article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
we studied cation exchange (ce) in core / shell cu2xse / cu2xs nanorods with two cations, ag+ and hg2 +, which are known to induce rapid exchange within metal chalcogenide nanocrystals (ncs) at room temperature. at the initial stage of the reaction, the guest ions diffused through the cu2xs shell and reached the cu2xse core, replacing first cu+ ions within the latter region. these experiments prove that ce in copper chalcogenide ncs is facilitated by the high diffusivity of guest cations in the lattice, such that they can probe the whole host structure and identify the preferred regions where to initiate the exchange. for both guest ions, ce is thermodynamically driven as it aims for the formation of the chalcogen phase characterized by the lower solubility under the specific reaction conditions. |
|
despite attempts to increase the number of potential kidney donors, there continues to be a significant shortage of kidneys available to meet the demand for renal transplantation. the gap between the number of patients waiting for a kidney transplant and the number of patients receiving a transplant has widened over the last decade ; this has resulted in a continued increase in the waiting time from listing to transplant. at the end of 2008, 50,624 patients were active candidates waiting for kidney transplant, but only 10,551 patients received a deceased donor kidney, and 5,966 received a living donor kidney. living kidney donation is one of the most attractive approaches to correct the shortage of deceased kidneys available for transplantation. open living donor nephrectomy had been the standard procedure performed for kidney donation during the previous four decades. large series have reported an estimated perioperative mortality of 0.03% and 0.2% major and 8% minor complication rates [2, 3 ]. in 1995, the first laparoscopic donor nephrectomy was reported by ratner., and in 1998 the hand - assisted variant of the laparoscopic donor nephrectomy was described by wolf jr. the decreased donor morbidity, faster recovery, comparable patient and graft survival compared with open kidney donation have resulted in several major transplant centers adopting either a pure or hand - assisted laparoscopic technique as their procedure of choice for live kidney donation [610 ]. despite extensive experience with laparoscopic donor nephrectomy, major series continue to report major complications including bleeding, transfusion, open conversion, kidney damage at the time of extraction, delayed graft function (dgf), ureteral complications, chylous ascites, small bowel obstruction, and incisional hernias [1116 ]. the hand - assisted technique was introduced to make the entire procedure quicker and safer by having the hand in the abdominal cavity. it facilitates the procedure and allows the surgical team to act quickly in case of any complication such as acute bleeding. the first hand - assisted laparoscopic living donor nephrectomy (haldn) was performed at our institution by dr. h. roger hadley and dr. the laparoscopic living donor nephrectomy program was established in january 2003 based on the joint efforts of the department of urology and the transplantation institute. several modifications of the conventional laparoscopic donor nephrectomy were instituted in an attempt to increase the safety of living donor nephrectomy and to enhance the early graft function in the recipient. these modifications included the use of a hand - assisted technique to shorten the learning curve and increase the margin of safety for the procedure, preoperative imaging with a 4-phase ct angiogram with maximum intensity projections (mips) and three - dimensional reconstructions, a technique to postpone hilar dissection until the end of the procedure, and finally the establishment of a donor team consisting of a laparoscopic transplant surgeon (pwb) and an endourologist (ddb). we report the outcome of the first 200 consecutive haldn performed using this protocol, focusing on short - term kidney allograft function and donor and recipient perioperative complications. we retrospectively reviewed the data of the first 200 consecutive donors who underwent haldn using the established donor protocol as well as the data of their corresponding recipients between january 1, 2003 and february 28, 2009. the initial 41 cases, which were the subject of a previous report (group 1), were compared to the subsequent 159 cases (group 2). data collected on each patient included donor and recipient demographics, donor body mass index (bmi), number of donor renal arteries, donor and recipient serum creatinine at the time of discharge, and 6 months, length of hospital stay (los), estimated blood loss (ebl) and donor and recipient complications. these data were analyzed using the statistical package for social sciences version 17.0 software (spss, inc., chicago, il, usa) and statistical analysis systems (sas institute ; cary, nc) version 9.2. differences in nominal data were tested using chi - square or fisher 's exact tests when counts were small. data are shown as a mean standard deviation (sd) unless otherwise indicated. one - way anova and kruskal - wallis were used to compare the difference between the groups. univariate analysis of variance was used to compare the serum creatinine of the recipient groups at discharge adjusting for peak pra percentage. from january 1, 2003 to february 28, 2009, a mean of 95 kidney transplants (a mean of 33 laparoscopic living donors and a mean of 62 deceased donors) were performed annually at loma linda university medical center (figure 1). following the implementation of this living donor protocol, only one donor has requested an open technique. one hundred and fifty - two nephrectomies performed during the study period were left - sided and seven were right - sided (all of these patients belong to group 2). the mean number of living kidney donations for the 4 years prior to the adoption of the laparoscopic technique as the procedure of choice for kidney donation was 26 per year. 35% of all kidney transplants performed per year (mean : 33 laparoscopic donors / year) during the last 6 years were living donor kidney transplants done using a hand - assisted technique. a single patient underwent open donation in group 1, solely based upon patient preference. the mean age of the donor population for groups 1 and 2 is 36.4 10.6 and 36.9 11.9 years, respectively. more than 60% of the donors were females in both groups (group 1 : 63% and group 2 : 62%). bmi was not significantly different between the groups (25.2 5.2 and 25.6 3.1 for group 1 and 2, resp.). over 80% of the donors in each group had a single renal artery (group 1 : 35, 85% and group 2 : 130, 82%). thirty - one kidney donors had two renal arteries (group 1 : 12% and group 2 : 16%). three renal arteries were found in one donor in group 1 and two donors in group 2. three donors had a complete ureteral duplication (one in group 1 and 2 in group 2). nearly one - third of the donors (29%) were siblings of the recipients, while 21% were from children of the recipients. eleven percent of the kidney donations came from friends of the recipients (figure 2). more males than females received laparoscopic living donor kidneys in each group (group 1 : 22/19 and group 2 : 94/65). the group 2 recipients were slightly older (41.2 15.3 years) than the recipients in group 1 (39.9 18.5 years), but this was not statistically significant. thirty - four patients (21.4%) in group 2 had a high - panel reactive antibody (pra) greater than 20% compared to 7 patients (17.1%) in group 1 (p = 0.54). eight patients received a previous kidney transplant, two patients in group 1, and 6 patients in group 2. one patient in group 1 had received a heart transplant, and another one in group 2 had received two heart transplants (table 1(b)). there was a significant decrease in donor median ebl in group 2 (group 1, 100 ml and group 2, 50 ml, p < 0.0001). donor median serum creatinine at discharge was 1.2 mg / dl for both groups (p = 0.55) (table 2). recipient median serum creatinine levels at discharge were 1.1 mg / dl (0.65.1) and 1.3 mg / dl (0.48.6) (p = 0.07) for groups 1 and 2, respectively (table 3). the donor median serum creatinine at 6 months remained stable at 1.2 mg / dl for each group, (group 1 : 1.2 mg / dl (0.81.9) and group 2 : 1.2 mg / dl (0.72.2), p = 0.69) (table 2). the recipient median serum creatinine at 6 months after transplant was 1.3 mg / dl (0.82.2) and 1.3 mg / dl (0.43.3), for groups 1 and 2, respectively (table 3). the median los for donors in groups 1 and 2 was the same (3 days) (table 2). for recipients, median los was a day less for group 2 when compared to group 1 (4 days versus 5 days, p = 0.0078, table 3). fifteen kidney donors (7.5%) developed complications, three (1.5%) intraoperative, eight (4%) in the immediate postoperative period, and four (2%) in the late postoperative period (more than 6 months after donation). seven donors of group 1 (17%) and eight donors of group 2 (5%) developed complications (table 4). four patients developed a supraumbilical incisional hernia, one at 9 months in group 1 (0.5%) and 3 after 6 months of donation in group 2 (1.5%). the last intraoperative bleeding complication was seen in case number 59 (group 2). two patients complained of significant left testicular pain (lasting longer than 3 weeks), and one patient developed a mild stricture of the external urethral meatus. one patient developed a struvite ureteral stone one week following donation and secondary acute renal insufficiency (serum creatinine peak was 4.1 mg / dl) that resolved after stent placement and subsequent stone removal (serum creatinine was 1.4 mg / dl at discharge). eleven of the intraoperative and perioperative complications of the donor population were classified as grade 1 (n = 11, 5.5%), according to the modified clavien classification except four complications that were classified as grade 2, 2% (four patients developed incisional hernias after 6 months of donation that required surgical repair, group 1, n = 1, 0.5% and group 2, n = 3, 1.5%). there were no open conversions, bowel injuries, or readmission to the hospital for small bowel obstruction or prolonged ileus. there were a total of 25 complications (12.5%) in the transplant recipient patients of hand - assisted laparoscopic kidneys. six recipients (15%) of group 1 and nineteen patients (12%) of group 2 developed postoperative complications (table 5). a 50-year - old female developed acute allograft dysfunction on postoperative day 5, and kidney allograft biopsy showed de novo crescentic glomerulonephritis. her most recent serum creatinine was 1.3 mg / dl, almost 6 years later (2/21/09). another 21-year - old woman with a history of focal segmental glomerulosclerosis developed a recurrent disease 5 months after transplantation. at 7 months after transplantation, her creatinine was 3.2 mg / dl but she did not require dialysis. three patients of group 1 and 5 patients of group 2 developed acute rejection in the first 4 weeks after transplantation. one patient of group 1 developed moderate hydronephrosis one week following transplantation. upon revision of ureteroneocystostomy, a well - vascularized distal ureter was noted. his creatinine was 2.0 mg / dl at 3 months after transplantation. a patient of group 2 developed thrombosis of anastomosis of the inferior polar artery to the inferior epigastric artery. he underwent revision of this anastomosis 4 hours after transplantation but developed ureteral stricture 4 months later which was treated successfully with ureteral stent and dilatation. dgf was infrequent with haldn, only occurring in 1/41 patients (2.4%) in group 1 and 4/159 patients (2.5%) in group 2. a heart / kidney transplant recipient of group 1 developed dgf due to hypotension secondary to retroperitoneal bleeding after femoral vein puncture for endomyocardial biopsy to rule out acute rejection. four patients of group 2 developed dgf, one due to severe hypotension after subcapsular bleeding and acute myocardial infarction, one due to acute humoral and cellular rejection, one due to acute kidney allograft ischemia secondary to a kinked renal artery anastomosis, and another one due to a renal vessel thrombosis 4 hours after transplantation. deaths in the perioperative period were uncommon. there were three deaths in the series, all of them in group 2 (3/200 patients, 1.5%). two of them died as a consequence of acute myocardial infarction, one at 9 days (he developed delayed graft function), and another one at 30 days after transplant (normal kidney transplant function). the last patient died 4 years after pancreas transplant due to rupture of an iliac artery aneurysm. the rest of the recipients are alive, and their allografts are functioning at 6 months after transplantation (tables 3 and 5). this report details our experience of the first 200 donors and recipients following the decision to implement a protocol where all patients were offered haldn. it is estimated that the total complication rate ranges from 0% to 35%, depending on how individual authors choose to define and classify major and minor complications. [1822 ]. the donor complication rate of this population (major complication 5.5% and minor complication rate 2%) is comparable to other reported series. patel., found a major complication rate of 4.2% and 6.8% of minor complication rate. reported 2.9% of major and 18% of minor postoperative complications rated by the clavien classification system (grade 3). we believe that the consistent use of our hand - assisted laparoscopic living donor protocol allowed us to obtain excellent results. a meticulous and precisely dissecting laparoscopic technique, combined with the use of a detailed ct renal angiogram readily available in the operating room and evaluated preoperatively to determine the size and location of the lumbar vein branches and renal vessels, further improves the safety of the procedure and decreases the risk for bleeding complications. in our experience, flipping the kidney medially facilitates the dissection of the posterior aspect of the renal artery and the lumbar vein branches. this improved exposure avoids any accidental tearing and the potential for significant bleeding which in other series has resulted in open conversion. the renal artery dissection was performed only at the origin of the renal artery from the abdominal aorta and just before kidney removal in order to minimize the time in vasospasm and subsequent ischemia to the kidney. the renal vessels were transected after ligation with double hem - o - lock clips until recently, when we began routinely using a vascular stapling ligation. the ebl was significantly different among the groups having the lowest amount of ebl in the last 159 patients (group 2, p < 0.0001). our findings are similar to others including the results of the meta - analysis done by kokkinos. that showed that the hand - assisted group had significantly less intraoperative blood loss than the standard laparoscopic group. since the introduction of the haldn technique, many studies have compared the outcome of the standard laparoscopic technique to the outcome of the hand - assisted technique, but unfortunately all resulted in equivocal findings. they found that the hand - assisted technique appeared to have the same donor and recipient complication rate than the standard technique but with shorter operative and warm ischemia time as well as decreased intraoperative bleeding. the data from this study supports the ease and safety of the hand - assisted technique. the technique can be mastered by a surgeon with experience in advanced laparoscopic surgical procedures. the successful implementation of a laparoscopic donor nephrectomy program also ultimately depends upon the surgical experience of the transplant surgery team [2830 ]. in conclusion, these data showed that haldn is very well tolerated with acceptable donor morbidity and excellent short - term allograft function. by potentially increasing the safety of the procedure while maintaining the benefits of the minimally invasive approach, haldn may effectively increase the donor pool and may ultimately decrease the alarming gap between the donor and recipient populations. | background. recipients of laparoscopically procured kidneys have been reported to have delayed graft function, a slower creatinine nadir, and potential significant complications. as the technique has evolved laparoscopic donor nephrectomy technique is becoming the gold standard for living donation. study design. we retrospectively reviewed the data of the first 200 hand - assisted laparoscopic living donor nephrectomies performed between january 2003 and february 2009. the initial 41 donors and their recipients (group 1) were compared to the next 159 donors and their recipients (group 2). the estimated blood loss, serum creatinine at discharge and 6 months, and the incidence of delayed graft function and perioperative complications were analyzed. results. the median donor serum creatinine at discharge and 6 months was 1.2 mg / dl in each group. none of the laparoscopic procedures required conversion to an open procedure, and none of the donors required perioperative blood transfusion. the median recipient serum creatinine at 6 months after transplant was 1.2 mg / dl for each group. no ischemic ureteral complications related to the laparoscopic technique were seen. conclusions. haldn with meticulous surgical technique allows kidney procurement with very low morbidity and no mortality. this improved safety and decreased invasiveness from laparoscopic approach may further decrease morbidity of the procedure and increase organ donation. |
asphalt modification is a common practice since the last two decades throughout the united states of america (usa). asphalt modification with synthetic and natural polymers is not a new concept in this industry, as one can find traces of modification back in 1843. synthetic rubber (neoprene) was used for asphalt modification in latin america in the 1950s. europe was ahead of usa in 1970s as the contractor in europe preferred to afford the initial cost instead of bearing the maintenance cost. the disadvantage of higher initial cost of polymer - modified asphalt limited its use in us. however, with the invention of newer polymers, european technologies began to be used in usa [5, 6 ]. according to a survey in 1997, 47 out of 50 states reported that they would be using modified asphalt in the future and 35 of the states from the 47 reported that they would use greater amounts. this inclination towards the use of modified asphalt was due to its proven advantages over the lifetime of the pavements. there were many types of polymers added to the asphalt in order to modify it. some of them are sbs (styrene - butadiene - styrene), sbr (styrene - butadiene - rubber), elvaloy rubber, eva (ethylene - vinyle acetate), hdp (high density polyethylene), ldp (low density polyethylene), tire rubber, and others. this polymer - modified asphalt was expected to show greater elastic recovery, a higher softening point, greater viscosity, greater cohesive strength, and greater ductility [3, 8 ]. it was found that polymer modification can improve structural and engineering properties of the binder, which is a result of improvement in rheological characteristics of binder as well as its adhesion capability with the aggregate. enhancement in these characteristics inevitably enhanced the performance characteristics of asphalt, that is, fatigue life, resistance to rutting, and thermal cracking. polymer - modified asphalt is being used frequently in almost every part of the world, especially in developed countries. the amount of energy used for the modification and price of the polymer is a big question mark for the researchers and contractors. polymers need high temperatures (150f to 375f) and an extended period of time (60 to 200 min) to achieve a homogenous blend with asphalt. moreover, it is not about preparation of modified asphalt ; yet whether it is sustainable enough to resist the environmental conditions or not is also a big concern. last but not least, hma resistance to the cutbacks (diesel, gasoline, engine oil etc.). these concerns are very important to consider while modifying asphalt. since polymer modification of asphalt is expensive, especially in developing countries, therefore its use is very limited in developing countries. the price of sbs dramatically increased due to shortage of styrene - butadiene polymers in the asphalt industry since 2008. asphalt costs approximately $ 0.6 per kg, whereas recycled tire rubber costs about $ 0.3 per kg. likewise, polymer may cost more than $ 1 per kg (e.g., sbs price is around $ 1.25 per kg). the shortage involved a variety of polymers, including linear and radial sbs polymers and diblock sbs polymers. the main reason why sbs is short in supply is its raw material, which is ethylene. alternatives of sbs are gtr (ground tire rubber), which requires high temperature and very high shear mixing conditions. chemical stabilizers are also added in the mixing process, which increase the cost of the material as well. some other alternatives are sbr - latex, eva (ethyle vinyl acitate), and ppa (polyphosphoric acid). sbr - latex is not storage stable, eva is used in warm climates, and ppa is merely an extender ; it is not an alternative. as far as tire rubber is concerned, it requires almost 340f to 410f temperature to blend the rubber in the asphalt. this is very high temperature for asphalt blending, especially at 3500 rpm. in this study, an attempt has been made to utilize bone glue (bg), a by - product of food and cattle industries, to modify asphalt binders. bg is protein - based glue made from collagen extracted from animal bones, hides, and flesh waste. it is the most abundant protein in animals that makes up 25% to 35% of the whole body protein content. it has some types, out of which collagen i is the main type of collagen, which is 90% of the total collagen present in the body. this type of collagen is acquired from skin, organs, bones, and so forth. it is easily available in developing countries ; however the production of this product is very limited due to its limited use, mainly in local furniture industry. if this product is encouraged, the price can be reduced as well, which will inevitably reduce the initial cost. presently, it is about $ 0.8 to $ 1.9 per kg as per manufacturer in pakistan, which can be further reduced if purchased in bulk as tons. a quick survey of this industry, conducted by the researchers in july 2013, revealed that approximately 20 factories are currently producing this product all over pakistan. the limited use of the product reduces the number of producers to such a low level. advent of synthetic glue also played its role in limiting the use of bone glue. it can be determined through this survey that if demand increases, the supply will also increase, which will inevitably reduce the cost as well. apart from the above discussion, the current price of bg is easily comparable with any other polymer available in the market. in many cases, especially sbs, sbr, and elvaloy, the price of bg is still as low as 50% of the present cost of other polymers. a thorough and extensive literature review revealed that no research has been conducted on the use of bg for asphalt modification till now. the reason for selecting bg for modification is three - fold : it is cheap and conveniently and locally available for developing countries who have been manufacturing this product for centuries, and the process of modification is environment friendly. cost concern is the main reason for not using modified asphalt as these countries can not afford the manufacturing, processing, and construction costs of polymer - modified asphalt. however, they need to improve the performance of the pavements in particular at high temperature ranges. it is believed that the bg can be a viable and useful alternative for asphalt modification. the objectives of study are as follows.(1)explore the best possible method to blend bg in asphalt binder based on least possible energy and time consumption.(2)evaluate the viscosity and g of neat and bg - modified binders at various temperatures and load frequency. explore the best possible method to blend bg in asphalt binder based on least possible energy and time consumption. evaluate the viscosity and g of neat and bg - modified binders at various temperatures and load frequency. two viscosity graded asphalts, ac 5 (pg58 - 22) and pac 30 (pg70 - 22), were modified with 2.5, 5, 10, and 20 percent of bg. the bg, in pallets, was supplied by a vender from pakistan. in order to achieve homogeneous mix, it is very important to evolve a thorough, manageable, and low cost process. the idea behind the research is to develop a material, which is strong, sustainable, and resistant to the distress ; however, it is not advisable to come up with a procedure, which is highly expensive or significantly dangerous and damaging. this inability of melting was a considerable issue in asphalt mixing, as asphalts are always mixed at high temperatures with aggregates in order to achieve homogeneous mixing. however, if water is heated, this process of dissolution can be significantly expedited. hence, it was decided that, at first stage, dissolve the bg in water and then the solution of water and bg would be mixed in asphalt binder, since water can easily be evaporated at temperature range of 115c to 135c, which is also least damaging to the binder. in order to organize the mixing time, temperature, and quantity, it was found that the following procedure was quick and energy conserving. in order to mix 10% of bg, by weight of asphalt binder, 20 gm of bg pallets was put in 40 gm of water at room temperature. the dry weight of the pan, weight with water, and bg were recorded. time was set for 50 minutes in order to make solution of bg and water. after 50 minutes, the pan with water and bg was weighed again. after weighing, the moment water starts boiling the burner is slowed down in order to avoid spillage. when the solution becomes homogenous (visually), the pan and solution are weighed again. required amount of asphalt binder is taken in a beaker of 600 ml and the bg - solution is added to the binder. the beaker is put in an oil bath for mixing at 130c using shear mixer at 1000 rpm. the mixing was stopped after 70 minutes or with respect to the percentage of water. mass loss due to evaporation was determined. when the mass loss equals the actual mass of the water added, the mixing time was considered adequate. viscosity is key information for asphalt mixtures as hma mixing and compaction depend on the values determined through viscosity testing. the superpave mix design recommends rotational viscometer for determining the viscosity of asphalt binder at high construction temperatures to ensure that binder is sufficiently fluid for pumping and mixing. the standard astm method d4402 or aashto tp48 was adopted to determine the viscosity of neat and bg - modified binders. the viscosity readings were used to determine the improvement in pg grading and overall mixing and compaction temperatures. bohlin 's dynamic shear rheometer (dsr) was used to conduct frequency sweep tests on neat and ac5 and bg - modified binders. tests were conducted at temperatures of 1, 8, 15, 25, 34, 46, 52, and 58c. the tests were conducted within the viscoelastic stress and strain levels for a range of frequencies from 1 to 60 hz at logarithmic increments. ftir analysis was performed with thermo scientific nicolet is10 ft - ir spectrometer in order to observe if the mixing process is homogeneous or not. as a matter of fact water can also be damaging for asphalt binder and water was used in the mixing process ; hence ftir was the best way to figure out if there are any water traces left in the mixture. it was found that with the increase of the bg dosage the time of evaporation increased. this issue was catered in establishing different times of mixing for different percentages of bg dosage, keeping few things constant, such as 200 g of asphalt and 130c temperature using oil bath in a 600 ml beaker. the mixing times reported in table 1 seem to be very less as compared to other polymer mixing times, especially when the mixing temperatures are also significantly higher, which results in less asphalt aging and less damage to the binder. it was also observed that the change of binder did not affect the mixing time, as the same time of 70 minutes was sufficient to evaporate the water from the pac30 binder as was found for ac5 binder, which is a very unique finding of this study. this mixing procedure does not require excessive heating, which results in excessive energy loss and unaffordable process. this process utilized very less energy, which makes it not only energy conserving to reduce the cost of the binder preparation, but also environment friendly. additionally, bg itself is not dangerous for human health and it is degradable as compared to other polymers. the limitation of the pan and beaker size restricted researchers to limited quantities ; however, it is expected that it will be easier to evaporate the water from the mixture when this procedure is applied at a larger scale, which will be more effective in both ways : energy conservation and less aging of asphalt. figure 1 clearly shows that viscosity of the bg - modified ac5 binder did not change significantly at 135c. this could be attributed to no aging effect during low temperature mixing process for a short time period. this result proved that the process of mixing is not only quick and easy, but also environment friendly, as the temperatures involved in this mixing process are very low, as compared to other polymer - modified asphalt mixing processes. on the other hand, viscosity of 20% bg - modified binder was increased up to 200%, at 150 and 165c. this increase might be due to the stiffening effect of bg and aging due to extended mixing time. the results of viscosity - temperature chart indicated that the mixing temperature ranges of hma mixtures for ac5 neat and 10% bg - modified binder are 143 to 147c and 148 to 158c, respectively. similarly, the compaction temperature ranges for ac5 neat and 10% bg - modified binder are 135 to 140c and 139 to 144c, respectively. it can be observed that average difference in mixing temperature is about 8c and the average difference in compaction temperature is 4c. compaction is the main process in which most of the heating energy is consumed and environment is polluted, and the labor is also exposed to the emissions during this process. a study conducted by european asphalt pavement association (eapa) reveals that reduction of temperature by 10c results in an emission reduction by 50% and a reduction in temperature by 11 to 12.5c reduces the bsm (benzene soluble matter) fume emission by a factor of 2 [12, 13 ]. moreover, another positive effect of the temperature reduction is a sustained improvement of the labor safety. this is a very important matter of concern in asphalt industry, especially in paving industry. lower compaction and mixing temperatures of bg modified binders as compared to polymer modified binders are remarkable achievements of the developed mixing procedure. interestingly, this binder was already modified with 4% sbs polymer and was further modified with 10% bg. warm to hot weather conditions are detrimental to asphalt pavements, especially if they are not modified. hence we considered the superpave rutting parameter of the complex shear modulus (g / sin) in order to compare the results of ac5 neat with 5%, 10%, and 20% and pac30 neat with 10% modified binder, as shown in tables 2 and 3. the data in the table indicates that the g / sin increases with the increase of bg dosage showing an optimum value that is 10% bg, after which g / sin decreases. on the other hand, at 1c the increase in g / sin values is 36% to 81% from higher frequency to lower frequency, respectively. the improvements in rutting parameter as discussed above imply high resistance to permanent deformation or rutting. this improvement is encouraging and provides solid ground to explore other performance characteristics as well. similar results were determined in pac30 binder modification ; the improvement was determined to be 23% on average at both temperatures. the infrared (ir) spectra of asphalt composite (ac5) show carbon - hydrogen stretching and bending frequencies characteristic of a hydrocarbon. ir peaks at 28502960 cm can be attributed to the c h symmetric and asymmetric stretch. h bending vibrations (scissoring) while the peaks at 11501350 cm most likely are due to c h bending vibrations such as twisting and wagging. the peaks at 720740 cm are indicative of a c h rocking vibrational mode. as one adds bone glue to the ac 5 sample, these same characteristic c h vibrational modes of the asphalt composite are still present in the ir spectrum. however, as one increases the amount of bone glue to the sample, then the amount of water in the ac 5 sample also increases and this becomes observable in the ir spectrum. in particular, at the 10% level of bone glue in the ac 5 sample and at 20% bone glue, the o h stretching frequency of water in the ir spectrum is observed at 32003400 cm, ~2100 cm, and 1640 cm. one may initially conclude that, with increasing bone glue and water addition to the ac 5 sample, the presence of water in the ir spectrum appears to be the major change. a longer reaction and evaporation time is warranted to remove the excess water seen in the sample (figure 3). based on the results and discussion the following conclusions and recommendations were drawn.(1)the mixing procedure derived is cost effective and timesaving.(2)the viscosity results indicate that mixing and especially compaction temperatures will not change in this modification, which makes it environment friendly and a better product in terms of labor health and safety.(3)improvement has been determined in g / sin values, which is an indicator of rutting resistance improvement. this characteristic, especially, will help in warm climate countries like southeast asia.(4)use of another binder proved that the effect of the bg is not binder sensitive ; rather it can improve any binder without affecting its mixing and compaction temperatures.(5)ftir analysis proved that the mixing procedure produced homogeneous mixing and no extra and abrupt peaks were observed in the spectrum. 10% and 20% mixtures exhibited some water traces, which can easily be removed by incrementing the mixing time to 2 to 3 minutes, as it was observed in pac30 and 10% bg mixing.(6)further research on different percentages of bg in binder and further rheological studies in order to fully explore this modifying material are in process. the viscosity results indicate that mixing and especially compaction temperatures will not change in this modification, which makes it environment friendly and a better product in terms of labor health and safety. improvement has been determined in g / sin values, which is an indicator of rutting resistance improvement. use of another binder proved that the effect of the bg is not binder sensitive ; rather it can improve any binder without affecting its mixing and compaction temperatures. ftir analysis proved that the mixing procedure produced homogeneous mixing and no extra and abrupt peaks were observed in the spectrum. 10% and 20% mixtures exhibited some water traces, which can easily be removed by incrementing the mixing time to 2 to 3 minutes, as it was observed in pac30 and 10% bg mixing. further research on different percentages of bg in binder and further rheological studies in order to fully explore this modifying material are in process. | asphalt has been modified for the past several decades using various additives, including synthetic polymers. polymer modification improves structural and engineering characteristics of the binder, which is a result of improvement in rheological characteristics of binder as well as its adhesion capability with the aggregate. such enhancement inevitably enhances the performance characteristics of hot mix asphalts (hma) such as fatigue life, resistance to rutting, and thermal cracking. even though polymer - modified hma is popular in north america and european countries, its use is still limited in developing countries of southeast asia due to high costs associated with its manufacturing, processing, and energy consumption. in this study, a new kind of asphalt modifier derived from animal wastes, such as bones, hides, and flesh commonly known as bone glue, is studied. this biomaterial which is a by - product of food and cattle industries is cheap, conveniently available, and produced locally in developing countries. the results of the research study showed that the bone glue can easily be mixed with asphalt without significantly altering the asphalt binder 's viscosity and mixing and compaction temperatures of hma. additionally, improvements in complex shear modulus for a range of temperatures were also determined and it was found that complex shear modulus was improved by bone glue modification. |
traumatic injuries to the spinal cord frequently leave permanent neurological disabilities to the victims and impose enormous economic burdens on the families and society, yet there is no single effective therapeutic option to improve functional recovery. recent studies have shown promises that cellular replacement either by transplantation of neural stem or progenitor cells (nsc) or mobilization of endogenous nscs could be an effective therapeutic option (rossignol., 2007 ; however, inhospitable microenvironment of injured spinal cord has been shown to limit survival and differentiation of either grafted or endogenous nscs (monje., 2002 ; snyder and park, 2002 ; ishii., 2006 ; kim., 2007 moreover, differentiation of nscs into neuronal or oligodendroglial lineages in the injured spinal cord is significantly hampered (cao., 2001 ; cao., 2002). therefore, modification of the inhospitable microenvironment would greatly improve the efficacy of nsc transplantation approach for spinal cord injury. since the complexity of cellular and molecular composition can hardly be modeled in dissociated cell culture system, however, screening potential candidate factors in in vivo system would require a considerable amount of time and cost (pena, 2010). an in vitro system that allows facile manipulation of the microenvironment and yet closely mimics in vivo complex tissue microenvironment, therefore, would be desirable for this purpose. the organotypic slice culture allows long - term maintenance of tissue architecture in dish and has been an important tool in neurobiology research (gahwiler., 1997 ; noraberg., the current study sought to establish and characterize the organotypic spinal cord slice culture in which exogenous nscs are seeded or endogenous neural progenitor cells are marked. in this culture system, we performed exemplary experiments to study possible effects of environmental manipulation on biological behavior of either exogenous nscs or endogenous neural progenitor cells in a complex tissue environment similar to that of in vivo system. as an exogenous source of nscs, we used immortalized human neural stem cell (nsc) line, which has been widely employed in various animal models of cns diseases (jeong., 2003 ; meng., 2003 ; yasuhara., 2006 ; lee., 2007 ; hwang., preparation and culture of this nsc line has been reported in detail elsewhere (lee., 2009). briefly, the human nsc line was generated by transducing dissociated cells of fetal human telencephalon tissues (at 14 weeks gestation) by replication incompetent retroviral vector containing v - myc (flax. the permission to use the fetal tissues was granted by the clinical research screening committee involving human subjects of the university of british columbia, and the fetal tissues were obtained from the anatomical pathology department of vancouver general hospital. cryopreserved nscs were thawed and cultured in dulbecco 's modified eagle medium (dmem ; hyclone, logan, ut, usa) with high glucose supplemented with 5% fetal bovine serum (fbs) and 20 mg / ml gentamicin (sigma, st louis, mo, usa) for at least three days before cell seeding. we also generated a nsc line overexpressing green fluorescent protein (gfp) by transducing the human nsc line by retrovirus encoding gfp. organotypic spinal cord slice cultures were prepared according to the standard interface method (stoppini., 1991). after decapitation, the brain was removed, and the entire spinal cord block was dissected from p5 - 7 sprague dawley rats through an opening in the ventral side of the spine. axial slices of the cervical and lumbar cord were dissected and transversely sliced into a 350 um thickness on a mcilwain tissue chopper (the mickle laboratory engineering co., guildford, uk) in sterile gey 's balanced salt solution (sigma - aldrich). the slices were then carefully separated with two pairs of fine forceps and transferred to sterile, 30 mm diameter millipore milicell - cm (0.4 m ; millipore, bedford, ma) culture plate insert, using a glass pasteur pipette. five or six randomly selected slices that looked apparently intact and undamaged were transferred and placed on each insert. the inserts were placed in 35 mm diameter culture wells (six well culture trays ; bd falcon, franklin lakes, nj). cultures were maintained in 1 ml of the serum - based medium containing 50% basal medial eagle (sigma - aldrich), 25% hank 's balanced salt solution (gibco), 2.2 g glucose, 1 mm glutamax - i supplement (invitrogen, carlsbad, ca), and 20% fbs. culture plates were incubated at 37 in a 5% co2 - 95% o2 humidified incubator. the level of the medium was adjusted to slightly below the surface of the slices in order to provide a sufficient supply of the culture medium and mixed gases. the human nscs were trypsinized just before seeding, and a total of 1,000 cell/1l cells for each slice were seeded using a glass micropipette. one day after seeding, the culture medium was changed. to induce differentiation of nscs grown on top of slices, to identify seeded nscs, cells were prelabeled with brdu or dii. for brdu prelabeling, cells were treated with 2 m brdu dissolved in culture media for 24 hours prior to harvesting for transplantation. the human nscs were labeled vybrantdii (molecular probe) according to the manufacturer 's instruction. to mark endogenous proliferating neural progenitor cells, brdu at a concentration of 1.0 m was added to the culture media one day before fixation (24 hours incubation). il-1 (r&d systems, minneapolis, mn) was added to the media at a concentration of 20 ng / ml for three days before fixation. to mimic secondary injury process after spinal cord injury, cultured spinal cord slices were exposed to a hypoxic chamber (forma scientific, marietta, oh). glucose - free medium dmem was saturated with nitrogen gas mixture (95% n2, and 5% co2) for 40 min to obtain an o2 gas pressure close to zero, as measured by a dip - type o2 microelectrode. after saturation, the inserts with spinal cord slices were placed in 1 ml of saturated glucose - free medium dmem and then maintained at 37 in a n2 saturated environment. after 40 minutes in the chamber, the inserts were moved to the fresh culture medium and atmosphere with 5% co2 - 95% o2. slice was excised from the culture insert together with the attached membrane, and each slice is transferred to a 24 well plate. the slices were permeabilized and blocked by 0.5% triton with 10% goat serum for 2 hours. then, slices were incubated overnight with primary antibodies at 4 or 2 hours at room temperature. we used polyclonal ng2 antibody (1:1,000 ; millipore, bedford, ma) as a marker for oligodendrocyte progenitors, polyclonal gfap antibody (1:500 ; dako, carpinteria, ca) for astrocytes, tuj1 (1:500 ; millipore, bedford, ma) for immature neurons, cd11b (1:300 : abcam, cambridge, uk) for resident microglia, and brdu (1:500 ; serotec, oxford, uk) for a marker of proliferating nscs. for brdu staining, dna denaturation was achieved by treatment with 2 m hcl at room temperature for 60 min followed by incubation for 30 min with 0.1 m borate solution (sigma - aldrich). after thorough rinsing, slices were incubated by rat igg secondary antibody tagged with alexa fluor 594 or 488 (molecular probes, eugene, or) for 1 hour at room temperature to visualize antigen - antibody complex. as an exogenous source of nscs, we used immortalized human neural stem cell (nsc) line, which has been widely employed in various animal models of cns diseases (jeong., 2003 ; meng., 2003 ; yasuhara., 2006 ; lee., 2007 ; hwang., preparation and culture of this nsc line has been reported in detail elsewhere (lee., 2009). briefly, the human nsc line was generated by transducing dissociated cells of fetal human telencephalon tissues (at 14 weeks gestation) by replication incompetent retroviral vector containing v - myc (flax. the permission to use the fetal tissues was granted by the clinical research screening committee involving human subjects of the university of british columbia, and the fetal tissues were obtained from the anatomical pathology department of vancouver general hospital. cryopreserved nscs were thawed and cultured in dulbecco 's modified eagle medium (dmem ; hyclone, logan, ut, usa) with high glucose supplemented with 5% fetal bovine serum (fbs) and 20 mg / ml gentamicin (sigma, st louis, mo, usa) for at least three days before cell seeding. we also generated a nsc line overexpressing green fluorescent protein (gfp) by transducing the human nsc line by retrovirus encoding gfp. organotypic spinal cord slice cultures were prepared according to the standard interface method (stoppini., 1991). after decapitation, the brain was removed, and the entire spinal cord block was dissected from p5 - 7 sprague dawley rats through an opening in the ventral side of the spine. axial slices of the cervical and lumbar cord were dissected and transversely sliced into a 350 um thickness on a mcilwain tissue chopper (the mickle laboratory engineering co., guildford, uk) in sterile gey 's balanced salt solution (sigma - aldrich). the slices were then carefully separated with two pairs of fine forceps and transferred to sterile, 30 mm diameter millipore milicell - cm (0.4 m ; millipore, bedford, ma) culture plate insert, using a glass pasteur pipette. five or six randomly selected slices that looked apparently intact and undamaged were transferred and placed on each insert. the inserts were placed in 35 mm diameter culture wells (six well culture trays ; bd falcon, franklin lakes, nj). cultures were maintained in 1 ml of the serum - based medium containing 50% basal medial eagle (sigma - aldrich), 25% hank 's balanced salt solution (gibco), 2.2 g glucose, 1 mm glutamax - i supplement (invitrogen, carlsbad, ca), and 20% fbs. culture plates were incubated at 37 in a 5% co2 - 95% o2 humidified incubator. the level of the medium was adjusted to slightly below the surface of the slices in order to provide a sufficient supply of the culture medium and mixed gases. the human nscs were trypsinized just before seeding, and a total of 1,000 cell/1l cells for each slice were seeded using a glass micropipette. to induce differentiation of nscs grown on top of slices, the fbs concentration was lowered to 5%. to identify seeded nscs, cells were prelabeled with brdu or dii. for brdu prelabeling, cells were treated with 2 m brdu dissolved in culture media for 24 hours prior to harvesting for transplantation. the human nscs were labeled vybrantdii (molecular probe) according to the manufacturer 's instruction. to mark endogenous proliferating neural progenitor cells, brdu at a concentration of 1.0 m was added to the culture media one day before fixation (24 hours incubation). il-1 (r&d systems, minneapolis, mn) was added to the media at a concentration of 20 ng / ml for three days before fixation. to mimic secondary injury process after spinal cord injury, cultured spinal cord slices were exposed to a hypoxic chamber (forma scientific, marietta, oh). glucose - free medium dmem was saturated with nitrogen gas mixture (95% n2, and 5% co2) for 40 min to obtain an o2 gas pressure close to zero, as measured by a dip - type o2 microelectrode. after saturation, the inserts with spinal cord slices were placed in 1 ml of saturated glucose - free medium dmem and then maintained at 37 in a n2 saturated environment. after 40 minutes in the chamber, the inserts were moved to the fresh culture medium and atmosphere with 5% co2 - 95% o2. slice was excised from the culture insert together with the attached membrane, and each slice is transferred to a 24 well plate. the slices were permeabilized and blocked by 0.5% triton with 10% goat serum for 2 hours. then, slices were incubated overnight with primary antibodies at 4 or 2 hours at room temperature. we used polyclonal ng2 antibody (1:1,000 ; millipore, bedford, ma) as a marker for oligodendrocyte progenitors, polyclonal gfap antibody (1:500 ; dako, carpinteria, ca) for astrocytes, tuj1 (1:500 ; millipore, bedford, ma) for immature neurons, cd11b (1:300 : abcam, cambridge, uk) for resident microglia, and brdu (1:500 ; serotec, oxford, uk) for a marker of proliferating nscs. for brdu staining, dna denaturation was achieved by treatment with 2 m hcl at room temperature for 60 min followed by incubation for 30 min with 0.1 m borate solution (sigma - aldrich). after thorough rinsing, slices were incubated by rat igg secondary antibody tagged with alexa fluor 594 or 488 (molecular probes, eugene, or) for 1 hour at room temperature to visualize antigen - antibody complex. when the cultured slice was view with the transmitted light, the gray matter was apparently distinguished from the surrounding white matter (fig. neurofilament staining revealed clear margin of the dorsal horn where profuse axons and scattered neuronal cell bodies were observed (fig. in contrast, axonal fibers in the white matter were sparsely observed, suggesting that axons in the white matter tract underwent some degree of degeneration after disconnected from the cell bodies. in the ventral horn, large neurons suggestive of spinal motor neurons they grew long neurites within the slice indicating that the neurons were healthy and made connections with different neurons in the slice. gfap staining showed a large number of astrocytes located in both the white and gray matter (fig. numerous oligodendrocyte progenitors expressing ng2 proteoglycan (dawson., 2000) were also observed. however, cd11b (ox42) staining did not show apparent microglial cells in the slice (data not shown), suggesting that no macrophages migrate to the spinal cord to become resident microglial cells before postnatal day 5. together, these results showed that the spinal cord slices maintain characteristics of the cellular and tissue architecture of the in vivo spinal cord tissue. to mimic nsc grafting into the spinal cord, we seeded nscs on top of cultured spinal cord slices using the hamilton syringe at between 7 to 10 days after initial culture. the seeded hnscs on spinal cord slice culture were prelabeled by dii or brdu. in some experiments, we used gfp expressing hnscs to identify the seeded cells. many of the cells survived the seeding procedure and were identified up to 4 weeks after seeding (fig. they were dispersed throughout the surface of the spinal cord slice, but many of them were found at or near the parts of the slice where they were dislodged from the hamilton syringe (fig. these findings indicated that nscs can be cultured on top of cultured spinal cord slices, providing an opportunity to examine biological behavior of nscs in an environment which closely mimics in vivo spinal cord tissue, yet is still amenable to experimental manipulation. transplantation of nscs into injured spinal cord is usually complicated by a poor survival of grafted cells (okada. increasing survival of grafted nscs could lead to an improved efficiency of nsc transplantation strategy. to mimic the post - injury microenvironment, cultured spinal cord slices were exposed to hypoxic and aglycemic chamber for 40 minutes. then nscs were seeded onto the slice, and the survival of nscs was compared to nscs seeded onto control slices without exposure to the hypoxic chamber. we found that pre - exposure of slices to hypoxic and aglycemic chamber markedly reduced the survival of nscs compared to those grown on control slices (fig. when nscs collected from spinal cord were transplanted into spinal cord, they could not differentiate into neurons, whereas the same nscs differentiated neurons when they were transplanted into the brain (shihabuddin., 2000). addition of retinoic acid into the culture medium did not increase tuj-1 expression (data not shown). some nscs (20% of brdu+ cells) were colocalized with gfap, indicating differentiation into astrocytic lineage (fig., they were able to differentiate into ng2 positive oligodendrocytic lineage cells (26% of brdu+ cells ; fig., the microenvironment created by cultured spinal cord tissue does not seem to be conducive to neuronal differentiation of nscs, lending a support to the notion that spinal cord is non - neurogenic. endogenous glial progenitor cells are present in adult spinal cord and increase their number in response to spinal cord injury (horner., 2000 ; it is possible that they can differentiate into mature oligodendrocytes that may participate in spontaneous remyelination process (yang., 2006), although the extent of remyelination is often limited. to recapitulate the glial progenitor cells in a complex environment 4a). as expected from the in vivo observation (horner., 2000), brdu positive progenitor cells were never colocalized with neuronal markers (data not shown). instead, they showed expression of glial marker such as gfap (fig. 4c), suggesting that the proliferating neural progenitors are already committed to glial rather than neural lineage. to examine whether the molecular microenvironment in the injured spinal cord could affect the lineage determination of glial progenitor cells, we chose il-1 which is a well characterized proinflammatory cytokine and know to be unregulated after spinal cord injury (rice. 4e). however, addition of il-1 increased the number of ng2 + oligodendrocyte lineage cells by more than three folds (p<0.05, n=3 slices per condition) (fig. we found that in organotypic spinal cord slices, regional specificity such as gray and white matter is conserved and cellular diversity and/or complexity is maintained encompassing neurons and glial cells. the fact that the cultured slices retain major characteristics of in vivo spinal cord tissue implies that seeded nscs on spinal cord slices are exposed to the microenvironment very similar to the in vivo spinal cord tissue. it has to be mentioned, however, that the cultured spinal cord slices can not represent all the in vivo properties. for example, there were no microglial cells in the slices that play various functions of paramount importance in inflammatory conditions (ankeny and popovich, 2009). in addition, the majority of long white matter tracts surrounding gray matter seemed to be degenerated, indicating that contribution of myelin can not be mimicked in cultured spinal cord slices. we considered, however, that the advantage of in vitro system for being easily amenable to experimental manipulation may offset a large part of the differences between the in vivo tissue and the organotypic spinal cord slice. taken together, our findings suggested that organotypic slices can mimic the complex spinal cord tissue environment, and it would be feasible to study environmental factors affecting nsc using in the injured spinal cord. it has been increasingly clear that adult cns, especially diseased cns, is not always favorable to the integration nscs with host tissue (bjorklund and lindvall, 2000 ; snyder and park, 2002 ; okano., injured cns microenvironment considerably limits the survival of grafted cells (emgard., 2003 ; bakshi., 2005 ; lee., 2009), which may pose a significant hurdle to be overcome before nsc transplantation strategy is applied to human patients. traumatic spinal cord injuries are usually complicated by a breakdown of blood supply leading to tissue ischemia and hypoxia (chu., 2002). as an example of altering the microenvironment in a manner similar to the spinal cord injury, the cultured spinal cord slices were pre - exposed to a hypoxic (aglycemic as well) chamber before the nscs were seeded on the them. although hypoxic injury is not supposed to replicate all the changes related to traumatic injuries, we found that exposure to hypoxic chamber for 40 minutes did make a difference in the survival of seeded nscs on the slices. it is assumed that hypoxic conditions altered the environment of spinal cord slices to become more inhospitable for nscs to survive. therefore, the hypoxic condition used in this experiment can be used to screen potential factors or small molecules that regulate the survival of grafted nscs in the injured spinal cord. after spinal cord injury, demyelination of spared white matter significantly hampers spontaneous function recovery (kim., 2007). therefore, preventing demyelination or promoting remyelination is one of the key strategies to improve function outcomes after spinal cord injury (mcdonald and belegu, 2006). modifying the microenvironment of the injured spinal cord may improve the extent of oligodendrogenesis and ultimately promote remyelination. we tested whether inflammatory molecules can affect the fate of glial progenitors, especially oligodendrocytic lineage, in the cultured spinal cord slice. the cultured spinal cord slices closely recapitulated in vivo glial progenitors since the proliferating cells showed only glial rather than neuronal lineage. therefore, this culture system allowed a convenient, yet highly relevant assay system to identify a potential environmental factor. it can be envisioned that the organotypic spinal cord culture system is used as a platform of an assay screening a potential candidate from small molecule library to modify inhibitory microenvironment for endogenous neural progenitors (wang., 2006). to summarize, the current study established the utility of the organotypic spinal cord slices to study neural stem / progenitor cell microenvironment in the injured spinal cord. exposure of the cultured slices to hypoxic chamber mimicked the post - injury environment in that the survival of seeded nscs was reduced. cultured spinal cord slices retained the non - neurogenic characteristics of in vivo spinal cord tissue since they did not support neuronal differentiation of either exogenous nscs or endogenous neural progenitors. the cultured spinal cord slices also provided an opportunity to examine the influence of inflammatory environment mimicking post - injury condition on endogenous neural progenitors. collectively, we conclude that the organotypic spinal cord slice culture can be properly utilized to study molecular factors from the post - injury microenvironment affecting nscs in the injured spinal cord. | the molecular microenvironment of the injured spinal cord does not support survival and differentiation of either grafted or endogenous nscs, restricting the effectiveness of the nsc - based cell replacement strategy. studying the biology of nscs in in vivo usually requires a considerable amount of time and cost, and the complexity of the in vivo system makes it difficult to identify individual environmental factors. the present study sought to establish the organotypic spinal cord slice culture that closely mimics the in vivo environment. the cultured spinal cord slices preserved the cytoarchitecture consisting of neurons in the gray matter and interspersed glial cells. the majority of focally applied exogenous nscs survived up to 4 weeks. pre - exposure of the cultured slices to a hypoxic chamber markedly reduced the survival of seeded nscs on the slices. differentiation into mature neurons was severely limited in this co - culture system. endogenous neural progenitor cells were marked by brdu incorporation, and applying an inflammatory cytokine il-1 significantly increased the extent of endogenous neural progenitors with the oligodendrocytic lineage. the present study shows that the organotypic spinal cord slice culture can be properly utilized to study molecular factors from the post - injury microenvironment affecting nscs in the injured spinal cord. |
