elements. loss of precision during matrix assembly can be reduced if the contributions are sorted from smallest to highest magnitude. instead we have opted to assemble the system matrix in double precision and map the values to single precision after assembly. the assembly step is performed on the host side, with negligible performance impact because assembly time is generally small compared to solve time. to compare the results of matrix assembly in single and double precision, we have performed an fem forward solution from single - precision system matrices that were assembled in both single and double precision. the domain was a homogeneous cylinder of radius 25 mm and height 50 mm, with optical parameters a = 0.01 mm and = 0.3 mm. a point source modulated at frequency = 2 100 mhz was placed on the cylinder mantle. figure 3 shows the differences between single and double precision forward solution in log amplitude (figure 3(a)) and phase (figure 3(b)) of the complex photon density field along a line from the source position across the volume of the cylinder. the solid lines represent the single - precision error where the system matrix has been assembled in double precision before being mapped to single precision, while the dashed line is the error arising from a system matrix assembled in single precision. it can be seen that system matrix assembly in double precision can significantly reduce the solution errors, in particular at large distances from the source. the influence of optical parameters on the single - precision error of the forward data is shown in figure 4. the forward solutions were calculated for three different combinations of absorption and scattering coefficient (i) a = 0.01 mm, s = 1 mm, (ii) a = 0.1 mm, s = 1 mm, and (iii) a = 0.1 mm, s = 1.5 mm. it can be seen that the discrepancies become more severe at higher values of the optical parameters. the results are particularly sensitive to an increase of the scattering parameter. due to attenuation, the photon density fields inside the object decay rapidly, leading to large dynamic range in the data. increased absorption and scattering parameters aggravate this effect, which impairs the accuracy of the single - precision solution, in particular in regions far away from the source. it should be noted, however, that, for moderate optical parameters in a typical range for optical tomography, the single precision solution is accurate, with maximum relative errors of 10 to 10 in log amplitude and phase, respectively. the device supports double as well as single precision arithmetic, so results for both were collected. for performance comparison, the same model calculations were also performed with a cpu - based serial implementation on an intel xeon processor clocked at 2.0 ghz with 4 mb cache and 12 gb main memory. the fem model consisted of a homogeneous cylindrical mesh with radius 25 mm and height 50 mm at various element resolutions. one of the meshes, together with the resulting system matrix sparsity structure, is shown in figure 5. for run - time performance comparison between gpu and cpu implementations under a variety of conditions the forward solutions were computed for both a complex - valued problem using a modulation frequency of = 2 100 mhz and a real - valued steady - state problem of = 0. for the complex - valued problem, the bicgstab linear solver was used to compute the linear system in (7) while, for the real - valued problem a cg solver was used. we tested the performance of the gpu solution as a function of the cg and bicgstab convergence tolerances, either without preconditioner or with a diagonal preconditioner. the results are shown in terms of the gpu performance factor, given by the ratio of the cpu and gpu run times. figure 6 shows the performance factors for single precision (figure 6(a)) and double precision (figure 6(b)) calculations. it can be seen that the gpu achieves a performance factor between 8 and 19 for single precision calculations, depending on the problem type, where the real - valued bicgstab solution without preconditioner shows the highest improvement at 1419, while the complex bicgstab solution without preconditioner exhibits the smallest improvement at 811.5. the performance factors for double - precision solutions are significantly lower, in a range between 3.7 and 4.7. this is due to the fact that while gpu performance drops significantly for double - precision calculations, the cpu solver performance is generally not affected, and indeed the cpu performance is slightly higher at double precision because it avoids casting floating point buffers between single and double precision. the drop in performance factor for lower tolerance limits is not present in the double - precision results. the next test compares the cpu and gpu performance as a function of the mesh node density and the resulting size of the linear system. the performance factors for the forward solvers applied to cylindrical meshes of different mesh resolutions as a function of node count are shown in figure 7. at each mesh resolution, we solved both a real - valued steady - state problem with the preconditioned cg solver, and a complex - valued frequency - domain problem with the preconditioned bicgstab solver, at single - precision (figure 7(a)) and double - precision (figure 7(b)) resolution. all solver results are for calculating the real or complex photon density fields for 80 sources, for a solver tolerance fixed at 10. it can be seen that in all cases gpu performance improves with increasing size of the linear system. for the single - precision solver, the performance factors range between 1 and 26 for mesh node counts between 9000 and 3.3 10, respectively, for the steady - state problem, and between 2 and 30 for mesh node counts between 9000 and 2.5 10, respectively, for the frequency domain problem. note that for the frequency domain problem, the performance factors could not be computed for the two largest meshes due to excessive computation time of the cpu solution. it can be seen that for the largest mesh resolutions, forward solver times on the cpu can take in excess of an hour. this can be prohibitive for clinical applications in iterative reconstruction, where each step of the reconstruction may require multiple evaluations of the forward problem to calculate the objective function and its gradient at the current estimate or perform a line search along the current search direction. by comparison, the gpu times for these problems typically require 2 to 10 minutes, which is feasible for reconstruction problems. to provide a comparison with a cpu - based parallel solver, we also show the performance factors of a shared - memory thread - based version of the fem forward solver using up to 8 threads, compared to the single - thread serial implementation. the thread implementation uses a coarse - grain parallelisation strategy, dividing the solution of the linear problems for different right - hand sides over the available worker threads. this method provided better processor utilisation and less communication overhead for the problem considered here than a fine - grain strategy of parallelising the iterative solver itself. because the cpu implementation showed no significant performance difference between the single and double precision solution, we present here only the double - precision results. figure 8 shows the performance factors for 2, 4, and 8 threads for the real - valued problem using a cg solver, and for the complex - valued problem using a bicgstab solver. the cg solver reaches factors between 1.5 (2 threads) and 2.8 (8 threads) while the bicgstab solver reaches factors between 1.7 (2 threads) and 4 (8 threads). we computed the finite difference implementation of the time - domain problem (12) over 100 time steps of 50 picoseconds for cylinder meshes of different complexity. for these simulations, a crank - nicholson scheme (= 0.5) was used. signal intensity time profiles were calculated at 80 detector position for each of 80 source locations. it can be seen that the performance improvements of the gpu implementation is again strongly dependent on mesh resolution, ranging from a factor of 3 to 13 for the double - precision arithmetic calculation, and from 6 to 17 for the single - precision calculation. at the highest mesh resolution, the total forward solver run time is approximately 8 hours for the cpu implementation for both single and double precision while the gpu run time is approximately 29 and 36 minutes for the single and double precision solutions, respectively. we have developed a gpu implementation of a finite element forward model for diffuse light transport that can be used as a component in an iterative nonlinear reconstruction method in diffuse optical tomography. the efficiency of the forward solver has a significant impact on reconstruction performance, and the reduction of reconstruction times is essential in making optical tomography a viable imaging modality in clinical diagnosis. the model presented here supports real and complex - valued problems and can be applied to steady - state, time, or frequency - domain imaging systems. the linear system arising from the fem discretisation is solved either with a conjugate gradient or biconjugate gradient stabilised iterative solver on the gpu device. we have shown that the gpu solver can achieve significant performance improvements over a serial cpu implementation in the range of factors between 5 and 30, depending on mesh complexity, tolerance limit, and solver type. the gpu - based forward solver provides higher performance gains than a thread - based parallel cpu implementation that was used for comparison. we have shown that for the forward problem a single precision linear solver can be applied for typical ranges of optical parameters in clinical applications of optical parameters. however, at very high absorption and scattering parameter values, the linear system may become increasingly ill - conditioned and no longer converge with single - precision arithmetic. in these cases, double - precision computation is required. | we introduce a gpu - accelerated finite element forward solver for the computation of light transport in scattering media. the forward model is the computationally most expensive component of iterative methods for image reconstruction in diffuse optical tomography, and performance optimisation of the forward solver is therefore crucial for improving the efficiency of the solution of the inverse problem. the gpu forward solver uses a cuda implementation that evaluates on the graphics hardware the sparse linear system arising in the finite element formulation of the diffusion equation. we present solutions for both time - domain and frequency - domain problems. a comparison with a cpu - based implementation shows significant performance gains of the graphics accelerated solution, with improvements of approximately a factor of 10 for double - precision computations, and factors beyond 20 for single - precision computations. the gains are also shown to be dependent on the mesh complexity, where the largest gains are achieved for high mesh resolutions. |
atherosclerosis, a progressive inflammatory disorder, may lead to peripheral artery disease, coronary artery disease or stroke. the prevalence of atherosclerosis associated with mortality, and morbidity is very high in developed countries.1,2 in western societies, it is the underlying reason of about approximately 50% of all deaths. specifically, cerebrovascular accident or stroke is the third etiology of death in usa today, preceded only by cardiovascular disease and cancer.1,3,4 over 750,000 new or recurrent strokes occur in the united states annually. in this country, the atherosclerosis is believed to account for about approximately 50% of all embolic strokes and causes to billions of dollars in direct and indirect costs annually.57 not only in the usa, but also in other countries, atherosclerosis and its more dramatic consequences strokes and heart attacks represent an important health problem. although the rate of stroke death has decreased over the past decades in spain, it is still the second reason of death in men and the first in women.8 in turkey, stroke or cerebrovascular accident is the third etiology of death, preceded only by cardiovascular disease and cancer.9 the majority (approximately 80%)10 of these strokes are ischemic and due to atherosclerotic disease in the region of the carotid bifurcation.11 it was showed that caucasian men are at greater risk for the stroke from atherosclerotic plaques that arise from carotid arteries.12 the presence of carotid artery calcifications (cacs) on standard panoramic radiographs (prs) was first showed by friedlander and lande.13 they suggested that these radiographs were able to play an important role in the early diagnosis of cacs, which could result in more serious heart disease and cerebro - vascular accident.14 therefore, prs may help us as a diagnostic tool for detecting cacs and the early diagnosis could potentially decrease the morbidity and mortality for subjects with cacs. recently, a number of studies have revealed the detection of cacs on prs in many populations,1223 but, there is no enough study regarding this topic in turkish population. there is only one report about cacs detected by prs in normal population in turkey. 24 the aim of the present study is to determine retrospectively the presence of cacs detected on prs in a group of turkish population living in cappadocia region. further, the relationship between cacs and gender, life style, and medical history was evaluated. according to our knowledge, this is the first study done in cappadocia region and investigating the risk factors related to cac in the turkish population. all the prs were taken between 2004 to 2006 at the erciyes university faculty of dentistry, department of oral diagnosis and radiology. the patients with or without dental problems were older than 40 years and treated with this clinic. seven hundred and fifty (n=750) of these radiographs were of good image quality. prs that were excluded because of the subject s movements during the exposure or did not include c3 and c4 were eliminated (n= 532). the prs were processed according to the manufacturer s recommendations in an automatic film processor. each radiograph was viewed in subdued ambient light using transmitted light from a standard view box. a radiopaque nodular mass or masses adjacent to the cervical vertebrae at or below the intervertebral space between c3 and c4 were diagnosed as cacs23 (figure 1). for the differential diagnosis of cacs, other cervical calcifications such as calcified triticeous cartilage, calcified thyroid cartilage, hyoid bone and submandibular salivary gland sialoliths were excluded according to carter s study.25 to check the intra - observer variations, all the prs were reevaluated by the same author after one month. when the cacs were detected, the medical records were reviewed for the factors related to atherosclerosis including hyperlipidemia, hypertension, renal diseases, diabetes mellitus, cardiovascular disease, smoking etc. any relationship between cacs and gender, age, and past medical history was evaluated. the results were analyzed with spss 10.0 (statistical package for social science inc., data were obtained using chi - square test for comparing the cac prevalence between the males and the females. the results were considered to have a significant difference if the significance level was lesser than.05. the study population consisted of 268 males and 482 females with a mean age of 51.08.3 (range : 4083 years) at the time of prs taken. of the 750 individuals, 38 (5.06%) were detected to have cac on prs. the thirty eight individuals who had cacs consisted of 12 males (4.5%) and 26 females (5.4%). the mean age of these patients at that time was 55.78.02 years (men : 587.3, women : 54.68.2 years). carotid artery calcifications were seemed as a radiopaque mass or masses adjacent to or just upper the intervertebral space between c3 and c4 (figure 1). these calcifications were unilateral in 26 (68.4%) and bilateral in 12 (31.6%) subjects. of the 38 patients there were 12 bilateral (six males, six females : table 1) cacs. of the 38 (n=50 cacs) patients, 31 (62%) of the cacs were located on the right side and 19 (38%) were located on the left side. the medical records of 38 patients with cac were analyzed for the risk factors associated with cac. table 1 shows the relationship between medical history and cacs. in 38 patients with cacs, 12 subjects (31.58%) reported hyperlipidemia, 12 subjects (31.58%) reported hypertension, 10 subjects (26.3%) reported renal disease, 7 subjects (18.4%) reported diabetes mellitus, 6 subjects (15.8 %) reported cardiovascular disease, and 6 subjects (15.8 %) reported smoking, as shown in table 1. carotid artery calcification, especially close to carotid bifurcation, can result in important vascular obstruction causing stroke.16 several factors for the stroke are stratified into no modifiable and modifiable risk factors. the former are gender, age, ethnicity, and heredity, and the latter are hypertension, diabetes mellitus, hyperlipidemia, obesity, smoking, and carotid atherosclerotic disease.26 early detection of these risk factors reduces the morbidity and mortality.16 in 1981, it was suggested that standard pr is a useful tool in detecting patients at risk of stroke, because the cac may be seen in the standard pr adjacent to the cervical vertebrae at the level of the c3c4 intervertebral junction.13 such calcification may seem as either a radiopaque vertical line or nodular radiopaque mass inferior to the angle of mandible.13 dentists should be able to diagnose cacs and be able to distinguish them from a myriad of anatomical and pathological lesions which may be seen in the region.18,27,28 verification of cac must be conducted with cervical spine radiographs, angiography or doppler ultrasound analysis and imaging.29 prs are used routinely in the evaluation of patients with dental problems. it is not as useful as doppler ultrasonography and three dimensional computed tomography for detecting atherosclerotic plaque in the carotid arteries and especially the stenosis of the vessels,30 but it is very cheap and non - invasive method in comparison to other imaging methods. prs may help us in the early diagnosis and in the evaluation of cacs in patients with or without associated risk factors and decrease the morbidity and mortality due to diseases caused by atherosclerosis.24 there are only two turkish reports investigating the cac prevalence on prs in normal population and in patients with end - stage renal disease (esrd).24,31 bayram evaluated the prs of 4106 subjects in terms of cac in the capital of turkey. of these patients, 88 patients (2.1%) had cacs. in the current study, this difference may be due to regional, dietary, and lifestyle differences of the subjects. we think that the availability of both of them (risk factors and cac on prs) may be important for the initial diagnosis and further evaluation of this disorder. in another study, the cac prevalence on prs was investigated for the 69 adult patients with renal disease (35 with renal transplant recipients and 34 with esrd).31 it was reported that the cac prevalence was 15.7% in patients with renal transplant patients and 17.6% in patients with haemodialysis.31 this high prevalence was due to esrd leading to atherosclerosis. recently, the literature has been reported several articles on incidental cacs in the carotid bifurcation region detected by prs in the other populations.1223 pornprasertsuk - damrongsri and thanakun,16 found a rate of 2.5% in dental school patients showing cac on the prs. in the present study, the prevalence of positive findings of cac on routine dental prs (5.06%) was higher than the report in thai population (2.5%). carter evaluated the cac prevalence on prs in 1175 newly accepted dental school patients in state university, new york. it was showed that the prevalence was 3.6% in this population. in other study, these differences in terms of the cac prevalence in all the populations might be due to ethnicity, dietary factors, lifestyle, and the other risk factors. there are also many studies evaluating the cac prevalence in patients with occult metabolic syndrome,33 treated with therapeutic irradiation,34 dilated cardiomyopathy,35 type 2 diabetes mellitus,36 obstructive sleep apnea37, etc. it was due to underlying disorders causing atherosclerosis. in the present study, of the 38 patients with cac, 12 (4.5%) were males and 26 (5.4%) were females. as in our study, in pornprasertsuk - damrongsri and thanakun16 and carter studies, the cac prevalence was not different between male and female population. tamura and bayram revealed that the cac incidence in female patients was approximately three times higher than the incidence in males. we suggest that all these different cac prevalences in female and male populations are probably due to the sample of the studies. commonly, cacs are formed at the bifurcation point of the vessels where turbulent flow is increased.22 in the majority of the reports in normal populations,15,16,32 the cacs were unilateral and located on the left side rather than the right side. in the current study, the most of the cacs were unilateral, but generally located on the right side. in another study, ohbe investigated the cac prevalence in the patients older than 80 years. it was found that the most of the cacs were located on the right side as in our study. they showed that cacs on the left side are less detected than those on the right side on prs. however, we think that these different cac localizations in the reports may be related to the sample of the studies. as for diseases and life style factors associated with cacs, hyperlipidemia, hypertension, cardiovascular diseases, smoking, obesity, renal disease,31 diabetes mellitus,36 obstructive sleep apnea syndrome,37 and periodontitis15 were reported. in the present study, in 38 patients with cacs, 12 subjects (31.58%) reported hyperlipidemia, 12 subjects (31.58%) reported hypertension, 7 subjects (18.4%) reported diabetes mellitus, and 6 subjects (15.8 %) reported smoking. pornprasertsuk - damrongsri investigated the archival records of 34 cac patients for the risk factors. it was found that all the patients with cac were associated with hypertension (52.9%), diabetes mellitus (29.4%), hyperlipidemia (14.7%), smoking (2.9%), and other risk factors such as renal disease, cardiovascular disease, etc.16 their findings were consistent with a previous study in terms of hypertension (77.8%) and diabetes mellitus (22.2%) reported by lewis carter and colleagues found that obesity (45.2%) was most strongly related to the occurrence of cac.32 we think that this relationship may be related to obesity associated co - morbidities including hypertension, hyperlipidemia, diabetes mellitus etc. rather than the disease. cohen revealed 1879 male patients over age 55 having standard prs with 71 (3.8%) showing cacs. in their study, 53.5% of those patients with cacs had a history of hypertension, 36.6% had hyperlipidemia, 22.5% had diabetes mellitus, and 54.9% were smokers.14 their morbidity rates were higher than the rates of our study as in tamura report. these may be due to smaller selected age groups of the both studies in comparison to cohen report. however, we think that all these differences in terms of risk factors may be due to ethnicity, dietary factors, lifestyle, and regional differences. as a result, cacs found as incidental findings on standard prs may be important markers for future coronary artery disease, strokes and death.14 pr should be carefully examined in the area of the carotid artery in not only patients with systemic disease such as diabetes, renal disease etc., but also asymptomatic patients.31 the cacs in the present study were detected by standard pr in 5.06% of the patients with dental problems. the cac incidence in female patients is approximately two times higher than the rate in male patients in our sample. in the current study, 31.58% of our patients with cacs had a history of hyperlipidemia, 31.58% had hypertension, 18.4% had diabetes mellitus, and 15.8% had smoking as consistent with the other previous reports. therefore, any patient with cacs should be evaluated in terms of risk factors for atherosclerosis. according to our knowledge, this study has the highest cacs prevalence in comparison to the other studies. also, this is the first study done in cappadocia region and investigating the risk factors related to cac in the turkish population. in conclusion, we believe that dentists caring for subjects with dental problems should carefully evaluate their prs for the evidence of cacs, and refer them for medical evaluation as indicated. | objectivesthe aim of this study is to determine retrospectively the presence of carotid artery calcifications (cacs) detected on panoramic radiographs (prs) in a group of turkish population. further, the relationships between cacs and gender, life style, and medical history were evaluated.methodsduring the years 2004 to 2006, a random sample of 1282 prs was collected from patients older than 40 years who were being treated by the school of dentistry, erciyes university. of these 1282 prs, 750 prs were included in this study. medical data was collected from the archival records of the dental school.resultsabout 38 (5.06%) cacs were found on the prs of 12 (4.5%) males and 26 (5.4%) females. the cac prevalence was not significantly different between the males and females (p=0.583). these calcifications were unilateral in 26 (68.4%) and bilateral in 12 (31.6%) subjects. of those in the positive group, there were 12 subjects (31.58%) with hyperlipidemia, 12 subjects (31.58%) with hypertension, 7 subjects (18.4%) with diabetes mellitus, 6 subjects (15.8%) with cardiovascular disease, and 6 subjects (15.8%) with smoking history.conclusionsthis study has the highest cacs prevalence in comparison to the other studies. therefore, dentists caring for subjects with dental problems should carefully evaluate their prs for the evidence of cacs, and refer them for medical evaluation as indicated. so, incidental findings could provide life - saving information. |
microglia are a unique cell population within the central nervous system (cns) as they descend from myeloid origin and are commonly recognized as the resident immune cells in the brain. they constitute about 1020% of glial cell population and are continuously monitoring the surrounding environment, acting as sensors of cns homeostasis [2, 3 ]. microglia rapidly change their morphology, gene expression, and functional performance upon any threat to tissue homeostasis, acquiring an activated phenotype, which is an adaptive process specific for each stimulus and cns region. accumulating evidence supports their involvement in synaptic development and remodeling, emphasizing that microglial functions are extended beyond immune - defense mechanisms. although microglial cells are first protectors of brain homeostasis, in case of prolonged or chronic stimulation they may become deleterious to the neuronal population. indeed, exacerbated stages of neurotoxicity can progress to pathological conditions including neurodegenerative disorders such as alzheimer 's disease or parkinson 's disease, where microglia actively contributes to neuroinflammation and neuronal degeneration. despite the diversity of microglia responses, their activation has been characterized by a recognized number of phenotypes classically described for macrophages. the surveillant / nonpolarized phenotype, also known as m0, describes alert but not activated microglia which are continuously screening the environment. the almost exclusive microglial fractalkine receptor, cx3c chemokine receptor 1 (cx3cr1), is highly expressed in m0 phenotype but, besides the maintenance of microglia surveillance, cx3cr1/fractalkine cross talk is also important in promoting migration of activated cells. the m1 phenotype or classical activated microglia can be induced by lipopolysaccharide (lps) or interferon - gamma (ifn-) with increased production of proinflammatory cytokines, chemokines, matrix metalloproteinases (mmps), as well as reactive oxygen and nitrosative species (ros and rns, resp.), among others. m1 microglia is associated with a neurotoxic phenotype with enhanced major histocompatibility complex class ii (mhc - ii), inducible nitric oxide synthase (inos / nos2), and interleukin-1 (il-1) markers. the alternative m2 phenotype that is related to the damage resolution may include several subtypes and is induced by il-4, il-10, and transforming growth factor- (tgf-). arginase 1 (arg1), found in inflammatory zone 1 (fizz1), and ym1 are recognized markers of m2 polarization. however, although the expression of these markers is used to differentiate microglia phenotypes, there is still much to learn about the determinants of microglia specific functional polarization. stimulation of the toll - like receptors (tlrs) signaling cascade is known to trigger the translocation of nuclear factor kappa b (nf-b) into the nucleus and the expression of proinflammatory genes, involving the activation of the inflammasome. inflammasome mediators comprise nod - like receptor family, pyrin domain containing 3 (nlrp3) and caspase-1 responsible for the cleavage of il-18 and il-1 proforms. recently, it was shown that the release of the alarmin high mobility group box 1 (hmgb1) is mediated by the nlrp3 inflammasome activation and constitutes a signal to activate microglia, though the regulation process is still unclear. together with the release of inflammatory mediators, microglia migration and phagocytosis. protein milk fat globule - egf factor 8 (mfg - e8) was shown to recognize phosphatidylserine (ps) in the apoptotic neurons, thus enabling microglial phagocytosis. the majority of these inflammatory pathways have been identified along diverse studies performed with macrophage / microglia primary cultures. due to such culture time consumption and reduced yield for the experimental assays, all the collected information on microglia inflammatory mediators is fragmented. therefore, we here embraced the assessment of an integrated study on the several inflammatory signaling pathways leading to the upregulation of microglia m1 polarization biomarkers and downregulation of those related to m2 subtypes in the microglial n9 cells upon lps treatment. n9 cells were generated by immortalization of embryonic primary cultures from the ventral mesencephalon and cerebral cortex of icr / cd1 mice using oncogenic murine retroviruses carrying the v - myc or the v - mil oncogenes of the avian retrovirus mh2. these cells have been preferentially used due to the simplicity and ease of manipulation, but only a limited number of inflammatory mediators and genes were identified in n9 cells, despite responding similarly to lps as primary microglial cells derived from the same mouse strain. micrornas (mirnas) have recently emerged as key regulators of inflammation and as mediators of macrophage / microglia polarization. actually the inflamma - mirs, mir-155, and mir-146a have been related to the microglia polarization into m1. while the first enhances the proinflammatory response, the second acts as a negative regulator being essential in halting excessive inflammation. oppositely, mir-124, mir-21, and mir-145 are associated with an anti - inflammatory response repressing the m1 phenotype polarization. however, it is accepted that such microglia phenotype regulation is quite complex and mir-146a, as an example, may be increased during m1 microglia polarization being also overexpressed in dystrophic / senescent macrophages, whereas mir-124 has been identified in surveillant microglia, as well as in m2 microglia. another issue that has been recently addressed is the particular importance of the exosomes for sustained inflammation. exosomes are small vesicles (~100 nm) formed through the endocytic process and released upon multivesicle bodies fusion with the plasma membrane [27, 28 ]. they have been associated with intercellular communication, even at long distances, by direct transfer of mrna, proteins, and mirnas, the last being essential for regulating gene expression in the recipient cells. since the pathways underlying the switch of microglia towards the m1 phenotype are not fully understood, we first characterized the polarization of n9 microglial cells into the m1 subtype upon lps exposure, based on macrophage / microglia m1 and m2 biomarkers, and consequent microglia innate functions, such as phagocytosis and chemotaxis. much attention has been lately given on microglia - dependent inflammasome activation [29, 30 ], but no data are available on lps - treated microglia, which is the reason why we assessed the inflammasome multiprotein complex in our model. once mirnas are emerging as potent fine - tuners of neuroinflammation and indicated to regulate the inflammatory response when transported in exosomes from primary bone marrow - derived dendritic cells, we decided to assess their representation in the lps - polarized cells and in their derived exosomes to extend our knowledge on such issue, still scarcely explored in microglia primary cultures and unknown in n9 cells. actually, exosomal mirnas are currently being extensively studied as biomarkers of disease and the understanding on how they are loaded into exosomes and delivered to specific recipient cells may help in developing therapeutic approaches to modulate innate cell function. here, we have further clarified microglia inflammatory mediators and targets that once modulated may restrict microglia activation in neurodegenerative disorders, like alzheimer 's disease and amyotrophic lateral sclerosis. n9 cell line was a gift from teresa pais (institute of molecular medicine, universidade de lisboa, portugal). cells (8.3 10 cells / cm) were plated on uncoated 12- or 6-well tissue culture plates (orange scientific, braine - l'alleud, belgium) in culture medium [rpmi media supplemented with fetal bovine serum (fbs) (10%) and l - glutamine (1%) and with the antibiotic penicillin / streptomycin (1%) ] and were grown to confluence before experiments. no bacterial contaminations were observed in any experiment. to induce n9 cells reactivity we used 300 ng / ml of lipopolysaccharide (lps, e. coli o111:b4, 437627, calbiochem, darmstadt, germany) diluted in basal media for 24 h, as described by cui and colleagues. phycoerythrin - conjugated annexin v (v - pe) and 7-aminoactinomycin - d (7-aad) mixture (guava nexin reagent, # 4500 - 0450, millipore, billerica, ma, usa) were used to determine the percentage of viable, early - apoptotic, and late - apoptotic / necrotic cells by flow cytometry. after incubation, adherent microglia were collected by trypsinization and added to the cells present in the incubation media. after centrifugation, the pellet of cells was resuspended in pbs containing 1% of bovine serum albumin (bsa), stained with guava nexin reagent according to manufacturer 's instruction, and analyzed on a guava easycyte 5ht flow cytometer (guava nexin software module, millipore), as usual in our lab. after incubation, cellular media were removed and cells were collected with trizol (life tecnologies, carlsbad, ca, usa) using a cell scrapper as implemented in the lab. total rna was then extracted from n9 cells using trizol reagent method according to manufacturer 's instructions and quantified using nanodrop nd-100 spectrophotometer (nanodrop technologies, wilmington, de, usa). conversion into cdna was performed with revertaid h minus first strand cdna synthesis kit (thermo scientific, waltham, ma, usa). quantitative rt - pcr (qrt - pcr) was performed by using -actin as an endogenous control to normalize the expression level. the sequences used for primers are represented in table s1 (supplementary data, in supplementary material available online at http://dx.doi.org/10.1155/2016/6986175). qrt - pcr was accomplished on a 7300 real - time pcr system (applied biosystems, life technologies) using a sybr green qpcr master mix (thermo scientific). the qrt - pcr was performed in 96-well plates with each sample performed in triplicate, and no - template control was included for each amplification. qrt - pcr was achieved under optimized conditions : 52c for 2 min followed by 95c for 10 min and finally 40 cycles at 95c for 0.15 min and 62c for 1 min. in order to verify the specificity of the amplification, conversion of cdna was achieved with the universal cdna synthesis kit (exiqon, vedbaek, denmark) as described by cardoso. the mircury lna universal rt mirna pcr system (exiqon) was used in combination with predesigned primers (exiqon), represented in table s1 (supplementary data), using snord110 as reference gene. the reaction conditions consisted of polymerase activation / denaturation and well - factor determination at 95c for 10 min, followed by 50 amplification cycles at 95c for 10 s and 60c for 1 min (ramp - rate 1.6/s). after incubation, cellular media were removed and cells collected with cell lysis buffer (cell signaling, beverly, ma, usa) plus 1 mm phenylmethylsulfonyl fluoride (pmsf, sigma) as usual in our lab. briefly, total cell extracts were lysed for 5 minutes on ice with shaking, collected with cell scrapper, and sonicated for 20 secs. the lysate was then centrifuged at 14,000 g for 10 min at 4c, and the supernatants were collected and stored at 80c. protein content in the extracellular media was obtained by precipitation using trichloroacetic acid in 10% (v / v) of acetone solution. after a centrifugation of 15,000 g for 10 min at 4c, the pellet was washed in acetone containing 10 mm dithiothreitol resuspended in lysis buffer and stored at 80c. protein concentration in total and nuclear extracts, as well as in extracellular medium, was determined using a protein assay kit (bio - rad, hercules, ca, usa) according to manufacturer 's specifications. then, equal amounts of protein were subject to sds - page and transferred to a nitrocellulose membrane. after blocking with 5% (w / v) nonfat milk solution, membranes were incubated with primary antibodies (supplementary data, table s2) diluted in 5% (w / v) bsa overnight at 4c, followed by the secondary antibodies goat anti - rabbit hrp - linked (1 : 5000, sc-2004, santa cruz biotechnology, ca, usa) and goat anti - mouse hrp - linked (1 : 5000, sc-2005, santa cruz biotechnology) diluted in blocking solution. chemiluminescence detection was performed by using lumiglo reagent (cell signaling) and bands were visualized in the chemidoc xrs system (bio - rad). the relative intensities of protein bands were analyzed using the image lab analysis software (bio - rad). for immunofluorescence detection, n9 cells were fixed with freshly prepared 4% (w / v) paraformaldehyde in pbs and a standard immunocytochemical technique was performed as previously indicated. briefly, cells were incubated overnight at 4c with the primary antibodies : rabbit anti - iba1 (1 : 250, 019 - 19741, wako, wako pure chemical industries ltd., osaka, japan), rabbit anti - nf-b (1 : 500 or 1 : 200 for nuclear extracts, sc-372, santa cruz biotechnology), and goat anti - ki-67 (1 : 50, santa cruz biotechnology, sc-7846). the secondary antibodies incubated for 2 h at room temperature were goat anti - rabbit alexa fluor 488, goat anti - rabbit alexa fluor 594, and rabbit anti - goat 594 (1 : 1000, invitrogen corporation, carlsbad, ca, usa). cell nuclei were stained with hoechst 33258 dye (blue, sigma - aldrich). fluorescence was visualized using an axiocam hr camera adapted to an axioscope a1 microscope (zeiss, germany). merged images of uv and fluorescence of ten random microscopic fields were acquired per sample by using zen 2012 (blue edition, zeiss) software. original magnifications used were 400 and 630x. for morphological characterization of n9 microglia, we used the particle measurement analysis in imagej (1.47v, nih, usa) to automatically measure the 2d area, perimeter, and feret 's diameter of single microglia cells after iba-1 immunostaining, which are considered valuable additional parameters to evaluate the shape of microglia. as indicated in figure s1, we observed that ramified n9 microglia presented lower number of ramifications in comparison to primary cultured microglia (fig. nevertheless, we were able to observe different n9 microglia morphologies that included round / oval shape (fig. s1c - d), and amoeboid shape, either completely devoid of ramifications or with thicker and shorter branches (fig. translocation of nf-b from the cytoplasm to the nucleus was determined by the quantification of the number of nf-b - positive nuclei and normalized to the total number of cells. for evaluation of the proliferation ability of microglia ki-67 is present in the nucleus during all phases of the cell cycle while being absent in the resting stage (g0). no levels were estimated by assessing the concentration of nitrites (no2), the stable end - product from no metabolism, in culture media by the griess method, as we published. briefly, extracellular media free from cellular debris were mixed with griess reagent in 96-well tissue culture plates for 10 min in the dark, at rt. two readings were performed for each sample. mmp-9 and mmp-2 activities were determined in the n9 extracellular media by performing a sds - page zymography in 0.1% gelatin-10% acrylamide gels, under nonreducing conditions, as previously described. after electrophoresis, the gels were washed for 1 h with 2.5% triton - x-100 in 50 mm tris ph 7.4 containing 5 mm cacl2 and 1 m zncl2, to remove sds and to renature the mmp species in the gel. to induce gelatin lysis, the gels were incubated at 37c in the developing buffer (50 mm tris ph 7.4, 5 mm cacl2, 1 m zncl2) overnight. for enzyme activity analysis, the gels were stained with 0.5% coomassie brilliant blue r-250 (sigma - aldrich) and destained in 30% ethanol/10% acetic acid / h2o (v / v). gelatinase activity, detected as a white band on a blue background, was measured using computerized image analysis (image lab, bio - rad). activity of caspase-1 was determined by a colorimetric method (calbiochem, darmstadt, germany) as published by us. briefly, cells were harvested, washed with ice - cold pbs, and lysed for 30 min on ice in the lysis buffer. the activity of caspase-1 was assessed in cell lysates by enzymatic cleavage of chromophore pna from the substrate, according to manufacturer 's instructions. the proteolytic reaction was carried out in protease assay buffer containing 2 mm ac - yvad - pna. following incubation of the reaction mixtures, the formation of pna was measured at = 405 nm with a reference filter of 620 nm. one reading was performed for each sample. to evaluate the phagocytic ability of n9 microglia, cells were incubated with 0.0025% (w / w) fluorescent latex beads, diameter 1 m, for 75 min at 37c and fixed with freshly prepared 4% (w / v) paraformaldehyde in pbs. n9 cells were immunostained with rabbit anti - iba1 (1 : 250, 019 - 19741, wako), and nuclei were counterstained with hoechst 33258 dye (blue). uv and fluorescence images of ten random microscopic fields (original magnification : 400x) were acquired per sample by using zen 2012 (blue edition, zeiss) software. total phagocytic cells and the number of ingested beads per cell were counted with imagej software to determine the percentage of phagocytic cells and the mean number of ingested beads per cell. cell migration assay was performed in a 48-well microchemotaxis chamber (boyden chamber, neuro probe, gaithersburg, md, usa) as we published. briefly, n9 cells were resuspended in serum - free rpmi and 50 l of cell suspension was placed into each top well (24 10 cells per well). the bottom wells were filled with serum - free rpmi (basal medium) alone, or with atp (10 m), and lps (300 ng / ml) diluted in basal medium. microglial cells were allowed to migrate for 6 h through a polycarbonate track - etch membrane with polyvinylpyrrolidone (pvp) (neuro probe) towards the solution in the bottom wells. cells were stained with 10% giemsa in pbs (w / v), freshly prepared and filtered. the number of total cells was counted in ten microscopic fields with imagej software (original magnification : 100x) acquired to observe the complete well using leica im50 software and leica dfc490 camera (leica microsystems, wetzlar, germany), adapted to an axioskope hbo50 microscope (zeiss). for each experiment, at least three wells per condition were acquired. exosomes were obtained from the extracellular media of n9 cells either from control or from lps - stimulated cells, according to wang. briefly, 20 ml of extracellular media was centrifuged at 1,000 g for 10 min to remove dead cells and debris followed by another centrifugation at 16,000 g for 60 min, to separate microvesicles (size ~1000 nm). the recovered supernatant was passed through a 0.2 m filter to remove suspended particles and this pellet fraction (exosomes, size ~100 nm) was resuspended in pbs and centrifuged again at 100,000 g for 120 min. the final pellet containing exosomes was resuspended in lysis buffer and rna inside exosomes was extracted using mircury isolation kit - cell (exiqon), according to manufacturer 's instructions. briefly, after lysis of the exosomes, the rna was absorbed to a silica matrix, washed with the recommended buffers, and eluted with 20 l of the supplied elution buffer by centrifugation. size measurements were made at 25c with a zetasizer nano s dls apparatus (malvern instruments, worcestershire, after the ultracentrifugation procedure abovementioned, each sample was diluted in pbs and was read three times in the zeta sizer nano s (zen 1600) to evaluate the diameter of the collected particles. a histogram of the percentage of particles with specific diameters was calculated using dts (nano) 7.03 software (malvern instruments). comparisons between lps - treated n9 cells and nontreated cells (control) in all experiments were made via two - tailed student 's t - test or unpaired t - test with welch 's correction, depending on whether variances were equal or different, respectively. comparison of more than two groups, namely, in the morphological characterization, chemotaxis assay, and phagocytosis tests, was done by one - way anova followed by multiple comparisons bonferroni post hoc correction using graphpad prism 5 (graphpad software, san diego, ca, usa). values of p < 0.05 were considered statistically significant and those of p < 0.01 and p < 0.001 highly significant. despite the great plasticity of microglial responses, the different subsets of microglia activation have been characterized by the expression of specific markers, as previously referred. moreover, in addition to the well - known proinflammatory response mediated by tlr / nf - kb pathway, microglia activation may also imply the alteration of the gene expression profile not only by inducing the transcription of specific genes but also by downregulating nonrequired functions. we have explored the mrna expression of m1 and m2 markers, as well as the fractalkine receptor cx3cr1 in n9 microglia exposed to lps, not fully documented in previous studies. as shown in figure 1, incubation of n9 microglia with lps led to increased expression of the m1-markers nos2 and mhc - ii, while promoting the downregulation of the m2-markers arg1 and fizz1 (figure 1(a)). expression of both mrna and protein levels of cx3cr1 were found diminished by lps exposure (figures 1(b) and 1(c), resp.), indicating a reduced prevalence of cells with surveillant / anti - inflammatory properties, thus favoring a major representation of m1 polarized microglial cells. although insufficient to characterize microglial functional behavior, these parameters are still useful to illustrate microglia activation. therefore, we have additionally performed a morphological characterization by immunocytochemistry using the microglia specific marker iba1, together with cell area, perimeter, and feret 's diameter. as depicted in figure 2, our results showed that n9 microglia change from a round / oval or ramified morphology to an amoeboid shape, presenting either a complete absence of ramifications or the presence of thicker and shorter branches, in about 75% of the cells (p < 0.001) incubated with lps (figures 2(a) and 2(b)). we have previously shown that reactive isolated primary microglial cultures also show a similar morphology. accordingly, area, perimeter, and feret 's diameter were increased in lps - treated cells (figures 2(c), 2(d) and 2(e), resp.). in order to evaluate cell density, we evaluated the cd11b expression and the number of cells presenting nuclear ki-67 expression. we observed an increased cd11b expression (figure 2(f)) and a higher number of ki-67-positive nuclei (figures 2(g) and 2(h)) in lps - stimulated cells as compared with control samples. now, considering the cellular viability of n9 microglia after lps exposure, we found that the number of viable cells was decreased (from 84% in control to 67% in lps - treated n9 cells, p < 0.01, table 1), as a consequence of the increased number of microglia showing early - apoptotic features. after confirming the typical features of microglia m1 polarization in n9 cells for that, we have performed a chemotaxis assay using the boyden chamber, and migration of lps - treated and nontreated microglia was tested towards well - known chemoattractants, such as atp (10 m) [3, 9 ] and lps (300 ng / ml). nontreated n9 cells were highly responsive to atp chemoattraction (~2-fold increase, p < 0.001) in comparison to those freely migrating to the basal medium and to the lps - treated cells that were revealed to become unresponsive (figure 3). to note, however, is that lps - treated cells showed the same migration ability as nontreated microglia towards the basal medium. lps revealed a lower chemoattractive capacity when compared to that of atp (p < 0.001) and, as observed for atp, the lps - treated cells also showed a reduced mobility as compared to cells that were not exposed to lps stimulus. when analyzing the phagocytic properties of microglia, essential for clearance of debris and elimination of pathogenic organisms, the treatment with lps reduced the number of cells showing no intracellular beads (p < 0.05), while increasing those with more than 6 ingested beads (p < 0.05) (figures 4(a) and 4(b)). in addition, we were able to observe, for the first time in this model, that 24 h incubation with lps induces the expression and release of mfg - e8 from n9 cells (~1.5- and ~2-fold, respectively, p < 0.01), as indicated by western blot analysis of total extracts and extracellular media (resp., figures 4(c) and 4(d)). we may then assume that lps - treated cells intensify their phagocytic ability as a defensive mechanism despite their increased immobility. by investigating the signaling pathway mediated by tlr / nf-b activation, we found that tlr4 was translocated to the membrane of microglial cells incubated with lps, as demonstrated by an increased expression of the glycosylated form (p < 0.01, figure 5(a)). we also noticed an increased expression of tlr2 (p < 0.05, figure 5(b)). consequently, nf-b was translocated into the nucleus, as demonstrated by the ~2-fold increase in protein expression in the nuclear fraction (p < 0.05, figure 5(c)) and by the elevated staining of lps - treated n9 microglia nuclei when compared to control samples (figures 5(d) and 5(e)). nf-b transactivation was also demonstrated in reactive microglia primary cultures and to be implicated in inflammasome activation [47, 48 ] that is associated with the maturation of the microglial proinflammatory cytokines il-1 and il-18 by caspase-1 [16, 49 ]. hence, the next step was to evaluate the cascade of such events in the n9 microglia exposed to lps. as depicted in figure 5, lps significantly enhanced the expression of nlrp3 inflammasome (figure 5(f), p < 0.001) as well as of il-1beta (figure 5(g), p < 0.05) and il-18 (figure 5(h), p < 0.05) in n9 cells. the activation of inflammasome was also observed by treating n9 cells, immortalized microglia, and cultured primary microglia (our unpublished data) with amyloid - beta peptide. moreover, the high caspase-1 activity we observed (figure 5(i), p < 0.01) further indicates an increased capacity to mediate the cleavage of il-1 and il-18 proforms. m1 polarized microglia is also related to the generation of other inflammatory mediators, such as ros and mmps [12, 13 ]. actually, we found elevated levels of mmp-9 (~3-fold, p < 0.01), but not of mmp-2 (figures 6(a) and 6(b), resp.), which may derive from the observed nf-b activation (figures 5(c)5(e)) demonstrated to be a regulator of mmp-9 gene expression, but not of mmp-2. our studies showed that the concentration of nitrites, indirectly indicating the level of no, was likewise markedly enhanced in the extracellular medium (figure 6(c)). proinflammatory effects of lps were shown to be enhanced by the endogenous danger signal molecule hmgb1 released by necrotic cells. the majority of the studies have reported hmgb1 effects on macrophages and microglia activation [18, 54 ], but only a few report its increased expression in activated microglia, both in the postischemic brain and in the reactive primary microglia cultures. in addition, we recently found more than a 2-fold increase in both gene and protein expression of hmgb1 in n9 cells treated with 1 m amyloid - beta peptide. therefore, we examined the pattern of cellular and extracellular distribution of hmgb1 in our inflammatory n9 cells. surprisingly, we observed a reduced hmgb1 protein expression in cell lysates of microglia activated by lps and in nuclear extracts (figures 6(d) and 6(e)). however, once hmgb1 was shown to be massively released into the extracellular environment in pathological conditions, we decided to evaluate its presence in cellular supernatants. in accordance with this, hmgb1 was found to accumulate in culture medium after incubating n9 microglial cells with lps for 24 h (~2-fold increase, p < 0.05), as depicted in figure 6(f). these results indicate that hmgb1 is rapidly released into the extracellular space after lps - induced microglial activation. to identify mirna subtypes subsequent to n9 cell polarization by lps we evaluated the expression of specific inflammatory mirnas associated with microglia activation, namely, mmu - mir-155 - 5p (mir-155), related to m1 phenotype, hsa - mir-146a-5p (mir-146a) linked to repair, and resolution and hsa - mir-124 - 3p (mir-124), expressed in surveillant and anti - inflammatory microglia. such inflamma - mirs were previously identified in reactive cultured microglia and both mir-155 and mir-146a found to be elevated in n9 cells upon treatment with amyloid - beta peptide. as displayed in figure 7, microglia stimulation with lps induced an elevated expression of mir-155 (~6-fold, p < 0.01) and of mir-146a (2-fold, p < 0.05), while promoting the downregulation of mir-124 expression (0.4-fold, p < 0.05). these data support the acquisition of a m1 phenotype in microglia activated by lps with the loss of their neuroprotective properties and sustained upregulation of proinflammatory features by the mir-155 regulation networks. intriguingly, the overexpression of mir-146a may constitute a mechanism of regulating the inflammatory response, exemplifying the complexity of the m1/m2/m0 landscape. in addition, we found that n9 cells were able to release exosomes of approximately 160 nm diameter, as determined by dls analysis (figure 7(b)). we observed that these extracellular vesicles carried the same mirnas of the m1 polarized cell, demonstrating that such exosomes recapitulate the mirna cargo of the cell of origin. moreover, since mir-124 was only detectable in nonstimulated n9 cells (control), we may hypothesize that mir-155 and mir-146a are the most implicated in promoting the phenotypic conversion of adjacent cells. in this study, we have profiled n9 microglia activation upon lps stimulation at cellular, functional, and molecular levels, by considering either gene or protein expression of inflammatory / anti - inflammatory associated markers. in addition, we not only characterized the different faces of microglial response associated with the m1 polarization but also explored the involvement of new inflammatory players. data support lps - induced microglia m1 phenotype with the activation of the inflammatory cascade mediated by tlr / nf-b signaling pathway in n9 cells. more interestingly, we provide new evidence indicating decreased migration ability but increased phagocytosis with the involvement of mfg - e8 production and release. in addition, our study is innovative in evidencing that lps triggers the upregulation of the nlrp3 inflammasome complex in n9 cells and leads hmgb1 release to the extracellular medium together with that of mmp-9. for the first time we obtained upregulation of mir-155 and mir-146, along with a reduced expression of mir-124 in the n9 cells treated with lps, as previously observed in macrophages / microglia m1 polarized cells, and we showed that a similar representative profile occurs in exosomes isolated from lps - treated n9 cells supernatants. n9 cell line has been widely used in the evaluation of microglial functions in different conditions, as an alternative to primary cell cultures, due to increased yield and homogeneity of cells in culture. more importantly, no differences were found between n9 cells and microglia primary cultures relative to the activation of inflammatory mediators by lps. previous separated studies evidenced an assembly of effects induced by lps that included nf-b activation, amoeboid morphology with process retraction [58, 59 ], release of proinflammatory mediators [4, 58 ], low migratory capacity, and increased phagocytic ability. nevertheless, there is still limited information concerning the activation pattern of these cells and the combined events implicated in the phenotypic transition towards m1 polarization, which are mandatory when intrinsic characteristics of microglia are to be explored and therapeutic agents to be tested. moreover, no inflammasome activated complex was ever described, nor were inflamma - mir profiling and exosome cargo identified. in addition, only our data report the increased expression of hmgb1 in amyloid - beta peptide - treated n9 cells, as well as its nucleocytoplasmic shuttling and further release in lps - treated cells, as we describe in this study. we first settled that our n9 microglia predominantly switched to the m1 subtype in the presence of lps, as described for macrophages and microglia primary cultures [12, 13 ]. using established markers that allow the differentiation between m1 and m2 activated cells (for review see), we observed that the m1-markers nos2 and mhc - ii were upregulated while the m2-markers arg1 and fizz1 were downregulated after lps exposure. in conformity, we also observed downregulation of cx3cr1, a condition identified in m1 monocyte - macrophages and in primary microglia exposed to lps. moreover, low cx3cr1 is associated with marked neuronal loss after systemic inflammation and facilitates sepsis - induced immunosuppression resulting from monocyte inability to recognize cx3cl1 and kill pathogenic microorganisms. therefore, the decrease of cx3cr1 in our model may relate to the persistent microglia activation. the increased number of amoeboid n9 microglia and the reduction of ramified cells are features of microglia activation and were observed after treatment with lps [58, 59 ]. increased proliferation rate of microglia by lps, as we obtained in n9 cells based on the nuclear appearance of the ki-67 marker and upregulation of cd11b expression, was previously noticed in bv2-stimulated microglia. nevertheless, in vivo data do not sustain the presence of proliferating microglia during systemic inflammation, though it was evidenced during ischemia. the ability of microglia to sense distant signals and be attracted to them, a function designated by chemotaxis, is orchestrated by multiple chemotactic compounds released at the site of damage, either by injured cells or by pathogenic organisms. as claimed by others, atp showed to be a chemotactic agent and promoted the migration of n9 microglia, a property that was however reduced after lps treatment, probably as a consequence of the diminished processes that compromise the migratory capacity towards a chemoattractant signal. indeed, cell migration to lesion sites is faster than morphological changes associated with microglia activation, in which purines such as atp can no longer attract and may even repel them. such alterations may relate to changing of surface markers such as p2y12 upon lps exposure. reduced ability to migrate towards lps was also a feature of our m1 polarized n9 cells, although there is some controversy on the ability of lps to induce or inhibit migration [45, 70, 71 ], since it may depend on lps concentration and on mediators released by the activated microglia near the site of injury. phagocytosis is another microglial function that is extremely important to their neuroprotective properties, required not only for synaptic plasticity but also for clearance of cellular debris and elimination of pathogenic organisms. our results indicate that lps increases n9 microglia phagocytosis, as previously described for lps - treated bv2 cells, as well as primary cultures of microglia and macrophages. in vivo studies showed that lps administration increases microglia phagocytosis of viable neurons during development, inflammation, and neuropathology, a property denominated as phagoptosis. a new finding was the increased expression of the phagocytosis - associated protein mfg - e8, together with its release, when the n9 cells were treated with lps. there are still controversial data concerning the protective / noxious role of mfg - e8. on one hand, mfg - e8 has been associated with microglia anti - inflammatory properties, as demonstrated by spittau., when the cells were stimulated by tgf-, in the mgf - e8 mice showing an increased proinflammatory response, as well as in the septic mouse presenting downregulation of mfg - e8 levels. on the other hand, liu and colleagues have demonstrated that mfg - e8 overexpression occurred concomitantly with tnf- and il-1 upregulation. thus, given the increased expression of intracellular and released mfg - e8 found in our model, we hypothesize that mfg - e8 upregulation is typical of m1 polarized microglia. considering the inflammatory signaling cascades, the activation of tlr4/2-nf-b pathway is consistent with the proinflammatory response triggered by lps [57, 58 ]. our data show for the first time that expression of nlrp3, il-1, and il-18 mrna increases by lps exposure and may relate to the activation of caspase-1. bauernfeind and colleagues proposed that nf-b induces mrna expression of nlrp3, which is further required for the formation of inflammasome complexes. others have reported the activation of nlrp3 complexes and recruitment of caspase-1, together with il-18/il-1 release, in primary microglia and in macrophages stimulated by infection - associated agents. our results are also consistent with works in the bv-2 cell line and in rat primary microglia reporting that microglia exposed to lps show increased generation of redox molecules (no) and inos activation [57, 58 ], as well as enhanced mmp-9 expression and activity. most interesting, tlr2-dependent no expression was shown to be necessary for microglial mmp-9 expression. although it has been shown that mmp-2 may be also involved in glial cell activation and our recent studies indicate increased release of mmp-2 into the extracellular media in microglia treated with amyloid - beta peptide (unpublished results), we did not observe any variation between lps - stimulated and nonstimulated cells (control) in terms of mmp-2 release. this difference between the results found for mmp-9 and mmp-2 may be explained by the existence of specific binding sites for nf-b in mmp-9, which are lacking in mmp-2 promoter region, as reported by fanjul - fernndez.. we next explored the expression of the alarmin hmgb1 in the context of inflammation in our culture model, since it has been described to be a signal released to the extracellular environment that leads to inflammatory mechanisms through the activation of rage and tlr2/tlr4 receptors. we are the first to report that the decrease in its nuclear and cytoplasmic content in n9 microglia after the lps stimulus is most likely due to its substantial release to the cell supernatants. actually, hmgb1 is released from the cells after translocation from the nucleus to the cytoplasm, indicating that secretion of hmgb1 may be associated with inflammasome complex activation. the influence of mirna in microglia - mediated immune response was recently reviewed and abnormal expression of inflamma - mirs showed them to contribute to chronic proinflammatory status and to be a significant mortality risk factor. mirnas are small noncoding rna molecules that are 1825 nucleotides in length involved in the regulation of gene expression. we found upregulation of mir-155 and mir-146, together with a reduced expression of mir-124, in n9 microglia upon lps exposure. this pattern corroborates the increased representation of polarized m1 microglial n9 by lps over the m2 polarization, as described by several authors [24, 36 ]. freilich and colleagues found a similar expression profile in primary cultured microglia upon a short - time incubation with lps (4 h). targets of mir-155 are the suppressor of cytokine signaling 1 (socs1), ccaat / enhancer - binding protein alpha (c / ebp), and smad2 [24, 36 ] which are important players in anti - inflammatory response. as such, increased expression of mir-155 potentiates inflammation and sustains microglia activation and resulting neurotoxicity. we have also demonstrated here that incubation with lps promotes upregulation of mir-146a in n9 microglia. it is possible that such effect results from the tlr2/tlr4 activation, as described for bv-2 and eoc 13.31 cell lines. others indicate that mir-146a regulates nf-b signaling pathway by directly targeting irak1 and tumor - necrosis - factor - receptor - associated factor 6 (traf6), proteins involved in the transduction pathway of nf-b transactivation by immune stimulation. however, in our model, the upregulation of mir-146a at 24 h incubation with lps was not able to suppress inflammatory response. this inability was similarly observed when 72 h treatment was assayed (data not shown). interestingly increased expression of mir-146a may be related to lps tolerance, previously observed in monocytes and suggested to act as a tuning mechanism to prevent an overstimulated inflammatory state. in what concerns mir-124, known to promote microglia quiescence, it was revealed to switch cell polarization from m1 to the m2 phenotype in various subsets of monocyte cells and microglia. this finding indicates that the decreased expression of mir-124 that we found in our model is consistent with the phenotype m1 preponderance. our data also indicate that the expression profile of inflamma - mirs in exosomes recapitulates the one found in the cells, which suggests that m1 polarized microglia is able to directly transport mirnas to an adjacent cell and modulate its phenotype, besides the release of soluble inflammatory signals. as a consequence, the proinflammatory environment observed in many neurotoxic situations may be sustained through the transfer of the microglia phenotype associated mirnas from cells into exosomes. overall, the present data integrate an ensemble of signaling cascades related to the m1 path activation of n9 microglial cells, together with innovative data pointing to inflammasome complex activation, downregulation of the neuronal fractalkine receptor cx3cr1, and reduction of mir-124 upon incubation with lps. new findings also include the lps - induced increase in the expression of mfg - e8, mir-155, and mir-146a, together with raised secretion of hmgb1 and mmp-9, as schematically represented in figure 8. our study firstly identified that the delivery of mir-155 from microglia to adjacent cells may be mediated by exosomes, as previously observed for dendritic cells in response to endotoxin. our model of lps - induced m1 polarization of n9 cells, by exploring new molecules and pathways implicated in such activation, enhanced our understanding on the neurodegenerative processes associated with microglia inflammation, while identifying promising biomarkers to be used in neurological disorders, in particular exosomes and their cargo in mir-155. finally, our study further suggests that targeting nlrp3 inflammasome, hmgb1 signaling, and mir-155 transfer to exosomes may be suitable therapeutic approach to restrain neuroinflammation in disorders whereby microglia activation has a critical role. | identification of mediators triggering microglia activation and transference of noncoding microrna (mirna) into exosomes are critical to dissect the mechanisms underlying neurodegeneration. we used lipopolysaccharide- (lps-) induced n9 microglia activation to explore new biomarkers / signaling pathways and to identify inflammatory mirna (inflamma - mir) in cells and their derived exosomes. upregulation of inos and mhc - ii (m1-markers) and downregulation of arginase 1, fizz1 (m2-markers), and cx3cr1 (m0/m2 polarization) confirmed the switch of n9 lps - treated cells into the m1 phenotype, as described for macrophages / microglia. cells showed increased proliferation, activated tlr4/tlr2/nf-b pathway, and enhanced phagocytosis, further corroborated by upregulated mfg - e8. we found nlrp3-inflammasome activation in these cells, probably accounting for the increased extracellular content of the cytokine hmgb1 and of the mmp-9 we have observed. we demonstrate for the first time that the inflamma - mir profiling (upregulated mir-155 and mir-146a plus downregulated mir-124) in m1 polarized n9 cells, noticed by others in activated macrophages / microglia, was replicated in their derived exosomes, likely regulating the inflammatory response of recipient cells and dissemination processes. data show that lps - treated n9 cells behave like m1 polarized microglia / macrophages, while providing new targets for drug discovery. in particular, the study yields novel insights into the exosomal circulating mirna during neuroinflammation important for emerging therapeutic approaches targeting microglia activation. |
dc are the professional antigen - presenting cells (apc) of the immune system that instruct and control the activation of b and t lymphocytes, the mediators of specific immunity. dc are highly mobile cells and by their sequential migration from peripheral tissues to lymphoid organs they serve as sentinels of the immune system. immature dc are very efficient in antigen uptake, mediated by high endocytotic activity and expression of an array of cell surface receptors capable of capturing antigens [34, 53 ]. inflammatory mediators and danger signals promote maturation and re - routing of dc to the secondary lymphoid organs [5, 43 ]. in the secondary lymphoid tissues, dc are mature and well equipped to attract, interact and activate naive t cells to initiate a primary immune response [1, 5 ]. dc are also able to directly activate nk cells and can produce large amounts of interferon upon encounter with viral pathogens, thus, providing a link between the adaptive and innate immune system. in murine tumor models, protective immunity as well as regression of established tumors have been observed after vaccination with dc loaded with tumor antigens [13, 44, 66 ]. their unique capacity to initiate and modulate immune responses is currently exploited by many groups, including ours, to fight infectious diseases and cancer. one aspect of dc biology that is rapidly evolving is the apparent diversity of dc - subsets. at least two distinct ontogenic pathways for dc development have been reported, the myeloid progenitor- and the lymphoid progenitor - derived dc. part of these different dc - subsets may also be explained by differences in the maturation stage of dc and the local cytokine environment. the geographical localization of the dc - subsets in secondary lymphoid tissues is distinct, myeloid derived dc mainly migrate to or reside in the marginal zone (a primary entry point for blood - born antigens), whereas the lymphoid dc mainly reside in the t - cell areas. this supports distinct functions for the dc - subsets, as shown in murine studies [5, 40 ]. it is now well appreciated that the dc subset, its maturation state and the microenvironment or type of pathogen a dc encounters in the periphery, determine the type of immune response that is induced, ranging from a th1 or th2 response to immune tolerance [38, 40, 51 ]. data are now accumulating that immature dc can induce tolerance and are able to induce regulatory t cells in vitro [35, 54 ] and in vivo. regulatory t cells are involved in the control of peripheral tolerance and the prevention of vigorous inflammatory reactions. these regulatory t cells affect immune responses at the level of antigen - presentation and during the effector phase of t cells at the site of the tumor. although the exact mechanisms by which regulatory t cells exert their suppressive functions are not yet elucidated, direct cell our data on vaccination of melanoma patients also demonstrate that mature dc, but not immature dc, induce strong immune responses in vivo. another aspect in the evolving field of immunotherapy is the re - acknowledgement of the role of the innate immune system. the eradication of a malignancy is the result of a concerted action of adaptive and innate immunity, in which natural killer (nk) cells and natural killer t (nkt) cells are important effector cells. next to the direct cytotoxic effect on tumor cells, nk cells produce type i interferons that contribute to a great extent to a proinflammatory microenvironment. clinical studies on adoptive nk - cell immunotherapy have shown that nk cells can target human tumors [45, 52 ]. over 60 different clinical studies have been carried out between 1996 and 2004, applying tumor antigen - loaded dc - based vaccines. the vast majority of these studies have been performed in melanoma patients [27, 49 ]. in our studies, as well as in other groups, immunological and, notably long - lasting, clinical responses have consistently been observed following cellular therapy [6, 27, 46 ]. in several patients these clinical responses coincide with the induction of specific cytotoxic t - cell responses. we have explored vaccination of cancer patients with monocyte - derived dc loaded with peptides derived from tumor - associated antigens. in our current culture protocol, we routinely generate large amounts of clinical grade mature and immature dc. the first dc trial at our institution has been initiated in 1998. herein, the safety of dc - based vaccines and the efficacy of immature dc versus mature dc was studied. hla - a2.1 +, gp100 +, tyrosinase+ metastatic melanoma patients were treated with peptide - pulsed immature or mature dc. as peptides we used two hla - a2.1 restricted gp100 peptides (either native or modified peptides to improve their hla - a2.1 binding affinity) [3, 4 ] and a tyrosinase peptide. all dc vaccines were co - loaded with the foreign protein klh (calbiochem, darmstadt, germany) that serves as a control for immune competence and stimulation of a t - helper response. vaccinations were given 3 times with 2-week intervals, followed by injections with the peptides alone. immune monitoring consisted of (1) dth responses with pulsed dc and unpulsed dc, (2) elispot - assays [31, 55 ] and (3) tetramer assays [2, 22, 30 ]. in addition to peripheral blood, immune monitoring was also performed using biopsies taken from dth sites (see later). the results of the first clinical trial have been published, and unequivocally demonstrated that mature but not immature dc are capable of inducing potent anti - klh - specific t - cell, and b - cell responses. clinical results demonstrated that 3/20 objective remissions were observed in stage iv melanoma patients vaccinated with mature dc. in this group 10 patients were vaccinated with mature dc, of these patients 1 was not evaluable because of detoriating condition and of the remaining 9 patients, 3 showed stable disease > 4 months (respectively, 4.5, 7.5 and 22) 1 patient showed a mixed response and 1 patient achieved a partial response with complete remission after surgical intervention, that now lasts > 7 years. all patients in this study were melanoma patients with metastatic disease (m1c, 1 patient m1a) in who performance status 0. moreover, clinical results correlated with the presence of vaccine - induced immune responses against the tumor peptides (see later). to date, > 200 melanoma patients have been vaccinated in our ongoing dc - trials, we observed no clinical benefit from vaccinations in patients with high - tumor load (as judged by the clinician), elevated serum ldh, brain metastases or rapid progressive disease. therefore, we excluded these patients, with a life expectancy less than 3 months, in ongoing studies. while on the down side the vaccine is not yet very effective, with an objective clinical response rate (i.e. > 1 year sd or better, stage iv melanoma patients) of approximately 1015%, the positive message is that we clearly find t cell - mediated immunological responses : 60% in patients with regional lymph node metastasis and 30% in patients with metastatic disease. nevertheless, a number of variables need to be evaluated and controlled to further improve clinical outcome in cellular therapies, among these are generation of dc, use of different dc - subsets, route of administration, optimal activation stimuli for dc, antigen loading of dendritic cells, selection of tumor - derived antigens and so on. these variables are in ongoing debate, but one can conclude that the full potential of dc - based cellular therapy has not yet fully been exploited. however, the current consensus is to continue cellular therapy in well - designed small trials that meet a standardized list of quality criteria. this consensus list should at least describe quality - control criteria for ex vivo generated dc, patient characteristics, trial design including the different variables that are investigated, and tests for clinical and immunological responses [27, 33 ]. significant progress in cellular therapy against cancer, including dc vaccination, is only to be expected by careful immune monitoring studies in order to obtain detailed insight of the underlying (pathological) physiological processes that determine the success or failure of treatment. different compartments and modalities are considered to monitor induced immune responses ; e.g. accuracy of delivery, immune responses in peripheral blood, tumor and delayed type hypersensitivity (dth) test biopsies, and clinical evaluation. recently, it was shown that the modality of vaccination with a tumor - specific antigen influences the differentiation pathway of the anti - vaccine cd8 t cells, which may have an effect on their capacity to trigger a tumor rejection response. observed that patients with a high - baseline level of melanoma antigen - specific immunity more often show an immune response to the vaccine. furthermore, they show that patients who survived longer are those who showed immune response against two melanoma antigens presented on the dc vaccine. although sometimes correlations between tumor regression and t - cell responses are observed [25, 41 ], the immunological studies performed so far are too diverse in their setup to pool them in a meta - analysis. for example, an intact and proper functioning immune system seems to have a higher potential to react on immune therapy. from our immune monitoring data, mentioned below, we might not only conclude that the presence of tetramer - specific t cells is correlated with an improved progression free survival. another conclusion should be that in the end - stage melanoma patients these tetramer - specific t cells are less frequently induced (8 of 26 patients) than in melanoma patients with regional lymph node metastasis (24 of 31 patients). secondly, upon induction of tumor antigen - specific t cells, the next hurdle to take is the local immune suppressive environment created by the tumor. in the end - stage melanoma patients, we have seen that in some patients tetramer - specific t cells are present after dc vaccination, but still experience progression. it became clear that these tetramer - specific t cells did not produce interferon- nor showed cytotoxic activity upon tumor challenge. apparently, these effector cells were not capable of breaking the local suppressive tumor - environment. we might take better advantage of the unique capacity of dc to direct the immune response by exploiting dc - based cellular therapy earlier in the disease course. it has been demonstrated that already in sentinel nodes melanoma - specific t cells are present, together with antigen - presenting cells. in this window between primary tumor and metastasis it might be at this turning point in the development of melanoma, that ex vivo generated dc can assist the immune system. for dc to induce potent immune responses their migration towards lymph nodes is essential. in mice, we have demonstrated that major differences can be found in numbers of migrating dc depending on the route of administration (subcutaneous gave the best results) and the maturation state (mature gave the best results). with respect to the latter we were able to confirm these data in stage iii melanoma patients with lymph node metastases who were scheduled for radical lymph node resection. during the first vaccination these patients received an injection of indium - labeled mature or immature dc to allow scintigraphic imaging to study in vivo migration. regardless of the route of administration (intradermal or intranodal) mature dc were more efficient than