sexually undifferentiated juvenile sea bass (approximately 1 year of age) were obtained from coelho & castro lda. (pvoa do varzim, portugal) and were kept in 2,000-l glass fiber tanks (density, 24 kg / m) supplied with natural sea - water (20 1) until exposures began. fish used for studies had an average body weight of 30 10 g (study 1, n = 224) and 32 10 g (study 2, n = 120). e2 (98% purity), ee2 (98% purity), and bpa (99% purity) were purchased from sigma - aldrich, (st. louis, mo, usa), and the marine salt was supplied by sera premium (heinsberg, germany). we followed the principles in the guide for the care and use of laboratory animals (institute of laboratory animal resources 1996). master stock solutions of chemicals were prepared in methanol (analytical grade) and stored at 20c. aqueous stock solutions were regularly prepared from aliquots of master solutions and administrated to the tanks using a multi - channel peristaltic pump equipped with silicon tubing (watson - marlow, falmouth, cornwall, uk). diluted solution flowed into the experimental tanks, which resulted in a theoretical complete water change every 30 hr. dosing started with the simultaneous addition of a required volume of chemical solution directly into the tanks. water flowing from tanks was filtered through activated carbon before being delivered into the municipal sewage system. seawater used in the system was artificially prepared using marine salt diluted in dechlorinated filtered municipal tap water. dissolved oxygen saturation (> 80%) and total ammonia concentrations (< 0.0010.2 test vessels and tanks were constructed of glass, with a minimum of other materials in contact (e.g., silicon rubber tubing) with the test solutions. exposures were carried out at 15c in artificial seawater (20) under a photoperiod of 12 hr light:12 hr dark. before exposure, animals were allowed to acclimatize for 1 week to experimental test conditions. fish were fed food pellets (aquasoja, portugal) 1% of body weight per day throughout the exposure period. concentrations of methanol served as the solvent control, and 100 ng / l ee2 was the positive control. we planned the concentrations of test chemicals based on range - finding studies, such that the entire effect range was covered between low and maximal effects, allowing statistical estimation of concentration response functions for effects between 1 and 100%. each experiment was performed using at least six different concentrations, ranging from 0.04 to 3.7 nm (101,000 ng / l) for e2, 0.03 to 6.8 nm (102,000 ng / l) for ee2, and 0.04 to 7.0 m (101,600 g / l) for bpa. selected concentrations of e2 (0.04, 0.15, 0.37, and 3.7 nm) and bpa (0.04, 0.13, and 0.44 m) were repeated after 3 months. stock solutions of each tested chemical were prepared in methanol (analytical grade) and dosed to glass mixed vessels by means of a peristaltic pump at a rate of 0.10.5 ml / min ; these solutions were then mixed with the dilution water flowing to mixing vessels at a rate of 32 ml / min, resulting in 1:3211:65 dilutions. to assess whether joint effects of three estrogenic chemicals were additive, we compared the observed effects with the ca predictions for a wide range of different vtg levels. to keep the number of fish to a minimum, the response - surface instead, we chose the fixed - ratio design (faust., the ratio of concentrations of individual compounds is kept constant, and only the total concentration of the mixture is varied. by using this approach a complete concentration response relationship for the mixture can be generated, which allows a comparative assessment between observed and predicted ec values for a wide range of effects. we prepared a master stock solution containing each of the chemicals at their nominal ec50 (median effective concentrations ; equipotent ratio). dilutions of this mixture were then tested, such that the entire range of vtg responses between 100 and 0% was covered evenly according to the expectation of the ca model. after 2 months, we repeated three selected mixture concentrations in an independent second mixture study. the first set of water samples was collected 1 week after the chemical dosing of the tanks began (t0). after this first sampling, the fish were placed into the tanks. the second set (t7) was taken after 2 weeks of dosing, and the third set (t14) was taken after the third and final week, on the day that the experiment was terminated. all samples were solid - phase extracted on a dvb speedisk (baker, deventer, the netherlands). for the single chemical exposures as well as the t0 sampling points of the mixture exposures, we used an isocratic hplc method (adapted from belfroid. 1999) coupled to diode array detection (varian model 9065 ; palo alto, ca, usa). separation was done using a mobile phase consisting of methanol / water (60/40, vol / vol). for the t7 and t14 sampling points of the mixture experiments, the same method was used as for e2 and ee2, consisting of gas chromatography coupled to ion trap detection (gc - itd) using a saturn 2200 ion trap detector (varian model 9095), which had the advantage of requiring a smaller sample volume because of the higher sensitivity of the method. for the analyses of e2, ee2, and bpa using gc - itd, we added a deuterated standard containing e2-d4, ee2-d4, or bpa - d6 to the samples prior to solid phase extraction (adapted from belfroid. derivatization was carried out using silyl reagent before analysis. unless stated otherwise, concentration response data given in this article refer to the arithmetic mean of measured concentrations in the three periods of sampling (t0, t7, t14), as proposed by the organisation for economic co - operation and development (oecd 2000). fish were anesthetized and blood was extracted from the caudal vein using a heparinized syringe. plasma was obtained after blood centrifugation (6,000 g for 7 min at 5c) in heparinized tubes containing phenylmethylsulfonyl fluoride (1 mm) and stored at 20c until required for vtg analysis. (n = 8/treatment) were determined using a competitive elisa assay, as described by maans. sea bass vtg used for coating elisa plates and as a standard was isolated as described by maans. the secondary antibody (goat anti - rabbit antibody igg) and the tetramethyl benzidine peroxidase substrate kit were obtained from bio - rad (hercules, ca, usa). the range of the standard vtg curve was 2100 ng / ml, corresponding to 80% and 20% of binding, with 50% of binding around 15 ng / ml. juvenile plasma samples were tested at a dilution of 1:10 or higher in order to place all measurements within the confidence range of standard curve ; intraassay and interassay coefficients of variation (cvs) were similar to those described by maans. we accounted for slight differences in absolute control effects between studies by standardizing absolute effect scales to relative effects : the mean vtg concentration in fish from negative - control and positive - control tanks were used as the minimum and maximum responses, respectively, in order to standardize individual vtg measurements to values between zero (i.e., no vtg induction) and one (i.e., vtg level in positive control). scaling to relative effects was carried out after individual vtg effect data were log10-transformed (i.e., an ec50 corresponds to the concentration that produces a log10-transformed vtg induction), a value that is the median in relation to negative and positive controls. we performed statistical concentration response analyses in the same way for all compounds and for the mixture by applying a best - fit procedure : various nonlinear regression models were fitted independently to the same data set, and we selected the best fit on the basis of statistical criteria. if data from repeated studies were obtained, the pooled data was used ; to account for intra- and inter - experimental variability associated with this nested data scenario, we adopted the generalized nonlinear mixed modeling approach [see brian. otherwise, the regression models were fitted to the data as described by scholze. effect concentrations (ecx) were calculated from the functional inverse of the best fit - ting model. statistical uncertainties for estimated effect concentrations were expressed as 95% confidence intervals (cis) and approximately determined by applying the bootstrap method (efron and tibshirani 1993). additionally, we derived no observed effect concentrations (noecs) using the likelihood ratio test under total order restriction (bretz and hothorn 2003). calculations for statistical inference are based on absolute vtg values, and all approaches were implemented using sas statistical software (sas 2001). based on the best - fit regression functions of single compounds, we calculated expected effect concentrations for the ternary mixture in definite ratios. quantitative relations between effects of single substances and the mixture are described by the concept of ca. for a multi - component mixture of n components, it is defined by where ecxi denotes the effect concentrations of single compounds 1 to n (i.e., those concentrations that alone would produce the same quantitative effect x as the mixture), ecxmix is the mixture concentration that induces an overall effect x, and pi is the proportion of the ith component in the mixture. individual effect concentrations, ecxi, are derived from individual concentration response functions, fi, by using their inverse functional form. graphs of predicted concentration response curves were obtained by calculating numerous ecxmix values, with x varying from 1% to 99% in steps of 1%. all individual effect concentrations, ecxi, are estimates and are therefore subject to stochastic variability, which means that the predicted mixture effect concentration also has a measure of statistical uncertainty. this was achieved using the bootstrap method (efron and tibshirani 1993), which enabled 95% cis to be derived for predicted mean effect. predicted and observed effect concentrations were deemed to be statistically significantly different when the 95% ci of predicted and observed effects did not overlap. the analytical determination of each mixture concentration often necessitated adjustments of the nominal mixture ratios, with relative proportions, pi, of the compounds being different for each measured mixture exposure. this still enabled the calculation of expected mixture concentrations because all the information required is available as demanded by equation 1. in a strict quantitative sense, however, this can be done only for the tested mixture concentrations ; because extrapolation methods are unsuitable, the mixture data can not be figured out using the same concentration scale. however, if the variation of the individual mixture ratios follows a random process, then smoothing techniques can be applied in order to estimate an average mixture ratio, which also enables the usual concentration response relationships to be constructed for the mixture. we determined the mean mixture ratio by calculating the average fraction for each compound within the total mixture using data for the six highest tested mixture concentrations. sexually undifferentiated juvenile sea bass (approximately 1 year of age) were obtained from coelho & castro lda. (pvoa do varzim, portugal) and were kept in 2,000-l glass fiber tanks (density, 24 kg / m) supplied with natural sea - water (20 1) until exposures began. fish used for studies had an average body weight of 30 10 g (study 1, n = 224) and 32 10 g (study 2, n = 120). e2 (98% purity), ee2 (98% purity), and bpa (99% purity) were purchased from sigma - aldrich, (st. louis, mo, usa), and the marine salt was supplied by sera premium (heinsberg, germany). we followed the principles in the guide for the care and use of laboratory animals (institute of laboratory animal resources 1996). master stock solutions of chemicals were prepared in methanol (analytical grade) and stored at 20c. aqueous stock solutions were regularly prepared from aliquots of master solutions and administrated to the tanks using a multi - channel peristaltic pump equipped with silicon tubing (watson - marlow, falmouth, cornwall, uk). diluted solution flowed into the experimental tanks, which resulted in a theoretical complete water change every 30 hr. dosing started with the simultaneous addition of a required volume of chemical solution directly into the tanks. water flowing from tanks was filtered through activated carbon before being delivered into the municipal sewage system. seawater used in the system was artificially prepared using marine salt diluted in dechlorinated filtered municipal tap water. test vessels and tanks were constructed of glass, with a minimum of other materials in contact (e.g., silicon rubber tubing) with the test solutions. exposures were carried out at 15c in artificial seawater (20) under a photoperiod of 12 hr light:12 hr dark. before exposure, animals were allowed to acclimatize for 1 week to experimental test conditions. fish were fed food pellets (aquasoja, portugal) 1% of body weight per day throughout the exposure period. concentrations of methanol served as the solvent control, and 100 ng / l ee2 was the positive control. we planned the concentrations of test chemicals based on range - finding studies, such that the entire effect range was covered between low and maximal effects, allowing statistical estimation of concentration response functions for effects between 1 and 100%. each experiment was performed using at least six different concentrations, ranging from 0.04 to 3.7 nm (101,000 ng / l) for e2, 0.03 to 6.8 nm (102,000 ng / l) for ee2, and 0.04 to 7.0 m (101,600 g / l) for bpa. selected concentrations of e2 (0.04, 0.15, 0.37, and 3.7 nm) and bpa (0.04, 0.13, and 0.44 m) were repeated after 3 months. stock solutions of each tested chemical were prepared in methanol (analytical grade) and dosed to glass mixed vessels by means of a peristaltic pump at a rate of 0.10.5 ml / min ; these solutions were then mixed with the dilution water flowing to mixing vessels at a rate of 32 ml / min, resulting in 1:3211:65 dilutions. to assess whether joint effects of three estrogenic chemicals were additive, we compared the observed effects with the ca predictions for a wide range of different vtg levels. to keep the number of fish to a minimum, the response - surface instead, we chose the fixed - ratio design (faust. the ratio of concentrations of individual compounds is kept constant, and only the total concentration of the mixture is varied. by using this approach a complete concentration response relationship for the mixture can be generated, which allows a comparative assessment between observed and predicted ec values for a wide range of effects. we prepared a master stock solution containing each of the chemicals at their nominal ec50 (median effective concentrations ; equipotent ratio). dilutions of this mixture were then tested, such that the entire range of vtg responses between 100 and 0% was covered evenly according to the expectation of the ca model. after 2 months, we repeated three selected mixture concentrations in an independent second mixture study. we planned the concentrations of test chemicals based on range - finding studies, such that the entire effect range was covered between low and maximal effects, allowing statistical estimation of concentration response functions for effects between 1 and 100%. each experiment was performed using at least six different concentrations, ranging from 0.04 to 3.7 nm (101,000 ng / l) for e2, 0.03 to 6.8 nm (102,000 ng / l) for ee2, and 0.04 to 7.0 m (101,600 g / l) for bpa. selected concentrations of e2 (0.04, 0.15, 0.37, and 3.7 nm) and bpa (0.04, 0.13, and 0.44 m) were repeated after 3 months. stock solutions of each tested chemical were prepared in methanol (analytical grade) and dosed to glass mixed vessels by means of a peristaltic pump at a rate of 0.10.5 ml / min ; these solutions were then mixed with the dilution water flowing to mixing vessels at a rate of 32 ml / min, resulting in 1:3211:65 dilutions. to assess whether joint effects of three estrogenic chemicals were additive, we compared the observed effects with the ca predictions for a wide range of different vtg levels. to keep the number of fish to a minimum, the response - surface instead, we chose the fixed - ratio design (faust. the ratio of concentrations of individual compounds is kept constant, and only the total concentration of the mixture is varied. by using this approach a complete concentration response relationship for the mixture can be generated, which allows a comparative assessment between observed and predicted ec values for a wide range of effects. we prepared a master stock solution containing each of the chemicals at their nominal ec50 (median effective concentrations ; equipotent ratio). dilutions of this mixture were then tested, such that the entire range of vtg responses between 100 and 0% was covered evenly according to the expectation of the ca model. after 2 months, we repeated three selected mixture concentrations in an independent second mixture study. the first set of water samples was collected 1 week after the chemical dosing of the tanks began (t0). after this first sampling, the fish were placed into the tanks. the second set (t7) was taken after 2 weeks of dosing, and the third set (t14) was taken after the third and final week, on the day that the experiment was terminated. all samples were solid - phase extracted on a dvb speedisk (baker, deventer, the netherlands). for the single chemical exposures as well as the t0 sampling points of the mixture exposures, we used an isocratic hplc method (adapted from belfroid. 1999) coupled to diode array detection (varian model 9065 ; palo alto, ca, usa). separation was done using a mobile phase consisting of methanol / water (60/40, vol / vol). for the t7 and t14 sampling points of the mixture experiments, the same method was used as for e2 and ee2, consisting of gas chromatography coupled to ion trap detection (gc - itd) using a saturn 2200 ion trap detector (varian model 9095), which had the advantage of requiring a smaller sample volume because of the higher sensitivity of the method. for the analyses of e2, ee2, and bpa using gc - itd, we added a deuterated standard containing e2-d4, ee2-d4, or bpa - d6 to the samples prior to solid phase extraction (adapted from belfroid. 1999 and houtman. 2004). following the cleanup of the extracts with c18 cartridges, derivatization was carried out using silyl reagent before analysis. unless stated otherwise, concentration response data given in this article refer to the arithmetic mean of measured concentrations in the three periods of sampling (t0, t7, t14), as proposed by the organisation for economic co - operation and development (oecd 2000). fish were anesthetized and blood was extracted from the caudal vein using a heparinized syringe. plasma was obtained after blood centrifugation (6,000 g for 7 min at 5c) in heparinized tubes containing phenylmethylsulfonyl fluoride (1 mm) and stored at 20c until required for vtg analysis. (n = 8/treatment) were determined using a competitive elisa assay, as described by maans. sea bass vtg used for coating elisa plates and as a standard was isolated as described by maans. the antibody against sea bass vtg was raised in rabbits. the secondary antibody (goat anti - rabbit antibody igg) and the tetramethyl benzidine peroxidase substrate kit were obtained from bio - rad (hercules, ca, usa). the range of the standard vtg curve was 2100 ng / ml, corresponding to 80% and 20% of binding, with 50% of binding around 15 ng / ml. juvenile plasma samples were tested at a dilution of 1:10 or higher in order to place all measurements within the confidence range of standard curve ; intraassay and interassay coefficients of variation (cvs) were similar to those described by maans. we accounted for slight differences in absolute control effects between studies by standardizing absolute effect scales to relative effects : the mean vtg concentration in fish from negative - control and positive - control tanks were used as the minimum and maximum responses, respectively, in order to standardize individual vtg measurements to values between zero (i.e., no vtg induction) and one (i.e., vtg level in positive control). scaling to relative effects was carried out after individual vtg effect data were log10-transformed (i.e., an ec50 corresponds to the concentration that produces a log10-transformed vtg induction), a value that is the median in relation to negative and positive controls. we performed statistical concentration response analyses in the same way for all compounds and for the mixture by applying a best - fit procedure : various nonlinear regression models were fitted independently to the same data set, and we selected the best fit on the basis of statistical criteria. if data from repeated studies were obtained, the pooled data was used ; to account for intra- and inter - experimental variability associated with this nested data scenario, we adopted the generalized nonlinear mixed modeling approach [see brian. otherwise, the regression models were fitted to the data as described by scholze. effect concentrations (ecx) were calculated from the functional inverse of the best fit - ting model. statistical uncertainties for estimated effect concentrations were expressed as 95% confidence intervals (cis) and approximately determined by applying the bootstrap method (efron and tibshirani 1993). additionally, we derived no observed effect concentrations (noecs) using the likelihood ratio test under total order restriction (bretz and hothorn 2003). calculations for statistical inference are based on absolute vtg values, and all approaches were implemented using sas statistical software (sas 2001). based on the best - fit regression functions of single compounds, we calculated expected effect concentrations for the ternary mixture in definite ratios. quantitative relations between effects of single substances and the mixture are described by the concept of ca. for a multi - component mixture of n components, it is defined by where ecxi denotes the effect concentrations of single compounds 1 to n (i.e., those concentrations that alone would produce the same quantitative effect x as the mixture), ecxmix is the mixture concentration that induces an overall effect x, and pi is the proportion of the ith component in the mixture. individual effect concentrations, ecxi, are derived from individual concentration response functions, fi, by using their inverse functional form. graphs of predicted concentration response curves were obtained by calculating numerous ecxmix values, with x varying from 1% to 99% in steps of 1%. all individual effect concentrations, ecxi, are estimates and are therefore subject to stochastic variability, which means that the predicted mixture effect concentration also has a measure of statistical uncertainty. this was achieved using the bootstrap method (efron and tibshirani 1993), which enabled 95% cis to be derived for predicted mean effect. predicted and observed effect concentrations were deemed to be statistically significantly different when the 95% ci of predicted and observed effects did not overlap. the analytical determination of each mixture concentration often necessitated adjustments of the nominal mixture ratios, with relative proportions, pi, of the compounds being different for each measured mixture exposure. this still enabled the calculation of expected mixture concentrations because all the information required is available as demanded by equation 1. in a strict quantitative sense, however, this can be done only for the tested mixture concentrations ; because extrapolation methods are unsuitable, the mixture data can not be figured out using the same concentration scale. however, if the variation of the individual mixture ratios follows a random process, then smoothing techniques can be applied in order to estimate an average mixture ratio, which also enables the usual concentration response relationships to be constructed for the mixture. we determined the mean mixture ratio by calculating the average fraction for each compound within the total mixture using data for the six highest tested mixture concentrations. analytical data ascertaining nominal concentrations for single exposures and for the mixture are given in table 1. for the sake of simplicity, only average values of data from t0, t7, and t14 from the first mixture testing are shown (the second mixture study yielded nearly identical mixture ratios). the average variation of the individual bpa measurements between the sampling days was relatively low (cv = 18%), and the exposures were constant over the testing period. we found relatively good agreement between nominal and measured concentrations, with an average recovery rate of around 95% for single exposures and for within the mixture. for single ee2 and e2 exposures, data variation between the sampling days was higher, with an average cv of 70% for e2 and 80% for ee2, and 27% for all positive controls (100 ng / l ee2). this higher variation mainly occurs because recovery rates at t0 (90%) were higher, but they decreased after 1 week of testing to around 2040%, resulting in an overall mean recovery rate of 47.0% for ee2 and 46.7% for e2 these findings were confirmed by repeated studies ; thus, we exclude laboratory accident as the reason for these rates. within the mixture, the recovery rates for ee2 were slightly higher, with an overall average recovery of 55.2%. the mixture ratio was originally conceived to be proportional to nominal ec50 values of the individual compounds. because of the lower recovery rates for both steroids, it is obvious that the mixture ratio differed when based on measured concentrations. as a result, the fraction of bpa in the mixture was higher than planned, with an average 99.76% instead of 99.52% of the total concentration (table 2). for the effective exposure ranges of the mixture (3.8438.4 mg / l, nominal), recovery rates for all three compounds were relatively stable and of low variation, indicating that the corresponding mixture ratios for each mixture concentration were nearly identical. thus, the use of a common average mixture ratio for all mixture exposures appears justified, and observed and predicted mixture effects can be compared for untested concentration ranges by interpolation. figure 1 shows concentration response data for each tested chemical and their best - fit regression curves. the corresponding functions, model parameters, and statistical estimates of estrogenic potencies are given in table 2. because of the relatively low data variability (the cv was 2.55% for the negative controls and 2.57% for the positive controls), the statistical power was sufficiently large to detect responses down to 5% ; this allowed precise regression estimations of mean vtg responses. the effect concentrations for median and low vtg induction (ec50, ec10) are given in table 2 ; the corresponding 95% cis are relatively low for all compounds. using the median effect level as reference, we found that ee2 was the most potent steroid tested, with an ec50 of 0.029 g / l, 3.6 times more potent than e2 (ec50 = 0.104 g / l). as expected, bpa was the least potent of the chemicals, with an ec50 of 77.94 all tested bpa concentrations produced statistically significant responses, with 10 g / l being the lowest tested exposure yielding a vtg induction of around 10% (ec10 the noecs derived for e2 and ee2 were equal to the lowest tested concentrations and were lower than the respective ec10. a positive control of 100 ng ee2/l was expected to produce the maximal possible vtg induction in our system. this assumption was based mainly on outcomes from previous range - finding studies ; furthermore, this dose is commonly used as positive control in flow - through systems with fish (e.g., brian. however, our studies demonstrated clearly that higher ee2 concentrations are able to induce stronger effects, with a maximal induction of around 3 10 ng vtg / ml, 6 times higher than observed for 100 ng ee2/l. consequently, our assumed maximal control reference represents a slight underestimate, with a corresponding impact on every effect and effect concentration estimation. however, because we used the log10-transformed vtg scale for the assessment, the differences were negligible and did not change the statistical estimates. for example, the estimated ec50 for ee2 might in reality refer not to a 50% effect, but to 49.3%. to guarantee comparability between studies, the mixture was prepared from a master stock solution containing e2, ee2, and bpa at a ratio of their nominal ec50 values (table 2) ; dilutions of 100, 66, 33, 10, 6.7, 3.3, and 1% were tested, corresponding to expected vtg responses between 100% and 0%. this experiment was repeated for three mixture concentrations (corresponding dilutions of 66, 33, and 10%), and the vtg data for both studies agreed excellently (figure 2). figure 3 shows the individual and mean vtg responses from the first mixture study normalized to the negative and positive controls, and based on measured concentrations. there was excellent agreement with the ca - predicted concentration response curve, which was generated based on the concentration response functions shown in table 2. we did not detect a statistically significant deviation from predictions for either of the selected effect levels (table 3). when we used the exact mixture ratios measured for each mixture concentration, the resulting mixture effects were almost identical to those in figure 2 and did not fall outside the 95% ci of the prediction curve (figure 3). figure 4 shows a comparison of the observed mixture effects with the expected effects of the individual compounds that would occur if they were present alone at their respective levels in the mixture. all individual curves are based on the regression fits of the compounds tested alone (table 2). figure 4 shows that a single compound alone can not explain the observed mixture effect. furthermore, figure 4 shows that concentrations of the compounds without statistically significant effects can still produce a detectable mixture effect when they are present together. for example, the comparison between the median vtg response for the nominal 19.2 mg / l mixture and the corresponding individual effects of the compounds demonstrates how strongly low - steroidal exposures can enhance a weak vtg induction by bpa ; for bpa alone, we observed a 20% vtg response, but the presence of 12 ng / l ee2 and 33 ng / l e2 increased the vtg induction to 50%. analytical data ascertaining nominal concentrations for single exposures and for the mixture are given in table 1. for the sake of simplicity, only average values of data from t0, t7, and t14 from the first mixture testing are shown (the second mixture study yielded nearly identical mixture ratios). the average variation of the individual bpa measurements between the sampling days was relatively low (cv = 18%), and the exposures were constant over the testing period. we found relatively good agreement between nominal and measured concentrations, with an average recovery rate of around 95% for single exposures and for within the mixture. for single ee2 and e2 exposures, data variation between the sampling days was higher, with an average cv of 70% for e2 and 80% for ee2, and 27% for all positive controls (100 ng / l ee2). this higher variation mainly occurs because recovery rates at t0 (90%) were higher, but they decreased after 1 week of testing to around 2040%, resulting in an overall mean recovery rate of 47.0% for ee2 and 46.7% for e2 these findings were confirmed by repeated studies ; thus, we exclude laboratory accident as the reason for these rates. within the mixture, the recovery rates for ee2 were slightly higher, with an overall average recovery of 55.2%. the mixture ratio was originally conceived to be proportional to nominal ec50 values of the individual compounds. because of the lower recovery rates for both steroids, it is obvious that the mixture ratio differed when based on measured concentrations. as a result, the fraction of bpa in the mixture was higher than planned, with an average 99.76% instead of 99.52% of the total concentration (table 2). for the effective exposure ranges of the mixture (3.8438.4 mg / l, nominal), recovery rates for all three compounds were relatively stable and of low variation, indicating that the corresponding mixture ratios for each mixture concentration were nearly identical. thus, the use of a common average mixture ratio for all mixture exposures appears justified, and observed and predicted mixture effects can be compared for untested concentration ranges by interpolation. figure 1 shows concentration response data for each tested chemical and their best - fit regression curves. the corresponding functions, model parameters, and statistical estimates of estrogenic potencies are given in table 2. because of the relatively low data variability (the cv was 2.55% for the negative controls and 2.57% for the positive controls), the statistical power was sufficiently large to detect responses down to 5% ; this allowed precise regression estimations of mean vtg responses. the effect concentrations for median and low vtg induction (ec50, ec10) are given in table 2 ; the corresponding 95% cis are relatively low for all compounds. using the median effect level as reference, we found that ee2 was the most potent steroid tested, with an ec50 of 0.029 g / l, 3.6 times more potent than e2 (ec50 = 0.104 g / l). as expected, bpa was the least potent of the chemicals, with an ec50 of 77.94 g / l being the lowest tested exposure yielding a vtg induction of around 10% (ec10 = 9.12 the noecs derived for e2 and ee2 were equal to the lowest tested concentrations and were lower than the respective ec10. a positive control of 100 ng ee2/l was expected to produce the maximal possible vtg induction in our system. this assumption was based mainly on outcomes from previous range - finding studies ; furthermore, this dose is commonly used as positive control in flow - through systems with fish (e.g., brian. 2005). however, our studies demonstrated clearly that higher ee2 concentrations are able to induce stronger effects, with a maximal induction of around 3 10 ng vtg / ml, 6 times higher than observed for 100 ng ee2/l. consequently, our assumed maximal control reference represents a slight underestimate, with a corresponding impact on every effect and effect concentration estimation. however, because we used the log10-transformed vtg scale for the assessment, the differences were negligible and did not change the statistical estimates. for example, the estimated ec50 for ee2 might in reality refer not to a 50% effect, but to 49.3%. to guarantee comparability between studies, we did not change the positive control concentration. the mixture was prepared from a master stock solution containing e2, ee2, and bpa at a ratio of their nominal ec50 values (table 2) ; dilutions of 100, 66, 33, 10, 6.7, 3.3, and 1% were tested, corresponding to expected vtg responses between 100% and 0%. this experiment was repeated for three mixture concentrations (corresponding dilutions of 66, 33, and 10%), and the vtg data for both studies agreed excellently (figure 2). figure 3 shows the individual and mean vtg responses from the first mixture study normalized to the negative and positive controls, and based on measured concentrations. response curve, which was generated based on the concentration response functions shown in table 2. we did not detect a statistically significant deviation from predictions for either of the selected effect levels (table 3). the predicted ec values were based on a common, average mixture ratio. when we used the exact mixture ratios measured for each mixture concentration, the resulting mixture effects were almost identical to those in figure 2 and did not fall outside the 95% ci of the prediction curve (figure 3). figure 4 shows a comparison of the observed mixture effects with the expected effects of the individual compounds that would occur if they were present alone at their respective levels in the mixture. all individual curves are based on the regression fits of the compounds tested alone (table 2). figure 4 shows that a single compound alone can not explain the observed mixture effect. furthermore, figure 4 shows that concentrations of the compounds without statistically significant effects can still produce a detectable mixture effect when they are present together. for example, the comparison between the median vtg response for the nominal 19.2 mg / l mixture and the corresponding individual effects of the compounds demonstrates how strongly low - steroidal exposures can enhance a weak vtg induction by bpa ; for bpa alone, we observed a 20% vtg response, but the presence of 12 ng / l ee2 and 33 ng / l e2 increased the vtg induction to 50%. current knowledge about the sensitivity of marine fish to estrogenic environmental chemicals is still limited, and our study fills these gaps by providing data about vtg induction in sea bass. the vtg responses observed here are comparable to the sensitivity rank orders reported for freshwater species : in our study, ee2 was the most potent inducer of vtg, an order that was also found in rainbow trout and zebra fish, in which the lowest observed effect concentration (loec) for ee2 was 4-fold lower than that for e2 (20 however, for fathead minnow and rainbow trout, up to 25-fold higher potency differences between ee2 and e2 have been reported (brian. 2005 ; thorpe. the estimated ec10 values for vtg induction, 17 ng / l for ee2 and 31 ng / l for e2, were of the same magnitude as values shown to induce endocrine disruption in freshwater and seawater fish (e.g., folmar. exposure of 6 ng / l ee2 to sand goby induced impaired male maturation and reproductive behavior (robinson. 2003). (2001) reported a lack of sexual differentiation in the male fathead minnow after exposure to 4 ng ee2/l. the sensitivity of the sea bass to bpa (ec10 = 9 g / l) is comparable to that of the fathead minnow (ec10 = 50 g / l) (sohoni. 2001), but it seems to be higher in comparison to other freshwater species ; that is, the ec10 was about two orders of magnitude lower than the loec for juvenile rainbow trout (loec = 1,000 g / l), and the ec50 (78 g / l) was nearly 2-fold lower than for fathead minnow (ec50 = 158 g / l) (van den belt. it is unclear whether this is due to the high stability of the compound in our test system or to differences in metabolism. the relevance of exposure to e2, ee2, and bpa in estuaries and coastal zones is increasingly recognized. this is not confined only to surface waters, but also occurs in sediments and marine biota. bpa can be found in sea - water at concentrations of up to 2 g / l and in seafood at levels of up to 213 g / g (basheer. 2004). because both steroidal estrogens are poorly removed in coastal treatment plants (braga. 2005a), they could be detected in sediments in the proximity of a coastal primary sewage treatment plant in ranges of 0.222.48 ng / g (e2) and up to 0.5 ng / g (ee2) (braga. however, it is more likely that the measured environmental exposures, at which we observed significant vtg responses in juvenile sea bass under controlled experimental conditions, reflect the levels encountered at highly exposed point sources rather than the average diffuse environmental burden, which is likely to be much lower. although a realistic exposure assessment for edcs in the marine environment is still missing, it is conceivable that even very low concentrations of these compounds can contribute to an overall significant mixture effect, as confirmed in this and other mixture studies (brian. 2005 ; silva. thus, it can not be excluded a priori that the complex mixture scenario of the edcs in the marine environment contributes significantly to adverse health effects in fish. if a sufficient number of edcs is present, theoretically significant vtg inductions can occur when the individual compounds are below the technical detection limit. because of the difficulties of trace analysis in seawater matrix, the detection limits for estrogenic chemicals are quite high each tank (30 l) was supplied with a relatively low water exchange rate (30 l / day), mainly to minimize the relatively high costs of artificial seawater. because of these testing limitations, we detected strong differences between nominal and measured concentrations, in particular for e2 and ee2, where the measured exposures were remarkably lower at the middle and the end of the study (t7, t14) than shortly before the placement of fish (t0). this can be explained by active microbial degradation (methanol solvent influence), adsorption to various surfaces such as organic matter (fish feces) in the water and glassware, or the uptake of the chemicals by fish. in contrast, bpa was very stable in seawater (95.2% average recovery), which is in good agreement with the recent findings of kang and kondo (2005). in theory, measured concentrations of the test chemicals in the water should provide quite accurate reflections of the actual exposure conditions. however, it is not clear whether analytical data give a valid estimation for exposures that are responsible for the observed vtg induction after 14 days. even when recovery rates are extremely low, we can not always assume that the fish were exposed to small amounts. if we exclude the possibility that technical issues were responsible for a lower chemical in flux (which was proven not to be the case in our study), then low recovery rates could be the result of large uptake by fish, leading to low concentrations. in this case the resulting uncertainties in terms of effective concentrations are difficult to model statistically, and the use of arithmetic means of all measured concentrations may be a poor reflection of biologically active concentrations. however, because of the unknown complex relationship between intake, uptake, technical testing environment, and the observed biological effect at the end of the study, more valid approaches are not available. this general uncertainty explains some of the differences in potency when concentration response results for the same compound and species are compared from laboratories using flow - through systems with different flow rates. the question arises whether these technical issues influence the outcomes of mixture studies, especially when they are aiming to investigate the predictability of mixture effects. (2001, 2003) did not demonstrate relevant differences between nominal and measured exposures over the whole exposure period, both for the single exposures and mixtures. thus, the experimental design of their mixture studies put the assessment of the predictive power of the ca model on a sound footing. the high replacement rates of the test chemicals, together with relatively large tanks and small fish, were largely responsible for the small variations between nominal and actual concentrations in these studies. if the recovery patterns between nominal and measured concentrations are reproducible for each compound over the whole testing period, then the important prerequisite of comparability for the ca model is fulfilled and the observed and predicted mixture effects allow a comparative assessment. moreover, the relative relationship between observed and predicted effects for the mixture remains the same when using nominal instead of measured concentrations, and thus a comparative assessment based on nominal concentrations will come to the same conclusions as when based on measured concentrations. in the present study, we detected higher recovery rates of ee2 in the mixture than we observed in the single studies, which were confirmed by the second mixture study. thus, the reproducibility assumption was violated, and the comparison between observed and predicted mixture effects could only be done on measured concentrations. the detailed information about actual concentrations of the components in the mixture was essential. a mixture analysis based on the fixed - ratio design can be problematic when the mixture composition varies significantly between the tested mixture concentrations (e.g., when the recovery rate for one individual component is not constant). the observed effect data are not comparable in the sense that they can be analyzed on a common concentration scale, consequently, statistical concentration effect regression approaches can not be used for the generation of a fitting curve. thus, observed and predicted mixture effects however, it might be possible to model the variable mixture compositions in function of the single measured exposures (variable mixture ratio). the present study highlights the potential hazard of joint exposure to steroidal estrogens (e2 and ee2) and bpa to marine fish. we have shown that the pharmacologic concept of ca very accurately describes the vtg induction of estrogenic chemicals in marine fish. this is in good agreement with the outcomes from previous multicomponent mixture studies in freshwater fish (brian. taken altogether, these studies provide sufficient evidence that edcs act dose - additively in inducing vtg, independent of the fish species. if information is available about each compound present in the mixture and if exposure patterns and the effects are reproducible, then ca can be used as a tool to predict accurately the joint effects of edcs. because the effect assessment for edcs is receiving more and more attention, a proper exposure assessment remains important for assessing the risk. one factor that limits progress in risk assessments for edc mixtures in marine life is a lack of information on relevant exposure levels. monitoring programs for most of the known edcs are not implemented for the marine environment. moreover, it is unknown how many edcs are in the field, although new exposure assessment tools, such as the adaptation of the toxicity identification and evaluation for edcs, might be a promising solution for the future. | backgroundthe potential impact of natural and synthetic estrogens on aquatic ecosystems has attracted considerable attention because it is currently accepted that their joint effects are more severe when they are present in mixtures. although it is well - known that they occur as mixtures in the marine environment, there is little information about the combined effects of estrogenic chemicals on marine biota.objectivein 14-day tests with juvenile sea bass, we analyzed singly and in combination the estrogenic activity of estradiol (e2), ethynylestradiol (ee2), and bisphenol a (bpa) using vitellogenin induction as an end point.methodsfish were exposed to each compound, and on the basis of these concentration response data, we predicted mixture effects by applying the model of concentration addition. the mixtures were tested using a fixed - ratio design, and the resulting mixture effects were compared to the predictions.resultsee2 was the most potent steroid, with an ec50 (median effective concentration) of 0.029 g / l, 3.6 times more potent than e2 (ec50 = 0.104 g / l) ; bpa was the least potent chemical, with an ec50 of 77.94 g / l. the comparative assessment yielded a good agreement between observed and predicted mixture effects.conclusionsthis study demonstrates the potential hazard of these compounds to seawater life by their ability to act together in an additive manner. it provides evidence that concentration addition can be used as a predictive tool for assessing the combined effects of estrogenic chemicals in marine ecosystems. |
the basic reproduction number r0 of an infectious agent is defined as the expected number of secondary cases caused by one typical infected individual in a population consisting of susceptibles only. when an outbreak has started and the approximation that the population is fully susceptible no longer holds, one generally refers to the effective reproduction number r. the value of r0 is, as a rule, different for different infectious agents and depends among other things on the characteristics of the population that the agent invades. given this, it is not immediate that one can adopt previously determined values or size ranges for a new outbreak, unless many of the complicated characteristics of, for example, population composition and contact structure are comparable. for various reasons one can be interested in the value of r0 or r early in an outbreak and during the outbreak. notably, under a homogeneous mixing assumption, the values give insight into the extent of the control problem and a means of calculating how much control effort is needed. in recent years several new methods for estimating r0 from outbreak data have been published, either as a general tool or for specific applications. some, like wallinga and teunis do not need much data, but require knowledge of the generation time distribution. most of these methods, however, are data - hungry : they either need contact information, use the whole outbreak time series (so are effectively retrospective measures), or increase in accuracy as the time series becomes longer. for example, we do not observe infections we observe detections, i.e. individuals (people, animals, farms, plants) exhibiting symptoms. there is then a possibly unknown incubation period distribution that convolutes the infection process into the observed process. moreover, r0 is a generation - based concept, but generations are not observed a daily number of new detections is observed from possibly mixed generations. also, heterogeneity between individual infectivity and susceptibility and in contact pattern may cause the distribution of which r0 is the mean to be highly skewed (e.g.). to make matters worse, we almost never have data from an uncontrolled situation some control measures, effective or not, often operate from the moment of detection of the index case. despite advances, but in light of the problems encountered, many publications in which r0 is estimated from outbreak data still depend on cumulative incidence and generation interval only (see for example). as a rule, the cumulative incidence in outbreaks of an infectious disease is observed to initially grow approximately exponentially with time (and hence the incidence grows exponentially too). a frequently used approach is to fit an exponential function to the (cumulative) incidence and to use the approximate relationship \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { r_0 } \approx { e^{r{t_g}}}$$ \end{document } to estimate r0, where r is the exponential growth rate and tg is the observed mean generation interval of the epidemic. for rtg small the further approximation \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { r_0 } \approx 1 + r{t_g}$$ \end{document } is sometimes used. for example, the real value of r is not observed, not only because of control measures in operation but also due to the stochasticity in the early phase. in addition, the definition of the generation interval is not always consistently used and the method presupposes that the population is homogeneously mixing. still, the method is easy and intuitive and one can wonder in which circumstances it would be a good approximation, and how large discrepancies can be when these circumstances are not met. in this paper we now derive estimates of r0 based on specific models and compare these with the previously mentioned approximations, which we denote \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ + = { e^{r{t_g}}}$$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - = 1 + r{t_g}$$ \end{document}. we need to emphasise that r0 is independent of timescale, whereas tg has dimension time and r has dimension time. we also need to emphasise that we do not know r or tg, we assume that they have been estimated from data in some way, for example by estimating the doubling time of the incidence, d, and writing r = log(2)/d. we do not write ^r or ^tg for these estimates, as this would result in far too many hats in one paper. the incidence of an emerging infection may be calculated from \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ i(t) = \delta (t) + { { s(t) } \over n}\int\limits_0^\infty { a(\tau) i(t - \tau) d\tau } $ $ \end{document } where (t), a unit spike, is the incidence of infection at time zero, the kernel a() is the expected infectivity of an infected as a function of, the time since exposure to infection. the number in the population susceptible at time t is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ s(t) = n - \int\limits_0^t { i(u){\rm{d}}u } $ $ \end{document } for an emerging infection we assume the entire population to be susceptible at time zero. if this is not the case, we take n to be the size of the susceptible population prior to infection. as a first step towards developing a model, we specify the general form of the kernel a(). we write a() = r0f(), where r0 is the basic reproduction number that we wish to estimate, and f() is the infectivity kernel, which is also the probability distribution of the generation interval. for an emerging infection we have little information about f. we may have observations of the latent period (the time from exposure to infection to becoming infectious, te) ; the incubation period (the time from exposure to infection to the onset of symptoms) which we may in some cases assume to equal te ; or the infectious period ti. given these we may wish to impose a particular form on the kernel, and use our limited knowledge to estimate parameter values for the distribution. one quantity of interest is the mean generation interval of the epidemic, which is taken here to be the mean time from an individual s exposure to infection to exposing others to infection (see, for an insightful exposition). we refer not to the time to the first occurrence of a secondary infection, but to the average time to all secondary infections. alternatively, and equivalently, it can be defined as the expected duration of the primary infection at the time that a secondary infection occurs (see). the mean generation interval may be determined from the formula \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = \int\limits_0^\infty { tf(t){\rm{d}}t } $ $ \end{document } given a probability distribution for the generation interval, f(), and an estimated initial rate of exponential increase for the epidemic, r, we approximate the initial stages of the epidemic by i(t) = e with s(t) n. equation (1) then leads to a model - consistent estimate of the basic reproduction number via the formula \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { r_0}\int\limits_0^\infty { { e^ { - rt}}f(t){\rm{d}}t } = 1$$ \end{document } (see). if f(t) were a delta function, then eqs. (2, 3) would lead to the estimate r0 = r0 +. for the sir model, where f(t) (2, 3) lead to the estimate r0 = r0. we now computer0 for three distribution functions which may be used as kernels : those with a fixed, exponentially or trapezoidally distributed infectious period (see fig. 1). we refer to these as r0fix, r0exp and r0trap, respectively. we also compute r0 for the model with latent and infectious periods that each have gamma distributions, referred to as r0(m, n). we have r0exp = r0(1,1) } and r0fix = limm, nr0(m, n). fig. 1a selection of kernels, f() that may be used to model emerging infections : kernels due to fixed and exponentially distributed latent and infectious periods are shown as dashed and dashed / dotted lines, respectively ; and the trapezium kernel is shown as a solid line. all kernels are scaled to have integral one. a kernels suitable for modelling influenza, with latent period te = 1.6 days and infectious period ti = 4.0 days. b kernels suitable for modelling sars, with latent period te = 5.5 days and infectious period ti = 7.0 days a selection of kernels, f() that may be used to model emerging infections : kernels due to fixed and exponentially distributed latent and infectious periods are shown as dashed and dashed / dotted lines, respectively ; and the trapezium kernel is shown as a solid line. a kernels suitable for modelling influenza, with latent period te = 1.6 days and infectious period ti = 4.0 days. b kernels suitable for modelling sars, with latent period te = 5.5 days and infectious period ti = 7.0 days given fixed latent and infectious periods, te and ti respectively, and assuming f constant when non - zero, we have f() = 1/ti for te x whenever x > 0, and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { \lim _ { x \to 0}}{{\sinh x } \over x } = 1$$ \end{document } we have r0fix r0 +, and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { \lim _ { { t_e } \to { t_g}}}r_0^{{\rm{fix } } } = r_0^ + $ $ \end{document}. wallinga and lipsitch showed that r0 + is an upper bound on estimates of r0 for any distribution f(t). consider the kernel \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ f(\tau) = \left\ { { \matrix { { { 1 \over { { t_i}}}{{\tau - { \tau _ a } } \over { { \tau _ b } - { \tau _ a } } } } & : & { \tau \in \left ({ { \tau _ a},{\tau _ b } } \right) } \cr { { 1 \over { { t_i } } } } & : & { \tau \in \left ({ { \tau _ b},{\tau _ c } } \right) } \cr { { 1 \over { { t_i}}}{{{\tau _ d } - \tau } \over { { \tau _ d } - { \tau _ c } } } } & : & { \tau \in \left ({ { \tau _ a},{\tau _ b } } \right) } \cr 0 & : & { { \rm{otherwise } } } \cr } } \right.$$ \end{document } this is a suitable approximation to an infectivity function where nobody is infectious before a time units or after d time units post - exposure, maximum infectivity occurs between b and c time units after exposure, and contact rates are constant. the distribution is consistent with a mean latent period of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_e } = { { { \tau _ a } + { \tau _ b } } \over 2}$$ \end{document }, a mean infectious period of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_i } = \left ({ { \tau _ d } + { \tau _ c } - { \tau _ b } - { \tau _ a } } \right)/2$$ \end{document } and a mean generation interval of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { { { t_i } } \over 2 } + { { { { \left ({ { \tau _ d } - { \tau _ c } } \right)}^2 } - { { \left ({ { \tau _ b } - { \tau _ a } } \right)}^2 } } \over { 12\left ({ { \tau _ d } + { \tau _ c } - { \tau _ b } - { \tau _ a } } \right)}}$$ \end{document } hence, if the trapezium is symmetric \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { { { t_i } } \over 2}$$ \end{document }, which is the same relationship as that for the fixed infectious period. the basic reproduction number solves r0trapf(r) = 1, where f(s) is the laplace transform of f(t) (see appendix 1) in an extended seir differential equation model the population of size n is made up of s susceptibles, e that have been exposed to infection but are not yet infectious, i infectious and r that have been infected and recovered. if the epidemic processes have a much faster timescale than the demographic processes, we obtain the equations \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \eqalign { & { { d{e_1 } } \over { dt } } = \beta { s \over n}\sum\limits_{j = 1}^n { { i_j } - mv{e_1 } } \cr & { \rm{for } } i { { d{e_i } } \over { dt } } = mv{e_{i - 1 } } - mv{e_i } \cr & { { d{i_1 } } \over { dt } } = mv{e_m } - n\gamma { i_1 } \cr & { \rm{for } } j = 2,...,n{\rm { } } { { d{i_j } } \over { dt } } = n\gamma { i_{j - 1 } } - n\gamma { i_j } \cr & { { dr } \over { dt } } = n\gamma { i_n } \cr } $ $ \end{document } the exposed and infectious classes have been subdivided e = i=1mei and i = j=1nij, respectively. the times spent in the exposed and infectious classes are gamma distributed with means te = 1/ and ti = 1/, respectively, andr0 = /. the mean generation interval is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { { n + 1 } \over { 2n}}{t_i}$$ \end{document } (see appendix 2). if the initial rate of exponential increase of the epidemic is r, then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^{(m, n) } = { { { { 2nr } \over { n + 1}}\left ({ { t_g } - { t_e } } \right){{\left ({ 1 + { r \over m}{t_e } } \right)}^m } } \over { 1 - { { \left ({ 1 + { { 2r } \over { n + 1}}\left ({ { t_g } - { t_e } } \right) } \right)}^ { - n}}}}$$ \end{document } this result is derived in appendix 2, where it is also shown that given values of r, te and tg, r0(m, n) is an increasing function of both m and n. the well - known seir differential equation model is the special case of eqs. the times spent in the exposed and infectious classes are exponentially distributed with means te = 1/ and ti = 1/ respectively, and the appropriate kernel function in eqs. (2, and 3) is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ f(\tau) = { { \gamma v } \over { \gamma - v}}\left ({ { e^ { - v\tau } } - { e^ { - \gamma \tau } } } \right)$$ \end{document } (see). the mean generation interval is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { t_i}$$ \end{document }, and given r we have \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^{\exp } = r_0^{(1,1) } = 1 + r\left ({ { 1 \over v } + { 1 \over \gamma } } \right) + { { { r^2 } } \over { v\gamma } } = 1 + r{t_g } + { r^2}{t_e}\left ({ { t_g } - { t_e } } \right)$$ \end{document } the approximation \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - = 1 + r{t_g } \le r_0^{\exp } $ $ \end{document } is appropriate for the sir model, for which, te 0 and tg ti = 1/. hence r0 performs best as an estimate when either the latent period te or the infectious period ti is small compared to tg, and performs worst when they are equal. given fixed latent and infectious periods, te and ti respectively, and assuming f constant when non - zero, we have f() = 1/ti for te x whenever x > 0, and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { \lim _ { x \to 0}}{{\sinh x } \over x } = 1$$ \end{document } we have r0fix r0 +, and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { \lim _ { { t_e } \to { t_g}}}r_0^{{\rm{fix } } } = r_0^ + $ $ \end{document}. wallinga and lipsitch showed that r0 + is an upper bound on estimates of r0 for any distribution f(t). consider the kernel \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ f(\tau) = \left\ { { \matrix { { { 1 \over { { t_i}}}{{\tau - { \tau _ a } } \over { { \tau _ b } - { \tau _ a } } } } & : & { \tau \in \left ({ { \tau _ a},{\tau _ b } } \right) } \cr { { 1 \over { { t_i } } } } & : & { \tau \in \left ({ { \tau _ b},{\tau _ c } } \right) } \cr { { 1 \over { { t_i}}}{{{\tau _ d } - \tau } \over { { \tau _ d } - { \tau _ c } } } } & : & { \tau \in \left ({ { \tau _ a},{\tau _ b } } \right) } \cr 0 & : & { { \rm{otherwise } } } \cr } } \right.$$ \end{document } this is a suitable approximation to an infectivity function where nobody is infectious before a time units or after d time units post - exposure, maximum infectivity occurs between b and c time units after exposure, and contact rates are constant. the distribution is consistent with a mean latent period of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_e } = { { { \tau _ a } + { \tau _ b } } \over 2}$$ \end{document }, a mean infectious period of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_i } = \left ({ { \tau _ d } + { \tau _ c } - { \tau _ b } - { \tau _ a } } \right)/2$$ \end{document } and a mean generation interval of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { { { t_i } } \over 2 } + { { { { \left ({ { \tau _ d } - { \tau _ c } } \right)}^2 } - { { \left ({ { \tau _ b } - { \tau _ a } } \right)}^2 } } \over { 12\left ({ { \tau _ d } + { \tau _ c } - { \tau _ b } - { \tau _ a } } \right)}}$$ \end{document } hence, if the trapezium is symmetric \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { { { t_i } } \over 2}$$ \end{document }, which is the same relationship as that for the fixed infectious period. the basic reproduction number solves r0trapf(r) = 1, where f(s) is the laplace transform of f(t) (see appendix 1) in an extended seir differential equation model the population of size n is made up of s susceptibles, e that have been exposed to infection but are not yet infectious, i infectious and r that have been infected and recovered. if the epidemic processes have a much faster timescale than the demographic processes, we obtain the equations \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \eqalign { & { { d{e_1 } } \over { dt } } = \beta { s \over n}\sum\limits_{j = 1}^n { { i_j } - mv{e_1 } } \cr & { \rm{for } } i = 2,...,m{\rm { } } { { d{e_i } } \over { dt } } = mv{e_{i - 1 } } - mv{e_i } \cr & { { d{i_1 } } \over { dt } } = mv{e_m } - n\gamma { i_1 } \cr & { \rm{for } } j = 2,...,n{\rm { } } { { d{i_j } } \over { dt } } = n\gamma { i_{j - 1 } } - n\gamma { i_j } \cr & { { dr } \over { dt } } = n\gamma { i_n } \cr } $ $ \end{document } the exposed and infectious classes have been subdivided e = i=1mei and i = j=1nij, respectively. the times spent in the exposed and infectious classes are gamma distributed with means te = 1/ and ti = 1/, respectively, andr0 = /. the mean generation interval is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { { n + 1 } \over { 2n}}{t_i}$$ \end{document } (see appendix 2). if the initial rate of exponential increase of the epidemic is r, then \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^{(m, n) } = { { { { 2nr } \over { n + 1}}\left ({ { t_g } - { t_e } } \right){{\left ({ 1 + { r \over m}{t_e } } \right)}^m } } \over { 1 - { { \left ({ 1 + { { 2r } \over { n + 1}}\left ({ { t_g } - { t_e } } \right) } \right)}^ { - n}}}}$$ \end{document } this result is derived in appendix 2, where it is also shown that given values of r, te and tg, r0(m, n) is an increasing function of both m and n. the well - known seir differential equation model is the special case of eqs. (6) with m = n = 1. for this model the times spent in the exposed and infectious classes are exponentially distributed with means te = 1/ and ti = 1/ respectively, and the appropriate kernel function in eqs. (2, and 3) is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ f(\tau) = { { \gamma v } \over { \gamma - v}}\left ({ { e^ { - v\tau } } - { e^ { - \gamma \tau } } } \right)$$ \end{document } (see). the mean generation interval is \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { t_i}$$ \end{document }, and given r we have \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^{\exp } = r_0^{(1,1) } = 1 + r\left ({ { 1 \over v } + { 1 \over \gamma } } \right) + { { { r^2 } } \over { v\gamma } } = 1 + r{t_g } + { r^2}{t_e}\left ({ { t_g } - { t_e } } \right)$$ \end{document } the approximation \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - = 1 + r{t_g } \le r_0^{\exp } $ $ \end{document } is appropriate for the sir model, for which, te 0 and tg ti = 1/. hence r0 performs best as an estimate when either the latent period te or the infectious period ti is small compared to tg, and performs worst when they are equal. we assumed that we had estimated values of the initial rate of exponential increase of infection incidence, r, the mean latent period, te, and the mean generation interval, tg. (4, and 7) to calculate model - based estimates of the basic reproduction number using the assumptions of a fixed or exponentially distributed infectious period, leading to r0fix and r0exp, respectively. we did this for values of the ratio of the latent period to the generation interval, te / tg, in the range zero to 0.99. the values of r0fix and r0exp are plotted as functions of te / tg for rtg = 0.5, 1.0, 1.5, 2.0 in fig. 2, and compared with the values of the estimators \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - = 1 + r{t_g}$$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ + = { e^{r{t_g}}}$$ \end{document } in those cases. when rtg = 0.5, 1.0, 1.5 or 2.0 we have r0 = 1.5, 2.0, 2.5 or 3.0 and r0 + = 1.65, 2.72, 4.48 or 7.39, respectively. 2estimates of the basic reproduction number r0 as a function of the ratio of the latent period to the mean generation interval, te / tg. the solid plots are a, b fixed infectious period : r0fix with rtg = 0.5 (lower), rtg = 1.5 (upper) ; and rtg = 1.0 (lower), rtg = 2.0 (upper) respectively, and c, d exponentially distributed infectious period : r0exp with rtg = 0.5 (lower), rtg = 1.5 (upper) ; and rtg = 1.0 (lower), rtg = 2.0 (upper), respectively. the horizontal dotted and dashed lines indicate the corresponding values of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - = 1 + r{t_g}$$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ + = { e^{r{t_g}}}$$ \end{document }, respectively estimates of the basic reproduction number r0 as a function of the ratio of the latent period to the mean generation interval, te / tg. the solid plots are a, b fixed infectious period : r0fix with rtg = 0.5 (lower), rtg = 1.5 (upper) ; and rtg = 1.0 (lower), rtg = 2.0 (upper) respectively, and c, d exponentially distributed infectious period : r0exp with rtg = 0.5 (lower), rtg = 1.5 (upper) ; and rtg = 1.0 (lower), rtg = 2.0 (upper), respectively. the horizontal dotted and dashed lines indicate the corresponding values of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - = 1 + r{t_g}$$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ + = { e^{r{t_g}}}$$ \end{document }, respectively the results shown in fig. 2 illustrate that for fixed values of r, te and tg, the values of r0 and r0 + are lower and upper bounds, respectively for both r0exp and r0fix. in sects. (2.1 and 2.4) it was shown that r0fix r0 + and r0 r0exp, respectively. it is proved in appendix 2 that r0(m, n) 0 is an increasing function of both m and n. putting these results together we obtain the inequality \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - \le r_0^{\exp } \le r_0^{(m, n) } < r_0^{{\rm{fix } } } \le r_0^ + $ $ \end{document } where m and n are any finite positive integers. table 1 was constructed to illustrate the results that may be obtained for some specific infections. parameters were chosen from the literature to be representative of influenza, severe acute respiratory syndrome (sars), smallpox and foot and mouth disease (fmd). for each infection a trapezium distribution was constructed for f(), and used together with an estimate of r0 to calculate an estimate of the initial exponential increase, r. the function f() was also used to calculate values for the mean generation interval tg, the mean latent period te and the mean infectious period ti. table 1estimates of r0 that could be made for emerging infectionsinfectionrtgtetir0r0+r0fixr0expr0trapinfluenza0.1983.651.604.101.722.062.001.852.00sars0.1349.005.507.002.213.343.222.553.20smallpox0.057620.515.011.02.183.263.202.453.20fmd0.1656.002.008.001.992.702.512.212.50the initial rate of exponential increase (r day), mean generation interval (tg days), mean latent period (te days) and mean infectious period (ti days) that could be observed for epidemics of influenza, sars, smallpox ; and for foot andmouth disease (fmd) spreading between farms ; together with the corresponding estimates of the basic reproduction numbermade using the approximations r0 = 1+rtg and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ + = { e^{r{t_g}}}$$ \end{document }, or assuming a rectangular, exponential or trapeziodal distribution for the infectious period, leading to r0fixr0exp and r0trap, respectively estimates of r0 that could be made for emerging infections the initial rate of exponential increase (r day), mean generation interval (tg days), mean latent period (te days) and mean infectious period (ti days) that could be observed for epidemics of influenza, sars, smallpox ; and for foot andmouth disease (fmd) spreading between farms ; together with the corresponding estimates of the basic reproduction numbermade using the approximations r0 = 1+rtg and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ + = { e^{r{t_g}}}$$ \end{document }, or assuming a rectangular, exponential or trapeziodal distribution for the infectious period, leading to r0fixr0exp and r0trap, respectively if these values of r, tg and te had been estimated from data, and then r0 had been estimated by r0, r0 +, r0fix, r0exp or r0trap, the estimates presented in table 1 would have resulted. by construction, the estimated value of r0trap then corresponds to the assumed value of r0. hence table 1 must be regarded as a comparison of estimates that may be made ; the relative values are important rather than the absolute values. we have derived and discussed model - consistent methods for estimating the basic reproduction number (r0) for an infectious disease from the initial rate of exponential growth of incidence of infection (r) at the beginning of an epidemic. these methods can only be applied to incidence data from the period where it is reasonable to assume that the whole population may be regarded as susceptible (s(t) } ~ n). among the first pieces of information obtained for an emerging infection are observations of the latent and infectious periods. these may be used as estimates to construct a rectangular kernel for an integral equation model, or to derive rate parameters for a differential equation model. examples of infectivity kernels with the same latent and infectious periods are shown in fig. 1. these kernels appear to be quite different, with the exponential kernel allowing some transmission of infection from time zero, and exhibiting a long infection tail. the transmission at early times mitigates against the success of control methods based on contact tracing, or any other method with inherent delays. the tail can lead to transmission appearing to continue in the model long after control measures should have eliminated the infection. 1 allow for some variability in the fixed and latent periods to be incorporated in the model. 1a) is consistent with a latent period uniformly distributed between 1.2 and 2.0 days, and an infectious period of 4.0 days. 1b) is consistent with nobody being infectious before 4 days, everybody infectious by 7 days, everybody still infectious at 11 days and nobody infectious after 14 days ; with the proportion infectious at intermediate times determined by linear interpolation. as well as allowing for some variability, the trapezoidal kernel has the advantage over the rectangular one that it is a continuous function, and this avoids problems with numerical schemes that do not allow discontinuities. of course, if further information is available, then other distributions may be more appropriate. figure 2 compares estimates of the basic reproduction number based on fixed (fig. 2a, 2b) and exponentially distributed (fig. 2c, 2d) infectious periods, r0fix andr0exp, respectively, with the estimates based only on mean generation interval, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ - = 1 + r{t_g}$$ \end{document } and \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ r_0^ + = { e^{r{t_g}}}$$ \end{document}. the estimate r0 is inaccurate whenever rtg is not small. using the fixed infectious period model, r0 + approximates r0fix when te / tg is near to one, that is when the infection has a long latent period and a short infectious period. the estimate r0 is an approximation to r0exp if either the latent period or infectious period are very short, but r0 + is never a good estimator for r0exp and it s use is therefore inconsistent with an seir model. the estimates of r0 derived in this paper have the ordering r0 r0exp r0(m, n) < r0fix r0 +. this inequality establishes that, given the same values of r, te and ti, r0 provides a closer estimate for r0exp than for r0fix, and r0 + provides a closer estimate for r0fix than for r0exp. even though results derived from the gamma distributed kernel, r0(m, n), are not displayed in fig. 2, we have established that r0fix and r0exp are upper and lower bounds respectively for r0(m, n). note that for the model with a fixed infectious period, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { t_i}/2$$ \end{document }, but for the model with an exponentially distributed infectious period, \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ { t_g } = { t_e } + { t_i}$$ \end{document}. the inequality, and the results presented in fig. 2 are derived on the assumption that te and tg are the same in both models ; ti is defined consistently with the model, and hence differs between models. 1, which have the same latent and infectious periods, te and ti, and hence different mean generation intervals tg. table 1 shows results that could be obtained when estimating r0 for emerging infections, with parameters suitable for these infections. the parameter values indicated for each infection should be regarded as sensible values rather than exact estimates, and the results are presented to indicate the relevance of fig. this is not surprising for the influenza example where the trapezium kernel has steep sides (fig. the results in table 1 confirm that if rtg is small, hence r0 is close to one, then r0 may be used as an estimator for r0exp when an exponential model is appropriate. if a model with a fixed infectious period is more appropriate then r0 + is a better estimate for r0fix, especially when te /tg is closer to one : compare for example the relative values of r0 + and r0fix for smallpox where te /tg = 0.73 and fmd where te /tg wearing. compared estimates based on r0exp with results obtained using gamma - distributed infection kernels. heffernan and wahl also examined the problem, and provided correction factors for estimates of r0 based on both the mean and variance of observed transition times. wallinga and lipsitch used a similar approach to ours, and derived estimates of r0 for a selection of infectivity kernels f(t), including those derived from a gamma - distributed infectious period but only with te = 0. they also considered the case where f(t) is a normal distribution ; if employed though this distribution should be truncated to avoid the possibility of negative generation intervals. even though we selected a number of particular kernels for our study, and these cover a reasonable range of first choices, our method is applicable to all biologically sensible kernels. estimates made early in an epidemic are likely to be based on household studies, and may be truncated due to local saturation of contacts. in addition, it is unclear how valid such estimates are when extrapolated to the wider community with multiple levels of mixing as a new infection emerges the appropriate model is speculative, and in any situation there is no such thing as the correct model. had tg = 2.6 and te = 1.48 days, and estimated r0 r0, obtaining values in the range 1 2. their model was more complex than those discussed here, but we have seen that for low values of rtg, r0 provides a reasonable estimate.. used an seir model, and estimated r from r0exp which is consistent with their model. our approach is to advocate using an estimate of r0 that is consistent with the model used to evaluate control strategies. | we investigate the merit of deriving an estimate of the basic reproduction number \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \mathcal{r}_0 $ $ \end{document } early in an outbreak of an (emerging) infection from estimates of the incidence and generation interval only. we compare such estimates of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \mathcal{r}_0 $ $ \end{document } with estimates incorporating additional model assumptions, and determine the circumstances under which the different estimates are consistent. we show that one has to be careful when using observed exponential growth rates to derive an estimate of \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document } $ $ \mathcal{r}_0 $ $ \end{document }, and we quantify the discrepancies that arise. |