immature dc in reaching the draining lymph node in vivo. the results described earlier were obtained by our developed method of radioactive labeling of dc (fig. 1) [18, 23 ]. dc have therefore been labeled with radionuclides for scintigraphic imaging of cell trafficking, which is until to date the only fda - approved clinical cellular imaging modality [18, 42 ]. a major drawback of scintigraphy, however, is the lack of anatomical detail allowing only gross anatomical determination of migration between lns without the ability to assess the intranodal distribution pattern of dc within each ln. furthermore, due to its low spatial distribution, accurate delivery of cells which may be essential for subsequent migration into nearby lymph nodes can not be properly evaluated using scintigrapy. in contrast, mr imaging is well suited to obtain 3d whole body high - resolution images and is widely used in clinical practice. the currently most sensitive markers to label cells for mr detection are (ultrasmall) superparamagnetic iron oxide [(u)spio ] particles. we took advantage of the fact that dc naturally endocytose clinically applied, fda - approved spio - labels in significant amounts, obviating these concerns. this provided us with the opportunity to label cells with high efficiency without affecting their function and use these cells in humans.fig. 1monitoring the accuracy of delivery of spio - labeled cells using mr imaging and scintigraphy. monocytes are obtained by cytopheresis from stage iii melanoma patients (a), they are cultured and labeled with spio particles and indium (b). the cells are then injected intranodally into the lymph node basin that is to be resected and their biodistribution is monitored in vivo by scintigraphy (c) and mri (d). the lymph node basin is resected (e) and separate lymph nodes are visualized with high - resolution mri at 7 tesla (f) and histology (g) monitoring the accuracy of delivery of spio - labeled cells using mr imaging and scintigraphy. monocytes are obtained by cytopheresis from stage iii melanoma patients (a), they are cultured and labeled with spio particles and indium (b). the cells are then injected intranodally into the lymph node basin that is to be resected and their biodistribution is monitored in vivo by scintigraphy (c) and mri (d). the lymph node basin is resected (e) and separate lymph nodes are visualized with high - resolution mri at 7 tesla (f) and histology (g) we investigated the biodistribution of these spio - prelabeled dc applied as cancer vaccines in melanoma patients using mr imaging. in our dc vaccination protocols, in vitro generated dc loaded with tumor - derived antigenic peptides were administered to stage iii melanoma patients as outlined in fig. 1 [18, 19 ]. dc were labeled with in - oxine and spio (endorem) separately and co - injected in ln in the lymph node basin to be resected. this provided the unique opportunity to not only obtain mr scans at 3 tesla (t) before surgery but also to generate high - resolution mr images at 7 t of individual resected lns, and to correlate the results with scintigraphy and (immunology) histopathology. dc were correctly injected into the ln, despite ultrasound guidance of the injection needle by a highly experienced radiologist. subsequent migration could be observed only when dc were correctly injected into the lymph node, demonstrating not only the importance of accurate delivery but also of careful monitoring of cell tracking in cellular therapy. inadequate delivery may be an important reason why only a limited proportion of patients respond in ongoing clinical trials using dc vaccines. we found that the accuracy of mr imaging to visualize truly dc - positive lns was significantly better than scintigraphy. these findings illustrate the power of additional anatomical information, which can also be of value for other fields of biomedical research we observed immunohistologically that the spio - labeled dc that do migrate enter the lymph nodes via the sinuses and reach the t - cell areas where the actual dc we were able to demonstrate that intranodally injected spio - labeled dc, electroporated with rna encoding the tumor antigen gp100, express the gp100 protein. from resected lymph nodes rosettes, containing spio - labeled dc surrounded by enlarged and activated t cells, immune monitoring is most straightforward after vaccination with defined antigens, however, responses have also been detected after lysate or total rna - loaded dc vaccines. fortunately, many novel tools are now available to detect immune responses against known and unknown tumor antigens, including mhc - tetramers, eli - spot assays and cytokine release / catch assays [2, 22, 31, 55 ]. we developed a novel approach to efficiently monitor dc vaccine related t - cell responses in vaccinated patients using biopsies derived from dth sites. the results of this monitoring method correlated with the clinical outcome in stage iii and iv melanoma patients. dth challenges consisting of peptide - loaded dc plus or minus klh, dc loaded with klh, and unloaded dc revealed that essentially all patients mounted a positive dth response with indurations up to 33 mm. as both unloaded dc and dc loaded with klh and/or peptides were positive, indurations at the dth site were not predictive of vaccine - related t - cell responses in our setting. however, as no dth was detected after the first intradermal injection of the vaccine, the occurrence of a positive dth reaction should be directly related to the vaccination. the reason for the dth response to unloaded dc is not clear but could be explained by the vast amount of chemokines produced by mature dc. punch biopsies (6 mm) were taken from positive dth sites and divided in half. one part was used for histochemistry and the other part was used to isolate dth - infiltrating leukocytes (dil). immune staining showed clusters of cd2 + and cd3 + infiltrating cells of which 5070% were cd4 + and 5030% were cd8 + t cells. dil were generated by cutting the biopsies in pieces and culturing of the outgrowing cells for 23 weeks in the presence of low dose il-2 (100 u / ml) without restimulation. interestingly, dil specific for klh could easily be found in biopsies from klh - pulsed dc, not in dil from peptide or unpulsed dth biopsies. moreover, in 11 (6 stage iii, 5 stage iv) of 22 patients tested, gp100/tyr tetramer - positive t - cell populations were readily detected. in 5 additional patients, antigen - specific cytotoxic t cells in dil cultures no tetramer - positive t cells were detected in dth biopsies injected with unloaded dc or klh - loaded dc. strikingly, in 6 of 7 patients in whom no tetramer - positive cells were found in freshly isolated pbmc, significant numbers (up to 45%) of tetramer - positive t cells were present in their cultured dth biopsies taken at the same time point. cytokine production and cytotoxicity of dil upon co - culture with the appropriate target cells were fully correlated with the specificity in the tetramer analysis. moreover, dth reactions induced with dc pulsed with the gp100 peptides accumulated gp100-specific t cells and not tyrosinase and vice versa (fig. 2). finally, in situ tetramer staining on cryo - sections revealed that gp100/tyr - specific tetramer - positive cells were specifically present in the infiltrating t - cell clusters. collectively, these data not only indicate that significant numbers of tetramer - positive t cells accumulate in the dth site but also demonstrated that these t cells specifically produced cytokines (fig. 2) and/or are cytotoxic for tumor antigen expressing target cells (data not shown).fig. 2specificity in dth - infiltrated leukocyte (dil) cultures derived from patients vaccinated with peptide - loaded dc. a in dil cultured from a dth performed with dc loaded with gp100 and klh only t cells positive for the gp100 tetramers were observed. tyrosinase tetramer - positive cells were observed in the dil derived from a dth induced with tyrosinase peptide - loaded dc. b dil derived from a dth site induced by dc loaded with gp100 and klh did not produce cytokines in response to the hla - a2.1-positive melanoma cell line blm transfected with control antigen g250 (a) whereas blm transfected with gp100 was recognized (b). the dil culture also recognized an hla - a2.1-positive melanoma cell line expressing both gp100 and tyrosinase (c) specificity in dth - infiltrated leukocyte (dil) cultures derived from patients vaccinated with peptide - loaded dc. a in dil cultured from a dth performed with dc loaded with gp100 and klh only t cells positive for the gp100 tetramers were observed. tyrosinase tetramer - positive cells were observed in the dil derived from a dth induced with tyrosinase peptide - loaded dc. b dil derived from a dth site induced by dc loaded with gp100 and klh did not produce cytokines in response to the hla - a2.1-positive melanoma cell line blm transfected with control antigen g250 (a) whereas blm transfected with gp100 was recognized (b). the dil culture also recognized an hla - a2.1-positive melanoma cell line expressing both gp100 and tyrosinase (c) next, we compared the clinical and immunological data of 26 stage iv melanoma patients (fig. 3). patients had documented progressive disease within 2 months before study entry, serum lactate dehydrogenase 2 the upper limit of normal, no prior chemotherapy or immunotherapy within 3 months before study entry, and no residual toxicity from prior treatments. of these patients, 15 patients had progressive disease (pd), 9 patients had stable disease with > 4 months duration (sd), and 2 patients, one with multiple liver metastases at time of inclusion, are in complete remission (cr). no tumor - reactive dil were found in 13 of the 15 patients with pd. of the 9 patients with sd, 4 patients with specific t cells had a progression free survival of > 42, 22, 12, and 4.5 months (median 12 months). in the 5 patients with sd without tumor - reactive dil the median progression free survival was 6 months (range 114.5). both patients in cr (> 60 and > 42 months) had tumor - specific t cells. although the number of patients in this study is limited, a statistically significant (p = 0.0012) correlation was observed between the presence of tumor - specific t - cell reactivity and progression free survival. 3presence of tetramer - specific t cells highly correlates with progression free survival in melanoma patients. correlation between the presence of specific t cells and clinical outcome is shown in this plot comparing the progression free survival of stage iv melanoma patients with (closed line) and without (hatched line) tumor - specific t cells in their dth - infiltrated lymphocytes presence of tetramer - specific t cells highly correlates with progression free survival in melanoma patients. correlation between the presence of specific t cells and clinical outcome is shown in this plot comparing the progression free survival of stage iv melanoma patients with (closed line) and without (hatched line) tumor - specific t cells in their dth - infiltrated lymphocytes besides the production of highly reproducible gmp quality controlled batches of dc vaccines, in vitro and in vivo tools to analyze b and t - cell responses are developed and injected dc can now be visualized in the patient by advanced imaging technology. another major breakthrough is the application of rna transfected dc that express complete tumor antigens. this has now proven to be effective and safe in patients and, in comparison to gene therapy, rna transfection is much more straight forward. cellular therapy with dendritic cells is still in its infancy, but a number of variables are recognized that can contribute to exploit its full potential. in particular, monocyte - derived dc may not seem optimally equipped for their task in vivo. in this context, rna technology is a promising new tool to achieve temporarily expression or suppression of specific proteins to optimize dc function. recent findings have shown that dc transfected with rna encoding the full - length tumor antigens express the corresponding protein in vivo for a prolonged period of time. moreover, these rna transfected dc are able to induce anti - tumor responses in patients. but one can think of a broad range of applications of this technology to improve the functional capabilities of monocyte - derived dendritic cells. during our investigations we observed that the majority of injected dc die early by apoptosis and necrosis. after injection the cells encounter hypoxic conditions and it is known that hypoxia inhibits migration of dc, likely because it blocks the production of metalloproteases. similarly, decoy receptor 3 was shown to be upregulated by dc that propagates apoptotic signals. secondly, migration of current monocyte - derived dc in vivo is poor, their migration may be impaired due to limited chemokine receptor and cell adhesion receptor functioning. by exploiting rna technology similarly, induced production of gm - csf and il-15 might directly or indirectly enhance dc migration. next, rna technology can be exploited to improve dc maturation and t - cell stimulation. toll - like receptors have been shown to be of key importance in dc maturation and subsequent induction of immunity through the upregulation of cytokines / chemokines and co - stimulatory molecules. to enhance dc maturation dc might be transfected with rna encoding constitutively active tlrs or rnas encoding co - stimulatory molecules, like cd70 and cd40l, can be introduced. expression of cd40l in dc has previously been reported to enhance the magnitude of cd4 + and cd8 + t - cell responses in preclinical models [21, 28 ]. recently, cd70 has emerged as a key molecule for priming of cd8 + t - cell responses. rna interference to optimize t - cell stimulation by ex vivo generated dc by another means is to induce expression of pro - inflammatory cytokines like interleukin-12 and type i interferons. aside expression of activatory molecules in dc, it is becoming more and more evident that down regulatory mechanisms are in place that limit the dc s potential as a vaccine adjuvant. recent murine data have demonstrated that socs1 (suppressor of cytokine signaling 1) expression restricts the dendritic cells ability to break tolerance and induce antitumor immunity [24, 56 ]. we have recently demonstrated that upon human dc maturation socs1 as well as socs3 are also rapidly upregulated. therefore, silencing of inhibitory molecules like socs 1 and il-10 by rna interference might be another means to improve human dc - based cancer vaccines. furthermore, one of the most potent factors limiting vaccine efficacy is the immune suppressive activity of the regulatory t cell (treg). remarkably, several reports indicate the rapid expansion of treg following immunotherapy, including following dc vaccination. another treg stimulatory molecule / pathway in dc as a candidate to silence concerns the enzyme indoleamine-2,3-dioxygenase (ido). ido1 appears most crucial for tryptophan catabolism and immune suppression [32, 50 ]. direct targeting of antigens to dc surface receptors in vivo might replace laborious and expensive ex vivo culturing, and facilitate large - scale application of dc - based vaccination therapies. a major advantage of in vivo targeting strategies is that they can be produced in bulk quantities, whereas vaccines based on dc loaded with antigens ex vivo require tailor - made procedures for each individual. in addition, the opportunity to target natural dc - subsets and at multiple sites in vivo might be preferable above loading more artificial ex vivo cultured dc. many of the receptors that are studied in targeting strategies belong to the c - type lectin receptor (clr) family. the clrs are a family of calcium - dependent lectins that share primary structural homology in their carbohydrate domain. through this domain, clrs bind to specific self or non - self sugar residues and are implicated in antigen capture and endocytosis. in our targeting studies we mainly investigated the targeting of dc - sign. dc - sign is predominantly expressed on immature dc and at lower levels on mature dc and macrophages [9, 29, 58 ]. by cloning the hypervariable domains of a mouse antibody specific for human dc - sign into human framework regions we demonstrated that this antibody efficiently targets myeloid apc in vivo and reached saturation with one single dose. the binding of the humanized antibody to dc - sign showed high affinity and facilitated endocytosis. furthermore, targeted delivery to human monocyte - derived dc of a model antigen conjugated to the humanized dc - sign - specific antibody leads to presentation of the antigen by mhc class i and ii molecules and elicits both naive and memory t - cell responses in vitro. the clr targeting strategies that are most likely to enter the clinic in the near future target dc - sign, cd205 (dec205) and the mannose receptor. of these, dc - sign seems the most dc / macrophage lineage - specific receptor, which might be advantageous since the targeting vector will not be scavenged by other cell types that could result in lower targeting efficiencies and undesirable side - effects. the expression of cd205 for example is in humans less restricted than in mice. although human cd205 expression levels are highest in mature dc, cd205 is also expressed by b cells, t cells, monocytes, macrophages and nk cells. cd205 however seems to be more potent in mediating cross - presentation in vitro compared to the other two receptors. furthermore, due to lack of direct control in these targeting strategies, the duration and stability of the vaccine following administration will be difficult to determine. it has proven to be feasible, non - toxic and effective in some cancer patients, particularly if the dc are appropriately matured and activated. one of the concerns related to ex vivo generated dc is how to ensure effective migration to the t - cell areas in the lymph node. in this context, we are pursuing the enhancement of migration of ex vivo generated dc by preconditioning the skin with inflammatory cytokines. the recent application of rna technology in cellular therapy has paved the way to the next generation of dendritic cell - based therapies. different aspects of dc biology can now be optimized to enhance immunological and clinical responses. one can think of exploiting ex vivo generated dc equipped with enhanced expression of chemokine receptors to locate lymph nodes, silenced apoptotic pathways to increase longevity and upregulated production of pro - inflammatory cytokines to skew naive t cells. these multiple approaches need to be investigated in small two - armed principle of concept trials with thorough immune monitoring, in order to increase the clinical efficacy of dc - based cancer vaccines. a second promising approach that circumvents many of the posed hurdles with ex vivo targeting studies using members of the clr family have paved the way to clinical studies. | we exploited dendritic cells (dc) to vaccinate melanoma patients. we recently demonstrated a statistical significant correlation between favorable clinical outcome and the presence of vaccine - related tumor antigen - specific t cells in delayed type hypersensitivity (dth) skin biopsies. however, favorable clinical outcome is only observed in a minority of the treated patients. therefore, it is obvious that current dc - based protocols need to be improved. for this reason, we study in small proof of principle trials the fate, interactions and effectiveness of the injected dc. |
gastrointestinal bleeding (gib) is a well - described complication of the left ventricular assist device (lvad) placement and has been reported to occur in 1940% of patients with the heartmate ii device. the mechanism of gib in these patients may be secondary to alterations in vascular endothelial physiology, hemodynamic alterations, hematologic imbalances, coagulopathy, acquired von willebrand disease, and angiodysplastic lesions. the patient had a heartmate ii lvad placed 3 years prior to presentation for medically refractory heart failure. he presented to the emergency department with light - headedness and hematochezia for several days. his inr was 2.8, creatinine was 2.3 mg / dl, and hemoglobin was 10.4 from baseline of 12 to 13 g / dl. he underwent esophagogastroduodenoscopy revealing a gastric ulcer with a clean base with no evidence of active bleeding. a colonoscopy revealed a likely malignant tumor in the cecum, diverticulosis, and nonbleeding colonic angiodysplastic lesions [figure 1 ]. the cecal mass was biopsied ; it appeared to be actively bleeding and uncontrollable endoscopically. colonoscopic image of apparent cecal mass with surrounding blood he was taken emergently to the operating room. a midline laparotomy was undertaken and he was found to have a cecal mass that was perforated into a retroperitoneal abscess. the right colon was mobilized to the hepatic flexure and the abscess cavity was debrided. a right colectomy was performed with a stapled side - to - side ileocolonic anastomosis. a drain was placed in the abscess cavity, fascia was closed, and the skin and subcutaneous tissues were packed with gauze. it revealed a transmural defect of 1.0 cm 0.5 cm with organizing hematoma and acute on chronic inflammation. the patient 's postoperative course was complicated by prolonged ileus necessitating total parenteral nutrition and pelvic abscess that required percutaneous drain placement. the patient 's postoperative complications eventually resolved, and he was discharged to home with home health. gib is more common in lvad patients than patients with mechanical valves on anticoagulation, showing that lvad physiology is a major factor. it is difficult to determine the risk associated with warfarin, since inr is variable in different studies and aspirin is routinely used. causes of gib in a meta - analysis of 136 patients showed angiodysplasia (29%), gastritis (22%), peptic ulcer disease (13%), diverticular bleeding (6%), colonic polyps (5%), colitis (3%), and unknown or other causes (22%). location of bleeding by pooled event rates in this study was 48% for upper gib, 22% for lower gib, 15% for small intestinal bleeding, and 19% was unable to be localized or not evaluated. to our knowledge, this is the first report of a gib masquerading as a colonic malignancy in a patient with an lvad. there has been a shift from pulsatile to continuous flow pumps such as the heartmate ii. continuous flow pumps have shown improved durability, decreased thromboembolic events, and improved survival at the cost of increased incidence of gib. found that history of previous gib was independently associated with gib with lvad placement, while a meta - analysis of 1839 lvad patients found that older age and elevated creatinine were associated with gib whereas prior history of gib or differences in lvad settings were not associated with differences. when treating the gib is a cessation of anticoagulants, correction of underlying coagulopathy, resuscitation, and acid suppression. capsule endoscopy or push enteroscopy may be used to help with localization in difficult cases. potential therapeutic options include endoscopic treatments, embolization, and surgical intervention, when less invasive means prove to be unsuccessful. octreotide has been tried, but there is no strong evidence to support its routine use. depending on the severity of the gib, lesion, and treatment, inr goal may be lowered to reduce the risk of future events or anticoagulation may even be withheld when necessary. there is a theoretical higher risk of thromboembolic events when anticoagulation is reduced. in a study by morgan., patients with an episode of gib transitioned to lower dose warfarin (inr 1.52.0) and aspirin (n = 8) or with aspirin only (n = 5) therapy had no thromboembolic events. previous gib, advanced age, continuous flow lvads, and renal failure are the risk factors. treatment includes reversal of anticoagulation, resuscitation, localization, endoscopy, and surgery, if needed. | there are many complications associated with the left ventricular assist devices (lvads), including gastrointestinal bleeding (gib). we present a case of a pseudo colonic mass visualized on colonoscopy during workup for gib in an lvad patient necessitating a right colectomy with final pathology negative for malignancy. a review of the literature in regards to the pathology, diagnosis, and treatment of this interesting condition is included. |
acute coronary syndrome (acs) represents one of the most common causes of death worldwide. several practice guidelines have been developed in europe and north america to improve outcome of acs patients through implementation of the recommendations into clinical practice. it is well know that there is wide gap between guidelines and implementation in real practice as was demonstrated in registry findings mainly conducted in the developed world. a prospective observational acute coronary syndrome (renasica ii) registry conducted by the mexican cardiology society from december 2002 to november 2003. the main objective was to provide insights into risk factors and clinical characteristics, use of diagnostic resources, risk stratification, acute treatments, and hospital outcomes in patients hospitalized with acs. patients were enrolled at 60 hospitals (48% public health system hospitals, 39% private hospitals, and 12% teaching hospitals from other health systems). almost half (48%) of the hospitals were enrolled in mexico city. tertiary - care hospitals (35%) with access to coronary angiography, percutaneous coronary angioplasty and coronary artery bypass grafting (cabg) enrolled 90% of the patients. patients with characteristics of stemi on electrocardiogram (ecg) and who presented within 24 hours from symptoms ' onset were eligible for enrollment. the diagnosis of stemi was confirmed by the presence of biomarkers of myocardial necrosis and characteristic evolving changes on the ecg. in - hospital outcome was analyzed through major adverse cardiac events, including death, recurrent ischemia, acute mi, re - infarction, shock and stroke. 502 patients were excluded due to unspecified chest pain. of the remaining 8098 patients, 4555 (56.3%) the most prevalent risk factors were smoking (66%), hypertension (htn) (50%), diabetes mellitus (dm) (43%), and hypercholesterolemia (26%). a history of previous mi was present in 23%. on admission 85% of patients had typical chest pain and 74% of patients presented with killip class i. anterior mi occurred in 56% of patients and postero - inferior mi in 40% of patients. 88% of patients received aspirin during acute hospitalization, 64% angiotensin - converting enzyme inhibitors and 51% -blockers. only 37% of patients received fibrinolytic therapy, where streptokinase was the most frequent fibrinolytic regimen used and 15% had primary pci performed. major adverse cardiac conditions were as follows ; recurrent ischemic in 12%, re - infarction in 4%, cardiogenic shock in 4%, and stroke in 1%., killip class iv, high - grade av block, inferior st elevation, left bundle branch block (lbbb), cardiogenic shock, stroke and re - infarction. the renasica ii was the largest acs registry in latin america and provided important insights into risk factors, management and outcome in that part of the world. the investigators compared their findings with previously published registries, most importantly registries from high - income countries, such as the global registry of acute cardiac events (grace), the national registry of myocardial infarction (nrmi), and the euro heart survey (ehs) 1 and 2. dm and smoking were overrepresented in mexican patients whereas high total cholesterol and triglycerides had a lower frequency when compared with high - income populations. the proportion of stemi cases among acs patients, the frequencies of hypertension, male sex and 30-day death rates were comparable with those registries. lytic therapy was the most frequently reperfusion therapy and the vast majority of patients (82%) were treated with streptokinase because of its wider availability and lower cost than other fibrinolytic agents. ischemic time delay in renasica ii was attributed to the limitations and barriers that exist in limcs for a timely first medical contact and decreasing the door - to - reperfusion period and was similar to that reported in the create (treatment and outcomes of acute coronary syndromes in india) and access registries. the investigators reported several limitations of their study including ; relatively old registry (20022003) and most patients were recruited in hospitals with coronary care units from the mexico city. we compared the findings of renasica ii to that of registries recently conducted in the middle east ; gulf race (registry of acute cardiac events) and gulf race ii (see table 1). it is noteworthy that the prevalence of dm among acs in both regions (40%) is probably the highest when compared to other ethnicities (2235%). we also reported high prevalence of metabolic syndrome (46%), data on metabolic syndrome was lacking in renasica ii. mexican acs patients were older and had higher prevalence of htn, smoking when compared to their middle - eastern counterparts. furthermore, mexicans were more likely to present stemi, while ppci percentage use was very low in both regions when compared to reports from registries conducted in europe and north america. findings from gulf race and gulf race-2 resulted in changing practice for stemi patients in qatar. countrywide primary ppci (24 hours service) in qatar, which was launched in october 2013 and so far it is the main modality of reperfusion therapy (> 99% of stemi patients), further highlighting the importance of conducting regional registries for quality improvement. renasica ii highlights the importance of conducting registries in various geographic locations and among different ethnicities. these registries represent a link between randomized clinical trials, guidelines, and real clinical practice in the various communities and may help decision makers for quality improvement in the care of stemi patients. | cardiovascular diseases are the leading cause of death, worldwide, with disproportionate representation in low- and middle - income countries (lmics). the registro nacional de los sndromes coronarios agudos ii (renasica ii) investigators reported smoking, hypertension and diabetes were the main risk factors among mexican patients presenting with st - elevation myocardial infarction (stemi). fibrinolytic therapy was administered to 37%. primary percutaneous coronary intervention (ppci) was performed in only 15% of patients. 30-day mortality was 10%. this study highlights the importance of conducting regional registries for quality improvement. |
historically, anesthesia providers have had substantial difficulty using conventional peripheral nerve stimulators (pns) to achieve a low incidence of residual neuromuscular blockade (nmb). in a meta - analysis which aimed to examine the effect of intraoperative neuromuscular monitoring on the incidence of postoperative residual nmb, the authors could not demonstrate that the use of an intraoperative neuromuscular function monitor decreased the incidence of postoperative residual neuromuscular blockade. multiple studies that have reported on the use of conventional pns and intermediate - acting neuromuscular blocking drugs (nmbds) have documented a high incidence of residual nmb [24 ]. a more recent and well - conducted multicenter observational study reported a 63.5 % incidence of residual paralysis at the time of extubation [5 ]. taken together, these results indicate that reducing the incidence of residual nmb is a great challenge when working with conventional pns and cholinesterase inhibitors. this review provides recommendations for anesthesia providers who may not yet have quantitative neuromuscular monitoring and rely on monitoring with conventional qualitative peripheral nerve stimulators (pns). the authors summarize what they believe is the best practice with a qualitative standard pns monitor and neostigmine. in order to highlight the differences between qualitative and quantitative monitors, it is assumed that the reader is somewhat familiar with tof monitoring and the tof ratio and that long - acting muscle relaxants such as pancuronium are no longer preferred due to their significant association with residual neuromuscular blockade. conventional nerve stimulators may also be referred to as subjective, simple, or qualitative. a major limitation of a qualitative pns monitor is that it can not confirm that reversal is successful, i.e., the absence of residual paralysis, which is currently defined as a train - of - four (tof) ratio (the ratio of the amplitudes of the fourth twitch to the first twitch, t4:t1) < 0.9 at the ulnar nerve / adductor pollicis. qualitative pns do not provide an objective, quantitative assessment of the amplitudes of the twitch heights, but rather rely on subjective visual or tactile assessment of the relative strength of the twitches. despite this limitation, anesthesia providers who carefully apply and thoroughly understand most importantly, by using the qualitative pns monitor to guide the timing for pharmacological reversal, the incidence and severity of residual paralysis can be reduced. this was shown by kopman. in 2004 when they reported the results of using a protocol for muscle relaxant and subsequent neostigmine administration (0.05 mg / kg) that included reversal at a tof count of 2. patients received cisatracurium or rocuronium and only 2 of 60 patients had tof ratios < 0.70, 15 min after reversal. to further improve on these results with the aim of reaching the updated threshold tof ratio of 0.9, while still working within the limitations of pns and neostigmine, it is necessary to confirm a higher level of spontaneous recovery prior to reversal. the pns should be applied early after anesthetic induction and before muscle relaxants have been administered. the distal black (negative) electrode should be placed near the wrist crease and the proximal red (positive) electrode should be placed 36 cm proximal to the black electrode along the path of the ulnar nerve. the pns should be able to display the stimulating current, which should be at least 5060 ma. the hand and fingers should be immobilized while the thumb should be able to move freely. we recommend tactile assessment which is performed by holding the thumb in full abduction and the evoked twitch response is evaluated at the distal thumb phalanx in the direction of the adductor pollicis contraction (the trajectory of this contraction may vary from patient to patient). early use of the qualitative pns monitor immediately after induction of anesthesia and prior to administration of neuromuscular blockade allows confirmation of proper placement of electrodes and functioning of the pns and helps to prevent the situation where the anesthesia provider finds no twitch response at the end of the surgical procedure and may be in doubt whether the monitor works properly. an additional important benefit of early monitoring is early identification of so - called outliers. there is great inter - patient variation in response to nmbds, and we refer to the patients who have a substantially prolonged effect from usual doses of nmbds as outliers. they can be identified by a slower than expected reappearance of twitches after the initial intubating dose of nmbd. when such patients are identified, it is important to monitor them closely and to reduce each incremental dose in order to avoid accumulation and a prolonged duration of the block. when an outlier has been identified and anesthesia is maintained with a potent inhalational agent, it may be reasonable to consider conversion to total intravenous anesthesia (tiva) as reversal with neostigmine under tiva is more predictable compared to reversal in the context of inhalational anesthesia. this is consistent with volatile anesthetics potentiating the effects (prolong duration of action and recovery) of nondepolarizing muscle relaxants. outlier patients may also make good candidates for sugammadex, if this drug is available. after baseline tof has been established over the ulnar nerve as described previously, a more accessible site for qualitative pns monitoring may need to be chosen depending on the procedure and positioning of the arms. when the adductor pollicis is unavailable bilaterally, the next best site for the evaluation is the great toe twitch with stimulation of the posterior tibial nerve, if it can be easily and safely accessed and monitored. several studies have compared posterior tibial and ulnar nerve stimulation and have found a more rapid recovery of the tof response at the great toe [1317 ]. monitoring of the great toe may, therefore, result in a relative underestimation of the neuromuscular blockade and it is important to move monitoring to the adductor pollicis for the pre - reversal assessment when the arms become accessible again at the end of the surgical procedure. facial nerve stimulation and evaluation of eye muscle twitches have been shown to be unreliable and associated with a five - fold increase in the incidence and severity of residual paralysis [18 ]. muscles surrounding the eye, which are stimulated in facial nerve monitoring, are relatively resistant to nmbds compared to the adductor pollicis and studies have consistently documented an earlier recovery of twitches at this site [1927 ]. it is possible that direct muscle stimulation, circumventing the neuromuscular block, plays a role in some cases. importantly, if an alternate site other than the ulnar nerve / adductor pollicis is used, expert researchers have suggested to move monitoring to the ulnar nerve / adductor pollicis at the end of the procedure and prior to administration of neostigmine to properly assess the degree of neuromuscular blockade [28 ]. the appropriate depth of intraoperative neuromuscular block is highly variable and depends on many factors including the type and phase of the surgical procedure, individual patient and surgeon, and also on the anesthetic technique. the block should not be deeper than what is required, and for many procedures a tof count of 12 is appropriate. for lower abdominal surgeries, optimal adjustment of the depth of the block requires effective communication with the surgeon regarding his / her requirement for intraoperative muscle relaxation. if the block is too deep for tof monitoring, i.e., there are no twitches in the tof response, then post - tetanic count (ptc) should be used for monitoring. this is a mode that takes advantage of post - tetanic facilitation and is performed as follows : a 50 hz tetanic stimulus is given for 5 s, this is followed by a 3-s pause after which single twitch stimulation at 1 hz (one twitch per second) is started. a ptc of 1 or 2 reflects a very deep block and virtually guarantees patient immobility in cases where this is important, e.g., in certain neurosurgical and open eye surgical procedures. there is no convincing evidence that a deep block is of benefit in laparoscopic surgery, and although a period of ptc = 0 may occur after the intubating dose has been administered, there is rarely a need to maintain a block that is deeper than ptc = 1. when rocuronium is used, the first twitch in the tof can be expected to appear when the ptc reaches approximately 10 (range 616). when anesthesia providers subjectively assess the twitch response of the adductor pollicis to ulnar nerve stimulation, they are not reliably able to identify fade when the tof ratio exceeds 0.4. this means that even when the amplitude of the 4th twitch is only half of the amplitude of the first twitch, and the tof ratio is 0.50, we perceive this as four equal twitches and fail to detect the fade. when using a qualitative pns monitor, the tof ratio ranging from 0.40 to 0.90 has therefore been referred to as the zone of blind paralysis. the main benefit of a quantitative nerve stimulator is that it can reliably and quantitatively measure tof ratios throughout this entire range. although the method of delivering tetanic stimulation for 5 s at 100 hz with the qualitative pns monitor has been demonstrated to detect fade at tof ratios of 0.80.89, its reliability is significantly less than that of a quantitative pns monitor to detect residual paralysis, and it can cause a mild degree of fade itself. additionally, the high stimulation frequency used for this method is also painful for an awake or nearly awake patient, making its use restricted to deeper levels of anesthesia. when a quantitative pns monitor is not available and we use a qualitative pns monitor, it is critical to maximize the chances of a successful reversal. this is most reliably accomplished by confirming an adequate level of spontaneous recovery prior to administration of neostigmine. this may be considered the most critical aspect of management when aiming to prevent residual paralysis while using a qualitative pns monitor and neostigmine. many providers were taught in training to administer neostigmine with only one or two twitches present. however, several studies have led to the updated recommendations to administer neostigmine only after the 4th twitch has reappeared [12, 28, 31, 3335 ]). in fact, a successful reversal to tof ratio of 0.9 is not guaranteed even when neostigmine is administered at a tof count of 4 ; but, the odds of a successful reversal are significantly improved with this approach compared to when neostigmine is administered at a lower degree of spontaneous recovery. reported on the likely outcome from reversal at the various tof counts. when giving neostigmine with only the first twitch present, the odds of achieving a tof ratio of 0.9 in 10 min was zero and the odds of getting a tof ratio of at least 0.8 was 0.07. the odds of achieving a tof ratio of 0.8 in 10 min increased to 2.0 when neostigmine administration was delayed until the fourth twitch had reappeared. this means that relative to a patient who received neostigmine with a tof count of 1, a patient who receives neostigmine with a tof count of 4 is 30 times more likely to achieve a tof ratio of 0.8 in 10 min. kim. also reported data strongly supporting the advantage of reversing from tof count of 4 (fig. 1). if spontaneous recovery is allowed to progress until qualitative visual or tactile assessment of fade in the tof disappears before neostigmine is administered (i.e., the tof ratio is expected to be at least 0.4), the odds of a successful reversal become excellent as long as the neostigmine dose is appropriately adjusted [36, 37 ]. the dose of neostigmine should be reduced and not exceed 2025 mcg / kg when no fade is observed with qualitative tof monitoring.fig. 1percent of patients with recovery greater than train - of - four (tof) ratio of 0.9 at 10 min after neostigmine (70 mcg / kg) administration during propofol- or sevoflurane - based anesthesia. bar graphs are based on data reported by percent of patients with recovery greater than train - of - four (tof) ratio of 0.9 at 10 min after neostigmine (70 mcg / kg) administration during propofol- or sevoflurane - based anesthesia. bar graphs are based on data reported by if the tof count is 3 or less, the patient should be kept anesthetized or deeply sedated until the 4th twitch is clearly present [31, 35 ]. it is understandable that delaying reversal (and thereby also delaying the subsequent emergence and extubation), while first awaiting the return of the 4th twitch, will often be considered inconvenient. of course, avoiding all overdosing will help ensure that the blockade is not unnecessarily deep at the end of the surgical procedure. this includes careful dose adjustment of nmbds for age, gender, obesity, as well as only judicious administration of incremental doses towards the end of the surgical procedure [38, 39, 4042 ]. it may also be helpful to educate all members of the surgical and perioperative teams about fundamentals of safe management of nmbds to increase acceptance of this critical step of awaiting adequate spontaneous recovery. return of spontaneous ventilation and normal tidal volumes should not be used for timing of pharmacologic reversal as intubated patients often have adequate ventilation despite low tof counts. an earlier reversal, such as at tof counts of 1 to 3, will routinely yield a tof response with no fade at 10 min after reversal, however without a quantitative monitor there is no way of confirming that the reversal was successful. patients who are reversed at lower tof counts while receiving volatile anesthetics are more likely to end up in the zone of blind paralysis (i.e., tof ratio 0.40.9) than to achieve a tof ratio of 0.9 at 10 min after neostigmine [12, 43 ]. thus, reversal at low tof counts often leads to low tof ratios which are not adequate for a safe extubation. increasing number of tof twitches prior to reversal correlates with a decreasing incidence and severity of residual paralysis, and a decreased incidence of postoperative pulmonary complications such as atelectasis and pneumonia. every attempt to maximize reversal should be used in patients with known or anticipated airway or pulmonary impairment. after administering neostigmine, it may take as much as 10 min for neostigmine s peak effect to occur [44, 45 ]. patients who are successfully reversed should have no fade with double burst stimulation or tetanic stimulation at 50 hz. however, the use of tetanic stimulation is not the most sensitive approach to detecting residual paralysis. clinical tests (head lift, hand grip, etc.) are not adequate to rule out residual paralysis, either. anesthesiologists who use a quantitative monitor can take a different approach from the one recommended for use with a pns. in this case while it would be expected that reversal to a tof ratio of 0.9 often takes 20 min or even longer, the quantitative monitor eliminates the problem of the zone of blind paralysis and the patient can be accurately monitored throughout. in some cases, reversal will occur more quickly, and when this is confirmed with the quantitative monitor, extubation can be safely performed without delay. quantitative monitoring has proved to be not only efficacious but also effective [4851 ]. currently, the most widely available monitor is the tof - watch which is based on acceleromyography. calibration of this monitor is easily performed in less than 30 s and improves its accuracy. measurements often show some variability and it is therefore customary to perform several measurements until two consecutive measurements are within 10 % and then to average these. the monitor works best when applied to a freely moving thumb, and devices have been developed to protect the thumb from external disturbances during surgery. if a freely moving thumb is not available intraoperatively, the monitor can be used at alternate sites but should be moved to the ulnar nerve / adductor pollicis when this site becomes available at the end of the case. as mentioned, reversal can be administered at lower tof counts with the quantitative pns monitors as the tof ratio can be assessed continuously to ensure a tof ratio equal to or greater than 0.9 prior to extubation. when all operating rooms in an anesthesia department were equipped with these monitors, the incidence of residual paralysis declined continuously over a 9-year period from 62 % to just 3 %. while optimal management of nmbds requires a quantitative monitor, this review provides recommendations also for anesthesia providers who have access only to conventional qualitative monitoring. the pns should be used throughout the case to help the anesthesia provider to titrate and monitor the required intraoperative relaxation but most importantly to confirm adequate spontaneous recovery prior to reversal with neostigmine. the best location for monitoring is the ulnar nerve / adductor pollicis and if a different site has been used intraoperatively, monitoring should be moved to the ulnar nerve / adductor pollicis prior to reversal. the return of 4 twitches at the adductor pollicis should be confirmed prior to administering neostigmine. when fade is absent in the tof, the neostigmine dose should be adjusted and not exceed 25 mcg / kg. while following the recommendations in this article will reduce the incidence and severity of residual paralysis, only a quantitative monitor allows for definitive confirmation of full recovery from the effects of muscle relaxants prior to extubation. | this review provides recommendations for anesthesia providers who may not yet have quantitative monitoring and sugammadex available and thus are providing care within the limitations of a conventional peripheral nerve stimulator (pns) and neostigmine. in order to achieve best results, the provider needs to understand the limitations of the pns. the pns should be applied properly and early. all overdosing of neuromuscular blocking drugs should be avoided and the intraoperative neuromuscular blockade should be maintained only as deep as necessary. the adductor pollicis is the gold standard site and must be used for the pre - reversal assessment, also when the ulnar nerve and thumb were not accessible intraoperatively. spontaneous recovery should be maximized and neostigmine should be administered after a tof count of 4 has been confirmed at the adductor pollicis. extubation should not occur within 10 min after administration of an appropriate dose of neostigmine. |
these are peer - reviewed poster - platform submissions finalized by the scientific program committee. a total of 153 abstracts (14 platforms [pp1 through pp14 ] & 139 posters [1 through 139 ]) were selected from 161 submissions to be considered for presentation during november 4 8, 2011, at the hilton baltimore hotel, to pathologists, cytopathologists, cytotechnologists, residents, fellows, students, and other members of cytopathology - related medical and scientific fields. |
|
the tongue plays a fundamental role in several bodily functions such as swallowing, breathing, speaking, and chewing. the tongue originates from the branchial arches, approximately from the fourth week of pregnancy.1 the connective tissue and the vascular system are derived from the cranial neural crest cell derived mesenchyme, while most of the tongue muscles are developed from the myoblasts that migrated from the occipital somites of the mesoderm.1 there is also a close embryological and functional relationship between the tongue, the occipital area, and the hyoid bone, which originates from the second branchial arch.1 the tongue is a complex muscular organ composed of intrinsic and extrinsic muscles : four couples of intrinsic muscles without bone support (transversalis, verticalis, inferior longitudinalis, and superior longitudinalis) and four couples of extrinsic muscles with bone support (genioglossus, styloglossus, hyoglossus, and palatoglossus).2 the fibers of the extrinsic muscles originate from the external bony attachments, ie, the mandible, the hyoid bone, and the styloid process, and terminate in the mass of the tongue.2 according to a study, other muscles that belong to the group of the extrinsic muscles are the glossopharyngeus (ie, a slip from the superior pharyngeal constrictor connecting to the tongue) and the chondroglossus (a small muscle sometimes regarded as part of the hyoglossus).2 the contraction of the fibers of the intrinsic muscles determines the shape of the tongue, whereas the fibers of the extrinsic muscles mostly influence its position.3 the cortical part of the tongue is integrated at different levels, with an evident somatotropic structure.4 its innervation is provided by the lingual nerve and the hypoglossal nerve, with a wide distribution to the muscular fibers.5 the hypoglossal nerve is connected to the first cervical roots through the cervical loop and receives presynaptic impulses from the phrenic nerve and the intercostal muscles.5 the floor of the mouth is innervated by the trigeminal system through afferent fibers.5 therefore, based on this complex of efferent and afferent information, one can understand why any dysfunction in the tongue may produce a negative impact not just limited to the one area. chewing involves an anterior posterior movement of the tongue and of the hyoid bone on the horizontal plane, whereas the hyoid bone has almost no role in speaking.6 during respiration, the hyoid bone is moved in a cranial caudal direction (due to the action of the extrinsic muscles of the tongue), and the pharyngeal space enlarges.7 the tonus of these muscles must be well - balanced, otherwise dysfunctions can occur, resulting in alteration of the position of the hyoid bone and of the functionality of the tongue.2 we will propose two osteopathic techniques based on the anatomy and the embryology of the tongue, with special attention to the abovementioned connections with the hyoid bone and the occipital cervical tract. the techniques described below can be defined as an indirect osteopathic approach or a myofascial release. osteopathic techniques aim to release fascial restrictions, to mobilize tight ligaments, and to drain congested lymphatics.8 the purpose of these therapies and treatments is to alter the mechanical properties of fascia, such as density, stiffness, and viscosity, so that the fascia can more readily adapt to physical stresses.8 in fact, some osteopathic physicians and manual therapists report local tissue release after the application of a slow manual force to tight fascial areas ; these reports have been explained as a breaking of fascial cross - links, a transition from gel to sol state in the extracellular matrix and other passive viscoelastic changes of fasciae.8 the fascial osteopathic technique is the application of a low load, long duration stretch into the myofascial complex, with the aim of restoring the optimal length of this complex.8 the practitioner palpates the fascial restriction and the pressure is applied directly to the skin, into the direction of restriction, until resistance (the tissue barrier) is felt.8 once found, the collagenous barrier is engaged for 90120 seconds, without sliding over the skin or forcing the tissue, until the fascia complex starts to yield and a sensation of softening is achieved.8 we do not know the exact scientific reasons for this fascial release, although previous studies already demonstrated the usefulness of the fascial osteopathic treatment in many clinical conditions.8 in vitro studies demonstrated how the osteopathic techniques can influence the metabolic behavior of fibroblasts, in terms of proliferation and inflammatory response.8 the myofascial techniques practiced by manual operators utilize an approach very similar to indirect techniques. myofascial release is a widely employed direct manual medical treatment, which utilizes specifically guided mechanical forces in order to manipulate and reduce myofascial restrictions of various somatic dysfunctions.8 it is proved that, by applying this method, fibroblasts are able to change their orientation and probably their mechanical behavior. another different explanation not related to the use of indirect techniques has been previously proposed. an improved sliding of the various fascial layers would allow to reset the afferent of the free nerve endings, resulting in physiologic response of the efferent ones.8 the muscular complex of the tongue, its links with the hyoid bone, and the occipital a previously healthy 30-year - old male patient with a recent history of whiplash (type ii from whiplash - associated disorders) was admitted to the santa maria nascente irccs, don carlo gnocchi foundation, institute of hospitalization and care with scientific address 6 months after the traumatic event. the patient complained of severe neck pain (in particular, the first cervical tract c1c3) during swallowing and the reduced ability to open his mouth, as the opening of the mouth led to increasing pain. all the movements of the cervical spine were limited, but not painful. the x - ray performed after the trauma showed a loss of the physiological cervical lordosis, in the absence of hernias or other serious injury. the patient was a business owner, an active sporty person, without any family history of spinal pathologies. he did not consume any drug, except for nimesulide in order to alleviate the pain related to the recent trauma. after the osteopathic evaluation, it was decided to treat the patient with two techniques focused on the tongue, since an abnormal tension in tongue s activity (probably consequent to cervical and oropharyngeal tension) was considered as the main cause of symptoms. the two techniques we used in this case consisted of indirect osteopathic approach and myofascial release to the tongue and the occipital area / hyoid bone. the tongue is held with one hand with a piece of gauze (in order not to release the hold), while the patient is in a supine position. the other hand with the palm opened has to be placed behind the head of the patient, in an area that includes the cervical and occipital surface (figure 1). the tongue must be gently pulled out, until the tension generated is perceived in the occipital this position has to be maintained until the muscular tissue of the tongue and the posterior cervical and occipital tract is reduced, and a sensation of looseness and lightness is perceived. for the second technique, with the patient being always in supine position, the tongue is held with one hand as previously described, whereas the other hand gently grasps the hyoid bone (figure 2). in this position, we wait until the suprahyoid tissue and that of the tongue reach a balanced tension, resulting in a perception of looseness and lightness. the hyoid bone is essential for proper functioning of the tongue and represents the junction point between the tongue and the occipital after two osteopathic sessions in 1 week, the patient could swallow and open his mouth without pain ; the movements of the cervical spine were normal, with no functional limitations. the patient signed an informed consent ; all patients of our clinic are evaluated and are subjected to standard treatment, according to the declaration of helsinki - ethical principles for medical research involving human subjects. one study reported that a whiplash trauma causes several health problems and structural alterations, including functional impairment in the occipital myofascial area, resulting in painful syndromes.10 neck pain and concomitant dysfunction in the mouth opening can be observed, due to muscular and neurological connections.11 whiplash trauma can also cause difficulty in swallowing, probably related to a morphological and functional alteration of the oropharyngeal region.12 myofascial release has been reported to reduce pain and improve quality of life in different pathologies.13 dysfunctions arising from physical trauma are thought to decrease fascia tissue length and elasticity resulting in limiting the sliding of the various fascial layers.13 the pain relief obtained by using osteopathic techniques probably represents the result of the restoration of the physiological length of the fascial system, reducing the activity of trigger points of the cervico - occipital, and with less inflammatory status.13 furthermore, the symptoms resolution obtained through the osteopathic treatment of the tongue reported in this case can be explained when considering the myofascial and neurological connections to the cervical spine and the hyoid area ; when these neurological connections are improved with manual techniques, the symptoms also improve. we know that there is a mechanical hypersensitivity after whiplash, with hyperexcitability in central nociceptive pathways via trigeminal reflex (the lingual nerve is part of the trigeminal system, and the hypoglossal nerve is connected to the trigeminal system).14 we can speculate that the osteopathic treatment improves the receptorial mechanical response, reducing the hyperexcitability that leads to pain. the methods of treatment are sequential and can be integrated in a process of rehabilitation that combines the work of the doctor with that of the therapist. further studies dealing with the tongue are needed in the field of osteopathy, with the final purpose of corroborating the osteopathic practice and hypotheses of treatment illustrated in the article. | the tongue plays a fundamental role in several bodily functions ; in the case of a dysfunction, an exhaustive knowledge of manual techniques to treat the tongue is useful in order to help patients on their path toward recovery. a 30-year - old male patient with a recent history of whiplash, with increasing cervical pain during swallowing and reduced ability to open the mouth, was treated with osteopathic techniques addressed to the tongue. the osteopathic techniques led to a disappearance of pain and the complete recovery of the normal functions of the tongue, such as swallowing and mouth opening. the manual osteopathic approach consists of applying a low load, in order to produce a long - lasting stretching of the myofascial complex, with the aim of restoring the optimal length of this continuum, decreasing pain, and improving functionality. according to the authors knowledge, this is the first article reporting a case of resolution of a post whiplash disorder through osteopathic treatment of the tongue. |
the head and neck region is the most frequent site where a burn injury occurs. these percentages vary between 27 to 60%, depending on country, the setting and the definition of what constitutes a facial burn. children represent 25 to 50 % of the total burn population and the prevalence of facial burns in children is between 24 and 52 % (1). the face is a psychologically significant area of the body and its disfigurement has been found to have numerous potential psychosocial consequences for patients. facial burns are extremely common, making up at least 30 to 50% of minor to moderate burns. facial burns are also present in over 50% of large burns, the vast majority being partial thickness. because of the difficulty and complexity of wound care including pain and the frequent cleansing to avoid infection, partial thickness burns of the face, often require hospital care (2 - 6). medium - thickness second - degree burns, which epithelialize in 10 to 14 days, often heal without scarring, although long - term alterations in skin pigmentation and texture are frequent. medium to deep second - degree burns, which epithelialize in 14 to 28 days or longer, must be carefully monitored because they are prone to the development of late hypertrophic scarring (7) ? in the face, full - thickness burns are rare since the high vascularity of the face rapidly dissipates the heat. also facial burns are often caused by flash burns, which usually cause partial - thickness burns. however, full - thickness burns can be seen, especially in contact burns and in the event of prolonged exposure to the heating source, for example if the patient was sub- or unconscious or paralyzed at the time of accident. in addition, in some places (e.g. the nose and ears) facial skin is very thin and more vulnerable to deep burns. if nose and ears are deeply burned, the anatomical structures can change or disappear (8). the objective of this study is to understand the causes of facial burns, depth of facial burns, localization, distribution of facial burns by gender and over years, the methods of treatments. this is a retrospective study that included 350 patients with facial burns treated in 2006 - 2011 period in department of plastic and reconstructive surgery kosova. the data was collected and analyzed from the archives and protocols of the university clinical center of kosova. in this retrospective study we included 350 patients in 6 year period with facial burns. facial burns were predominant in male patients with 291 cases or 83.1% while only 59 were female or 16.9% (table 1). scald and liquid was responsible for burns in 156 cases or 44.6%, followed by burns due to flame and fire burns in 109 cases or 31.1% and in 85 cases or 24.3% the cause of facial burns were flame due electricity (table 1). nineteen or 5.4% of patients had only a facial burn and 331 of patients or 94.6% were patients who except face have burned other parts of the body (table 1). superficial burns were present in 298 cases or 85.1 %, and deep burns were present with 52 cases or 14.9%. conservative treatments were applied in 335 cases or 95.7% with cleaning of burned surface and therefore surgical treatment were applied in 15 cases or 4.3% (table 2). they pose difficulties in pre - hospital resuscitation and are challenge to clinicians managing surviving burn victims in the intensive care setting (10 - 11). in this retrospective study facial burns were predominant in male patients with 291 cases or 83.1% while only 59 were female or 16.9%. a similar study of 1061 patients with facial burns by castana. reported that females predominated, with an incidence of 61%, compared to a male incidence of 39% (12). scald and liquid was responsible for burns in 156 cases or 44.6%, followed by burns due to flame and fire burns in 109 cases or 31.1% and in 85 cases or 24.3% the cause of facial burns were flame due electricity. another similar study of 277 patients conducted by mustafa h.ali reported that scalds were the main causes of burn injuries with 49.1%, followed by flame burns with 37.5% (13). nineteen or 5.4% of patients had only a facial burn and 331 of patients or 94.6% were patients who except face have burned other parts of the body. superficial burns were present in 298 cases or 85.1%, and deep burns were present with 52 cases or 14.9%. conservative treatments were applied in 335 cases or 95.7% with cleaning of burned surface and therefore surgical treatment were applied in 15 cases or 4.3%. there may be soot around the nose and mouth and coughing may produce phlegm that includes ash. they pose difficulties in pre - hospital resuscitation and are challenge to clinicians managing surviving burn victims in the intensive care setting. management problems resuscitation, airway maintenance and clinical treatment of facial injuries are compounded if the victim is child. inhalational burns reduce survivability, certainly in adult victim. in our retrospective study we found that facial burns dominated in male gender, liquids and scalds are the most common causes of facial burns in children whereas the flame and electricity were the most common causes of facial burns in adults. we came to the conclusion in our study that surgical treatment minimizes complications and duration of recovery. | facial burns are generally considered severe. this is due to the possibility of respiratory complications. first responders check the nostrils for singed hairs. in severe cases there may be soot around the nose and mouth and coughing may produce phlegm that includes ash. facial and inhalational burns compromise airways. they pose difficulties in pre - hospital resuscitation and are challenge to clinicians managing surviving burn victims in the intensive care setting. management problems resuscitation, airway maintenance and clinical treatment of facial injuries are compounded if the victim is child. inhalational burns reduce survivability, certainly in adult victim. in our retrospective study we found that facial burns dominated in male gender, liquids and scalds are the most common causes of facial burns in children whereas the flame and electricity were the most common causes of facial burns in adults. we came to the conclusion in our study that surgical treatment minimizes complications and duration of recovery. |
the most common etiology of upper gastrointestinal (gi) bleeding is peptic ulcer disease. various studies have reported the advantages of pump proton inhibitor drugs (ppi) over histamine receptor blockers and placebo for lowering the complications of gi bleeding. the preference of ppi drugs in comparison with h2 receptor antagonists is related to its long - term ability to maintain stomach ph levels greater than 6. the advantage of high stomach ph is to maintain stability and resistance of platelets and blood clots created at the site of the peptic ulcers. currently, treatments for bleeding peptic ulcers include appropriate endoscopic therapy and prescription of pump inhibitor drugs. prescription of pump inhibitor drugs following endoscopy lead to reductions in rebleeding and decreased need for surgery. studies have shown that the type of ppi has no effect on treatment outcome. the appropriate dose of pump inhibitor drugs for controlling bleeding has not been determined. the high - dose regimen is the most common method currently used for treating patients. in this regimen, patients receive an initial 80 mg bolus of pantoprazole followed by 8 mg per hour iv infusions for a three - day period. advocates of the high - dose regimen believe that this regimen has superiority over low - dose by decreasing complications from bleeding such as mortality, surgery, and rebleeding. studies have shown that the low - dose regimen is as useful as the high - dose regimen for treating these patients. the current clinical study has been designed to compare the efficacy of high and low dose pantoprazole in khuzestan province, iran with a different racial combination in comparison with previous studies. this was a double - blind clinical trial conducted at ahvaz imam hospital, a referral center. there were 166 patients assigned to the study groups by computer generated randomization (figure 1). inclusion criteria included patients with symptoms of upper gi bleeding such as hematemesis, melena, hematochezia, or symptoms such as dizziness and light - headedness, and endoscopic confirmation of upper gi bleeding. all patients underwent upper gi endoscopy within 6 hours after admission to the emergency department. the endoscopy was performed following stabilization of the patient 's hemodynamic status. in this study we examined only high - risk ulcers such as adherent clot and visible vessel or oozing ulcer. ulcers in these patients were treated by a combination of endoscopic therapy with argon plasma coagulation (apc) and a 15 cc injection of diluted epinephrine. exclusion criteria included : malignant ulcer, multiple ulcers visualized on endoscopy, cirrhotic patients with coagulative abnormalities and/or variceal bleeding, chronic renal failure, recent history of hospitalization and gi bleeding, those on maintenance doses of corticosteroids or non - steroidal anti - inflammatory drugs (nsaids), use of ppi or antibiotics during the previous month, history of peptic ulcer disease (pud), and persons under 16 years and above 70 years of age. exclusion of nsaid users was intended to prevent selection bias because nsaids have a higher fatality of bleeding among women. a number from 1 to 166 was randomly selected for each patient by spss version 14 software and the random - select program. patients underwent treatment on the basis of whether this number belonged to the high- or low - dose group. we observed patients for the development of rebleeding, need for re - endoscopy, surgery, and mortality. patients in the high - dose group received an initial 80 mg bolus followed by 8 mg per hour infusion of pantoprazole over a three - day period. in the low - dose group, patients received an initial 40 mg bolus followed by 4 mg per hour infusion of pantoprazole over a three - day period. the researcher and patients were unaware of the selected regimen ; follow - up of the patient during hospitalization was accomplished by other colleagues. we compared the primary results (rebleeding, drop of hemoglobin more than two units, infused blood, duration of hospitalization and need for surgery) and secondary results (mortality rate). a second look endoscopy was performed for patients who had evidence of further bleeding such as hematemesis, more than a 2 g drop in hemoglobin or hemodynamic instability. after discharge patients were followed for evidence of rebleeding, need for surgery and endoscopy, and mortality. we considered results of previous studies to calculate the sample size based on a 24% bleeding reduction in the high - dose group and 7% in the low - dose group. the formula for calculating the sample size to compare the ratio in both regimens was defined with =5% and =20%. fisher s exact and chi - square tests, and survival analysis for the numerical variables such as hospitalization days were used for data analysis. patients initially received an explanation of the study after which they signed the written consent form. this research, as part of a thesis, was approved by the ethical committee of ahvaz jundishapur university of medical sciences (ajums) with registration no. we considered results of previous studies to calculate the sample size based on a 24% bleeding reduction in the high - dose group and 7% in the low - dose group. the formula for calculating the sample size to compare the ratio in both regimens was defined with =5% and =20%. fisher s exact and chi - square tests, and survival analysis for the numerical variables such as hospitalization days were used for data analysis. patients initially received an explanation of the study after which they signed the written consent form. this research, as part of a thesis, was approved by the ethical committee of ahvaz jundishapur university of medical sciences (ajums) with registration no. overall, there were 166 patients with bleeding peptic ulcers who participated in this study. we observed no statistically significant differences between groups in terms of hospital stay more than 5 days (p=0.53), rebleeding (p=0.3), mortality (p=0.99), and need for surgery (p=0.75). the mean units of blood transfused were 3.311.71 for the high - dose group and 2.821.73 for the low - dose group (p=0.50). we compared two strategies of intravenous ppi administration in the prevention of rebleeding, surgery and death in patients with bleeding gastric and/or duodenal ulcers who achieved endoscopic homeostasis. following endoscopic homeostasis of the bleeding ulcers, there were 2 (6.3%) patients with gastric ulcers from the high - dose group and 2 (5.4%) from the low - dose group who underwent surgical intervention. there were 4 (7.8%) patients with duodenal ulcers in the high - dose group (p=0.99) and 3 (6.5%) patients with duodenal ulcers in the low - dose group (p=0.99) who underwent surgery. the mortality rate was 1 (3.1%) for gastric ulcers in the high - dose group and 3 (8.1%) for gastric ulcers in the low - dose group (p=0.61). there were 3 (5.9%) patients with duodenal ulcers in the high - dose group and 2 (4.3%) with duodenal ulcers in the low - dose group who expired (p=0.99 ; tables 2 and 3). 1- among the patients with gastric ulcers, 32 patients were in the high - dose group and 37 patients were in the low - dose group. 2- among the patients with duodenal ulcers, 51 patients were in the high - dose group and 46 patients were in the low - dose group. 1. among the patients with gastric ulcers, there were 32 patients in the high - dose group and 37 patients in the low - dose group. 2. among the patients with duodenal ulcers, there were 51 patients in the high - dose group and 46 patients in the low - dose group. the mean numbers of transfused blood units were 3.451.85 for patients with gastric ulcers in the high - dose group and 2.941.45 for patients with gastric ulcers in the low - dose group (p=0.27). for patients with duodenal ulcers, there were 3.261.48 units transfused in the high - dose group and 3.261.48 units transfused in the low - dose group (p=0.11). episodes of rebleeding occurred in 21 (25.3%) patients in the high - dose group and in 27 (32.5%) patients in the low - dose group (p=0.3). additional bleeding occurred in 9 (10.8%) patients from the high - dose group and in 4 (4.8%) patients from the low - dose group during one month (p=0.14). a total of 6 (7.2%) patients in the high - dose group and 5 (6%) in the low - dose group underwent surgery one week following discharge (p=0.75). there were 5 (6%) patients in the high - dose group and 4 (4.8%) from the low - dose group who died after one week of discharge (p=0.99 ; table 4). 1.among the patients with gastric ulcers, 32 patients were in the high - dose group and 37 patients were in the low - dose group. 2.among the patients with duodenal ulcers, 51 patients were in the high - dose group and 46 patients were in the low - dose group. ppi drugs combined with appropriate endoscopic therapy are standard treatment for patients with bleeding peptic ulcers. in this treatment, the high - dose regimen ppi drugs are administered to patients. in this double - blind clinical trial we have found that among patients with bleeding from acute peptic ulcers, both high- and low - dose pantoprazole regimens have similar outcomes. rebleeding (p=0.30), duration of hospitalization more than 5 days (p=0.53), hemoglobin drop of more than two units (p=0.15), mean amount of transfused blood (p=0.50), mortality (p=0.99) and surgery (p=0.75) have shown no significant differences. low gastric ph can cause disaggregation of platelet plugs and prevent stabilization of the clot. one of the concerns about low - dose regimens is the ability for maintaining the ph above 6. this matter has been investigated by choi. who showed that the time intervals of ph > 6 were equal in both regimens. with regards to the ppi medications in terms of type of dose and pharmaceutical form it is possible to generalize results of this investigation to other ppi drugs and their oral or injective forms. in a study conducted by andriulli., 238 patients in the high - dose group and 236 patients in the low - dose group were examined. rebleeding (p=0.34), mean units of transfused blood (p=0.32), duration of hospitalization (p=0.18) and surgery (p=0.03) were similar in both groups, but not significantly different. the ratio of rebleeding in this study was similar to the current study results (p=0.30) and those of a study by yao - chun. on 120 patients (p=0.1), wang. we detected no difference between risk of rebleeding among patients with gastric and duodenal ulcers (p=0.84).there is concern about earlier discharge in the low - dose group so evaluation of rebleeding after 72 hours in andriulli s study could not be an appropriate criterion for comparing two groups. a retrospective study by simon - rudler. evaluated patients admitted between 1997 and 2001 in a low - dose group and from 2001 to 2004 in a high - dose group. in this historical cohort, sample sizes were 45 patients in one group and 69 in the next. the high - dose regimen reported lower rebleeding (p=0.01), mortality (p=0.001) and need for surgery (p=0.05) rates than the low - dose group. however in this study, methods of endoscopic therapy were different in each group. on the other hand, the low number of patients and method of conducting the study were other pitfalls. of note, some studies have indicated that patients infected with h. pylori were less likely to respond to ppi. on the other hand, when there is h. pylori induced gastritis, the secreted interleukin-1 beta acts as a strong ppi. chen. studied 93 patients in two groups : high- and low - dose. each group consisted of 45 and 48 patients, respectively. in this study, rebleeding during four time periods (3, 7, 14 and 28 days) after initial bleeding was evaluated. at the end, bleeding rates were equal in all four time periods between the two groups (p=0.50). a retrospective study by chih - ming. showed that rebleeding, mortality and surgery rates in 477 patients who had a rockall score of < 6 did not significantly differ between the low- and high - dose groups (p=1.000) whereas higher rates of rebleeding occurred in patients who had a rockall score 6 (p=0.001). the double blind clinical trial method used in the current study is superior compared to an open - label trial, retrospective methods or historical cohorts. a separate survey of primary and secondary outcomes in gastric and duodenal ulcers in this study was a noteworthy point. we did not observe significant differences in results related to gastric or duodenal ulcers. in some studies pinephrine injections were the only therapeutic treatment.however, the use of hemoclips and an epinephrine injection is the preferred method. due to a local lack of access to hemoclips our endoscopic method was the injection of epinephrine combined with apc. one of the advantages of our study was the inclusion of patients with high - risk stigmata. within a month, we evaluated the study patients in terms of rebleeding, need for re - endoscopy, surgery and mortality however these criteria have only been investigated in one other study. second, if we had checked the ph of the stomach and assayed for h. pylori infection, we could have obtained more complete results for comparison between the two groups. after endoscopic therapy, prescription of low - dose pantoprazole might be as effective as the high - dose. thus, for economic reasons, the use of low - dose compared to high - dose regimen should be better. we suggest additional studies that enroll a larger sample size for further clarification of this issue. this work was supported by the research institute for infectious diseases of the digestive system, ahvaz jundishapur university of medical sciences, ahvaz, iran. we are grateful to the research deputy at ahvaz jundishapur university of medical sciences for his encouragement and constructive advice during the preparation of this manuscript. | background the appropriate dose of proton pump inhibitors for treatment of patients with upper (gi) bleeding remains controversial. this study compares high - dose versus low - dose intravenous proton pump inhibitor (ppi) infusion for prevention of gi bleeding complications. methods a total of 166 patients with bleeding peptic ulcers underwent therapeutic endoscopy using concomitant therapy by argon plasma coagulation (apc) and diluted epinephrine injection. patients were randomly divided into two groups : high - dose pantoprazole (80 mg bolus, 8 mg per hour) and low - dose pantoprazole (40 mg bolus, 4 mg per hour) infused for three days. initial outcomes were rebleeding, need for surgery, hemoglobin drop more than two units, and hospitalization for more than five days. secondary outcome included mortality rate. results overall, 166 patients (83 patients per group) enrolled in the study. the average age of patients in the high - dose group was 59.515.6 years and 52.313.3 years in the low - dose group (p=0.58). males comprised 69.7% of patients. in the high - dose group, the mean number of units of transfused blood was 3.31.71 and in the low - dose group, it was 2.821.73 (p=0.50). there were 36 (43.37%) patients in the high - dose group and 40 (48.19%) in the low - dose group who were hospitalized for more than 5 days (p=0.53). rebleeding was observed in 27 (32.53%) patients in the high - dose group and in 21 (25.30%) in the low - dose group (p=0.30). there were no significant differences observed in drop in hemoglobin of more than two units (p=0.15), mortality (p=0.99) and surgery (p=0.75) between the two groups. conclusion for controlling peptic ulcer bleeding, there is no difference between high dose and low dose pantoprazole infusion. |