developmental dyslexia is a neurological condition characterized by difficulties in reading - related tasks such as word recognition and spelling in spite of normal intelligence, adequate education and motivation to read proficiently (lyon., 2003). (2012) for meta - analyses ] have identified abnormalities associated with dyslexia in regions within the reading network (pugh., 2000a). whether alteration in cortical structure reflects pathology inherent to dyslexia or environmental influence (e.g., impoverished reading experience or compensatory changes) remains unclear. prior studies have addressed this question using mri measures of gray matter volume (gmv). (2011) reported that pre - reading children with familial history of dyslexia have less gmv within the reading network, relative to control children without a familial history of dyslexia. this finding suggests that structural brain anomalies in dyslexia are present before reading experience rather than experience - dependent. in contrast, krafnick. (2014) showed that gmv in multiple regions, including the left temporal cortex, is reduced in dyslexic children relative to age - matched controls, but not relative to reading - level - matched younger controls. the authors concluded that gmv differences in dyslexia are related to the level of current reading ability, which partially reflects the impoverished reading experience in dyslexics, rather than dyslexia per se. alternative measurements of cortical gray matter to gmv include cortical thickness (ct) and surface area (sa). both ct and sa are highly heritable (joshi., 2011 ; panizzon., 2009 ; rimol., 2010) and can delineate genetic influences on brain structure with more precision than gmv (winkler., 2010). in addition, ct can be affected by life experience, such as training (engvig., 2010 ; thus far, few studies have examined ct and sa variations associated with dyslexia (altarelli., 2013 ; altarelli., 2014 ; frye., 2010 ; kushch.,, we examined ct, sa and gmv to identify structural abnormalities in subgroups of dyslexia with different levels of reading ability. we used an observational design and tested remediated (i.e., normalized reading ability) and non - remediated dyslexia subgroups, as well as an age-, gender-, handedness-, and iq - matched typically developing comparison group. if structural abnormalities are present in all subgroups with a history of dyslexia, relative to controls, this would suggest persistent cortical abnormalities that characterize dyslexia, irrespective of current reading ability. such findings could potentially serve as early and reliable cortical markers of dyslexia in children. by contrast, abnormal ct, sa or gmv only in the non - remediated group, but not in the remediated groups would reflect the effect of current reading impairments, and thus support environmental effects (e.g., impoverished reading experience, which may be normalized in the remediated groups). hypothesizing that cortical abnormalities are inherent to dyslexia (galaburda., 1985 ; raschle., 2011), we predicted that altered patterns of ct, sa and/or gmv, if present, could be found across all dyslexia subgroups, regardless of remediation status. we also addressed a long - lasting question regarding the absence of a leftward structural asymmetry in the dyslexia brain (galaburda., 1985 ; kushch., 1993 ; larsen., 1990 ; leonard., in addition, since ct is a measure genetically and phenotypically independent from sa and gmv (dickerson., 2009 ; lemaitre., 2012 ; panizzon., 2009 ; winkler., 2010), we expected that ct findings would generally diverge from other measures. finally, we evaluated whether there was an additive effect of dyslexia and remediation on gray matter structure for each surface - based metric by testing for differential effects in each remediation subgroup (i.e., whether the largest gray matter abnormalities are found in the non - remediated subgroup). children with a history of dyslexia (dys) were identical to those published previously by koyama. (2013), except for one participant excluded due to severe artifacts in the t1 image. they were native english speakers (n = 32), recruited through referrals from the clinical services at the child study center at new york university langone medical center and the new york international dyslexia association. inclusion was based on parental report of prior diagnosis of reading disorder in accordance with dsm - iv or icd-10, and prior written documentation. we also investigated history of previous or current dsm - iv - tr diagnoses other than dyslexia through informal interviews with parents and by reviewing prior clinical evaluations whenever available. three out of the 32 children were diagnosed with adhd. based on the current literacy competence level, measured by the wechsler individual achievement test second edition (wiat) (wechsler, 2001), children with a history of dyslexia were sub - divided into three groups : (1) children with current deficits in both reading and spelling (dys - n : dyslexia with no remediation, n = 10), (2) children with a previous diagnosis of dyslexia but exhibiting no current reading deficit (dys - r : dyslexia with reading remediation, n = 11), and (3) children with a previous diagnosis of dyslexia but exhibiting no current deficits in either reading or spelling (dys - rs : dyslexia with reading and spelling remediation, n = 11). a reading or spelling deficit was defined as a current standard score below 85 (i.e., one standard deviation below the norm) on the wiat word reading or spelling subscales. information from parental report (and supporting documentation when available) confirmed that none of the children in the dys - n group had a history of targeted dyslexia intervention training prior to the current study, while all children in the dys - r and dys - rs groups had been in one or more targeted programs (e.g., the orton gillingham approach, http://www.ortonacademy.org ; wilson language training, http://www.wilsonlanguage.com ; or various school intervention efforts). information from prior written documentation verified a history of literacy impairment in all children in the remediation groups (standard scores lower than 85 on any type of standardized literacy test prior to remediation), and provided evidence that the majority of these children had exhibited phonological deficits. typically developing children (tdc, n = 32), who were native speakers of english, were selected as controls from a larger pool of children participating in ongoing studies at nyu child study center. all children in the tdc group exhibited intact reading and spelling skills with both wiat word reading and spelling scores above 85. no previous or current dsm - iv - tr diagnoses were found based on the schedule for affective disorders and schizophrenia for school - age children present and lifetime version (ksads - pl) (kaufman., 1996), which was administrated to parents and child participants separately. the dys and the tdc groups were group - matched on age (overall mean age = 12.1 2.3 years : range = 7.716 years), gender, estimated full - scale iq and handedness. full - scale iq was estimated with the wechsler abbreviated scale of intelligence (wasi) (wechsler, 1999) ; all participants had full - scale iq above 85. table 1 provides demographic and cognitive measures for the dys and the tdc groups. table 2 provides demographic and cognitive measures for the three subgroups within the dys group. mri data were collected on a siemens allegra 3 t scanner at the new york university center for brain imaging. we acquired a high - resolution t1-weighted volume for each participant (tr = 2530 ms ; te = 3.25 ms ; ti = 1100 ms ; flip angle = 7 ; 128 slices ; field of view = 256 mm ; voxel size = 1.3 1 1 mm). freesurfer (5.1.0) software package (http://surfer.nmr.mgh.harvard.edu) was used to reconstruct cortical surfaces of each participant from the mri scans. main steps included (1) talairach registration, (2) intensity normalization, (3) skull stripping, (4) white matter segmentation, (5) generation, refinement and tessellation of the white matter surface (i.e., the boundary between gray and white matter), (6) deformation of the white matter surface into the pial surface (i.e., the boundary between the gray matter and the cerebrospinal fluid) and (7) automatic correction of topological defects. details of these steps are described elsewhere (dale., 1999 ; fischl., we also inspected and manually edited the reconstructed surfaces whenever necessary during the process. all inspection and editing were performed by one trained operator to avoid variability introduced by multiple raters. ct at each vertex was measured as the average of the shortest distances from this vertex to the opposing surface, and to this vertex from the opposing surface (fischl and dale, 2000) ; sa at each vertex was measured as the average number of tessellation units surrounding it (winkler., 2012). gmv at each vertex was the product of ct and sa. for group comparisons of ct, sa and gmv, cortical surfaces of each participant were registered based on folding patterns to a spherical coordinate system (fischl. individual ct, sa and gmv maps were smoothed with a gaussian kernel (10 mm fwhm) before comparison. for group comparisons of asymmetry indices (ai), an inter - hemispheric registration procedure was adopted to register surfaces of both left and right hemispheres to a symmetrical template (greve., individual ct, sa, and gmv maps were then smoothed with a gaussian kernel (10 mm fwhm). asymmetry indices were constructed as (left right) / (left + right) and calculated vertex - wise for each measure. we selected 11 rois within cortical areas that have been reported to show gray matter abnormalities in dyslexia (altarelli., 2013 ; eckert, 2004 ; kronbichler., 2008 ; pernet., 2009). using an anatomical parcellation atlas (destrieux., 2010), we examined the following regions : (1) inferior frontal gyrus pars opercularis (ifgop), (2) inferior frontal gyrus pars orbitalis (ifgor), (3) inferior frontal gyrus pars triangularis (ifgtr), (4) heschl 's gyrus (hg), (5) the superior temporal gyrus (stg), (6) planum polare (pp), (7) planum temporale (pt), (8) supramarginal gyrus (smar), (9) angular gyrus (ag), (10) fusiform gyrus (ffg), and (11) inferior occipital gyrus (iog). the regions were then combined into one cortical mask for each hemisphere for vertex - wise analysis. 2 shows the destrieux atlas, the cortical rois, and the mask overlaid on the inflated white matter surface of the left hemisphere. alterations in ct, sa, gmv, and their lateralization associated with a history of dyslexia were investigated with vertex - wise t tests between the tdc and the dys groups within the cortical mask (vertex - wise alpha =.05). significance maps were corrected for multiple comparisons using cluster - based monte - carlo simulation with 10,000 iterations of randomly generated z maps within the mask (cluster - wise alpha =.05) (hagler., 2006). group - wise comparison between each dyslexia subgroup and the tdc group was then performed in significant clusters found through this approach to further confirm our prediction that such alteration was present across all dyslexia subgroups regardless of remediation status. possible additional effects of remediation on gray matter structures were tested by vertex - wise anova between the dyslexia subgroups on each measure and its lateralization within the mask. significant maps were corrected for multiple comparisons using the same cluster - based monte - carlo simulation. finally, to consider abnormalities outside the cortical mask, we conducted vertex - wise whole - brain analyses following the same procedure for the masked analysis. vertex - wise t tests of ct within the cortical mask revealed that the dys group had significantly thicker cortex than the tdc group in a cluster in the left fusiform gyrus (centroid mni : 32, 46, 20, cluster - wise p =.006) and a cluster in the right superior temporal gyrus, extending into the planum temporale (centroid mni : 61, 28, 11, cluster - wise p =.0001). in the left fusiform gyrus cluster, mean ct of the dys group was significantly larger than the tdc group (mean_dys = 3.05 mm, mean_tdc = 2.86 mm, t(62) = 3.654, p =.001, 95%ci = [0.294, 0.086 ] mm). group - wise comparisons of mean ct between the tdc (mean_tdc = 2.86 mm) and the three dyslexia subgroups confirmed significant increase in ct in the dys - r (mean_dys - r = 3.02 mm, t(41) = 2.13, p =.037, 95%ci = [.30,.01 ] mm) and dys - rs (mean_dys - rs=3.13 mm, t(41) = 3.65, p =.001, 95%ci = [.41,.11 ] mm) groups, and marginally significant increase in the dys - n group (mean_dys - n = 3.01 mm, t(40) = 1.95, p =.056, 95%ci = [.298, 0.004 ] mm). in the right superior temporal gyrus cluster, mean ct of the dys group was significantly larger than the tdc group (mean_dys = 3.26 mm, mean_tdc = 3.05 mm, t(62) = 4.025, p.05, 95%ci = [.008,.019 ]). a follow - up repeated measures anova detected a significant interaction between hemisphere and group for mean ct in this cluster, f(1, 62) = 13.35, p =.001 : the cortex within this cluster was significantly thicker in the dys group (mean_dys = 3.18 mm) than in the tdc group (mean_tdc = 2.96 mm) in the right hemisphere, t(62) = 3.84, p.05, 95%ci = [0.11, 0.14 ] mm. thus, the deviation from normal lateralization pattern in the dys group for this cluster was driven by increased ct in the right hemisphere rather than decreased ct in the left hemisphere. group - wise comparisons of mean ai for the superior temporal gyrus cluster between the tdc and the three dyslexia subgroups confirmed that rightward asymmetry in ct was present in the dys - n (mean_dys - n =.027, t(40) = 2.05, p =.045, 95%ci = [.0007,.064 ]), dys - r (mean_dys - r =.052, t(41) = 3.78, p <.001, 95%ci = [.027,.088 ]) and dys - rs (mean_dys - rs =.026, t(41) = 2.06, p =.044, 95%ci = [.0009,.062 ]) subgroups. vertex - wise anova among the dyslexia subgroups revealed no additional effect of remediation on ct lateralization. vertex - wise t test within the cortical mask revealed no significant differences in either sa or gmv between the dys and the tdc groups. null findings for sa, gmv, and their lateralization were not tested across dyslexia subgroups. vertex - wise anova among dyslexia subgroups also failed to detect changes in these measures associated with remediation. vertex - wise whole - brain analyses revealed only one significant cluster with abnormal cortical thickness increase in the right superior temporal gyrus, extending into the planum temporale, middle temporal gyrus, posterior sylvian fissure, heschl 's gyrus and supramarginal gyrus (centroid mni : 55.6, 26.2, 2.5, cluster - wise p =.0001). this cluster encompasses the right superior temporal gyrus cluster in the masked analysis (fig. similar to the masked analysis results, in this cluster, mean ct of the dys group was significantly larger than the tdc group (mean_dys = 3.13 mm, mean_tdc = 2.92 mm, t(62) = 4.768, p <.001, 95%ci = [0.29, 0.12 ] mm). group - wise comparisons of mean ct revealed ct increase in dys - n (mean_dys - n = 3.16 mm, t(40) = 4.58, p <.001, 95%ci = [.34,.13 ] mm), dys - r (mean_dys - r = 3.10 mm, t(41) = 2.78, p =.008, 95%ci = [.31,.05 ] mm) and dys - rs (mean_dys - rs = 3.12 mm, t(41) = 3.82, p <.001, 95%ci = [.31,.09 ] mm) groups as compared to the tdc group. our findings demonstrate that children with dyslexia, irrespective of remediation status, exhibit cortical thickness (ct) abnormalities in the left fusiform gyrus and the right superior temporal gyrus, extending into the right planum temporale. the ct increase in the right superior temporal gyrus contributed to a rightward asymmetry of a smaller area in the posterior superior temporal gyrus. no abnormalities were identified by either surface area (sa) or gray matter volume (gmv). this is consistent with prior studies that suggest ct as a phenotypic measure that is independent from gmv and sa (dickerson., 2009 ; lemaitre., 2012 ; panizzon., 2009 the consistency of the observed effects across three different dyslexia subgroups, irrespective of remediation status, suggests that our findings should generalize to children with a history of dyslexia diagnosis, regardless of reading level. this supports that cortical thickness abnormalities, at least in the temporal and occipitotemporal regions, are inherent to dyslexia. our finding of increased ct in the left fusiform gyrus indicates persistent abnormalities in the ventral reading pathway in dyslexia. the left fusiform gyrus cluster we identified contains the visual word form area, a region critical for visual word processing (cohen., 2000, 2002). this region may also play a role in object naming (mccrory., 2005) and phonological decoding (e.g., sounding out the spoken representation of a written word) (desroches. abnormalities associated with the left fusiform gyrus in dyslexia include decreased gmv (kronbichler., 2008 ; raschle., 2011) and altered activation during reading - related tasks (aylward., 2003 ; mccrory., 2005 our finding extends the range of dyslexia - associated anomalies in this region to include abnormal ct increase. a previous study by altarelli. (2013) detected dyslexia - related ct reduction in a subregion [mni : 42, 48, 15 ] of the left occipitotemporal region that overlaps with our left fusiform finding. the mean age of this study sample was comparable to ours, although differences were present in girls but not boys in their study. to facilitate comparison with our findings, we performed a 2 (dyslexia, control) by 2 (girls, boys) anova on mean ct of the left fusiform gyrus cluster in our sample to test for an interaction (see supplementary results 1). our analysis revealed no differential effect by gender ; abnormal ct increase was present in both boys and girls. abnormal increase in ct may result from a failure of myelination or synaptic pruning during a critical period of development. the age range of our sample (716) corresponds to a period of brain maturation in which wide - spread cortical thinning accompanies myelination and synaptic pruning (sowell., 2004). in a sample of individuals ranging in age from 9 to 23, thinner cortex in the fusiform gyrus is associated with stronger verbal fluency (porter., 2011). similarly, in adults, thinner cortex in this region is associated with stronger performance on a phonetically irregular word reading test (blackmon., children with dyslexia may show disruption or delay of developmental pruning, potentially leading to thicker cortex. to interrogate possible age - related differences in our dyslexia sample relative to controls, we performed supplementary analyses of the interaction between age and group on ct in each significant cluster [i.e., left fusiform cluster, right superior temporal gyrus cluster, and the superior temporal gyrus cluster with significant ai difference between groups (see supplementary results 2) ]. furthermore, there was evidence for a decrease in ct as a function of age in the right superior temporal gyrus cluster in the dys group, which is consistent with typical growth trajectories for this age range (shaw., 2006, 2008 ; sowell., although these results should be interpreted with caution given our cross - sectional data, they rule out age - related effects as the primary factor driving the observed group differences. to scrutinize factors underlying increased left fusiform ct in dyslexia, a future study should employ a longitudinal approach to examine developmental changes in ct from the pre - reading period. in all three dyslexia subgroups, we found increased ct in the right superior temporal gyrus, extending into the planum temporale, which resulted in deviation from normal lateralization pattern in a smaller area within this region. whole - brain analysis revealed that abnormally increased ct extended into the surrounding areas including the posterior sylvian fissure and perisylvian regions. the superior temporal region is involved in auditory processing, the disruption of which is directly relevant to dyslexia (eckert, 2004 ; eckert and leonard, 2000 ; eden and zeffiro, 1998). increase in ct and deviation from normal lateralization pattern in this area may reflect disruption in functional networks supporting auditory processing. functional imaging studies of dyslexia support this notion : there is hyperactivation in the right superior temporal gyrus, accompanied by underactivation in the left posterior temporal and inferior parietal regions in dyslexic children and adults (rumsey., 1992 ; simos., similarly, a functional connectivity study showed increased connectivity with the right temporoparietal region (i.e., adjacent to our right superior temporal gyrus cluster), together with decreased connectivity with the left temporal region, during both rest and tasks (schurz., 2014) thus, our findings indicate that deviation from normal language organization in dyslexia might be reflected by increased right hemisphere ct and subsequently abnormal rightward ct lateralization in the superior temporal region. our study revealed ct symmetry in typically developing children and rightward asymmetry in children with dyslexia. previous studies have reported leftward asymmetry in sa / gmv in both typically developing children and neurologically normal adults, with symmetry or rightward asymmetry in individuals with dyslexia (altarelli., 2014 ; galaburda., 1985 ; kushch., 1993 ; larsen., these seemingly inconsistent findings are not surprising, but rather emphasize that ct is independent from sa and gmv (dickerson., 2009 ; lemaitre., 2012 ; winkler., 2010) with its own lateralization pattern. further support for our results comes from studies on ct asymmetry in the general population, which have not found asymmetry in either typically developing children or healthy adults in our superior temporal gyrus cluster (luders., 2006 ; combined with previous studies, our finding indicates relative increase in the right hemisphere cortical structures as compared to the left hemisphere in dyslexia. previous studies suggest that activation of the right perisylvian region during language tasks is functional in dyslexia, compensating for disruptions in the left hemisphere language network (pugh. right angular gyrus cerebral blood flow during single - word reading tasks is positively correlated with reading scores in dyslexia, and negatively correlated in controls (rumsey., 1999). however, given the absence of remediation effects on brain structure in our study, it is not likely that findings reflect compensatory synaptogenesis and neuronal growth in the right hemisphere superior temporal gyrus. this does not mean that compensatory functional network changes are not present in this region, only that they do not appear to be accompanied by macroscopic structural changes (eden. regardless of remediation status indicates that deviation from normal superior temporal asymmetry in the dyslexia group is more suggestive of an anatomical anomaly associated with a history of dyslexia rather than compensatory brain growth. similar rightward anomalies were recently found in a sample of children with dyslexia of comparable age to our sample, although results were limited to a rightward asymmetry in sa, not ct, and were found in boys but not girls (altarelli., 2014). deviation from normal planum temporale asymmetry occurs in approximately 35% of the postmortem brains of neurologically normal adults and does not identify a reading disorder in isolation (geschwind and levitsky, 1968). however, galaburda. (1985) argued that this finding, in combination with left hemisphere cortical anomalies, might increase the likelihood of a developmental reading disorder. our study detected no abnormalities in sa, gmv, or their lateralization in individuals with a history of dyslexia, although we adopted widely accepted procedures for semi - automated morphometric analysis of high resolution mri scans (clarkson., 2011 ; dewey., 2010 ; ghosh., 2010 ; pantazis., 2010) and controlled for confounding variables including age, gender, handedness and iq. this suggests that negative results should not be attributed to novel methodology or sample confounds. also, the lack of remediation effect on these measures reduces the likelihood that variation introduced by remediation has confounded the results. the absence of abnormalities associated with sa, gmv, and their lateralization is inconsistent with previous positive findings (altarelli., 2014 ; galaburda., 1985 ; kushch., 1993 ; larsen., however, convergence between gray matter abnormality findings has been limited as is pointed out by richlan. (2013), and no net differences between dyslexia and typically developing children in gmv were detected in one study with comparable sample size to ours (pernet. similarly, normal sa and gmv lateralization in dyslexia has been reported by recent studies (best and demb, 1999 ; eckert., 2003 ; eckert and leonard, 2000 ; heiervang., 2000 pernet., 2009 ; preis., 1998 ; robichon., 2000 ; rumsey., 1997 ; schultz., 1994). such inconsistency across studies, along with our findings of abnormalities in ct and its lateralization associated with a history of dyslexia, supports the notion that dyslexia is associated with multiple neural risk factors (eckert and leonard, 2000). this is in accord with the notion that ct and sa are independent measures (dickerson., 2009 ; lemaitre., 2012 ; winkler., 2010) and that gmv is influenced more by the latter than by the former (frye., 2010 ; kapellou., 2006 ; winkler., this is in contrast to prior research showing that remediation is associated with changes in task - related brain activity (aylward., 2003 ; richards., 2000 ; shaywitz., 2004 ; simos., 2002, 2007 ;, 2003), intrinsic functional connectivity (koyama., 2013), white matter integrity (keller and just, 2009), and gmv (krafnick., 2011). we propose several factors that might have contributed to the lack of differences in gray matter associated with remediation status in our study. specifically, changes in brain functioning may not be accompanied by macroscopic changes in cortical structure (haier., 2009). second, the variety of interventions adopted by our participants, which likely affects multiple brain regions (dmonet., 2004), may have diluted focal effects, such as those observed in prior studies (krafnick., third, gray matter changes that are observed shortly after remediation training may be reversed when assessed after a long delay, although improvement in reading skills persists (driemeyer., 2008). finally, the smaller sample size of our remediation subgroups may have prevented more subtle effects of remediation from being detected. our findings do not rule out remediation effect on cortical structure in dyslexia, but emphasize the presence of cortical abnormalities that persist despite remediation. first, we matched participant groups on age, gender, handedness and iq to prevent the confounding effect of these factors. however, the distributions of these variables often differ between children with dyslexia and typically developing children (eglinton and annett, 1994 ; stuebing., 2002) ; therefore, our findings should be considered generalizable to children with dyslexia who are right - handed and have an iq within normal limits. second, while our study reveals focal regions of abnormal ct associated with a history of dyslexia, the cellular and cytoarchitectonic nature of these abnormalities remains unknown. prior histological studies suggest the presence of cortical ectopias and dysplasia (galaburda., 1985 ; humphreys., 1990) but these studies are few in number and require updating with more recent classification schemes for focal cortical dysplasia (blmcke., 2011). such work would provide critical information for comparing the features of cortical malformations across different neurodevelopmental disorders, such as autism and epilepsy, and would improve our knowledge of dyslexia etiology. furthermore, while left fusiform and right superior temporal gyrus ct abnormalities may be a persistent marker of dyslexia in childhood, this may no longer be the case in adulthood. in a sample of adults ranging in age from 20 to 42, there were no findings of ct abnormalities associated with dyslexia (frye., 2010). a recent longitudinal study of ct trajectory from the autism literature may shed light on this discrepancy (zielinski., 2014). in this study, abnormal ct development in autism varied with age, so that while child participants with autism had thicker cortex than typically developing participants in the occipital lobe, such a difference was not present in adolescence. further studies that span children and adults are needed to determine whether mri markers differ across developmental epochs. finally, our study design is observational and cross - sectional ; therefore, we were not able to investigate within - subject changes in structure that may accompany remediation. however, our study design is comparable to prior cross - sectional studies that report structural differences pre - dating reading experience (raschle., 2011) and those that report no structural differences when reading level is equated (krafnick., our results should therefore be considered an extension of this debate, with additional support for the former hypothesis of an early developmental origin for structural abnormalities (raschle., 2011) rather than an acquired structural variant attributable to insufficient reading experience (krafnick., 2014). using surface - based analysis of cortical structures, we found increased ct of the left fusiform gyrus and right superior temporal gyrus (extending into the right planum temporale) in individuals with a history of dyslexia. thus, we detected structural abnormalities in both the ventral and dorsal processing pathways of the known reading network. these effects were irrespective of remediation status ; they were present in children in two dyslexia subgroups who had remediated their reading and/or spelling performance. this suggests that structural differences are associated with early developmental factors leading to dyslexia diagnosis rather than reading level effects, as has been recently suggested (krafnick., 2014). double hit in the dyslexia group, characterized by cortical anomalies in the left fusiform region and abnormal rightward asymmetry of the superior temporal gyrus, supports the theory that multiple structural anomalies confer a greater risk of reading impairment (eckert and leonard, 2000 ; galaburda., 1985) | abnormalities in cortical structure are commonly observed in children with dyslexia in key regions of the reading network. whether alteration in cortical features reflects pathology inherent to dyslexia or environmental influence (e.g., impoverished reading experience) remains unclear. to address this question, we compared mri - derived metrics of cortical thickness (ct), surface area (sa), gray matter volume (gmv), and their lateralization across three different groups of children with a historical diagnosis of dyslexia, who varied in current reading level. we compared three dyslexia subgroups with : (1) persistent reading and spelling impairment ; (2) remediated reading impairment (normal reading scores), and (3) remediated reading and spelling impairments (normal reading and spelling scores) ; and a control group of (4) typically developing children. all groups were matched for age, gender, handedness, and iq. we hypothesized that the dyslexia group would show cortical abnormalities in regions of the reading network relative to controls, irrespective of remediation status. such a finding would support that cortical abnormalities are inherent to dyslexia and are not a consequence of abnormal reading experience. results revealed increased ct of the left fusiform gyrus in the dyslexia group relative to controls. similarly, the dyslexia group showed ct increase of the right superior temporal gyrus, extending into the planum temporale, which resulted in a rightward ct asymmetry on lateralization indices. there were no group differences in sa, gmv, or their lateralization. these findings held true regardless of remediation status. each reading level group showed the same double hit of atypically increased left fusiform ct and rightward superior temporal ct asymmetry. thus, findings provide evidence that a developmental history of dyslexia is associated with ct abnormalities, independent of remediation status. |
cancer occurrence is highly influenced by environment, genetic, gender, age, race, socioeconomic status, education, culture, obesity, and all life style related factors which might result in incidence rate change of these cancers in every population (1, 2). main gynecologic cancers (ovary, endometrium and cervix) besides breast cancer are responsible for 1.6% of total human cancers in the world (3). breast, endometrium and ovary are cancers with high incidence in the developed and western countries, north europe and north america. lower incidence in the less developed regions including asian countries is observed (35). there are suggestions regarding different survival of ovarian cancer, adjusted by available diagnostic and therapeutic modalities. more attention to confounding factors are needed, for instance undiag - nosed late stage ovarian cancer cases leading to dead affect involved diagnosed cancer population into more early stage and lower age population (6). cervical cancer incidence is among the 3 most common female cancers in 90% of the countries in the world (7). breast and gynecologic cancer incidence rates are the consequence of many factors. a common well known etiology for breast, ovarian and endometrial cancer is parity, with lower incidence in mul - tiparous women (811). risk factors of ovarian cancer include age, white race, nulliparity, positive family history of ovarian, endometrial and breast cancer (1214). cervical cancer is more common in the regions with low socioeconomic status (15). study of incidence trend might clarify epidemio - logic and clinical points to be studied more and used as and documented background for decision making and necessary interventions. in the present study change of incidence rate in breast, ovarian, endometrial and cervical cancer in a 4 - 5 year period of time in different countries including iran data of 2004 national cancer registry of iran, published by the iranian ministry of health regarding all reported breast, ovarian, endometrial and cervical cancers were included in this comparative study (16). iranian national cancer registry report, as pathology based registry has presented crude incidence rates. these data are not standardized by population in 2004, so comparing it with those of the other countries is not possible. from 2008, so, in the first step, results of breast, ovarian, endometrial and cervical cancer patients were standardized with standard world population. all reported female cancers of breast, cervix, ovary, and endometrium were included in the analysis. since other gynecologic cancers are rare their crude incidence rates were not included in the study. data of each of cancers in 2004 was separately proceeded to age- standard incidence rate according to the world standard population of the same year. in the second step, results of age- standard incidence rates (asr) of the 4 above mentioned cancers in iran, 2004 besides asr of 6 other countries including usa, australia, japan, india, africa and thailand, 2004 were compared to asr reports of all above mentioned cancers in 2008, globocan database. the main variables are asr of breast, ovarian, endometrial and cervical cancer cases in different countries which are presented in two time cutoff (2004 and 2008), in order to clarify the trend of disease in these time periods in different regions. cancer registry data of iran is pathology based which include 80% of cancer cases (16). published data of the iranian ministry of health and care is ethically available for study and private data of patients is not included. about 24498 female cancer patients were reported in 2004 iran, including 1923 (7.8%) gynecologic cancer patients (ovary, endometrium, uterus, cervix, vagina, vulva, placenta and other female genital organ), 16310 (66.6%) non - gynecologic patients and 6265 (25.6%) breast cancer cases. that is, breast and gynecologic cancer patients cover 33.42% of all site female cancer cases in 2004. age groups of patients (all female) are shown in table 1 as demographic picture. the number and frequency of breast and gynecologic female cancer patients according to age - groups in iran, 2004 the percentages of cancer patients in iran 2008 was 8.1% gynecologic, 69.9% non - gynecologic, 22% breast cancer based on globocan, 2008 database (17). the depiction of comparing iranian female cancers 2004 and 2008 percentage in non - gynecologic, breast, ovarian, cervix and endometrial subgroups are presented in fig.1. compared asr of iranian female gynecologic and breast cancer cases in 2004 and 2008 trend are presented in table 2. asr trend of gynecologic and breast cancer cases in iran, 2004 and 2008 comparison of the 4 mentioned cancers and asr trends of each cancer between iran and 6 other countries, in 2004 and 2008 are presented in table 3. percentage of female cancer cases (categorized based on gynecologic, non - gynecologic and breast) in iran, 2004 and 2008 comparison of standard incidence rate and its trend (2004 to 2008), in breast, cervical, endometrial and ovarian cancer patients in different countries we noticed in this study that in iran the incidence trend of breast and endometrium are decreasing, besides increasing trend of ovary and cervix. most of breast and gynecologic female cancer patients occur in 40 - 59 age group (table 1). this distinct the disease burden in terms of considering the high probable diagnosis and anticipating therapy for this age group. the frequency of occurrence for different cancers in iran has been shown in fig. 1 through the percentages of non gynecologic cancers and gynecologic cancers along with breast cancer in 2004 and 2008. as it is shown, breast cancer is the most common female cancers among iranian women. among the gynecologic cancer cases, ovary is the most common. this marks the burden of gynecologic cancer in iranian female population through 2004 - 2008 (fig.1). compared asr of iranian female gynecologic and breast cancer cases, 2004 - 2008 shows that the incidence of ovarian, cervical and endometrial cancer has not changed significantly, although the asr of breast cancer has decreased from 24.93 in 100,000 population in 2004 to 18.4 in 100,000 population in 2008 (table 2). this decreasing trend needs more evaluation. the lower occurrence and the younger age population in iran might explain the mentioned trend (17). a brief comparison of breast and gynecologic cancer asr of iran and those of the other countries are presented below. the most common cancer in the world among 4 under study cancers is breast cancer followed by cervix, endometium and ovary (table 2). breast cancer in all of the compared six countries revealed the highest incidence rate cancer. the highest age standard incidence rate (asr) of breast cancer is observed in usa and australia with a decreasing trend. in iran and uganda there is a higher asr in comparison to iran, thailand and uganda and lower in comparison to western countries, decreasing trend is like iran. in india and thailand, asr is lower with a rising trend (table 3). several risk factors are associated with breast cancer including smoking, late child bearing, nuliparity, early menarche and late menopause, low breast - feeding, post - menopausal estrogen- progesterone replacement therapy, low physical activity, high bmi in older age, alcohol consumption, diet and the old age (1820). these risk factors are an area of more study in the future to clarify causes of any increasing or decreasing trends in each country. iran is a low incidence area of breast cancer like other asian countries and inverse to western countries (17). in iran in older age and after menopause slope of increasing breast cancer incidence by age exhibit slow rise in contrast to usa with continuous increase after menopause (21). trend of breast cancer in usa has increased 26% within 1980s and with lower speed within 1990s (22). a 3.5% decrease in breast cancer asr is observed from 2001 to 2004 which might be due to decreasing practice of hormone replacement therapy (23). as observed in table 3 trend of breast cancer asr from 2004 to 2008 in usa has been decreasing. increase of breast cancer incidence rate observed in the data of the present study, in thailand and india might be the result of adoption of some aspects of western life style such as lower activity, more fast food usage, trend to obesity, later marriage, lower parity and so on. the most common gynecologic cancer in the world is cervical cancer (table 3). in africa the most common gynecologic cancer in japan, india, uganda, africa and thailand is cervical cancer, as well. cervical cancer incidence in usa and australia is relatively low and trend is in favor of decrease. in countries such as uganda, africa and thailand incidence is high and trend is increasing (table 3). in iran, asr of cervical cancer is low (the lowest asr of cervical cancer among the compared countries) but trend is increasing (table 2). hpv infection as a sexually transmitted infection is regarded as the main factor influencing cervical cancer development (25). other risk factors are as follows : multiple partners, early age intercourse, smoking, socioeconomic status, and multiparty (26, 27). proper screening (pap smear and hpv testing) results in cervical cancer asr decrease, which is observed in developed countries (2830). this matter might explain the observed decreasing trend of cervical cancer asr in usa and australia from 2004 - 2008 (table 3). the most common gynecologic cancer in iran is ovary, although asr of ovarian cancer is lower in comparison to other countries (table 3). trend of ovarian cancer asr in iran is increasing such as africa and india which are increasing, as well. in western countries such as usa and australia, ovarian cancer asr is higher with a decreasing trend. other studies report high rates of ovarian cancer in developed and western countries with a platue in asr and a lower rate in developing and asian countries including iran with increasing trend as observed in the present cancer data (4, 5). main risk factors of ovarian cancer are nuliparity, low parity, obesity, white race, high fat diet and inactivity. in contrast breast feeding, multiparity and oral contraceptive pill consumption are protective factors (5, 31, 32). it seems reasonable that a trend to western lifestyle, that influence diet, obesity and lower parity is lead to increase in trend of ovarian cancer asr which is observed in the present data (table 3). the most common gynecologic cancer in usa and australia is endometrial cancer (table 3). in contrast to japan and india where endometrial cancer incidence is lower with increasing trend, in iran endometrial cancer asr is low and the trend is decreasing (table 2) one of the main limitations of comparative asr studies is different management of data gatherings. more careful organized cancer registry may simulate higher asr, and vice versa is true as well. data of iranian cancer registry might be in improvement curve and not in maximum clarify specially due to its pathologic basis. main risk factors of endometrial cancer are old age, nuliparity, early menarche, late menopause and obesity (33). trend of developing countries to obesity and higher life expectancy might explain the increasing trend of endometrial cancer incidence in these countries. probable causes of the decreasing trend in endometrial cancer in developed countries might be studied more in the future. two main limitations of the study are as follows. at first, underestimate of cancer incidence especially in 2004 is probable due to new organization of cancer registry and pathology based method. second point is the wide range of causes, risk factors, epidemiologic parameters in different regions and for each of 4 studied gynecologic cancers. so, authors seriously feel the need of several step by step studies for more definite clinical discussion followed by decision in practice. the most common cancer in the world among 4 under study cancers is breast cancer followed by cervix, endometium and ovary (table 2).. the highest age standard incidence rate (asr) of breast cancer is observed in usa and australia with a decreasing trend. in iran and uganda there is a higher asr in comparison to iran, thailand and uganda and lower in comparison to western countries, decreasing trend is like iran. in india and thailand, asr is lower with a rising trend (table 3). several risk factors are associated with breast cancer including smoking, late child bearing, nuliparity, early menarche and late menopause, low breast - feeding, post - menopausal estrogen- progesterone replacement therapy, low physical activity, high bmi in older age, alcohol consumption, diet and the old age (1820). these risk factors are an area of more study in the future to clarify causes of any increasing or decreasing trends in each country. iran is a low incidence area of breast cancer like other asian countries and inverse to western countries (17). in iran in older age and after menopause slope of increasing breast cancer incidence by age exhibit slow rise in contrast to usa with continuous increase after menopause (21). trend of breast cancer in usa has increased 26% within 1980s and with lower speed within 1990s (22). a 3.5% decrease in breast cancer asr is observed from 2001 to 2004 which might be due to decreasing practice of hormone replacement therapy (23). as observed in table 3 trend of breast cancer asr from 2004 to 2008 in usa has been decreasing. increase of breast cancer incidence rate observed in the data of the present study, in thailand and india might be the result of adoption of some aspects of western life style such as lower activity, more fast food usage, trend to obesity, later marriage, lower parity and so on. the most common gynecologic cancer in the world is cervical cancer (table 3). in africa the most common gynecologic cancer in japan, india, uganda, africa and thailand is cervical cancer, as well. cervical cancer incidence in usa and australia is relatively low and trend is in favor of decrease. in countries such as uganda, africa and thailand incidence is high and trend is increasing (table 3). in iran, asr of cervical cancer is low (the lowest asr of cervical cancer among the compared countries) but trend is increasing (table 2). hpv infection as a sexually transmitted infection is regarded as the main factor influencing cervical cancer development (25). other risk factors are as follows : multiple partners, early age intercourse, smoking, socioeconomic status, and multiparty (26, 27). proper screening (pap smear and hpv testing) results in cervical cancer asr decrease, which is observed in developed countries (2830). this matter might explain the observed decreasing trend of cervical cancer asr in usa and australia from 2004 - 2008 (table 3). the most common gynecologic cancer in iran is ovary, although asr of ovarian cancer is lower in comparison to other countries (table 3). trend of ovarian cancer asr in iran is increasing such as africa and india which are increasing, as well. in western countries such as usa and australia, ovarian cancer asr is higher with a decreasing trend. other studies report high rates of ovarian cancer in developed and western countries with a platue in asr and a lower rate in developing and asian countries including iran with increasing trend as observed in the present cancer data (4, 5). main risk factors of ovarian cancer are nuliparity, low parity, obesity, white race, high fat diet and inactivity. in contrast breast feeding, multiparity and oral contraceptive pill consumption are protective factors (5, 31, 32). it seems reasonable that a trend to western lifestyle, that influence diet, obesity and lower parity is lead to increase in trend of ovarian cancer asr which is observed in the present data (table 3). the most common gynecologic cancer in usa and australia is endometrial cancer (table 3). in contrast to japan and india where endometrial cancer incidence is lower with increasing trend, in iran endometrial cancer asr is low and the trend is decreasing (table 2) one of the main limitations of comparative asr studies is different management of data gatherings. more careful organized cancer registry may simulate higher asr, and vice versa is true as well. data of iranian cancer registry might be in improvement curve and not in maximum clarify specially due to its pathologic basis. main risk factors of endometrial cancer are old age, nuliparity, early menarche, late menopause and obesity (33). trend of developing countries to obesity and higher life expectancy might explain the increasing trend of endometrial cancer incidence in these countries. probable causes of the decreasing trend in endometrial cancer in developed countries might be studied more in the future. two main limitations of the study are as follows. at first, underestimate of cancer incidence especially in 2004 is probable due to new organization of cancer registry and pathology based method. second point is the wide range of causes, risk factors, epidemiologic parameters in different regions and for each of 4 studied gynecologic cancers. so, authors seriously feel the need of several step by step studies for more definite clinical discussion followed by decision in practice. in countries such as usa and australia asr of breast, ovary and endometrium are higher in comparison with other countries including iran and the trend is decreasing. the incidence of cervical cancer is lower and trend is in favor of more decrease. in contrast in countries, such as africa, thailand, india and iran, although asr of breast, ovary and endometrium is lower in comparison with western countries, the trend is in favor of increase, except of breast in iran with a decreasing trend. changes in lifestyle towards western pattern might explain increase trend of breast, ovary and endometrial cancer in the globe. the first one probable reason is change of sexual behavior towards western lifestyle and the second, is lack of organized preventative screening programs resulting in increase in cervical cancer asr. more studies focusing on epidemiologic patterns and the causes including risk factors for each cancer besides more attention to continuation of the present study trend in the future might clarify and suggest preventative interventions in public health planning and clinical decision making regarding cancer. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. | abstractbackgroundfemale cancer, especially breast and gynecologic cancers are considered multistage disease, highly influenced by risk and protective factors and/or screening preventive modalities. consequences of all these factors result in the trend of change over time.methodsin this comparative study, based on data of national cancer registry of iran 2004 published by iranian ministry of health, age standard incidence rate (asr) according to the world population was calculated in all reported gynecologic and breast cancers. source of all subjects are pathologic based. in the next step, the calculated asr of iran and those of the other countries in 2004 were compared to globocan asr reports of 2008.resultsin iran asr of breast cancer 2004 (24.93) changed to 18.4 in 2008. ovarian cancer asr of 2004, 3.07 was 3.1 in 2008. endometrial cancer asr in 2004 (2.29) was 1.7 in 2008. cervical cancer asr of 1.71 in 2004 was 2.2 in 2008.conclusionsin iran incidence trend of breast and endometrium are decreasing in the same direction of usa and australia. increasing trend of ovary and cervix asr in iran is in the inverse direction of usa and australia which are decreasing. future studies to find out the same trend or any changes, might develop these findings and improve consequent practical decisions based on results of this study and complementary future studies. |
traumatic duodenal injuries with significant tissue loss are rarely seen but are a potentially challenging problem when they occur in either children or adults [1 - 3 ]. the incidence of duodenal injury in the literature ranges from 3.7% to 5.0% and it is often accompanied by other abdominal injuries because of its close anatomic relationship with the liver, pancreas, gallbladder, and ampulla of vater. in uncomplicated cases, the duodenal defect can simply be closed primarily. however, more complex injuries require pyloric exclusion with a gastrojejunostomy or a pancreaticoduodenectomy. several experimental studies have also examined whether other approaches could reduce the morbidity and mortality that is associated with the management of complicated large duodenal defects. several flaps have been used successfully to repair abdominal wall defects, including the rectus femoris muscle, antero - lateral thigh fasciocutaneous, and sartorius muscle or myocutaneous flaps. however, the reconstruction of an abdominal wall defect that is associated with a large duodenal disruption is clinically challenging and technically demanding. in the present report, we describe an alternative technique for closing an abdominal wall defect that is associated with a large duodenal disruption : a free flap was used with the help of the temporary placement of a covered expandable metallic stent. to our knowledge, this is the first time this approach has been reported. he had intra - abdominal exsanguinating bleeding, duodenal disruption, and multiple small bowel perforation. duodenojejunostomy, the resection of about 150 cm of small bowel followed by anastomosis, and bleeding control were performed. despite of repeated reanastomosis due to anastomosis failure, he developed sepsis and multiorgan failure. a surgical reexploration was performed and it revealed duodenojejunal disruption and multiple enteroenteric anastomosis failure ; there was a large amount of bilestained fluid in the abdomen. since less than 1 m of the small bowel remained, pyloric exclusion or pancreaticoduodenectomy could no longer be considered. therefore, we performed enteroenterostomy and duodenal primary repair, and placed a feeding tube distal to the perforated duodenum. fortunately, after intensive care, the patient could be transferred to the general ward after ventilator weaning. however, due to severe retraction of the duodenum, a duodenal disruption gap that was approximately 5 cm long developed. however, because of persistent leakage of gastric, bile, and pancreatic juice through the duodenal defect, the abdominal wall defect could not be repaired directly with a free flap. therefore, the bile and pancreatic juices were diverted first by placing separate pancreatic duct and bile duct drainage tubes by endoscopic retrograde cholangiopancreaticography. thereafter, the interventional radiologist placed a 16-mm diameter, 90-mm long covered expandable metallic stent (s&g biotech, seongnam, korea) from the duodenal bulb to the jejunum. bile and pancreatic juices were diverted through endoscopic nasobiliary drainage and endoscopic nasopancreatic drainage completely. seven days after stent placement, the patient underwent debridement and closure of the abdominal wall defect with a free flap. duodenostomy was performed by placing a drainage tube that decompressed the duodenum and prevented infection. endoscopic images obtained 3 months after stent placement revealed a widely patent stent, although granulation tissue had formed above the stent. the stent was electively removed 112 days after placement by using a stent removal set. the pancreatic duct and bile duct drainage tubes were removed 13 days after stent removal. on the 234 th postoperative day, an upper gastrointestinal water - soluble contrast study was performed and showed good passage of contrast with a small enterocutaneous fistula and no significant obstruction (fig. various treatment options have been reported to be effective for the surgical management of large duodenal defects. these include duodenal resection with end - to - end anastomosis, roux - en - y duodenojejunostomy, diverticulization, polytetrafluoroethylene patching, omental plug closure, jejunal serosal patching, and pedicled grafts. in the present report, a free flap was used with the help of a temporary stent to close a large duodenal defect and an abdominal wall defect. in this case, the patient had less than 1 m of small bowel left due to several previous small bowel resections. the main advantage of the alternative technique described in the present report is that it did not involve intestinal resection. it also prevented the possible risk of gastrointestinal contamination, peritoneal soiling, and organ injury. in our case, severe retraction of the duodenum led to a duodenal disruption that was approximately 5 cm long. contact between the free flap and the bowel appeared to be an important factor in duodenal prefabrication. an expandable metallic stent successfully reestablished duodenal continuity until the abdominal wall defect had been repaired. the stent was removed 112 days after its placement because of granulation tissue formation above the stent. a postoperative upper gastrointestinal water - soluble contrast study revealed good repair of the abdominal wall defect and the large duodenal disruption. however, the repaired duodenal wall is surrounded with a free flap, and we remain concerned that a fibrotic stricture could occur. in recent years, expandable metallic stents have been used in many hospitals for the palliative treatment of inoperable malignant gastroduodenal strictures. however, intestinal stent implantation remains potentially controversial because these stents can not always be removed easily after placement. stents used to treat a benign gastrointestinal stricture should be designed to be retrievable to prevent long - term complications such as granulation tissue formation and stent migration. in this patient with large duodenal disruption and abdominal wall defect, we placed a fully covered expandable stent to prevent leakage of bile juice and to establish duodenal continuity. we could remove the stent through per - oral route after repair of abdominal wall defect. although further clinical trials and extended follow - up studies are needed, the present case indicates that combining a free flap with a covered expandable metallic stent can effectively and successfully repair an abdominal wall defect that is associated with a large duodenal disruption. | abdominal wall defect with large duodenal disruption after penetrating abdominal injury is a rare emergency situation that can result in life - threatening complications. we report on a 64-year - old man who had abdominal wall defect with large duodenal disruption after penetrating abdominal injury. the patient presented with intra - abdominal exsanguinating bleeding, duodenal disruption, and multiple small bowel perforation. the rarity of this complex injury and its initial presentation as a posttraumatic large duodenal disruption with abdominal wall defect warrant its description. the present case indicates that combining a free tissue flap with a covered expandable metallic stent can effectively and successfully repair an abdominal wall defect that is associated with a large duodenal disruption. |
huntington 's disease (hd) is an adult - onset autosomal - dominant inherited neurodegenerative disorder with progressive symptoms that include involuntary movements, cognitive deficits, and various psychiatric disturbances [13 ]. hd is caused by an expanded cag repeat in the huntingtin gene [46 ]. the expanded cag repeat gives rise to an abnormally long polyglutamine stretch in the mutant huntingtin, which is toxic to neurons in the striatum and frontal cortex. the most striking pathophysiology of hd is the progressive degeneration of projection neurons and heightened gliosis, leading to a marked atrophy of the striatum and cerebral cortex. so far, although potential therapeutic interventions aimed at suppressing the production of the mutant huntingtin protein and reducing its toxicity have been aggressively pursued [913 ], no effective treatment for hd has been developed. offering hope, however, are findings by recent studies suggesting that the adult brain 's capacity to generate new neurons may be a resource for replacing the affected neurons with newly generated ones. in the mammalian brain, the subventricular zone (svz), which is a thin cell layer in the lateral walls of lateral ventricles, continues to produce new neurons during adulthood. postmortem analyses have shown that the svz in hd patients is thickened by increased cell proliferation [14, 15 ]. in addition, in an hd transgenic mouse model, r6/2 mice carrying the human hd gene with long cag repeats generate new neurons in the svz that migrate into the affected striatum and differentiate into mature neurons. unfortunately, although these alterations may reflect protective responses provoked by the progressive degeneration of striatal neurons owing to hd, they are insufficient to compensate for the pathological process. nonetheless, these observations may signal the possibility of future interventions that promote the production and migration of new neurons to the damaged striatum and improve the neurological impairments of this disease and/or stop its progression. here, we review current knowledge on the generation of new neurons (neurogenesis) in the adult brain and discuss its potential for replacing neurons damaged by pathological conditions, including hd. in the mammalian brain, the production of new neurons in the svz and the subgranular zone (sgz) in the dentate gyrus (dg) of the hippocampus continues during adulthood (figure 1(a)) [1721 ]. here, we particularly focus on the svz because the new neurons generated there have the notable ability to migrate fast and for a long distance in the adult brain. there are four types of cells in the adult svz : neural stem cells, transit - amplifying cells, newly generated immature neurons, and ependymal cells (figure 1(b)). the neural stem cells in the adult svz express the astrocyte - specific protein gfap, and their morphology is not clearly distinguishable from nonneurogenic astrocytes in other brain regions [23, 24 ]. the svz is thought to provide a specific microenvironment, a stem cell niche, that supports the neural stem cells ' ability to maintain their self - renewing, multipotent state. the process and regulatory mechanisms of neurogenesis in the adult brain have been studied in detail, particularly in rodents. in the svz, the stem cells proliferate slowly and continuously to generate transit - amplifying cells, which proliferate quickly ; their progeny become immature new neurons. new neurons in the adult rostral migratory stream (rms), which leads to the olfactory bulb (ob) at the anterior tip of the telencephalon, are still proliferative during their migration. interestingly, whereas the wnt--catenin signaling is involved in the proliferation and differentiation of transit - amplifying cells, we found that diversin, a component of the wnt pathway, is important in the proliferation of the new neurons. it is particularly notable that the new neurons migrating through the rms move quite quickly, 100 m / h in rodents. this rapid, directional migration is controlled by signals involved in cytoskeletal modification, directional guidance, and interactions between the new neurons and their microenvironment [2741 ]. during their migration in the rms, the new neurons exhibit a highly polarized morphology with an extended leading and trailing process, and they form elongated cell aggregates called chains, within which they move over and past one another (figure 1(c)). polysialic acid - neural cell adhesion molecule (psa - ncam) and 1-integrin expressed on the surface of the new neurons and intracellular cdk5 signaling are involved in this chain migration [28, 31, 32, 39 ]. these chains of new neurons move inside tunnels formed by astrocytic processes, termed glial tubes (figure 1(c)) [33, 35, 36 ], which assist the migration of the new neurons. we recently demonstrated that the relationship between the neurons and glia appears to be interdependent. the tunnel - like arrangement of astrocytes depends on a diffusible protein, slit1, secreted by the new neurons migrating inside them.. the neuron - glia interaction may be particularly important for neuronal migration in the adult brain, since it includes a large glial population. in addition, matrix metalloproteases produced by the new neurons, and extracellular matrix molecules including tenascin - c, proteoglycans, and the laminins are all involved in the migration of new neurons in the rms [28, 33, 37 ]. new neurons are guided by extracellular cues to migrate toward the ob, and we found that the directional flow of cerebrospinal fluid (csf) in the lateral ventricle plays a critical role in their rostral migration. csf flow is created by the coordinated beating of the multiple ependymal cell cilia, and generates concentration gradients of diffusible proteins, including chemorepellents, secreted into the lateral ventricle. in addition, new neurons are guided to the ob by a number of secreted proteins that are produced in the ob, including prokineticin 2, glial cell - line - derived neurotrophic factor (gdnf), and brain - derived neurotrophic factor (bdnf) [29, 40 ]. new neurons that reach the ob detach from the chain, and the individual cells migrate radially into the granule cell layer and the glomerular layer, where they differentiate into granule cells and periglomerular cells, respectively (figures 1(d) and 1(e)). the granule cells and periglomerular cells are gabaergic interneurons, which include a small number of periglomerular dopaminergic interneurons. although the functional significance of these new neurons remains unclear, the neurogenic capacity of the adult rodent brain encourages the hope that this ability might be harnessed to replace neurons destroyed by injury or disease. the human svz and dg also retain some ability to generate neurons in adulthood [21, 42 ], but it is difficult to evaluate human neurogenesis quantitatively, because the experimental procedures are limited. studies using nonhuman primates and postmortem or surgically dissected human brain tissues indicate that neurogenesis is much less active in the human svz than in that of rodents [4345 ]. however, new neurons in the human svz exhibit a migratory - like polarized morphology and are distributed between the svz and ob. these morphological and histological characteristics suggest that new neurons might migrate for long distances in the adult human brain, but this possibility is still controversial [4549 ]. in any case, some of the mechanisms that regulate neurogenesis are likely to be common in humans and rodents. neurogenesis in the adult brain is affected by various brain insults. following the loss of neurons caused by pathological conditions including stroke and neurodegenerative diseases, newly generated neurons appear in and around the damaged areas. studies of grade 3 hd patients reported that the svz becomes 2.8-fold thicker, with a 2.6-fold increase in the production of new neurons [49, 50 ]. although the numbers of transit - amplifying cells and new neurons in the patients ' svz had increased moderately, the most prominent increase observed was of neural stem cells. in addition, the svz of r6/2 mice, a transgenic model for hd, becomes thicker, with a marked increase in the proportion and proliferation of neural stem cells. the self - renewal ability of neural stem cells dissociated from the r6/2 mouse svz gradually increases in parallel with disease progression. the rostral migration of new neurons from the svz toward the ob is significantly suppressed in these mice ; instead, a large population of new neurons migrates laterally into the affected striatum where they differentiate into mature neurons (figure 2(a)). the precise mechanism that leads these changes remains to be elucidated ; however, the stem cells in the svz may function to replace degenerated striatal neurons with new ones, at least in the rodent hd model. in addition, the svz - associated neuroregenerative response observed in hd takes place in other pathologies, including ischemic stroke and parkinson 's disease (pd). cerebral ischemia is the most commonly studied model of neuronal regeneration after extensive neuronal death (figure 2(b)). in patients after ischemic stroke, cell proliferation and the production of new neurons in the svz are increased, and immature new neurons appear in the cortex close to injured areas and in the striatum close to the svz [5153 ]. the mechanism and functional significance of the ischemia - induced neurogenesis have mostly been studied using rodent models of transient middle cerebral artery occlusion (mcao), an experimental model of focal brain ischemia that causes infarction of the ipsilateral striatum and adjacent neocortex. the new neurons generated in the svz have a migratory morphology that is directed toward the infarct area, and frequently form chain - like aggregates similar to those observed in the rms (figure 2(c)). our lineage - specific tracing study revealed that the svz is almost the sole source of migrating new neurons in the striatum. we also found that new neurons in the striatum are closely associated with astrocytic processes and migrate along blood vessels (figures 2(d) and 2(e)) [55, 56 ]. several proteins produced by the glia and endothelial cells around the infarct area are implicated in this migration, as are their receptors and the mmps expressed by the new neurons [5760 ]. after the migration, most of the new neurons die before they mature, but some survive to differentiate into functional neurons with synaptic contacts. in a rat mcao model, the number of new striatal neurons increased 31-fold compared with that in sham - operated animals. using the immunocytochemical detection of brdu, a thymidine analog that is incorporated into dna during cell proliferation, and of neun, a neuronal marker, newly generated neurons have been identified in the injured striatum of several mcao models. when brdu (50 mg / kg) was administered twice a day for 14 days to post - mcao rats, the density of brdu / neun - colabeled new neurons in the striatum 6 weeks after mcao was more than 700 cells / mm. on the other hand, in a nonhuman primate (common marmoset) mcao stroke model, brdu (50 mg / kg) injections once a day for 18 days after mcao resulted in a density of brdu / neun - colabeled new striatal neurons 45 days after mcao that was less than 3 cells / mm, that is, about 50 cells / mm, considering the thickness of the brain sections. these reports suggest that the efficiency of neuronal regeneration is lower in the primate brain, although a precise comparison is not possible due to the difference in brdu - treatment procedures. moreover, even in the rat mcao model, these new neurons could replace only about 0.2% of the dead striatal neurons, suggesting that the spontaneous neuronal regeneration would be insufficient to replace the functions of the lost neurons in human patients. because of the low efficiency of neuronal regeneration, interventions that promote this process are now the focus of intense study. growth factors that promote cell proliferation, differentiation, migration, and/or survival have been reported to act on neural stem cells and/or their progenies to enhance neuronal regeneration [62, 63 ] (table 1). in mcao model animals, epidermal growth factor (egf) overexpression in the svz and the intracisternal administration of fibroblast growth factor 2 (fgf-2) induced increases in the number of proliferating cells in the svz [64, 65 ] whereas infusion of gdnf around the infarct area increased the new neurons in the region by 2-fold. on the other hand, the stromal cell - derived factor-1 (sdf-1) cxcr4 signal has been reported to be involved in neuronal migration toward the infarct area [57, 59, 67 ]. furthermore, in the r6/2 model mice, bdnf overexpression in the svz increased the production of new striatal neurons by about 21-fold, which was enhanced by the co - overexpression of noggin, a soluble inhibitor of the bone morphogenic proteins (bmps). some of these growth factors may thus be effective in reducing the pathology associated with neuronal loss. alterations in neurogenesis are also observed in pd, a more common neurodegenerative disease than hd. pd is a motor system disorder characterized by the selective degeneration of dopaminergic neurons in the substantia nigra pars compacta, a basal ganglion of the midbrain, that project into the striatum. therefore, treatments that increase the dopaminergic stimulation of the striatum improve neurological symptoms. in animal models of pd, after chemically induced dopaminergic denervation of the striatum, new neurons migrate from the svz to the striatum, where they differentiate into dopaminergic neurons [7880 ]. however, these reports are controversial because other researchers showed that the new neurons did not efficiently migrate into the denervated striatum, but into the ob, and that the svz - derived migrating progenitors that did arrive in the striatum never differentiated into mature dopaminergic neurons. therefore, even if the svz can generate new neurons that migrate to the striatum in pathological conditions, such as hd, these neurons may not replace the functionality of the lost neurons, possibly because they do not mature and differentiate into the needed neuronal types. as mentioned above, in contrast, more than 90% of striatal neurons are medium - sized spiny projection neurons, and these are the neurons that are mainly injured in hd and cerebral ischemia [8287 ]. although some previous studies reported the regeneration of mature neurons with phenotypes of striatal projection neurons [54, 88 ], more recent studies demonstrated that, after ischemic stroke, the new neurons that were generated in the svz and differentiated in the striatum almost exclusively became calretinin - expressing neurons, a major type of olfactory interneuron [8991 ]. these findings suggested that the neurons generated in the svz have a limited differentiative capacity for neuronal regeneration. in considering how to attenuate the progression of hd, it is particularly important to learn whether and how we can control the fates of new neurons generated in the adult brain so that they adopt striatal neuronal phenotypes. the spontaneous regeneration response of the adult svz to pathological neuronal loss does not lead to the regeneration of the lost neurons, because of limitations in the numbers of neurons generated and the fates they adopt. however, many studies support the idea that interventions to increase the production of new neurons in the svz and promote their migration, maturation, and survival in the damaged area could be beneficial for treating a variety of neurological deficits, including hd (table 1). to develop a new therapeutic strategy for pathological neuronal loss, including in cases of hd and stroke, using this system, it will be critical to develop a more precise and comprehensive understanding of the mechanisms that regulate neurogenesis in both physiological and pathological conditions. | currently, there is no effective treatment for the marked neuronal loss caused by neurodegenerative diseases, such as huntington 's disease (hd) or ischemic stroke. however, recent studies have shown that new neurons are continuously generated by endogenous neural stem cells in the subventricular zone (svz) of the adult mammalian brain, including the human brain. because some of these new neurons migrate to the injured striatum and differentiate into mature neurons, such new neurons may be able to replace degenerated neurons and improve or repair neurological deficits. to establish a neuroregenerative therapy using this endogenous system, endogenous regulatory mechanisms that can be co - opted for efficient regenerative interventions must be understood, along with any potential drawbacks. here, we review current knowledge on the generation of new neurons in the adult brain and discuss their potential for use in replacing striatal neurons lost to neurodegenerative diseases, including hd, and to ischemic stroke. |
n bond in an aromatic system results in azaborines, heterocycles that retain most of the aromatic character and thermal stability associated with their c = c analogues. n bond desymmetrizes the heterocycle, allowing functionalization at various positions around the ring with complete regiochemical control. this permits access to elaborate azaborines, the corresponding carbon analogues of which can not easily be prepared. n bonds are isoelectronic with c = c double bonds, azaborines have been examined as isosteres for all - carbon aromatics in medicinal chemistry. azaborines have demonstrated antifungal activity against several different fungi in addition to exhibiting antibacterial activity against gram - negative bacteria. furthermore, the azaborine derivatives of ethylbenzene can bind the hydrophobic pocket of the l99a mutant of the t4 lysozyme as well as inhibit the ethylbenzene dehydrogenase (ebdh) enzyme. therefore, the synthesis of complex azaborines can provide access to novel drug candidates, thereby aiding the exploration of novel chemical space. additionally, the replacement of a c = c bond with a b thus, in addition to their applications in medicinal chemistry, the isosteric replacement of c = c with b n has led to the synthesis of classes of compounds that serve as organic light - emitting diodes (oleds) and organic field - effect transistors (ofets). consequently, functionalization of azaborine cores is anticipated to provide access to new classes of compounds with potentially different and impactful photophysical properties. the promise of azaborines in these fields led us to develop a method to synthesize the core of 2,1-borazaronaphthalene, the b n analogue of naphthalene (eq 1). 2,1-borazaronaphthalenes synthesized through this route are stable toward both strong acid (ph 2 at 37 c) and base (cs2co3/h2o at 60 c), thus demonstrating their aromatic nature. however, the synthesis of an azaborine core is only the starting point because further functionalization of these molecules allows facile access to novel, increasingly complex molecules.1 the method developed for accessing the core of 2,1-borazaronaphthalenes permitted the synthesis of a library of over 50 compounds with various substitutions. this convergent, modular route utilized simple starting materials under mild reaction conditions to afford a highly functionalized azaborine core, allowing selective substitution around the 2,1-borazaronaphthalene system by starting from an n- or aryl - substituted 2-aminostyrene to synthesize 1-, 2-, 5-, 6-, 7-, or 8-substituted 2,1-borazaronaphthalenes. however, it was not possible to access 3-substituted-2,1-borazaronaphthalenes through this method, as the reaction between potassium phenyltrifluoroborate and (e)-2-styrylaniline did not provide any of the desired product (eq 2).2 an alternative method was therefore required for substitution at the 3-position of these azaborines, and thus, a different retrosynthetic disconnection was envisioned (scheme 1). a suzuki miyaura cross - coupling between brominated 2,1-borazaronaphthalenes and potassium (hetero)aryltrifluoroborates was proposed to elaborate the 2,1-borazaronaphthalenes. through such a protocol, a library of (hetero)arylated azaborines could be synthesized easily from a brominated starting material, thereby building substantial molecular complexity over two short steps. only two isolated examples of the cross - coupling of halogenated azaborines and aryl nucleophiles have been previously reported. boronic acids and many boronic acid surrogates are capable of undergoing transmetalation in cross - coupling reactions because an activated palladium complex interacts with a vacant orbital on the boron. because of the b n bond, the empty p orbital on boron within the azaborine is occupied by electron donation from the nitrogen. this feature contributes to the azaborine s aromatic stability but was anticipated to reduce its ability to participate in transmetalation. therefore, we expected selectivity in transmetalation such that the cross - coupling would proceed with the external organoboron nucleophile, leaving the b c bond of the azaborine intact. reported herein is the cross - coupling of 3-bromo-2,1-borazaronaphthalenes with an array of potassium (hetero)aryltrifluoroborates, providing access to 3-(hetero)aryl-2,1-borazaronaphthalenes. this cross - coupling represents the first reported cross - coupling between an electrophilic brominated azaborine and a nucleophilic organometallic reagent. in this work, 26 2,1-borazaronaphthalenes with various substitutions on boron and nitrogen were brominated, and 43 different cross - coupled 2,1-borazaronaphthalenes were obtained utilizing a palladium - catalyzed suzuki miyaura cross - coupling reaction. the method was then extended to show a second site - selective bromination and subsequent cross - coupling to access diarylated products. the methods developed herein demonstrate that the unique site - selective emplacement of groups about the azaborine core allows more diverse and precise elaboration of these systems with far greater ease and higher selectivities than with naphthalene itself. 2,1-borazaronaphthalenes exhibit reactivity toward electrophilic aromatic substitution that is complementary to that of their c = c counterparts because the b n bond desymmetrizes the molecule, with different positions being activated relative to those in naphthalene. because azaborines are generally less aromatic than their c = c analogues, 2,1-borazaronaphthalenes are also activated toward electrophilic aromatic substitution, and in general such reactions take place under milder reaction conditions. therefore, initial efforts were focused on the bromination of 2,1-borazaronaphthalenes through an electrophilic aromatic substitution to generate the required electrophilic partner. the bromination and chlorination of 2-methyl-2,1-borazaronaphthalene (1) were first reported by dewar in 1961 (eq 3). to this day, these two halogenated 2,1-borazaronaphthalenes remain the only 3-substituted-2,1-borazaronaphthalenes reported in the literature. the addition of bromine to a solution of 1 in acetic acid resulted in a 60% isolated yield of the desired product. a major halogenated, deboronated side product was generated in 29% yield as a result of the harsh reaction conditions. n isostere of benzene, was reported to provide the desired product in 91% yield under milder reaction conditions. utilizing these modified conditions for the bromination of 2,1-borazaronaphthalene by changing the solvent from acetic acid to dichloromethane and cooling the reaction to 0 c enabled the desired 3-bromo-2,1-borazaronaphthalenes to be easily synthesized. the rate of addition of bromine was vital to the success of the reaction : a rate of 1 mmol / h resulted in a high yield for many 2,1-borazaronaphthalenes, while more rapid addition of bromine caused the reaction to exotherm, resulting in decomposition of the 2,1-borazaronaphthalene. brominations could also be carried out in a shorter period of time by conducting the reaction at 78 c.3 the bromination conditions were applied to an array of 2,1-borazaronaphthalenes to access 3-bromo-2,1-borazaronaphthalenes in high yield (table 1). free n - h 2,1-borazaronaphthalenes with alkyl substituents on boron were brominated in yields of up to 99% (entries 15). bromination of 2-aryl-2,1-borazaronaphthalenes with either electron - withdrawing or electron - donating groups on the arene afforded the desired products in yields of 8199% (entries 810, 1317, and 19). brominated heteroaryl - containing 2,1-borazaronaphthalenes were obtained in variable yields (entries 11, 12, and 18). substitution on nitrogen did not interfere with the bromination, and the desired products were obtained in modest to excellent yields (entries 6, 7, and 1319). the brominated products 2r and 2 t were synthesized in lower yield as a result of the formation of side products resulting from multiple additions of bromine. interestingly, good to excellent yields of the brominated borazines were achieved even in the presence of what might be considered to be activated arenes (entries 9, 12, 14, and 19). the extraordinary reactivity of the 2,1-borazaronaphthalene toward electrophilic aromatic substitution was further demonstrated in the cases of substrates 2 g, 2 m, 2n, and 2 t, where the azaborine core was brominated in preference to either an allyl group on nitrogen or an alkyne on boron (entries 7, 13, 14, 20). reaction conditions (unless otherwise noted) : 1.0 equiv of 2,1-borazaronaphthalene, 1.1 equiv of br2, ch2cl2, 0 c to rt. attempts to synthesize 2,1-borazaronaphthalenes from electron - poor 2-aminostyrenes (i.e., 2-amino-5-trifluoromethylstyrene) were unsuccessful under our developed conditions. however, n - substituted 2-aminostyrenes are suitable substrates for the synthesis of azaborines. substitution of the all - carbon ring of the 2,1-borazaronaphthalene does not affect the bromination because the corresponding products were isolated in good yields (entries 21 and 22). the desired 3-bromo-2,1-borazaronaphthalenes were synthesized with aryl, heteroaryl, alkynyl, and alkyl substituents on boron. however, the presence of an alkene on boron resulted in dibromination of the alkene as the major product (eq 4). the same result was evident in the bromination of an alkenyl - substituted arene, where addition of bromine resulted in dibromination of the alkene followed by bromination of the arene.4 the addition of a second equivalent of bromine to the 2,1-borazaronaphthalene resulted in site - selective dibromination at the 3- and 6-positions of the 2,1-borazaronaphthalene (eq 5), providing the desired product in excellent yield and again demonstrating extraordinary complementarity to naphthalene systems in terms of both selectivity and structural diversity.5 as noted previously, the isosteric replacement of c = c with b n effectively desymmetrizes the molecule and selectively activates the system for electrophilic aromatic substitution to such an extent that both the mono- and dibromination reactions proceed with complete regiochemical control. resonance structures can be used to rationalize activation of c3 and c6, but such an analysis indicates that c8 should also be activated (scheme 2). this observed selectivity of electrophilic aromatic substitution at c3 and c6 was reinforced and refined by a rudimentary dft calculation analyzing the homo of the 2,1-borazaronaphthalene. this calculation, completed at the b3lyp/6 - 31g(d) level of theory, detailed the electron density of the homo of 2,1-borazaronaphthalene (figure 1). the increased electron density at the fused carbons (c4a and c8a) suggests that c4a should be nucleophilic. however, addition of an electrophile at c4a would break the aromaticity in both rings of the azaborine, resulting in a higher energy barrier for reaction, thereby disfavoring addition at this carbon. the carbon with the highest electron density in the homo is c3, with an electron density of 0.342, whereas c6 is a close second with an electron density of 0.325. the electron density of c8 is only 0.024, showing the lack of nucleophilicity of this carbon relative to c3 and c6. similar calculations for substrates with substitution around the azaborine (i.e., 2u and 2v) show a similar trend, confirming the high reactivity at the 3-position. dft - calculated homo of 2,1-borazaronaphthalene [calculated at the b3lyp/6 - 31g(d) level of theory ]. computational studies of brominated intermediates are equally informative in rationalizing the site selectivity observed. a series of calculations at the b3lyp/6 - 31g(d) level of theory evaluated the relative energies of the intermediates formed after addition of bromine to 2-methyl-2,1-borazaronaphthalene 1 (figure 2). the relative energy of the intermediate for the bromination at c3 is much lower than those at c6 and c8, explaining the first bromination at the 3-position. n ring because it is both less aromatic and less thermally stable than a c = c ring, which in turn increases its reactivity. addition of a second equivalent of bromine results in addition to the c = c ring of the 2,1-borazaronaphthalene, specifically at the 6-position, because the intermediate derived from addition at that site is 2 kcal / mol lower in energy than that of the c8-brominated intermediate. relative energies for the addition of bromine to 2-methyl-2,1-borazaronaphthalene intermediates [calculated at the b3lyp/6 - 31g(d) level of theory ]. the impact of the site - selective bromination can be demonstrated by comparison with the bromination of naphthalene. unlike 2,1-borazaronaphthalenes, which undergo electrophilic aromatic substitution selectively at the 3-position, the natural site for electrophilic aromatic substitution of naphthalene is the 1-position. in fact, the bromination of 2-methylnaphthalene to form 1-bromo-2-methylnaphthalene proceeds in 87% yield whereas the bromination of the corresponding azaborine 1 yields 3-bromo-2-methyl-2,1-borazaronaphthalene (2a) in 99% yield, demonstrating complementary electrophilic aromatic substitutions of the c = c and b n analogues to access molecules with different substitution patterns. furthermore, to install a halogen at the 3-position of naphthalene requires either a directing group under harsh reaction conditions or a gold - catalyzed cyclization in the presence of nis. the corresponding bromination of 2,1-borazaronaphthalene is a one - step process resulting in the addition of bromine to a highly functionalized molecule. upon the synthesis of the brominated 2,1-borazaronaphthalenes, investigations of the suzuki 3-bromo-2-methyl-2,1-borazaronaphthalene 2a and potassium phenyltrifluoroborate were chosen as model substrates in the reaction to synthesize 2-methyl-3-phenyl-2,1-borazaronaphthalene (3a) (eq 6).6 initially, stability tests were performed to ensure that 2,1-borazaronaphthalenes would be stable in basic media at the elevated temperatures required for the cross - coupling. heating of the 2,1-borazaronaphthalenes at 60 c in a 1:1 thf / h2o solvent system with 3 equiv of cs2co3 resulted in complete recovery of the 2,1-borazaronaphthalenes. initial reaction conditions for the cross - coupling of phenyltrifluoroborate with the brominated azaborine 2a were determined through a limited screening process. of the palladium sources and ligands tested in this initial screen, the (t - bu3p)(aminobiphenyl)palladium chloride precatalyst (commercially available t - bu3p - pd - g2 ; figure 3) was chosen for future study as it contained a relatively inexpensive phosphine ligand and demonstrated high conversion of the starting material. optimization continued by variation of the temperature, solvent, and catalyst loading with cs2co3 as the base (table 2). with a solvent system of 1:1 dioxane / h2o, a reaction temperature of 40 c resulted in incomplete conversion after 18 h (entry 1) ; however, increasing the temperature to 60 c provided complete conversion to the desired product in 18 h (entry 2). no side products were observed with any solvent, meaning the solvent affected only the rate of the reaction. both cyclopentyl methyl ether (cpme) and dioxane afforded complete conversion to the desired product, whereas toluene and thf did not (entries 35). cpme was chosen as the cosolvent in the reaction because of its more favorable properties relative to dioxane. because of the increased temperature, decreasing the palladium loading to 1 mol % resulted in complete conversion (entry 6), but when the catalyst loading was further decreased to 0.5 mol %, starting material remained after 18 h (entry 7). the concentration of the reaction was also screened, and complete conversion was achieved with a concentration of 0.5 m (entries 8 and 9). therefore, 1 mol % t - bu3p - pd - g2, 3 equiv of cs2co3, and 1:1 cpme / h2o at 60 c for 18 h were used as the standard cross - coupling conditions. determined by hplc with the addition of 10 mol % 4,4-di - tert - butylbiphenyl as an internal standard. entries 2, 3, 6, 8, and 9 resulted in complete conversion of the starting material. the general reaction conditions were applied to a representative set of potassium aryltrifluoroborates with 3-bromo-2-methyl-2,1-borazaronaphthalene as the electrophilic partner in the cross - coupling reaction (table 3). to investigate the method fully, both electron - rich (entries 18) and electron - poor (entries 1013) aryltrifluoroborates were examined. all of the aryltrifluoroborates utilized were successfully cross - coupled without employing an excess of the organotrifluoroborate, providing the desired 3-aryl-2,1-borazaronaphthalenes in yields of 5398%. aryltrifluoroborates with ortho (entry 3), meta (entries 2, 812, 14), and para (entries 4, 5, and 13) both 1- and 2-naphthyltrifluoroborate were successful nucleophiles in this reaction, and the products were obtained in yields of 93% and 95%, respectively (entries 6 and 7). when a disubstituted aryltrifluoroborate was subjected to the reaction, the scalable nature of the cross - coupling was demonstrated by performing the reaction on a 4.5 mmol scale with 0.5 mol % t - bu3p - pd - g2, which provided the desired products in high yield (entries 1 and 2). reaction conditions (unless otherwise noted) : 1.0 equiv of 3-bromo-2-methyl-2,1-borazaronaphthalene, 1.0 equiv of potassium aryltrifluoroborate, 1 mol % t - bu3p - pd - g2, 3.0 equiv of base, 1:1 cpme / h2o, 60 c, 18 h. reaction concentration of 0.1 m. reaction completed on a 4.5 mmol scale with 0.5 mol % t - bu3p - pd - g2. to expand the range of nucleophiles, 3-bromo-2-methyl-2,1-borazaronaphthalene was coupled with a variety of potassium heteroaryltrifluoroborates (table 4). the thienyltrifluoroborates were successfully cross - coupled, affording the desired products in yields of 84% and 86% (entries 2 and 3). other heteroaryltrifluoroborates, including furyl and isoxazolyl, were successfully coupled, and the corresponding 3-heteroaryl-2,1-borazaronaphthalenes were synthesized in yields up to 72% (entries 4 and 5). larger heteroaryltrifluoroborates, such as 4-dibenzofuranyl- and 4-dibenzothienyltrifluoroborate, were efficient as nucleophiles in the coupling, furnishing the products in yields of 54% and 52%, respectively, after the concentration of the reaction was lowered to 0.1 m (entries 6 and 7). reaction conditions (unless otherwise noted) : 1.0 equiv of 3-bromo-2-methyl-2,1-borazaronaphthalene, 1.0 equiv of potassium heteroaryltrifluoroborate, 1 mol % t - bu3p - pd - g2, 3.0 equiv of base, 1:1 cpme / h2o, 60 c, 18 h. reaction concentration of 0.1 m. to demonstrate the versatility of this method, other 3-bromo-2-alkyl-2,1-borazaronaphthalenes were synthesized and subjected to the standard cross - coupling conditions with potassium 3-methoxyphenyltrifluoroborate as the nucleophilic partner (table 5). brominated n - substituted b - alkyl 2,1-borazaronaphthalenes were successful electrophiles in this cross - coupling reaction. benzyl and allyl substituents on nitrogen did not affect the cross - coupling, providing the desired products in yields of 93%, and 83%, respectively (entries 1 and 2). the product from the cross - coupling of 3-bromo-2-(,,-trifluoroethyl)-2,1-borazaronaphthalene was obtained in 67% yield, providing access to fluorinated 2,1-borazaronaphthalenes (entry 3). secondary cyclic (cyclobutyl and cyclopropyl) and noncyclic (isopropyl) substituents on boron afforded the corresponding cross - coupled product in yields of 70%, 84%, and 77%, respectively (entries 46). reaction conditions : 1.0 equiv of 3-bromo-2-alkyl-2,1-borazaronaphthalene, 1.0 equiv of potassium 3-methoxyphenyltrifluoroborate, 1 mol % t - bu3p - pd - g2, 3.0 equiv of base, 1:1 cpme / h2o, 60 c, 18 h. after viable reaction conditions for the coupling of 3-bromo-2-alkyl-2,1-borazaronaphthalenes were determined, the coupling of the corresponding 3-bromo-2-aryl-2,1-borazaronaphthalenes was investigated. although transmetalation of the b - alkyl systems would likely never compete with those of the arylboron nucleophiles, aryl groups are much more easily transferred. therefore, there was concern that 3-bromo-2-aryl-2,1-borazaronaphthalenes would not be stable in the cross - coupling reaction, with the potential that the b - aryl group of the azaborine could compete with the nucleophilic aryltrifluoroborate in the reaction, resulting in a mixture of products. fortunately, subjecting 3-bromo-2-phenyl-2,1-borazaronaphthalene (2h) to the reaction conditions with 1 equiv of either potassium phenyltrifluoroborate or phenylboronic acid resulted in the desired cross - coupled product 11a in a yield of 77% or 54%, respectively (table 6, entry 1). on the basis of these results, the scope of the cross - coupling was analyzed with an array of potassium (hetero)aryltrifluoroborates (table 6). aryltrifluoroborates with either para or meta substitution provided the desired product in yields of 71% and 32%, respectively (entries 2 and 3). several heteroaryltrifluoroborates were successful nucleophiles in this coupling, such as thienyl, furyl, and isoxazolyl, affording the cross - coupled products in yields of 70%, 80%, and 88%, respectively (entries 57). the desired cross - coupled product was obtained in 75% yield when an n - boc - indolyltrifluoroborate was employed as the nucleophile in the reaction (entry 8). reaction conditions (unless otherwise noted) : 1.0 equiv of 3-bromo-2-phenyl-2,1-borazaronaphthalene, 1.0 equiv of potassium (hetero)aryltrifluoroborate, 1 mol % t - bu3p - pd - g2, 3.0 equiv of base, 1:1 cpme / h2o, 60 c, 18 h. phenylboronic acid was utilized as the nucleophile. to demonstrate the versatility of this method, other 3-bromo-2-(hetero)aryl-2,1-borazaronaphthalenes were synthesized and subjected to the standard cross - coupling conditions with potassium 3-methoxyphenyltrifluoroborate as the nucleophilic partner (table 7). two additional 3-bromo-2-aryl-2,1-borazaronaphthalenes were subjected to the cross - coupling reaction, and the corresponding products were isolated in yields of 62% and 50% (entries 1 and 2). when the electrophile was 3-bromo-2-(3-thienyl)-2,1-borazaronaphthalene, the desired product was obtained in 24% yield (entry 3). steric hindrance of the 2,1-borazaronaphthalene can affect the success of the coupling reaction. for example, 3-bromo-2-(4-dibenzofuranyl)-2,1-borazaronaphthalene could serve as the electrophilic partner in this reaction but afforded the desired product in only 32% yield (entry 4). reaction conditions : 1.0 equiv of 3-bromo-2-(hetero)aryl-2,1-borazaronaphthalene, 1.0 equiv of potassium 3-methoxyphenyltrifluoroborate, 1 mol % t - bu3p - pd - g2, 3.0 equiv of base, 1:1 cpme / h2o, 60 c, 18 h. after the analysis of the scope of the cross - coupling to include both b - alkyl- and b - aryl-2,1-borazaronaphthalenes, studies were directed toward accessing doubly cross - coupled products. addition of 2 equiv of 3-methoxyphenyltrifluoroborate to 3,6-dibromo-2-methyl-2,1-borazaronaphthalene (2v) provided the desired product in 97% isolated yield (eq 7).7 unfortunately, the cross - coupling was not selective upon addition of 1 equiv of potassium aryltrifluoroborate. therefore, to access doubly cross - coupled products utilizing different potassium (hetero)aryltrifluoroborates, the product of one cross - coupling had to be subjected to a second site - selective bromination. in the case of cross - coupling products 3a and 3b, the second bromination proceeded at the 6-position to yield 6-bromo-3-(3-methoxyphenyl)-2-methyl-2,1-borazaronaphthalene (9a) and 6-bromo-3-phenyl-2-methyl-2,1-borazaronaphthalene (9b), respectively, in moderate to good yields (eq 8). rather remarkably, the borazine was brominated effectively at its second most reactive site in the presence of the electron - rich methoxy - substituted arene.8 these brominated 2,1-borazaronaphthalenes reacted with an array of potassium (hetero)aryltrifluoroborates to provide access to highly substituted 2,1-borazaronaphthalenes (table 8). a 3,5-disubstituted aryltrifluoroborate reacted with 9a to provide the cross - coupled product 10a in 86% isolated yield (entry 1). heteroaryltrifluoroborates were also efficient nucleophiles for this reaction, as 3-thienyltrifluoroborate and 3-furyltrifluoroborate reacted with 9b to afford the desired products in 84% and 69% yield, respectively (entries 2 and 3). reaction conditions : 1.0 equiv of 6-bromo-3-aryl-2-methyl-2,1-borazaronaphthalene, 1.0 equiv of potassium (hetero)aryltrifluoroborate, 1 mol % t - bu3p - pd - g2, 3.0 equiv of base, 1:1 cpme / h2o, 60 c, 18 h. the overall impact of the approaches to borazine synthesis described herein can be appreciated by comparing these tactics to those utilized for the construction of various substituted naphthalenes. for example, the most convenient synthesis of 2,3-disubstituted naphthalenes provides the symmetrical products in good to excellent yields, but unsymmetrical naphthalenes would result in a mixture of products. the cross - coupling route described herein allows direct and site - specific installation of a (hetero)aryl unit at the c3 position, thus alleviating the limitation of obtaining regioisomeric products. in a similar scenario, the products of the cross - coupling of brominated n - substituted 2,1-borazaronaphthalenes are isosteric to 1,2,3-trisubstituted naphthalenes, whose synthesis often results in mixtures of regioisomers. in the case of the 2,1-borazaronaphthalenes, bromination and subsequent cross - coupling lastly, the products obtained using the 3,6-diaryl-2,1-borazaronaphthalenes are isosteres of 2,3,6-trisubstituted naphthalenes. there are currently no examples of naphthalenes with this substitution pattern, whereas the corresponding cross - couplings described herein allow the ready synthesis of such site - specific polysubstituted 2,1-borazaronaphthalenes in high yield. 2,1-borazaronaphthalenes undergo site - selective bromination at the 3-position, whereupon addition of a second equivalent of bromine allows access to 3,6-dibromo-2,1-borazaronaphthalenes. in this work furthermore, this cross - coupling easily builds molecular complexity within this family of azaborines. most of the research conducted on azaborines has primarily focused on their synthesis, with limited studies of their reactivity as isosteres of the all - carbon analogues. before this study, bromine and chlorine were the only two substituents reported at the 3-position of 2,1-borazaronaphthalene, and they were synthesized in low to moderate yields in the early 1960s. the methods described herein expand the substitution at the c3 position to include aryl and heteroaryl substituents. most importantly, however, the protocols developed demonstrate that 2,1-borazaronaphthalenes are stable toward palladium catalysis, thereby allowing access to highly functionalized molecules and opening the door to the exploration of azaborines in other transition - metal - catalyzed reactions. b nmr spectra were obtained on a spectrometer equipped with the appropriate decoupling accessories. all of the b nmr chemical shifts were referenced to external bf3oet2 (0.0 ppm), with a negative sign indicating an upfield shift. data are presented as follows : chemical shift (multiplicity, coupling constant, integration). chemical shifts () are reported in parts per million and coupling constants (j) in hertz. multiplicities are abbreviated as follows : s = singlet, d = doublet, t = triplet, m = multiplet, br = broad. analytical thin - layer chromatography (tlc) was performed on tlc silica gel plates (0.25 mm) precoated with a fluorescent indicator. hrms data were obtained by either esi or ci using a tof mass spectrometer 3-vinylphenylboronic acid, 4-naphthalene-1-ylphenylboronic acid, and 3-methoxy-5-methylphenylboronic are commercially available. h nmr (500 mhz, dmso - d6) 7.46 (br s, 1h), 7.3 (d, j = 6.8 hz, 1h), 7.18 (d, j = 7.1 hz, 1h), 7.137.10 (m, 1h), 6.726.67 (m, 1h), 5.70 (d, j = 17.9 hz, 1h), 5.14 (d, j = 10.8 hz, 1h). c nmr (125.8 mhz, dmso - d6) 138.7, 135.2, 131.8, 129.9, 126.9, 123.5, 112.2. ir (neat) 1322, 1260, 1056, 957, 794, 662 cm. hrms (esi) m / z calcd for c8h7bf3 [m k ] 171.0593, found 171.0586. h nmr (500 mhz, dmso - d6) 7.967.94 (m, 2h), 7.897.86 (m, 1h), 7.637.60 (m, 2h), 7.557.40 (m, 4h), 7.307.27 (m, 2h). c nmr (125.8 mhz, dmso - d6) 141.3, 137.2, 133.9, 131.9, 131.5, 128.6, 128.3, 127.3, 127.0, 126.3, 126.1, 126.0, 125.9. ir (neat) 3058, 2920, 1647, 1394, 1217, 773 cm. hrms (esi) m / z calcd for c16h11bf3 [m k ] 271.0906, found 271.0906. h nmr (500 mhz, acetone - d6) 6.94 (s, 1h), 6.89 (s, 1h), 6.48 (s, 1h), 3.69 (s, 3h), 2.22 (s, 3h). c nmr (125.8 mhz, acetone - d6) 158.8, 136.3, 124.8, 113.5, 112.1, 54.0, 20.7. ir (neat) 2918, 1588, 1321, 1287, 1021, 956, 850, 803 cm. hrms (esi) m / z calcd for c8h9bof3 [m k ] 189.0694, found 189.0693. 2,1-borazaronaphthalenes were synthesized according to the literature procedure. obtained as an off - white solid (130 mg, 21%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 9.74 (br s, 1h), 8.13 (d, j = 11.2 hz, 1h), 7.70 (d, j = 7.7 hz, 1h), 7.567.52 (m, 1h), 7.477.43 (m, 1h), 7.237.18 (m, 1h), 6.946.90 (m, 1h), 2.422.30 (m, 2h). c nmr (125.8 mhz, acetone - d6) 145.3, 140.3, 129.2, 128.4, 127.3 (q, j = 278 hz), 125.3, 121.1, 118.3. ir (neat) 3361, 2970, 1563, 1278, 1236, 1102, 1032, 768 cm. hrms (ci) m / z calcd for c10h9bnf3 [m ] 211.0780, found 211.0778. obtained as an off - white solid (650 mg, 76%, 5 mmol scale). h nmr (500 mhz, acetone - d6) 9.06 (br s, 1h), 8.01 (d, j = 11.5 hz, 1h), 7.6 (d, j = 7.6 hz, 1h), 7.537.49 (m, 1h), 7.407.35 (m, 1h), 7.137.09 (m, 1h), 6.876.82 (m, 1h), 1.561.48 (m, 1h), 1.181.11 (m, 6h). c nmr (125.8 mhz, acetone - d6) 144.5, 140.7, 128.9, 127.8, 125.2, 120.2, 118.2, 19.6. ir (neat) 3361, 2940, 1560, 1438, 1056, 1035, 761 cm. hrms (ci) m / z calcd for c11h14bn [m ] 171.1219, found 171.1223. obtained as an off - white solid (379 mg, 69%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 9.09 (br s, 1h), 8.02 (d, j = 11.5 hz, 1h), 7.61 (d, j = 7.8 hz, 1h), 7.517.48 (m, 1h), 7.397.35 (m, 1h), 7.147.09 (m, 1h), 6.906.85 (m, 1h), 2.472.40 (m, 1h), 2.272.11 (m, 5h), 2.072.00 (m, 1h). c nmr (125.8 mhz, acetone - d6) 144.5, 140.7, 128.9, 127.8, 125.2, 120.2, 118.0, 25.5, 22.1. ir (neat) 3363, 2960, 2934, 2858, 1560, 1438, 760 cm. hrms (ci) m / z calcd for c12h14bn [m ] 183.1219, found 183.1212. obtained as an off - white solid (834 mg, 71%, 5 mmol scale). h nmr (500 mhz, acetone - d6) 9.77 (br s, 1h), 8.18 (d, j = 11.5 hz, 1h), 7.707.66 (m, 2h), 7.637.60 (m, 2h), 7.467.42 (m, 1h), 7.397.35 (m, 1h), 7.317.27 (m, 1h), 7.217.17 (m, 1h), 7.006.97 (m, 1h), 3.85 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.6, 145.4, 141.0, 129.0, 129.0, 128.2, 125.6, 125.4, 120.7, 118.5, 118.1, 114.9, 54.4. ir (neat) 3368, 3051, 2406, 1566, 1250, 1039, 763 cm. hrms (ci) m / z calcd for c15h14bno [m ] 235.1168, found 235.1177. obtained as an off - white solid (569 mg, 56%, 3 mmol scale). h nmr (500 mhz, cdcl3) 8.15 (d, j = 11.2 hz, 1h), 7.73 (d, j = 7.6 hz, 1h), 7.407.36 (m, 2h), 7.317.28 (m, 1h), 7.237.20 (m, 1h), 7.177.11 (m, 3h), 7.097.01 (m, 4h), 6.926.88 (m, 1h), 5.43 (br s, 2h), 3.66 (s, 3h), 2.34 (s, 3h). c nmr (125.8 mhz, cdcl3) 162.2, 158.8, 145.3, 141.2, 136.6, 130.2, 129.3, 128.8, 128.5, 127.2, 125.6, 124.8, 120.9, 117.2, 117.0, 113.9, 54.8, 52.3, 21.0. ir (neat) 2995, 1548, 1415, 1255, 1225, 1028, 766 cm. hrms (ci) m / z calcd for c23h22bno [m ] 339.1794, found 339.1781. obtained as a yellow oil (285 mg, 52%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 7.91 (d, j = 11.2 hz, 1h), 7.64 (d, j = 7.8 hz, 1h), 7.527.59 (m, 1h), 7.467.42 (m, 1h), 7.177.14 (m, 1h), 6.816.78 (m, 1h), 6.086.02 (m, 1h), 5.09 (d, j = 10.5 hz, 1h), 4.91 (d, j = 17.4 hz, 1h), 4.704.68 (m, 2h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.0, 141.5, 134.7, 130.0, 128.1, 126.6, 120.2, 115.5, 114.6, 48.9. ir (neat) 3008, 1609, 1551, 1412, 1353, 1219, 757 cm. hrms (esi) m / z calcd for c12h14bn [m ] 183.1219, found 183.1215. obtained as a yellow oil (486 mg, 59%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 8.13 (d, j = 11.2 hz, 1h), 7.76 (d, j = 7.8 hz, 1h), 7.647.61 (m, 1h), 7.567.51 (m, 1h), 7.357.31 (m, 1h), 7.287.23 (m, 1h), 7.187.14 (m, 2h), 6.956.89 (m, 2h), 6.186.11 (m, 1h), 5.225.17 (m, 1h), 4.994.93 (m, 1h), 4.854.82 (m, 2h), 3.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.1, 145.2, 141.0, 136.1, 130.1, 128.7, 128.5, 127.0, 124.3, 121.0, 117.3, 116.7, 114.9, 113.3, 54.3, 50.3. ir (neat) 3009, 2939, 2830, 1549, 1413, 1281, 1049, 764 cm. hrms (esi) m / z calcd for c18h19bno [m + h ] 276.1560, found 276.1564. obtained as a white solid (585 mg, 54%, 3 mmol scale). h nmr (500 mhz, cdcl3) 8.338.30 (m, 1h), 7.897.72 (m, 5h), 7.557.35 (m, 6h), 7.287.19 (m, 3h), 5.53 (s, 2h). c nmr (125.8 mhz, cdcl3) 146.3, 141.3, 139.2, 132.9, 132.5 (q, j = 226 hz), 130.8, 130.2 (d, j = 32 hz), 129.2, 127.8, 127.4, 125.9, 124.6 (d, j = 3 hz), 123.8, 121.8, 117.4, 52.8. ir (neat) 2923, 1551, 1233, 859, 762, 682, 632 cm. hrms (ci) m / z calcd for c22h17bnf3 [m ] 363.1406, found 363.1403. obtained as a white solid (700 mg, 68%, 3 mmol scale). h nmr (500 mhz, cdcl3) 8.19 (d, j = 11.5 hz, 1h), 7.77 (d, j = 7.3 hz, 1h), 7.607.57 (m, 2h), 7.467.41 (m, 2h), 7.287.25 (m, 1h), 7.117.09 (m, 5h), 6.926.90 (m, 2h), 5.43 (s, 2h), 3.83 (s, 3h). c nmr (125.8 mhz, cdcl3) 163.1 (d, j = 245 hz), 158.5, 145.5, 141.2, 134.5 (d, j = 7 hz), 131.02, 130.3, 128.6, 127.3, 126.7, 121.1, 117.1, 114.7 (d, j = 20 hz), 114.3, 55.2, 51.8. ir (neat) 3027, 1550, 1414, 1234, 787, 761, 731 cm. hrms (ci) m / z calcd for c22h19bnof [m ] 343.1544, found 343.1540. to a flame - dried 100 ml round - bottom flask with a stir bar was added the corresponding 2,1-borazaronaphthalene (2.0 mmol). the flask was sealed with a rubber septum, evacuated under vacuum, and purged with ar three times. anhydrous ch2cl2 (10 ml) was added, and the flask was cooled to 0 c. bromine (352 mg, 2.2 mmol, 1.1 equiv) in ch2cl2 (10 ml) was added under ar at a rate of 1.1 mmol / h. the reaction was monitored by tlc, and when it was complete (usually after warming to rt), the reaction mixture was concentrated in vacuo. the crude 2,1-borazaronaphthalene was purified by flash column chromatography with 030% ch2cl2/hexane as the eluent to provide the desired 3-bromo-2,1-borazaronaphthalene. obtained as an off - white solid (1969 mg, 99%, 9 mmol scale). h nmr (500 mhz, acetone - d6) 9.63 (br s, 1h), 8.29 (s, 1h), 7.62 (d, j = 7.8 hz, 1h), 7.477.42 (m, 2h), 7.177.14 (m, 1h), 0.79 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.3, 140.2, 128.6, 128.55, 124.9, 121.2, 118.2. ir (neat) 3361, 2940, 1560, 1438, 1056, 1035, 761 cm. hrms (ci) m / z calcd for c9h9brbn [m ] 221.0011, found 221.0019. obtained as an off - white solid (138 mg, 96%, 0.5 mmol scale). h nmr (500 mhz, acetone - d6) 9.87 (br s, 1h), 8.44 (s, 1h), 7.717.64 (m, 2h), 7.537.49 (m, 1h), 7.267.23 (m, 1h), 2.555.49 (m, 2h). c nmr (125.8 mhz, acetone - d6) 146.2, 139.5, 129.3, 128.8, 128.7 (q, j = 274 hz), 125.2, 122.3, 118.8. ir (neat) 3361, 2970, 1563, 1278, 1236, 1102, 1032, 768 cm. hrms (ci) m / z calcd for c10h8brbnf3 [m ] 288.9885, found 288.9884. obtained as an off - white solid (488 mg, 98%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 9.26 (br s, 1h), 8.33 (s, 1h), 7.657.57 (m, 2h), 7.457.41 (m, 1h), 7.207.15 (m, 1h), 1.851.80 (m, 1h), 1.191.15 (m, 6h). c nmr (125.8 mhz, acetone - d6) 145.5, 140.1, 128.6, 128.5, 125.0, 121.4, 118.5, 18.6. ir (neat) 3373, 2956, 2852, 1610, 1558, 1424, 1137, 849, 757 cm. hrms (ci) m / z calcd for c11h13brbn [m ] 249.0324, found 249.0330. obtained as an off - white solid (689 mg, 93%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 8.87 (br s, 1h), 8.28 (s, 1h), 7.617.58 (m, 1h), 7.467.42 (m, 1h), 7.417.38 (m, 1h), 7.147.10 (m, 1h), 0.880.86 (m, 2h), 0.850.82 (m, 2h), 0.770.73 (m, 1h). c nmr (125.8 mhz, acetone - d6) 144.6, 140.3, 128.6, 128.5, 124.7, 121.0, 118.1, 6.1. ir (neat) 3374, 2954, 1557, 1428, 1105, 925, 848, 748 cm. hrms (ci) m / z calcd for c11h11brbn [m ] 247.0168, found 247.0159. obtained as an off - white solid (506 mg, 97%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 9.33 (br s, 1h), 8.28 (s, 1h), 7.647.60 (m, 2h), 7.467.42 (m, 1h), 7.197.15 (m, 1h), 2.652.61 (m, 1h), 2.262.15 (m, 5h), 1.971.93 (m, 1h). c nmr (125.8 mhz, acetone - d6) 145.0, 140.0, 128.6, 128.5, 125.0, 121.4, 118.5, 25.0, 21.8. ir (neat) 3353, 2979, 1612, 1557, 1428, 1205, 927, 757 cm. hrms (ci) m / z calcd for c12h13brbn [m ] 261.0324, found 261.0330. obtained as an off - white solid (886 mg, 95%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 8.34 (s, 1h), 7.657.63 (m, 1h), 7.407.33 (m, 2h), 7.237.12 (m, 6h), 5.38 (s, 2h), 0.97 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.8, 140.6, 138.0, 129.5, 128.8, 128.6, 127.0, 126.0, 125.7, 121.3, 116.3, 51.6. ir (neat) 2917, 1608, 1359, 1028, 753, 735, 722, 697 cm. hrms (ci) m / z calcd for c16h15brbn [m ] 311.0481, found 311.0490. obtained as a yellow oil (781 mg, 98%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 8.25 (s, 1h), 7.62 (d, j = 7.8 hz, 1h), 7.48 (d, j = 3.4 hz, 2h), 7.207.16 (m, 1h), 6.086.00 (m, 1h), 5.135.08 (m, 1h), 4.944.90 (m, 1h), 4.744.72 (m, 2h), 0.92 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.5, 140.5, 134.1, 129.5, 128.7, 125.8, 121.1, 115.9, 115.0, 50.0. ir (neat) 3031, 1607, 1362, 1216, 913, 760, 741 cm. hrms (ci) m / z calcd for c12h13bbrn [m ] 261.0324, found 261.0330. obtained as an off - white solid (840 mg, 99%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 9.90 (br s, 1h), 8.54 (s, 1h), 7.957.92 (m, 2h), 7.757.71 (m, 2h), 7.547.51 (m, 1h), 7.457.40 (m, 3h), 7.277.23 (m, 1h). c nmr (125.8 mhz, acetone - d6) 146.7, 140.1, 133.5, 128.9, 128.8, 128.5, 127.4, 124.9, 121.6, 118.6. ir (neat) 3371, 3052, 1552, 1420, 1009, 761, 748, 702 cm. hrms (ci) m / z calcd for c14h11brbn [m ] 283.0168, found 283.0174. obtained as an off - white solid (325 mg, 52%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 9.87 (br s, 1h), 8.54 (s, 1h), 7.727.69 (m, 2h), 7.537.48 (m, 3h), 7.377.34 (m, 1h), 7.267.23 (m, 1h), 7.016.97 (m, 1h), 3.84 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.0, 146.8, 140.1, 128.9, 128.6, 128.5, 125.8, 124.9, 121.7, 119.0, 118.6, 114.4, 54.5. ir (neat) 3323, 2970, 2933, 1557, 1427, 1252, 1047, 791 cm. hrms (ci) m / z calcd for c15h14bbrno [m + h ] 314.0352, found 314.0341. obtained as an off - white solid (274 mg, 91%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 9.89 (br s, 1h), 8.50 (s, 1h), 7.997.96 (m, 2h), 7.697.66 (m, 2h), 7.527.49 (m, 1h), 7.247.18 (m, 3h). c nmr (125.8 mhz, acetone - d6) 163.6 (d, j = 246 hz), 146.8, 140.1, 135.9 (d, j = 7.5 hz), 128.9, 128.5, 124.9, 121.7, 118.6, 114.3 (d, j = 20.2 hz). ir (neat) 3376, 3055, 1615, 1593, 1425, 1214, 800, 757 cm. hrms (ci) m / z calcd for c14h10bbrfn [m ] 301.0074, found 301.0080. obtained as a light - brown solid (305 mg, 53%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 9.91 (br s, 1h), 8.52 (s, 1h), 8.358.32 (m, 1h), 7.83 (d, j = 4.9 hz, 1h), 7.70 (d, j = 8.1 hz, 1h), 7.66 (d, j = 8.1 hz, 1h), 7.577.54 (m, 1h), 7.537.48 (m, 1h), 7.257.20 (m, 1h). c nmr (125.8 mhz, acetone - d6) 146.8, 140.0, 133.7, 132.0, 128.9, 128.5, 124.8, 124.7, 121.5, 118.4. ir (neat) 3749, 2977, 2349, 1557, 758 cm. hrms (ci) m / z calcd for c12h10bbrns [m + h ] 289.9810, found 289.9810. obtained as an off - white solid (663 mg, 89%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 10.33 (br s, 1h), 8.66 (s, 1h), 8.188.13 (m, 2h), 7.96 (d, j = 7.3 hz, 1h), 7.82 (d, j = 7.9 hz, 1h), 7.787.76 (m, 1h), 7.637.57 (m, 2h), 7.537.47 (m, 2h), 7.417.38 (m, 1h), 7.347.31 (m, 1h). c nmr (125.8 mhz, acetone - d6) 159.0, 156.0, 147.0, 140.0, 133.2, 129.3, 128.9, 127.3, 125.3, 124.3, 123.2, 123.0, 122.6, 122.2, 121.8, 120.9, 119.0, 111.8. ir (neat) 3382, 3036, 1567, 1185, 748, 726 cm. hrms (ci) m / z calcd for c20h13bbrno [m ] 373.0274, found 373.0276. obtained as a white solid (513 mg, 53%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 8.51 (s, 1h), 7.787.74 (m, 1h), 7.637.56 (m, 2h), 7.507.47 (m, 2h), 7.437.37 (m, 3h), 7.337.28 (m, 1h), 6.035.96 (m, 1h), 5.13 (d, j = 10.5 hz, 1h), 4.944.90 (m, 1h), 4.734.71 (m, 2h). c nmr (125.8 mhz, acetone - d6) 146.1, 140.0, 135.0, 131.4, 129.6, 129.0, 127.8, 127.4, 126.4, 121.9, 117.1, 115.3, 51.4. ir (neat) 2979, 1607, 1586, 1544, 1368, 1245, 965, 701 cm. hrms (esi) m / z calcd for c17h15brbn [m ] 323.0481, found 323.0494. obtained as a yellow oil (324 mg, 46%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 8.52 (s, 1h), 7.807.78 (m, 1h), 7.647.55 (m, 2h), 7.347.30 (m, 2h), 7.066.94 (m, 2h), 6.966.93 (m, 1h), 6.056.00 (m, 1h), 5.175.13 (m, 1h), 4.954.92 (m, 1h), 4.764.73 (m, 2h), 3.80 (s, 3h). c nmr (125.8 mhz, acetone - d6) 158.9, 146.1, 140.0, 135.2, 129.6, 129.0, 128.7, 126.4, 123.5, 121.9, 117.0, 116.8, 115.2, 113.2, 54.3, 51.4. ir (neat) 2953, 1644, 1545, 1366, 1282, 1048, 763 cm. hrms (esi) m / z calcd for c18h18brbno [m + h ] 354.0665, found 354.0657. obtained as an off - white solid (710 mg, 95%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 8.58 (br s, 1h), 7.79 (d, j = 7.6 hz, 1h), 7.497.41 (m, 4h), 7.367.30 (m, 3h), 7.287.23 (m, 3h), 7.207.17 (m, 1h), 7.147.09 (m, 2h), 5.39 (s, 2h). c nmr (125.8 mhz, acetone - d6) 146.4, 140.0, 138.4, 131.5, 129.7, 129.0, 128.6, 127.9, 127.5, 126.8, 126.7, 125.5, 122.0, 117.5, 53.0. ir (neat) 3025, 1606, 1545, 1367, 1355, 1243, 971, 763, 723, 703 cm. hrms (ci) m / z calcd for c21h17brbn [m ] 373.0637, found 373.0638. obtained as an off - white solid (211 mg, 48%, 1 mmol scale). h nmr (500 mhz, acetone - d6) 8.61 (s, 1h), 7.81 (d, j = 7.9 hz, 1h), 7.717.67 (m, 4h), 7.467.42 (m, 2h), 7.297.25 (m, 3h), 7.217.18 (m, 1h), 7.137.11 (m, 2h), 5.36 (s, 2h). c nmr (125.8 mhz, acetone - d6) 147.0, 140.1, 138.3, 132.3, 130.1, 129.8, 129.5 (q, j = 4 hz), 128.9, 128.0, 127.3, 127.1, 127.0 (q, j = 272 hz), 125.8, 122.5, 117.7, 53.4. ir (neat) 3029, 1546, 1323, 1122, 834, 725 cm. hrms (ci) m / z calcd for c22h16brbf3n [m ] 441.0511, found 441.0511. obtained as an off - white solid (207 mg, 49%, 1 mmol scale). h nmr (500 mhz, acetone - d6) 8.56 (s, 1h), 7.78 (d, j = 7.8 hz, 1h), 7.537.41 (m, 4h), 7.277.24 (m, 1h), 7.137.10 (m, 2h), 7.047.00 (m, 2h), 6.876.85 (m, 2h), 5.31 (s, 2h), 3.71 (s, 3h). c nmr (125.8 mhz, acetone - d6) 162.8 (d, j = 245 hz), 158.8, 146.4, 140.0, 133.7 (d, j = 8 hz), 130.0, 129.7, 129.0, 126.7, 126.6, 122.0, 117.5, 114.3 (d, j = 20 hz), 114.0, 54.5, 52.4. ir (neat) 2971, 1550, 1414, 1234, 762, 625 cm. hrms (ci) m / z calcd for c22h18brbnof [m ] 421.0649, found 421.0654. obtained as an off - white solid (237 mg, 25%, 2.5 mmol scale). h nmr (500 mhz, acetone - d6) 8.56 (s, 1h), 7.817.80 (m, 1h), 7.567.54 (m, 1h), 7.507.48 (m, 1h), 7.467.41 (m, 2h), 7.327.29 (m, 2h), 7.277.21 (m, 3h), 7.167.14 (m, 2h), 5.44 (s, 2h). c nmr (125.8 mhz, acetone - d6) 146.3, 138.6, 131.7, 131.0, 129.7, 129.6, 129.0, 128.7, 126.9, 126.6, 125.5, 124.8, 122.0, 117.4, 53.2. ir (neat) 2958, 1733, 1540, 758, 719 cm. hrms (ci) m / z calcd for c19h15brbns [m ] 379.0202, found 379.0208. obtained as an off - white solid (337 mg, 81%, 1 mmol scale). h nmr (500 mhz, acetone - d6) 8.57 (s, 1h), 7.79 (d, j = 7.8 hz, 1h), 7.477.42 (m, 2h), 7.297.26 (m, 2h), 7.107.05 (m, 2h), 7.037.00 (m, 4h), 6.906.87 (m, 1h), 5.35 (s, 2h), 3.66 (s, 3h), 2.24 (s, 3h). c nmr (125.8 mhz, acetone - d6) 158.9, 146.4, 140.0, 136.3, 135.5, 129.6, 129.2, 129.0, 128.7, 126.7, 125.5, 123.5, 121.9, 117.5, 116.7, 113.4, 54.2, 52.8, 20.0. ir (neat) 3048, 1406, 1336, 1313, 1094, 875, 792, 704 cm. hrms (ci) m / z calcd for c23h21brbno [m ] 417.0900, found 417.0913. obtained as a yellow oil (83 mg, 29%, 1 mmol scale). h nmr (500 mhz, acetone - d6) 9.96 (br s, 1h), 8.40 (s, 1h), 7.66 (d, j = 8.1 hz, 1h), 7.597.57 (m, 1h), 7.507.47 (m, 1h), 7.227.19 (m, 1h), 2.40 (t, j = 6.8 hz, 2h), 1.591.49 (m, 4h), 0.950.90 (m, 3h). c nmr (500 mhz, acetone - d6) 145.1, 139.6, 128.8, 128.5, 124.7, 121.6, 118.1, 109.5, 30.5, 21.5, 19.1, 12.9. ir (neat) 3649, 2956, 2931, 1613, 1556, 997, 799, 759 cm. hrms (ci) m / z calcd for c14h15bnbr [m ] 287.0481, found 287.0481. obtained as a white solid (50 mg, 77%, 0.2 mmol scale). h nmr (500 mhz, cdcl3) 8.25 (s, 1h), 7.477.44 (m, 1h), 7.347.31 (m, 2h), 7.287.25 (m, 1h), 7.147.10 (m, 3h), 7.006.97 (m, 1h), 5.35 (s, 2h), 2.34 (s, 3h), 1.00 (s, 3h). c nmr (500 mhz, cdcl3) 144.5, 140.8, 138.9, 137.8, 129.2, 128.7, 127.0, 125.7, 123.9, 122.6, 116.2, 51.9, 22.1. ir (neat) 2926, 1590, 1452, 1364, 809, 685 cm. hrms (ci) m / z calcd for c17h17bnbr [m ] 325.0637, found 325.0647. obtained as a white solid (24 mg, 64%, 0.1 mmol scale). h nmr (500 mhz, cdcl3) 8.17 (s, 1h), 7.317.22 (m, 3h), 7.157.11 (m, 2h), 6.93 (s, 1h), 6.73 (s, 1h), 5.31 (s, 2h), 3.89 (s, 3h), 3.67 (s, 3h), 1.01 (s, 3h). c nmr (500 mhz, cdcl3) 150.3, 144.4, 140.1, 138.1, 136.2, 129.1, 127.5, 126.0, 119.7, 110.0, 55.2, 55.9, 52.9. ir (neat) 2924, 1258, 1029, 823, 810, 751, 687, 609 cm. hrms (ci) m / z calcd for c18h19bno2br [m ] 371.0692, found 371.0683. obtained as an off - white solid (221 mg, 34%, 2 mmol scale). h nmr (500 mhz, acetone - d6) 9.60 (br s, 1h), 8.13 (d, j = 11.6 hz, 1h), 7.697.67 (m, 1h), 7.517.43 (m, 2h), 7.217.17 (m, 1h), 6.936.91 (m, 1h), 4.914.85 (m, 1h), 4.23 (d, j = 10.7 hz, 1h), 1.98 (d, j = 6.4 hz, 3h). c nmr (500 mhz, acetone - d6) 145.9, 139.7, 129.2, 128.4, 125.5, 121.2, 118.4, 50.5, 25.4. ir (neat) 3360, 2978, 1614, 1562, 1441, 760 cm. hrms (ci) m / z calcd for c11h13bbr2n [m + h ] 327.9508, found 327.9509. obtained as an off - white solid (167 mg, 51%, 1 mmol scale). h nmr (500 mhz, acetone - d6) 9.47 (br s, 1h), 7.72 (s, 1h), 7.66 (d, j = 7.6 hz, 1h), 7.557.51 (m, 2h), 7.447.41 (m, 1h), 7.177.14 (m, 1h), 6.906.87 (m, 1h), 6.826.80 (m, 1h), 3.80 (s, 3h), 0.65 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.3, 147.1, 141.6, 140.8, 133.0, 129.5, 128.5, 124.6, 120.8, 117.9, 115.7, 113.7, 113.4, 55.1. ir (neat) 3382, 2987, 1616, 1457, 1345, 122, 1014, 759 cm. hrms (ci) m / z calcd for c16h16bbrno [m + h ] 328.0508, found 328.0518. obtained as an off - white solid (240 mg, 81%, 1 mmol scale). h nmr (500 mhz, acetone - d6) 9.58 (br s, 1h), 7.867.83 (m, 2h), 7.517.48 (m, 1h), 7.447.38 (m, 5h), 7.307.28 (m, 1h), 0.88 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.6, 140.1, 139.4, 131.3, 130.6, 128.3, 128.2, 126.8, 126.3, 119.7, 112.6. ir (neat) 3350, 2961, 1606, 1439, 1313, 821, 702 cm. hrms (ci) m / z calcd for c15h13bbrn [m ] 297.0324, found 297.0330. to a flame - dried 100 ml round - bottom flask with a stir bar was added the corresponding 2,1-borazaronaphthalene (2.0 mmol). the flask was sealed with a rubber septum, evacuated under vacuum, and purged with ar three times. anhydrous ch2cl2 was added (10 ml), and the flask was cooled to 0 c. bromine (703 mg, 4.4 mmol, 2.2 equiv) in ch2cl2 (10 ml) was added under ar at a rate of 1.1 mmol / h. after the addition, the reaction mixture was slowly warmed to rt. the reaction was monitored by tlc, and when it was complete (usually after warming to rt), the reaction mixture was concentrated in vacuo. the crude 2,1-borazaronaphthalene was purified by flash column chromatography with 030% ch2cl2/hexane as the eluent to provide the desired 3,6-dibromo-2,1-borazaronaphthalene. obtained as an off - white solid (822 mg, 92%, 3 mmol scale). h nmr (500 mhz, acetone - d6) 9.70 (br s, 1h), 8.268.22 (m, 1h), 7.77 (s, 1h), 7.527.50 (m, 1h), 7.407.38 (m, 1h), 0.78 (s, 3h). c nmr (125.8 mhz, acetone - d6) 143.2, 139.1, 131.2, 130.5, 126.4, 120.2, 113.1. ir (neat) 3350, 2961, 1554, 1423, 1195, 911, 861, 811 cm. hrms (ci) m / z calcd for c9h8br2bn [m ] 298.9117, found 298.9125. in a biotage microwave vial equipped with a stir bar were successively introduced t - bu3p - pd - g2 (3.8 mg, 7.5 mol, 1 mol %), potassium (hetero)aryltrifluoroborate (0.75 mmol, 1 equiv), 3-bromo-2-methyl-2,1-borazaronaphthalene (167 mg, 0.75 mmol, 1 equiv), and cs2co3 (731 mg, 2.25 mmol, 3 equiv). the vial was sealed with a cap lined with a disposable teflon septum, evacuated under vacuum, and purged with ar three times. degassed cpme (0.75 ml) and degassed h2o (0.75 ml) were added under ar. the resulting mixture was heated at 60 c and stirred for 18 h. after cooling to rt, the vial was uncapped, and the reaction mixture was diluted with etoac (3 ml) and h2o (3 ml). the reaction mixture was extracted with etoac (3 3 ml) and dried (mgso4). the solvent was removed in vacuo, and the product was purified by rapid flash column chromatography on silica gel or neutral alumina using 0 to 20% ch2cl2/hexane as the eluent for most 2,1-borazaronaphthalenes. the cross - couplings for tables 58 were completed on a 0.5 mmol scale. h nmr (500 mhz, acetone - d6) 9.41 (br s, 1h), 7.91 (s, 1h), 7.69 (d, j = 7.69 hz, 1h), 7.517.45 (m, 3h), 7.437.40 (m, 3h), 7.307.27 (m, 1h), 7.177.14 (m, 1h), 0.84 (s, 3h). c nmr (125.8 mhz, acetone - d6) 145.0, 141.2, 140.3, 129.3, 128.1, 128.0, 127.9, 125.8, 125.0, 120.5, 117.5. ir (neat) 3373, 3054, 1613, 1563, 1454, 1421, 756, 700 cm. hrms (ci) m / z calcd for c15h14bn [m ] 219.1219, found 219.1223. h nmr (500 mhz, acetone - d6) 9.43 (br s, 1h), 7.93 (s, 1h), 7.69 (d, j = 7.6 hz, 1h), 7.49 (d, j = 8.3 hz, 1h), 7.427.38 (m, 1h), 7.347.30 (m, 1h), 7.177.13 (m, 1h), 7.047.00 (m, 2h), 6.886.85 (m, 1h), 3.83 (s, 3h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.7, 146.5, 141.1, 140.3, 129.3, 129.0, 127.9, 124.9, 120.5, 120.5, 117.5, 113.7, 111.3, 54.5. ir (neat) 3346, 3001, 1573, 1461, 1225, 1019, 753 cm. hrms (ci) m / z calcd for c16h16bno [m ] 249.1325, found 249.1325. obtained as a yellow oil (176 mg, 94%). h nmr (500 mhz, acetone - d6) 9.28 (br s, 1h), 7.76 (s, 1h), 7.64 (d, j = 7.6 hz, 1h), 7.48 (d, j = 8.3 hz, 1h), 7.407.37 (m, 1h), 7.297.26 (m, 1h), 7.217.19 (m, 1h), 7.147.11 (m, 1h), 7.016.98 (m, 2h), 3.74 (s, 3h), 0.62 (s, 3h). c nmr (125.8 mhz, acetone - d6) 156.5, 141.0, 140.3, 134.4, 129.5, 129.0, 127.6, 127.5, 125.0, 120.4, 120.3, 117.5, 110.4, 54.5. ir (neat) 3372, 2997, 2939, 2832, 1596, 1458, 1417, 1220, 759, 750, 702 cm. hrms (ci) m / z calcd for c16h16bno [m ] 249.1325, found 249.1317. reaction performed with a concentration of 0.1 m. obtained as an off - white solid (173 mg, 67%). h nmr (500 mhz, acetone - d6) 9.49 (br s, 1h), 8.038.01 (m, 2h), 8.007.98 (m, 1h), 7.977.95 (m, 1h), 7.737.71 (m, 1h), 7.607.57 (m, 2h), 7.537.45 (m, 8h), 7.177.15 (m, 1h), 0.91 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.1, 141.4, 140.4, 140.1, 138.2, 134.0, 131.6, 129.8, 129.7, 129.3, 128.3, 128.1, 128.0, 127.5, 126.8, 126.0, 125.7, 125.6, 125.4, 125.0, 120.6, 117.5. ir (neat) 3375, 3051, 1614, 1565, 1425, 1220, 844, 800, 777, 759 cm. hrms (ci) m / z calcd for c25h20bn [m ] 345.1689, found 345.1690. h nmr (500 mhz, acetone - d6) 9.41 (br s, 1h), 7.88 (s, 1h), 7.67 (d, j = 7.8 hz, 1h), 7.48 (d, j = 7.48 hz, 1h), 7.407.37 (m, 1h), 7.357.33 (m, 2h), 7.217.19 (m, 2h), 7.157.12 (m, 1h), 2.35 (s, 3h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 142.0, 140.7, 140.2, 135.1, 129.2, 128.7, 127.9, 127.7, 125.0, 120.5, 117.5, 20.2. ir (neat) 3383, 3022, 2938, 1613, 1566, 1454, 1425, 879, 822, 759, 749 cm. hrms (ci) m / z calcd for c16h16bn [m ] 233.1376, found 233.1374. obtained as a yellow oil (187 mg, 93%). h nmr (500 mhz, acetone - d6) 9.55 (br s, 1h), 7.93 (d, j = 8.1 hz, 1h), 7.87 (s, 1h), 7.847.82 (m, 1h), 7.78 (d, j = 8.6 hz, 1h), 7.707.76 (m, 1h), 7.597.55 (m, 1h), 7.547.51 (m, 1h), 7.497.44 (m, 2h), 7.417.37 (m, 1h), 7.347.31 (m, 1h), 7.207.16 (m, 1h), 0.49 (s, 3h). c nmr (125.8 mhz, acetone - d6) 143.4, 142.3, 140.6, 133.8, 131.8, 129.2, 128.1, 128.0, 127.7, 136.4, 126.3, 125.7, 125.5, 125.4, 125.3, 124.8, 120.6, 117.7. ir (neat) 3369, 3053, 2980, 1613, 1566, 1421, 777, 759 cm. hrms (ci) m / z calcd for c19h16bn [m ] 269.1376, found 269.1368. h nmr (500 mhz, acetone - d6) 9.50 (br s, 1h), 8.04 (s, 1h), 7.957.85 (m, 4h), 7.747.71 (m, 1h), 7.677.64 (m, 1h), 7.547.51 (m, 1h), 7.507.41 (m, 3h), 7.197.16 (m, 1h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 142.7, 141.6, 140.4, 133.8, 132.1, 129.3, 128.0, 127.8, 127.7, 127.5, 127.3, 126.1, 125.9, 125.7, 125.2, 125.0, 120.1, 117.6. ir (neat) 3366, 3053, 2979, 1561, 1308, 758, 744 cm. hrms (ci) m / z calcd for c19h16bn [m ] 269.1376, found 269.1372. obtained as a yellow oil (128 mg, 71%). h nmr (500 mhz, acetone - d6) 9.45 (br s, 1h), 7.93 (s, 1h), 7.737.69 (m, 1h), 7.567.47 (m, 2h), 7.447.34 (m, 4h), 7.177.13 (m, 1h), 6.866.80 (m, 1h), 5.86 (d, j = 17.4 hz, 1h), 5.25 (d, j = 10.8 hz, 1h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 145.3, 141.2, 140.3, 137.4, 137.2, 129.2, 128.2, 127.9, 127.7, 125.9, 124.9, 123.6, 120.5, 117.5, 113.0. ir (neat) 2917, 2848, 1596, 1422, 1161, 1036, 761 cm. hrms (ci) m / z calcd for c16h16bno [m ] 249.1325, found 249.1325. obtained as a yellow oil (174 mg, 73%). h nmr (500 mhz, acetone - d6) 9.53 (br s, 1h), 8.00 (s, 1h), 7.72 (d, j = 7.6 hz, 1h), 7.517.48 (m, 1h), 7.467.42 (m, 1h), 7.34 (s, 1h), 7.26 (s, 1h), 7.197.15 (m, 2h), 3.93 (s, 3h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 160.0, 147.7, 142.0, 140.1, 130.9 (q, j = 32 hz), 129.5, 128.4, 126.6 (q, j = 260 hz), 124.6, 120.6, 117.6, 117.4, 116.8 (q, j = 3.7 hz), 107.9 (q, j = 3.7 hz), 55.0. ir (neat) 3378, 2940, 2842, 1598, 1354, 1121, 1057, 759, 692 cm. hrms (ci) m / z calcd for c17h15bnof3 [m ] 317.1199, found 317.1207. h nmr (500 mhz, acetone - d6) 9.56 (br s, 1h), 8.26 (s, 1h), 8.13 (d, j = 7.8 hz, 1h), 8.00 (s, 1h), 7.85 (d, j = 7.6 hz, 1h), 7.72 (d, j = 7.8 hz, 1h), 7.677.64 (m, 1h), 7.517.48 (m, 1h), 7.477.42 (m, 1h), 7.187.15 (m, 1h), 0.80 (s, 3h). c nmr (125.8 mhz, acetone - d6) 148.4, 146.7, 142.5, 140.6, 134.4, 129.6, 129.3, 128.6, 124.5, 122.3, 120.7, 120.5, 117.6. ir (neat) 3376, 3054, 2967, 1609, 1579, 1417, 1253, 879, 759, 749, 698 cm. hrms (ci) m / z calcd for c15h13bn2o2 [m ] 264.1070, found 264.1080. obtained as a yellow oil (182 mg, 88%). h nmr (500 mhz, acetone - d6) 9.45 (br s, 1h), 8.18 (s, 1h), 7.93 (s, 2h), 7.737.69 (m, 2h), 7.527.47 (m, 2h), 7.447.42 (m, 1h), 7.177.13 (m, 1h), 3.90 (s, 3h), 0.80 (s, 3h). c nmr (125.8 mhz, acetone - d6) 166.6, 145.3, 141.7, 140.5, 132.6, 130.2, 129.4, 128.9, 128.3, 128.2, 126.7, 124.8, 120.6, 117.6, 51.4. ir (neat) 3354, 3051, 2949, 1711, 1567, 1436, 1306, 756 cm. hrms (esi) m / z calcd for c17h17bno2 [m + h ] 278.1352, found 278.1342. obtained as a yellow oil (160 mg, 90%). h nmr (500 mhz, acetone - d6) 9.48 (br s, 1h), 7.93 (s, 1h), 7.69 (d, j = 7.6 hz, 1h), 7.49 (d, j = 8.1 hz, 1h), 7.437.40 (m, 2h), 7.277.24 (m, 1h), 7.207.13 (m, 2h), 7.057.02 (m, 1h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 163.8 (d, j = 248 hz), 147.6 (d, j = 7.6 hz), 141.7, 140.5, 129.70 (d, j = 8.8 hz), 129.3, 128.2, 124.7, 120.1 (d, j = 2.5 hz), 120.6, 117.6, 116.5 (d, j = 20.1 hz), 112.3 (d, j = 11.2 hz). ir (neat) 3376, 3054, 2967, 1609, 1579, 1417, 1253, 879, 759, 749, 698 cm. hrms (ci) m / z calcd for c15h13bnf [m ] 237.1125, found 237.1120. obtained as an off - white solid (156 mg, 88%). h nmr (500 mhz, acetone - d6) 9.54 (br s, 1h), 7.95 (s, 1h), 7.737.69 (m, 3h), 7.637.61 (m, 2h), 7.527.49 (m, 1h), 7.457.42 (m, 1h), 7.177.14 (m, 1h), 0.80 (s, 3h). c nmr (125.8 mhz, acetone - d6) 149.2, 142.2, 140.6, 129.5, 128.6, 128.5, 127.3 (q, j = 32 hz), 124.8 (q, j = 276 hz), 124.9 (q, j = 3.8 hz), 123.7, 120.7, 117.6. ir (neat) 3346, 3030, 1614, 1334, 1325, 110, 1071, 762, 755 cm. hrms (ci) m / z calcd for c16h13bnf3 [m ] 287.1093, found 287.1093. obtained as an off - white solid (145 mg, 79%). h nmr (500 mhz, acetone - d6) 9.59 (br s, 1h), 8.00 (s, 1h), 7.81 (s, 1h), 7.787.73 (m, 2h), 7.707.67 (m, 1h), 7.657.60 (m, 1h), 7.527.49 (m, 1h), 7.467.43 (m, 1h), 7.177.14 (m, 1h), 0.79 (s, 3h). c nmr (125.8 mhz, acetone - d6) 146.3, 142.3, 140.6, 132.7, 131.3, 129.5, 129.3, 129.2, 128.5, 124.6, 120.7, 118.7, 117.6, 112.1. ir (neat) 3338, 2980, 1558, 1260, 1088, 945, 793 cm. hrms (ci) m / z calcd for c16h13bn2 [m ] 244.1172, found 244.1174. obtained as an off - white solid (150 mg, 56%). h nmr (500 mhz, acetone - d6) 9.42 (br s, 1h), 8.20 (d, j = 8.3 hz, 1h), 7.94 (s, 1h), 7.707.67 (m, 1h), 7.667.64 (m, 2h), 7.507.48 (m, 1h), 7.447.38 (m, 2h), 7.167.13 (m, 1h), 6.696.67 (m, 1h), 1.69 (s, 9h), 0.83 (s, 3h). c nmr (125.8 mhz, acetone - d6) 149.4, 141.0, 140.2, 139.7, 133.8, 130.8, 129.1, 127.7, 126.0, 125.0, 124.8, 120.5, 120.0, 117.5, 114.5, 107.4, 83.3, 27.3. ir (neat) 3375, 2976, 1730, 1370, 1160, 1134, 759, 749, 727 cm. hrms (ci) m / z calcd for c22h23bn2o2 [m ] 358.1853, found 358.1856. obtained as an off - white solid (145 mg, 86%). h nmr (500 mhz, acetone - d6) 9.41 (br s, 1h), 8.10 (s, 1h), 7.677.64 (m, 1h), 7.477.44 (m, 2h), 7.407.37 (m, 3h), 7.167.13 (m, 1h), 0.90 (s, 3h). c nmr (125.8 mhz, acetone - d6) 145.8, 140.41, 140.4, 129.4, 128.1, 128.0, 128.0, 125.2, 120.8, 120.8, 117.9. ir (neat) 3372, 3052, 2938, 1612, 1563, 1426, 878, 777, 758, 748 cm. hrms (ci) m / z calcd for c13h12bns [m ] 225.0784, found 225.0789. h nmr (500 mhz, acetone - d6) 9.50 (br s, 1h), 8.13 (s, 1h), 7.68 (d, j = 7.8 hz, 1h), 7.477.44 (m, 1h), 7.427.39 (m, 1h), 7.367.34 (m, 1h), 7.287.25 (m, 1h), 7.167.13 (m, 1h), 7.117.08 (m, 1h), 0.95 (s, 3h). c nmr (125.8 mhz, acetone - d6) 147.7, 140.1, 139.8, 129.1, 128.0, 127.6, 124.6, 124.5, 123.9, 120.8, 117.5. ir (neat) 3371, 3056, 2945, 1612, 1560, 1426, 1336, 877, 757, 693 cm. hrms (ci) m / z calcd for c13h12bns [m ] 225.0784, found 225.0784. h nmr (500 mhz, acetone - d6) 9.58 (br s, 1h), 8.27 (s, 1h), 7.6 (d, j = 7.3 hz, 1h), 7.477.41 (m, 2h), 7.167.13 (m, 1h), 1.58 (s, 3h), 1.39 (s, 3h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 163.1, 158.3, 144.1, 140.6, 129.1, 128.3, 124.5, 120.5, 118.3, 117.7, 10.5, 9.7. ir (neat) 3372, 3052, 2967, 1613, 1566, 1449, 1187, 777, 749 cm. hrms (ci) m / z calcd for c14h15bn2o [m ] 238.1277, found 238.1283. h nmr (500 mhz, acetone - d6) 9.41 (br s, 1h), 8.09 (s, 1h), 7.79 (s, 1h), 7.677.65 (m, 1h), 7.617.58 (m, 1h), 7.477.43 (m, 1h), 7.387.35 (m, 1h), 7.147.11 (m, 1h), 6.876.89 (m, 1h), 0.89 (s, 3h). c nmr (125.8 mhz, acetone - d6) 142.9, 139.9, 139.7, 138.8, 128.9, 128.6, 127.5, 124.9, 120.5, 117.4, 109.4. ir (neat) 3362, 2932, 1614, 1426, 1031, 872, 760 cm. hrms (ci) m / z calcd for c13h12bno [m ] 209.1012, found 209.1006. reaction performed with a concentration of 0.1 m. obtained as an off - white solid (125 mg, 54%). h nmr (500 mhz, acetone - d6) 9.56 (br s, 1h), 8.13 (s, 1h), 8.09 (d, j = 7.6 hz, 1h), 8.00 (dd, j = 7.1 hz, 1.5 hz, 1h), 7.747.71 (m, 1h), 7.597.54 (m, 2h), 7.497.41 (m, 4h), 7.387.34 (m, 1h), 7.197.17 (m, 1h), 0.73 (s, 3h). c nmr (125.8 mhz, acetone - d6) 155.9, 153.5, 142.8, 140.6, 129.8, 129.4, 128.3, 127.6, 127.0, 124.7, 124.4, 123.9, 123.0, 122.7, 120.7, 120.6, 118.6, 117.7, 111.4. ir (neat) 3374, 3052, 2968, 1614, 1566, 1425, 1187, 777, 749 cm. hrms (ci) m / z calcd for c21h16bno [m ] 309.1325, found 309.1313. reaction performed with a concentration of 0.1 m. obtained as an off - white solid (127 mg, 52%). h nmr (500 mhz, acetone - d6) 9.63 (br s, 1h), 8.31 (d, j = 7.8 hz, 1h), 8.22 (d, j = 7.8 hz, 1h), 8.10 (s, 1h), 7.907.88 (m, 1h), 7.727.70 (m, 1h), 7.597.54 (m, 2h), 7.507.45 (m, 3h), 7.387.35 (m, 1h), 7.217.18 (m, 1h), 0.66 (s, 3h). c nmr (125.8 mhz, acetone - d6) 142.1, 140.8, 140.2, 139.5, 138.6, 136.1, 135.5, 129.4, 128.5, 126.6, 126.4, 124.8, 124.4, 124.3, 122.5, 121.8, 120.7, 119.3, 117.7. ir (neat) 3366, 3056, 2980, 1707, 1567, 1440, 1021, 749 cm. hrms (ci) m / z calcd for c21h16bns [m ] 325.1097, found 325.1086. obtained as a yellow oil (157 mg, 93%). h nmr (500 mhz, acetone - d6) 7.92 (s, 1h), 7.74 (d, j = 7.6 hz, 1h), 7.42 (d, j = 8.3 hz, 1h), 7.357.27 (m, 4h), 7.237.21 (m, 1h), 7.207.16 (m, 3h), 7.016.98 (m, 2h), 6.906.87 (m, 1h), 5.44 (s, 2h), 3.83 (s, 3h), 0.86 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.6, 146.8, 141.8, 141.0, 138.5, 130.3, 128.9, 128.6, 128.3, 126.7, 126.1, 125.7, 120.9, 120.8, 115.8, 114.1, 111.3, 54.5, 50.9. ir (neat) 3027, 1734, 1604, 1368, 1046, 727 cm. hrms (ci) m / z calcd for c23h22bno [m ] 339.1794, found 339.1786. h nmr (500 mhz, acetone - d6) 7.85 (s, 1h), 7.72 (d, j = 7.3 hz, 1h), 7.567.53 (m, 1h), 7.497.45 (m, 1h), 7.337.28 (m, 1h), 7.217.17 (m, 1h), 6.956.93 (m, 2h), 6.886.84 (m, 1h), 6.146.07 (m, 1h), 5.13 (d, j = 10.5 hz, 1h), 4.97 (d, j = 17.4 hz, 1h), 4.814.79 (m, 2h), 3.83 (s, 3h), 0.84 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.6, 146.8, 141.5, 140.8, 134.7, 130.3, 128.9, 128.2, 125.9, 120.8, 120.6, 115.4, 114.7, 114.0, 111.2, 54.5, 49.3. ir (neat) 3648, 2979, 1734, 1367, 1047, 761 cm. hrms (ci) m / z calcd for c19h20bno [m ] 289.1638, found 289.1649. h nmr (500 mhz, acetone - d6) 9.66 (br s, 1h), 8.03 (s, 1h), 7.77 (d, j = 7.8 hz, 1h), 7.70 (d, j = 8.1 hz, 1h), 7.517.48 (m, 1h), 7.377.33 (m, 1h), 7.287.24 (m, 1h), 6.986.96 (m, 2h), 6.916.88 (m, 1h), 3.84 (s, 3h), 2.48 (q, j = 14.2 hz, 2h). c nmr (125.8 mhz, acetone - d6) 159.9, 145.6, 143.0, 139.7, 129.4, 129.2, 128.9 (q, j = 272 hz), 128.5, 125.0, 121.6, 120.5, 118.2, 113.7, 111.6, 54.5. ir (neat) 3408, 2961, 1699, 1596, 1240, 1038, 760 cm. hrms (esi) m / z calcd for c17h14bnof3 [m h ] 316.1121, found 316.1120. h nmr (500 mhz, acetone - d6) 9.12 (br s, 1h), 7.87 (s, 1h), 7.67 (d, j = 7.6 hz, 1h), 7.61 (d, j = 8.1 hz, 1h), 7.427.39 (m, 1h), 7.337.30 (m, 1h), 7.177.14 (m, 1h), 6.986.96 (m, 2h), 6.886.86 (m, 1h), 3.83 (s, 3h), 1.931.90 (m, 1h), 1.101.07 (m, 6h). c nmr (125.8 mhz, acetone - d6) 159.6, 146.9, 142.1, 140.3, 129.1, 128.9, 127.9, 124.7, 120.7, 120.4, 117.9, 113.7, 111.1, 54.5, 19.3. ir (neat) 3380, 2938, 1732, 1574, 1461, 1280, 760 cm. hrms (ci) m / z calcd for c18h20bno [m ] 277.1638, found 277.1637. obtained as yellow oil (115 mg, 84%). h nmr (500 mhz, acetone - d6) 8.64 (br s, 1h), 7.88 (s, 1h), 7.66 (d, j = 7.8 hz, 1h), 7.48 (d, j = 8.3 hz, 1h), 7.377.31 (m, 2h), 7.157.10 (m, 3h), 6.686.65 (m, 1h), 3.83 (s, 3h), 0.830.80 (m, 2h), 0.750.72 (m, 2h), 0.540.50 (m, 1h). c nmr (125.8 mhz, acetone - d6) 159.6, 146.3, 141.0, 140.4, 129.2, 128.9, 127.9, 124.7, 120.7, 120.4, 117.6, 113.9, 111.3, 54.5, 6.4. ir (neat) 3382, 2993, 1597, 1464, 1258, 1046, 760 cm. hrms (ci) m / z calcd for c18h18bno [m ] 275.1481, found 275.1476. obtained as yellow oil (101 mg, 70%). h nmr (500 mhz, acetone - d6) 9.18 (br s, 1h), 7.88 (s, 1h), 7.68 (d, j = 7.6 hz, 1h), 7.63 (d, j = 7.8 hz, 1h), 7.437.40 (m, 1h), 7.307.27 (m, 1h), 7.177.14 (m, 1h), 6.966.92 (m, 2h), 6.866.83 (m, 1h), 3.82 (s, 3h), 2.752.70 (m, 1h), 2.122.04 (m, 5h), 1.931.85 (m, 1h). c nmr (125.8 mhz, acetone - d6) 159.6, 146.5, 141.6, 140.2, 129.2, 128.8, 127.9, 124.9, 120.7, 120.3, 117.8, 113.4, 111.2, 54.5, 25.6, 21.5. ir (neat) 3381, 2962, 1596, 1461, 1046, 758, 703 cm. hrms (ci) m / z calcd for c19h20bno [m ] 289.1638, found 289.1635. h nmr (500 mhz, acetone - d6) 9.70 (br s, 1h), 8.07 (s, 1h), 7.79 (d, j = 7.8 hz, 1h), 7.737.70 (m, 1h), 7.507.45 (m, 3h), 7.317.22 (m, 9h). c nmr (125.8 mhz, acetone - d6) 144.6, 143.3, 140.4, 133.5, 129.3, 128.6, 128.3, 128.1, 127.8, 127.3, 125.8, 125.2, 121.1, 118.2. ir (neat) 3371, 3051, 2923, 1560, 1420, 1307, 756 cm. hrms (ci) m / z calcd for c20h16bn [m ] 281.1376, found 281.1371. obtained as a yellow oil (106 mg, 71%). h nmr (500 mhz, acetone - d6) 9.70 (br s, 1h), 8.06 (s, 1h), 7.777.75 (m, 1h), 7.71 (d, j = 8.1 hz, 1h), 7.487.45 (m, 3h), 7.317.24 (m, 6h), 7.067.01 (m, 2h). c nmr (125.8 mhz, acetone - d6) 161.6 (d, j = 243 hz), 143.4, 140.8 (d, j = 2.5 hz), 140.4, 133.4, 130.3 (d, j = 7.5 hz), 129.4, 128.4, 128.2, 127.4, 125.1, 121.1, 118.2, 114.5 (d, j = 21 hz). ir (neat) 3381, 3050, 2979, 2348, 1698, 1218, 834, 753 cm. hrms (ci) m / z calcd for c20h15bfn [m ] 299.1282, found 299.1280. h nmr (500 mhz, acetone - d6) 9.83 (br s, 1h), 8.25 (s, 1h), 8.22 (s, 1h), 8.138.08 (m, 1h), 7.84 (d, j = 7.8 hz, 1h), 7.757.72 (m, 1h), 7.687.65 (m, 1h), 7.547.50 (m, 2h), 7.467.43 (m, 2h), 7.337.24 (m, 4h). c nmr (125.8 mhz, acetone - d6) 148.2, 146.4, 144.5, 140.7, 135.1, 133.3, 129.7, 129.0, 128.9, 128.3, 127.5, 124.9, 122.9, 121.4, 120.5, 118.3. ir (neat) 3371, 3051, 2780, 1560, 1286, 1264, 756, 699 cm. hrms (esi) m / z calcd for c20h15bn2o2na [m + na ] 349.1124, found 349.1125. obtained as an off - white solid (88 mg, 52%). h nmr (500 mhz, acetone - d6) 9.61 (br s, 1h), 8.04 (s, 1h), 7.76 (d, j = 7.8 hz, 1h), 7.707.68 (m, 1h), 7.537.51 (m, 2h), 7.477.43 (m, 1h), 7.337.27 (m, 3h), 7.237.20 (m, 1h), 6.82 (s, 1h), 6.746.72 (m, 2h), 4.254.20 (m, 4h). c nmr (125.8 mhz, acetone - d6) 143.3, 142.7, 142.3, 140.2, 137.8, 133.3, 129.2, 128.1, 128.0, 127.3, 125.2, 121.7, 121.1, 118.1, 117.0, 116.4, 65.2, 64.1. ir (neat) 3355, 2980, 1560, 1506, 1412, 1307, 1281, 1244, 754 cm. hrms (ci) m / z calcd for c22h19bno2 [m + h ] 340.1509, found 340.1516. obtained as an off - white solid (100 mg, 70%). h nmr (500 mhz, acetone - d6) 9.63 (br s, 1h), 8.22 (s, 1h), 7.75 (d, j = 7.8 hz, 1h), 7.707.67 (m, 1h), 7.567.52 (m, 2h), 7.477.43 (m, 1h), 7.367.29 (m, 4h), 7.237.20 (m, 1h), 7.167.14 (m, 1h), 7.087.06 (m, 1h). c nmr (125.8 mhz, acetone - d6) 145.1, 142.3, 140.2, 133.1, 129.2, 128.4, 128.2, 128.1, 127.4, 125.2, 124.6, 121.2, 120.8, 118.2. ir (neat) 3372, 2979, 2919, 1613, 1559, 1423, 754 cm. hrms (ci) m / z calcd for c18h14bns [m ] 287.0940, found 287.0939. obtained as a dark - yellow oil (104 mg, 80%). h nmr (500 mhz, acetone - d6) 9.61 (br s, 1h), 8.24 (s, 1h), 7.75 (d, j = 7.8 hz, 1h), 7.667.64 (m, 1h), 7.607.57 (m, 2h), 7.497.43 (m, 2h), 7.397.37 (m, 3h), 7.237.21 (m, 2h), 6.85 (s, 1h). c nmr (125.8 mhz, acetone - d6) 142.6, 140.8, 140.0, 139.8, 132.6, 129.0, 128.2, 128.0, 127.9, 127.5, 125.2, 121.2, 118.1, 109.9. ir (neat) 3353, 2979, 1706, 1506, 1318, 951, 815, 703 cm. hrms (ci) m / z calcd for c18h14bno [m ] 271.1168 found 271.1156. obtained as a white solid (132 mg, 88%). h nmr (500 mhz, acetone - d6) 9.84 (br s, 1h), 8.04 (s, 1h), 7.787.74 (m, 2h), 7.547.50 (m, 3h), 7.347.29 (m, 3h), 7.267.23 (m, 1h), 2.11 (s, 3h), 1.86 (s, 3h). c nmr (125.8 mhz, acetone - d6) 163.4, 158.5, 146.0, 140.7, 132.8, 129.2, 128.7, 128.5, 127.6, 124.8, 121.2, 118.4, 118.3, 10.5, 9.8. ir (neat) 3378, 1615, 1423, 1156, 756, 709 cm. hrms (esi) m / z calcd for c19h18bn2o [m + h ] 301.1512, found 301.1521. h nmr (500 mhz, acetone - d6) 9.65 (br s, 1h), 8.11 (s, 1h), 8.078.04 (m, 1h), 7.797.77 (m, 1h), 7.737.71 (m, 1h), 7.637.62 (m, 1h), 7.537.47 (m, 4h), 7.297.21 (m, 5h), 6.576.56 (m, 1h), 1.67 (s, 9h). c nmr (125.8 mhz, acetone - d6) 149.4, 143.4, 140.3, 139.4, 133.5, 130.7, 129.2, 128.1, 128.0, 127.3, 125.9, 125.5, 125.3, 121.1, 120.5, 118.2, 114.2, 107.3, 83.3, 59.6, 27.4. ir (neat) 3371, 2975, 1731, 1370, 1162, 1135, 764, 752 cm. hrms (esi) m / z calcd for c27h25bn2o2na [m + na ] 443.1907, found 443.1902. h nmr (500 mhz, acetone - d6) 9.73 (br s, 1h), 8.08 (s, 1h), 7.77 (d, j = 7.8 hz, 1h), 7.69 (d, j = 8.3 hz, 1h), 7.537.44 (m, 3h), 7.257.18 (m, 2h), 7.057.00 (m, 2h), 6.876.80 (m, 3h), 3.67 (s, 3h). c nmr (125.8 mhz, acetone - d6) 163.2 (d, j = 250 hz), 159.5, 145.9, 143.3, 140.4, 135.7, 135.6, 129.4, 128.9, 128.4, 125.1, 121.2, 120.9, 118.2, 114.1 (d, j = 20.5 hz), 111.6, 54.3. ir (neat) 3371, 2928, 1595, 1570, 1417, 1277, 1161, 760 cm. hrms (ci) m / z calcd for c21h18bnof [m + h ] 330.1465, found 330.1466. h nmr (500 mhz, acetone - d6) 9.68 (br s, 1h), 8.10 (s, 1h), 7.797.77 (m, 1h), 7.727.70 (m, 1h), 7.497.46 (m, 1h), 7.247.18 (m, 3h), 7.097.05 (m, 2h), 6.906.86 (m, 3h), 6.816.79 (m, 1h), 3.67 (s, 3h), 3.65 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.4, 158.9, 146.0, 143.1, 140.4, 129.3, 128.7, 128.4, 128.3, 125.6, 125.1, 121.2, 120.9, 118.6, 118.2, 114.2, 113.9, 115.6, 54.3, 54.1. ir (neat) 3344, 3006, 2938, 1597, 1223, 1037, 786, 703 cm. hrms (esi) m / z calcd for c22h21bno2 [m + h ] 342.1665, found 342.1650. obtained as a yellow oil (39 mg, 24%). h nmr (500 mhz, acetone - d6) 9.74 (br s, 1h), 8.01 (s, 1h), 7.75 (d, j = 8.1 hz, 1h), 7.66 (d, j = 8.1 hz, 1h), 7.577.55 (m, 1h), 7.487.45 (m, 1h), 7.397.36 (m, 1h), 7.277.18 (m, 3h), 6.936.84 (m, 3h), 3.73 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.4, 146.5, 143.1, 140.3, 132.0, 131.9, 129.3, 128.8, 128.3, 124.9, 124.3, 121.0, 120.8, 118.0, 114.0, 111.7, 54.3. ir (neat) 3374, 2924, 1562, 1261, 852, 761, 685 cm. hrms (ci) m / z calcd for c19h17bnos [m + h ] 318.1124, found 318.1109. h nmr (500 mhz, acetone - d6) 10.11 (br s, 1h), 8.24 (s, 1h), 8.088.04 (m, 2h), 7.87 (d, j = 7.8 hz, 1h), 7.787.76 (m, 1h), 7.557.41 (m, 4h), 7.377.34 (m, 1h), 7.317.25 (m, 2h), 7.137.10 (m, 1h), 6.946.92 (m, 1h), 6.916.90 (m, 1h), 6.716.68 (m, 1h), 3.53 (s, 3h). c nmr (125.8 mhz, acetone - d6) 159.4, 158.9, 155.8, 145.9, 143.1, 140.0, 132.8, 129.5, 128.7, 128.4, 126.9, 125.3, 124.1, 122.8, 122.5, 122.3, 121.4, 120.7, 120.6, 120.5, 118.3, 113.6, 111.7, 111.4, 54.2. ir (neat) 3390, 3051, 2929, 1564, 1450, 1165, 756 cm. hrms (esi) m / z calcd for c27h21bno2 [m + h ] 402.1665, found 402.1673. obtained as a yellow oil (172 mg, 97%). h nmr (500 mhz, acetone - d6) 9.50 (br s, 1h), 8.048.01 (m, 2h), 7.757.71 (m, 1h), 7.577.55 (m, 1h), 7.397.27 (m, 4h), 7.037.01 (m, 2h), 6.906.86 (m, 2h), 3.86 (s, 3h), 3.84 (s, 3h), 0.85 (s, 3h). c nmr (125.8 mhz, acetone - d6) 160.3, 159.7, 146.4, 142.2, 141.3, 139.9, 133.3, 129.7, 129.0, 127.4, 126.9, 125.1, 120.5, 118.9, 118.0, 113.7, 112.2, 112.1, 111.4, 54.6, 54.5. ir (neat) 3366, 2954, 1733, 1576, 1038, 933, 776, 699 cm. hrms (ci) m / z calcd for c23h23bno2 [m + h ] 356.1822, found 356.1829. h nmr (500 mhz, acetone - d6) 9.10 (br s, 1h), 7.82 (s, 1h), 7.637.61 (m, 1h), 7.407.35 (m, 3h), 7.127.10 (m, 1h), 6.966.94 (m, 1h), 6.72 (s, 1h), 6.53 (s, 1h), 6.526.50 (m, 2h), 3.85 (s, 3h), 3.43 (s, 3h), 2.16 (s, 3h), 0.21 (s, 3h). c nmr (125.8 mhz, acetone - d6) 158.9, 158.8, 145.1, 143.0, 141.6, 140.2, 138.2, 132.6, 130.6, 128.9, 127.6, 124.9, 123.0, 120.3, 117.4, 115.0, 112.9, 112.5, 111.8, 54.6, 54.0, 20.6. ir (neat) 3390, 3052, 2932, 1595, 1451, 1164, 758 cm. hrms (esi) m / z calcd for c24h25bno2 [m + h ] 370.1978, found 370.1960. obtained as a white solid (126 mg, 84%). h nmr (500 mhz, acetone - d6) 9.49 (br s, 1h), 8.04 (s, 1h), 7.95 (s, 1h), 7.787.78 (m, 1h), 7.687.66 (m, 1h), 7.587.56 (m, 1h), 7.537.51 (m, 2h), 7.477.45 (m, 2h), 7.437.40 (m, 2h), 7.307.27 (m, 1h), 0.81 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.9, 142.0, 141.2, 139.6, 128.5, 128.1, 128.0, 126.5, 126.4, 126.2, 126.1, 125.8, 125.2, 119.1, 118.0. ir (neat) 3366, 3058, 2931, 1596, 1450, 1220, 750, 700 cm. hrms (ci) m / z calcd for c19h16bns [m ] 301.1097, found 301.1099. h nmr (500 mhz, acetone - d6) 9.50 (br s, 1h), 8.01 (s, 1h), 7.947.92 (m, 2h), 7.687.66 (m, 2h), 7.63 (s, 1h), 7.517.48 (m, 1h), 7.477.44 (m, 2h), 7.427.38 (m, 2h), 7.307.27 (m, 1h), 0.79 (s, 3h). c nmr (125.8 mhz, acetone - d6) 144.9, 143.8, 141.0, 139.4, 138.2, 128.0, 128.0, 126.3, 125.9, 125.9, 125.8, 125.2, 125.0, 118.0, 108.6. ir (neat) 3366, 3058, 2929, 1596, 1450, 1220, 1163, 750, 760 cm. hrms (ci) m / z calcd for c19h16bno [m ] 285.1325, found 285.1318. the geometries were optimized at the b3lyp/6 - 311g(d) level, and molecular orbitals and molecular energies were calculated at the same level. | despite their potential applications in both medicinal chemistry and materials science, there have been limited reports on the functionalization of 2,1-borazaronaphthalenes since their discovery in 1959. to access new chemical space and build molecular complexity, the suzuki miyaura cross - coupling of brominated 2,1-borazaronaphthalenes has been investigated. the palladium - catalyzed cross - coupling proceeds with an array of potassium (hetero)aryltrifluoroborates in high yield with low catalyst loadings under mild reaction conditions. by the use of a high - yielding bromination of various 2,1-borazaronaphthalenes to generate electrophilic azaborine species, a library of 3-(hetero)aryl and 3,6-diaryl-2,1-borazaronaphthalenes has been synthesized. |