chronic filarial lymphedema is an uncommon etiology for the development of cutaneous angiosarcoma. to the best of our knowledge lymphedema - associated angiosarcoma also known as lymphangiosarcoma is the commonest type of cutaneous angiosarcoma. post - mastectomy lymphedema is the most frequent cause, while chronic filarial lymphedema is one of the most uncommon etiology for development of lymphangiosarcoma. we report the case of cutaneous lymphangiosarcoma developing in chronic filarial lymphedema, because of its rarity and review previously reported three cases. the prognosis is very poor, with a 5-year survival rate of between 12 and 33%. a 50 year old male patient was admitted with swelling of right leg since 25 years. painful nodules and ulcerations were observed on the same leg since three months [figure 1 ]. on examination, the right leg showed markedly thickened skin with three brownish nodules with raw surface and oozing of blood. right inguinal lymph nodes (2 in number) were palpable, each measuring 2 2 cm. right leg venous doppler study revealed subcutaneous edema with normal wall to wall colour flow. patient was a known case of filariasis and had chronic lymphedema of 25 years duration. aspiration cytology of right inguinal lymph nodes showed chronic lymphadenitis with no evidence of any live or dead microfilariae. dermis showed a tumour comprised of ill - defined lobules of malignant spindle cells with intervening stroma showing proliferating slit - like vascular channels lined by plump cells with scant cytoplasm and hyperchromatic nucleus [figure 3 ]. the vascular nature of the tumour was confirmed immunohistochemically with endothelial markers like cd 34 and cd 31 displaying distinct membranous positivity [figures 5 and 6 ]. marked thickening of the skin of the right lower leg with two ulcerated nodular lesions gross photograph showing two brownish tissue bits photomicrograph showing a dermal tumour comprised of ill - defined lobules of malignant spindle cells with intervening stroma showing proliferating slit - like vascular channels lined by plump cells with scant cytoplasm and hyperchromatic nucleus (h and e, 40) photomicrograph showing high mitotic activity (h and e, 400) photomicrograph showing distinct membranous positivity by malignant endothelial cells (cd34, 100) photomicrograph showing distinct membranous positivity by malignant endothelial cells (cd31, 40) angiosarcoma includes lymphangiosarcoma and malignant hemangioendothelioma, as there are no currently reliable means of distinguishing blood vascular from lymphatic endothelial differentiation (or origin). it is likely that individual cases of angiosarcoma may differentiate in either or both directions. cutaneous angiosarcoma are further divided into (1) idiopathic angiosarcoma of head and face ; (2) lymphedema - associated angiosarcoma also known as lymphangiosarcoma ; and (3) post radiation angiosarcoma. lymphangiosarcoma arises in arm of females 1 - 30 years after mastectomy with removal of axillary lymph nodes, with or without radiation therapy (stewart - treves syndrome). more rarely this type can also occur in other types of chronic lymphedema, including congenital, iatrogenic, lymphatic malformations and filarial lymphedema. the prognosis is very poor, with a 5-year survival rate of between 12 and 33%. the association of lymphangiosarcoma with chronic filarial lymphedema is very rare. to the best of our knowledge only three cases have been reported in the world literature till date and ours is the fourth case.[24 ] we report this case because of its rarity and to highlight this rare complication of chronic filarial lymphedema, so that the treating physician is aware of this impending fatal complication and early radical surgery may save the life of the patient. in our case, there was no history of leg or groin trauma, surgery, radiation, or lymphadenopathy before the development of lymphedema. although we did not find viable parasites, the patient 's history and tissue findings support a diagnosis of chronic filariasis. in two previously reported cases, areas of calcifications were noted consistent with prior filarial infection, which was not seen in our case. histologically, all the four cases including ours, showed above described characteristic histological features.[24 ] we have ruled out epithelioid hemangioendothelioma, which is usually seen in middle aged people in soft tissue and visceral organs with no report of any cutaneous location. kaposi sarcoma can be ruled out, as it has never been described in association with chronic lymphedema. our patient was hiv 1 and 2 negative and there was no history of receiving any immunosuppressive therapy. patients suffering from chronic filarial lymphedema should be monitored for possible development of lymphangiosarcoma and any suspicious lesion should be biopsied. the prognosis of lymphangiosarcoma due to chronic lymphedema is similar to idiopathic angiosarcoma of head and face, however the behaviour of lymphangiosarcoma due to chronic filarial lymphedema is not known and therefore more cases need to be studied for proper understanding of its course. | lymphedema - associated angiosarcoma also known as lymphangiosarcoma is the commonest type of cutaneous angiosarcoma. post - mastectomy lymphedema is the most frequent cause, while chronic filarial lymphedema is one of the most uncommon etiology for development of lymphangiosarcoma. we report a case of a 50 year old male suffering from chronic filarial lymphedema of right lower extremity, presented with brownish nodules on the right leg, which were diagnosed histopathologically as lymphangiosarcoma. |
interstitial lung disease (ild) is defined as a specific form of chronic fibrosing interstitial pneumonitis limited to the lung. it is a rare, chronic, progressive, usually fatal interstitial lung disorder (1 - 3). in children, interstitial pneumonitis (ip) presents with a wide spectrum of histologic abnormalities that usually do not fit the classification for ip used in the adult population (4). the familial form can be described, as ip occurred in at least two members of a family (2, 3, 6). the proportion of familial ild is unknown, and a genetic basis of it is estimated to be 0.5 - 2.2% of cases (6). in approximately half of the clinically unaffected family members, it is transmitted as an autosomal dominant trait with reduced penetrance but autosomal recessive pattern is not excluded (3, 6 - 8). although the etiology of the majority of ilds is still unknown, there is increasing understanding of the cellular and cytokine interactions associated with inflammation and fibrosis. host susceptibility, genetic factors and environmental cofactors may influence clinical expression of each disease (9). the inflammatory process of ild begins with an initial injury to the alveolar and interstitial structures (alveolitis), which is followed by a stage of tissue repair and variable degrees of fibrosis, and an alveolar infiltrate with variable amounts of proteinaceous material (4, 10). the accumulation of proteinaceous material in the alveolar space is a characteristic finding in lung diseases associated with surfactant system abnormalities (4). there are reports that mutations in surfactant protein b (sp - b) and surfactant protein c (sp - c) are associated with familial usual interstitial pneumonitis in adults and with cellular nonspecific interstitial pneumonitis (nsip) in children (6). recently, a mutation in the gene encoding the hydrophobic, lung - specific sp - c was discovered in association with a decrease in the level of sp - c in familial ilds (4, 10, 11). here we report a very young korean girl with symptoms and radiological findings of ild similar to those of her older sister who died from this disease. chest computed tomography (ct) scans of both sisters were compared and the findings, etiology and treatment of this disease are discussed. a 21 month - old girl was brought to asan medical center suffering fever, cough and tachypnea for 4 months. abnormal lung findings were first noted by a chest radiography taken due to fever when she was 8 months old. the symptoms of the patient at 21 months of age were the same as those that her sister had shown at age 4 yr. physical examination of the patient revealed tachypnea at rest (beyond 60/min) and chest retraction without rales or wheezing, but no digital clubbing. on arrival at the hospital, the denver symptom score (12) of ild gave a value of 2 points meaning the patient showed respiratory symptoms but oxygen saturation was normal in room air under all conditions. blood, urine, sputum and stool studies revealed no evidence of acute viral or bacterial infection. neither virus (adenovirus, influenza virus, parainfluenza virus, respiratory syncytial virus, cytomegalovirus) nor bacteria was found in bronchoalveolar lavage fluid. the chest radiography showed a dense hazy area at the central region of both lungs and blunting on the left costophrenic angle. 1a) demonstrated diffuse fibrosis on the medial portion of both lung fields and subpleural consolidation along both lateral pleura. 1b), the sister of the patient had been diagnosed with uncharacterized ild, and died 5 months after diagnosis. surgical open lung biopsy (fig. a diagnosis of nsip was made based on the findings of diffuse, uniform thickening of the interstitium with lymphoplasmacytic infiltration and collagen fibrosis. some alveoli contain accumulation of intra - alveolar macrophages, while some alveoli had hyperplastic type ii alveolar pneumocytes. examination of peripheral blood cells from the patient 's parents also showed no evidence of mutations in these genes. the patient was treated with high - dose intravenous methylprednisolone (30 mg / kg / day, 3 doses every other day, monthly) and oral hydroxychloroquine (daily). during treatment, tachypnea and dyspnea on exertion were still evident and the denver symptom score was 2 points at follow - up. follow - up high resolution ct (hrct) showed that there was no further disease progression after 21 months. there have been previous reports of familial ild, and infants with this disease can become symptomatic in the first 6 weeks of life (1). such patients have tachypnea and respiratory distress with grunting, intercostal and subcostal retraction, and cyanosis. the mortality rate is high, especially in children younger than 1 yr (1). the ild of unknown origin which was developed in the present patient 's sister progressed quickly and she died at 4 yr of age, 5 months after she had been diagnosed. risk factors for ild are virus (adenovirus, epstein - barr virus, influenza virus, cytomegalovirus), mycoplasma or other infectious agents, drugs, chronic aspiration, environmental factors like metal dust and wood dust, and genetic predisposition (5, 13). given that investigations on the etiology of the present patient ruled out any environmental or infectious causes, we examined genetic factors. there were analyses of candidate loci near the human leukocyte antigen (hla) region of chromosome 6 to suggest a genetic basis for ild in familial cases (6). in addition, an association has been established between interstitial pulmonary fibrosis and 1-antitrypsin inhibition alleles present on chromosome 14 (2). recently, several investigators reported that multiple heterozygous mutations in the surfactant protein c gene were associated with ild (10). triggers such as infection or toxins may contribute to the wide diversity in clinical presentation of surfactant protein c gene - associated pulmonary fibrosis (6). in our case, the pathological findings were compatible with nsip but we did not find a surfactant protein gene mutation in lung biopsy samples or peripheral blood cells from the patient, or in peripheral blood cells from her parents. there was a report of fatal respiratory diseases in full - term infants with symptoms of surfactant deficiency in whom a deficiency of surfactant protein b was excluded. it suggested that the mutation of the genes for atp - binding cassette transporter a3 (abca3) that were involved in the transport of phospholipids and sterols could be associated with unexplained surfactant deficiency in full - term infants (14). hrct allows early diagnosis of ild and commonly shows patchy, predominantly peripheral, subpleural, bibasilar reticular abnormalities (15). the extent of pulmonary infiltration on ct is an important predictor of survival (2). we had two similar hrct images, one from the patient and the other from her sister whose disease had progressed further. the chronic pneumonitis in infancy is characterized by interstitial thickening with mesenchymal cells rather than inflammatory cells and by an alveolar infiltration with variable amounts of proteinaceous material (10, 15). the findings of the lung biopsy specimen from the present patient also showed mild, diffuse, and uniform thickening of the interstitium with mild fibrosis, consistent with the diagnosis of nsip. corticosteroid administration (1, 16, 17) has been the mainstay of therapy for ild, and chloroquine and hydroxychloroquine (1, 17) have also been used successfully in the treatment of childhood ip. for the present patient, treatment with methylprednisolone and hydroxychloroquine was initiated soon after ild diagnosis due to her family history. the denver symptom score was used to evaluate the symptoms, and continued use of this system indicated that patient 's disease was not progressing during 21 months of follow - up. in summary, we have described an infant with nsip whose sibling died from a similar disease. the need of early diagnosis and treatment with corticosteroids in combination with hydroxychloroquine for the familial ild could be considered. trying to determine the etiology of the familial form of this disease is likely to result in better treatment for these patients. | most of the interstitial lung diseases are rare, chronic, progressive and fatal disorders, especially in familial form. the etiology of the majority of interstitial lung disease is still unknown. host susceptibility, genetic and environmental factors may influence clinical expression of each disease. with familial interstitial lung diseases, mutations of surfactant protein b and surfactant protein c or other additional genetic mechanisms (e.g. mutation of the gene for atp - binding cassette transporter a3) could be associated. we found a 21 month - old girl with respiratory symptoms, abnormal radiographic findings and abnormal open lung biopsy findings compatible with nonspecific interstitial pneumonitis that is similar to those of her older sister died from this disease. we performed genetic studies of the patient and her parents, but we could not find any mutation in our case. high - dose intravenous methylprednisolone and oral hydroxychloroquine were administered and she is still alive without progression during 21 months of follow - up. |
the adjacent structures include the spleen, transverse colon, liver, diaphragm, pancreas, abdominal wall, adrenal gland, small intestine, and retroperitoneum. while the treatment strategy for locally advanced gastric cancer remains controversial, patients with proven t4 disease who achieve an r0 resection have a clinically and statistically significant survival advantage over those undergoing only palliative resection.1 we recently treated a patient with a large perforating gastric cancer with invasion of the abdominal wall. gastric perforation in this case was directed toward the abdominal wall and the initial presentation was that of soft tissue infection. to protect the peritoneal cavity from bacterial contamination, we incised the abscess pocket and drained pus before entering the peritoneal cavity. we report on this rare but critical case to discuss the optimal treatment plan and clinical course of an advanced gastric cancer invading the abdominal wall. a 71-year - old woman was admitted to the emergency department of our hospital with the complaint of a painful abdominal mass. the patient was malnourished and had poor hygiene ; at the time of admission, she was febrile with a temperature of 38 and her pulse rate was 106 beats per minute. there was no evidence of a heart murmur or lung crackles on auscultation, and the patient 's breath sounds were clear. there were no signs of abdominal or rebound tenderness suggestive of peritonitis ; however, there was a large tender mass in the abdominal left upper quadrant (fig. laboratory findings included : hemoglobin, 8.3 g / dl ; white blood cell count, 17,510/ml (89.3% neutrophils) ; blood urea nitrogen, 27.5 mg / dl ; creatinine, 0.38 mg / dl ; sodium, 142 meq / l ; chloride, 105 meq / l ; potassium, 3.2 meq / l ; and c - reactive protein, 304 mg / l. chest radiography showed no abnormalities and computed tomography of the abdomen revealed a large abscess pocket on the left anterior abdonmail wall originating from the greater curvature of the stomach (fig. 2). as a surgical emergency, we incised the mass and drained a large abscess. on entering the abdominal cavity through a midline incision, a huge gastric cancer invading the abdominal wall was observed, with no apparent distant metastasis. dissection of the stomach from the peritoneal membrane was impossible because the stomach cancer had penetrated into the soft tissue layer of the abdominal wall (fig. 3). therefore, we decided to perform total gastrectomy along with resection of the involved abdominal wall, including peritoneum, rectus abdominis muscle, and subcutaneous tissue. as a result, there was no remaining muscle or subcutaneous layer on the patient 's left upper quadrant, and the overlying skin was not viable due to thermal injury during the operation and a poor vascular supply (fig. 4). there was no way to repair the defect, and only wet gauze packing of the wound was performed. we could only perform d1 lymph node dissection for the perigastric lymph nodes because the patient was hypotensive and septic. the r status was expected to be r1 for the microscopic invasion of cancer cells into the abdominal wall. after surgery, the patient was admitted to the intensive care unit for postoperative care and received resuscitation. on the first postoperative day (pod), the vital signs became stable ; however, the patient was febrile with a temperature of 38.8 and chest radiography showed diffuse haziness in both lung fields. with spuiscion of pneumonia, intensive treatment, including broad - spectrmu antibiotics and parenteral nutrition, was performed, and she was closely observed for suspicious leakage at the anastomosis. on the third pod, the patient resumed oral intake, and chest radiography on the seventh pod showed improvement of the pneumonia. the patient was moved to a general ward on the eighth pod and resumed ambulation. wet dressing of the wound was continued and an abdominal binder was used to prevent evisceration of the rina - t abdominal organs through the abdominal ' hole. ' we planned to perform chemotherapy after improvement in her general condition ; however, the growth of the cancer progressed rapidly. on the 40th pod, 5), and the prognosis was expected to deteriorate. after discussing treatment plans with the patient and her family, we performed conservative management, including analgesics, sedatives, and nutrition for palliation. by the 60th pod, on the 82nd pod, she died of multiorgan failure caused by sepsis and pneumonia. harvested, 5 were cancer - cell positive (n2) ; the t stage could not be determined because of the anatomic disruption of the gastric serosa ; however it was suspected to be t4a for cancer invasion through the gastric wall into the abdominal wall. the management of locally advanced gastric cancer is challenging, as the balance between cancer - related mortality and operation - related complications should be considered in deciding treatment strategy. while two randomized controlled trials concluded that multiorgan resection significantly increased morbidity and mortality,23 recent retrospective studies reported that radical surgery could increase the survival rate.4 for cases with gastric cancer perforation and invasion into adjacent organs, such as this case, decision - making might be difficult, as the patient is often septic ; therefore, treatment is usually straightforward life - saving salvage. previously, local surgery, such as simple closure of the malignant perforation, has been the preferred treatment;5 however, heimlich6 reported in 1963 that immediate gastrectomy could improve survival. to the best of our knowledge, there has been no prospective study or large - scale retrospective study regarding optimal treatment strategy and clinical outcomes of advanced gastric cancer perforation with invasion of adjacent organs. according to recent studies, the attempt to perform curative resection including lymphadenectomy whenever technically feasible might secure a good clinical outcome.578 however, the results were disappointing for advanced gastric cancer perforation, such as our case. one study group reported that emergent gastrectomy with secondary lymphadenectomy could increase the survival ; however, they could not use this strategy in their 12 advanced gastric cancer cases.7 another case series reported on 13 perforated gastric cancers, of which 5 were advanced gastric cancer ; only one d2 lymph node dissection was possible5. survival duration may be related to the stage of gastric cancer and the type of surgery performed.5789 a recent systematic review reported that one - year survival was 12.0% to 66.7% for noncurative gastrectomy, 26.6% to 80.3% for gastric resection, and 3.0% to 37.5% for surgical bypass or exploratory laparotomy.9 however, the included study groups were different with respect to cancer stage and preoperative condition ; therefore, there seem to be no established data about the prognosis and clinical outcomes of perforated gastric cancer. despite the lack of evidence, it seems reasonable to attempt curative resection to the extent possible to improve the clinical outcome. the concern is possible cancer cell dissemination ; however, this might not significantly affect long - term survival in patients after gastrectomy.810 we contended with three problems in our case : 1) life - threatening sepsis ; 2) wound management ; 3) long - term survival. surgery was for curative intent, although d2 lymph node dissection could not be performed due to hemodynamic instability. the patient received intensive treatment after surgery, including broad - spectrum antibiotics and total parenteral nutrition to treat pneumonia and sepsis, and to prevent surgery - related complications, such as leakage of the anastomosis. we prevented immediate postoperative complications and focused on wound management. because there was no remaining tissue between the intra - abdominal organs and the skin in the left upper quadrant, we had no means of repairing the wound defect, including flap surgery, and the secondary healing of the wound was not anticipated. instead, we protected the wound with wet dressings and applied an abdominal binder to prevent evisceration of the intra - abdominal organs, along with infection prevention. we planned to perform chemotherapy after improvement of her general condition ; however, the growth of cancer progressed rapidly. on the 40th pod, the wound was filled with growing cancer and the patient died on the 82nd pod. the major concerns during treatment changed from life - saving and wound management to addressing goals of care. there have been no established treatment guidelines for perforated gastric cancer with invasion to adjacent organs, and no reports on gastric cancer invading the abdominal wall. in such cases, we believe that drainage of pus before surgery can protect the peritoneal cavity from contamination, and might be helpful in performing curative resection. | surgeons occasionally encounter a patient with a gastric cancer invading an adjacent organ, such as the pancreas, liver, or transverse colon. although there is no established guideline for treatment of invasive gastric cancer, combined resection with radical gastrectomy is conventionally performed for curative purposes. we recently treated a patient with a large gastric cancer invading the abdominal wall, which was initially diagnosed as a simple abdominal wall abscess. computed tomography showed that an abscess had formed adjacent to the greater curvature of the stomach. during surgery, we made an incision on the abdominal wall to drain the abscess, and performed curative total gastrectomy with partial excision of the involved abdominal wall. the patient received intensive treatment and wound management postoperatively with no surgery - related adverse events. however, the patient could not receive adjuvant chemotherapy and expired on the 82nd postoperative day. |
september 2011, mosquito larvae were collected in irrigated rice fields surrounding tiassal, southern cte divoire (55247n ; 44948w) and reared to adults in insectaries on a diet of mikromin (tetra, melle, germany) fish food. mosquitoes, 35 days of age, were exposed to 1 of 5 insecticides (0.1% bendiocarb, 1.0% fenitrothion, 0.75% permethrin, 0.05% deltamethrin, 4% ddt) or a control papers for 1 hour, according to standard who procedures (7). dna was extracted from individual mosquitoes according to the livak method (8), and a subsample of 500 mosquitoes were all found to be the m molecular form of an. the target site mutation g119s in the ace-1 gene (ace-1) and l1014f and l1014s kdr mutations were screened by using restriction fragment length polymorphism (10) or taqman assays (11), respectively. according to who criteria, an. gambiae mosquitoes from tiassal are resistant to all insecticide classes, and resistance is extremely prevalent ; more than two thirds of mosquitoes survived the diagnostic dose for 4 of the 5 insecticides tested (table 1). to assess the level of resistance, we exposed the tiassal population and a susceptible laboratory population of an. gambiae (kisumu) mosquitoes to the pyrethroid deltamethrin or the carbamate bendiocarb for a range of exposure times and assessed deaths 24 hours later (technical appendix). we found an unexpectedly strong resistance phenotype to the 2 insecticides (figure 1, figure 2). for deltamethrin, 4 hours of exposure were required to kill 50% (median lethal time, [lt50 ]) ; in comparison, the lt50 for the susceptible kisumu strain was < 2 minutes (resistance ratio = 138) (technical appendix). similarly, the lt50 for bendiocarb was nearly 5 hours for the tiassal strain yet < 12 minutes for the susceptible strain (resistance ratio = 24) (technical appendix). all mosquitoes were resistant according to world health organization classification (< 80% dead) (7). time - mortality curve for wild - caught anopheles gambiae mosquitoes from tiassal, southern cte divoire, exposed to deltamethrin (median time to death = 248 minutes). logistic regression line was fitted to time - response data by using sigmaplot version 11.0 (www.sigmaplot.com). time - mortality curve for wild - caught anopheles gambiae mosquitoes from tiassal, southern cte divoire, exposed to bendiocarb (median time to death = 286 minutes). logistic regression line was fitted to time - response data by using sigmaplot version 11.0 (www.sigmaplot.com). to investigate the causes of this resistance, we screened a subset of mosquitoes for the target site mutations, kdr 1014f and 1014s. only the 1014f kdr mutation was detected, and this resistance allele was found at high frequency (83%). there was a significant association between presence of the 1014f kdr allele and ability to survive exposure to ddt but not to either pyrethroid (table 2). in contrast, the ace-1 allele was strongly associated with survival after exposure to bendiocarb and fenitrothion (table 2). f and l represent mutant resistant alleles (phenylalanine) and wild - type alleles (leucine), respectively ; s and g represent mutant resistant alleles (serine) and wild - type alleles (glycine), respectively. no resistant homozygotes gg were found among the 186 mosquitoes genotyped for ace-1 by restriction fragment length polymorphism (a subset of 48 was further screened by using the taqman assay ; congruence between the 2 methods was 100%). the frequencies were calculated for each insecticide and mosquito status (alive / dead) after exposure. genotypic odds ratios (ors) are shown because these exceed allelic ors for ddt (recessive model), bendiocarb, and fenitrothion (both overdominant models), and are similar for permethrin and deltamethrin. for bendiocarb and fenitrothion absence of gg genotypes in the alive group means that ors are infinity, therefore ors are shown if one gg was present. f and l represent mutant resistant alleles (phenylalanine) and wild - type alleles (leucine), respectively ; s and g represent mutant resistant alleles (serine) and wild - type alleles. gambiae mosquitoes was first reported from cte divoire in 1993 (12) ; carbamate resistance was detected in the 1990s (13). nevertheless, 2 decades later, it is surprising and worrying to find complete resistance to all insecticides tested, particularly for deltamethrin and bendiocarb at such high levels. ace-1 is strongly associated with organophosphate and carbamate resistance, and the absence of 119s homozygotes might be attributable to the high fitness cost of the ace-1 allele in the absence of insecticide (14). presence of the 1014f kdr allele alone does not confer the ability to survive diagnostic doses of pyrethroids ; thus, alternative mechanisms must be responsible for the high - level pyrethroid resistance in this population. the selective pressures responsible for this intense multiple - insecticide resistance in tiassal mosquitoes are unclear. there is a high coverage of insecticide - treated bed nets, but this coverage does not differ from that in other parts of the continent, and indoor residual spraying has not been conducted in this region. this use is perhaps the most likely explanation in this district of intense commercial production of rice, cocoa, and coffee. whatever the cause, the implications of this resistance scenario for malaria control are severe. with no new classes of insecticides for malaria control anticipated until 2020 at the earliest (15), assessing the effect of pyrethroid resistance on the efficacy of insecticide - treated bed nets is complex because of the poorly understood associations between net integrity, insecticide content, net usage, and net efficacy. nevertheless, resistance levels, such as those reported here, combined with continual selection pressure will inevitably lead to suboptimal mosquito control by use of insecticide - treated bed nets and indoor residual spraying. if unchecked, this resistance could spread rapidly and threaten the fragile gains that have been made in reducing malaria across africa. time - mortality curve for anopheles gambiae mosquitoes, kisumu strain, exposed to deltamethrin and bendiocarb, and time - death data for adult female a. gambiae s.s. mosquitoes, tiassal strain, and standard susceptible colony kisumu 24 hours after exposure to bendiocarb or deltamethrin. | preventing malaria used to seem as simple as killing the vector, the mosquito ; however, a recent study shows that this concept is now anything but simple. the highly effective use of insecticide - treated bed nets and indoor insecticide spraying is being challenged by mosquito resistance to insecticides. in west africa, populations of this mosquito vector are now resistant to all 4 classes of insecticide approved for this use. and no new classes of insecticide are anticipated until 2020, at the earliest. development of newer classes of insecticide is crucial because if resistance continues unchecked, the hard - earned progress in malaria control in africa could be quickly reversed. |
many studies have shown a significant role for thyroid hormones in the development and maturation of the mammalian central nervous system.1,2 these hormones regulate axonal and dendritic growth and synapse formation.3 growth retardation and severe cognitive impairment are known complications following thyroid hormone deficiency in the prenatal and neonatal periods.4 it has been shown that hypothyroidism is associated with changes in gene expression in both the central and peripheral nervous system.5 the inability to produce long - term potentiation (ltp) in the rat hippocampus and impaired learning and memory in both rats and humans are among the functional consequences of hypothyroidism.6 other studies have suggested that hypothyroidism affects behavioral conditions and is accompanied by emotional symptoms, including lethargy and dysphoria.7 - 11 the results of other studies have shown that several cognitive deficits, including attention and memory processing deficits, general intelligence and visual - spatial skills, are induced by hypothyroidism.9,10 hypothyroidism has a lesser effect on auditory attention, motor skills, language and set - shifting.7,10,12 in addition, there is evidence indicating that even subclinical hypothyroidism is associated with depressive symptoms and cognitive impairment.13 nitric oxide (no), a free radical gas, is known to play critical roles in biologic systems;14 it acts like a diffusible intercellular signaling molecule in the brain and spinal cord.15 no synthase (nos) is the enzyme that produces no from l - arginine. no can act as an important mediator in synaptic plasticity, ltp and the consolidation of ltp.16 - 18 in addition, there are reports that suggest a relationship between nmda (n - methyl - d - aspartate)receptors and the no system in learning and memory.19,20 several studies have shown that nos inhibitors impair the consolidation of memory21,22 and block the induction of ltp.21 - 24 there is, however, some evidence showing that l - arginine, an no precursor, improves memory formation and reverses the effect of nos inhibition.25 there are also reports indicating that no donors activate both ltp and long - term depression.23,26 these results suggest the involvement of no in learning and memory processes. the relationship between thyroid hormones and the no system has been well documented.23,26 - 28 there is evidence that thyroid hormones are involved in regulating no synthase gene expression in the brain. considering the aforementioned findings, this study aimed to investigate the effect of hypothyroidism induced during the neonatal and juvenile periods on learning and memory of offspring and on no metabolite concentrations in the hippocampus. twenty pregnant female wistar rats (8 weeks old and weighing 200 20 g) were kept in separate cages at 22 2 c in a room with a 12 h light / dark cycle (light on at 7:00 am). offspring were randomly divided into two groups and treated according to the experimental protocol from the first day after birth through the first two months of life. rats in the control group received normal drinking water, whereas the second group received the same drinking water supplemented with 0.03% methimazole (sigma, usa) to induce hypothyroidism.29 after 60 days, seven male offspring of each group were randomly selected and tested in the morris water maze (mwm). in the methimazole group, hypothyroidism was confirmed by testing serum thyroxine concentration levels using the radioimmunoassay method (daisource, t4- ria - ct). animal handling and all related procedures were carried out in accordance with the rules set by the mashhad university of medical sciences ethical committee. a circular black pool (136 cm diameter, 60 cm high, 30 cm deep) was filled with water (2024 c). a circular platform (10 cm diameter, 28 cm high) was placed within the pool and was submerged approximately 2 cm below the surface of the water in the center of the southwest quadrant. outside the maze, fixed visual cues were present at various locations around the room (i.e., a computer, hardware and posters). an infrared camera was mounted above the center of the maze and an infrared led was attached to each rat for motion tracking. before each experiment, each rat was handled daily for 3 days and habituated to the water maze for 30 sec without a platform. the animals performed four trials on each of the eight consecutive days, and each trial began with the rat being placed in the pool and released facing the side wall at one of four positions (the boundaries of the four quadrants, labeled north (n), east (e), south (s) and west (w). the rat was allowed to swim until it found and remained on the platform for 15 seconds. if 60 seconds had passed and the animal had not found the platform, it was guided to the platform by the experimenter and allowed to stay on the platform for 15 sec. the rat was then removed from the pool, dried and placed in its holding bin for 5 min. the time latency to reach the platform and the length of the swimming path were recorded by a video tracking system.29,32 - 34 on the ninth day, the platform was removed, and the animals were allowed to swim for 60 s. the time spent in the target quadrant (q1) and the traveled path were compared between groups. after the last session of the mwm test, blood samples were taken from all rats to determine hypothyroidism status and to measure the no metabolites no2 and no3 (griess reagent method). the animals were then sacrificed, and hippocampi were removed and submitted to no metabolite measurements in the tissue. the griess reaction was adapted to assay nitrates as previously described.35 briefly, standard curves for nitrates (sigma, st. louis, missouri, usa) were prepared, and samples (50 l plasma and 100 l tissue suspension) were added to the griess reagent. the proteins were subsequently precipitated by the addition of 50 l of 10% trichloroacetic acid (sigma). the contents were then vortex - mixed and centrifuged, and the supernatants were transferred to a 96-well flat - bottomed microplate. absorbance was read at 520 nm using a microplate reader, and final values were calculated from standard calibration plots.36 swim time latency and the length of the traveled path over the eight training days were analyzed by repeated measures analysis of variance anova. the time spent in the target quadrant (q1) and the length of the swimming path in this quadrant was compared using unpaired t - tests. comparison of serum thyroxin levels and plasma levels of no metabolites was carried out using unpaired t - tests. twenty pregnant female wistar rats (8 weeks old and weighing 200 20 g) were kept in separate cages at 22 2 c in a room with a 12 h light / dark cycle (light on at 7:00 am). offspring were randomly divided into two groups and treated according to the experimental protocol from the first day after birth through the first two months of life. rats in the control group received normal drinking water, whereas the second group received the same drinking water supplemented with 0.03% methimazole (sigma, usa) to induce hypothyroidism.29 after 60 days, seven male offspring of each group were randomly selected and tested in the morris water maze (mwm). in the methimazole group, hypothyroidism was confirmed by testing serum thyroxine concentration levels using the radioimmunoassay method (daisource, t4- ria - ct). animal handling and all related procedures were carried out in accordance with the rules set by the mashhad university of medical sciences ethical committee. a circular black pool (136 cm diameter, 60 cm high, 30 cm deep) was filled with water (2024 c). a circular platform (10 cm diameter, 28 cm high) was placed within the pool and was submerged approximately 2 cm below the surface of the water in the center of the southwest quadrant. outside the maze, fixed visual cues were present at various locations around the room (i.e., a computer, hardware and posters). an infrared camera was mounted above the center of the maze and an infrared led was attached to each rat for motion