in june 2001, five persons with a febrile respiratory illness visited a community hospital. the patients were among 15 persons (age range 1961 years ; median 38 years), residents of four states, who had participated in a geology - biology community college class trip to nicaragua. to determine the cause and describe characteristics of the outbreak, we interviewed trip participants and reviewed medical records to collect demographic information, clinical history, and activities during the trip. based on the partcipant s exposure to a cave with bats and clinical characteristics suggestive of acute histoplasmosis a case of acute histoplasmosis was defined as illness in a person who tested positive by one of the following laboratory tests : serology, urine antigen, histopathology, or culture. immunodiffusion and complement- fixation serologic tests were performed at the centers for disease control and prevention (cdc). the immunodiffusion test was considered positive if an h or m band or both were detected. a complement - fixation titer to the yeast or mycelial antigens of > 1:32 or a fourfold increase in the titer between acute- and convalescent - phase serum specimens was considered evidence of acute infection. identification of the organism as h. capsulatum was confirmed by genprobe assay (genprobe, san diego, ca). urine antigen tests, which were performed 2 weeks after exposure, are considered positive if > 1 unit is detected (3,4). the travelers began their trip on may 19 and returned to the united states on may 30. during their trip, they explored rock quarries, visited a biological research station, swam in freshwater lakes, and were exposed to parrots and insects. on may 21, a total of 14 of the 15 travelers entered a small cave that had previously been used as a silver mine. they remained in the cave for 10 minutes, during which time they saw several flying bats and bat guano on the ground. the infection rate was 100% among the 14 travelers who entered the cave, and 12 (86%) were symptomatic. of the 14 patients, 12 (86%) had urine antigen tests (table). the only traveler who did not enter the cave tested negative by serology and urine antigen. among 14 persons with histoplasmosis. urine antigen tests were performed for 12 persons. among the 12 symptomatic persons. five persons missed 2 weeks3 months of work, and five persons missed one semester of school. the average incubation period was 11 days (range 1012 days), assuming that exposure occurred on may 21. among the 12 symptomatic persons, 12 (100%) had a fever of 38.9c to 40c, nonproductive cough, myalgias, fever, chills, night sweats, loss of appetite, and mild headache. many had nausea and vomiting (83%), chest pain (58%), and arthralgias (58%). six persons had mild to moderate respiratory distress, with oxygen saturation of 88% to 95%. on physical examination, all the travelers lung fields were clear to auscultation, a feature consistent with histoplasmosis infection. the two asymptomatic persons had previous exposure to bats or caving. among the symptomatic persons, we found no differences in severity of symptoms according to sex, prior exposure to spelunking, residence in a histoplamosis - endemic area, or activities while in the mine. in accordance with clinical treatment guidelines, physicians decided to treat patients with itraconazole for 6 to 12 weeks ; some patients also received steroids (5). laboratory studies showed normal complete blood counts, serum chemistries, and renal function tests. four persons had mild to moderate elevation in liver function tests (alanine aminotransferase, range 55204 ; aspartate aminotransferase, range 48153 ; and alkaline phosphatase, range 95311). all 12 symptomatic persons had abnormal chest radiograph results with bilateral nodular infiltrates (figure). chest radiograph of patient who acquired acute pulmonary histoplasmosis after visiting a cave in nicaragua. hematoxylin and eosin stained sections of the lung tissue from the biopsy showed macrophages and neutrophils in the interstitium ; no granulomatous inflammation was observed. culture of the bronchoalveolar lavage fluid from this patient grew h. capsulatum after 4 weeks of incubation. this report highlights the importance of histoplasmosis as a potentially serious travel - related illness. histoplasmosis is usually considered a mild, self - limited illness ; however, this outbreak of histoplasmosis among previously healthy travelers was associated with a 100% infection rate of histoplasmosis and an 86% rate of symptomatic infection in the persons who entered the cave. among the symptomatic persons, 50% required hospitalization and 83% missed school or work (range : 2 weeks3 months) as a result of their illness (table). because of the high attack rate and the large percentage of patients with severe infection, these travelers were likely exposed to very high concentrations of h. capsulatum spores during their brief visit inside the cave. h. capsulatum exists throughout the world (1,6) ; however, nonimmune travelers from areas with a low prevalence of histoplasmosis, who engage in high - risk activities in disease - endemic areas, are at greater risk of acquiring symptomatic fungal infection. the number of outbreaks of histoplasmosis, especially among u.s. histoplasmosis has been reported in groups of travelers who entered caves with bats in costa rica (7 ; unpub. data, centers for disease control and prevention cdc), ecuador (8), and peru (9). in 2001, more than 200 college students became infected with histoplasmosis during a spring break trip to acapulco, mexico (10,11). clinicians should consider fungal pathogens when evaluating returning travelers who have a febrile respiratory syndrome. the differential diagnosis of acute febrile respiratory illness in international adventure travelers is extensive and includes legionellosis, psittacosis, leptospirosis, schistosomiasis, histoplasmosis, coccidioidomycosis, influenza, parainfluenza, mycoplasma, dengue, and malaria. the timely diagnosis of histoplasmosis in travelers may be particularly challenging for clinicians evaluating one sporadic case or a patient involved in an undetected multistate outbreak. antibody response can take 46 weeks to develop, reducing its usefulness in the acute setting and requiring the collection of a convalescent - phase specimen for confirmation. antibodies may also persist for 5 years, making it difficult to distinguish between prior and recent infection without obtaining a convalescent - phase specimen. the sensitivity of immunodiffusion is 72% to 85%, while that of complement fixation is 80% to 90% (20,21). the antigen test can be used for urine, cerebrospinal fluid, serum, and bronchoalveolar lavage fluid, and results are available in 24 hours. this test had been used most extensively in aids patients ; however, it is less sensitive in nonimmunocompromised persons with acute pulmonary infection. sensitivity of the urine antigen test for detection of acute pulmonary infection ranges from 44% to 75% and increases when performed early after the onset of symptoms (3,4). in this outbreak, however, most clinicians may not have thought to counsel them about histoplasmosis risk and prevention. during pretravel visits, clinicians should review patients itineraries for possible fungal exposures and should counsel them to avoid entering caves, especially those known to be bat infested. since travelers may not know whether their itinerary includes visits to bat - infested caves, adventure travelers and persons who are at high risk for severe histoplasmosis infection, such as immunocompromised travelers (especially persons with aids), should be counseled to avoid possible exposures, either by avoiding caves or by using special protective masks. the national institute for occupational safety and health has published guidelines for special masks that can be used to reduce occupational and other exposures (e.g., among spelunkers). unfortunately, these special masks are bulky and may be impractical for many travelers (22). while most nonimmunocompromised patients with acute pulmonary histoplasmosis improve without treatment, persons with hypoxemia, diffuse pulmonary histoplasmosis, or severe illness requiring hospitalization may benefit from antifungal therapy and, in some cases, corticosteroids (5). as adventure travel becomes increasingly accessible, especially among persons at high risk, immunocompromised persons, and the elderly, histoplasmosis and other fungal infections in travelers may become more common. enhanced surveillance for histoplasmosis and other fungal infections by public health officials, combined with heightened awareness by clinicians who are evaluating symptomatic, post - travel patients, can lead to greater understanding of the epidemiology of fungal infections among travelers and, ultimately, to improved prevention measures. | we investigated an outbreak of unexpectedly severe histoplasmosis among 14 healthy adventure travelers from the united states who visited a bat - infested cave in nicaragua. although histoplasmosis has rarely been reported to cause serious illness among travelers, this outbreak demonstrates that cases may be severe among travelers, even young, healthy persons. |
atherosclerotic coronary artery disease (cad) has long been shown to involve inflammatory processes. numerous pathways and markers have been studied in order to detect the presence and evolution of this disease. the role of various biological inflammatory markers as risk factors and prognosticators has been elucidated in different cad patients ranging from population - based asymptomatic subjects to patients with myocardial infarction undergoing coronary artery bypass graft surgery (cabg). in addition, since the earlier phase of cad involves asymptomatic coronary artery calcification (cac), there have also been different studies examining the relationship between multiple classic as well as novel biological markers of inflammation and cac. however, most of the current studies that investigated associations between inflammatory biomarkers and cac used novel markers that might not be readily available clinically in general hospital settings and they were conducted in asymptomatic subjects. data with classic inflammatory markers derived from complete blood count (cbc) such as red blood cell indices, white blood cell indices, and platelet counts is still conflicting and sparse in symptomatic patients. whether various blood cell counts and ratios can reflect presence and/or extent of cac in this population with cad is still uncertain. the objective of our study is to examine the relationship between hematological indices assessed with cbc and cac in symptomatic patients without known history of cad. this study is a cross - sectional analysis of a prospective observational cohort study examining usefulness of cac score in triaging chest pain patients presenting at emergency department in our hospital, which is described elsewhere. subjects were consecutive patients older than 18 years who were admitted under observational status for further evaluation of acute chest pain of unknown cardiac significance but suggestive of myocardial ischemia within the previous 24 hours. the decision to discharge patients home, admit patients under observational status, or admit patients under full admission status is determined by emergency department physicians or the patient 's personal physician. the chest pain observation protocol includes performing serial 12-lead electrocardiograms (ekgs), troponin level, and a stress test. exclusion criteria included patients with non - cardiac chest pain based on clinical assessment (e.g., pleuritic, musculoskeletal chest pain), history of cad based on previous coronary angiography or prior coronary revascularization, elevated troponin in initial blood samples, new or presumably new st - segment elevation or depression (1 mm) on baseline electrocardiogram, hemodynamic or clinical instability defined by systolic blood pressure 400). during the observation period, all clinical information was collected including demographic information, cardiovascular history, and blood samples for lipid profiles, cardiac biomarkers and renal function tests. cardiovascular history included information on cardiovascular symptoms ; history of hypertension, diabetes mellitus, dyslipidemia, smoking, peripheral arterial disease, carotid artery disease, abdominal aortic aneurysm ; family history of cad and current cardiovascular medication profiles. descriptive statistics for studied variables are presented as mean (standard deviation, sd) for normally distributed variables, median (interquartile range, iqr) for non - normally - distributed variables and frequency (percentage) of categorical variables. analysis of variance (anova) and student 's t - test were used to identify differences in means between cac categories. kruskal - wallis h test and wilcox - mann - whitney u - test were used to examine differences in medians between cac categories. all statistical tests were performed with ibm spss / pasw statistics 20 (spss inc., chicago, il). a two - tailed p value 400). during the observation period, all clinical information was collected including demographic information, cardiovascular history, and blood samples for lipid profiles, cardiac biomarkers and renal function tests. cardiovascular history included information on cardiovascular symptoms ; history of hypertension, diabetes mellitus, dyslipidemia, smoking, peripheral arterial disease, carotid artery disease, abdominal aortic aneurysm ; family history of cad and current cardiovascular medication profiles. descriptive statistics for studied variables are presented as mean (standard deviation, sd) for normally distributed variables, median (interquartile range, iqr) for non - normally - distributed variables and frequency (percentage) of categorical variables. analysis of variance (anova) and student 's t - test were used to identify differences in means between cac categories. kruskal - wallis h test and wilcox - mann - whitney u - test were used to examine differences in medians between cac categories. all statistical tests were performed with ibm spss / pasw statistics 20 (spss inc., consecutive 868 patients, who underwent agatston cac scoring during observation period and had cbc performed, were included in the final analysis. baseline and study clinical characteristics are shown in table 1. baseline characteristics the median cac score in our study population was 0 (iqr 0 - 43). most (522 of 866, 60.3%) had absent cac, followed by 21.8% (189 of 866) with mild cac, 10.0% (87 of 866) with moderate cac, and 7.9% (68 of 866) with severe cac. mean age of patients in absent cac group was lower than patients with cac (overall p = 0.021). however, only patients with mild cac were significantly older than patients with absent cac (p = 0.013), but not patients with moderate cac (p = 0.074) or severe cac (p = 0.054). higher cac groups had significantly higher 10-year risk for cad than lower cac groups predicted by framingham risk score (overall p 0) or absent - to - mild cac (cac score 100) and moderate - to - severe cac (cac score > 100), there was still no significant difference between all cell counts or nlr. mean 95% confidence interval of red blood cell indices (hemoglobin level, mean corpuscular volume, mcv ; mean corpuscular hemoglobin, mch ; mean corpuscular hemoglobin concentration, mchc ; red cell distribution width, rdw) and platelet level among different coronary artery calcium score categories (0, 1 100, 101 400, > 400) mean 95% confidence interval of white blood cell (wbc) indices including absolute / relative neutrophil counts, absolute / relative lymphocyte counts, absolute / relative monocyte counts, neutrophil - to - lymphocyte ratio (neu : lymp ratio) among different coronary artery calcium score categories (0, 1 - 100, 101 - 400, > 400) in correlation analysis, mch had weak but significant association with cac score (coefficient 0.075, p = 0.03). examination on other hematological indices did not show statistically significant correlation with cac score including hemoglobin (p = 0.79), mcv (p = 0.17), mchc (p = 0.11), rdw (p = 0.64), total wbc counts (p = 0.18), relative neutrophil counts (p = 0.63), absolute neutrophil count (p = 0.17), relative lymphocyte counts (p = 070), absolute lymphocyte count (p = 0.76), nlr (p = 0.77), relative monocyte counts (p = 0.24), absolute monocyte count (p = 0.66), and platelet counts (p = 0.54). with all of the above analysis separately performed for each gender, no statistically significant differences or correlations were shown. in regression model analyses, higher mch was found to have significant univariate association with higher absolute cac score (p = 0.03) ; however, after adjustment with framingham risk, the association diminished and did not reach the predefined significant threshold (p = 0.09). other hematological indices were not associated with either presence of cac or cac score as shown in table 2. association of hematological indices with presence of coronary calcification and coronary artery calcium score (cacs) consecutive 868 patients, who underwent agatston cac scoring during observation period and had cbc performed, were included in the final analysis. baseline and study clinical characteristics are shown in table 1. baseline characteristics the median cac score in our study population was 0 (iqr 0 - 43). most (522 of 866, 60.3%) had absent cac, followed by 21.8% (189 of 866) with mild cac, 10.0% (87 of 866) with moderate cac, and 7.9% (68 of 866) with severe cac. mean age of patients in absent cac group was lower than patients with cac (overall p = 0.021). however, only patients with mild cac were significantly older than patients with absent cac (p = 0.013), but not patients with moderate cac (p = 0.074) or severe cac (p = 0.054). higher cac groups had significantly higher 10-year risk for cad than lower cac groups predicted by framingham risk score (overall p 0) or absent - to - mild cac (cac score 100) and moderate - to - severe cac (cac score > 100), there was still no significant difference between all cell counts or nlr. mean 95% confidence interval of red blood cell indices (hemoglobin level, mean corpuscular volume, mcv ; mean corpuscular hemoglobin, mch ; mean corpuscular hemoglobin concentration, mchc ; red cell distribution width, rdw) and platelet level among different coronary artery calcium score categories (0, 1 100, 101 400, > 400) mean 95% confidence interval of white blood cell (wbc) indices including absolute / relative neutrophil counts, absolute / relative lymphocyte counts, absolute / relative monocyte counts, neutrophil - to - lymphocyte ratio (neu : lymp ratio) among different coronary artery calcium score categories (0, 1 - 100, 101 - 400, > 400) in correlation analysis, mch had weak but significant association with cac score (coefficient 0.075, p = 0.03). examination on other hematological indices did not show statistically significant correlation with cac score including hemoglobin (p = 0.79), mcv (p = 0.17), mchc (p = 0.11), rdw (p = 0.64), total wbc counts (p = 0.18), relative neutrophil counts (p = 0.63), absolute neutrophil count (p = 0.17), relative lymphocyte counts (p = 070), absolute lymphocyte count (p = 0.76), nlr (p = 0.77), relative monocyte counts (p = 0.24), absolute monocyte count (p = 0.66), and platelet counts (p = 0.54). with all of the above analysis separately performed for each gender, no statistically significant differences or correlations were shown. in regression model analyses, higher mch was found to have significant univariate association with higher absolute cac score (p = 0.03) ; however, after adjustment with framingham risk, the association diminished and did not reach the predefined significant threshold (p = 0.09). other hematological indices were not associated with either presence of cac or cac score as shown in table 2. association of hematological indices with presence of coronary calcification and coronary artery calcium score (cacs) role of inflammation in the pathogenesis of atherosclerotic cad has been extensively studied for the past decades. there is evidence of inflammation in every stage of the disease from the very beginning of atherosclerosis when fatty streaks are formed on the vascular wall. this is demonstrated by presence of leukocytes in fatty streaks and their transformation into foam cells. this eventually leads to atherosclerotic plaque formation and to myocardial infarction. as further evidence, medications with anti - inflammatory effect such as aspirin, statins, and steroids have been shown to affect clinical outcomes in various populations of cad. in addition, in patients with systemic inflammatory disorders such as rheumatoid arthritis (ra), it has been illustrated that prevalence of atherosclerotic cad is increased and progression of cac is accelerated compared to those without ra. the main finding of this study is the lack of statistically significant association between cac detected by cardiac ct and hematological indices using cbc, which is readily available clinically in symptomatic patients without known cad. this finding is inconsistent with a recently published cardiac ct - based study by korkmaz. which demonstrated a strong relationship between total wbc counts and presence of agatston cac score (or 1.7 ; 95%ci 1.3 - 2.1, p 0) and cac score > 10. in addition, value of crp was also shown to correlate with value of cac score. in contrast, redberg. demonstrated an inverse relationship between high crp and cac detected by electron beam ct (ebct) in postmenopausal women. however, their population size was modest and comprised high proportion of patients without cac (44%). other markers that have been described in association with cac in recent literature include fibrinogen, monocyte chemotactic protein-1 (mcp-1), resistin, lipoprotein - associated phospholipase a2 (lp - pla2), tumor necrosis factor alpha (tnf-), beta fibroblast growth factor (-fgf), and interleukin-6 (il-6). in addition, relationships between clinical events or other surrogates and these inflammatory biomarkers have also been examined. those markers are not only limited to the aforementioned markers but also include interleukin-18, gelatinase - associated lipocalin, vaspin, macrophage migration inhibiting factor (mmif), and fetuin - a. in summary, we have demonstrated the lack of significant association between cbc indices and cac in symptomatic patients suspected for cad. these findings are in contrary to most of the other current studies in literature, regarding inflammatory markers and cad. this discrepancy might possibly be from robustness of cbc indices in detecting chronic low level of inflammation in atherosclerotic cad, heterogeneity between previous studies and our studies in the studied population, definition of each cad group as well as imaging modalities to detect cac. nevertheless, our findings suggest that none of cbc indices can be used reliably as a marker of cac in clinical setting. the limitation of this study is the single - center cross - sectional nature of examining association between the hematological indices and cac score. also some patients did not have cbc performed, so we excluded those patients from the study. our study did not detect significant association between agatston coronary artery calcification score and hematological indices assessed with cbcs including hemoglobin level, mcv, mch, mchc, rdw, total wbc counts, absolute / relative neutrophil counts, absolute / relative lymphocyte counts, neutrophil - to - lymphocyte ratio, absolute / relative monocyte counts, and platelet counts in symptomatic patients without history of cad. the findings were in contrast with the previously reported data and potentially suggested that cbc indices could not be used reliably as a marker of cad in clinical setting. | background : atherosclerotic coronary artery disease (cad) has long been shown to involve chronic low - grade subclinical inflammation. however, whether there is association between hematological indices assessed by complete blood count (cbc) and coronary atherosclerotic burden has not been well studied.materials and methods : consecutive 868 patients without known cad who presented with acute chest pain to emergency department and underwent coronary artery calcium (cac) scoring evaluation by multi - detector cardiac computed tomography were included in our study. clinical characteristics and cbc indices were compared among different cac groups.results:the cohort comprised 60% male with a mean age of 61 (sd = 14) years. median framingham risk of cad was 4% (range 1 - 16%). median cac score was 0 (iqr 0 - 43). higher cac groups had significantly higher framingham risk of cad than lower cac groups (p < 0.001). among different cac categories, there was no statistically significant difference in hemoglobin level (p 0.45), mean corpuscular volume (p 0.43), mean corpuscular hemoglobin (p 0.28), mean corpuscular hemoglobin volume (p 0.36), red cell distribution width (0.42), total white blood cell counts (p 0.291), neutrophil counts (p 0.352), lymphocyte counts (p 0.92), neutrophil to lymphocyte ratio (p 0.68), monocyte count (p 0.48), and platelet counts (p 0.25).conclusion : our study did not detect significant association between hematological indices assessed with cbc and coronary calcification in symptomatic patients without known cad. |
the field of cancer chemotherapy has been developed enormously during the past fifty years. prior to 1969, however, the arsenal of chemotherapeutic agents was devoid of compounds which are inorganic in nature because of generally accepted belief that most metals and their compounds were potentially carcinogenic. in 1969, rosenberg and his coworkers made the serendipitous discovery that certain pt compounds were potent antitumor agents against sarcoma 180 tumors and l1210 leukemia in mice and must be considered to be an outstanding development in the field of metal compounds in medicine. cis - platin is the first drug from inorganic chemistry to have come under routine clinical use in medical oncology ; in 1986, it was the largest selling anticancer drug worldwide. its success placed the co - ordination chemists on the front line in the fight against cancer and stimulated the search for other metal - containing compounds with potential anticancer activity. in last 20 years about more than 12000 complexes of 55 metals have been tested, many of them are now entering for clinical trials, and some may ultimately rival cis - platin [57 ]. although the majority of these successes involved complexes containing transition metal ions such as cr, co, cu, pd, rh, ru, and au [58 ], but some main group metals (i.e., al, ga, in, ad tl ; ge, sn, and pb ; bi and po) compounds, especially organotins, have also been discovered which show promise as future members of man 's anticancer arsenal [913 ]. further, several organotin(iv) derivatives have been reported to exhibit good anti - inflammatory activity [1422 ]. the mechanism of mode of action of cis - platin is due to the formation of an intrastrand crosslink with dna, involving the n7 of two guanine residues [23, 24 ]. the mode of action of organotin compounds is not very well documented. in order to obtain a better insight about the interaction of organotins with dna inside the biological systems,, some studies on organotin - nucleotides both in solid - state and in solution have been carried out [2530 ]. stannylated ribonucleotides in the presence of iodine as activating agent have been used in chemical synthesis of mgppnu (nu = a, g, c, and u). in continuation to our recent studies on the interaction of organotin(iv) moieties with guanine and guanosine, in this paper, we wish to report the results of the interaction of 5-guanosine monophosphate with tri- and diorganotin(iv) moieties. dimethyltin(iv) dichloride di - n - butyltin(iv) dichloride, diphenyltin(iv) dichloride, trimethyltin(iv) chloride, tri - i - propyltin(iv) chloride, tri - n - butyltin(iv) chloride, triphenyltin(iv) chloride (e. merck), di - n - octyltin(iv) oxide (aldrich), and disodium salt of 5-guanosine monophosphate (na2(5-gmp) (sigma) were used as received. the elemental analysis, namely, melting points, carbon, hydrogen, nitrogen, and tin of the synthesized compounds was determined on the same instruments as reported earlier [21, 22 ]. infrared and far - infrared spectra were recorded on a perkin - elmer 1600 series ft ir spectrophotometer in the range 4000400 cm from kbr discs and 600200 cm from csi discs. h and c spectra were recorded on a bruker drx 300 (300 mhz ft nmr) spectrometer at the central drug research institute, lucknow, india, using cd3od as solvent and tms as the internal standard. sn nmr spectra were recorded on a bruker drx 500 (500 mhz ft nmr) spectrometer at the institute instrumentation centre, iit, roorkee, india, using dmso - d6/cd3od as solvent and tms as the internal standard [21, 22 ]. sn mssbauer spectra were recorded on mssbauer spectrometer model ms-900 according to the procedure reported previously at the department of chemistry and physics, university of the district of columbia, washington, dc, usa [21, 22 ]. toxicity (ld50 : average lethal dose at 50% survival) and anti - inflammatory activity of the studied derivatives were determined according to the procedures reported earlier [21, 22 ]. na2(5-gmp) (0.814 g, 2.0 mmol) was dissolved in the minimum amount (20 ml) of aqueous methanol (1 : 1 or 50%). it was added an aqueous methanol (20 ml, 1 : 1) solution of dimethyltin(iv) dichloride (0.440 g, 2.0 mmol)/di - n - butyltin(iv) dichloride (0.608 g, 2.0 mmol)/diphenyltin(iv) dichloride (0.688 g, 2.0 mmol) at room temperature (30 2c). the resulting solution was further refluxed with constant stirring for another ~20 h for di - n - butyl / diphenyltin(iv) derivatives, whereas only stirring was carried out at room temperature for dimethyltin(iv) derivative. the solid product thus obtained was washed with water and then with methanol - hexane or methanol - petroleum ether (b.p. 4060c) mixture (1 : 3 v / v) and dried under vacuum. : c 27.30, h 3.82, n 13.26, sn 22.48%. found : c 27.03, h 3.57, n 13.01, sn 22.13%. ir : (nh2)+(oh), 3426 s, 3309 s, 3233 s ; (c = o), 1717 vs ; (nh2), 1635 vs ; (c = n) + (c = c), 1600 s, 1565 s ; (co) in ribose, 1113 vs ; as (po3)/s (po3), 1080 s, 1009 s, 925 w ; ribose pucker, 791 s ; as (snc)/s (snc), 605 w, 565 sh, 530 m ; (sno)/(snosn), 452 m. [n - bu2sn(5-gmp)h2o]n (2) : white solid ; yield 72% ; m.p. calc. for [c18h32n5o9psn]n : c 35.32, h 5.27, n 11.44, sn 19.39%. ir : (nh2)+(oh), 3400 brs, 3230 sh, 3137 s ; (co), 1695 vs ; (nh2), 1650 sh ; (c = n) + (c = c), 1612 m, 1585 sh, 1533 m ; (co) in ribose, 1106 m ; as (po3)/s (po3), 1075 m, 1020 w, 977 m ; ribose pucker, 803 m ; as (snc)/s (snc), 577 w, 512 w ; (sno)/(snosn), 512 w. [ph2sn(5-gmp)h2o]n (3) : cream solid ; yield, 73% ; m.p. calc. for [c22h24n5o9psn]n : c 40.52, h 3.71, n 10.74, sn 18.20%. found : c 40.29, h 3.46, n 10.57, sn 17.91%. ir : (nh2)+(oh), 3413 sbr, 3362 s, 3222 sh ; (co), 1689 vs ; (nh2), 1635 vs ; (c = n) + (c = c), 1598 sh, 1535 vw ; (co) in ribose, 1125 vs ; as (po3)/s (po3), 1023 s, 905 w ; ribose pucker, 860 w ; as (snc)/s (snc), 280 m, 222 w ; (sno)/(snosn), 509 m. the procedure for the syntheses of triorganotin(iv) derivatives of (5-gmp) was same as discussed in the previous paragraph using the stoichiometric ratio of na2(5-gmp) and triorganotin(iv) chloride equal to 2 : 1. [(me3sn)2(5-gmp)h2o]n (4) : white solid ; yield 79% ; m.p. : c 27.19, h 4.56, n 9.91, sn 33.59%. found : c 26.85, h 4.26, n 9.73, sn 33.30%. ir : (nh2)+(oh), 3430 s, 3130 m ; (co), 1691 vs ; (nh2), 1639 w ; (c = n) + (c = c), 1600 sh, 1535 w ; (co) in ribose, 1150 w ; as (po3)/s (po3), 1065 s, 986 m ; ribose pucker, 800 m ; as (snc)/s (snc), 605 w, 513 w ; (sno)/(snosn), 475 sh. [(i - pr3sn)2(5-gmp)h2o]n (5) : white solid ; yield 81% ; m.p. ir : (nh2)+(oh), 3439 sh, 3352 sbr, 3217 w, 3143 sh ; (co), 1687 vs ; (nh2), 1630 vs ; (c = n) + (c = c), 1598 sh, 1535 m ; (co) in ribose, 1115 sh, 1155 w ; as (po3)/s (po3), 1078 s, 996 m ; ribose pucker, 809 w ; as (snc)/s (snc), 610 w, 517 m ; (sno)/(snosn), 470 m. [(n - bu3sn)2(5-gmp)h2o]n (6) : white solid ; yield 72% ; m.p. for [c34h68n5o9psn2]n : c 42.57, h 7.30, n 7.14, sn 24.75%. found c 42.21, h 7.06, n 6.76, sn 24.48%. ir : (nh2)+(oh), 3430 sbr, 3345 sh, 3117 s ; (co), 1691 s ; (nh2), 1650 sh ; (c = n) + (c = c), 1609 m, 1580 sh, 1539 s ; (co) in ribose, 1148 s ; as (po3)/s (po3), 1074 vs, 996 s ; ribose pucker, 822 m ; as (snc)/s (snc), 609 m, 513 m ; (sno)/(snosn), 461 w. [(ph3sn)2(5-gmp)h2o]n (7) : cream solid ; yield 71% ; m.p. for [c46h44n5o9psn2]n : c 51.19, h 4.11, n 6.49, sn 21.99%. found : c 50.83, h 3.88, n 6.33, sn 21.78%. ir : (nh2)+(oh), 3422 sbr, 3213 sh, 3130 s ; (co), 1691 vs ; (nh2), 1635 m ; (c = n) + (c = c), 1604 m, 1535 m ; (co) in ribose, 1143 m ; as (po3)/s(po3), 1065 vs, 996 s ; ribose pucker, 800 m ; as (snc)/s (snc), 276 vsm, 227 m ; (sno)/(snosn), 509 m. reactions of r2sncl2 (r = me, n - bu, and ph) or r3sncl (r = me, i - pr, n - bu, and ph) (aqueous methanol (50%) solution) with na2(5-gmp) in a 1 : 1 and 2 : 1 molar ratio, respectively, led to the formation of organotin(iv) derivatives 17 according to scheme 1. all of the synthesized compounds are obtained as white or cream solid in 6581% yield and stable towards air and moisture. the analytical data of all of the newly synthesized derivatives of (5-gmp) suggest that the resulting complexes are crystallized with 1 : 1 stoichiometry in case of diorganotin(iv) derivatives of (5-gmp), whereas 2 : 1 (sn : 5-gmp) stoichiometry is observed for triorganotin(iv) derivatives of (5-gmp). in the entire studied derivatives one molecule of water is also involved. in the infrared spectra of di- and triorganotin(iv) derivatives of (5-gmp), three bands due to the (nh2) and (oh) are observed in the 31173362 cm region as compared to a single broadband observed at 3314 cm in na2(5-gmp). further, nh2 deformation vibration undergoes some shifts (~10 cm) in these organotin(iv) derivatives as compared to na2(5-gmp) (1638 cm). these shifts may be due to the different extent of hydrogen bonding in organotin(iv) derivatives in the solid - state. an additional band observed beyond 3400 cm in these complexes indicates the presence of water molecule. the (c = o) stretching frequencies observed at 1690 cm in na2(5-gmp) remains almost unchanged upon complexation. the (co) of the hydroxyl group (oh) of the ribofuranose residue in na2(5-gmp) appears at 1116 cm. all of the diorganotin(iv) derivatives of (5-gmp) exhibit (co) frequencies in the region 11061125 cm, whereas all of the triorganotin(iv) derivatives are shown in the region 11431155 cm. these shifts may be attributed to a change in conformation in the ribose ring, and larger shifts in the triorganotin(iv) derivatives may be due to the possibility of bonding of second r3sn(iv) group to the 3-o, which is in agreement with reported value (1143 cm) for (n - bu3sn)2(5-gmp)h2o. ribose pucker marker bands have been reported in the 800850 cm region with a band at ~800 cm associated with the c3-endo and at ~>820 cm associated with the c2-endo, the two most commonly found ribose puckers in nucleotides and nucleic acids. ph2sn(iv) and iso - pr3sn(iv) derivatives have ribose pucker band at 860 and 822 cm, respectively, whereas all other complexes show this band at 805 5 cm, which indicate the c2-endo conformation in the former and c3-endo in the latter complexes. the symmetric stretching vibration of the phosphate group (po3) of na2(5-gmp) gets shifted towards higher wave number except in [ph2sn(5-gmp)h2o]n upon complexation, whereas the smaller shifts are also observed for the asymmetric stretching vibrations in all of the studied complexes, which indicate the bonding of the phosphate group with the organotin moiety. the appearance of new bands of medium intensity in the region 452512 cm in the studied complexes, which may be assigned to (sn o), further confirms the coordination of the (po3), group of (5-gmp) to tin through covalent bonding. therefore, coordination of (5-gmp) through nh2 and c = o groups of nucleobase is unlikely. c2) bands observed at around 594 17 cm and 521 9 cm can be identified as as (sn c) and s(sn c), respectively, which is consistent with the cis - disposition of alkyl groups, whereas for the phenyl derivatives, the corresponding (sn c2) stretching bands are observed in the far - ir region of 222280 cm [21, 22 ]. the structures of r2sn(iv) and r3sn(iv) derivatives of (5-gmp) are considerably more complex than those of guanosine. the sn mssbauer spectra of di- and trialkyltin(iv) derivatives of (5-gmp) exhibit a doublet centered (is) at 1.14 1 and 1.40 mm s, respectively, and quadrupole splitting in the range 3.243.55 mm s and 3.303.35 mm s, respectively, while the is and qs values for [ph2sn(5- gmp)h2o]n are 0.61 mm s and 1.83 mm s, respectively, and those of [(ph3sn)2(5-gmp)h2o]n are 0.95 mm s and 2.52 mm s, respectively. this suggests that the electric field gradient around the tin nucleus is generated by unequal electron densities in the tin - nucleotide bonds like tin - peptide [13, 17, 32 ] and is also due to the geometric distortions. the (qs / is) values (> 2.0 in all of the r2sn(iv)/r3sn(iv) derivatives) suggest a coordination number of tin greater than four, and a significant line intensity asymmetry (the goldanskii - karyagin effect) (except [me2sn(5-gmp)h2o]n) suggests an intermolecularly associated lattice [13, 17, 32 ]. the three possible isomers of r3snl (where l = bidentate ligand) have been reported to have different qs values : qs for isomer (a) 1.72.3 mm s ; for (b) 3.03.9 mm s ; and for (c) 3.54.1 mm s (figure 1). therefore, on the basis of the qs values, the geometry adopted by all of the triorganotin(iv) derivatives would be similar to that as shown in figure 1(b). the slightly low value of qs (2.52 mm s) for triphenyltin(iv) derivatives is in accordance with the reported the fact that qs and is values decrease when an alkyl group is replaced by a phenyl group. therefore, polymeric structures involving a bidentate phosphate group in axial position and three organic groups in equatorial position leading to either 2- or 3-dimensional associated lattice have been proposed for triorganotin(iv) derivatives of (5-gmp) as shown in figure 2. a monomeric structure involving a four coordinate r3sn(iv) moiety bonded individually to (po3) and 3-o has been ruled out on the basis of the presence of only one tin species in sn mssbauer spectra with value greater than four. a considerable number of possible structures (figure 3) may be proposed for diorganotin(iv) derivatives of (5-gmp), which correspond to a distorted trigonal - bipyramidal geometry involving one water molecule with either two axial or axial - equatorial disposition of both organic groups and a bidentate phosphate group (figure 3(a) and figure 3(b)), and a distorted cis - octahedral geometry (figure 3(c)). the structure as shown in figure 3(c) may be ruled out on the basis of sn nmr chemical shift (discussed later) corresponding to five - coordinated tin (table 2). the characteristic resonances in the h, c, and sn nmr spectral data of the studied di- and triorganotin(iv) derivatives of (5-gmp), recorded in dimethyl - sulfoxide - d6, are presented in table 2. the h nmr spectral data of na2(5-gmp) are also included in table 2 for comparison. in di- and triorganotin(iv) derivatives of (5-gmp), all the resonances of (5-gmp) are observed at the expected position as compared to na2(5-gmp). the h-5 resonances are considerably shifted indicating the involvement of (po3) group in bonding with organotin(iv) moiety. the resonances observed due to the tin - alkyl / phenyl protons in the studied organotin(iv) derivatives of (5-gmp) are observed in the expected regions. the downfield shifts in n(1)-h and nh2 resonances may be due to the different extent of hydrogen bonding in the studied derivatives. the c nmr spectra of [n - bu2sn(5-gmp)h2o]n and [(me3sn)2(5-gmp)h2o]n could not be recorded because of their extremely low solubility in dmso - d6/cdcl3/cd3od. the chemical shifts of various magnetically nonequivalent carbons of (5-gmp) have been assigned in the studied derivatives. the c-5 resonances in organotin(iv) derivatives of (5-gmp) are shifted towards downfield upon complexation as compared with that of ligand, which indicate the involvement of phosphate group (po3) in bonding with tin. while all other carbon shifts remains almost unchanged, the c chemical shifts of alkyl and phenyl groups attached to tin are also observed in the expected regions which are consistent with previously reported values [13, 29 ]. the characteristic resonances in the sn nmr spectra of some of the studied derivatives, recorded in dimethylsulfoxide - d6, are also presented in table 2. the satisfactory sn nmr spectra of 1, 2, 4, and 6 could not be recorded due to their poor solubility even in dmso - d6. the sn chemical shifts in iso - pr3sn(iv), ph2sn(iv), and ph3sn(iv) derivatives of (5-gmp) are observed at 256, 225, and 226 ppm, which are characteristic of the five - coordinated organotin(iv) derivatives [13, 17, 21, 22, 32 ]. the anti - inflammatory activity (% inhibition) and toxicity data of di- and triorganotin(iv) derivatives of (5-gmp) are presented in table 3. the activity of the studied derivatives is influenced by the nature of the ligand and the organic groups attached to tin. organotin(iv) derivatives of (5-gmp) show better activity as compared to those of guanosine (~7.519.21% inhibition at 40 mg kg dose), whereas di- and triorganotin(iv) derivatives of (5-gmp) displayed mild - to - moderate anti - inflammatory activity (~15.6420.63% inhibition at 40 mg kg dose) which is significantly lower than that of phenylbutazone (34.56% inhibition). it has been observed that the activity decreases with the increases in size of the alkyl group, that is, me2sn(iv) derivative is better than n - bu2sn(iv), and iso - pr3sn(iv) derivative is better than n - bu3sn(iv) derivative. furthermore, triorganotin(iv) derivatives of guanosine and (5-gmp) show slightly higher activity than the corresponding diorganotin(iv) derivatives. [(ph3sn)2(5-gmp)h2o]n exhibited the highest anti - inflammatory activity (20.63% inhibition) among the studied derivatives. the higher activity of diphenyltin(iv) and triphenyltin(iv) derivatives of (5-gmp) among the studied derivatives may be due to the formation and frequent transportation of ph2sn(iv)/ph3sn(iv) moiety across the cellular membrane as part of the mechanism for inhibition. the observed ld50 values (table 3) indicate that di- and triorganotin(iv) derivatives of (5-gmp) are less toxic (ld50 > 400 mg kg) than the corresponding derivatives of guanosine (ld50 > 200 mg kg). further, it has been observed that the ld50 values of the studied derivatives are comparable (> 400 mg kg) with those of other compounds reported earlier and much higher than those of the diorganotin(iv) derivatives of the simple -amino acids (< 50 mg / kg), indicating that the bigger biomolecules lower the toxicities. | reaction(s) of 5-guanosine monophosphate (5gmp) with di- and triorganotin(iv) chloride(s) led to formation of organotin(iv) derivatives of general formulae, [r2sn(5-gmp)h2o]n and [(r3sn)2(5-gmp)h2o]n, where r = me, n - bu, and ph ; r = me, i - pr, n - bu, and ph ; (5-gmp)2 = 5-guanosine monophosphate. an attempt has been made to prove the structures of the resulting derivatives on the basis of ft - ir, multinuclear 1h, 13c, and 119sn nmr and 119sn mssbauer spectroscopic studies. these investigations suggest that both di- and triorganotin(iv)-5-guanosine monophosphates are polymeric in which (5-gmp)2 is bonded through phosphate group resulting in a distorted trigonal bipyramidal geometry around tin. the ribose conformation in all of the derivatives is c3-endo, except diphenyltin(iv) and tri - i - propyltin(iv) derivatives where it is c2-endo. all of the studied derivatives exhibited mild - to - moderate anti - inflammatory activity (~15.6420.63% inhibition) at 40 mg kg1 dose and ld50 values > 400 mg kg1 in albino rats. |
platelet - rich plasma (prp) is a platelet concentrate in a small plasma volume. these proteins are capable of enhancing cell adhesion and act like a matrix for the formation of bone, connective tissue and epithelium.1 platelets contain growth factors in their alfa granules, such as platelet - derived growth factor, transforming growth factor- and insulin - like growth factor - i which, once released, may positively regulate the wound - healing process.1 the therapeutic administration of prp ranges from the treatment of multiple musculoskeletal disorders to the regeneration and accelerated healing of a wide range of tissues. however, there are controversies in the literature regarding the potential benefits of this procedure. although some authors have reported significant improvements in tissue healing and bone formation using platelet - rich plasma,26 others have not.710 such discrepancies are probably related to the lack of suitable standardization and definition of the different prp preparations.11 the protocols and surgical techniques used in the preparation and administration of the prp differ widely.12,13 variations in some key properties of the prp, such as the platelet concentration, can greatly influence the different biological effects.11 according to whitman and marx,15 prp is prepared by the discontinuous cell separation method from a blood volume of approximately 450 ml. however, this protocol for prp preparation involves sophisticated technology and a large blood volume, limiting its use to blood transfusion medical centers or hospital facilities.16 therefore, equipment capable of producing small amounts of prp has become available commercially. this seems to have resulted in higher acceptance by patients because of lower cost and the feasibility of being conducted in non - hospital environments.17 several simplified protocols for the preparation of prp have been developed to facilitate its clinical application.2,18,19 however, these protocols must be followed carefully, taking several technical issues into account. basically, the centrifugation process for prp preparation must be sterile and precisely suited to platelet separation from red blood cells and their sequestration in high concentrations without any damage or lysis that might trigger the premature release of gfs.1 it must be remembered that the prp platelet count is strictly dependent on the type of protocol used for prp preparation.20 according to marx,1 prp should have a platelet concentration 300 to 400% greater than that of the whole blood in order to be considered a lower concentrations are reportedly unreliable in enhancing wound healing, while higher concentrations have not been shown to further enhance wound healing.21 marx stated that a double - centrifugation technique is necessary to truly concentrate platelets from autologous blood. on the other hand, anitua2,22 described using a single - spin technique, although the platelet concentrations obtained by this procedure were not reported. in spite of the amount of platelets, anitua has demonstrated enhancement and acceleration of bone regeneration and more rapid and predictable soft tissue healing in future sites for implants that were treated with prp prepared according to a single - spin technique.2 other authors have reported obtaining platelet concentrations of 356% using the single - spin technique.23 the purpose of this study was to compare the quantity and quality of platelets in prp samples prepared using either the single- or the double - centrifugation protocol in an animal model. the experimental protocol was approved by the so paulo state university, unesp, dental school of araatuba institutional animal care and use committee. ten adult male white new zealand rabbits weighing 2.8 to 4 kg (unesp, dental school of araatuba, animal care unit) were used in this study. an endoparasitosis control program, including vaccination, vermifungal treatment regimen and balanced diet was instituted. the animals were housed in individual cages at room temperature and were fed solid chow and water ad libitum. the animals were anesthetized by intramuscular injection of xylazine (10 mg / kg body weight) and ketamine (1.5 mg / kg body weight). a) cardiac puncture and blood sample collection : a 10 ml volume of autologous blood was drawn from each animal via cardiac puncture. each blood sample was divided into two 5 ml vacuum tubes containing 10% sodium citrate. the two 5 ml blood samples were randomly assigned to one of the following groups : group i, in which the prp was prepared according to a single - centrifugation protocol,2 or group ii, in which the prp was prepared according to a double - centrifugation protocol.19 b) protocol for prp preparation in group i : the separation of the blood cell elements was performed using a laboratory centrifuge (beckman j-6 m induction drive centrifuge, beckman instruments inc., the blood samples were centrifuged at 160 g for 6 minutes at room temperature resulting in three basic components : red blood cells (bottom of the tube), prp (middle of the tube) and platelet - poor plasma (ppp) (top of the tube). next, a mark was made 2 mm below the line separating the middle component from the lower component of the tube. all content above this point (approximately 1.2 ml) was pipetted and comprises the volume of prp. c) protocol for prp preparation in group ii : first centrifugation : the separation of the blood cell elements was performed using a laboratory centrifuge (beckman j-6 m induction drive centrifuge, beckman instruments inc., the tubes were centrifuged at 160 g for 20 minutes at room temperature resulting in two basic components : blood cell component (bcc) in the lower fraction and serum component (sec) in the upper fraction. second centrifugation : a mark was made 6 mm below the line that separated the bcc from the sec. to increase the total amount of platelets collected for the second centrifugation, all content above this point was pipetted and transferred to another 5 ml vacuum tube without anticoagulant. the sample was then centrifuged again at 400 g for 15 minutes resulting in two components : sec and prp. the platelets in the whole blood and prp samples from groups i and ii were counted manually in the neubauer chamber. two parameters, based in part on the study by tamimi,21 were evaluated for the prp samples : platelet increase compared to whole blood and platelet concentration. these values were calculated using the following equations : % platelet increase over whole blood = platelet count of prpplatelet count of whole bloodplatelet count of whole blood100 platelet concentration (%) = platelet count of prpplatelet count of whole blood100 prp and whole blood were also used to perform smears which were stained with (laborclin, pinhais, pr, brazil) in order to reveal the morphology of the blood cells and platelets. the platelet counts and the analysis of the platelet morphology were performed by a veterinary hematologist blinded to the prp preparation protocol used. the significance of differences between the whole blood and the prp platelet counts as well as between the prp platelet counts of groups i and ii was determined by an analysis of variance (repeated measures anova), followed by a post hoc tukey s test when the anova suggested a significant difference between groups (p<.05). pearson s correlation coefficient (rp) was used to demonstrate the relationship between the platelet counts from the prp and whole blood samples of groups i and ii. the experimental protocol was approved by the so paulo state university, unesp, dental school of araatuba institutional animal care and use committee. ten adult male white new zealand rabbits weighing 2.8 to 4 kg (unesp, dental school of araatuba, animal care unit) were used in this study. an endoparasitosis control program, including vaccination, vermifungal treatment regimen and balanced diet was instituted. the animals were housed in individual cages at room temperature and were fed solid chow and water ad libitum. the animals were anesthetized by intramuscular injection of xylazine (10 mg / kg body weight) and ketamine (1.5 mg / kg body weight). a) cardiac puncture and blood sample collection : a 10 ml volume of autologous blood was drawn from each animal via cardiac puncture. each blood sample was divided into two 5 ml vacuum tubes containing 10% sodium citrate. the two 5 ml blood samples were randomly assigned to one of the following groups : group i, in which the prp was prepared according to a single - centrifugation protocol,2 or group ii, in which the prp was prepared according to a double - centrifugation protocol.19 b) protocol for prp preparation in group i : the separation of the blood cell elements was performed using a laboratory centrifuge (beckman j-6 m induction drive centrifuge, beckman instruments inc., the blood samples were centrifuged at 160 g for 6 minutes at room temperature resulting in three basic components : red blood cells (bottom of the tube), prp (middle of the tube) and platelet - poor plasma (ppp) (top of the tube). next, a mark was made 2 mm below the line separating the middle component from the lower component of the tube. all content above this point (approximately 1.2 ml) was pipetted and comprises the volume of prp. c) protocol for prp preparation in group ii : first centrifugation : the separation of the blood cell elements was performed using a laboratory centrifuge (beckman j-6 m induction drive centrifuge, beckman instruments inc., the tubes were centrifuged at 160 g for 20 minutes at room temperature resulting in two basic components : blood cell component (bcc) in the lower fraction and serum component (sec) in the upper fraction. second centrifugation : a mark was made 6 mm below the line that separated the bcc from the sec. to increase the total amount of platelets collected for the second centrifugation, all content above this point was pipetted and transferred to another 5 ml vacuum tube without anticoagulant. the sample was then centrifuged again at 400 g for 15 minutes resulting in two components : sec and prp. the platelets in the whole blood and prp samples from groups i and ii were counted manually in the neubauer chamber. two parameters, based in part on the study by tamimi,21 were evaluated for the prp samples : platelet increase compared to whole blood and platelet concentration. these values were calculated using the following equations : % platelet increase over whole blood = platelet count of prpplatelet count of whole bloodplatelet count of whole blood100 platelet concentration (%) = platelet count of prpplatelet count of whole blood100 prp and whole blood were also used to perform smears which were stained with pantico rpido lb (laborclin, pinhais, pr, brazil) in order to reveal the morphology of the blood cells and platelets. the platelet counts and the analysis of the platelet morphology were performed by a veterinary hematologist blinded to the prp preparation protocol used. the significance of differences between the whole blood and the prp platelet counts as well as between the prp platelet counts of groups i and ii was determined by an analysis of variance (repeated measures anova), followed by a post hoc tukey s test when the anova suggested a significant difference between groups (p<.05). pearson s correlation coefficient (rp) was used to demonstrate the relationship between the platelet counts from the prp and whole blood samples of groups i and ii. two animals were excluded from the study after blood centrifugation for prp preparation in group i. the low ppp volume in these samples did not allow for preparation of the prp as specified in the single - centrifugation protocol. the prp smears of both groups i and ii showed higher concentrations of platelets than their respective whole blood smears (figure 1). in both groups, numerous packed red blood cells were seen surrounding compact round platelet aggregates. only the prp smears from group ii presented platelets with altered morphology. from eight prp smears analyzed from each group, six prp smears of group ii showed some deformed platelets suggestive of elongated pseudopodia (figure 2). a few lymphocytes with increased cytoplasm were observed in the prp smears of both groups i (2 prp smears) and ii (5 prp smears) (figure 3). the average prp platelet count in group i was 781,875 217,693/l, whereas it was 1,986,875 685,020/l in group ii (figure 4). significant differences were observed between the platelet counts from the prp samples of groups i and ii (p<.05). significant differences between the whole blood and prp platelet counts were observed only in group ii (p<.05). a significant correlation was observed between the platelet count from the whole blood and prp samples in groups i (rp=0.93, p=0.002) and ii (rp=0.89, p=0.0010) platelet concentration of prp and platelet increase over whole blood samples between groups i and ii are depicted in table 1. the percentage increase in the platelet count of prp compared to whole blood was higher in group ii than in group i (table 1). two animals were excluded from the study after blood centrifugation for prp preparation in group i. the low ppp volume in these samples did not allow for preparation of the prp as specified in the single - centrifugation protocol. the prp smears of both groups i and ii showed higher concentrations of platelets than their respective whole blood smears (figure 1). in both groups, numerous packed red blood cells were seen surrounding compact round platelet aggregates. only the prp smears from group ii presented platelets with altered morphology. from eight prp smears analyzed from each group, six prp smears of group ii showed some deformed platelets suggestive of elongated pseudopodia (figure 2). a few lymphocytes with increased cytoplasm were observed in the prp smears of both groups i (2 prp smears) and ii (5 prp smears) (figure 3). the average prp platelet count in group i was 781,875 217,693/l, whereas it was 1,986,875 685,020/l in group ii (figure 4). significant differences were observed between the platelet counts from the prp samples of groups i and ii (p<.05). significant differences between the whole blood and prp platelet counts were observed only in group ii (p<.05). a significant correlation was observed between the platelet count from the whole blood and prp samples in groups i (rp=0.93, p=0.002) and ii (rp=0.89, p=0.0010) platelet concentration of prp and platelet increase over whole blood samples between groups i and ii are depicted in table 1. the percentage increase in the platelet count of prp compared to whole blood was higher in group ii than in group i (table 1). different prp preparation protocols may result in varying platelet concentrations, and thus different biologic effects may occur.21,24,25 the platelet count should be one of the key factors by which to standardize studies investigating the regenerative capacity of prp.26 in addition, qualitative alterations in the platelets may also affect the regenerative potential of prp.27 according to marx,1 platelets damaged or rendered nonviable by the protocol used to process the prp will not secrete bioactive growth factors. the present study evaluated both the quantity and quality of platelets in prp samples prepared according to two different protocols. according to marx, a therapeutic prp should present approximately one million platelets per microliter in humans, considering that the whole blood contains approximately 200,000 75,000 platelets per microliter. therapeutic prp is one that has an average percentage increase of approximately 400% in the platelet count. studies in dogs and rabbits have demonstrated that a 4-fold increase in the platelet concentration was effective in accelerating bone healing.25,28 in the present study, the animals showed an average whole blood platelet count of 446,389 platelets per microliter, which is within the normal range for the animal model used.29 in this study, only the double centrifugation protocol used in group ii produced a therapeutic prp (table 1). the low platelet concentrations obtained in the prp samples of group i are most likely attributable to the fact that only a single centrifugation was used in this protocol. according to marx, clinicians should use either a double - centrifugation technique or some other fda approved system specifically developed for prp preparation.1,30 in the double - centrifugation protocol, the first spin (called the hard spin) separates the red blood cells from the plasma, which contains the platelets, the white blood cells and the clotting factors. the second spin (called the soft spin) further separates the platelets, white blood cells and few remaining red blood cells from the plasma. instead, it would produce a mixture of prp and ppp, resulting in disappointingly low platelet concentrations.1 in the present study, the double - centrifugation protocol yielded increases in platelet concentrations similar to those obtained in humans with two systems developed specifically for prp preparation (pccs, 3i, inc., palm beach gardens, fl, usa and harvest technologies, plymouth, ma, usa).1 in addition to the number of centrifugations, there are several important factors that should be considered with regard to the prp preparation method chosen. an increase in g may result in higher platelet concentrations.3 in the present study, blood centrifugation at 400 g (group ii) provided a significantly higher platelet concentration than did blood centrifugation at 160 g (group i). however, it is important to remember that increasing the g used for the centrifugation may prematurely activate the platelets.31 platelets can also be prematurely activated by excessive pipetting32,33 or by the type of anticoagulant used during the preparation of prp.29,30 the effects of the protocol to prepare prp on the quality of the concentrated platelets were evaluated in this study through platelet smear analysis. smears are valid to evaluate many parameters that are indicative of platelet function, such as changes in morphology, size, shape, staining characteristics, degree of activation and clump formation, distribution of granules and appearance of vacuoles.34 in the present study, the prp smears of group ii showed some deformed, round - shaped platelets which may indicate premature platelet activation. premature activation would lead to an early release of growth factors, causing them to move to the top of the tube when centrifuged. thus, the resultant prp would be poor in growth factors.21 since the levels of growth factors present in the prp samples of the present study were not measured, further studies are required to confirm this hypothesis. additionally, the prp smears of both groups had some lymphocytes with increased cytoplasm. this observation is consistent with activation of the immune response resulting in increased synthesis and release of cytokines by white blood cells, which could prematurely activate platelet degranulation and thus cause a decrease in the number of growth factors present at the time the prp is placed.21 a recent in vivo study lends support to this hypothesis. radiographic and histomorphometric analyses were conducted to evaluate bone healing in the calvaria of rabbits following the use of autogenous grafts combined with prp obtained by either a single- or double - centrifugation protocol.35 the combination of prp with autogenous bone did not improve the initial healing process, irrespective of the prp preparation protocol used. according to the authors, both protocols may have harmed platelets or caused them to degranulate prematurely, thus reducing the effect of prp. from a clinical standpoint, a second important consideration is that the platelet concentration process used to prepare the prp be very reliable.20 both protocols evaluated in the present study showed a high correlation between the whole blood and prp platelet counts (group i - rp=0.93 and group ii - rp=0.89). therefore, the level of correlation between these two parameters suggests that the whole blood platelet count can be used as an estimate of the platelet count likely to be produced by the two protocols evaluated in this study. significant variations in hematocrit between subjects must also be considered when choosing a method of prp preparation. the single - centrifugation protocol used in this study did not result in any prp being produced in two animals whose samples had a total plasma volume smaller than 1 ml after blood centrifugation because the protocol requires that 1 ml of ppp be discarded. after pipetting and discarding the upper layer of ppp, there was only the rbc layer left. however, the double - centrifugation protocol was able to produce prp in both animals. it is important to emphasize that, in this study, the final volume of the prp samples in groups i and ii were different (1.2 ml and 0.5 ml, respectively). according to efeoglu,29 the platelet concentration may be higher in a small volume of plasma than in a greater volume of plasma. the findings of the present study corroborate this statement because the protocol used in group ii led to a significantly greater amount of platelets in prp samples than the one obtained in prp samples of group i. the selection of the animal model used is also very important because some have blood volumes too small to produce autologous prp, thus necessitating the use of donor blood for the prp preparation protocol. the use of homologous prp could compromise the reliability of the results of those studies because, according to marx,1 only autologous prp is true prp. in the present study, prp was prepared using a small blood volume (10 ml). the total amount of blood that can be collected from an adult new zealand rabbit without risking its life is limited to 15 ml.29 therefore, the amount of blood collected in this study allowed autologous prp preparation without causing any systemic problems. new zealand rabbits are also easy to obtain and can be cared for at affordable prices. this makes them a favorable alternative in experimental studies investigating the biological effects of prp.29 finally, the platelet count method used in this study was important as well since there is no consensus regarding the ideal method to quantify this blood element. studies have raised doubts about the level of agreement between manual and automated platelet counts.3539 although some authors have discussed the advantages of automated platelet counts,40 others have concluded that this method is less reliable than manual counts, especially in cases of thrombocytopenia.36,37 therefore, manual platelet counts were used in the present study. the controversies regarding the influence of prp on wound healing should be re - examined, taking into consideration many variables including the protocol used for prp preparation. within the limits of this study, it can be concluded that the double - centrifugation protocol used in this study achieved higher platelet concentrations than did the single - centrifugation protocol used in this study. however, the double - centrifugation protocol caused alterations in platelet morphology and was more sensitive to small processing errors. due to the small n numbers in each study group, | objectives : the purpose of this study was to compare the quantity and quality of platelets in platelet - rich plasma (prp) samples prepared using either the single- or the double - centrifugation protocol.methods:ten adult white new zealand rabbits were used. ten ml of blood were drawn from each animal via cardiac puncture. each blood sample was divided into two equal parts for prp preparation : 5 ml of blood were centrifuged according to a single - centrifugation protocol (group i), and 5 ml were centrifuged according to a double - centrifugation protocol (group ii). manual platelet counts were performed on the whole blood and prp samples of each group. smears were also done on all samples in order to see the morphology of the platelets. the data obtained in the manual platelet count were submitted to statistical analysis (repeated measures anova, tukey, p<.05).results : the average whole blood platelet count was 446,389/l. the prp samples in group ii presented an average platelet amount significantly higher than that of group i (1,986,875 685,020/l and 781,875 217,693/l, respectively). the prp smears from group ii were the only one to present platelets with altered morphology (75% of the smears). a few lymphocytes with increased cytoplasm were observed in the prp smears of both groups i (25% of the smears) and ii (62.5% of the smears).conclusions : within the limits of this study, it can be concluded that the double - centrifugation protocol resulted in higher platelet concentrations than did the single - centrifugation protocol. however, the double - centrifugation protocol caused alterations in platelet morphology and was more sensitive to small processing errors. |
thoracolumbar penetrating spinal cord injury (sci) often produces motor and sensory alterations in hindlimbs. promising pharmacological treatments and treadmill locomotion training are used for inducing restoration of locomotion and spinal reflexes after contusive, compressive lesions or by a penetrating sci [24 ]. locomotion disturbances occur in concordance with the type of injury and the spinal cord area suffering the trauma [5, 6 ]. axonal and neuronal death is an important secondary effect after a penetrating injury in brain and spinal cord lesions [7, 8 ]. tamoxifen has been shown to be an effective treatment to brain and spinal cord injuries ; it has been proposed as an inflammatory response modulator and participates in locomotion recovery after a sci [2, 8, 9 ]. tamoxifen is a selective estrogen receptor modulator (serm) acting on - and -estrogen receptors ; also, it is been shown to prevent demyelination and promote differentiation to oligodendrocytes from multipotential cells in the cerebral cortex. it is unknown whether tamoxifen exerts neuroprotective effects in cats after a sci. in this study, experiments were made on cats with a t13-l1 level spinal cord hemisection and the effects of tamoxifen were assessed by evaluating the survival of neurons in the spinal cord, axonal myelin preservation, or remyelination and by analyzing the kinematic angular displacement of both hindlimbs during unrestricted gait. adult male cats were used in this study (laboratory animal center of the guadalajara university, 3.54 kg, n = 9). all the procedures described here were performed with the guidelines contained in the national institutes of health guide for the care and use of laboratory animals (usa) and with the ethical considerations stipulated in the experimental animal treatment on the official mexican norm (nom-062-zoo-1999). experiments were approved by the ethics committee for research and biosafety (universidad de guadalajara). cats were divided in three groups : intact (int, n = 3), injured and treated with tamoxifen (iwt, n = 3), and injured without tamoxifen (iwot, n = 3). a prophylactic antibiotic treatment was given (gentamicin 2 mg / kg i.m.). the cats were anesthetized with ketamine (10 mg / kg i.p.) and xylazine (1 mg / kg i.p.) for performing spinal cord injury. the dorsal surface of the t12 vertebra was exposed and the apophysis was removed with a surgical gouge. a microdrill was used for opening the right lamina, and a surgical blade (hergom number 11) for hemisecting the spinal cord segment. after surgery, a drop of medical grade cyanoacrylate was applied on the dura mater and bone wax was used to cover the vertebra. animals were treated for three days with postoperative antibiotics (gentamicin 2 mg / kg i.m.). iwt cats received tamoxifen (1 mg / kg i.p.) at days 0, 1, and 2 dai (days after injury). animals had free access to water and food and were housed one per cage (1 m height 1 m wide 1 m tall) to allow them to move freely. prior to the surgery, animals were trained to walk through a transparent acrylic passway (200 cm long 50 cm high 20 cm width) daily during one week, in order to record a basal walk kinematic in cats. video contrasting dots were placed in the iliac crest, hip (i.e., greater trochanter), knee, ankle (i.e., lateral malleolus), and fifth metatarsal phalangeal joints. the marks were placed in both hindlimbs and videotaped with a 30-frame - per - second video camera (sony fdr - ax100). total video converter (shareware) was used for decomposing the video into individual frames and the cartesian coordinates of each joint mark were determined by the image j software (scion corporation, nih). subsequently, the joint mark coordinates were introduced in a labview environment computer program (developed in cinvestav, ipn, mxico). line graphs were constructed to illustrate the hindlimb movements from at least 3 consecutive strides. the computer program also calculates the hip and knee joint angles in a movement sequence executed by the ipsilateral and contralateral hindlimbs during strides. the joint angular displacement (jad) was calculated from the difference between the maximum and minimal angular values of each stride. in addition, hindlimb plm was analyzed by determining the angle between a line drawn from the iliac crest to the ankle and the y - axis (figure 1). control kinematics data was obtained prior to spinal cord injury in all subjects ; subsequently, the experimental values were acquired at 4, 16, and 30 dai in iwt and iwot groups. all data were normalized and were graphically represented as a percent of the angular displacement. at 30 dai cats were deeply anesthetized (pentobarbital euthanasia dose 50 mg / kg i.m.) and intracardially perfused with 500 ml of 0.1 m phosphate buffered saline (pbs) containing 0.5 ml of heparin (1000 u.i./ml), followed by 500 ml of a fixative solution (4% paraformaldehyde in 0.1 m pbs). the spinal cord segment t13-l1 was extracted and placed in the fixative solution during 24 hours and then washed in 0.1 m pbs for another 24 hours. the spinal cord segment was cryoprotected in 0.1 m pbs containing 30% of sucrose and 30% ethylene glycol for 72 hours. subsequently, the spinal cord segment was divided in three regions : (1) injury site (is), (2) cuts initiating 200 m rostral from the injury site (rfi), and (3) cuts initiating caudally from the injury site (cfi). the tissue was embedded in leica tissue freezing medium and representative 15 m thick coronal cuts of each section were obtained from the t13-l1 segment using a leica cm1850 cryostat. nine coronal cuts were placed per each slide ; two slides per section were stained and analyzed. a hematoxylin and eosin (h&e) staining protocol was used for evaluating the histopathology status (observing whether wallerian degeneration occurred ; and the lesion similarity) of the spinal cord in int, iwt, and iwot cats. hematoxylin solution was used for 5 minutes per slide and alcoholic eosin y solution (0.5% eosin in 90% ethanol) for 30 seconds ; slides were washed with tap water for 5 minutes after staining. toluidine blue staining protocol was used for assessing myelin thickness after sci in all groups. o - toluidine hydrochloride solution (3% o - toluidine in 0.1 m acetate - acetic buffer ph 5.0) was used for 5 minutes per slice ; 2-minute washing was performed with tap water. subsequently, an ethanol dehydration protocol was applied and the slices were mounted with entellan. the ventral white matter was visualized with light microscopy (olympus, bx51w1) and photographed with a high resolution camera (canon eos rebel t3). a 300 m square microscopic field was delimitated for establishing a qualitative white matter axon observation using the portable olympus image pro plus software v 6.0. the myelin area was determined in axons from the ventral white matter (cat 1, n = 30 ; cat 2, n = 20 ; cat 3, n = 30, per analyzed section) ; the inclusion criterions were maximum diameter of 15 m and a round - like morphology. this study was performed using an image software analyzer (motic images plus 2.0). the axonal myelin area was determined by establishing a perimeter trace around the outer myelin sheet and a second perimeter trace around the inside myelin sheet. the nonspecific antigen binding sites were blocked by a 10% normal goat serum for 1 hour at room temperature. the sections were incubated for 18 hours with the primary antibody at 4c : anti - fox3 for neurons, previously known as neun (abcam 104225, 1 : 1000). the slices were washed between incubations (three times) in pbs for 10 min. after primary antibody, the slices were incubated with the goat polyclonal secondary antibody : anti - igg alexa fluor 488 conjugated anti - rabbit (invitrogen a-11008, 1 : 1000) during 2 hours at room temperature. after the secondary antibody, tissues were incubated with 4,6-diamidino-2-phenylindole (dapi) (molecular probes d3571, 1 : 100) for 5 minutes. nine coronal cuts per slide were placed manually, and three slides were evaluated in each level (cat 1 : 18 cuts for rfi, 18 cuts for is, and 18 cuts for cfi ; cat 2 : 18 cuts for rfi, 18 cuts for is, and 18 cuts for cfi ; cat 3 : 18 cuts for rfi, 18 cuts for is, and 18 cuts for cfi) ; the ethanol dehydration protocol was applied and sealed with entellan. neurons were counted using a digital image software (portable olympus image pro plus software v 6.0), adapted to a fluorescence microscope. six microscopic fields (500 m) were studied in the dorsal horn (dh ; rexed lamina i and ii), ventral horn (vh ; rexed lamina viii and iv), and periaqueductal zone (paz ; rexed lamina x), ipsilateral and contralateral to the injury. all data is expressed as mean sd. neurons (n = 18 cuts per slide) and myelin morphometric (n = 30) data was analyzed using a nonparametric kruskal - wallis test and mann - whitney u test for multiple comparisons. kinematic assessment was analyzed using a nonparametric friedman test followed by wilcoxon post hoc test for multiple specific comparisons. ibm spss (release 20.0.0) software was used for statistical tests and graphs were made using statistical software (graphpad prism 6.0). a schematic drawing of the spinal cord damage for treated and untreated cats is illustrated in figures 2(b) and 2(c). the spinal cord slices from intact cats show defined borders between gray and white matter. the gray matter showed a purple homogeneous color definition (basophilic staining, figure 2(d)). considerable damage, involving a large portion of the ipsilateral white and gray matter, is observed in the iwot spinal cord tissue. the border between white and gray matter disappeared ; the contralateral white matter showed hypochromic staining and the gray matter has poor basophilic and eosinophilic staining features showing abnormal characteristics (figure 2(e)). in iwt cats, also tissue hallows as well as poor delimitation of white and gray matter were observed. in contrast, the contralateral side has preserved normal characteristics (figure 2(f)). a qualitative assessment of the ventral white matter axons was made. symmetrical axon morphology and a purple homogeneous color definition were observed in intact white matter, and there is no tissue inflammation or hollows (figures 3(a), 3(f), and 3(k)). at the is in the iwot cats, axons in the ventral white matter of the ipsilateral side appeared with spheroid morphology (figure 3(g)). in the contralateral side, a hypochromic staining with wallerian degeneration characteristics was observed (figure 3(i)). in iwt cats, axons appeared with a clearly defined morphology which was similar to int cats axons at the ipsi- and contralateral side (figures 3(h) and 3(j)). similar normal stained characteristics were observed in cfi (figures 3(l)3(o)). at rfi, myelin in int, iwt, and iwot ventral axons is illustrated in figures 4(a)4(o) ; intact axon myelin thickness in ventral axons was considered as 100%. ipsilateral is axonal myelin was reduced to 29.7 2.4% in iwot cats ; in iwt cats, myelin was reduced to 64 2.0% with a significant differences between groups (p < 0.001) (figure 4(q)). contralateral side myelin was reduced to 28.7 6.7% in iwot cats and to 65 11.06% in iwt cats (p < 0.001). similar results were obtained in the rfi and cfi regions (figures 4(p) and 4(r), resp.). iwt and iwot groups showed significant ipsilateral and contralateral statistical changes in the myelin percentages in comparison with int cats. these changes occurred in is, rfi, and cfi regions (figures 4(p)4(r)). although the previously mentioned results were normalized to percentage values, real myelin thickness values fox-3/dapi positive cells were counted for evaluating spinal cord neuronal survival in int, iwo, and iwt cats. at 30 dai, an increase of the neuronal survival in tamoxifen treated cats was observed, particularly in the ventral zone (figures 5(a)5(r)). the number of neurons in int, iwt, and iwot groups in ipsilateral and contralateral side at the is, rfi, and cfi regions is plotted in figure 6. at 30 dai, vh neurons decreased in is, rfi, and cfi regions on both sides in iwt and iwot cats. the number of ipsilateral and contralateral neurons was partially recovered by tamoxifen treatment (table 1, figures 6(c), 6(f), and 6(i)). spinal cord damage reduced paz neurons in all studied regions, in treated and untreated cats (table 1, figures 6(b), 6(e), and 6(h)). dh neurons quantities did not change in the is and the cfi site, in ipsilateral or contralateral spinal cord. this partial neuronal preservation occurred in treated and untreated cats (figures 6(d) and 6(g)). it is important to mention that dh neurons were significantly reduced in the rfi region in untreated cats but recovered in treated cats in ipsilateral and contralateral spinal cord regions (figure 6(a)). three consecutive ipsilateral hindlimb (ihl) and contralateral hindlimb (chl) strides were recorded (figure 7). in normal stepping cats, the ihl and chl executed symmetrical steps with well - defined stance and swing phases (figures 7(a) and 7(h)). in contrast, at 4 dai, ihl exhibited asymmetrical steps and limb dragging in both iwt and iwot cats (figures 7(b) and 7(c)). at 16 dai, we observed that iwt and iwot cats partially recovered their gait locomotor movements (figures 7(d) and 7(e)). at 30 dai, treated and untreated cats ilh showed a normal stepping sequence, indicating complete gait locomotion recovery (figures 7(f) and 7(g)). at 4 dai, iwot cats exhibited an altered stride and oscillatory - like hip movements (as a compensatory process for maintaining gait locomotion and avoiding animal downfall) (figure 7(i)). stride alteration continued at 16 dai (figure 7(k)) and partial locomotion recovery is observed at 30 dai (figure 7(m)). in iwt cats, a locomotion recovery was observed at day 16 and it was clearly maintained until 30 dai (figures 7(l)7(n)). the hip angular displacements in the ihl and chl in iwt and iwot cats are illustrated in figure 8. ipsilateral hip ad values in both groups of animals (iwt and iwot cats) decreased approximately by 40% at 4 dai but returned to their base values at 16 and 30 dai (figure 8(a) and table 2). whereas the iwot cat contralateral hip exhibited a significant decrement in jad values (nearly 50%) at 4 and 16 dai, in contrast, the contralateral hip of iwt cats showed a considerable increment in jad values (nearly to 150% ; table 2) at 4 and 16 dai and recovered their base values at 30 dai (tables 2 and 3, figure 8(b)). at 4 and 16 dai, the ipsilateral knee of iwot cats exhibited a statistically significant decrease in jad values, approximately 50%, whereas the knee joint of iwt cats showed an increment in jad values of approximately 50%. both groups (iwt and iwot cats) returned to their base values at 30 dai (figure 8(c)). no significant changes were observed in the contralateral knee (tables 2 and 3, figure 8(d)). in hindlimb plm, both ipsi- and contralateral had values recovered faster in cats treated with tamoxifen, as compared to nontreated animals. at 4 dai, ihl angular displacement values showed a statistically significant decrease in both, iwt and iwot groups. iwt cat 's pendulum - like movement values showed partial recovery at 16 dai and nearly a 100% recovery at 30 dai. at 30 dai, pendulum - like movement of iwot cats recovered by nearly 90% (tables 2 and 3, figure 8(e)). at 4 and 16 dai, ihl angular displacement values in iwot cats increased by 50% and 20%, respectively. at 30 dai, angular displacement values, no differences occurred in the contralateral plm (tables 2 and 3, figure 8(f)). the penetrating injury applied in our model produced a degeneration process characterized by spheroid axons and tissue hollows occurring in ipsilateral as well as in the contralateral side of the injury. a wallerian degenerative process seems to be occurring on both sides in accordance with previous results, reporting an axonal wallerian degeneration after a spinal cord injury [12, 13 ]. tamoxifen is serm acting on the -estradiol estrogen receptors (er) [14, 15 ]. in addition, it produces neuronal protection after brain penetrating injury and reduces microglia reactivity. in rats, tamoxifen reduces the inflammatory process after a spinal cord injury and the neuronal death. further experiments studying tamoxifen 's effects on neural inflammation process, neurotrophic factors, and inflammatory interleukins would be required for comparing tamoxifen 's effects in cats to those observed in rats. contusion impact in a cat 's spinal cord produces an altered axonal morphology. in our study, tamoxifen reduced spheroid axons in the ipsilateral spinal cord in iwt cats, recovering a quasi - normal morphology. this preservation could be favored by an inhibition of the glutamate excitotoxicity after the injury and also by an attenuation of inflammatory mediated damage [8, 19 ]. previous works indicate that tamoxifen promotes ng2 multipotent progenitor cell differentiation changing into oligodendrocytes and could favor remyelination after rat brain penetrating injury [7, 21 ]. rat spinal cord contusion produces deleterious effects in neurons at 24 hours [22, 23 ]. after one month, they were attributed to an inflammatory process. in iwot cats, at 30 dai, after the spinal cord injury, the number of positive fox-3 cells was reduced on both ipsilateral and contralateral sides. in iwt cats, the number of neurons in vh and dh is similar to the number in int cats. this result could be related to the morphological er distribution in the thoracolumbar spinal cord, as reported in other animal species [2426 ]. this effect could be attributed to a minor amount of er of the paz neurons. it has been demonstrated that estrogen receptors are poorly expressed in periaqueductal neurons and are present mostly in the ventral horn in the female cat 's lumbosacral spinal cord. further experiments must be performed for evaluating the spinal cord er distribution in male cats. therefore, important contralateral plastic changes could be contributing to a rapid locomotion recovery but not through the paz neurons pathway. in this study we analyzed overground locomotion. at 16 dai spinal cord injury models had been previously described [2931 ]. in these models, the locomotion recovery was related to the severity of the sci. in the present experiments, all cats suffered a similar damage at the t13-l1 level (figure 2). therefore, the locomotion recovery by tamoxifen treatment was consistent because the damage of the spinal cord extension was similar in all cats. in the present experiments, the locomotion onset might depend more on the undamaged contralateral spinal cord than a step training plasticity process, given that the cats were not trained for walking. the kinematic parameters were altered during the first 16 dai in both hindlimbs but were partially or fully restored after 30 dai. it is of interest that, in iwt cats, recovery to nearly normal values already occurred at 16 days ; therefore tamoxifen shortened the recovery time. to the best of our knowledge, hemisected cats treated with tamoxifen and walking overground were studied for the first time. locomotion recovery results observed in this study highlight the importance of preserving contralateral descending pathways for locomotion initiation and kinematic recuperation. it would be of interest to study the effects of tamoxifen in relation to avoiding obstacles during a cat 's normal walking task. a previous study sheds light on this question, in which they assessed hemisected spinal cord cats during overground walking while avoiding obstacles in their way. in addition to what was previously stated, a contusion model in rats has been used for studying tamoxifen anti - inflammatory effects, but the kinematics in injured rats under tamoxifen treatment remain to be established [5, 34 ]. at present time, we consider that a study must be made in which the combined treatment with tamoxifen and treadmill training to improve the outcome of hemisected animals should be carried out. the current study demonstrates that hemisected spinal cord produces important locomotion alterations in both hindlimbs. tamoxifen may be useful in several animal species as therapeutic treatment in spinal cord injury. | we performed experiments in cats with a spinal cord penetrating hemisection at t13-l1 level, with and without tamoxifen treatment. the results showed that the numbers of the ipsilateral and contralateral ventral horn neurons were reduced to less than half in the nontreated animals compared with the treated ones. also, axons myelin sheet was preserved to almost normal values in treated cats. on the contrary, in the untreated animals, their myelin sheet was reduced to 28% at 30 days after injury (dai), in both the ipsilateral and contralateral regions of the spinal cord. additionally, we made hindlimb kinematics experiments to study the effects of tamoxifen on cat locomotion after the injury : at 4, 16, and 30 dai. we observed that the ipsilateral hindlimb angular displacement (ad) of the pendulum - like movements (plm) during gait locomotion was recovered to almost normal values in treated cats. contralateral plm acquired similar values to those obtained in intact cats. at 4 dai, untreated animals showed a compensatory increment of plm occurring in the contralateral hindlimb, which was partially recovered at 30 dai. our findings indicate that tamoxifen exerts a neuroprotective effect and preserves or produces myelinated axons, which could benefit the locomotion recovery in injured cats. |
despite routine screening and advances in treatment, retinopathy of prematurity (rop) remains a major cause of vision loss in children. it is estimated that 14,00016,000 preterm infants in the usa are affected by some degree of rop each year, and the rate of rop is increasing worldwide. this disease entity is characterized by abnormal and premature arrest of developing retinal blood vessels. early intervention and treatment of infants with rop decrease the likelihood of blindness,1 but visual abnormalities are still associated with treatment - requiring rop (type 1 rop). it is estimated that 65% of infants treated for rop have visual acuity of less than 20/40 at school age.2 the effects of rop and its comorbidities on preterm infants go beyond vision. previous studies conducted in older children with a history of rop have reported poor neurodevelopmental outcomes associated with rop.311 these studies found that children with a history of rop suffer mental retardation, cerebral palsy, autism, seizures, delayed gross motor skills, impaired speech and hearing, and other cognitive and neurologic abnormalities. however, most of these studies were conducted in children with severe rop who went on to develop poor visual acuity and visual field defects. msall,6 assessed the functional outcomes of infants from the cryotherapy for retinopathy of prematurity study at 5.5 years and found history of threshold rop a strong risk factor for severe disability. allred also observed that children with a history of severe rop scored two to three standard deviations below the mean score on bayley scales of infant and toddler development. this finding led to the hypothesis that preterm children may have reduced growth factors, such as insulin - like growth factor 1, which is critical for both brain and retinal development and usually supplied by the mother in utero. a more recent study by beligere in india suggests that rop zone rather than stage is more predictive of future neurodevelopmental delays. it is thus important to have early detection of neurodevelopmental abnormalities in these children for institution of early intervention. as the human eye is a more accessible organ system for optical visualization than the brain, and thus more readily available for bedside imaging, it is proposed that assessment of normal and abnormal microanatomy of the preterm infant eye could be used as a screening tool for brain abnormalities.13 a better understanding of preterm retinal substructures and their association with brain anatomy will elucidate the pathway by which local retinal anatomic changes impact and predicts subnormal vision and central nervous system (cns) function. it will also enable distinction between ocular and extraophthalmic (eg, cns) causes of vision loss in children with a history of very preterm birth. in contrast to indirect ophthalmoscopy or photography, novel noncontact ocular imaging at the bedside may enable direct telemedicine screening for rop and neuro development in multiple nurseries.14 this is aimed at improving preterm infant health care via objective bedside imaging and characterization of early critical indicators of poor vision and neurological development. we herein review the recent advances in bedside retinal imaging in infants with rop and their correlations with brain development. the advent and adaptation of multiple imaging modalities promise to change our understanding of rop and neurodevelopment.15,16 the diagnosis, classification, and monitoring of rop and its response to treatment traditionally rely on indirect ophthalmoscopy of the fundus by an expert ophthalmologist. optical coherence tomography (oct) allows for in vivo, cross - sectional assessment of eye tissue, including the retina and its vasculature. by comparing the interference patterns of light that passes through live tissue to a reference arm, oct provides high - resolution imaging of just a few microns of eye microanatomy.17 advances in image acquisition and processing now allow for fully automated algorithms that can segment, or outline individual structures,18 and sum these serial images to create three - dimensional volumes,19 which can be compared across many different commercial platforms.20 oct has rapidly evolved from an experimental imaging modality to a mainstay of both research and clinical ophthalmology. the translation of oct to first children followed by infants has increased our understanding of pediatric eye pathologies ranging from pediatric glaucoma to pediatric retinal diseases.2124 this is especially important in rop, where structural abnormalities in the retina and the vasculature have been linked to developmental delays.11 oct imaging was initially limited to school - age children who could comply with the upright chin - rest apparatus designed for adults. joshi used an unmounted tabletop system to image eyes with stage 4a rop under general anesthesia in the operating room. vinekar similarly disassembled an oct device and used the freed camera to image nonanesthetized eyes. today, handheld spectral domain (sd)oct devices allow for noncontact, portable imaging of supine infants at the bedside for both clinical and research purposes.27 the mobile imaging hand piece is attached to a fiber optic cable and can be oriented at the appropriate angle directly above the nonsedated supine eye. furthermore, maldonado created an age - dependent model to estimate the axial length of the infant eye, which is required to extrapolate lateral measurements. the bedside assessment of term and preterm infant eyes while in the nursery has led to a wealth of information regarding eye development and maturation. bedside spectral domain optical coherence tomography (sdoct) imaging (with the envisu, bioptigen inc., research triangle park, nc, usa) is performed with the infant supine within his or her incubator or bed, and with the examiner holding the eyelids open and this noncontact system over the eye. rothman,28 published video links to bedside imaging in the nicu and imaging in the clinic.28 imaging is first centered on the macula, with a single volume of macula, then a volume across optic nerve and preferably a volume containing both macula and the optic nerve to allow one to draw an organizing axis from optic nerve to fovea.29 these volumes, typically 6075 scans per volume with 600900 a scans per b scans covering an area of ~67 67 mm, are useful to extract central foveal scan and to segment for layers such as retinal nerve fiber layer (rnfl).28,29 while oct promises to be a useful tool for identifying abnormalities associated with rop, it first helped to describe normal neonatal retinal development and maturation. imaging preterm infants before term - equivalent age allows for in vivo assessment of optic nerve and retinal architecture that would usually be found in utero. alternatively, preterm infant microanatomy can be compared with age - matched term infant eyes to identify potential abnormalities. maldonado used oct to describe the eloquent centripetal migration of outer retinal structures, including the photoreceptors, toward the fovea that is synchronized with concurrent centrifugal migration of the inner retinal layers away from the fovea (figure 1). the unique preterm infant foveal morphology observed on oct has been confirmed in similar infant imaging studies.31,32 hendrickson verified these developmental patterns with postmortem eye tissue, and vajzovic validated that the unique layers observed on sdoct correlate with histology (figure 2). vajzovic then used sdoct to describe a delay in photoreceptor development in very preterm infants at term - equivalent age compared with age - matched term infants. they observed ellipsoid zone at the foveal center in (22/47) 47% of term infants imaged in the nursery, but only (9/64) 14% of very preterm infants (p<0.001) ; for those infants without ellipsoid zone at the fovea, there was also a greater mean distance of the ellipsoid zone to the foveal center in very preterm versus term infants (p=0.01), further representing a delay in photoreceptor migration. recently, lee reported measurement of the timeline of foveal development of term - born infants from birth through age 027 years. they demonstrated the continued increase in central foveal thickness with age and progressive maturation of photoreceptors over several years after birth, providing important age - appropriate normative data on healthy foveal development. macular imaging with oct has identified a unique representation of cystoid macular edema (cme) in the preterm population (figure 3), also known as macular edema of prematurity, with neurodevelopmental implications. the macular edema is bilateral, symmetric, isolated to the inner nuclear layer, and typically causes foveal bulging with elongation of hyperreflective septae. lee compared the utility of traditional indirect ophthalmoscopy with sdoct during routine rop exams to evaluate preretinal and retinal structures. the authors reported that sdoct allowed identification of cme in 39% of examinations and epiretinal membrane in 32% of exams, neither of which were identified on indirect ophthalmoscopy. they did note that traditional examination was required for full rop assessment (stage, zone, plus disease). vinekar performed a similar study in an indian population and observed subclinical cme in 29% of infants on rop exam. interestingly, all of the infants with cme in this study had stage 2 rop, while no eyes with stage 0 or 1 rop had cme. the authors posited that these cystoid structures might have caused by vascular leakage secondary to vascular endothelial growth factor imbalances or direct mechanical traction on the retina. maldonado performed a study that identified cme in 50% of preterm infants at a tertiary care center. they found that, while the presence or absence of cme was not associated with rop outcomes, markers of cme severity such as central foveal thickness, inner nuclear layer thickness, and the foveal - to - parafoveal ratio were greater in eyes that either required laser photocoagulation or had stage 3 rop. they did not find any strong relationship between cme and a battery of systemic health factors. another study reports both persistence of and formation of new cme following bevacizumab (an antivascular endothelial growth factor used off - label for rop treatment) administration, further suggesting this phenomenon is not directly tied to vascular endothelial growth factor.40 a case report of an infant with hemochromatosis and severe, bilateral cme that resolved following liver transplantation suggests other unidentified systemic health factors may play a role in neonatal cme.41 while the etiology of preterm infant cme is unclear, several pilot studies have identified functional outcomes suggesting this is a pathologic phenomenon rather than a phenotypic variant of development. one study followed 53 very preterm infants with cme in the intensive care nursery and performed bayley scales at 1824 months corrected age to assess neurodevelopment and found cme was associated with worse language (p=0.002) and motor skills (p=0.03) as a toddler. within the subset of very preterm infants with cme, there was an association between the severity of cme as assessed by increasing foveal - to - parafoveal thickness ratio and worsening cognitive (p=0.03, r=0.16) and language scores (p=0.03, r=0.15). according to rothman,42 because the neurosensory retina is an extension of the cns, sdoct allows for direct visualization of cns tissue and the cme observed may be an ophthalmologic manifestation of cellular events occurring elsewhere in the brain and cns. another study followed 13 infants (eleven preterm and two term) imaged in the nursery and found that all eight children with age - appropriate microanatomy on sdoct had 20/40 visual acuity or within the normal limits on teller acuity cards, while the five infants with cme later had suboptimal acuity, sensorimotor deficits, abnormalities on brain magnetic resonance imaging (mri), or poor neurodevelopment.27 vinekar also reported reduced visual acuity as early as 3 months corrected age in infants with cme. this may be due to delayed photoreceptor development for very preterm infants with or without cme35 or other confounding health parameters in this sick and vulnerable population. preliminary investigations have also demonstrated oct as an effective tool to characterize the retinal vasculature. while traditional indirect ophthalmoscopy provides an en face view of the fundus, oct provides three - dimensional data and unique information in the anterior posterior axis. maldonado proposed a vascular abnormality score by oct (vaso) to quantify abnormalities graded on oct such as vessel elevation, hyporeflective vessels, scalloping of retinal layers, and perivascular spaces (figure 4). retinal surface maps can also be created with segmentation software to greater appreciate vessel tortuosity and dilation. in addition, pilot data suggest a correlation between vaso and worsening language and motor skills as a toddler (unpublished data). future studies may relate vaso and vessel mapping to markers of development and maturation such as photoreceptor development, cme, and rnfl thickness. the rapidly evolving modifications to oct imaging promise to change our approach to rop. for example, color doppler oct visualizes blood flow and could allow for in vivo, cross - sectional assessment of blood flow and three - dimensional construction of retinal vasculature in infants with rop.4547 advances in oct angiography may become both a useful clinical tool for patients with rop and research tool that helps characterize the vasculature and answer questions such as the significance of a smaller foveal avascular zone in preterm infants.48 swept - source oct promises to replace sdoct with faster data acquisition, which will prove useful when imaging nonsedated infants.49 alternatively, oct may be paired with other technologies such as wide - field fluorescein angiography, which allows characterization of the permeability of peripheral vasculature.50 in addition to macular and vessel imaging, oct imaging provides valuable information about the optic nerve and rnfl. provis described the initial burst of axonal proliferation that peaks during 1617 weeks gestational age at ~3.7 million axons. this overproduction is followed by apoptosis of the optic nerve axons that plateaus approximately 29 weeks gestational age at 1.1 million axons. the actual optic nerve is 75% of its adult size at birth52 when it is unmyelinated until about age 2.53 because the microanatomy of the anterior visual pathway undergoes such dynamic change both in utero and during infancy, studies specific to this time window are valuable for understanding normal development and its phenotypic and pathologic variants. samarawickrama imaged 12-year - old children and found that low birth weight, short birth length, and small head circumference correlated with larger optic nerve cup - to - disc ratio. tong then compared optic nerve parameters in term versus preterm infants imaged with sdoct and found a larger cup - to - disc ratio in preterm infants (p<0.001). within the preterm cohort, they correlated increased cup - to - disc ratio with diagnosis of periventricular leukomalacia (p=0.005) and clinical need for mri while in the nursery (p=0.023) as well as worse cognitive skills as a toddler as assessed by the bayley scales (p=0.049). the rnfl consists of the unmyelinated ganglion cell axons that compose the innermost layer of the neuro sensory retina prior to converging as the optic nerve. as such, average rnfl thickness is a more accurate measure of retinal ganglion cell integrity than the estimate provided by optic nerve head analysis. several studies in school - age children have associated thinner rnfl with both lower birth weight56,57 and prematurity.5860 akerblom prescribe these differences to thinner rnfl in children with a history of stage 3 or 4 rop, while pueyo similarly described thinner rnfl in preterm children who required treatment for rop and had concomitant pathologies such as hypoxic - ischemic events and perinatal infections. recently, park and oh61 also found this inverse relationship between rop stage and average rnfl thickness in school - age children. one limitation of these studies, however, is that the rnfl was measured years after rop diagnosis and its associated comorbidities and treatments. rnfl measurements in adults are usually taken at a mean radial distance of 1.7 mm from the center of the optic nerve based on the reproducibility studies of schuman.62 because the neonatal eye is smaller than even the eyes of school - age children, average rnfl thickness should be measured at a distance of 1.5 mm from the center of the optic nerve, based on both pilot sdoct data in healthy, term infants29 and proportionality calculations derived from fundus photography of infants63 and adults.64 because the sdoct scans of infants are obtained when the noncooperative child is supine, the scans are usually not orthogonally oriented. previous work suggests that rnfl measurements should be standardized relative to the axis aligning the foveal center to the opening of bruch s membrane.65,66 several custom matlab scripts (mathworks, inc., users then manually mark the center of the optic nerve and fovea to create an organizing axis and then can calculate the average rnfl thickness at any radial distance from the center of the optic nerve across an arc of any specified degree. this method has provided a normative dataset of mean rnfl thickness in healthy, term infants imaged prior to discharge from the nursery.29 this same methodology has since been applied to very preterm infants and validated as a way to reproducibly measure rnfl over time in this vulnerable population. at term - equivalent age, very preterm infants have significantly thinner rnfl across both the papillomacular bundle (defined as the arc from 15 to + 15 degrees relative to the organizing axis, p<0.001) and the temporal quadrant (the arc from 45 to + 45 degrees relative to the organizing axis, p=0.005) compared with healthy, term infants. furthermore, these very preterm infants imaged at < 36 weeks postmenstrual age and again at term - equivalent age demonstrated a significant increase in mean thickness over this time interval (p<0.001). because the ganglion cell axons are unmyelinated anterior to the lamina cribrosa, this increase in axonal thickness may parallel the increase in volume of gray brain matter observed in preterm infants on mri during this time window (figure 5).67 interestingly, these pilot data did not identify within the very preterm cohort (n=57) a relationship between rop stage, plus disease, or need for rop treatment and rnfl thickness nor did it find a difference in rnfl thickness between those very preterm infants with or without a list of common preterm pathologies such as hydrocephalus, intraventricular hemorrhage, and bronchopulmonary dysplasia. there was, however, a significant relationship between mean rnfl thickness and gross brain abnormalities and lesions observed on mri obtained while in the intensive care nursery. a pediatric neuroradiologist masked to all infant data other than age at mri used a modified version of the grading scale described by kidokoro to assess a global brain lesion burden index, which was composed of white matter, gray matter, and cerebellar subscores. there was a significant relationship between increasing global (p=0.001, r=0.35), white matter (p=0.008, r=0.26), and gray matter (p=0.009, r=0.25) brain lesion indices on near - term mri, signifying increasing brain abnormalities and thinner rnfl. likewise, there was a significant correlation between worse cognitive (p=0.01, r=0.18) and motor skills (p=0.02, r=0.17) as a toddler, as assessed by the bayley scales, and thinner rnfl while in the intensive care nursery.13 the presence of cme and thinner rnfl in the very preterm infant population appears to be independent. the rnfl thinning is believed to be retrograde transsynaptic degeneration of ganglion cells similar to that observed in primates after mechanical injury that leads to enlarged optic nerve cup - to - disc ratio and thinner rnfl.69,70 rather than a direct result of physical insult, cme is likely a manifestation of systemic physiologic insult such as inflammation or vascular endothelial growth factor dysregulation.42 average rnfl thickness may be a promising biomarker of brain pathology and subsequent neurodevelopment as an adjunct clinical tool to brain mri. there are several indications for brain mri in the preterm population that often demonstrate differences from term brain development at this age71 due to the relationship between white matter injury and neuro development.7274 lennartsson qualitatively described an inverse relationship between rnfl thickness in adults and the extent of white matter injury and damage to optic radiations as observed on fiber tractography experienced after premature birth. recent developments in bedside oct imaging have contributed to our understanding of the retinal microanatomy of the preterm infant eye, including in those with rop. the oct imaging has provided a useful new perspective of retinal neurovascular development along with a three - dimensional view of the focal abnormalities of rop : changes in retinal and choroidal vasculature, axonal layer thinning, and macular edema. it is through recognizing and documenting the age - appropriate stages of normal neonatal retinal development and maturation that one can identify changes associated not only with rop but also with prematurity. these include delayed photoreceptor development, cme, enlarged optic nerve c / d ratio, and thin rnfl. more importantly, these anatomic abnormalities have been linked to abnormalities in brain anatomy as well as in neurodevelopment. therefore, bedside oct imaging maybe a useful and sensitive tool for early screening of very preterm infants who are at very high risk of these brain abnormalities and poorer neuro development. because the eye and brain continue to develop well after term birth, it is highly likely that similar research in full - term infants may find similar relationships between eye microanatomy and neurodevelopment and cns disease. ongoing studies aim to establish and evaluate bedside oct imaging in the role of prenatal screening. telemedicine, with transmission of digital eye images to centralized reading centers for expert interpretation, may increase the patient s access to screening.76,77 while current studies focus on screening with digital fundus photography, this would be an obvious area for extension into oct in the future.78 multidisciplinary approach and collaborative efforts across multiple centers will be essential in improving developmental outcomes and monitoring therapeutic response to treatments or nutritional interventions to improve brain development in this vulnerable population. | preterm infants with retinopathy of prematurity are at increased risk of poor neurodevelopmental outcomes. because the neurosensory retina is an extension of the central nervous system, anatomic abnormalities in the anterior visual pathway often relate to system and central nervous system health. we describe optical coherence tomography as a powerful imaging modality that has recently been adapted to the infant population and provides noninvasive, high - resolution, cross - sectional imaging of the infant eye at the bedside. optical coherence tomography has increased understanding of normal eye development and has identified several potential biomarkers of brain abnormalities and poorer neurodevelopment. |
in recent years, as cesarean sections themselves have become more common, more and more delivery rooms have allowed husbands / partners to be present during a cesarean section, arguing that this reduces the mother 's anxiety, cements the father 's role in childrearing, and reflects current occupational positions on patient autonomy of decision and quality of care [13 ]. indeed, the husband / partner 's right to be present has been extended to any close relative or husband the birthing mother wants alongside her. often finds the experience emotionally painful, even traumatic, that they can interfere with the staff 's work and decision making, and that their close attendance might even multiply already frequent enough malpractice claims [46 ]. apart from this legal consideration, the attitudes of doctors and nurses on this issue have been found to be influenced by their occupational training and ethos, their cultural background, and their previous experience of admitting husbands to an operating room. nurses have reported that they felt uncomfortable and uneasy at having family members watching their every move [4, 7 ]. the researchers have found very little research data on the above issues from israel, and one of this study 's aims is to fill this gap for israel and break new ground. the study is designed to investigate the attitudes of doctors and nurses in operating rooms and delivery rooms to the presence of the husband during a cesarean section and the association between these attitudes and the staffers ' willingness to promote this organizational change. the study 's ultimate goal is to improve the quality of care of the birthing mother and her family before and during a cesarean section. the study 's theoretical model comes from fishbein and ajzen 's theory of reasoned action (figure 1). the theory aims to furnish a means of understanding and predicting most of human behavior by means of a small number of concepts intentions, attitude, beliefs, perceived social pressure, and perceived behavioral control (pbc). fishbein and ajzen, while appreciating that social reality is highly complex, nevertheless offer to explain it with a relatively simple theory, and their empirically testable theory offers a systematic means of investigating behavior across a wide range of contexts. applying it to different populations, it can identify the factors distinguishing groups from each other and explain why they behave differently in the same situation. since the present study aims to predict the behavior of four occupational groups (gynecologists, anesthetists, operating - room nurses, and midwives) who differ both by current occupation and past training, the fishbein and ajzen theory seems a suitable tool. the theory 's authors claim that behavioral intention is the product of two independent variables a person 's attitudes to the behavior in question and their perception of social norms (subjective norms). (a) a person 's attitudes to the behavior in question are defined as the sum total of their beliefs about the behavior. (b) subjective norms are defined as how the person perceives the interpersonal and social repercussions of their behaving in the given manner. in 1986, ajzen and madden expanded their theory of reasoned action by adding the construct of perceived behavioral control (pbc). this is defined as a person 's confidence in their ability to carry through a given behavior. do they have the personal resources necessary and will their working environment allow them to carry the behavior through ? the more they believe they have both, the stronger their pbc will be. from the ajzen and madden theory, we derive the basic premise of this study that there is a direct relation between, on the one hand, operating and delivery room staff attitudes to the presence of a husband during cesarean sections, their perceived behavioral control, and their perception of social pressure on this issue and, on the other hand, their behavioral intention to act to bring about this change. the more favorable the staffers ' own attitudes, the stronger their perceived behavioral control, and the more supportive they perceive their working environment to be on the issue of allowing a husband 's presence, the stronger will be their intention to promote this change. (1) there is a positive relation between staffer attitudes (gynecologists, anesthetists, midwives, and operating - room nurses) to admitting a husband to cesarean sections, their subjective norms and their perceived behavioral control on the prospect of bringing about this behavior. (2)the four occupational subgroups will differ on their attitudes and perceived behavioral control. (3) there is a positive relation between staffer attitudes and their behavioral intention to admit husbands during a cesarean section. (4) there is a positive relation between staff 's perceived behavioral control and their intention to admit husbands during a cesarean section. the sample was a convenience sample composed of gynecologists, anesthetists, midwives, and operating - room nurses at the assaf harofeh hospital in tel aviv. it comprised all the staffers working in two obstetrics departments, a gynecology department, a high - risk pregnancy department, and 12 delivery rooms. of the 96-strong sample, 51% were nurses, almost equally divided between operating - room nurses and midwives, and 49% were doctors (45% anesthetists and 55% gynecologists). of the 49 nurses, 31 had an academic nursing qualification (b.a. or m.a.), and 20 had graduated a regular basic training program. the single instrument used was a self - administered questionnaire, constructed and validated by the senior researcher and identical for all participants. it was designed to detect associations between the five variables it measured and whether they affected the components of the research model. not finding a validated and reliable instrument in the published literature, the senior researcher based the questionnaire, as noted, on the expanded ajzen and madden theory of reasoned action, supplementing it with questions taken from three other researchers who had used this theory to investigate behavior in the context of various health care issues (nurses ' promotion of patient privacy, emergency nurses ' attitudes to allowing family presence during invasive and resuscitation procedures, and the public 's willingness to donate organs for transplant). the first draft of the questionnaire was reviewed by four medical experts from the fields of gynecology, anesthesiology, nursing, and statistics and then pilot - tested on eight subjects, two each from the four selected professions (gynecologists, anesthetists, midwives, and operating - room nurses). the cronbach alpha scores for the internal reliability of sections 25 of the questionnaire were all high over 0.8. section 116 questions on participants ' sociodemographic variables. 16 questions on participants ' sociodemographic variables. section 2staff behavioral attitudes to admitting a husband to cesarean sections. a subject 's self - confidence on this issue stems from internal and external factors : internal factors : confidence in his / her own ability and knowledge to carry through the behavior and external factors : fear of legal suits and the suitability of operating room conditions for husbands to be in attendance. a subject 's self - confidence on this issue stems from internal and external factors : internal factors : confidence in his / her own ability and knowledge to carry through the behavior and external factors : fear of legal suits and the suitability of operating room conditions for husbands to be in attendance. section 4the subject 's behavioral intention to admit husbands to cesarean sections. will he / she find legitimate reasons to prevent the husband 's admission or, instead, find solutions to problems that may arise ? the subject 's behavioral intention to admit husbands to cesarean sections. will he / she find legitimate reasons to prevent the husband 's admission or, instead, find solutions to problems that may arise ? section 5the subject 's perception of social norms in their working environment on admitting a husband to cesarean sections and the resultant pressure on him / her. the subject 's perception of social norms in their working environment on admitting a husband to cesarean sections and the resultant pressure on him / her. all questions were answered on a 6-point likert scale from never to always and the mean scores were used to represent the range of individual scores. the questionnaire was distributed to staff shortly after the operating rooms had begun allowing a husband to attend cesarean sections. after the management of the assaf harofeh hospital and its helsinki committee had given permission for the research study the senior researcher distributed the questionnaires to all the staffers registered as working in the four selected units, who returned them later completed. hypothesis 1there is a positive relation between staffer attitudes (gynecologists, anesthetists, midwives, and operating - room nurses) to admitting a husband to cesarean sections, their subjective norms, and their perceived behavioral control on the prospect of bringing about this behavior. table 1 shows that for both occupational groups (doctors and nurses) and all four subgroups (gynecologists, anesthetists, midwives and operating - room nurses), there is a strong positive correlation (p <.001) between their attitudes and their pbc. the pearson correlation is highest for the midwives (r = 0.749) and lowest for the gynecologists (r = 0.506). although the significance level is lower for the gynecologists than for the other groups (p <.006) it is still high.the correlation between subjective norms and pbc is also strong and statistically significant for the whole sample, but only for three of the four subgroups (not for midwives). there is a positive relation between staffer attitudes (gynecologists, anesthetists, midwives, and operating - room nurses) to admitting a husband to cesarean sections, their subjective norms, and their perceived behavioral control on the prospect of bringing about this behavior. table 1 shows that for both occupational groups (doctors and nurses) and all four subgroups (gynecologists, anesthetists, midwives and operating - room nurses), there is a strong positive correlation (p <.001) between their attitudes and their pbc. the pearson correlation is highest for the midwives (r = 0.749) and lowest for the gynecologists (r = 0.506). although the significance level is lower for the gynecologists than for the other groups (p <.006) it is still high. the correlation between subjective norms and pbc is also strong and statistically significant for the whole sample, but only for three of the four subgroups (not for midwives). hypothesis 2the four occupational subgroups will differ on their attitudes and perceived behavioral control.nurses (mean = 3.49 ; sd = 0.05) were somewhat more supportive of admitting a husband to cesarean sections than doctors (mean = 3.24 ; sd = 0.55). the nurses ' perceived behavioral control (mean = 2.95 ; sd = 0.31) was also significantly stronger than that of the doctors (mean = 2.72 ; sd = 0.38), and there were also significant differences between the subgroups.hypothesis 2 was confirmed. nurses (mean = 3.49 ; sd = 0.05) were somewhat more supportive of admitting a husband to cesarean sections than doctors (mean = 3.24 ; sd = 0.55). (on subjective norms, no significant between - group differences were found.) the nurses ' perceived behavioral control (mean = 2.95 ; sd = 0.31) was also significantly stronger than that of the doctors (mean = 2.72 ; sd = 0.38), and there were also significant differences between the subgroups. hypothesis 3there is a positive relation between staffer attitudes, subjective norms, and their behavioral intention to admit a husband during a cesarean section. table 2 shows that for both occupational groups (doctors and nurses) (p <.001) and all four subgroups (p <.05) there is a strong positive correlation between their attitudes and their behavioral intention. the pearson correlation is highest for the anesthetists (r = 0.674) and lowest for the gynecologists (r = 0.378). the correlation between subjective norms and behavioral intention is strong and statistically significant for both occupational groups and all four subgroups, this time with the gynecologists displaying the strongest pearson correlation coefficient.hypothesis 3 can, therefore, be considered confirmed. there is a positive relation between staffer attitudes, subjective norms, and their behavioral intention to admit a husband during a cesarean section. table 2 shows that for both occupational groups (doctors and nurses) (p <.001) and all four subgroups (p <.05) there is a strong positive correlation between their attitudes and their behavioral intention. the pearson correlation is highest for the anesthetists (r = 0.674) and lowest for the gynecologists (r = 0.378). the correlation between subjective norms and behavioral intention is strong and statistically significant for both occupational groups and all four subgroups, this time with the gynecologists displaying the strongest pearson correlation coefficient. hypothesis 4there is a positive relation between staff 's perceived behavioral control and their behavioral intention to admit a husband during a cesarean section. table 3 shows a strong positive correlation between staff 's perceived behavioral control and their behavioral intention to admit a husband during a cesarean section, for both occupational groups and three subgroups, ranging from r = 0.355 to r = 0.632, with the anesthetists the exception in not displaying a statistically significant correlation.hypothesis 4 can be considered partially confirmed. there is a positive relation between staff 's perceived behavioral control and their behavioral intention to admit a husband during a cesarean section. table 3 shows a strong positive correlation between staff 's perceived behavioral control and their behavioral intention to admit a husband during a cesarean section, for both occupational groups and three subgroups, ranging from r = 0.355 to r = 0.632, with the anesthetists the exception in not displaying a statistically significant correlation. the aims of this study were to see if there is an association between attitudes and beliefs of the doctors and nurses involved in delivering babies as regards the policy of admitting a patient 's husband to cesarean sections and their intended behavior on that issue. the researchers also wanted to know if there were differences on this issue between the occupational subgroups. most of the findings supported the hypotheses derived from the ajzen and fishbein and ajzen and madden theory of reasoned action and confirmed earlier studies designed to verify this theory. hypothesis 1 was partially confirmed ; that is, staffer attitudes to admitting a husband to cesarean sections were found to be positively associated with their pbc on this issue. the correlation between subjective norms and pbc is also strong for three of the four subgroups. it is pertinent to note here that whereas the three other occupational groups work regularly together in the operating room, the brunt of midwives ' work is in pre - natal preparation. in the normal course of a pregnancy, the mother is prepared and instructed by a midwife, up to and including events in the delivery room itself. normal course breaks down, and it is decided to deliver by cesarean, is the mother taken over by the operating room team. midwives are strongly supportive of the husband 's close involvement in pregnancy and birth, including in a cesarean delivery, and in this, they are responding to their clients ' pressure, but the operating room staff has the veto prerogative. it is this inability to obtain their clients ' wishes that explains the nonstatistically significant correlation between the midwives ' subjective norms and their pbc. hypothesis 2, that the four occupational subgroups will differ on their attitudes and perceived behavioral control, was confirmed. kotkis also found disparities between occupational groups on the issue of allowing family members ' presence during resuscitation and other invasive procedures. hypothesis 3 : in other words, staffer attitudes to admitting a husband to cesarean sections are positively associated with their behavioral intention on this issue. in other words, if we want to modify intentions and behavior, we have to impact on attitudes and to change the beliefs which underlie attitudes we have to tie them into positive practical outcomes. it follows that the key to change lies in education and training. in the ajzen and madden theory, attitude is a product of beliefs, which in turn represent the individual 's knowledge on a given issue. supplying new information can, therefore, alter beliefs and attitudes, and this is what indeed happened in bassler 's study of intensive care nurses. beliefs and knowledge concerning a given behavior are also the outcome of the believer 's previous experience with that behavior so that supplying obstetricians and operating room nurses with new information about the consequences of admitting a husband to cesarean sections could have some positive effect if perhaps an effect limited by their own previous experience with the behavior. hypothesis 4 : the hypothesized positive relation between staff 's perceived behavioral control and their behavioral intention was confirmed for all subgroups except for the anesthetists. the most probable explanation for anesthetists being an exception to the rule is not that the anesthetists score low on pbc but that they have no intention of working to admit husbands to cesarean sections. sakala 's survey of nurses, midwives, gynecologists, and anesthetist 's attitudes to admitting fathers to cesarean sections found that the anesthetists were the most skeptical about the idea of the four groups. anesthetists provide services to gynecology departments but are not involved personally with the birthing mothers and their partners. they see them for the first time in the operating room, whereas the other staff groups may have known the couple throughout the pregnancy. an anesthetist 's work is extremely intense and critical, and this too may cause them not to welcome guests, all the more so as the place assigned to these guests in an operating room is the area which the anesthetist is responsible for. (i) the chief predictor of pbc and behavioral intention is a staffer 's behavioral attitudes. (ii) behavioral intention is a function of behavioral attitudes and occupation as table 2 shows. (iii) the way to improve the behavioral intention to admit a husband to cesarean sections is by altering individual attitudes and environmental norms on the issue. therefore, staff training should be altered to include material designed to raise awareness of the advantages of admitting a husband to cesarean sections and to show the practice in a positive light. (iv) topics to be addressed in by this material should include reducing staff anxiety, infection prevention, and legal issues. (v) working groups need to be set up on improving the physical conditions in delivery and operating rooms to make them fit to accommodate a husband. (vi) delivery and operating room staff need to be trained in workshops and/or training courses in the skills needed to promote the active participation of the baby 's mother and father in the delivery and, if necessary, in the cesarean section. (vii) performance protocols should be drawn up to guide staff on realizing the new policy. (viii) adding staff to the current complement in delivery and operating rooms would reduce the pressure added by the new policy and give staff the confidence that they have the resources to carry through the change of policy. | objective. in recent years, more and more delivery rooms have allowed husbands / partners to be present during a cesarean section nonetheless, many still oppose the idea. the study is designed to investigate the attitudes of israeli gynecologists, anesthetists, operating - room nurses, and midwives on this issue. design. the study 's theoretical model comes from fishbein and ajzen 's theory of reasoned action. a self - administered questionnaire was submitted to convenience sample. subjects. 96 gynecologists, anesthetists, midwives, and operating - room nurses. results. significant differences were found between the occupational subgroups. most of the findings supported the four hypotheses tested and confirmed earlier studies designed to verify the theoretical model. conclusions. the main conclusion drawn is that delivery and operating - room staff need to be trained in the skills needed to promote the active participation of the baby 's father in delivery and, if necessary, in a cesarean section. |