tracking. before each experiment, each rat was handled daily for 3 days and habituated to the water maze for 30 sec without a platform. the animals performed four trials on each of the eight consecutive days, and each trial began with the rat being placed in the pool and released facing the side wall at one of four positions (the boundaries of the four quadrants, labeled north (n), east (e), south (s) and west (w). for each trial, the rat was allowed to swim until it found and remained on the platform for 15 seconds. if 60 seconds had passed and the animal had not found the platform, it was guided to the platform by the experimenter and allowed to stay on the platform for 15 sec. the rat was then removed from the pool, dried and placed in its holding bin for 5 min. the time latency to reach the platform and the length of the swimming path were recorded by a video tracking system.29,32 - 34 on the ninth day, the platform was removed, and the animals were allowed to swim for 60 s. the time spent in the target quadrant (q1) and the traveled path were compared between groups. after the last session of the mwm test, blood samples were taken from all rats to determine hypothyroidism status and to measure the no metabolites no2 and no3 (griess reagent method). the animals were then sacrificed, and hippocampi were removed and submitted to no metabolite measurements in the tissue. the griess reaction was adapted to assay nitrates as previously described.35 briefly, standard curves for nitrates (sigma, st. louis, missouri, usa) were prepared, and samples (50 l plasma and 100 l tissue suspension) were added to the griess reagent. the proteins were subsequently precipitated by the addition of 50 l of 10% trichloroacetic acid (sigma). the contents were then vortex - mixed and centrifuged, and the supernatants were transferred to a 96-well flat - bottomed microplate. absorbance was read at 520 nm using a microplate reader, and final values were calculated from standard calibration plots.36 swim time latency and the length of the traveled path over the eight training days were analyzed by repeated measures analysis of variance anova. the time spent in the target quadrant (q1) and the length of the swimming path in this quadrant was compared using unpaired t - tests. comparison of serum thyroxin levels and plasma levels of no metabolites was carried out using unpaired t - tests. the serum thyroxine concentration in methimazole - treated animals was significantly lower compared to that of control animals (p<0.01 ; fig. 1). in addition, the time latency and the length of the swimming path over the eight training days were significantly higher in offspring of the methimazole group (p<0.001 ; figs. 2 and 3, respectively). in the probe trial, the time spent in the target quadrant (q1) by the offspring of the methimazole group was significantly lower compared to controls (p<0.001 ; fig. 4a). furthermore, the length of the traveled path in q1 by animals in the methimazole group was shorter than for those in the control group (p<0.001 ; fig. 4b). there were no significant differences in the time spent or the length of the swim path in the other quadrants between the two groups. in addition, there were no significant differences between the plasma concentrations of no2 or no3 ; however, the concentration of no metabolites in the hippocampi of the methimazole group offspring was higher than that of the control animals (p<0.05 ; figs. 5a and 5b, respectively). neonatal hypothyroidism has been clearly shown to be related to cognitive dysfunction.9 - 11,37,38 for example, studies in humans have shown that a temporal deficiency in thyroid hormones during developmental periods impairs cognitive functions such as attention, learning and memory.39 experimental hypothyroidism in developing rats has also been shown to result in impaired learning and memory.40,41 in this study we induced hypothyroidism in rats, resulting in impaired learning and memory during the neonatal and juvenile periods. hypothyroidism impairs hippocampal - dependent learning and short- and long - term memory.42,43 in addition, hypothyroidism impairs early and late phases of ltp.44 the exact mechanisms underlying the induced deficits in memory and ltp have not been elucidated. many studies have demonstrated that cognitive dysfunction in hypothyroidism is likely due to abnormal brain development, diminished inter - neuronal connectivity and, in particular, impaired synaptic plasticity in the hippocampus.45 it has been shown that maturation and function of the hippocampus are dependent on thyroid hormones.43 transient hypothyroidism has even been shown to impair synaptic transmission and plasticity in the adult hippocampus.46,47 it has also been reported that impairment of ltp and memory due to hypothyroidism correlates with changes in c - jun and c - fos protein expression and extracellular signal regulated kinases (erks) levels in the hippocampus during crucial periods of brain development.48,49 changes in the expression of other proteins such as synapsin i, synaptotagmin i, and syntaxin may also be involved in hypothyroidism - induced memory deficits.50 it has also been suggested that thyroid hormone deficiency results in changes in brain regions such as the dorsal hippocampal - mpfc pathway and changes in the glutamate release, which can lead to cognitive disturbances.51 - 53 moreover, hypothyroidism has been shown to induce oxidative stress in the hippocampus.54 the relationship between oxidative stress, neuronal damage and cognitive dysfunction has been well documented.55 - 58 in addition, it is well known that neonatal hypothyroidism is accompanied by a delay in myelinogenesis and a decrease in the number of myelinated axons.59,60 in the present study, we have shown that a deficiency of thyroid hormones during lactation and in the neonatal period could impair learning of offspring in the mwm test. the animals in the hypothyroid group had significantly higher time latency to find the platform during every day of training (fig. 2), indicating a deleterious effect of the lack of thyroid hormones on spatial learning processes. the results presented here also confirm that methimazole - induced hypothyroidism during the neonatal and juvenile periods impairs spatial memory given that the animals in the hypothyroid group spent less time in the target quadrant compared to the control group when tested on the ninth day (probe trial ; fig. the results of the present study are consistent with findings from our previous study, in which we found an impairment in the mwm in adult rats with methimazole - induced hypothyroidism over a 180-day period.29 it has also been reported that treatment of thyroidectomized adult rats with thyroxine improved radial arm water maze tasks and ltp in the ca1 area of the hippocampus.61 these researchers showed that cyclic - amp response element binding protein (creb) and mitogen - activated protein kinases (mapks) may contribute to the impairment of hippocampal - dependent learning and memory ; however, the authors suggested that calcium - calmodulin - dependent nos and brain - derived neurotrophic factor (bdnf) may not have roles in this process.61 the free radical gas no has been associated with different forms of learning and memory and in several forms of synaptic plasticity thought to be involved in memory formation. this association has been widely confirmed via pharmacological studies, which have utilized a variety of substances and methods to inhibit no synthase. results from knockout studies in mice have revealed that mice deficient in enos and nnos expression exhibit impaired ltp.20,61 - 65 it has also been reported that nitrergic neurons, the neurons that produce no, increase in number after spatial learning in rats, which can be interpreted as upregulation induced by behavioral training.63 this evidence implies that no participates in the memory process.63 in contrast to these results, which indicate a positive role for no in learning and memory, it has been shown that inhibition of nos does not prevent the induction of ltp or impair spatial memory. thus, these findings suggest that no does not play an important role in memory and learning.66 here, we have examined the relationship between no and hypothyroidism. we found that both hypothyroidism and impaired mwm performance were present in the methimazole group. we also found a significant increase in hippocampal no metabolites in the methimazole - treated group. the association between hypothyroidism and increased no levels in the brain has been previously investigated. one study indicated that maternal thyroid hormone deficiency during the early gestational period resulted in a significant elevation in neuronal nitric oxide synthase (nnos) expression with associated neuronal death in the embryonic rat neocortex.67 it has also been shown that nnos acts as a negative regulator of neurogenesis.67 - 69 the inhibitory effect of no on neurogenesis may be due to a reduction in the proliferative potential of neural precursor cells70 or a defect in the survival of newly generated neurons after differentiation.71 there is evidence showing that thyroid hormone deficiency increases cell death.67 the relationship between nnos and poor survival of neurons and thyroid hormone deprivation has also been suggested.67 it has been shown that even a moderate and transient decrease in maternal thyroxine significantly increases nnos expression, which is reversible by hormone replacement.67,72 in contrast, another report showed that propylthiouracil (ptu)-treated animals exhibited reduced nos activity that could be rescued by t4 administration.72 it has also been shown that hypothyroidism changes the pattern of nos activity in a tissue - dependent manner. nos activity was significantly increased in both the right and left ventricles, but it was significantly reduced in the aorta, whereas in the vena cava, renal cortex and medulla, the enzyme activity was non - significantly higher compared to controls.73 the results of the present study also showed no difference in no metabolites between the hypothyroid group and controls in peripheral blood samples. it might be suggested that an increase in no in the hippocampus is due to stimulatory effects of thyroid hormone deprivation on nnos activity. although some studies have suggested no to be a neurotransmitter that plays an important role in enhancing memory, others have claimed that its excess in the hippocampus may result in memory deficits.74 no has been shown to have bidirectional effects. under normal physiological conditions, it acts as an important neuronal messenger ; however, when no increases to high concentrations, it has a toxic effect that can lead to neuronal death.75 - 77 a common example of the toxic effect of no in the cns is due to glutamate neurotransmission and the activation n - methyl - d - aspartate (nmda) receptors, which leads to significant increases in intracellular calcium, followed by stimulation of neuronal nos.77,78 finally, other findings have suggested selective enhancement of reactive oxygen species (ros) and lipid peroxidation in the amygdala and hippocampus of rats after three weeks of treatment with methimazole. these authors showed a significant increase in nos activity,54 suggesting a correlation between increased nos activity and elevated oxidative stress. it may therefore be suggested that increased no production in the hippocampus during hypothyroidism acts as an oxidative stressor, which may explain the deficits in learning and memory observed here. in this study, we found that hypothyroidism induced during the neonatal and juvenile periods resulted in impaired learning and memory of rats tested in the morris water maze. in addition, we found an increase in no metabolites in the hippocampus, suggesting that the impairment of memory in hypothyroidism may be due to increases in nos and no. we would like to thank the vice chancellor of research of mashhad university of medical sciences for financial support. | introduction : severe cognitive impairment follows thyroid hormone deficiency during the neonatal period. the role of nitric oxide (no) in learning and memory has been widely investigated.methods:this study aimed to investigate the effect of hypothyroidism during neonatal and juvenile periods on no metabolites in the hippocampi of rats and on learning and memory. animals were divided into two groups and treated for 60 days from the first day of lactation. the control group received regular water, whereas animals in a separate group were given water supplemented with 0.03% methimazole to induce hypothyroidism. male offspring were selected and tested in the morris water maze. samples of blood were collected to measure the metabolites of no, no2, no3 and thyroxine. the animals were then sacrificed, and their hippocampi were removed to measure the tissue concentrations of no2 and no3.discussion:compared to the control group 's offspring, serum thyroxine levels in the methimazole group 's offspring were significantly lower (p<0.01). in addition, the swim distance and time latency were significantly higher in the methimazole group (p<0.001), and the time spent by this group in the target quadrant (q1) during the probe trial was significantly lower (p<0.001). there was no significant difference in the plasma levels of no metabolites between the two groups ; however, significantly higher no metabolite levels in the hippocampi of the methimazole group were observed compared to controls (p<0.05).conclusion : these results suggest that the increased no level in the hippocampus may play a role in the learning and memory deficits observed in childhood hypothyroidism ; however, the precise underlying mechanism(s) remains to be elucidated. |
organochlorines are persistent lipophilic compounds that accumulate in inuit people living in circumpolar countries. organochlorines accumulate as a result of the inuits ' large consumption of sea mammal fat ; however, available data are limited to blood lipids, milk fat, and adipose tissue. we report results of organochlorine determination in liver, brain, omental fat, and subcutaneous abdominal fat samples collected from deceased greenlanders between 1992 and 1994. eleven chlorinated pesticides and 14 polychlorinated biphenyl congeners were measured in tissue lipid extracts by high - resolution gas chromatography with electron capture detection. mean concentrations of polychlorinated biphenyls, 2, 2'-bis(4-chlorophenyl)-1,1-dichloroethylene, ss - hexachlorocyclohexane, hexachlorobenzene, mirex, trans - nonachlor, and oxychlordane in adipose tissue samples from greenlanders were 3 - 34-fold higher than those measured using the same analytical method in samples from canadians in quebec city, quebec. brain lipids contained lower concentrations of all organochlorines than lipids extracted from other tissues. organochlorine residue levels in lipid extracts from liver, omental fat, and subcutaneous abdominal fat samples were similar, with the exception of ss - hexachlorocyclohexane, which reached a greater concentration in liver lipids than in lipids from both adipose tissues (4-fold ; p < 0. 05). comparisons with available international data on adipose tissue levels reveal that the organochlorine body burden in the inuit population of greenland is presently among the highest resulting from environmental exposure.imagesfigure 1 |
|
a 35-year - old male, who suffered from tinnitus in the right side since childhood, presented in emergency with a history of sudden and severe headache of two hours duration. there was no associated relevant history and he was alert and oriented. there was slight nuchal rigidity and bruit could be heard in the occipital region on both sides. computed tomography scan done immediately showed diffuse subarachnoid haemorrhage (sah) along the inferior surface of the tentorium. magnetic resonance imaging (mri) showed abnormal flow voids just anterior to the torcula and in the left cerebellar hemisphere. 1). intracranial angiogram revealed a davf adjacent to the confluence of venous sinuses and an associated large focal venous ectasia (varix) near the torcula (fig. the main feeders were from both of occipital, ascending pharyngeal, middle meningeal and posterior meningeal arteries. these feeders converged into a big varix just anterior and to the right of the confluence and had two drainage outlets. the retrograde flow or reflux wandered into the left cerebellar cortical veins and multiple varices formation in the left cerebellar hemisphere whereas the other was an antegrade flow into the dominant right transverse sinus via a small channel. the patient was initially managed in another hospital by endovascular procedure for flow reduction, where the main feeders were palliatively embolized using particles via the transarterial route. feeders from right occipital, right middle meningeal and left occipital arteries were embolized and the main residual feeder was the left ascending pharyngeal artery. the patient 's symptom was improved and his tinnitus reduced in intensity. since there was a significant residual lesion, the patient was referred to our hospital for complete obliteration of the fistula. transvenous embolization (tve) was performed through the transfemoral approach six weeks after the first procedure. the procedure was performed under local anaesthesia and moderate sedation with propofol (diprivan, astrazeneca k.k., osaka, japan). a coaxial system was used to cannulate the transverse sinus. a 6 fr, 90 cm guiding sheath (shuttle - sl ; cook, bloomington, in, usa) and 6 fr, 100 cm, curved tip guiding catheter (envoy mpc, cordis, miami, fl, usa) were placed in the internal jugular vein. through this 6 fr guiding catheter, a 4 fr, 125 cm guiding catheter (cerulean g, medikit, tokyo, japan) was placed in the right transverse sinus (fig. the excelsior 1018 microcatheter (boston scientific, natick, ma, usa) was carefully placed at the origin of the left cerebellar cortical vein. the preferential and rapid flow into the refluxed vein helped us to easily direct the tip of the microcatheter. the distal end of this vein was occluded with 8 coils of various sizes from different companies. 3b). then the main varix was filled with 26 coils with an aim to block all the shunt points (fig. there were residual shunt points which allowed the flow of arterial blood into the transverse sinus. booster transarterial embolization with polyvinyl alcohol (pva) particles and microfibrous collagen was then performed through the left external carotid artery (eca). a complete occlusion of davf mri acquired 5 days after procedure showed thrombosis of the all the varices and cerebellar cortical vein without any edema or infarction (fig. a 35-year - old male, who suffered from tinnitus in the right side since childhood, presented in emergency with a history of sudden and severe headache of two hours duration. there was no associated relevant history and he was alert and oriented. there was slight nuchal rigidity and bruit could be heard in the occipital region on both sides. computed tomography scan done immediately showed diffuse subarachnoid haemorrhage (sah) along the inferior surface of the tentorium. magnetic resonance imaging (mri) showed abnormal flow voids just anterior to the torcula and in the left cerebellar hemisphere. 1). intracranial angiogram revealed a davf adjacent to the confluence of venous sinuses and an associated large focal venous ectasia (varix) near the torcula (fig. the main feeders were from both of occipital, ascending pharyngeal, middle meningeal and posterior meningeal arteries. these feeders converged into a big varix just anterior and to the right of the confluence and had two drainage outlets. the retrograde flow or reflux wandered into the left cerebellar cortical veins and multiple varices formation in the left cerebellar hemisphere whereas the other was an antegrade flow into the dominant right transverse sinus via a small channel. the patient was initially managed in another hospital by endovascular procedure for flow reduction, where the main feeders were palliatively embolized using particles via the transarterial route. feeders from right occipital, right middle meningeal and left occipital arteries were embolized and the main residual feeder was the left ascending pharyngeal artery. the patient 's symptom was improved and his tinnitus reduced in intensity. since there was a significant residual lesion, the patient was referred to our hospital for complete obliteration of the fistula. transvenous embolization (tve) was performed through the transfemoral approach six weeks after the first procedure. the procedure was performed under local anaesthesia and moderate sedation with propofol (diprivan, astrazeneca k.k., osaka, japan). a coaxial system was used to cannulate the transverse sinus. a 6 fr, 90 cm guiding sheath (shuttle - sl ; cook, bloomington, in, usa) and 6 fr, 100 cm, curved tip guiding catheter (envoy mpc, cordis, miami, fl, usa) were placed in the internal jugular vein. through this 6 fr guiding catheter, a 4 fr, 125 cm guiding catheter (cerulean g, medikit, tokyo, japan) was placed in the right transverse sinus (fig. 3a). the excelsior 1018 microcatheter (boston scientific, natick, ma, usa) was carefully placed at the origin of the left cerebellar cortical vein. the preferential and rapid flow into the refluxed vein helped us to easily direct the tip of the microcatheter. the distal end of this vein was occluded with 8 coils of various sizes from different companies. then the main varix was filled with 26 coils with an aim to block all the shunt points (fig., there were residual shunt points which allowed the flow of arterial blood into the transverse sinus. booster transarterial embolization with polyvinyl alcohol (pva) particles and microfibrous collagen was then performed through the left external carotid artery (eca). a complete occlusion of davf mri acquired 5 days after procedure showed thrombosis of the all the varices and cerebellar cortical vein without any edema or infarction (fig. davf in adulthood is usually considered to be an acquired and progressive disease and there is no relationship to the hereditary or developmental disorders. but there are a few case reports of davf in neonates and childhood which indicate a congenital origin [4, 5 ]. a long standing history of tinnitus in the present case might point towards the congenital origin of this davf. the formation of many cerebellar varices suggests a cortical venous reflux and asymptomatic chronic venous congestion. thus, a delicate balance between the inflow of arterial blood and the venous outflow contained the disease. the location of the varix was just anterior and to right side of the confluence of sinuses, probably in the subdural space. the wall of the varix abutted the cerebellar convexity dura as well as the tentorium. it received feeders from the meningeal branches of eca and vertebral arteries and tentorial branches of the internal carotid artery (ica). hence the fistulous points were located both in the convexity dura as well as the tentorium. since, it can not be categorised as a tentorial davf or a dural transverse sinus fistula alone, we have labelled it as a davf of the confluence. davf with leptomeningeal venous drainage or an associated varix are defined as high risk and are associated with a dismal natural history. these high risk fistulas typically present with hemorrhage or progressive neurological deficits. because the draining veins transverse the various compartments from the dura to the brain parenchyma, their rupture may create subdural, subarachnoid or intracerebral hemorrhage. in the present case, the cerebellar cortical vein which was the major drainage route must have burst in the subarachnoid space leading to subarachnoid bleeding. parenchymal hematoma is more often reported with similar type of davf and the varices in the cerebellar hemisphere were a potential source like present case. similar arterialised arachnoid draining veins at a distance from the nidus have been attributed for hemorrhage. in the literature, the angiographic features associated with the aggressive behaviour of the davfs include location at the tentorial incisura, leptomeningial or galenic venous drainage and presence of venous aneurysms. davf in the present case had a unique arterial feeder and venous drainage pattern which developed over the years. there were multiple feeders in dura and tentorium from all the major cranial arteries which opened into a large bowl like varix located in the subdural space. the varix was actually the pouch like dilated terminal portion of the cortical vein which had grown in size over the years due direct feeders. the normal antegrade drainage via a small channel opening in the sinus was the residual non - dilated distal portion of vein. similar parallel venous channel as the recipient pouch in the transverse and sigmoid sinus dural fistulae has been described by caragine. over the years, with recruitment of more feeders and increase in the calibre of the vessels, the flow into the varix might gradually increase. this resulted in outflow resistance due to thickening of the walls of the sinuses. and this reflux resulted in arterialisation of the vein and formation of multiple varices in the cerebellar parenchyma. this was not associated with any sinus thrombosis or any symptoms of parenchymal venous congestion. however, the flow of blood was more towards the cortical vein than the sinus as could be interpreted from the preferential movement of the catheter tip during the procedure. a perfect division of the out flowing blood through both the routes might prevent a catastrophe for such a long duration. the suddenness of the symptomatology can be explained by growing inflow of arterial blood by recruitment of fresh feeders. the walls of the veins and varices were strong enough to bear the pressure of arterial blood only up to a certain extent. in many cases reported in the literature the draining sinuses are blocked early in the course of disease leading to symptomatic cortical venous reflux. however, in this case the sinuses remained patent till the end. partial tae was performed in the acute phase for flow reduction as a palliative procedure. though the patient was symptomatically better, it was thought that complete obliteration of the fistula was essential to prevent its growth and another hemorrhagic event. on repeated angiogram at our center, there was an increase in the shunt flow as compared to the postprocedural angiogram after first embolization. this indicates the malignant nature of the lesion and its growth potential even in 6 weeks. tve for tentorial davf is to occlude the shunt points directly i.e., target embolization and thus restore the normal drainage pattern. many authors believe in obliterating the patent sinus to achieve a radical cure, although this has been condemned by others [9, 10 ]. tve is essentially indicated when davf is supplied from arteries supplying cranial nerves, predominant ica feeders and potential eca - ica collateral anatomises. many authors do not advocate tve due to complex venous anatomy in these cases, risk of venous perforation and incidence of venous hemorrhagic infarction. however, a meticulous and direct attack at the shunt point is the key to success in this procedure. early embolization of draining vein may lead to rupture of the varix directly associated with the fistula. but in the present case, we first embolized the draining vein. because we were afraid that partial embolization of davf resulted in the residual reflux, as that vein was the source of sah. partial reduction of arterial flow into the fistula has decreased the risk of rupture of the varix during the embolization of the vein. after achieving complete occlusion of the cerebellar vein, we quickly embolized the varix with the coils. and residual feeders from the eca could be embolized with the pva particles through the transarterial route. thus, a combination of various methods and a sandwich technique could help us attained complete obliteration. the davfs near the confluence are notorious and difficult to treat because of complex anatomy. they may fall into the combined category of tentorial medial davf and dural transverse sinus fistula according to the existing nomenclature. surgical, radiosurgical or endovascular approach might be one of the therapeutic options [11, 12 ]. and a combination of transarterial and transvenous route might be essential for radical cure. staged treatment to reduce the complication rates and to have a better understanding of the flow dynamics is recommended. endovascular embolization could be supplemented with surgical obliteration of residual lesion or radiosurgery in refractory cases [13, 14 ]. | dural arteriovenous fistula (davf) is classically defined as abnormal arteriovenous connections located within the dural leaflets. though the exact etiology is still not clear, they are generally accepted as acquired lesions. however, some davfs formed as the congenital disorders are called dural arteriovenous malformations and these lesions with a marked cortical venous reflux are considered to be aggressive and warrant an early intervention. the authors describe a case of 35-year - old man presented with unique type of davf. the fistula was located adjacent to the confluence of venous sinuses with multiple feeders. the feeders drained into a large venous pouch just anterior to the confluence which had a bilateral venous drainage. this was associated with multiple cerebellar venous ectasia along the draining cortical vein. it was managed by staged endovascular procedures and complete cure could be achieved. the pathogenesis and technique of embolization of this complex fistula / malformation are also discussed. |
dynamic interactions between proteins and dna underlie many biological processes and, as such, are the subject of intense investigation. numerous laboratories are now tackling these problems using new optical microscopy - based methods that enable the direct visualization of dna molecules or proteindna complexes at the single - molecule level in real time, and the information garnered from these experiments is being used to build detailed mechanistic models of many different types of reactions. additionally, micro- and nanoscale devices, in combination with optical - based detection, are also becoming increasingly powerful tools for the manipulation and analysis of individual dna molecules. one problem with many single - molecule techniques is that they are inherently designed to probe individual reactions, and as a consequence, it can be challenging to gather statistically relevant data. therefore, it is advantageous to establish new experimental platforms that can increase throughput capacity of single - molecule imaging while at the same time making these approaches both easier and more readily applicable to biological reactions involving different types of dna transactions. in an effort to help make single - molecule techniques more accessible, we have sought to develop novel methods enabling high - throughput single - molecule imaging by integrating nanoscale engineering, microfluidics, and lipid bilayer - coated surfaces with single - molecule optical microscopy. a key aspect of these new experimental platforms is that they utilize inert lipid bilayers to passivate the fused silica surface of a microfluidic sample chamber. artificial lipid membranes deposited on solid supports have proven to be useful for many types of biochemical studies. the chemical characteristics of the bilayer can be controlled through careful selection of the constituent lipids ; they can be partitioned with chemical or mechanical barriers, and the distributions of molecules anchored to lipids can be manipulated using photochemical modulation, electrical fields, or hydrodynamic force. on the basis of these properties, we have demonstrated that artificial bilayers can be used in combination with manually etched microscale barriers to lipid diffusion to align hundreds of lipid - tethered dna molecules ; we refer to these aligned molecules as dna curtains. alignment of the lipid - tethered dna is achieved by using hydrodynamic force to push the molecules into the leading edge of the diffusion barriers. more recently, we have employed electron beam (ebeam) lithography to fabricate diffusion barriers with nanoscale dimensions, which allows for much more precise control over both the location and lateral distribution of the dna molecules within the curtains. these nanofabricated dna curtains permit simultaneous visualization of thousands of individual dna molecules that are perfectly aligned with respect to one another and offer the potential for massively parallel data acquisition from thousands of individual proteindna complexes in real time using a robust experimental platform amenable to a wide variety of biological applications. we have also shown that these dna curtains are advantageous for studying proteindna interactions at the single - molecule level, and we have begun to apply these tools to biological systems such as nucleosomes and chromatin remodeling, homologous dna recombination, and postreplicative mismatch repair. one drawback of our previous dna curtain designs is that they require continuous application of a hydrodynamic force during data collection. this is because just one end of the dna is anchored to the lipid bilayer. if buffer flow is terminated, the single - tethered dna does not remain stretched, and as a consequence, it can not be visualized along its full contour length because it drifts outside of the detection volume defined by the penetration depth of the evanescent field. the need for buffer flow is not problematic for many types of measurements ; however, the hydrodynamic force exerted by the flowing buffer can potentially impact the behavior of proteins or protein complexes, and the magnitude of this impact is expected to scale in proportion to the hydrodynamic radius of the molecules under observation. the influence of buffer flow is especially apparent during measurements involving proteins that slide on dna by one - dimensional diffusion, because an applied flow force can strongly bias the direction in which the proteins travel along the dna.(26) here we have developed nanofabricated surface patterns for making curtains of aligned dna molecules anchored by both ends to the surface of a microfluidic sample chamber. these patterns are termed dna racks and are comprised of linear barriers to lipid diffusion, similar to our previous designs, along with arrays of metallic pentagons, which are coated with antibodies directed against a small molecule tag present at one end of the dna. the pentagons then serve as solid anchor points positioned at a defined distance downstream from the linear barriers. once aligned at the linear barriers and anchored to the pentagons, the double - tethered dna molecules are maintained in an extended state suspended above an inert lipid bilayer and remain confined within the detection volume defined by the penetration depth of the evanescent field. this anchoring strategy circumvents the requirement for continuous buffer flow and allows observation of long dna molecules along their full contour length, even in the absence of an applied hydrodynamic force. fused silica slides (g. finkenbeiner, inc.) were cleaned in nanostrip solution (cyantek corp., fremont, ca) for 20 min, then rinsed with acetone and 2-propanol, and dried with n2. the slides were spin - coated with a bilayer of polymethylmethacrylate (pmma) [molecular weight of 25k, 3% in anisole, and molecular weight of 495k, 1.5% in anisole (microchem, newton, ma) ], followed by a layer of aquasave conducting polymer (mitsubishi rayon). each layer was spun at 4000 rpm for 45 s using a ramp rate of 300 rpm / s. polygon patterns and linear barriers were written by ebeam lithography using an fei sirion scanning electron microscope equipped with a pattern generator and lithography control system (j. c. nabity, inc., resist was developed using a 3:1 solution of 2-propanol and methyl isobutyl ketone (mibk) for 1 min with ultrasonic agitation at 5 c. a 1520 nm layer of gold atop a 35 nm adhesion layer of either chromium (cr) or titanium (ti) was deposited using a semicore electron beam evaporator. alternatively, a 1520 nm layer of cr was deposited directly onto the fused silica without need for an adhesion layer. alternatively, barriers were made out of just a 1520 nm layer of chromium, as previously described. following liftoff, barriers were imaged using a hitachi 4700 scanning electron microscope and a psia xe-100 scanning probe microscope in noncontact mode. nanoimprint masters were fabricated using electron beam lithography, liftoff, and inductively coupled plasma etching. briefly, a bilayer of polymethylmethacrylate (pmma, 25k and 495k) was spun onto a silicon wafer with a thin coating of silicon dioxide. patterns were written by an fei sirion sem outfitted with a nabity nanopattern generation system and then developed in a 2-propanol / methyl isobutyl ketone mixture (3:1) at 5 c in a bath sonicator. the patterned masters were then plasma - etched to a depth of 100 nm in a mixture of c4f8 and o2 (9:1) for 90 s at a power of 300 w using an oxford icp etch tool. nanoimprint masters were then coated with a fluorinated self - assembled monolayer (nanonex, princeton, nj) to prevent adhesion between the master and resist. to make nanoimprinted barriers, pmma 35k (microresist technologies) was spin - coated on a fused silica microscope slide and baked on a hot plate for 5 min at 180 c. nanoimprint was performed in two stages : a 2 min preimprint phase with a pressure of 120 psi and pretemperature of 120 c followed by a 5 min imprint phase with a pressure of 480 psi and temperature of 190 c. this heated the pmma well above its glass transition temperature and allowed it to conform to the mold. after imprinting had been conducted, a descum process was undertaken to remove 10 nm of residual pmma. descum was done in an inductively coupled plasma under chf3 and o2 (1:1) and a power of 200 w for 40 s total (two iterations of 20 s). after descum, 1520 nm of cr was evaporated on the samples and liftoff was performed in a 9:1 mixture of methylene chloride and acetone at 65 c for several hours, followed by bath sonication to remove stray metal flakes. inlet and outlet ports were made by boring through the slide with a high - speed precision drill press equipped with a diamond - tipped bit [1.4 mm outside diameter (kassoy) ]. the slides were cleaned by successive immersion in 2% (v / v) hellmanex, 1 m naoh, and 100% meoh. the slides were rinsed with filtered sterile water between each wash and stored in 100% meoh until they were used. prior to assembly, the slides were dried under a stream of nitrogen and baked in a vacuum oven for at least 1 h. a sample chamber was prepared from a borosilicate glass coverslip (fisher scientific) and double - sided tape (25 m thick, 3 m). inlet and outlet ports (upchurch scientific) were attached with hot - melt adhesive (surebonder glue sticks, fpc corp.). the total volume of the sample chambers was 4 l. a syringe pump (kd scientific) and actuated injection valves (upchurch scientific) were used to control sample delivery, buffer selection, and flow rate. the flow cell and prism were mounted in a custom - built heater with computer - controlled feedback regulation to control the temperature of the sample between 25 and 37 c (0.1 c), as necessary. after each use, the slides were soaked in meoh to remove the ports and tape, rinsed with water, washed briefly (1520 min) with nanostrip, and rinsed with water. this procedure was sufficient to clean the slide surfaces for reuse, and each slide could be used multiple times without degrading the quality of the optical surface or the metallic patterns. dna curtains were constructed as described previously, with the exception of additional steps necessary for anchoring the second end of the dna. all lipids were purchased from avanti polar lipids, and liposomes were prepared as previously described. in brief, a mixture of dopc (1,2-dioleoyl - sn - glycerophosphocholine), 0.5% biotinylated dppe [1,2-dipalmitoyl - sn - glycero-3-phosphoethanolamine - n-(cap biotinyl) ], and 810% mpeg 550-pe { 1,2-dioleoyl - sn - glycero-3-phosphoethanolamine - n-[methoxy(polyethylene glycol)-550]}. the mpeg does not affect bilayer formation or assembly of the dna curtains but rather serves to further passivate the surface against nonspecific adsorption of quantum dots (which we use in our studies of proteindna interactions). liposomes were applied to the sample chamber in three injections of 200 l followed by 5 min incubations. excess liposomes were flushed away with 1 ml of buffer a, which contained 10 mm tris - hcl (ph 7.8) and 100 mm nacl, and the bilayer was incubated for an additional 30 min. buffer a with 25 g / ml anti - dig fab (roche), anti - fitc (invitrogen), or anti - brdu igg (sigma) was then injected into the sample chamber and incubated for 30 min. the sample chamber was then flushed with 1 ml of buffer b, which contained 40 mm tris - hcl (ph 7.8), 1 mm dtt, 1 mm mgcl2, and 0.2 mg / ml bsa, and incubated for an additional 5 min. one milliliter of buffer a containing neutravidin (330 nm) was then injected into the sample chamber and incubated for 20 min. the flow cell was then rinsed with 3 ml of buffer b to remove any unbound neutravidin. one milliliter of dna (20 pm) labeled at one end with biotin and at the other end with either digoxigenin, fitc, or bromodeoxyuridine (as indicated) and prestained with 12 nm yoyo1 was injected into the sample chamber in five 200 l aliquots, with a 23 min incubation period following each injection. the dna was then aligned at the linear barriers using a flow rate of 0.02 ml / min, and this rate was then increased to 23 ml / min to anchor the second end of the dna molecules. the dna substrates were made by ligating oligonucleotides to the 12-nucleotide overhangs at the end of the phage genome (48.5 kb). ligation mixes (total volume of 1 ml) contained 4 nm dna (invitrogen), 1 m biotinylated oligonucleotiode (5-pagg tcg ccg ccc [fitc]-3 or 5-pagg tcg ccg ccc [dig]-3), 1 m fitc - labeled oligonulceotide (or dig - labeled oligonucleotide ; 5-pggg cgg cga cct [bioteg]-3), and 1 ligase buffer (neb). the reaction mix was warmed to 65 c for 10 min and then cooled slowly to room temperature. after the mixture had cooled, ligase was added [t4 dna ligase (400 units/l) or taq ligase (40 units/l), neb ], and the mixture was incubated overnight at 42 c. reaction mixtures that included t4 ligase were then heat - inactivated at 65 c for 10 min, and the ligated dna products were purified over a sephacryl s200hr column (ge healthcare) run in 10 mm tris - hcl (ph 7.8), 1 mm edta, and 150 mm nacl. a dig - labeled oligonucleotide complementary to a position 14711 bp from the biotinylated end of the dna, 500 l of dna [200 pm, labeled at the ends with biotin and fitc (as described above) ] was incubated for 2 h with the nicking enzyme nt.bstnbi (50 units, neb) at 55 c in a buffer containing 10 mm tris - hcl (ph 7.8), 10 mm mgcl2, and 150 mm nacl. one millimolar oligonucleotide (5-pttc aga gtc tga ctt tt[dig]-3) was added to the solution, and the mixture was incubated at 55 c for 20 min and then cooled slowly to room temperature over the course of 1 h. atp was then added to a final concentration of 1 mm along with 2000 units of t4 ligase, and the reaction mixture was incubated at room temperature for 90 min. the ligase was then heat - denatured by incubation at 65 c for 20 min. the basic design of the microscope used in this study has been previously described.(10) in brief, the system is built around a nikon te2000u inverted microscope with a custom - made illumination system. for this study, a 488 nm, 200 mw diode - pumped solid - state laser (coherent, sapphire - cdhr) was used as the excitation source. the laser was attentuated as necessary with a neutral density filter and centered over the dna curtain by means of a remotely operated mirror (new focus). tirfm images were collected using a 60 water immersion objective lens (nikon, 1.2 na plan apo) and a back - illuminated emccd detector (photometrics, cascade 512b). anti - flag - labeled quantum dots (qds, invitrogen) were prepared as described previously.(21) mlh1 (250 nm) and anti - flag qds (500 nm) were incubated at a 1:2 protein : qd ratio in 20 mm tris (ph 7.8) and 100 mm nacl for more than 30 min on ice. the qd - tagged mlh1 was diluted to a final concentration of 10 nm in buffer containing 40 mm tris (ph 7.8), 1 mm dtt, 1 mm atp, 50 mm nacl, 1 mm mgcl2, and 0.4 mg / ml bsa and then injected into a sample chamber containing preassembled double - tethered dna curtains. here we expand on our previous work and demonstrate the development of new nanofabricated barrier patterns, termed dna the rack patterns utilize a combination of two distinct functional elements, and an overview of the general design is presented in figure 1a, c. in principle, one end of the dna is first anchored via a biotinneutravidin interaction to a supported lipid bilayer coating the surface of the fused silica sample chamber (figure 1b, c), as previously described. in the absence of a hydrodynamic force, the molecules are randomly distributed on the surface and lie primarily outside of the detection volume defined by the penetration depth of the evanescent field (150200 nm). application of buffer flow pushes the dna through the sample chamber while the biotinylated dna ends remain anchored within the mobile bilayer. the first pattern elements are linear barriers to lipid diffusion, which are oriented perpendicular to the direction of buffer flow at strategic locations in the path of the dna (figure 1b, c) ; these linear barriers are designed to halt the forward movement of the lipid - tethered dna molecules through the sample chamber, causing them to accumulate at the leading edge of the barriers where they then extend parallel to the surface. the second elements of the pattern are a series of arrayed pentagons positioned at a defined distance behind the linear barriers. the distance between the linear barriers and the pentagons is optimized for the length of the dna to be used for the experiments (figure 1b, c, and see below). the channels between the adjacent pentagons are intended to minimize accumulation of lipid - tethered dna molecules between the linear barriers and the pentagon arrays. this design feature takes advantage of our previous observation that geometric barrier patterns can be used to direct the movement of dna by making use of barrier edges that are not perpendicular to the direction of buffer flow.(9) any dna molecules anchored to the bilayer between the two barrier elements are expected to slide off the angled edges of the pentagons and should be funneled through the channels. the pentagons are also designed to present a large, exposed surface that can be nonspecifically coated with antibodies directed against small molecule haptens [either digoxigenin (dig), fluorescein isothiocyanate (fitc), or bromodeoxyuridine (brdu) (see below) ], which are covalently linked to the ends of the dna opposite the ends bearing the biotin tag (figure 1b). when the dna molecules are aligned along the linear barriers and stretched perpendicular to the surface, the hapten - tagged dna ends should bind the antibody - coated pentagons (figure 1c). in this scenario, the dna molecules should remain stretched parallel to the surface even when no buffer is being pushed through the sample chamber (figure 1c). panel a shows a diagram of the total internal reflection fluorescence microscope (tirfm) used to image single molecules of dna. for imaging with the tirfm, the long dna molecules (48 kb) used in these studies must be extended parallel to the surface of the sample chamber to remain confined within the evanescent field. panels b and c depict a cartoon illustration of the bilayer on the surface of a fused silica slide, and a single barrier set comprised of a linear barrier and a series of aligned pentagons separated by nanochannels. also depicted is the response of tethered dna molecules to the application of a hydrodynamic force. the magenta circles are the biotinylated ends, and the red squares are the hapten (digoxigenin, fitc, or brdu)-labeled ends of the dna. the top and bottom parts of panels b and c depict views from the side and above, respectively. in the absence of buffer flow, the dna molecules are tethered to the surface but are not confined within the evanescent field, nor are they aligned at the barrier. as depicted in panel c, when flow is applied, the dna molecules are dragged through the bilayer until they encounter the linear diffusion barrier, at which point they will align with respect to one another and the dig - labeled ends become anchored to the antibody - coated pentagons. dna located between the linear barriers and the pentagons passes through the nanochannels and goes to the next available linear barrier in the pattern. to achieve these desired design features, chromium (cr) or gold (au) barrier patterns were made on a 1 in. 3 in. fused silica slide glass by either ebeam lithography as previously described or nanoimprint lithography (see materials and methods). for most of the work described below, each slide contained 16 total rack patterns, arranged in a 4 4 array at the center of the slide. each rack pattern was 260 m in length with a distance of 13 m between the linear barriers and the back of pentagons. the center - to - center distance between each of the rack patterns within the 4 4 array was 500 m in the x - direction (parallel to the direction of buffer flow) and 370 m in the y - direction (perpendicular to the direction of buffer flow). the total area encompassed by the 4 4 array of rack patterns was 1513 m 1370 m (2.073 mm). figure 2 shows the characterization of a typical dna rack pattern made by ebeam lithography. figure 2a shows an optical image of the overall pattern design ; figure 2b shows measurements of these parameters using atomic force microscopy (afm), and figures 2c, d, and e show characterization of the patterns with scanning electron microscopy (sem). as demonstrated from these images, the height of the pattern elements was typically on the order of 20 nm and the width of the channels between adjacent pentagons was 500 nm, and as indicated above, the optimal distance between the leading edge of the linear barriers and the back of the pentagon array was 13 m. this distance was specifically selected for use with phage dna, a commercially available linear dna substrate that is 48502 bp with a fully extended contour length of approximately 16.5 m (see below). the separation distance of 1113 m between the leading edge of the linear barrier and the front and rear edges of the pentagons corresponds to 6580% mean extension of the dna substrate, depending upon the precise anchoring position on the pentagon surface. panel a shows an optical image of a single barrier set collected at 100 magnification, and relevant pattern dimensions are indicated. an afm image of a rack pattern is shown in panel b highlighting the height of the linear barriers and the pentagons, as well as the distance between these two barrier elements. an sem image of another rack pattern with a single linear barrier and the arrayed pentagons is shown in panel c, and details of the different barrier elements are shown in panels d and e. the overall design of the dna rack relies upon the selective but nonspecific adsorption of antibodies to the relatively large exposed surface of the metallic pentagons. the bilayer will coat the fused silica surface but will not coat the metallic patterns, leaving the nanofabricated patterns exposed to solution. antibodies injected into the sample chamber should not adsorb to the inert lipid bilayer, nor should they adsorb to the fused silica slide glass that is protected by the bilayer. the antibodies can nonspecifically adsorb to the exposed surfaces of both the linear barriers and the pentagons, because neither of these are protected by the bilayer and both are made from the same material. however, the larger exposed surface area of the pentagons should ensure adsorption of more antibody relative to the smaller area encompassed by the linear barriers. each pentagon has a surface area of 1.55 m, and there are 167 pentagons for each 260 m long linear barrier. this corresponds to a total surface area of 372 m for the pentagons compared to just 36 m for an entire linear barrier. in addition, any antibodies bound to the linear barriers will not interfere with the overall anchoring strategy, because any dna anchored to the linear barriers through a haptenantibody interaction would not be confined to the region encompassed by the evanescent field once buffer flow was terminated and would not be visible with the tirfm (see below). to assemble the double - tethered dna curtains, the surface of the flow cell was first coated with a lipid bilayer, as previously described, with the exception that bsa was omitted from all buffers used prior to deposition of the antibodies. omission of bsa was essential to ensure that the exposed pentagon surfaces were not passivated prior to the addition of the antibodies. once the bilayer was assembled on the surface, anti - dig fab (roche) or anti - fitc igg (invitrogen) was injected into the sample chamber and allowed to adhere nonspecifically to the exposed metal barriers. following a brief incubation, the free antibody was rinsed from the flow cell and replaced with buffer containing 0.2 mg / ml bsa, which served as a nonspecific blocking agent to passivate any remaining exposed surfaces. neutravidin was then injected into the sample chamber, where it could bind to the biotinylated lipids. dna labeled at one end with biotin and at the other end with dig (see materials and methods) was stained with the fluorescent intercalating dye yoyo1 and then injected into the sample chamber. following injection of the dna, the sample chamber was incubated briefly without buffer flow to allow the biotinylated ends to adhere to the surface of the bilayer, and then buffer flow was applied to push the dna molecules into the linear barriers. the anchored dna molecules were then imaged with the tirfm in the presence and absence of buffer flow. as previously reported, single - tethered dna curtains assembled with linear barriers could only be viewed when buffer was flowing, but the molecules drifted out of the evanescent field and disappeared from view when flow was terminated (figure 3a). in contrast, when the dna curtains were made using the new rack patterns, the anchored molecules remained fully extended and visible by tirfm even when no buffer was flowing through the sample chamber (figure 3b, c). any dna molecules that were anchored to the surface by just one end (either via the biotin or dig tag) can not be viewed along their contour length when buffer flow was terminated. rather, the bilayer - tethered ends of these molecules remain visible, causing a high background of fluorescence signal upstream of the linear barrier (i.e., outside the area of observation). this does not happen at the leading edge of the pentagons, because fewer dna molecules become anchored to the relatively small area of bilayer between the linear barrier and pentagon array, and also because any dna molecules that do happen to become anchored in the region are free to pass through the gaps between the adjacent pentagons. the fact that the single - tethered molecules disappear from view in the absence of buffer flow can be used to take advantage of the spatially selective illumination geometry provided by tirf illumination and ensures that any single - tethered dna molecules will not comprise imaging of the double - tethered dna. panel a shows a typical example of a single - tethered curtain, in the absence (top) and presence (bottom) of buffer flow. panels b and c show examples of double - tethered dna curtains in the absence of any buffer flow, illustrating that the dna molecules remain extended even in the absence of continual hydrodynamic force. the cr barrier patterns in panel b were made by ebeam lithography, and those in panel c were made by nanoimprint lithography. panel d shows the relative anchoring efficiency of the second dna end as a function of the separation distance between the linear barrier and the polygon array, revealing a peak tethering efficiency corresponding to 13 m, which corresponds to 80% extension of the dna relative to its full contour length (48502 bp, 16.5 m). panel d shows the percent of digoxigenin - labeled dna that remains anchored after defined time intervals, revealing a half - life of 69 min. several experimental parameters were assessed to optimize assembly of the double - tethered dna curtains. the relative anchoring efficiency was tested for rack patterns made with variable spacing between the linear barriers and pentagon anchor points (ranging from 5 to 15 m). as expected, the most efficient anchoring occurred with pattern distances corresponding to the length of the flow - stretched dna [13 m (figure 3d)].(10) control experiments with dna lacking the hapten tag or flow cells not treated with antibodies verified that both the dig label and the fab fragments were necessary for efficiently anchoring the two ends of the dna. approximately 95% of the anchored dna could be attributed to specific antibodyhapten interactions, with the remaining 5% due to nonspecific anchoring of the identity of the antibodyhapten pair was also investigated, and double - tethered dna curtains could be made using substrates that were end - labeled with a single digoxigenin, fitc, or brdu, and pentagons coated with the corresponding anti - dig, anti - fitc, or anti - brdu antibodies, respectively. the number of double - tethered dna molecules anchored to the surface decreased slowly over time, with a half - life of > 1 h for the dig - labeled molecules (figure 3e), in good agreement with the expectations for a high - affinity antibodyhapten interaction. the half - life of the fitc - anchored dna was comparable to that of the dig - anchored dna (not shown). however, the brdu - anchored dna molecules (labeled with either one or three brdu tags) had a much stronger tendency to dissociate from the pentagons, displaying a half - life on the order of just a few minutes (data not shown). finally, the double tethering procedure worked equally well with barriers made or chromium (cr) or gold (au), and neither of these materials interfered with acquisition of the fluorescent images. the cr patterns appeared dark against the background (figure 3b), because the cr blocks the incident light from the laser beam, whereas au barriers appeared bright against the darker background, presumably because a surface plasmon (sp) is established within the thin au layer and either the sp is more intense than the surrounding evanescent field on the fused silica or additional light is scattered due to the intrinsic roughness of the gold surface. this allowed the au patterns to be directly imaged with the tirfm, enabling the pattern elements to serve as fiduciary markers on the sample chamber surface (see below and figure 4c). defined orientation of the dna molecules. panel a shows a schematic diagram of the dna substrate labeled at each end with either biotin or fitc, as indicated, and labeled at an internal position with digoxigenin (dig). the internal dig tag was located 14711 bp from the biotinylated end of the dna and was labeled with an anti - dig - coated quantum dot (qd). panel b shows a schematic representation of the expected location of the fluorescent qd (magenta dots) if the dna molecules (green lines) are in the expected orientations (top panel) or the incorrect orientation (bottom panel) or randomly distributed between the two possible orientations (bottom panel). panel c shows an example of a double - tethered dna curtain labeled at the internal position with the anti - dig - coated qds ; the top panel shows a black and white image, and the bottom panel shows a pseudocolored version of the same image (the dna is green and the qds are magenta). fluorescent points outside of the nanofabricated pattern represent qds that are nonspecifically adsorbed to the bilayer. these are easily distinguished from those bound to dna because they do not colocalize with the dna molecules and are also free to diffuse in two dimensions, whereas those immobilized on the dna are not. the patterns used in this image were made from au (1520 nm) with a thin (35 nm) ti adhesion layer and appear bright against a darker background. the location of each of the dna - bound qds was determined by fitting the images to two - dimensional gaussian functions, as described previously,(23) and the position data were then plotted as a histogram in panel d. the differential chemistries used to tag the two ends of the dna were selected such that the molecules within the double - tethered curtains should be aligned in a defined orientation. that is, the biotinylated end should be anchored at the edge of the linear barriers, and the hapten - tagged end should be anchored to the downstream pentagons. this orientation specificity can be tested using an asymmetrically labeled dna substrate tagged with a fluorescent quantum dot [qd (figure 4a) ]. if the dna molecules were aligned as expected, then a qd located at a single specific site within the dna should appear as a fluorescent line spanning the dna curtain (figure 4b, top panel). the line of qds should be oriented perpendicular to the long axis of the extended dna molecules and should coincide with the known location of the engineered tag. if the dna were in the opposite orientation from that which was expected, then the qds would be found at an incorrect location within the double - tethered curtain (figure 4b, middle panel). finally, if the dna molecules were randomly oriented, then the qds should reveal both possible orientations of the dna molecules (figure 4b, bottom panel). to confirm that the dna was oriented correctly, the molecules were labeled at one end with fitc, labeled at the other with biotin, and labeled with dig at a position 14711 bp from the biotin tag (see materials and methods). the internal dig labels were made using an oligonucleotide replacement strategy in which the dna was nicked at specific sites with a nicking endonuclease and short ssdna fragments flanked by the resulting nicks were replaced with a dig - tagged oligonucleotide (see materials and methods). experiments with dna curtains anchored by a single end confirmed that the qds were present at a single location within the dna molecules as dictated by the sequences of the oligonucleotides.(25) the double - tethered curtains were then assembled using pentagons coated with anti - fitc antibodies, and the dig tags were labeled by injecting anti - dig - coated qds into the sample chamber. as shown in figure 4c, the dna - bound anti - dig qds were aligned with one another, and the mean position of the qd tags was found to be 14645 1585 bp (n = 78) from the biotinylated dna ends, which coincided to within 66 bp of the expected location (figure 4d). these results confirmed that all of the dna molecules anchored to the surface via the nanofabricated rack patterns were aligned in the same orientation, as defined by the distinct function groups engineered at the opposing ends of the dna molecules. the primary motivation for development of these double - tethered dna curtains was to facilitate visualization of passive diffusion of proteins along dna.(26) for example, in previous work, we have demonstrated that the msh2msh6 protein complex can diffuse in one dimension (1d) along duplex dna.(21) the msh2msh6 protein is an essential component of the postreplicative mismatch repair machinery and is responsible for locating and initiating repair of biosynthetic dna replication errors. our initial studies with the msh2msh6 complex relied upon dna molecules that were tethered by both ends to neutravidin nonspecifically absorbed to a fused silica surface.(21) with this approach, we would typically obtain only 1030 dna molecules per flow cell that were suitable for making diffusion measurements, often limiting data collection to just one molecule per field of view. moreover, these double - tethered dna molecules were randomly distributed on the flow cell surface and had to be manually located by scanning the entire surface of the flow cell, which made these 1d diffusion measurements technically demanding and time - consuming. as shown above, using the engineered surfaces with dna rack patterns, we can now visualize thousands of dna molecules per flow cell, and on the order of 50100 in each field of view. here we demonstrate that these anchored curtains of dna are suitable for studying proteindna interactions. to determine whether the double - tethered dna curtains made using the nanofabricated rack patterns could be used to study 1d diffusion of proteins, we tested the mismatch repair protein mlh1,(32) which was labeled with a single qd via a flag epitope tag ; complete analysis of qd - tagged mlh1 will be presented elsewhere.(33) the labeled proteins were injected into a flow cell containing a curtain of yoyo1-stained double - tethered dna molecules, and videos were collected over a 60 s period. as shown in figure 5a, we could readily detect binding of mlh1 to the dna molecules within the double - tethered curtains. there were 79 dna molecules and 235 dna - bound proteins observed in this single field of view (figure 5a), illustrating the dramatic improvement of this approach compared to our previous technique for making double - tethered dna molecules. the region of the bilayer below the pentagons was devoid of qds, indicating that adsorption of the qd - tagged mlh1 complex to the bilayer was minimal. the proteins that were bound to the double - tethered dna curtain diffused rapidly in one dimension along the dna molecules, exhibiting a mean diffusion coefficient of 0.14 0.13 m / s, and this motion was revealed in kymograms made from representative examples of molecules found within the dna curtains (figure 5b ; detailed analysis of this diffusive behavior will be presented elsewhere(33)). this experiment provides direct evidence that the double - tethered dna curtains assembled using nanofabricated rack patterns can be used to visualize the lateral motion of fluorescently tagged proteins along the dna molecules. using dna racks to visualize 1d protein diffusion. panel a shows an example of a double - tethered dna curtain bound by qd - labeled mlh1. this image represents a single 100 ms image taken from a 1 min video (not shown). panel b shows three representative kymograms (designated ac) made from individual dna molecules from within panel a. panel c shows examples of dna molecules taken from panel a that broke during the course of dna collection (numbered 13), demonstrating that both the dna and the bound proteins diffuse rapidly away from the surface and out of the evanescent field, this confirming that the qd - tagged proteins are not adsorbed to the bilayer. to verify that the lipid bilayers remained inert when used with the dna rack devices, we assessed whether the protein or dna molecules remained bound to the surface after breaking the dna. if either the proteins or the dna were nonspecifically linked to the lipid bilayer that coated the sample chamber surface, then they should remain within the evanescent field and in the field of view even if the dna breaks or detaches from one of its anchor points. in contrast, if neither the proteins nor the dna interacts nonspecifically with the bilayer, then detachment of the dna should cause the molecules to retract away from the surface and they should rapidly disappear from view. as shown in figure 5c, when the dna molecules randomly detached from the surface during the course of an observation, the proteins almost immediately disappeared from view as they drifted outside the detection volume defined by the penetration depth of the evanescent field. taken together, these data demonstrate that the fluorescently tagged proteins were bound to the dna, that the dna molecules interacted only with the sample chamber surface through their anchored ends, and that neither the qd - tagged proteins nor the dna interacted nonspecifically with the lipid bilayer. single - molecule imaging offers many unique opportunities to probe biological reactions in ways not possible through conventional biochemical or biophysical approaches. to facilitate these studies, we are developing new techniques for controlling the spatial organization of surface - anchored dna molecules within the confines of a microfluidic sample chamber. our unique approaches are based upon surface engineering techniques that enable us to control the distribution of dna substrates with micro- and nanoscale precision. here we build upon our previous work by using direct - write electron beam or nanoimprint lithography to fabricate patterns comprised of linear diffusion barriers followed by pentagonal anchor points, which together provide different functional features enabling dna curtains to be anchored by both ends on the surface of a microfluidic sample chamber. we refer to these patterned surfaces as dna racks because the molecules are stretched out and anchored to the flow cell surface where they can be viewed with the tirfm. we have demonstrated that these rack patterns can be used along with wide - field tirf microscopy to visualize hundreds of individual, perfectly aligned dna molecules, all of which are arranged in the same orientation and anchored by both ends to the sample chamber surface. although we have used pentagons as anchor points in this study, it is likely that other shapes would function just as well. an important aspect of these devices is that the fused silica surface is coated with a supported lipid bilayer, and the dna molecules are suspended above this bilayer, ensuring that they are maintained within an inert microenvironment compatible with a range of biological molecules. as with our previous nanofabricated devices, this new approach is relatively simple and robust, the flow cells are reusable, the barriers themselves are uniform, and they do not compromise the optical quality of the fused silica or interfere with signal detection. however, none of these methods offers the ability to pattern thousands of dna molecules all aligned in the same orientation using an experimental platform that is compatible with protein biochemistry and single - molecule fluorescence imaging. one drawback of our approach is that we have limited control over the tension of the dna, and the tension can not be varied during the course of an experiment, as can be done with techniques such as laser tweezers. however, it may be possible to integrate a multiplexed optical trap into our dna curtain experiments, which would provide a means for independently controlling the tension on the dna molecules within the curtain. as a first conceptual demonstration, we have shown that the curtains of double - tethered dna can be used to image 1d diffusion of dna - binding proteins. our previous approach to these experiments relied upon dna that was randomly anchored to a surface via biotinneutravidin interactions, which typically yielded no more than one to three molecules of dna per field of view, with just 1030 double - tethered dna molecules present over the entire surface of the flow cell. in addition, the molecules were randomly oriented on the flow cell surface, making it difficult to locate and compare different dna molecules. while this original approach proved to be useful for our initial studies, it was tedious and challenging to collect sufficient data for thorough analysis. as demonstrated here, we are now able to visualize on the order of 100 dna molecules per field of view, thousands of molecules are present on the surface of a typical flowcell, and all of these dna molecules are aligned in the exact same orientation. this novel approach will make 1d diffusion measurements and molecule - to - molecule comparisons more straightforward in future work. | single - molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. here we develop new strategies to construct curtains of dna in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the dna to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. this double - tethered dna substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements : linear barriers to lipid diffusion that align dna molecules anchored by one end to the bilayer and antibody - coated pentagons that provide immobile anchor points for the opposite ends of the dna. these devices enable the alignment and anchoring of thousands of individual dna molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the dna. this unique strategy offers the potential for studying proteindna interactions on large dna substrates without compromising measurements through application of hydrodynamic force. we provide a proof - of - principle demonstration that double - tethered dna curtains made with nanofabricated rack patterns can be used in a one - dimensional diffusion assay that monitors the motion of quantum dot - tagged proteins along dna. |
proteins are the major components of the living cell. they play crucial roles in the maintenance of life and protein dysfunctions may cause development of various pathological conditions. although for a very long time it has been believed that the specific functionality of a given protein is predetermined by its unique 3d structure [1, 2 ], it is recognized now that the fate of any given polypeptide chain is determined by the peculiarities of its amino acid sequence. in fact, figure 1 shows that although many proteins are indeed predisposed to fold into unique structures which evolved to possess unique biological functions, some proteins can misfold either spontaneously or due to the mutations and other genetic alterations, problematic processing or posttranslational modifications, or due to the exposure to harmful environmental conditions. such misfolding is now considered as a crucial early step in the development of various protein conformation diseases. finally, for more than five decades, researchers have been discovering individual proteins that possess no definite ordered 3d structure but still play important biological roles. the discovery rate for such proteins has been increasing continually and has become especially rapid during the last decade. such proteins are widely known as intrinsically disordered proteins (idps) among other names and are characterized by the lack of a well - defined 3d structure under physiological conditions. the discovery and characterization of these proteins is becoming one of the fastest growing areas of protein science and it is recognized now that many such proteins with no unique structure have important biological functions [416 ]. structural flexibility and plasticity originating from the lack of a definite - ordered 3d structure are believed to represent a major functional advantage for these proteins, enabling them to interact with a broad range of binding partners including other proteins, membranes, nucleic acids, and various small molecules [1719 ]. the functions attributed to idps were grouped into four broad classes : (1) molecular recognition ; (2) molecular assembly ; (3) protein modification ; and (4) entropic chain activities [5, 6 ]. idps are often involved in regulatory / signaling interactions with multiple partners that require high specificity and low affinity [7, 20 ]. some illustrative biological activities of idps include regulation of cell division, transcription and translation, signal transduction, protein phosphorylation, storage of small molecules, chaperone action, and regulation of the self - assembly of large multiprotein complexes such as the ribosome [410, 1316, 2027 ]. the crucial role of idps in signaling is further confirmed by the fact that eukaryotic proteomes, with their extensively developed interaction networks, are highly enriched in idps, relative to bacteria and archaea (see below, [2830 ]). recently, application of a novel data mining tool to over 200 000 proteins from swiss - prot database revealed that many protein functions are associated with long disordered regions [1315 ]. in fact, of the 711 swiss - prot functional keywords that were associated with at least 20 proteins, 262 were found to be strongly positively correlated with long intrinsically disordered regions (idrs), whereas 302 were strongly negatively correlated with such regions [1315 ]. therefore, the functional diversity provided by disordered regions complements functions of ordered protein regions. although unbound idps are disordered in solution, they often perform their biological functions by binding to their specific partners. this binding involves a disorder - to - order transition in which idps adopt a highly structured conformation upon binding to their biological partners [3138 ]. in this way, idps play diverse roles in regulating the function of their binding partners and in promoting the assembly of supramolecular complexes. furthermore, because sites within their polypeptide chains are highly accessible, idps can undergo extensive posttranslational modifications, such as phosphorylation, acetylation, and/or ubiquitination (sumoylation, etc.), allowing for modulation of their biological activity or function. intriguingly, idps were shown to be highly abundant in various diseases, giving rise to the disorder in disorders or d concept which generally summarizes work in this area. as the number of idps and idrs in various proteomes is very large (e.g., for mammals, ~75% of their signaling proteins are predicted to contain long disordered regions (> 30 residues), about half of their total proteins are predicted to contain such long disordered regions, and ~25% of their proteins are predicted to be fully disordered), and because idps and idrs have amazing structural variability and possess a very wide variety of functions, the unfoldome and unfoldomics concepts were recently introduced [4, 40, 41 ]. the use of the suffix the oxford english dictionary (oed) attributes genome to hans winkler from his 1920 work. while the oed suggests that genome arose as a portmanteau of gene and chromosome, this does not seem to be supported by literature. instead, lederberg and mccray suggest that as a botanist, winkler must have been familiar with terms such as biome (a biological community), rhizome (a root system), and phyllome (the leaves covering a tree) among others, all of which were in use well before 1920 and all of which signify the collectivity of the units involved. implies the complete set of the objects in question, with genome signifying the set of genes of an organism. by changing the e in -ics, the new word is created that indicates the scientific study of the -ome in question. for example, officially the change of genome to genomics occurred in 1987, when a journal by this name was founded by victor lederberg and mccray. many additional conversions from ome to omics have subsequently occurred and a large number of -omes have been accepted in biology, including but not limited to the following : genome, proteome, interactome, metabolome, transcriptome, diseasome, toxicogenome, nutrigenome, cytome, oncoproteome, epitome, and glycome, and so forth. for a more complete list, the reader is directed to http://omics.org/. overall, the suffixes ome and omics imply a new layer of knowledge, especially when a scientist is dealing with the data produced by the large - scale studies, including the high - throughput experiments and the computational / bioinformatics analyses of the large datasets. the unfoldome and unfoldomics concepts unfoldome is attributed to a portion of proteome which includes a set of idps (also known as natively unfolded proteins, therefore, unfoldome). the term unfoldome is also used to cover segments or regions of proteins that remain unfolded in the functional state. it considers not only the identities of the set of proteins and protein regions in the unfoldome of a given organism but also their functions, structures, interactions, evolution, and so forth. it is clearly recognized now that the disorderedness is linked to the peculiarities of amino acid sequences, as idps / idrs exhibit low sequence complexity and are generally enriched in polar and charged residues and are depleted of hydrophobic residues (other than proline). these features are consistent with their inability to fold into globular structures and form the basis of computational tools for disorder prediction [8, 10, 4548 ]. these same computational tools can also be utilized for the large - scale discovery of idps in various proteomes (see below). being characterized by specific (and somewhat unique) amino acid sequences, idps possess a number of very distinctive structural properties that can be implemented for their discovery. this includes but is not limited to sensitivity to proteolysis, aberrant migration during sds - page, insensitivity to denaturing conditions, as well as definitive disorder characteristics visualized by cd spectropolarimetry, nmr spectroscopy, small - angle x - ray scattering, hydrodynamic measurement, fluorescence, as well as raman and infrared spectroscopies [52, 53 ]. structurally, intrinsically disordered proteins range from completely unstructured polypeptides to extended partially structured forms to compact disordered ensembles containing substantial secondary structure [4, 8, 9, 23, 54 ]. extended idps are known to possess the atypical conformational behavior (such as turn out response to acidic ph and high temperature and insensitivity to high concentrations of strong denaturants), which is determined by the peculiarities of their amino acid sequences and the lack of ordered 3d structure. these unique structural features of extended idps and their specific