lafora disease is a form of progressive myoclonic epilepsy with autosomal recessive transmission. two genes have been identified so far : epm2a and nhlrc1, and a third gene, concerning a pediatric onset subform, has been recently proposed. we report the case of a 23-year - old woman of turkish origin with an unusual disease course. clinical onset was at the age of 19 years with tonic clonic seizures, followed by cognitive impairment ; eeg was in favor of lafora disease, and the mutation c.436g > a (a missense mutation substituting aspartic acid in asparagine) in the nhlrc1 gene confirmed this diagnosis. after 5 years of evolution, the patient only has moderate cognitive impairment. some nhlrc1 mutations, particularly c.436g > a, are associated with a slower clinical course, but there are conflicting data in the literature. this case strengthens the hypothesis that the c.436g > a mutation in the nhlrc1 gene leads to less severe phenotypes and late - onset disease. |
|
the management of high - risk surgical patients (hrsp) presents a huge challenge to anesthetist as a perioperative physician. often, there is a need to balance on one hand the provision of a good anesthesia that prevents undue stimulation of sympathetic responses / reflexes and then tilting the already deranged hemodynamics off balance. invasive or noninvasive hemodynamic monitoring (hm) offers the anesthetist the opportunity to walk on this tightrope successfully most times. in the united kingdom, surgical procedures involving high - risk patients is said to represent only about 10% of the procedures anesthetists perform each year, yet these patients account for over 80% of perioperative deaths. this is a pointer to the need for a closer attention to this subset of surgical patients. unfortunately, there is insufficient data to determine the burden of care and outcome in hrsp in nigeria. a similar survey conducted among randomly selected european and american anesthetists showed that having adequate physiological knowledge of hm is not directly related to application of such knowledge during patient care and that clinical practice may be heavily influenced by local factors that may not be justified by basic physiological considerations and the published body of evidence. in light of the above, it became necessary to assess and document the current hemodynamic management practices of anesthetists in nigeria regarding patients undergoing high - risk surgery. an electronic mail (e - mail) based survey was conducted among consultant anesthetists in nigeria. the membership strength of the nigerian society of anaesthetists (nsa) is about 650, with consultants making up a quarter ; others include medical officers with diploma and resident doctors. permission was obtained to use the e - mail addresses of all consultant anesthetists in the directory (180 members) for this survey. the survey contained 24 questions adapted from a similar study that range from practice location, experience in the perioperative management of hr patients, expectations of care, to what is available to the anesthetists to provide such care. the survey was on for 3 months with weekly reminders sent to participants to enhance the response rate., as those presenting for major surgery expected to last more than 1.5 h and having at least two of the following criteria : previous severe cardio - respiratory illness - acute myocardial infarction, chronic obstructive pulmonary disease / stroke, late - stage vascular disease involving aorta, age > 70 years with limited physiological reserve in one or more vital organs, extensive surgery for carcinoma (e.g., esophagectomy, gastrectomy, cystectomy), acute abdominal catastrophe with hemodynamic instability (e.g., peritonitis, perforated viscus, pancreatitis), acute massive blood loss > 8 units, septicemia positive blood culture or septic focus, respiratory failure : pao2 0.4 or mechanical ventilation > 48 h, acute renal failure : urea > 20 data were entered into the statistical package of social sciences (spss) version 17.0 chicago, illinois, usa. since the data were mainly categorical, they were expressed as counts / percentages and subjected to chi - square analysis. data were entered into the statistical package of social sciences (spss) version 17.0 chicago, illinois, usa. since the data were mainly categorical, they were expressed as counts / percentages and subjected to chi - square analysis. data were entered into the statistical package of social sciences (spss) version 17.0 chicago, illinois, usa. since the data were mainly categorical, they were expressed as counts / percentages and subjected to chi - square analysis. of the 180 consultant members of the nsa contacted, only 157 e - mail messages were delivered. twenty - one messages were undelivered, and 2 persons opted out of the survey without reasons. the survey showed that 67 (91.8%) of respondents provide or directly supervise anesthesia for hrsp, 50 (84%) of them do this 15 times a week. furthermore, 27 (40.3%) and 38 (56.7%) of them have been practicing as anesthetists for 510 years and above 10 years, respectively. most respondents in this survey work in the university teaching hospital 52 (71.2%) with the location of practice in the south west 25 (34.2%) [table 1 ]. the most frequent fellowship was critical care (19%), followed by pain (11%) and cardiac anesthesia (9.5%). characteristics of participants most respondents 60 (83%) admitted that no formal guidelines for the management of hrsp existed in their institutions [figure 1 ]. table 2 shows that most of our respondents routinely monitor noninvasive blood pressure monitoring (83.6%), central venous (35.6%), and invasive arterial blood pressure (28.8%) during surgery in hrsp. pie chart showing availability of guidelines for the management of high - risk surgical patients in respondent 's institution frequency of hemodynamic monitoring used during high - risk surgery in the current and previous surveys the practice setting (p = 0.129), presence of institutional guidelines (p = 0.277), and possession of additional fellowship (p = 0.108) did not influence the choice of noninvasive blood pressure, central venous pressure (cvp), and invasive arterial blood pressure use as hm devices. however, the duration (p = 0.023) and location of practice (p = 0.048) were significantly related to the use of invasive blood pressure monitoring with more respondents with duration of practice over 5 years and location of practice in the south west employing invasive blood pressure monitoring. three times more respondents will employ arterial pressure rather than venous pressure monitoring to optimize the hemodynamics 75% of the time intraoperatively [figure 2 ]. the responses to the questions on indicators of volume expansion, their opinion on what predicts increase in cardiac output after volume expansion and parameters involved in oxygen delivery to tissues are shown in tables 3, 4, and 5 respectively. frequency of optimization of arterial and central venous pressure intraoperatively indicators of volume expansion physician opinions on predictors of increase in cardiac output after volume expansion physician opinions as indicators of oxygen delivery a large number of our respondents 65 (83.3%) were of the opinion that oxygen delivery to tissues is of major importance during the management of hrsp and the following parameters are important for oxygen delivery ; cardiac output (75.6%), hemoglobin concentration (74.4%), and partial pressure of oxygen (66.7%) [table 5 ]. most respondents (73.9%) will optimize patients before induction of anesthesia, and most of them are of the opinion that this period is of utmost value to achieve hemodynamic optimization. considering the first choice solution for volume expansion, crystalloids, and hydroxyl ethyl starch (he s) were the first choice in 46 (63.0%) and 10 (14.0%) of respondents respectively. about two - third of our respondents 41 (59.41%) believe that their current practice of intraoperative hemodynamic management of the high - risk patient is inadequate. no difference was found between respondents with additional training and those without with regard to their opinion on the adequacy of current practice (p = 0.299). this survey revealed that most of our respondents are involved in the perioperative care of hrsp even without institutional guidelines or protocol for the management of such patients. we also observed the noninvasive blood pressure to be the most common parameter used for hm, with cvp, and invasive blood pressure monitoring in distant second and third positions. majority of our respondents work in university teaching hospitals, the consensus is that monitoring oxygen delivery in hrsp remains a major goal and cardiac output monitoring, hemoglobin assessment and partial pressure of oxygen assessment are important parameters involved. the goals of hm are essentially to guarantee the adequacy of perfusion, assist with early detection of inadequate perfusion so as to guide decision making on whether monitoring is sufficient or not, or if the patient need active intervention. others include titrating the therapy to specific hemodynamic endpoints in unstable patients and differentiating among various organ system dysfunctions. it is, therefore, important that clinical audit or surveys of this type be conducted from time to time to determine if expected goals are being achieved. despite the fact that most of the respondents are of the opinion that oxygen delivery to tissues are of major importance during management of hrsp and that cardiac output presents a very good tool to monitor this compared to cvp, more respondents employ cvp monitoring than routine cardiac output assessment or other parameters involved in oxygen delivery in hrsp. in agreement with a similar study, there appears to be a gap between the knowledge and practice with regard to routine monitoring devices employed by respondents in this study. though this result agrees with that obtained in similar studies conducted among korean, chinese, american, and european anesthetists, we observed a huge gap in the usage of these two monitoring devices in this survey. the reasons responsible for low application of the cardiac output monitoring in other studies include the fact that some believe that cardiac output maximization is unnecessary or may be harmful and that the procedure is difficult to perform routinely in the busy operating room. however, the reason for this gap in our environment is majorly the unavailability of these tools because of the high cost. poor funding of health care in general and particularly critical care services remain one of the reasons responsible for inadequate provision of basic monitoring devices and more advanced ones such as the cardiac output monitors, arterial blood gas machines, transesophageal echocardiography, etc. even when the facility is available, the prohibitive cost makes it unaffordable for an average patient. despite the infrequent use of the venous pressure for optimization of hemodynamics among our respondents, this addiction to cvp by many clinicians despite studies that have shown its inadequate predictability of fluid responsiveness has been documented by many other authors. this has been attributed to familiarity with traditional variables and unavailability of standard protocols for cardiac output optimization. considering available hm tools available in nigeria, central venous monitoring appears to be an important tool and may represent the peak device for assessing fluid responsiveness among high - risk patients. more recent parameters such as pulse pressure variation and systolic pressure variation are said to provide more reliable information about fluid responsiveness and can be employed readily. acquiring equipment that provides real - time values of these parameters may be a challenge for poor resource economy like ours, however, the parameters can be calculated intermittently at bedside from information obtained from the invasive arterial pressure waveform. as opined by most respondents in this survey, results of recent studies did not show improved outcome in hrsp and critically ill patients following liberal transfusion compared to restrictive blood transfusion. the choice of crystalloids as first choice fluid for resuscitation by most of our respondents agrees with the opinion of american anesthetists in a similar study but differs from that of european and chinese anesthetists. the availability and lower cost of crystalloids could have played a role. while the controversy surrounding the choice of the best fluid for resuscitation rages on, many authors continue to report on the limitations of crystalloids use. nunes. in their study on the hemodynamic effects of crystalloids of patients with circulatory shock observed that cardiac index decreased toward baseline values 60 min after crystalloid infusion. this further strengthens the body of evidence that the hemodynamic effect of volume expansion with crystalloid is short. reasons that have been adduced to be responsible for this includes the limited intravascular volume effect of crystalloids revealed by volume kinetics studies and damage to the endothelial glycocalyx layer under inflammatory conditions such as sepsis, surgery or trauma leading to protein extravasation, and reduced intravascular effect of crystalloids. some of our respondents will prefer he s as a first line product. though the use of he s helps with the reduction of resuscitation fluid volume, it is currently the subject of many trials trying to assess its safety. in studies involving a patient with severe sepsis, he s was associated with increased mortality and acute kidney injury resulting in the need for renal - replacement therapy. with almost half of our respondents possessing additional fellowship especially in critical care and cardiac anesthesia, the inability to constantly employ their skill may lead to skill attrition and frustration especially when they lack materials and equipment needed to provide standard care despite having adequate knowledge of what to do. anesthetists managing hrsp in our environment appear gravely constraint and are therefore left with basic monitoring tools for noninvasive blood pressure, electrocardiograph, oxygen saturation, and end - tidal carbon dioxide which are insufficient for high - risk patients and early goal directed therapy. it has been said that no monitoring tool, no matter how accurate, by itself has improved patient outcome. while attempts are on in improving access to new technologies to improve the level of monitoring available for hrsp, clinicians must ensure judicious use of available devices in the best way possible to reduce the morbidity and mortality in this group of patients. this is, however, higher than that obtained from the asa members (42.9%) and close to that of the esa members (57.1%) in a similar study. inadequate access to internet and use of wrong e - mail addresses played major roles in this low response rate. furthermore, there is a possibility that some of the anesthetists contacted may be uninterested in the survey because of little or no involvement in the care of hrsp. nigerian consultant anesthetists employ mostly noninvasive blood pressure, cvp, and invasive blood pressure for hm in hrsp. they demonstrated a good knowledge of necessary hemodynamic goals to achieve during management of hrsp. however, most rated their current practice as inadequate largely because of unavailability of better hm and other tools for monitoring oxygen delivery during surgery for high - risk patients. a prospective observational study is needed to assess outcome in this subset of nigerian patients. | background : hemodynamic monitoring (hm) and optimization of cardiac output and parameters of dynamic fluid responsiveness is said to improve perioperative outcome in high - risk surgical patients (hrsp). there is insufficient data to determine the burden of care and hm practices in hrsp in nigeria. hence, the need to assess and document the current hemodynamic management practices of anesthetists in nigeria regarding patients undergoing high - risk surgery.methods:an electronic mail (e - mail) based survey was conducted among 180 consultant members of the nigeria society of anaesthetists. the survey contained 24 questions that range from practice location, experience in the perioperative management of high - risk patients, expectations of care, to what is available to the anesthetists to provide such care. the survey was on for 3 months.results:a total of 157 e - mail messages were delivered, and 73 responses were received, giving a response rate of 46.5%. the survey showed that 67 (91.8%) of respondents provide or directly supervise anesthesia for hrsp, 50 (84%) of them do this 15 times a week. noninvasive blood pressure (83.6%) was routinely monitored while the central venous pressure (cvp 35.6%), invasive blood pressure (28.8%), and cardiac output (1.4%) monitored less often. urine output, arterial blood pressure, pulse rate, and clinical experience were considered best indicators of volume expansion. most respondents were of the opinion that oxygen delivery to tissues is of major importance during the management of hrsp.conclusion:nigerian consultant anesthetists employ mostly noninvasive blood pressure, cvp, and invasive blood pressure for hm in hrsp. though a good knowledge of hemodynamic goals was demonstrated, most rated their practice as inadequate. |
autism spectrum disorders (asd), according to the diagnostic and statistical manual of mental disorders 5 edition (dsm-5), are neurodevelopmental pathologies impairing both social competencies and patterns of behavior. until today it is probably also for this reason that in the last decades complementary and alternative medicine (cam) has spread widely among families of asd children, although apart from melatonin, there is no scientific evidence of their effectiveness. one of the most commonly used cam practices in asd children is the supplementation of omega-3 that are essential fatty acids present in the following foods : fish, seafood, meat, eggs, vegetable oils, cereal - based products. we describe the case of a child with asd who seemed to respond to omega-3 supplementation in a relevant and lasting manner. family history was positive for asd in two first - degree paternal cousins ; previous language delay in the paternal line. the boy came to our observation for the first time at the age of 2 years 10 months. already at that time, there were qualitative anomalies in terms of intersubjectivity (limited exchange capacity), communication (lacking both the verbal and nonverbal), and interests (perseverative activities such as hitting objects against each other), so as to justify a diagnosis of asd, according to the dsm-5 criteria. autism diagnostic observation schedule, module 1, showed an overall result above the cutoff for autism, with a score above the cutoff for autism in language and communication, as well as in reciprocal social interaction. the childhood autism rating scale 2 edition standard version (cars2-st) showed results consistent with mild to moderate symptoms of asd (see later). after obtaining an informed consent, at the age of 4 years 11 months an oral treatment with omega-3 at the dosage of 1 g a day was started. since then, significant improvements were observed in the clinical picture. the child appeared more active and responsive to solicitations, verbal (comprehension and expression) and nonverbal communication skills increased, personal autonomy improved, oppositional behaviors as well as hyperactivity and inattention decreased. these improvements have been quantified through cars2-st [figure 1 ] : while the total score was 36.5 (cutoff for the presence of mild to moderate symptoms of asd = 30) before omega-3 treatment start, it decreased to 33 at the most recent assessment, 22 months after omega-3 treatment start. according to cars2-st, improvement of scores involved the following items : relating to people ; visual and listening response ; verbal and nonverbal communication ; activity level ; and general impression [figure 1 ]. therefore, omega-3 supplementation seemed to have a favorable impact on the quality of life of the child. it should be noted that the applied behavior analysis intervention, already underway when the treatment with omega-3 was started, was not subsequently modified. various attempts to suspend the omega-3 supplementation during the 22 months of follow - up failed because of significant symptom worsening (restlessness, agitation, decrease of responsiveness to teaching), which then disappeared after the resumption of the treatment. there were no side effects attributable to omega-3. at the time of the most recent evaluation, at the age of 6 years and 9 months profile of the scores of the 15 items included in the childhood autism rating scale, 2 edition standard version, respectively before (black horizontal bars) and 22 months after (white horizontal bars) the start of omega-3 treatment. note that score 1 corresponds to the normal behavior, while score 4 corresponds to the most atypical behavior the interesting hypothesis of van elst. seems to be a good theoretical basis for treatment with omega-3 supplementation in children with asd. they speculated that the increase in asd prevalence during the last decades is related to dietary modifications of fatty acid composition, characterized by a higher ratio omega-6/omega-3. in particular, the omega-3 deficit, especially in the early stages of life, may cause changes of myelination, neurogenesis, synaptogenesis, neurotransmitter turnover, brain connectivity, cellular differentiation and development, inflammatory reactions, cognitive functioning, and behavior. but so far, based on the results of randomized clinical trials, evidence - based medicine negates the effectiveness of omega-3 in asd children in particular on symptoms such as deficits in social interaction and communication, hyperactivity, stereotypies. the empirical value of a case report like ours is obviously not comparable to that of a randomized clinical trial, primarily due to the risk of mistakenly considering a placebo effect as a real effect of the drug. we were aware of this possible bias when describing our case nevertheless, considering anecdotal experiences, including that of our patient, and nonrandomized trials, the presence of a subgroup of asd patients who are really responders to omega-3 can not be excluded. these responders might not appear when evaluating the omega-3 effects in a sample taken as a whole. further, considering the high heterogeneity of asd phenotypes and etiologies, it seems to be very unlikely that a given treatment produces the same results in all affected individuals. we believe that the question about the effectiveness of omega-3 in asd is still open and that it requires carrying out studies that check for the possible presence of a subgroup of asd individuals responders to this treatment. should the actual presence of these responders be determined, it would surely be very important to identify what the characteristics are that distinguish them from nonresponders. | one of the most commonly used complementary and alternative practices in children with autism spectrum disorder (asd) is the supplementation of omega-3. we describe the case of a child with asd who seemed to respond to omega-3 supplementation in a relevant and lasting manner. so far, based on the results of randomized clinical trials, evidence - based medicine negates the effectiveness of omega-3 in asd children. nevertheless, considering anecdotal experiences, including that of our patient, and nonrandomized trials, the presence of a subgroup of asd patients who are really responders to omega-3 can not be excluded. these responders might not appear when evaluating the omega-3 effects in a sample taken as a whole. studies that check for the possible presence of this subgroup of asd individuals responders to omega-3 are necessary. |
exposure to asbestos fibres has been shown to cause asbestosis, pleural diseases such as pleural plaques, lung cancer, malignant mesothelioma and some other types of cancers [13 ]. one of the most frequent diseases caused by inhalation of asbestos is asbestosis, an interstitial pulmonary process that slowly develops into diffuse pulmonary fibrosis. although the causal relationship between asbestos exposure and asbestosis has been well proved, little is still known about the genetic factors that may influence the development of this disease [2, 5 ]. at present it is suggested that both environmental and genetic factors may play an important role in the development of asbestosis [2, 6, 7 ]. the gene - environmental interaction studies published so far have mostly focused on the genes coding for xenobiotic metabolizing enzymes [2, 59 ]. numerous studies have suggested the central role of reactive oxygen and nitrogen species (ros and rns) in fibre - induced toxicity and development of asbestosis [1, 10, 11 ]. the most important reactive metabolites in the pathogenesis of asbestos - related lung diseases are superoxide anion (o2), hydrogen peroxide (h2o2), hydroxyl radical (oh) and nitric oxide (no) [10, 12, 13 ]. superoxide dismutases (sods) together with catalase and glutathione peroxidases constitute a primary defence against oxidative stress [10, 14, 15 ]. sods catalyze the conversion of superoxide anion (o2) to hydrogen peroxide (h2o2) and oxygen (o2) [14, 16 ]. manganese sod (mnsod or sod2) is a manganese (mn)-containing enzyme localized in mitochondria, whereas extracellular sod (ecsod or sod3), which contains copper (cu) and zinc (zn), is predominantly found in extracellular space [14, 15 ]. in humans, sod2 is encoded by the sod2 gene localized to chromosome 6 (region 6q25), and sod3 by the sod3 gene, which has been localized to chromosome 4 (region 4p - q21) [15, 17, 18 ]. the most common functional polymorphism of the sod2 gene is cytosine (c) to thymine (t) substitution (201c > t, rs4880), which results in alanine (ala) to valine (val) amino acid change at position 9 of the mitochondrial targeting sequence (sod2 ala 9val) [19, 20 ]. it has been suggested that this polymorphism alters the secondary structure of the protein, and hence may affect the efficiency of transport of the sod2 into the mitochondria, where it would be biologically available [19, 20 ]. sutton. demonstrated that ala - containing sod2 is actively targeted into the mitochondrial matrix, whereas the val - containing variant is partially arrested within the inner mitochondrial membrane. the ala - variant also resulted in 4-fold higher levels of the mature exogenous protein and sod2 activity than the val - variant. the frequency of each allele is around 50% in caucasian populations, whereas the val allele is more frequent in japan (87.9%). among asbestos - related diseases, the sod2 9val / val genotype was associated with increased lung cancer risk in individuals with a low asbestos exposure score, whereas another study found an increased risk of mesothelioma in subjects with the sod2 9ala / ala genotype. in contrast, a study by hirvonen. suggested no major modifying role for sod2 polymorphism in asbestos - related pulmonary disorders. sod3 binds lung matrix components and inhibits their fragmentation in response to oxidative stress [25, 26 ]. in the sod3 gene, a cytosine (c) to guanine (g) substitution (896c > g, rs1799895) causing an amino acid change from arginine (arg) to glycine (gly) at position 213 has been reported (arg213gly) [15, 27, 28 ]. although this polymorphism is rare, occurring in 2 to 6% of various populations [15, 27, 28 ], it causes an 8- to 15-fold increase in the concentration of plasma sod3 levels due to impaired binding to the extracellular matrix [27, 28 ]. to our knowledge, the influence of sod3 arg213gly polymorphism on the risk of developing asbestosis in workers exposed to asbestos has not been studied so far. most of the data come from studies on sod3 transgenic [29, 30 ] and knockout mice [31, 32 ] that clearly demonstrate the importance of sod3 in lung protection. enhanced lung damage, inflammation, and fibrosis were observed in sod3 knockout mice compared to wild - type mice in asbestos - induced lung injuries [25, 32, 33 ]. to study the influence of genetic polymorphisms of some of the most important metabolic enzymes on the risk for asbestosis and possible interaction with asbestos exposure, the basic aim of this study was to investigate the influence of the sod2 ala 9val and sod3 arg213gly genetic polymorphisms on the risk for developing asbestosis in workers occupationally exposed to asbestos. in a nested case - control study, all 356 subjects diagnosed with asbestosis were first selected from the cohort of 2 080 workers that were presented at the state board for the recognition of occupational asbestos diseases from 1 january 1998 to 31 december 2003. for each case, one control with no asbestos - related disease was recruited from the same cohort using gender and date of birth as matching factors. from the selected subjects, 2 cases and 9 controls developed cancer in the period between the recognition of the occupational disease and the beginning of the study, 40 cases and 29 controls died during the same period, and 52 cases and 53 controls refused to participate, so the final number of cases was 262 (73.6%) and that of controls 265 (74.4%). information about smoking, including duration of smoking and the number of pack - years of smoking, was obtained for all subjects during an interview using a standardized questionnaire [3, 34 ]. all subjects that participated in the study worked at the salonit anhovo asbestos cement manufacturing plant in anhovo, slovenia and were occupationally exposed to asbestos. for each case and control included in this study, the methodology of cumulative asbestos exposure calculation has already been described in detail in previous papers [3, 6 ]. the diagnosis of asbestosis or no asbestos - related disease was confirmed by two groups of experts from the state board for the recognition of occupational asbestos diseases that operate at the clinical institute of occupational medicine ; each group consisted of an occupational physician, a pulmonologist, and a radiologist. the diagnostic criteria were based on the helsinki criteria for diagnosis and attribution of asbestos diseases and on the american thoracic society recommendations. for genetic analysis, capillary blood samples from the fingertips of all subjects were collected on fta mini cards (whatman bioscience) and genomic dna was isolated as previously described. to determine sod2 ala 9val and sod3 arg213gly polymorphisms, taqman snp genotyping assays were used (c_8709053_10 and c_2307506_10, resp., ab assay, applied biosystems, foster city, calif. real - time pcr was performed under universal conditions on abi 7500 (applied biosystems, foster city, calif. taqman snp genotyping assays were validated on 100 samples genotyped by the pcr - rflp method. to determine sod2 ala 9val polymorphism, the region encompassing the polymorphic site was amplified and pcr products were digested with ngom iv (new england biolabs), as previously described. to determine sod3 arg213gly polymorphism, the corresponding pcr products were digested with mwoi (new england biolabs), as previously described. among statistical methods, next, t - tests for differences of means of variables between the cases and controls were calculated, and tests were used to determine whether the observed differences in proportions between the study groups were statistically significant. to assess the causal relationship between asbestosis, genotypes, cumulative asbestos exposure, and standard confounders (age, sex), univariate logistic regression was first used, followed by multivariate logistic regression modelling. a possible synergistic effect between genotypes and cumulative asbestos exposure was investigated by using dummy variables. the study was approved by the slovenian ethics committee for research in medicine and was carried out in line with the helsinki declaration. there was no statistical difference in gender between the cases and controls. among the 262 cases there were 186 men and 76 women, and among the 265 controls 183 men and 82 women (= 0.24, p =.628). on average, cases were 61 and controls 57 years old, showing a statistical difference between them (t = 5.18, p =.000). no difference in smoking was observed between the cases and controls (table 1). as expected, the mean cumulative asbestos exposure was higher among the cases than the controls (t = 4.78, p =.000) (table 1). all of the subjects were genotyped for sod2 ala 9val and sod3 arg213gly polymorphisms, although the amplification of the sod2 gene failed in 4 cases and 4 controls, and that of the sod3 gene in 4 cases and 2 controls. three different sod2 genotypes (ala / ala, ala / val, and val / val) and two sod3 genotypes (arg / arg and arg / gly) were detected. the sod2 9ala / ala genotype was observed in 29.0% of cases and 21.4% of controls, ala / val in 45.0% of cases and 53.3% of controls, and val / val in 26.0% of cases and 25.3% of controls. the sod3 arg / arg genotype was found in 95.7% of cases and 97.3% of controls, and the arg / gly genotype was observed in 4.3% of cases and 2.7% of controls. combining polymorphic sod2 genotypes, the frequency of the 9ala / ala genotype versus the frequency of the ala / val and val / val genotypes was significantly higher in the cases than in the controls (= 3.99, p =.046) (table 2). in contrast, no significant difference was found in the frequency of the sod3 arg / arg genotype compared to the frequency of the arg / gly genotype (= 1.00, p =.317) (table 2). in subsequent logistic regression analysis, no association was observed between asbestosis and ever / never smoking (or = 0.98, 95% ci 0.691.39). knowing that cumulative asbestos exposure was skewed to the right, logarithmically transformed cumulative asbestos exposure was calculated, giving an or of asbestosis of 3.21 (95% ci 2.434.23). analyzing the association between asbestosis and sod2 genotypes, the or of asbestosis was 1.61 (95% ci 1.052.46) for the 9ala / ala genotype versus the ala / val genotype, 1.32 (95% ci 0.812.14) for the ala / ala genotype versus the val / val genotype, and 1.50 (95% ci 1.012.24) for the ala / ala genotype versus combined ala / val and val / val genotypes. the or of asbestosis calculated for the sod3 arg / gly genotype compared to the arg / arg genotype was 1.63 (95% ci 0.624.27). using multivariate logistic regression modelling, the risk of asbestosis for the sod2 9ala / ala genotype versus combined ala / val and val / val genotypes did not change considerably after adjustment by gender, age, smoking, and cumulative asbestos exposure (table 3). the results showed that gender, age, and smoking did not substantially influence the risk of asbestosis for the sod3 arg / gly compared to arg / arg genotype either, but the involvement of cumulative asbestos exposure changed the or from 1.63 (95% ci 0.624.27) to 2.07 (95% ci 0.725.94), indicating a possible confounding effect of cumulative asbestos exposure (table 3). to test the possible interaction between asbestos exposure and the sod3 genotype, a dummy variable was created by multiplying the sod3 arg / gly genotype and cumulative asbestos exposure. no synergistic effect was found (or = 0.61, p =.456). when the sod2 and sod3 genotypes were simultaneously introduced into logistic regression analysis, the or of asbestosis was 1.51 (95% ci 1.012.25) for the sod2 9ala / ala genotype and 1.61 (95% ci 0.614.24) for the sod3 arg / gly genotype, showing independent activity of the two. increasing evidence suggests that both asbestos exposure and genetic factors play an important role in the development of asbestosis [2, 68 ], which is known to be among the most frequent asbestos - related diseases. the key finding of this study is that the sod2 9ala / ala genotype increases risk of asbestosis. although the function of sod2 ala 9val polymorphism requires further investigation and elucidation, it has been suggested that human sod2 with ala in the mitochondrial targeting sequence allows more efficient import into the mitochondrial matrix and is therefore presumed to result in higher levels of the mature sod2 and enzyme activity than the val - variant [19, 21 ]. in line with these observations, it could be predicted that having the sod2 9ala / ala genotype is beneficial. however, several epidemiological studies have indicated an increased risk of developing diseases in individuals carrying this genotype [22, 24, 40, 41 ]. in addition, it has been suggested that sod2 may play a dual role in relation to ros. on the one hand, sod2 is considered to be a detoxifying enzyme that removes superoxide anion [14, 16 ]. on the other hand, it has been suggested that h2o2 generated by sod2 is toxic because it can be converted to the more toxic oh radical if not removed quickly and efficiently enough by glutathione peroxidase and catalase [21, 42 ]. an elevated level of sod2 activity could therefore result in increased production of h2o2 and oh radicals, which can cause cell injury and consequently a higher risk of developing diseases. in line with these reports and the assumption that individuals with the sod2 9ala / ala genotype may have higher sod2 enzyme activity and therefore likely elevated levels of h2o2 and oh radicals, which are known to be involved in the pathogenesis of asbestosis, our finding of an increased risk of asbestosis in subjects with the sod2 9ala / ala genotype may be considered biologically plausible. in contrast to the observations of the present study, hirvonen. suggested no major modifying role for sod2 polymorphism in asbestos - related pulmonary disorders in a study based on 20 subjects with mesothelioma and 41 subjects with asbestosis or / and pleural plaques. found an increased risk of mesothelioma in subjects with the sod2 9ala / ala genotype, which very likely agrees with the findings of this study. a slightly elevated risk of asbestosis was also observed for the sod3 arg / gly genotype, but the result was not significant. despite the higher frequency of the sod3 arg / gly genotype in subjects with asbestosis compared to the controls, no significant difference was observed due to the lack of power. however, the results of several studies demonstrated that sod3 knockout mice show enhanced lung damage, inflammation, and fibrosis compared to wild - type mice in asbestos - induced lung injuries [25, 32, 33, 43 ]. in line with these reports, sod3 polymorphism might play a role in developing asbestosis and should therefore be further investigated in association with this disease. the risk of asbestosis for the sod3 arg / gly genotype increased slightly after involvement of cumulative asbestos exposure. the findings of the current study were not biased by genetic heterogeneity because all of the subjects were recruited in a small geographic area with an ethnically homogenous population. there were also no differences in the cumulative exposure or diagnosis of cancer between the participants and subjects that did not want to take part in the study, died or developed a malignant disease in the period between the recognition of occupational disease and beginning of this study. overall, this study found evidence of an association between asbestosis and sod2 ala 9val genetic polymorphism. the results of our previous studies showed a decreased risk of asbestosis in individuals with the glutathione s - transferase t1-null genotype and an increased risk in subjects carrying the glutathione s - transferase p1 genotype coding for an enzyme with high conjugation capacity. all of these results suggest that genetic factors may have a significant influence on the development of asbestosis. these findings should also be seriously considered in future research in association with other asbestos - related diseases. furthermore, to our knowledge this is the first study investigating the role of sod3 genetic variants in relation to asbestosis in workers occupationally exposed to asbestos, which is a topic that demands further investigation and elucidation. | manganese and extracellular superoxide dismutases (sod2 and sod3) are part of the enzymatic defence against reactive oxygen species, which are involved in the pathogenesis of asbestosis. this study investigates whether sod2ala 9val and sod3 arg213gly genetic polymorphisms represent risk factors for asbestosis in workers exposed to asbestos. the study included 262 cases with asbestosis and 265 controls with no asbestos - related disease. cumulative asbestos exposure was calculated for each subject. a real - time pcr assay was introduced for genotyping. logistic regression analysis was used to assess asbestosis risk. asbestosis was associated with the homozygous sod2 9ala / ala genotype (or = 1.50, 95% ci 1.012.24), whereas the association for the sod3 arg / gly genotype was not significant (or = 1.63, 95% ci 0.624.27). the finding that the sod2 9ala / ala genotype increases the risk for asbestosis indicates that, in addition to asbestos exposure, genetic factors may also have a significant influence on the development of asbestosis. |
many internet vendors including amazon, google, and microsoft have introduced various cloud solutions to provide computing resources, programming environments, and software as services in a pay - as - you - go manner. for example, amazon introduces amazon elastic compute cloud (ec2) which provides computing cycle as a service and google introduces google app engine (gae) to provide programming environments as a service [1, 2 ]. cloud has raised many concerns related to security, data leakage, and sharing of resources. as the heart of the security concern the first one is fingerprint verification while the second field represents partial encryption of digital image based on discrete wavelet transformation (dwt). biometrics - based individual authentication schemes that apply physiological biometric such as eye recognition, fingerprint, or behavioral actions such as speech and handwriting traits are becoming progressively widespread compared to conventional systems that are depending on e - tokens (e.g., rsa - token) or knowledge such as password. conventional authentication systems can not distinguish between an adversary that illegally gains the access privileges of an honest user and the sincere user himself. moreover, biometric authentication schemes can be more appropriate for the users since there is no password to fail to recall or token to be stolen / lost and a single biometric trait such as fingerprint can be used to access many accounts without needing to remember their passwords. it includes a set of ridge lines, which primary flow parallel, producing a pattern. the points of ridge lines terminate or bifurcation are named minutiae [57 ] whereas permitting to galton, each ridge is categorized by several minute individualities called minutiae, which may split and almost directly reunite, enclosing a small spherical or elliptical space or sometimes the autonomous beginning or termination of ridges. ridges and valleys often run in parallel ; sometimes they bifurcate or they terminate some other times. finally, a good quality fingerprint must contain 2580 numbers of minutiae according to the sensor resolution and finger location on the sensor. briefly, fingerprint technique considers a complex pattern recognition issue ; designing algorithms that have the ability to extract significant features and match them in a strong approach is fairly hard, especially in low quality fingerprint images. there is a common fallacy that self - propelled fingerprint recognition is a completely solved issue since it became in the first level of pattern recognition applications almost fifty years ago. on the other side, fingerprint technique is still a challenging and a vital pattern recognition issue. as a result, the fingerprint verification system consists of two phases : enrollment and verification. in enrollment phase, the user registers his fingerprint as a template to the server who extracts features from user 's fingerprint. at the verification phase, the fingerprint data of a user is compared with the template stored in the server and then it detects the validity of a user. we notice traditional fingerprint system required extra hardware and software for each user 's logging system. in this paper, we proposed a new scheme for verifiying user without required software for main stages : input fingerprint, preprocessing image, features extraction, classification, and verification. additionally, our proposed scheme does not need to use the extra hardware for reading user 's fingerprint for each user 's logging system. cryptography is considered as one of the technical field that means to support security to data being communicated on information and communications structures. it is especially beneficial in the states of monetary and user 's data, irrespective of the actuality that the user 's data is being sent over a medium or is saved on a storage device. it supports a powerful means of validating the authenticity of data and recognizing the culprit, if the authority and integrity of the data are desecrated. because of the improvement of electronic business, cryptographic methods are hardly critical to the improvement and usage of defiance information technologies and communications networks. dissimilar to text messages, digital image data have their special characteristics, such as bulk capacity, high correlation among pixels, and high redundancy, not to indicate that they commonly are enormous which together make conventional encryption schemes difficult to use and slow to process. the major aim of the partial encryption is to abbreviate the computational workload and performance and to obtain a good security level. image encryption algorithms can be classified into full encryption and partial encryption depending on the sum of the encrypted data. regrettably, the performance of encryption and decryption functions is a major concern in real - time image transmission. time can be classified into two ranks, the first rank of encryption time and the second rank of time transferring images. encryption and decryption functions are not fast enough to deal with the vast amount of transmitted data. an important criterion connecting to the scheme is to reduce the image encryption size and keep quality of the image. partial encryption method is an appropriate scheme to encrypt only the lowest segment of data to reduce the computational requirements of huge amounts of multimedia data. it is necessary to reduce the performance of images encryption in distributed network by minimizing the sum of data to encrypt, attaining a logical security, and minimizing the computation [10, 11 ]. in this paper, we propose a new scheme for user 's fingerprint authentication, solving the issues in the ordinary setting. second, we merge three factors (fingerprint, partial image encryption, and dwt) for proposing a new scheme based on user 's fingerprint verification. third, our proposed scheme does not require extra hardware (fingerprint scanner, e - token) and software (input fingerprint, preprocessing, feature extraction, classification, matching). fourth, our proposed scheme has a good balance between security and performance of fingerprint verification comparing with previous schemes. fifth, our proposed scheme contains important merits as follows : (1) it provides mutual verification between user and service provider ; (2) it accomplishes user anonymity ; (3) the service provider and the user can achieve verified session 's keys ; (4) it has several advantages such as low cost, simple integration with available infrastructure, and essay to deploy and manage in practical system. we detail the security analysis and implementation results in section 5, and section 6 concludes the paper. figure 1 explains the main idea of our proposed scheme, which consists of three components : trusted third party (ttp), service provider (sp), and users (ui). ttp is responsible for gaining main keys to each user valid () and service provider () to complete verification phase. generally, the proposed scheme can be divided into three phases : setup, registration, and verification. in our proposed scheme, ui will register their username (uni = h(uni)) and fingerprint (fp) to ttp in the setup phase. after that, ttp computes discrete wavelet transform on user 's fingerprint fp = dwt(fp) and generates shared key (sh). then, it sends important information (fp, sh, uni), (fp, sh) to the service provider and user, respectively. however, user 's important information and service provider 's important information are shared in (fp, sh). after that, ui encrypts and saves his important information in any extra device that prefers it. in verification phase, the valid user sends their username anonymity and encrypts their fingerprint fp based on (dwt, sh) to sp. then, sp verifies user 's securing information to check the validity of user depended on important information that has received at setup phase from ttp. then, sp sends back challenge value to the user for ensuring validity of sp. as a result the discrete wavelet transform is used to analyze the two - dimension image where it has the ability to divide the image into four main areas. the present subbands are as follows : high - low (hl), low - high (lh), and the high - high (hh). in brief, they are indicated as dwt [11, 12 ]. the wavelet analysis is permitted in using the long periods of time where the ambition is to get more accurate information from low frequency and high frequency from the shorter zones [912 ]. the important data reside in the low frequency because it gives you the opportunity to get a signal of an identity. when you go to the high frequency content, it is characterized by high accuracy. it can be observed by the wavelet analysis for lena 's image (see figure 2(a)). figure 2(b) displays the first level of the dwt [13, 14 ]. the tactic followed by the separation of the different characteristics of the signal relies on the method of gathering the energy of a few elements. this class of dwt refers to the place of analysis via the approximation area at level j in four zones. the histogram image means the process of distribution density of brightness and the contrast in the gray - level image [9, 10 ]. this method is applied in our approach as measure ; anyone can note enhanced ratio during this scale. correlation (crr) is a measure of sameness between the image before and after processing. the exemplary outcomes are near the one which can be identified by the following equation [1619 ] : (1) crr = (r=1nc=1m(in(r, c)in)(i0(r, c)in0)) ([r=1nc=1m(in(r, c)in)2]kkkkkkkk[r=1nc=1m(in(r, c)in)2][r=1nc=1m(in(r, c)in)2])1, where in(r, c) is the digital value of the pixel in the (r, c) of image before processing and in is referring to the image before processing : (2)in=1mnr=1n c=1m(in(r, c)).i0(r, c) is the digital value of the pixel in the (r, c) of image before processing : (3)i0=1mnr=1n c=1m(i0(r, c)), where m is height of the image, n is width of the image, and r and c are row and column numbers. the average of these correlations is used to generate the crr of the recreated color image in rgb system. the privacy of the encrypted data with stability in time and cost effectiveness of the encryption method is the main challenge that is faced in image encryption topic. there are many related works that referred to this challenge [917 ] distributing via the frequency, spatial, and the hybrid field methods in full encryption schemes. then, they used this key matrix to encrypt gray level as well as color images. their scheme works fine for all types of digital images excluding the images with background of the same gray scale or same color. nien. applied a hybrid encryption technique for the true image depending on the multichaotic model. they combined the pixel - chaotic - shuffle (pcs) and bit - chaotic - rearrangement (bcr) schemes. the first one (pcs), a fast encryption scheme which can vary the locations of each pixel, is practical to fully disregard the original image outlines applying four third - order chaos like henon, lorenz, chua, and rssler chaos maps. the second one (bcr) employs chaos scheme to make chaotic codes reorganization in pixels practical. the merging of the pcr and the bcr will cause us to increase the key space of digital images and suffers from resisting the extensive attack when correlation coefficient is refers to 0.0031. seyedzade. presented an algorithm for image encryption depending on sha-512 hash function. the first one does preprocessing procedure to shuffle one half of digital image while the second one applies hash function to create a random number mask. then, the mask is xored with the other section of the image that is going to be encrypted. abuhaiba and hassan propose a new image encryption scheme which employs amount and phase manipulation applying differential evolution (de) method. their scheme has passed key out of space analysis, algebraic analysis, and key sensitivity analysis to exhibit the security of the new image encryption scheme. munir presents a technique that uses the arnold cat map transformation on low frequency subband of the dct transformed to encrypt image. their essential idea for choosing the low frequency subband of the dct transformed image is certified to the truth that the human visual system (hvs) is more imagined to important information (such as object, shape) at lower frequencies compared with higher frequency information. their scheme is represented to be strong against noise, though to some amount since the decrypted image views some attendance of noise. in this paper, we use partial image encryption based on discrete wavelet transform detection as the main factor to verify legal user in cloud computing environment. ttp sends important information (discrete wavelet transform of user 's fingerprint, shared key, and user 's anonymity) to valid user and cloud service provider. the shared key derives from discrete wavelet transform of user 's fingerprint and uses then it uses it to encrypts / decrypts image. additionally, our proposed scheme embeds salt key with shared key to generate one time key for each user 's login. also, our work encrypts user 's fingerprint once time for each verification phase. in the performance our presented scheme has been evidenced to achieve sturdy security with low cost and high performance compared with previous schemes. the wide majority of modern automated fingerprint authentication schemes are minutiae (level 2 features) using biometric systems [6, 7 ]. the minutiae - based systems are generally implemented well with high - accuracy fingerprint images and an adequate fingerprint surface area. these conditions, however, may not be attainable at any time. in several cases, only a small part of the test fingerprint can be comparative with the reference fingerprint. additionally, comparing fingerprints gained via small - area sensors is hard due to the potentiality of having too little interference between different gains of the same finger. furthermore, the image of fingerprint is a unique pattern that consists of ridge and valley points on the surface of a finger. the ridge is well defined as a single curved section, and a valley is the region between two adjacent ridges. minutiae points (see figure 4) represent the local ridge cavities, which are classified into two classes : bifurcations and ridge endings. continuously, these minutiae points are employed to detect the uniqueness of a user 's fingerprint. ultimately, the minutiae consider the first part processes a raw fingerprint image and extracts fingerprint features from that image. on the other side arora and singla presented a scheme that depended on fingerprint verification which has been advanced using laboratory virtual instrument engineering workbench (labview). the proposed scheme uses a learning stage during the enrollment phase, which does not exist in conventional image - depending systems. in the learning stage a pseudorandom subsampling is achieved in which pixels are analyzed by testing their surrounding neighborhood for regularity and each pixel is categorized according to how large the regularity of its surrounding neighborhood is (e.g., 3 3, 5 5, etc.). this stage will reduce the amount of computations in the matching phase. in the verification phase chen. presented rebuilding the fingerprint 's orientation field from minutiae and employ it in the matching phase to enhance the system 's performance. cao. have presented two novel characteristics to deal with nonlinear deformation in fingerprints. presented incorporating ridge characteristics such as ridge count, ridge curvature direction, ridge length, and ridge type together with minutiae to increase performance of the matching phase. in this paper, we propose a secure and efficient fingerprint verification scheme for the cloud computing using partial encryption of fingerprint based on discrete wavelet transform. in this paper, we proposed a new scheme for verifying user without required software for main stages : input fingerprint, preprocessing image, feature extraction, classification, and verification. additionally, our proposed scheme does not need to use the extra hardware for reading user 's fingerprint for each user 's logging system. our proposed scheme consists of three phases setup, registration, and verification. in the setup phase, the major elements (ttp, sp, and ui) also use a cryptographic hash function h() and a symmetric key encryption / decryption enc()/dec(), and ttp sets up n = pq, where both p and q are two large primes. the user (ui) sends his username (uni = h(username)) and fingerprint fpi to the trusted third party (ttp) through a secure channel. after that, ttp computes fpi = dwt(fpi) where dwt is used to analyze the two - dimension image where it has the ability to divide the image into four main areas. the data area is called the low - low (ll) subband. occasionally, it is named as an approximation area and represents fpi. after that, ttp saves (uni, fpi) and then provides public parameters keys pk = (uni, fpi, sh zn) and secret keys sk = (fpi, sh zn) to service provider and each user, respectively, in the secure channel. lastly, ui encrypts his secret keys (sk = encsh(sk)) by using his shared key and then saves his encrypted file at his preferred storage such as usb, samsung mobile. after registration phase the verification session is qualified as follows (see figure 5).(1)ui sp : uni, fpi, ri. ui performs the following steps.(i)decrypt his secret keys file based on his shared key sk = decsh(sk).(ii)generate random number ri zn and compute one time anonymous username uni = h(uniri), once shared key sh = sh ri, and (fpi = encsh(fpi)).(iii)send uni, fpi, ri to sp as a first factor.(2)sp ui : (x, y), pi. sp checks the validity of user 's information as follows.(i)compute uni = h(uniri) and check whether uni equals uni. if so, he accepts the user 's information request and performs the next step. otherwise, sp terminates verification phase.(ii)sp computes sh = sh ri, encrypts (fpi = decsh(fpi)), and checks whether fpi equals fpi. if so, he accepts the user 's information request and performs the next step. otherwise, sp terminates verification phase.(iii)sp generates a random number from user 's fingerprint (pi fpi) and positions (x, y) of pi as a challenge to valid user for ensuring validity of sp (see figure 6).(3)user verifies fpi(x, y) = ? (i)decrypt his secret keys file based on his shared key sk = decsh(sk).(ii)generate random number ri zn and compute one time anonymous username uni = h(uniri), once shared key sh = sh ri, and (fpi = encsh(fpi)).(iii)send uni, fpi, ri to sp as a first factor. generate random number ri zn and compute one time anonymous username uni = h(uniri), once shared key sh = sh ri, and (fpi = encsh(fpi)). (i)compute uni = h(uniri) and check whether uni equals uni. if so, he accepts the user 's information request and performs the next step. otherwise, sp terminates verification phase.(ii)sp computes sh = sh ri, encrypts (fpi = decsh(fpi)), and checks whether fpi equals fpi. if so, he accepts the user 's information request and performs the next step. otherwise, sp terminates verification phase.(iii)sp generates a random number from user 's fingerprint (pi fpi) and positions (x, y) of pi as a challenge to valid user for ensuring validity of sp (see figure 6). compute uni = h(uniri) and check whether uni equals uni. if so, he accepts the user 's information request and performs the next step. computes sh = sh ri, encrypts (fpi = decsh(fpi)), and checks whether fpi equals fpi. if so, he accepts the user 's information request and performs the next step. sp generates a random number from user 's fingerprint (pi fpi) and positions (x, y) of pi as a challenge to valid user for ensuring validity of sp (see figure 6). user verifies fpi(x, y) = ? pi. if it holds, then ui ensures validity of sp.. we will show that our scheme is secure against well - known attacks such as mitm attack, replay attack, and insider attack. moreover, our proposed scheme enjoys several merits, such as containing user anonymity, mutual verification, and session key agreement. proofthe mutual verification feature requires that an attacker can not impersonate a legal user to the service provider, and vice versa. only the valid user has the secret information (uni, fpi, ri, sh) to send these parameters to the service provider. sp compares (uni, fpi) with (uni, fpi), respectively. therefore, our proposed scheme achieves mutual verification between the two entities (see figure 6). the mutual verification feature requires that an attacker can not impersonate a legal user to the service provider, and vice versa. only the valid user has the secret information (uni, fpi, ri, sh) to send these parameters to the service provider. sp compares (uni, fpi) with (uni, fpi), respectively. therefore, our proposed scheme achieves mutual verification between the two entities (see figure 6). proofif an adversary attempts to eavesdrop on the user 's login request, he can not find the user 's anonymity from crypto hash function uni = h(uniri) since it is embedded in a random number ri with username, which are not identified to an adversary. if an adversary attempts to eavesdrop on the user 's login request, he can not find the user 's anonymity from crypto hash function uni = h(uniri) since it is embedded in a random number ri with username, which are not identified to an adversary. proofin the proposed scheme, only user 's secret data (sk) is stored on user 's storage such as usb, samsung phone. the data of sk does not help an adversary to use it without the user 's shared key (sh). if the legal user loses his preferred storage, it is difficult for any adversary to access or update the credential information because he can not obtain the user 's secret key (sk). therefore, the user 's secret data protects from retrieving by an adversary. in the proposed scheme, only user 's secret data (sk) is stored on user 's storage such as usb, samsung phone. the data of sk does not help an adversary to use it without the user 's shared key (sh). if the legal user loses his preferred storage, it is difficult for any adversary to access or update the credential information because he can not obtain the user 's secret key (sk). proofin our proposed scheme, when the user sends his parameters to log in to the the service provider, he generates secret key sh = sh ri to encrypt discrete wavelet transform of his fingerprint which is represented by fpi = encsh(fpi). even if an adversary can access the previous session key, he is still unable to get fresh values of sh which generates once for each user 's login session. continuously, the service provider can obtain the same new key sh = sh ri based on secret parameters (sh, pi) to compute fpi = decsh(fpi). finally, sp checks the validity of user 's fingerprint based on sh. additionally, our proposed scheme depends on user 's fingerprint to obtain secret keys (sh, sh) that are derived by using ((x, y), pi).. in our proposed scheme, when the user sends his parameters to log in to the the service provider, he generates secret key sh = sh ri to encrypt discrete wavelet transform of his fingerprint which is represented by fpi = encsh(fpi). even if an adversary can access the previous session key, he is still unable to get fresh values of sh which generates once for each user 's login session., the service provider can obtain the same new key sh = sh ri based on secret parameters (sh, pi) to compute fpi = decsh(fpi). finally, sp checks the validity of user 's fingerprint based on sh. additionally, our proposed scheme depends on user 's fingerprint to obtain secret keys (sh, sh) that are derived by using ((x, y), pi). proofour proposed scheme preserves the user 's fingerprint even when the secret key sh is disclosed or leaked. if the secret key is revealed by the adversary, the verification of the system is not impressed, and he can not use this key in the next login phase. at the same time, it is extremely hard that an adversary can derive the secret key which consists of random number and shared key sh. an adversary still can not obtain the secret key sh which is used to encrypt user 's fingerprint fpi = encsh(fpi). our proposed scheme preserves the user 's fingerprint even when the secret key sh is disclosed or leaked. if the secret key is revealed by the adversary, the verification of the system is not impressed, and he can not use this key in the next login phase. at the same time, it is extremely hard that an adversary can derive the secret key which consists of random number and shared key sh. an adversary still can not obtain the secret key sh which is used to encrypt user 's fingerprint fpi = encsh(fpi). proofan adversary performs a replay attack by eavesdropping the login message which is sent by a legal user to the service provider. then, an adversary reuses this message to impersonate the user when logging into the system in a next session. in our proposed scheme, each new user 's login request should be identical with sp 's keys (uni, fpi, ri, sh). therefore, an adversary can not pass any replayed message to the sp 's verification. an adversary performs a replay attack by eavesdropping the login message which is sent by a legal user to the service provider. then, an adversary reuses this message to impersonate the user when logging into the system in a next session. in our proposed scheme, each new user 's login request should be identical with sp 's keys (uni, fpi, ri, sh). therefore, an adversary can not pass any replayed message to the sp 's verification. proofthis type of attack happens when a valid user submits his login message to the service provider ; the adversary tries to catch user 's message and send it (or an updated version of the message) back to the same user. in our proposed scheme, the adversary fails to cheat the service provider since he can not restore the pair ((uni, sh), fp) sent from the user via verification phase. the service provider and user have one - time secret keys (sh, sh) to compute (fpi, fpi), respectively. this type of attack happens when a valid user submits his login message to the service provider ; the adversary tries to catch user 's message and send it (or an updated version of the message) back to the same user. in our proposed scheme, the adversary fails to cheat the service provider since he can not restore the pair ((uni, sh), fp) sent from the user via verification phase. the service provider and user have one - time secret keys (sh, sh) to compute (fpi, fpi), respectively. proofthis type of attack is intended when an adversary has the ability to intercept the messages between users and the server. then, he uses this message when the user signs out from the server. in our proposed scheme, the factors are securely encrypted and sent to the service provider. generation of the random value ri is through the creation of sensitive data (sh, fp) by ui as a login request to sp. therefore, an adversary spotting communication between ui and sp can learn ri which is used only once ; he is unable to compute sh, fp. however, when ui signs out of the service provider, an adversary can not compute both factors to impersonate the genuine user. as a result, this type of attack is intended when an adversary has the ability to intercept the messages between users and the server. then, he uses this message when the user signs out from the server. in our proposed scheme, the factors are securely encrypted and sent to the service provider. generation of the random value ri is through the creation of sensitive data (sh, fp) by ui as a login request to sp. therefore, an adversary spotting communication between ui and sp can learn ri which is used only once ; he is unable to compute sh, fp. however, when ui signs out of the service provider, an adversary can not compute both factors to impersonate the genuine user. as a result, proofin case of lost or stolen information of user 's preferred storage such as usb, ui will present request to sp for its revocation by pushing his information (uni, fpi). sp verifies the user 's secure information and ensures whether uni = uni and ppi = ppi. if the result is valid, sp deletes registration of user 's file (sk = (fpi, sh, n) from registration table. lastly, the user can change his username and password by reperforming the registration phase. additionally, an adversary can not get any benefits from stealing user 's extra storage because he can not be tolerated to decrypt registration user 's file which requires from an adversary to obtain user 's fingerprint fpi. obviously, our proposed scheme can provide revocation. in case of lost or stolen information of user 's preferred storage such as usb, ui will present request to sp for its revocation by pushing his information (uni, fpi). sp verifies the user 's secure information and ensures whether uni = uni and ppi = ppi. if the result is valid, sp deletes registration of user 's file (sk = (fpi, sh, n) from registration table. lastly, the user can change his username and password by reperforming the registration phase. additionally, an adversary can not get any benefits from stealing user 's extra storage because he can not be tolerated to decrypt registration user 's file which requires from an adversary to obtain user 's fingerprint fpi. we conduct several experiments for gauging the efficiency and the effectiveness of our work. figure 7 shows time processing of verification and login phases. however, the average time for the login and verification phase of our work is equal to 0.135601 seconds for each user who indicates the high speed of our solution. we have registered during our experiments 2500 users and supposed that each user needs maximum 0.75 seconds for logging into the system. our proposed scheme uses casia fingerprint image database version 5.0 (or casia - fingerprintv5) that consists of 20,000 user 's fingerprint images of 500 topics. the users ' fingerprint images of casia - fingerprintv5 were taken using uru4000 fingerprint sensor in one session. the volunteers of casia - fingerprintv5 include graduate students, employees, and waiters. in partial image encryption of discrete wavelet transform of fingerprint, we demonstrate the experimental results of the first two users ' fingerprints of different sizes with color image. to prove the sturdiness of our proposed scheme, we have implemented statistical analysis by computing the histograms, entropy, and the correlation of two adjacent pixels in the original image / encrypted image. the results of experimental and statistical analysis show that our proposed scheme supports an efficient and secure manner for real - time image encryption and transmission. figures 8, 9, 10, and 11 explain histogram of original, encrypted, and decrypted images. in addition to that, table 4 shows the results of correlation and entropy of original, encrypted, and decrypted images. in this paper, we have proposed a new fingerprint verification scheme for cloud computing environment that includes one - time username anonymity and partial image encryption based on edge detection as a second factor. these vital merits include the following : (1) the valid user can freely choose his passwords ; (2) our proposed scheme supports mutual verification between service provider and legal user ; (3) it achieves one - time username anonymity ; (4) service provider and legal user can produce verified sessions keys ; (5) our proposed scheme can provide revocation and security of the stored data. moreover, our scheme can resist the stolen - verifier problem, reflection attacks, replay attacks, forgery attacks, and parallel session attacks. on the other side, partial encryption is considered one of the most promising clarifications to reduce the cost of data protection in communication network. in this paper, we proposed a good concept of pixel value manipulation using discrete wavelet transform for fingerprint partial encryption scheme. from the viewpoint of security, the experimental results explain that our proposed scheme achieves better security than the individual encryption schemes. the proposed scheme has a good performance, the highest entropy, and the lowest correlation compared to the present partial encryption schemes. hence, better security has been supported via several theorems that are presented at security analysis section. | now, the security of digital images is considered more and more essential and fingerprint plays the main role in the world of image. furthermore, fingerprint recognition is a scheme of biometric verification that applies pattern recognition techniques depending on image of fingerprint individually. in the cloud environment, an adversary has the ability to intercept information and must be secured from eavesdroppers. unluckily, encryption and decryption functions are slow and they are often hard. fingerprint techniques required extra hardware and software ; it is masqueraded by artificial gummy fingers (spoof attacks). additionally, when a large number of users are being verified at the same time, the mechanism will become slow. in this paper, we employed each of the partial encryptions of user 's fingerprint and discrete wavelet transform to obtain a new scheme of fingerprint verification. moreover, our proposed scheme can overcome those problems ; it does not require cost, reduces the computational supplies for huge volumes of fingerprint images, and resists well - known attacks. in addition, experimental results illustrate that our proposed scheme has a good performance of user 's fingerprint verification. |