conformational behavior were shown to be useful in elaboration the experimental techniques for the large - scale identification of these important members of the protein kingdom. three related methods were introduced : a method based on the finding that many proteins that fail to precipitate during perchloric acid or trichloroacetic acid treatment were idps ; a method utilizing the fact that idps possessed high resistance toward the aggregation induced by heat treatment [40, 56, 57 ] ; and a method based on the heat treatment coupled with a novel 2d gel methodology to identify idps in cell extracts. it is anticipated that these methodologies, combined with highly sensitive mass spectrometry - based techniques, can be used for the detection and functional characterization of idps in various proteomes. some of the computational and experimental tools for the unfoldome discovery are discussed below in more details. one of the key arguments about the existence and distinctiveness of idps came from various computational analyses. historically, already at the early stages of the field, simple statistical comparisons of amino acid compositions and sequence complexity indicated that disordered and ordered regions are highly different to a significant degree [45, 5860 ]. these sequence biases were then exploited to predict disordered regions or wholly disordered proteins with relatively high accuracy and to make crucial estimates about the commonness of disordered proteins in the three kingdoms of life [28, 45, 61 ]. similar to the normal foldable proteins whose correct folding into the rigid biologically active conformation is determined by amino acid sequence, the absence of rigid structure in the nontraditional nonfoldable idps is encoded in the specific features of their amino acid sequences. in fact, some of the i d proteins have been discovered due their unusual amino acid sequence compositions and the absence of regular structure in these proteins has been explained by the specific features of their amino acid sequences including the presence of numerous uncompensated charged groups (often negative) ; that is, a large net charge at neutral ph, arising from the extreme pi values in such proteins [6264 ], and a low content of hydrophobic amino acid residues [62, 64 ]. williams based on the abnormally high charge / hydrophobic ratio for the two i d proteins ; that is, using the same set of attributes, large net charge and low overall hydrophobicity. although this predictor was used to separate just two i d proteins from a small set of ordered proteins, this paper is significant as being the first indication that i d proteins have amino acid compositions that differ substantially from those of proteins with 3d structure. later, this approach was re - invented in a form of charge - hydropathy plot. to this end, 275 natively folded and 91 natively unfolded proteins (i.e., proteins which at physiologic conditions have been reported to have the nmr chemical shifts of a random - coil, and/or lack significant ordered secondary structure (as determined by cd or ftir), and/or show hydrodynamic dimensions close to those typical of an unfolded polypeptide chain) have been assembled from the literature searches. from the comparison of these datasets it has been concluded that the combination of low mean hydrophobicity and relatively high net charge represents an important prerequisite for the absence of compact structure in proteins under physiological conditions. this observation was used to develop a charge - hydropathy (ch) plot method of analysis that distinguishes ordered and disordered proteins based only on their net charges and hydropathy. figure 2(a) represents the original ch - plot and shows that natively unfolded proteins are specifically localized within a unique region of ch phase space. furthermore, i d and ordered proteins can be separated by a linear boundary, above which a polypeptide chain with a given mean net charge will most probably be unfolded. from the physical viewpoint, such a combination of low hydrophobicity with high net charge as a prerequisite for intrinsic unfoldedness makes perfect sense : high net charge leads to charge - charge repulsion, and low hydrophobicity means less driving force for protein compaction. in other words, these features are characteristic for i d proteins with the coil - like (or close to coil - like) structures. obviously, such highly disordered proteins represent only a small subset of the i d protein realm. more detailed analysis was elaborated to gain additional information on the compositional difference between ordered and i d proteins. comparison of a nonredundant set of ordered proteins with several datasets of disorder (where proteins were grouped based on different techniques, x - ray crystallography, nmr and cd, used to identify disorder) revealed that disordered regions share at least some common sequence features over many proteins [66, 67 ]. these differences in amino acid compositions are visualized in figure 2(b). here, the relative content of each amino acid in a given disordered dataset has been expressed as (disordered ordered)/(ordered). thus, negative peaks correspond the amino acids in which the disordered segments are depleted compared with the ordered ones, and positive peaks indicate the amino acids in which i d regions are enriched. the arrangement of the amino acids from least to most flexible was based on the scale established by vihinen.. this scale was defined by the average residue b - factors of the backbone atoms for 92 unrelated proteins. figure 2(b) shows that the disordered proteins are significantly depleted in bulky hydrophobic (ile, leu, and val) and aromatic amino acid residues (trp, tyr, and phe), which would normally form the hydrophobic core of a folded globular protein, and also possess low content of cys and asn residues. the depletion of i d protein in cys is also crucial as this amino acid residue is known to have a significant contribution to the protein conformation stability via the disulfide bond formation or being involved in coordination of different prosthetic groups. these depleted residues, trp, tyr, phe, ile, leu, val, cys, and asn were proposed to be called order - promoting amino acids. on the other hand, i d proteins were shown to be substantially enriched in polar, disorder - promoting, amino acids : ala, arg, gly, gln, ser, glu, and lys and also in the hydrophobic, but structure - braking pro [8, 69, 70 ]. note that these biases in the amino acid compositions of i d proteins are also consistent with the low overall hydrophobicity and high net charge characteristic of the natively unfolded proteins. in addition to amino - acid composition, the disordered segments have also been compared with the ordered ones by various attributes such as hydropathy, net charge, flexibility index, helix propensities, strand propensities, and compositions for groups of amino acids such as w + y + f (aromaticity). as a result, 265 property - based attribute scales and more than 6000 composition - based attributes (e.g., all possible combinations having one to four amino acids in the group) have been compared. it has been established that ten of these attributes, including 14 contact number, hydropathy, flexibility, -sheet propensity, coordination number, r + e + s + p, bulkiness, c + f + y + w, volume, and net charge, provide fairly good discrimination between order and disorder. later, it has been shown that not only the sequence compositions of ordered and disordered regions were different but also that disordered regions of various lengths were diverse as well. in particular, four classes of protein regions were compared : (a) low b - factor ordered regions ; (b) high b - factor ordered regions ; (c) short disordered regions ; and (d) long disordered regions. the four types of regions were shown to have distinct sequence and physicochemical characteristics, with short disordered regions and high b - factor regions being the two closest groups. furthermore, each of these two groups was closer to the long disordered regions than to the rigid ordered regions. in summary, the analysis of sequence and comparison of their various physicochemical properties indicated that all sets were mutually different. for example, the short disordered and high b - factor regions were shown to be more negatively charged, while long disordered regions were either positively or negatively charged, but on average nearly neutral. as the amino acid sequences of the idps and idrs differ dramatically from those of the ordered proteins and regions, these amino acid sequence differences were used to develop various predictors of intrinsic disorder. as it has been already mentioned, based on a very small number of proteins, williams suggested an approach for using amino acid sequence for identifying proteins that form random coils rather than globular structures, but this approach was never carefully tested. later, the first well - tested predictors of idps were independently published [45, 58 ]. protein disorder is a multifaced phenomenon ; that is, disordered proteins, being mobile, flexible, and dynamic, might have very different structural features, which range from collapsed molten globule - like conformation to extended coil - like state. it has been suggested that just as an ordered protein is comprised of different types of secondary structure (-helices, -strands, -turns, 310-helices, and others), i d protein can also be made up of distinguishable types of disorder. to check this hypothesis, this algorithm used the notion that a specialized predictor built on a given disorder flavor should have significantly higher same - flavor accuracy than other - flavor predictors or than a global predictor applied to the same given flavor. application of this partitioning algorithm to known disordered proteins identified three distinctive flavors of disorder, arbitrarily called v, c, and s. importantly, the flavor - specific disordered proteins have been shown to be distinguishable not only by their amino acid compositions but also by disordered sequence locations, and biological functions. based on these observations, it was proposed that specific flavor - function relationships do exist and thus it is possible (in principle) to identify the functions of disordered regions from their amino acid sequences alone, without any need for specific structural knowledge. since then, numerous researchers have designed many algorithms to predict disordered proteins utilizing specific biochemical properties and biased amino acid compositions of idps. many of these predictors, including pondrs [58, 70, 7477 ], foldindex, globplot, disembl, disopred and disopred2 [29, 8183 ], iupred, foldunfold, ronn, dispssmp, dispssmp2, spritz, and prdos, and so forth, can be accessed via public servers and evaluate intrinsic disorder on a per - residue basis. since the first predictors were published, more than 50 predictors of disorder have been developed. it is important to remember that comparing and combining several predictors on an individual protein of interest or on a protein dataset can provide additional insight regarding the predicted disorder if any exists. this is illustrated by a study where two distinct methods for using amino acid sequences to predict which proteins are likely to be mostly disordered, cumulative distribution function (cdf) analysis and charge - hydropathy (ch) plot, have been compared. cdf is based on the pondr vlxt predictor, which predicts the order - disorder class for every residue in a protein [28, 30 ]. cdf curves for pondr vlxt predictions begin at the point with coordinates (0,0) and end at the point with coordinates (1,1) because pondr vlxt predictions are defined only in the range (0,1) with values less than 0.5 indicating a propensity for order and values greater than or equal to 0.5 indicating a propensity for disorder. the optimal boundary that provided the most accurate order - disorder classification was determined and it has been shown that seven boundary points located in the 12th through 18th bin provided the optimal separation of the ordered and disordered protein sets. for cdf analysis, order - disorder classification is based on whether a cdf curve is above or below a majority of boundary points. in summary, cdf analysis summarizes the per - residue predictions by plotting pondr scores against their cumulative frequency, which allows ordered and disordered proteins to be distinguished based on the distribution of prediction scores. the other method of order - disorder classification is charge - hydropathy plots, in which ordered and disordered proteins being plotted in charge - hydropathy space can be separated to a significant degree by a linear boundary. it has been established that cdf analysis predicts a much higher frequency of disorder in sequence databases than ch - plot discrimination. however, the vast majority of disordered proteins predicted by charge - hydropathy discrimination were also predicted by cdf analysis. these findings are not a big surprise, as ch - plot analysis discriminates protein using only two attributes, mean net charge and mean hydrophobicity, whereas pondr vlxt (and consequently cdf) is a neural network, which is a nonlinear classifier, trained to distinguish order and disorder based on a relatively large feature space (including average coordination number, amino acid compositions (aromatic and charged residues), and net charge). thus, ch feature space can be considered as a subset of pondr vlxt feature space. importantly, these findings may be physically interpretable in terms of different types of disorder, collapsed (molten globule - like) and extended (premolten globule- and coil - like). under this consideration, the ch - plot classification discriminates proteins with the extended disorder from a set of globular conformations (molten globule - like or rigid well - structured proteins) and proteins predicted to be disordered by the ch - plot approach are likely to belong to the extended disorder class. on the other hand, pondr - based approaches can discriminate all disordered conformations (coil - like, premolten globules, and molten globules) from rigid well - folded proteins, suggesting that ch classification is roughly a subset of pondr vl - xt, in both predictions of disorder and feature space. it has been suggested that if a protein is predicted to be disordered by both ch and cdf, then, it is likely to be in the extended disorder class. however, a protein predicted to be disordered by cdf but predicted to be ordered by ch - plot might have properties consistent with a dynamic, collapsed chain ; that is, it is likely to be in the native molten globule class. finally, proteins predicted to be ordered by both algorithms are of course likely to be in the well - structured class. the first application of the disorder predictors was the evaluation of the commonness of protein disorder in the swiss - prot database. this analysis revealed that 25% of proteins in swiss - prot had predicted i d regions longer than 40 consecutive residues and that at least 11% of residues in swiss - prot were likely to be disordered. given the existence of a few dozen experimentally characterized disordered regions at the time, this work had significant influence on the recognition of the importance of studying disordered proteins. next, both pondr vlxt and 3 flavor pondr predictors were used to estimate the amount of disorder in various genomes. the predictions counted only disordered regions greater than forty residues in length, which has a false - positive rate of fewer than 400 residues out of 100 000. the result clearly showed that disorder increases from bacteria to archaea to eukaryota with over half of the eukaryotic proteins containing predicted disordered regions [28, 73 ]. one explanation for this trend is a change in the cellular requirements for certain protein functions, particularly cellular signaling. in support of this hypothesis, pondr analysis of a eukaryotic signal protein database indicates that the majority of known signal transduction proteins are predicted to contain significant regions of disorder. have refined and systematized such an analysis and concluded that the fraction of proteins containing disordered regions of 30 residues or longer (predicted using disopred) were 2% in archaea, 4% in bacteria, and 33% in eukarya. in addition, a complete functional analysis of the yeast proteome with respect to the three gene ontology (go) categories was performed. in terms of molecular function, transcription, kinase, nucleic acid, and protein - binding activity the most overrepresented go terms characteristic for the biological process category were transposition, development, morphogenesis, protein phosphorylation, regulation, transcription, and signal transduction. finally, with respect to cellular component, it appeared that nuclear proteins were significantly enriched in disorder, while terms such as membrane, cytosol, mitochondrion, and cytoplasm were distinctively overrepresented in ordered proteins. application of the ch - cdf analysis to various proteomes revealed that cdf analysis predicts about 2-fold higher frequency of disorder in sequence databases than ch - plot classification suggesting that approximately half of disordered proteins in different proteomes possess extended disorder, whereas another half represents proteins with the collapsed disorder. furthermore, the consensus cdf - ch method showed that approximately 4.5% of yersinia pestis, 5% of escherichia coli k12, 6% of archaeoglobus fulgidus, 8% of methanobacterium thermoautotrophicum, 23% of arabidopsis thaliana, and 28% of mus musculus proteins are wholly disordered. as mentioned above, the ch - plot, being a linear classifier, takes into account only two parameters of the particular sequence charge and hydropathy, whereas cdf analysis is dependent upon the output of the pondr vlxt predictor, a nonlinear neural network classifier, which was trained to distinguish order and disorder based on a significantly larger feature space that explicitly includes net charge and hydropathy. according to these methodological differences, ch - plot analysis is predisposed to discriminate proteins with substantial amounts of extended disorder (random coils and premolten globules) from proteins with globular conformations (molten globule - like and rigid well - structured proteins). on the other hand, pondr - based cdf analysis may discriminate all disordered conformations including molten globules from rigid well - folded proteins. this difference in the sensitivity of predictors to different levels of overall disorderedness was utilized in cdf - ch - plot analysis, which allows the ordered and disordered proteins separation in the ch - cdf phase space. in this approach, each spot corresponds to a single protein and its coordinates are calculated as a distance of this protein from the boundary in the corresponding ch - plot (y - coordinate) and an averaged distance of the corresponding cdf curve from the boundary (x - coordinate). positive and negative y values correspond to proteins which, according to ch - plot analysis, are predicted to be natively unfolded or compact, respectively. whereas positive and negative x values are attributed to proteins that, by the cdf analysis, are predicted to be ordered or intrinsically disordered, respectively. therefore, this plot has four quadrants : (,) quadrant, which contains proteins predicted to be disordered by cdf, but compact by ch - plot (i.e., proteins with molten globule - like properties) ; (,+) quadrant that includes proteins predicted to be disordered by both methods (i.e., random coils and pre - molten globules) ; (+,) quadrant which contains ordered proteins ; and (+, +) quadrant including proteins which are predicted to be disordered by ch - plot, but ordered by the cdf analysis. application of such a combined ch - cdf analysis to mice proteins revealed that ~12% mice proteins are likely to belong to the class of extended idps (native coils and native premolten globules), whereas ~30% proteins in mouse genome are potential native molten globules. recently, the disorderedness of genome - linked proteins vpg from various viruses were evaluated by a combined ch - cdf analysis [93, 94 ]. the genome - linked protein vpg of potato virus a (pva ; genus potyvirus) has essential functions in all critical steps of pva infection, that is, replication, movement, and virulence. the structural analysis of the recombinant pva vpg revealed this protein possesses many properties of a native molten globule. in a follow - up study, it has been shown that although vpgs from various viruses (from sobemovirus, potyvirus, and caliciviridae genera) are highly diverse in size, sequence, and function, many of them were predicted to contain long disordered domains. figure 3 summarizes these findings by showing the localization of several vpgs within the ch - cdf phase space. each spot represents a single vpg whose coordinates were calculated as a distance of this protein from the boundary in the corresponding charge - hydropathy plot (ch - plot, y - coordinate) and an averaged distance of the corresponding cumulative distribution function (cdf) curve from the boundary (x - coordinate). figure 3 clearly shows that many vpgs are expected to behave as native molten globules. several recent reviews summarized the current state of the art in the field of idp predictions and represent a useful overview of the prediction methods highlighting their advantages and drawbacks [46, 91 ]. concluding, the considered - above studies clearly showed that idps (both collapsed and extended) are highly abundant in nature and can be reliably identified by various computational means. misfolding (the failure of a specific peptide or protein to adopt its functional conformational state) and related dysfunction of many proteins were considered as a major cause for the development of different pathological conditions. such misfolding and dysfunction can originate from point mutation(s) or result from an exposure to internal or external toxins, impaired posttranslational modifications (phosphorylation, advanced glycation, deamidation, racemization, etc.), an increased probability of degradation, impaired trafficking, lost binding partners, or oxidative damage. all these factors can act independently or in association with one another. although the formation of various aggregates represents the most visible consequence of protein misfolding and although these aggregates form the basis for the development of various protein deposition diseases, pathogenesis of many more human diseases does not depend on aggregation being based on protein dysfunction. as many of the proteins associated with the conformational diseases are also involved in recognition, regulation, and cell signaling, it has been hypothesized that many of them are idps. in other words, according to this the disorder in disorders or d concept, idps are abundantly involved in the development of the conformational diseases, which therefore may originate from the misidentification, misregulation, and missignaling due to the misfolding of causative idps. to support this hypothesis, the first approach is based on the assembly of specific datasets of proteins associated with a given disease and the computational analysis of these datasets using a number of disorder predictors [25, 39, 95, 96 ]. in essence, this is an analysis of individual proteins extended to a set of independent proteins. a second approach utilized network of genetic diseases where the related proteins are interlinked within one disease and between different diseases. a third approach is based on the evaluation of the association between a particular protein function (including the disease - specific functional keywords) with the level of intrinsic disorder in a set of proteins known to carry out this function [1315 ]. these three approaches are briefly presented below. the easiest way to evaluate the abundance of intrinsic disorder in a given disease is based on a simple two - stage protocol, where a set of disease - related proteins is first assembled by searching various databases and then the collected group of proteins is analyzed for intrinsic disorder. the depth of this analysis is based on the breadth of the search for the disease - related proteins and on the number of different computational tools utilized to find disordered proteins / regions [25, 39, 44, 9597 ]. using this approach, it has been shown that many proteins associated with cancer, neurodegenerative diseases, and cardiovascular disease are highly disordered, being depleted in major order - promoting residues (trp, phe, tyr, ile, and val) and enriched in some disorder - promoting residues (arg, gln, ser, pro, and glu). high level of intrinsic disorder and a substantial number of potential interaction sites were also found using a set of computational tools. overall, these studies clearly showed that intrinsic disorder is highly prevalent in proteins associated with human diseases, being comparable with that of signaling proteins and significantly exceeding the levels of intrinsic disorder in eukaryotic and in nonhomologous, structured proteins. unfoldome of human genetic diseases was assembled via the analysis of a specific network which was built to estimate whether human genetic diseases and the corresponding disease genes are related to each other at a higher level of cellular and organism organization. this network represented a bipartite graph with a network of genetic diseases, the human disease network (hdn), where two diseases were directly linked if there was a gene that was directly related to both of them, and a network of disease genes, the disease gene network (dgn), where two genes were directly linked if there was a disease to which they were both directly related. this framework, called the human diseasome, systematically linked the human disease phenome (which includes all the human genetic diseases) with the human disease genome (which contains all the disease - related genes). the analysis of hdn revealed that of 1284 genetic diseases, 867 had at least one link to other diseases, and 516 diseases formed a giant component, suggesting that the genetic origins of most diseases, to some extent, were shared with other diseases. in the dgn, 1377 of 1777 disease genes were shown to be connected to other disease genes, and 903 genes belonged to a giant cluster hdn. the vast majority of genes associated with genetic diseases was nonessential and showed no tendency to encode hub proteins (i.e., proteins having multiple interactions). the large - scale analysis of the abundance of intrinsic disorder in transcripts of the various disease - related genes was performed using a set of computational tools which uncovers several important features [41, 44 ] : (a) intrinsic disorder is common in proteins associated with many human genetic diseases ; (b) different disease classes vary in the idp contents of their associated proteins ; (c) molecular recognition features, which are relatively short loosely structured protein regions within mostly disordered sequences and which gain structure upon binding to partners, are common in the diseasome, and their abundance correlates with the intrinsic disorder level ; (d) some disease classes have a significant fraction of genes affected by alternative splicing, and the alternatively spliced regions in the corresponding proteins are predicted to be highly disordered and in some diseases contain a significant number of molecular recognition features, morfs ; (e) correlations were found among the various diseasome graph - related properties and intrinsic disorder. in agreement with earlier studies, another approach is a computational tool elaborated for the evaluation of a correlation between the functional annotations in the swissprot database and the predicted intrinsic disorder was elaborated [1315 ]. the approach is based on the hypothesis that if a function described by a given keyword relies on intrinsic disorder, then the keyword - associated protein would be expected to have a greater level of predicted disorder compared to the protein randomly chosen from the swissprot. to test this hypothesis, functional keywords associated with 20 or more proteins in swissprot next, for each such a keyword - associated set, a length - matching set of random proteins was drawn from the swissprot, and order - disorder predictions were carried out for the keyword - associated sets and for the random sets [1315 ]. the application of this tool revealed that out of 710 swissprot keywords, 310 functional keywords were associated with ordered proteins, 238 functional keywords were attributed to disordered proteins, and the remainder 162 keywords yield ambiguity in the likely function - structure associations [1315 ]. it has been also shown that keywords describing various diseases were strongly correlated with proteins predicted to be disordered. contrary to this, no disease - associated proteins were found to be strongly correlated with absence of disorder. extended idps, being characterized by high percentages of charged residues, do not undergo large - scale structural changes at low ph. as a result, many of these proteins were shown to remain soluble under these extreme conditions [99, 100 ]. on the contrary, the protonation of negatively charged side chains in ordered proteins is commonly accompanied by protein denaturation or unfolding [101104 ]. unlike idps, the acidic ph - induced denatured conformations of structured proteins contain larger number of hydrophobic residues. the ph - induced exposure of these normally buried hydrophobic residues makes a states (i.e., partially folded conformations induced by acidic ph) of globular proteins analysis or literature data revealed a set of 29 proteins which do not precipitate during perchloric acid (pca) or trichloroacetic acid (tca) treatment of cell extracts and this resistance to pca or tca treatment was utilized for their isolation. however, 14 of these pca / tca - soluble proteins were experimentally determined to be totally unstructured, 6 were structured, and 9 had not been structurally characterized, suggesting that at least 50% of the proteins isolated by virtue of their resistance to pca or tca could be expected to be totally unstructured. to gain more information on the abundance of intrinsic disorder in acid - soluble proteins, their sequences were analyzed using two binary predictors of intrinsic disorder, ch - plot and cdf analysis, both of which perform binary classification of whole proteins as either mostly disordered or mostly ordered, where mostly ordered indicates proteins that contain more ordered residues than disordered residues and mostly disordered indicates proteins that contain more disordered residues than ordered residues. the results of this analysis revealed an excellent correlation between experiment and prediction : the majority of proteins experimentally shown to be structured or unfolded were predicted to be ordered or intrinsically disordered, respectively, by both predictors. additionally, three of four experimentally uncharacterized proteins were predicted to be wholly disordered by both classifiers. thus, a combination of experimental and computational approaches suggested that ~70% of acid soluble proteins isolated based on their resistance to pca or tca could be expected to be totally unstructured. based on these observations it was suggested that indifference to acid treatment represents one of the characteristic properties of extended idps, which can result in the substantial enrichment of idps in the soluble fraction after the acid treatment, and, therefore, can be exploited to develop standard protocols for isolating and studying idps on a proteomic scale. in agreement with this hypothesis, treatment of e.coli cell extracts with 1% pca resulted in a total protein reduction of ~30 000-fold when compared to the total soluble extract, and 3% pca was sufficient to denature and precipitate all nonresistant proteins because higher pca concentrations did not result in further yield reductions. the acid - soluble fractions from the e.coli extracts were visualized using 2d sds - page, which revealed that a substantial number of e. coli proteins were resistant to acid denaturation and concomitant precipitation. in fact, this analysis revealed that 158 proteins remained soluble in the presence of 5% pca. this suggests that ~110 of the pca - soluble proteins could be expected to be totally unstructured (based on the assumption that ~70% acid - stable proteins are totally unstructured, see above). this number compares favorably with the 85 to 196 totally disordered proteins estimated to be present in the e. coli proteome. therefore, treating total protein extracts with 35% pca or tca and determining the identities of the soluble proteins could form the basis for uncovering unfoldomes in various organisms. in fact, the solubility and limited secondary structure of extended idps, such as p21, p27, -synuclein, prothymosin, and phosphodiesterase subunit, were virtually unaltered by heating to 90c [31, 32, 63, 100, 105111 ]. this resistance to thermal aggregation, which likely originates from the low mean hydrophobicity and high net charge characteristic of extended idps, has been utilized for the purification of these proteins [63, 112115 ]. the indifference to heat treatment was proposed as an analytical tool for the evaluation of the abundance of extended idps in various proteomes [30, 57 ]. recently, the extracts of nih3t3 mouse fibroblasts were heated at a variety of temperatures and analyzed by sdspage to determine the extent of protein precipitation under these conditions. in agreement with previous studies, this analysis revealed that the increase in the incubation temperature was accompanied by the decrease in the amount of soluble proteins. in fact, 375, 388, and 198 proteins (287, 304, and 124 nonredundant proteins) were identified by maldi - tof / tof mass spectrometry from 584, 472, and 269 spots on 2d gels obtained for cell extracts treated at 4, 60, and 98c, respectively. these nonredundant proteins were further analyzed using a set of bioinformatics tools. in this study, proteins were classified as idps (proteins having an average pondr vlxt score > 0.5 and proteins having an average pondr score of 0.320.5 and possessing a high - mean net charge and low - mean hydrophobicity), intrinsically folded proteins (ifps, proteins having an average pondr score < 0.32), or mixed ordered / disordered proteins (mps, proteins that did not meet the described above criteria for iups or ifps). the analysis clearly showed that heat treatment resulted in an enrichment of idps and depletion of mps and ifps. in fact, although idps comprised only 11.8% of the proteins identified in the untreated cell extract (4c), their relative population increased to 41.9% after the heat treatment at 98c. on the other hand, mps and ifps, which comprised 42.8 and 45.4% of proteins in the untreated cell extract, were substantially depleted to 27.4 and 30.6%, respectively, after heat treatment at 98c. the fact that extended idps are characterized by heat stability and structural indifference to chemical denaturation was recently utilized in novel 2-d gel - electrophoresis technique which consists of the combination of native and 8 m urea electrophoresis of heat - treated proteins. extended idps are often heat - stable as demonstrated for csd1, map2, -synuclein [63, 107 ], its familial parkinson 's disease - related mutants, - and -synucleins, stathmin, p21, prothymosin, c - terminal domain of caldesmon, and phosphodiesterase. therefore, heat treatment should lead to a decent initial separation of the extended idps from globular proteins, the vast majority of which are known to aggregate and precipitate at high temperatures. in the native gel, idps and rare heat - stable globular proteins since the extended idps are as unfolded in 8 m urea as under native conditions, they are expected to run the same distance in the second dimension and end up along the diagonal. heat - stable globular proteins will unfold in urea, slow down in the second direction due to the increased size, and therefore will accumulate above the diagonal (see figure 4 for the schematic representation of this technique). this difference in conformational behavior between ordered proteins and idps can lead to their effective separation, enabling the idp identification by mass - spectrometry. the usefulness of this approach has been validated via the analysis of a set of 10 experimentally characterized idps (stathmin, map2c, mypt1-(304511), erd10, -casein, -casein, -synuclein, csd1, bob-1, and darpp32) and a set of 4 globular control proteins (fetuin, ipmdh, bsa, ovalbumin). the analysis revealed that idps ran at, or very near, the diagonal of the second (denaturing) gel, whereas globular proteins remained way above the diagonal, clearly showing that the proposed 2d electrophoresis is able to separate idps and globular proteins as predicted. next, heat - treated extracts of e. coli and s. cerevisiae were analyzed by this 2d electrophoresis. this analysis revealed that more s. cerevisiae proteins were seen in the diagonal in agreement with predictions that the frequency of protein disorder increases with increasing complexity of the organisms [5, 2830 ]. at the next step, some spots at and above the diagonal were identified by mass - spectrometry and the intrinsic disorder propensity of the identified proteins was estimated by pondr vlxt. this analysis revealed that the amount of predicted disorder in proteins located at the diagonal positions was very high (52.1 14.1%), noticeably exceeding that of typical idps such as -synuclein (37.1%) and -casein (41.15%). although many of the diagonal proteins have never been structurally characterized, literature data were available for some of them. the list of such previously characterized idps identified in this study includes ribosomal proteins, groes, and acyl carrier protein. the majority of proteins above the diagonal were found to be enzymes (e.g., superoxide dismutase), which are known to require a well - defined structure for function. based on these finding it has been concluded that the proposed 2d electrophoresis is suitable for the proteome - wide identification of idps. according to the genome - based bioinformatics predictions, significant fraction of any given proteome belongs to the class of idps. high degree of association between protein intrinsic disorder and maladies is due to structural and functional peculiarities of idps and idrs, which are typically involved in cellular regulation, recognition, and signal transduction. as the number of idps is very large and as many of these proteins are interlinked, the concepts of the unfoldome and unfoldomics were introduced. idps, especially their extended forms, are characterized by several unique features that can be used for isolation of these proteins from the cell extracts. the corresponding proteomic techniques utilize specific high resistance of idps against extreme ph and high temperature, as well as their structural indifference to chemical denaturation. at the computational side, several specific features of the idp amino acid sequences provide a solid background for the reliable identification of these proteins at the proteome level. these proteomic - scale identification and characterization of idps are needed to advance our knowledge in this important field. | contrarily to the general believe, many biologically active proteins lack stable tertiary and/or secondary structure under physiological conditions in vitro. these intrinsically disordered proteins (idps) are highly abundant in nature and many of them are associated with various human diseases. the functional repertoire of idps complements the functions of ordered proteins. since idps constitute a significant portion of any given proteome, they can be combined in an unfoldome ; which is a portion of the proteome including all idps (also known as natively unfolded proteins, therefore, unfoldome), and describing their functions, structures, interactions, evolution, and so forth. amino acid sequence and compositions of idps are very different from those of ordered proteins, making possible reliable identification of idps at the proteome level by various computational means. furthermore, idps possess a number of unique structural properties and are characterized by a peculiar conformational behavior, including their high stability against low ph and high temperature and their structural indifference toward the unfolding by strong denaturants. these peculiarities were shown to be useful for elaboration of the experimental techniques for the large - scale identification of idps in various organisms. some of the computational and experimental tools for the unfoldome discovery are discussed in this review. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.