the back squat (bs) is a fundamental exercise prescribed for both athletes and non - athletes for developing lower - body strength. the resulting leg, hip, and back strength from the prescription of systematic squat resistance training reportedly improves athletic performance when included in a training program (20, 23). recently, it has been suggested in the lay media that the rear leg elevated split squat (rless) places less compressive force on the back, while placing higher stress on the legs, hips and stabilizer muscles (6). since bs may be contraindicated in persons with lower back pain, it may be beneficial to examine different variations of squat exercises to determine the benefits of each, as it may have implications for athletic populations. for instance, there appears to be differences between variations of the squat for lifting heavy loads (3), and how trunk position affects the joints and muscles involved (18). additionally, gender differences in mechanics have been demonstrated when performing squats (2, 8, 25). electromyographic (emg) analyses are commonly conducted to quantify electrical activity of muscles during weight training. while the majority of research examining emg activity and unilateral squats has focused on rehabilitation (i.e. no external load) and general populations (1, 4, 5, 17, 26), one study (21) compared emg activity levels of the biceps femoris, rectus femoris, and gluteus medius in elite female athletes while performing both loaded back squats and loaded rless. they concluded that the rless produced greater biceps femoris and gluteus medius emg activity when compared to the traditional bilateral squat. in addition, rless produced a greater knee valgus angle, which may produce greater hamstring activity in an attempt to better stabilize the knee (21). however, a direct comparison with other types of unilateral squat was not conducted in that study. in addition to kinematics and emg, the ground reaction forces of bilateral squatting movements have been examined (7, 9, 10, 16, 19), in both loaded (10, 16, 19), and unloaded conditions (7, 9). similar variables have also been examined during unilateral squatting motions (9, 11, 18, 22, 27), however, these studies focused on unloaded single - leg squats for rehabilitation purposes. additionally, only two studies used a unilateral squat with a knee range of motion similar to a bilateral squat (9, 11). to our knowledge, this was also the only study that compared the kinetics of a unilateral and bilateral squat, but it focused on patellofemoral force differences and did not report any comparisons of ground reaction forces (9). in one investigation that compared different squat techniques, peak force and peak power appeared to be similar (19), however, this study compared the box squat and traditional bs, not unilateral and bilateral squats. in an effort to further understand the biomechanical aspects of bilateral and unilateral squat exercises, specifically bs, rless, and split squat (ss), this investigation was designed to examine the vertical displacement, muscular activity and unilateral ground reaction forces of these three exercises. we hypothesized that the vertical displacement would be similar in the three types of squat. additionally, it was expected that most of the thigh and hip musculature would be similarly active in all three exercises with exception being biceps femoris, which was expected to be more active during the unilateral exercises as suggested previously (21). further, the ankle and knee stabilizer muscles were expected to be more active in the rless and ss than the bs, and that the vertical grf will be similar between the exercises, suggesting similar demands are placed upon the prime mover musculature. nine healthy men (ages 24 to 36 ; 26.1 3.8 years) were recruited to participate. all participants had been participating in a heavy - resistance training program that included squatting exercises for at least the previous six months. all participants completed a health history questionnaire to screen for any pre - existing health conditions and injuries that would prevent participation. the study s purpose, procedures, and possible risks and benefits were explained to participants both orally and in written form, followed by the signing of informed consent documents. the study procedures were approved by the local university institutional review board prior to beginning research. this study used a repeated measures design to compare the biomechanical differences between a bs, ss, and rless. all three exercises were performed with one leg on the force platform and video recorded while muscle activity was monitored via emg. the independent and dependent variables were selected based on the existing literature, and we have attempted to increase the internal validity by carefully assigning loads based on bs 1-rm. all participants reported for two sessions : one informed consent and practice session, and one data collection session. after paperwork was completed during the first session, the participants completed a five - minute, self - paced general warm - up on a cycle ergometer, followed by the instruction and the practice of all three squat exercises. in addition, at the end of this session, bs one - repetition maximum (1-rm) testing was completed following protocol described by harman., participants completed the same cycle ergometer warm - up followed by seven warm - up sets of bilateral squats. the warm - up sets were performed as follows : six repetitions at 10%, 20%, and 30% 1-rm, three repetitions at 40% and 50% 1-rm, and one repetition at 60% and 70% 1-rm, with a rest period of exactly two minutes between sets. subsequent to warm - up, single - repetition bs, ss and rless were completed in stratified random order. for all lifts, the participant removed the weighted barbell from a rack with a high bar position on the upper back. bs were performed at 85% of the participants 1-rm with their feet shoulder - width apart and only the left foot on the force plate. this load was used because it represents a normal training load for the participants in our study. participants were instructed to squat to the lowest level possible and then complete the lift by returning to the starting position. this load was chosen for internal validity reasons, and for the fact that the participants were less trained in using rless and ss and thus 1-rm testing for those exercises was not feasible. for the rless, the participant was positioned with their left foot on the force platform under their hips, with their right foot elevated behind them with the anterior portion of the ankle on a 40-cm high stand designed for single - leg squats. the participants descended to a position where the knee of the right leg (elevated) touched the ground, and then returned to the starting position. the distance between the center of the stand and the tip of the 1 phalange of left foot was determined for each participant by calculating 85% of leg length (from asis to floor). for the ss, each participant was positioned with their left foot in the center of the force platform and right foot behind with a stance at the same length as rless (1 phalange to 1 phalange). participants then descended until the right knee touched the ground, and then returned to the starting position. a rest period of two minutes between the different squat exercises was provided. a single video camera (panasonic digital video camcorder, pv - dv203) captured the two dimensional (2-d) motion for analysis. the camera was interfaced with a pc and analyzed with datapac 5 software (run technologies ; mission viejo, ca). the shutter speed was set to 1/125 sec and the iris was set to + 18 db. data were sampled at 60 hz and filtered with a 4th order, low - pass butterworth filter at 20 hz. analog and kinematic data was synchronized with an analog spike (light - emitting diode (led) placed in camera s view) to serve as a signal for acquisition. a frame (1.8 m) with active led markers on each corner markers (active led) were placed on the left end of the barbell and on the left midaxial line at the level of the anterior superior iliac spine (asis). vertical displacement was determined from the barbell marker, and eccentric and concentric phases of the lifts were determined using the vertical displacement of the asis marker. muscle activity was measured for the gluteus maximus (gmx), biceps femoris (bf), semitendinosus (st), rectus femoris (rf), vastus lateralis (vl), vastus medialis (vm), tibialis anterior (ta), and medial gastrocnemius (mgas) of the left leg. this leg was the non - dominant leg for all participants, and was the front leg for the unilateral squat variations in this study. the non - dominant leg as chosen because generally, balance is better in the non - dominant leg. this was thought to improve the likelihood that the participants would not lose their balance during unilateral squats. prior to electrode application, the area was shaved to remove any hair ; the skin was then gently abraded with fine sandpaper to remove any other debris and the area was cleansed with alcohol. the electrodes were placed parallel to the estimated resting pennation angle so that the same muscle fibers intersected both electrodes. electrodes (ambu inc. ; glen burnie, md) were 2-cm round ag / agcl with an inter - electrode distance of two cm, and the ground electrode was placed on the anterior aspect of the patella for signal noise reduction. (run technologies ; mission viejo, ca) with eight dual - lead channels. the system has a common mode rejection of 90db, a band pass filter (10450hz), and input impedance of 10m. gain was set at 1000. synchronized data were collected at 2khz (datapac 5 ; run technologies ; mission viejo, ca) and channeled through a 12-bit analog - to - digital converter (das1200jr ; measurement computing, middleboro, ma). data were quantified by computing a root mean square (rms), 125ms time constant running average of the raw signal over the eccentric and concentric rom. vertical ground reaction force data (n) were acquired with an amti bp600900 (watertown, ma) force platform amplified with an amti msa-6 mini amp (watertown, ma) at a sampling rate of 2400hz using a das1200jr 12-bit analog to digital converter board (measurement computing ; norton, ma) and analyzed using datapac 5 (run technologies ; mission viejo, ca). data was filtered with a 4 order low pass butterworth digital filter at 20hz. means and standard deviations were calculated for all variables of interest. each dependent variable was compared with a 1 3 repeated measures anova (p < 0.05) to determine if any significant differences existed between squatting modalities. bonferroni post - hoc adjustments to dependent t - tests were used to determine where pairwise differences existed and cohen s d effect sizes (es) were calculated to quantify the magnitude of those differences (15), with corrections for repeated measures. anova and bonferroni adjustments were calculated with spss v. 20 (ibm ; armonk, ny). nine healthy men (ages 24 to 36 ; 26.1 3.8 years) were recruited to participate. all participants had been participating in a heavy - resistance training program that included squatting exercises for at least the previous six months. all participants completed a health history questionnaire to screen for any pre - existing health conditions and injuries that would prevent participation. the study s purpose, procedures, and possible risks and benefits were explained to participants both orally and in written form, followed by the signing of informed consent documents. the study procedures were approved by the local university institutional review board prior to beginning research. this study used a repeated measures design to compare the biomechanical differences between a bs, ss, and rless. all three exercises were performed with one leg on the force platform and video recorded while muscle activity was monitored via emg. the independent and dependent variables were selected based on the existing literature, and we have attempted to increase the internal validity by carefully assigning loads based on bs 1-rm. all participants reported for two sessions : one informed consent and practice session, and one data collection session. after paperwork was completed during the first session, the participants completed a five - minute, self - paced general warm - up on a cycle ergometer, followed by the instruction and the practice of all three squat exercises. in addition, at the end of this session, bs one - repetition maximum (1-rm) testing was completed following protocol described by harman., participants completed the same cycle ergometer warm - up followed by seven warm - up sets of bilateral squats. the warm - up sets were performed as follows : six repetitions at 10%, 20%, and 30% 1-rm, three repetitions at 40% and 50% 1-rm, and one repetition at 60% and 70% 1-rm, with a rest period of exactly two minutes between sets. subsequent to warm - up, single - repetition bs, ss and rless were completed in stratified random order. for all lifts, the participant removed the weighted barbell from a rack with a high bar position on the upper back. bs were performed at 85% of the participants 1-rm with their feet shoulder - width apart and only the left foot on the force plate. this load was used because it represents a normal training load for the participants in our study. participants were instructed to squat to the lowest level possible and then complete the lift by returning to the starting position. this load was chosen for internal validity reasons, and for the fact that the participants were less trained in using rless and ss and thus 1-rm testing for those exercises was not feasible. for the rless, the participant was positioned with their left foot on the force platform under their hips, with their right foot elevated behind them with the anterior portion of the ankle on a 40-cm high stand designed for single - leg squats. the participants descended to a position where the knee of the right leg (elevated) touched the ground, and then returned to the starting position. the distance between the center of the stand and the tip of the 1 phalange of left foot was determined for each participant by calculating 85% of leg length (from asis to floor). for the ss, each participant was positioned with their left foot in the center of the force platform and right foot behind with a stance at the same length as rless (1 phalange to 1 phalange). participants then descended until the right knee touched the ground, and then returned to the starting position. a rest period of two minutes between the different squat exercises was provided. a single video camera (panasonic digital video camcorder, pv - dv203) captured the two dimensional (2-d) motion for analysis. the camera was interfaced with a pc and analyzed with datapac 5 software (run technologies ; mission viejo, ca). the shutter speed was set to 1/125 sec and the iris was set to + 18 db. data were sampled at 60 hz and filtered with a 4th order, low - pass butterworth filter at 20 hz. analog and kinematic data was synchronized with an analog spike (light - emitting diode (led) placed in camera s view) to serve as a signal for acquisition. a frame (1.8 m) with active led markers on each corner was used to calibrate the space for the motion analysis. markers (active led) were placed on the left end of the barbell and on the left midaxial line at the level of the anterior superior iliac spine (asis). vertical displacement was determined from the barbell marker, and eccentric and concentric phases of the lifts were determined using the vertical displacement of the asis marker. muscle activity was measured for the gluteus maximus (gmx), biceps femoris (bf), semitendinosus (st), rectus femoris (rf), vastus lateralis (vl), vastus medialis (vm), tibialis anterior (ta), and medial gastrocnemius (mgas) of the left leg. this leg was the non - dominant leg for all participants, and was the front leg for the unilateral squat variations in this study. the non - dominant leg as chosen because generally, balance is better in the non - dominant leg. this was thought to improve the likelihood that the participants would not lose their balance during unilateral squats. prior to electrode application, the area was shaved to remove any hair ; the skin was then gently abraded with fine sandpaper to remove any other debris and the area was cleansed with alcohol. the electrodes were placed parallel to the estimated resting pennation angle so that the same muscle fibers intersected both electrodes. glen burnie, md) were 2-cm round ag / agcl with an inter - electrode distance of two cm, and the ground electrode was placed on the anterior aspect of the patella for signal noise reduction. (run technologies ; mission viejo, ca) with eight dual - lead channels. the system has a common mode rejection of 90db, a band pass filter (10450hz), and input impedance of 10m. gain was set at 1000. synchronized data were collected at 2khz (datapac 5 ; run technologies ; mission viejo, ca) and channeled through a 12-bit analog - to - digital converter (das1200jr ; measurement computing, middleboro, ma). data were quantified by computing a root mean square (rms), 125ms time constant running average of the raw signal over the eccentric and concentric rom. vertical ground reaction force data (n) were acquired with an amti bp600900 (watertown, ma) force platform amplified with an amti msa-6 mini amp (watertown, ma) at a sampling rate of 2400hz using a das1200jr 12-bit analog to digital converter board (measurement computing ; norton, ma) and analyzed using datapac 5 (run technologies ; mission viejo, ca). was compared with a 1 3 repeated measures anova (p < 0.05) to determine if any significant differences existed between squatting modalities. bonferroni post - hoc adjustments to dependent t - tests were used to determine where pairwise differences existed and cohen s d effect sizes (es) were calculated to quantify the magnitude of those differences (15), with corrections for repeated measures. anova and bonferroni adjustments were calculated with spss v. 20 (ibm ; armonk, ny). all nine participants completed the study and their descriptive statistics are presented as mean sd (table 1). muscle activity was only significantly greater for the bf during rless and bs than ss during the concentric phase (rless / ss - es= 2.11, p=0.008 ; bs / ss - es=1.78, p=0.029), and significantly greater during rless than ss during the eccentric phase (es= 2.13, p=0.012 ; figures 1 and 2). maximum vertical force (n) was also significantly greater during rless than ss (es= 3.03, p=0.001 ; figure 3) and tended to be greater during bs than ss but the trend did not reach significance (es = 1.42 ; p=0.058). this study was designed to compare two different single leg squat techniques and bilateral back squats with respect to vertical range of motion, muscle activity, and vertical ground reaction force. our data show significantly greater biceps femoris activity during rless and bs than ss, similarities in vertical displacement between the three lifts, and some differences in grf between the different variations of the squat. our data support contentions that similar lower body muscle activity can be achieved using the rless with half the load of bs. this likely would result in less compressive force on the back, however compressive force on the back is beyond the scope of the present study. our emg data support the contention that similar stimulus can be achieved with single leg squats of several types and bs. the only exception was bf activity, where rless and bs had a significantly higher activity than the split squat (es = 2.11 and 1.78 respectively) during the concentric phase of the lifts. rless also had significantly higher bf activity during the eccentric phase than split squats (es = 2.19). contrary to previous findings (21, 24), neither the rless nor the split squat had greater bf or rf activity than the bilateral squat. this may in part be due to differences in load calculation or sample population. one previous study (21) used 85% of the participants three - repetition maximum (3rm) for each lift, where we used 85% of bs 1-rm for the bs and half that load for the single - leg lifts. they also used a sample of female athletes and we used a sample of resistance - trained men. the other study (24) used a 50 lb barbell for both bilateral and single leg squats, and a sample of healthy men. it would be expected that muscle activity would be higher during a single leg squat if the same load were used. however, there are always limitations to calculating relative loads between different weight training exercises. peak vertical grf were similar between the bs and rless, suggesting that we adjusted the load sufficiently for loading the leg unilaterally. the rless had significantly larger peak ground reaction force than the ss (es=3.03) at the same load. peak vertical forces during the bs (1414.81 250.98n) were larger than the ss (1198.56 187.88n), however failed to reach significance (es = 1.42 ; p=0.058). previous researchers reported that the rear leg supported between 25% and 45% of the load during a split squat (13) suggesting that the smaller peak forces during the split squat are likely due to a larger portion of the load being supported by the rear leg. however, this is beyond the scope of the present study, as we were only able to collect data from the lead leg within the limitations of our experimental setup. as was expected, vertical bar displacement was similar between squats, suggesting similar depth of squat. this variable has not been compared between these lifts previously, therefore comparisons with other studies is impossible. we acknowledge that similar bar displacement does not equate to similar joint ranges of motion. one study (21) reported larger trunk inclination during bilateral squats than during rless, which likely would translate to greater hip flexion and rom. since joint rom was not examined herein, it is unclear if this was true in the current study ; however, for trunk inclination to be different, lower extremity joint rom would likely be different between squats to maintain the overall vertical displacement. the findings of the current study combined with those previously reported (21) suggest further examination of joint rom in these three squat types. due to the inherent limitations in using 2d video analysis for joint motion, in addition, we acknowledge the limitation that both legs were not monitored for emg activity and grf. while adding 3d analysis and additional emg channels may be feasible, instrumenting multiple force platforms so that force information can be collected from both legs may be challenging, especially instrumenting a stand for the rear leg in the rless. in spite of these limitations, our data are an important contribution to the relative scarcity of data on these types of squat. additionally, future studies may consider basing the prescribed loads off of the 1-rm for each individual squat type. performing multiple repetition sets, including those designed to induce considerable fatigue, may also be of interest to the practitioner. rear leg elevated split squats (rless) activate the lower body musculature similar to bilateral back squats while using half the load, but increased bf activity was seen for rless. therefore, if additional bf activity is desired, rless may be more appropriate than ss or bs. future research should consider additional measures of force and time such as impulse to clarify the potential differences in bilateral and unilateral squatting. additionally, comparisons of the dominant and non - dominant leg in unilateral squats may be of interest. | muscular activity, vertical displacement and ground reaction forces of back squats (bs), rear - leg elevated split squats (rless) and split squats (ss) were examined. nine resistance - trained men reported for two sessions. the first session consisted of the consent process, practice, and bs 1-repetition maximum testing. in the second session, participants performed the three exercises while emg, displacment and ground reaction force data (one leg on plate) were collected. emg data were collected from the gluteus maximus (gmx), biceps femoris (bf), semitendinosus (st), rectus femoris (rf), vastus lateralis (vl), vastus medialis (vm), tibialis anterior (ta), and medial gastrocnemius (mgas) of the left leg (non - dominant, front leg for unilateral squats). load for bs was 85% one repetition maximum, and rless and ss were performed at 50% of bs load. repeated measures anova was used to compare all variables for the three exercises, with bonferroni adjustments for post hoc multiple comparisons, in addition to calculation of standardized mean differences (es). muscle activity was similar between exercises except for biceps femoris, which was significantly higher during rless than ss during both concentric and eccentric phases (es = 2.11 ; p=0.012 and es= 2.19 ; p=0.008), and significantly higher during bs than the ss during the concentric phase (es = 1.78 ; p=0.029). vertical displacement was similar between all exercises. peak vertical force was similar between bs and rless and significantly greater during rless than ss (es = 3.03 ; p=0.001). these findings may be helpful in designing resistance training programs by using rless if greater biceps femoris activity is desired. |
genitourinary tuberculosis (tb) is the second most common extrapulmonary form of tb after lymphadenopathy. genitourinary tb accounts for 27% (range 1441%) of nonpulmonary cases and is usually a late complication of pulmonary tb. renal damage due to caseous destruction of renal parenchyma or obstructive uropathy is well known. made the first clinical description of granulomatous interstitial nephritis (gin) as the only manifestation of renal tb. overall, data on gin as the only manifestation of renal tb is limited to case reports and the most common clinical presentation is chronic renal insufficiency. interestingly, most patients of gin express active extrarenal foci, often pulmonary or peritoneal. we report a case of tuberculous gin associated with active cervical lymphadenitis and review the pertinent literature on gin due to tb in immunocompetent individuals. a 24-year - old previously healthy man developed fever and left cervical lymphadenopathy for which he was prescribed antibiotics (erythromycin) and antipyretics (paracetamol) for 2 weeks. he was also prescribed two antihypertensive drugs and advised further evaluation for proteinuria, which he deferred. two weeks later, he was referred to our center for fever, lymphadenopathy and recently detected renal failure. there was no history of treatment or contact with tb, loss of weight, red urine, skin rash, joint pains or use of native medicines. physical examination revealed pallor, bilateral pedal edema, pulse rate 92/min, blood pressure of 160/100 mmhg, temperature 38c and respiratory rate 15/min. g / l) was decreased and erythrocyte sedimentation rate was elevated to 94 mm / h. white blood cell count of 10.9 10/l (410 10/l) with neutrophils 72%, lymphocytes 23%, eosinophils 3% and monocytes 2%, platelet count 205 10/l (150400 10/l) and reticulocyte count 1.2% were normal. serum creatinine was increased to 660 mol / l (44140 mol / l) and the estimated four - variable modification of diet in renal disease- glomerular filtration rate was 9.59 ml / min/1.73 m. serum uric acid, calcium, inorganic phosphorus, liver function tests and lipid profile were within normal limits. there were 01 white blood cells per high power field, 810 red blood cells per high power field and no evidence of casts on microscopic examination of the urine sediment. antinuclear antibody (negative), anti - dsdna (12.25, 030 iu / ml) and anti - gbm titers (<3 cervical lymph node aspiration cytology showed granulomatous necrotizing inflammation with acid - fast bacilli (afb) suggestive of tb. he was initiated on antitubercular treatment (att), maintenance hemodialysis and ultrasound - guided percutaneous renal biopsy were done to identify the cause of rapidly progressive renal failure (rprf). on light microscopy, 19 of the 22 glomeruli were normal and 3 showed global sclerosis. interstitium showed lymphoid aggregates with well - formed epitheloid granulomas along with intense mononuclear infiltrate comprising of lymphocytes, histiocytes and plasma cells (figures 1 and 2). immunofluorescent micrography revealed absence of specific immunoglobulin or complement (c3, c1q) deposits. afb were not seen on ziehl nielsen staining and cultures for tubercle bacilli in renal biopsy were negative. on further evaluation, three samples of urine microscopy and culture for mycobacterium were negative and bone marrow examination was unremarkable. mantoux test was negative. however, urine dna - polymerase chain reaction (pcr) for mycobacterium tuberculosis was positive. he was started on steroid (oral prednisolone 1 mg / kg / day) together with att. six months since the onset of illness, his lymphadenopathy resolved but renal failure did not recover. steroids were tapered and withdrawn after 3 months and the patient is now on att and maintenance hemodialysis through radial arteriovenous fistula. renal biopsy showing epithelioid cell granuloma (a), sclerosed glomerulus (b), atrophic tubules (c) and interstitial inflammation (d) ; (hematoxylin and eosin stain ; 20 magnification). (a, b) epithelioid cell granuloma surrounded by mantle of lymphocytes (hematoxylin and eosin stain ; 40 magnification) (epithelioid cell marked with arrow in figure 2b). the interesting features in our patient were (i) coexistence of active renal and cervical lymph node tb in a 24-year - old male, (ii) gin presenting as rprf and nephrotic range proteinuria and (iii) diagnosis was made by positive urine pcr for m. tuberculosis, when afb could not be demonstrated in urine or renal biopsy. renal tb is rarely present in patients < 25 years of age and can occur during primary infection or pulmonary reactivation. if there is a history of pulmonary infection, the latency period from the time of the initial infection to diagnosis with renal disease ranges from 5 to 40 years. coexistence of active renal and cervical lymph node tb is a deviation from the normal time frame for development of renal tb. similar case reports of gin with pulmonary and peritoneal foci are described, but to the best of our knowledge, this is the first report of cervical adenitis in a patient with gin due to tb. it is possible that our patient had a primary infection involving the lymph node and the kidneys. another remarkable feature is the clinical presentation of hypertension, rprf and nephrotic range proteinuria, mimicking a glomerular disease. similar presentation of gin has so far been reported in only one other patient and there is no possible explanation for the nephrotic proteinuria seen in these patients. such presentations may be seen with non - steroidal anti - inflammatory drug - induced acute interstitial nephritis but in our case, detailed evaluation for other causes of gin like drugs, infections and systemic conditions like sarcoidosis, wegener s granulomatosis revealed negative results. urine cultures (three to five samples) of the first urine of the day are considered gold standard in diagnosis of genitourinary tb but are often negative. in comparison to urine cultures, pcr primers and probe derived from m. tuberculosis species - specific dna insertion sequence, is6110 has an overall sensitivity of 95.59% and specificity of 98.12% in the diagnosis of genitourinary tb. summary of case reports with gin due to renal tba esrd end - stage renal disease ; na not available ; neg negative ; cr complete recovery ; pr partial recovery. other diagnostic techniques. gin is seen in only in 0.50.9% of renal biopsy and of this 5% is caused by infections [1113 ]. often, features on biopsy do not help to determine the cause of gin. afb may be demonstrated in the renal biopsy tissue with ziehl nielsen or auromine - o stain but is positive only in 3243% of specimens. we suspected tb as the cause of gin due to the presence of afb in the cervical lymph node and subsequently, a positive urine dna pcr for m. tuberculosis helped to confirm the diagnosis. att (two, three or four drugs of isoniazid, rifampicin, pyrazinamide and ethambutol) has been used to treat all these patients. it has been observed that concomitant use of steroids bring about favorable recovery in these patients. since granulomatous inflammation heals by fibrosis ; steroids may decrease the inflammation and thereby reduce the amount of interstitial fibrosis. reported a similar case presenting as rprf with nephrotic proteinuria and obtained complete renal recovery with a combination of att and steroids. remarkably, the majority of these (rare) cases were observed in patients from india or black africans or african - americans. this could be due to a genetic predisposition causing varied host immune response or due to variations in phage type of m. tuberculosis, tb must be considered as a cause of gin particularly in patients with asian or african origin. urine pcr can have a significant role in the diagnosis of culture negative renal tb. steroids in combination with att should be considered as the first - line treatment for gin due to tb. | granulomatous interstitial nephritis (gin) is a rare manifestation of renal tuberculosis (tb). we report a case of rapidly progressive renal failure (rprf), granulomatous inflammation of cervical lymph node and gin as presenting manifestations of tb. aspiration cytology of cervical lymph node showed granulomatous necrotizing inflammation with acid - fast bacilli (afb). the renal biopsy and urine specimen did not show afb. urine polymerase chain reaction (pcr) for mycobacterium tuberculosis was positive. we observe that gin due to tb can present as rprf and emphasize the value of pcr - based techniques in making a correct diagnosis. |
the population impact of arterial hypertension (aht) consists in its high prevalence and in the strength of its risk ratio with cardiovascular pathologic conditions. more than a quarter of the world adult population is already hypertensive and this number is projected to increase to 1,56 billion people by 2025. this estimation relies especially on a steep increase of aht in the developing countries [1, 2 ]. a large number of clinical trials have shown that the cardiovascular risk could be considerably diminished by a tight reduction of the blood pressure (bp) values. despite their encouraging data, the real rates of arterial hypertension awareness, and control are continuing to remain unsatisfactory in many areas of the world [3, 4 ]. romania is an east european developing country, with a high mortality in cardiovascular disease, as was reconfirmed in the last european cardiovascular disease statistics report and it is supposed that uncontrolled aht is an important contributor to this result. in order to find out the prevalence, the awareness, and the control of blood pressure in romania, we have carried on a cross - sectional survey, named sephar : study for the evaluation of prevalence of hypertension and cardiovascular risk in adult population in romania. this study is the first assessment of blood pressure and major correlated cardiovascular risk factors accomplished on a representative sample for the entire adult population in romania. the design of the sephar study was similar with that of the natpol plus study, conducted earlier in poland [6, 7 ]. the procedures applied in the sephar study were in accordance with the declaration of helsinki of 1975, revised in 1983. romania 's area was divided into ten regions, recommended by the national commission of statistics. the locations of interviewing were selected at random, on a basis of a computerized system elaborated and applied by a company specialized in research. the structure of the population aged 18, according to sex, in each location, was obtained from the central bureau of statistics, having as a source document the census made in 2002. the addresses of interviewing were selected from the database of the general direction of computerized evidence of the population. consequently, we were able to find out that in a specific location there is a person, male or female, aged of certain years. it is worth noticing that, using this procedure, we did not reach a person with a precise identity ; we found out a subject with certain demographic characteristics, with respect to the law no. 677/2001 on protection of persons regarding the processing of personal data and their free circulation in romania. on the whole, 2131 subjects agreed to participate in the study, to have the blood pressure measured, and to fill in the medical history questionnaires. among these, 2017 have accepted also the collection of blood samples. specially trained nurses obtained data for the respondents at the patients ' home. during the visit, the nurse had to obtain the informed consent for the participation in the study, to complete the questionnaire, and to measure the arterial blood pressure, weight, height, and waist circumference. the bp was measured at each arm with fully automatic devices (oscillometric pressameters omron m5-i), adapted for the arm circumference. the highest value between the two arms was that of reference. if at the initial visit the bp was elevated and the subject was not known with arterial hypertension, two more visits for bp measurement were mandated to confirm the abnormal values, at one - to - three day interval. three measurements of bp had to be done at each visit with at least three minutes pause between the consecutive readings, ignoring the first one and calculating the average between the last two of them. the arterial ht was defined as values 140 mmhg for the sbp or 90 mmhg for the dbp, according to the european society of hypertension guidelines applicable in 2005 and reconfirmed by the guidelines issued in 2007. new diagnosed cases of arterial hypertension were those who have denied a previous diagnosis of hypertension and were found at the initial and at the confirmation visits with high bp. the prevalence of arterial hypertension resulted from the addition of known to the new diagnosed cases. the general control of hypertension was calculated from the ratio of subjects with blood pressure below 140/90 mmhg to the number of hypertensive persons on a whole (known and newly diagnosed). the control of treated hypertension was deduced from the ratio of subjects with blood pressure below 140/90 mmhg to the total number of treated hypertensive persons. data about the prevalence, awareness, rate of treatment, and control of hypertension were obtained for the whole sample and by comparing specific categories of population splitted by gender, age groups, and area of residence with the test. on the analysis of the results, the statistical significance was tested with an interval of confidence of 95%, for which the maximum error was of 2,18% for 2017 respondents. the age and gender structure, the repartition of subjects depending on the area of residence, and the mean values of blood pressure are represented in table 1. we have to mention that bucharest, the capital, which was analyzed separately from the other nine regions of the country, was included in the urban area, conducting to a higher number of subjects in this category of residence. the mean systolic bp was 137.63 23.43 mmhg, with an important rise for every age group in each gender. the values have continuously increased from 119.99 13.70 mmhg in the youngest age group to 152.76 24.17 mmhg in the age group 65 years old. the mean diastolic bp was 83.13 13.12 mmhg, higher with every age group until the age of 5564 years, but starting to decline in the oldest age group (65 years). for both systolic and diastolic bp, the mean level was higher in men than in women for adult subjects, the gender difference diminishing by the sixth decade. the total prevalence of the arterial hypertension was 44,92%, significantly higher in men (50,17%) than in women (41,11%) (p <.0001), but with the gender difference beginning to diminish in the age group of 5564 years. the frequency of arterial hypertension was augmenting with age, reaching a rate above 70% after 65 years. a greater prevalence of arterial hypertension was observed in the rural area (49,47%) as compared to the urban area (41,58%), which attended statistical significance (p <.02) table 2. the general rate of awareness was 44,26%, increasing with age, higher in women (52,8%) than in men (34,58%) (p <.0006), with the gender difference being noticed for every age group after 45 years old. the rate of treated hypertension was again in favor of women (46,56%) in comparison with men (30,11%) (p <.003) table 4. the number of the total hypertensive subjects who were on the target values of bp was 7,72%. the analysis of data regarding the treatment control has revealed a general rate of 19,88%, with no differences between gender or area of residence table 4. sephar was the first study addressed to the prevalence, awareness, and control of hypertension on a representative sample for the entire population of romania. even if the selection of the subjects was based on the method of stratified proportional sampling, the results must be cautiously interpreted due to the limited number of subjects included, in comparison with the adult inhabitants as a whole. when referring the data to the literature, we have to notice the heterogeneity of different studies with regard to the sampling method (stratified sampling or selection during clinical visits), age of subjects enrolled, number of visits for the measurements of blood pressure, adaptation of cuff size for the arm circumference, or the period of time when the survey has been done. therefore, a special attention will be focused on the comparison with the results of natpol plus, a study that has been realized with the same methodology in poland. our data are indicating a 44,92% prevalence of the aht in romania, higher than in poland, where was estimated at 29% [6, 7 ]. in general, the rates of aht are greater in europe than in the united states (28%), canada (27%), or asian countries including china (20%) or korea (22,9%) [4, 1012 ]. the prevalence of aht in romania can be integrated between lower values in europe like those in greece (31,1), sweden (38%), italy (38%), united kingdom (42%), czech republic (42%), or portugal (42,1%) and higher values such as those from spain (47%) or germany (55%) [4, 1315 ]. for each gender the ratio of aht frequency between the two genders is varying from one study to another and in poland was greater in women. there are not many studies analyzing the results in regard to the area of residence. in contrast to other observations and the assertion that aht is more often encountered in the urban areas, we have found a bigger prevalence of high blood pressure in the rural areas. we are not able to comment, at this moment, if these results could be explained by some deleterious habits in lifestyle such as the excessive salt or alcohol consumption or by concomitant predominance of obesity in the rural zones. less than half of the hypertensive subjects were aware of their condition. in the polish study,. in europe, the hypertension awareness is varying from 46% in portugal to 60% in greece or even 70% in czech republic. in countries with national health programs effectuated for cardiovascular risk reduction, the level of aht awareness has much improved, rising to 66% in united kingdom or 76% in united states and attesting the success of a coordinated policy for high bp detection. the rate of treatment control in our sample (19,88%) was similar with poland and comparable with the results of other studies [4, 14, 17 ]. the good survey has found that in the atlantic european mainland more patients had uncontrolled bp (80%) compared with northwest, mediterranean, and central europe (70%). recent data from bp - care study, conducted in central and east european countries (including romania) with subjects selected from clinical visits to general practitioners or specialists, are showing that bp control was achieved in only 27,1% of treated hypertensive persons. as a whole, in comparison with the results of the natpol plus study in poland, the prevalence of aht was higher, the awareness was worse, and the bp control was similar. these data should be interpreted, in the future, taking into account the differences between the genetic background, the lifestyle habitudes, and the health policies in each country. | east european countries have reported high prevalence of arterial hypertension (aht). in order to investigate the data for romania, we firstly performed a national survey the study for the evaluation of prevalence of hypertension and cardiovascular risk in adult population in romania (sephar). a representative population was selected using stratified proportional sampling, including 2017 adult subjects, 18 years old. the general prevalence of aht was 44,92%, higher in men (50,17%) than in women (41,11%) (p <.0001) and predominant in rural areas (49,47%) in comparison to the urban ones (41,58%) (p <.02). aht awareness attended 44,26%, rising with age, significantly lower in men (34,58%) than in women (52,8%) (p <.0006). we have found a 38,85% proportion of treated hypertensive persons, worse for men (30,11%) then for women (46,56%) (p <.003). the rate of aht control was 19,88%, with no significant differences between gender. in conclusion, we estimated for romania a high prevalence of aht, a level of awareness and treatment lower than in many european countries and a rate of treatment control at the inferior limit of the european average. males, characterized by a higher prevalence of aht, were also less aware and less treated than women. |
the high - density lipoprotein cholesterol (hdl - c) is a group of heterogeneous lipoproteins that are involved in the transport of sterols and lipids. guidelines for management of patients with dyslipidemia primarily focus on achievement of target low - density lipoprotein cholesterol (ldl - c) levels for coronary heart disease (chd) risk reduction (ncep - atp iii). however, there is increasing interest in high - density lipoprotein cholesterol (hdl - c) as a second line target of therapy. it is well - established that low concentration of hdl - c is associated with a higher risk of chd and rising concentrations are associated with a fall in risk of chd. however, how high serum concentration of hdl - c is good enough, is not very clear. hdl - c is popularly known as good cholesterol and high levels are associated with low cardiovascular risk, but the role of hdl in vascular disease is complex. anti - atherosclerotic effects of hdl - c include increment in reverse cholesterol transport and macrophage cholesterol efflux, anti - inflammatory activity, inhibition of low - density lipoprotein (ldl) cholesterol oxidation, endothelial cell apoptosis. it also interferes with the thrombotic component of atherosclerosis by inhibiting platelet aggregation and reducing expression of cellular adhesion molecules. the protective effect of hdl on atherosclerosis is suggested by the observation in humans that plasma hdl - c concentrations above 75 mg / dl are associated with prolonged life (the longevity syndrome) and relative freedom from coronary heart disease. studies in animals have shown that overexpression of the apolipoprotein a - i gene (the major apolipoprotein in hdl cholesterol) prevents the development or progression of atherosclerosis. in an analysis of 4 prospective studies, it was shown that the risk of chd with low hdl - c is independent of the risk attributed to elevated levels of ldl - c. an increase of 1 mg / dl of hdl - c resulted in decrease of chd by 2% in men and 3% in women. low serum hdl - c can occur alone or be combined with insulin resistance, hypertriglyceridemia, and small dense ldl - c. the inverse association between hdl - c and chd risk is a continuous variable ; no threshold relationship has been identified. ncep - atp ii specified low hdl - c (60 mg / dl { multivariate adjusted relative risk 1.47 (men) and 2.02 (women) vs. 0.56 (men) and 0.58 (women), respectively}.) serum hdl - c inversely predicts the time to a first major cardiovascular event as well as the risk of coronary events in patients with known chd across a broad range of ldl - cholesterol levels. low hdl - c is also a stronger predictor of chd events in patients with an ldl - c 60 mg / dl { multivariate adjusted relative risk 1.47 (men) and 2.02 (women) vs. 0.56 (men) and 0.58 (women), respectively}.) serum hdl - c inversely predicts the time to a first major cardiovascular event as well as the risk of coronary events in patients with known chd across a broad range of ldl - cholesterol levels. low hdl - c is also a stronger predictor of chd events in patients with an ldl - c < 125 mg / dl. when divided into quintiles, the highest quintile of hdl - c (mean sd 61.5 10.1 mg / dl) had 40% lower rates of chd than the lowest quintile (35.7 4.5 mg / dl). in a meta - analysis of studies in the asia - pacific region, there was a negative correlation between hdl - c and chd events (hazard ratio 1.57 ; 95% ci 1.31 - 1.87), again underscoring the role of low hdl - c. patients with diabetes mellitus have a higher risk of chd and in general, have been assigned a lower target value for serum ldl - c. however, in chinese patients with type 2 diabetes mellitus, hdl - c was again found to have no definite threshold for chd risk. with every 1 mmol / l (mmol / l= mg / dl x 0.02586) increase in hdl - c, the risk of chd decreased (hr 0.61, 95% ci 0.45 - 0.84). use of statins reduced the risk of chd by 51% in those with low hdl (< 1 mmol / l in males and < 1.3 mmol / l in females). however, certain conditions with low hdl - c do not have increased risk for chd, such as tangier disease, and stand out as exceptions to the hdl - c and chd association. it has also been reported that it may not be the hdl - c concentrations but the hdl - c particle number that is protective for markers of atherosclerosis. the drugs in clinical use that alter the serum hdl - c concentration favorably are niacin and gemfibrozil. however, many other drugs like statins, cholestyramine, and colestipol have been known to have some effect. a new class of drugs, cholesteryl ester transfer protein (cetp) inhibitors, is currently under trial for the same purpose. on intervention with pravastatin for each 10 mg / dl increase in hdl - c, the event rate decreased by 29% in those with ldl - c < 125 mg / dl compared to 10% in those with an ldl - c 125 mg / dl. with atorvastatin, 1 mg / dl increment in hdl at 3 months has been reported to decrease the risk of chd by 1.1% irrespective of sex. however, no threshold of hdl - c for the beneficial effect was observed in either of the trial. similarly, use of gemfibrozil has also been found to be effective in elevating hdl - c and reducing vascular events in patients with chd having ldl - c 140 mg / dl, an hdl - c 40 mg / dl, and triglycerides 300 mg / dl. in a trial of combined use of simvastatin and niacin for 3 years in patients with chd who also had hdl - c < 35 mg / dl and ldl - c < 145 mg / dl, it also resulted in reduction in vascular events much more than that expected with statins alone, possibly due to improvement in hdl - c. trials of niacin in patients with chd or chd risk equivalent, having low hdl - c have, shown elevation of hdl - c with niacin with reduction in carotid intima medial thickness. cetp is involved in metabolism of hdl - c and its role has also been studied. polymorphisms affecting the activity of cetp reduce the activity of cetp and increase hdl - c. cetp inhibitors have been tried to modify hdl - c, and they are still under trial. torcetrapib, anacetrapib, evacetrapib, and dalcetrapib inhibit cetp and raise hdl - c. however, torcetrapib was reported to increase risk of chd and interest in it has waned. the national cholesterol education program (adult treatment program [atp ] iii) guidelines, published in 2001, identified hdl - c more than 60 mg / dl as reasonably good level while less than 40 mg / dl was considered low. the goals of treating patients with low hdl - cholesterol have not been firmly established. relationship of hdl - c and chd risk is linear, and no upper limit of hdl - c has been identified. among all the drugs tried to improve serum hdl - c concentrations, statins only have shown reduction in chd risk and mortality. as far as chd risk is concerned, it appears that higher the hdl cholesterol is, better it is. | the high - density lipoprotein cholesterol (hdl - c) is considered anti - atherogenic good cholesterol. it is involved in reverse transport of lipids. epidemiological studies have found inverse relationship of hdl - c and coronary heart disease (chd) risk. when grouped according to hdl - c, subjects having hdl - c more than 60 mg / dl had lesser risk of chd than those having hdl - c of 40 - 60 mg / dl, who in turn had lesser risk than those who had hdl - c less than 40 mg / dl. no upper limit for beneficial effect of hdl - c on chd risk has been identified. the goals of treating patients with low hdl - c have not been firmly established. though many drugs are known to improve hdl - c concentration, statins are proven to improve chd risk and mortality. cholesteryl ester transfer protein (cetp) is involved in metabolism of hdl - c and its inhibitors are actively being screened for clinical utility. however, final answer is still awaited on cetp - inhibitors. |
venovenous extracorporeal membrane oxygenation (vv ecmo) has been well described to manage acute respiratory distress syndrome (ards). the onset of ards in the setting of h1n1 influenza is often hyper - acute, requiring emergent ventilatory support and, in severe cases, ecmo cannulation. in the setting of emergent intubation, tracheal injury is a rare but catastrophic complication, occurring in 1 in 20,000 endotracheal intubations. historically, urgent surgical intervention has been the mainstay of management of post - intubation tracheal injury. however, more recent reviews advocate a conservative approach, especially in patients who will require prolonged ventilation due to underlying pulmonary pathology [3, 4 ]. our case demonstrates successful management of concomitant tracheal injury and h1n1 influenza complicated by bacterial super - infection with vv ecmo supplemented by high - frequency oscillator ventilation (hfov), prone positioning, and tube thoracostomy in an adult patient. a 33 year - old previously healthy, morbidly obese (body mass index 40, body weight 98 kg, height 157 cm) female presented to an outside emergency department with progressive dyspnea and malaise. in the emergency department, she rapidly developed acute hypoxic respiratory failure with bilateral infiltrates on chest x - ray (figure 1a). post - intubation chest x - ray showed the endotracheal tube in the right main stem bronchus (figure 1b), requiring adjustment (figure 1c). she remained hypoxic and was transferred to a tertiary center for ards management. at arrival, she was hypoxic (arterial blood gas was ph 7.18, paco2 58, pao2 52, saturation 78%), despite fractional inspiratory oxygen (fio2) of 100%, tidal volume (tv) 600 ml, respiratory rate of 20 positive end expiratory pressure (peep) of 20 mm h2o with paralysis and epoprostenol (50 ng / kg / min) support. failed medical management necessitated urgent vv ecmo using a bi - caval dual lumen cannula (maquet, rastatt, germany) via the right internal jugular vein, after we obtained consent from her family. her oxygenation improved (ph 7.35, paco2 31, pao2 176 and saturation > 99%) with vv ecmo flow of 4 lpm, sweep of 6 lpm and fio2 100%. the patient was found to be positive for h1n1 influenza with super imposed methicillin - sensitive staphylococcus aureus (mssa) pneumonia ; tamiflu (75 mg q12 hours) and broad - spectrum antibiotic coverage with vancomycin (1.5 gram q12 hours, titrate by the rough level 15 - 20 mg / l) and piperacillin / tazobactam (3.375 gram q8 hours) were initiated. ventilator settings were changed from conventional mode (tv 600 ml, rate 20, fio2 100%, peep 20) to ardsnet protocol, with 300cc tv (tv=4 - 6 ml / kg, based on an ideal body weight of 55 kg), respiratory rate 10, and fio2 of 100% with peep 10 for lung protection. peak airway pressure and mean airway pressure remained elevated (58 cm h2o and 15 cm h2o respectively). post - ecmo chest x - ray showed a loculated lower left pneumothorax, treated immediately with bedside thoracostomy tube placement (figure 1d). post intubation x - ray shows endotracheal tube in the right main stem bronchus (1b). after repositioning the endotracheal tube, there is the progression of the bilateral infiltrations (1c). post ecmo cannulation at arrival to our facility, there is a large loculated pneumothorax in the left thorax (1d). bronchoscopy (figure 2) showed a 3 - 4 cm injury of the posterior membranous trachea approximately 1 cm above the carina, confirmed by computed tomography (figure 3). axial (a) and sagittal (b) computed tomography images demonstrating 3 - 4 cm defect in posterior membranous trachea (arrow). thoracic surgery was consulted for evaluation of the trachea injury, but the patient was deemed a poor surgical candidate due to severe ards requiring ecmo with high positive pressure ventilation. the patient began to show failure of ardsnet conventional ventilation (tv = 220 - 330 cc peep 10) with worsening air leak around the endotracheal tube despite of inflation of the cuff, air leak from the chest tube, pneumothorax, pneumomediastinum, and co2 retention on ardsnet ventilation (abg : ph 7.29, paco2 59, pao2 147 and saturation 99%) ; high frequency oscillatory ventilation (hfov, setting mean airway pressure 18 cm h2o, amplitude (p) 75 cm h2o. frequency 5 hz, fio2 50%.) was initiated. pneumothorax, pneumomediastinum and chest tube air leak improved, as well as the abg was improved with the hfov (ph 7.37, paco2 39, pao2 116, saturation 99%). the tracheal tear was evaluated daily by bronchoscopy with airway lavage to prevent mucous accumulation. with pneumothorax, pneumomediastinum, and air leak from the chest tube stabilized, on ecmo day 14 and 11 total days of hfov support, the patient was successfully weaned back to ardsnet protocol ventilation from hfov. with ongoing poor lung recruitment and progression of pulmonary infiltrate, the patient was transitioned to prone position ventilation, using the automated rotoprone system (kci, san antonio, tx). in prone position, abg improved to ph 7.46, paco2 34, pao2 105, saturation 98% from ph 7.41, paco2 43, pao2 67, saturation 93% while in supine. per protocol, the patient was continually rotated to at least 40 degrees for a minimum of 18 hours per day with a maximum prone interval of 3 hours and 15 minutes, interrupted with 45 minutes periods of supine positioning for general nursing care and to minimize facial edema. the patient s sedation was maintained with ketamine, fentanyl, and midazolam and she was paralyzed with rocuronium. enteral nutrition was continued while the patient was paralyzed through a post - pyloric nasal - duodenal tube to minimize risk for aspiration. the patient s pulmonary status improved with prone positioning after 6 days and she was successfully weaned and decannulated from vv ecmo on day 20. at the time of decannulation, bronchoscopy showed improvement of the tracheal injury and esophagogastroscopy confirmed no communication with the esophagus. on day 5 post - decannulation, the patient had a tracheostomy and gastrostomy tube placed for long - term ventilation weaning. on day 20 post decannulation, she was tolerating tracheostomy collar and transferred out of the intensive care unit to the ward. on day 28 post - decannulation, the patient underwent swallow evaluation and was cleared for a diet, tolerating a passy - muir valve (passy - muir, irvine, ca). the patient worked well with physical therapy, ambulating with assistance and was transferred to a rehabilitation facility on post decannulation day 48. the data presented in this paper was collected under approval from thomas jefferson university internal review board. concurrent acute hypoxic respiratory failure secondary to infection with h1n1 influenza and post - intubation tracheal injury pose a difficult management dilemma due to the requirement for long term positive pressure ventilation. during endotracheal intubation, superficial mucosal tears occur in 18% of patients ; however, full thickness post - intubation tracheal injury like this case is rare. patient risk factors for post - intubation tracheal injury include female gender, short stature (160 cm tall), difficult airway anatomy, underlying connective tissue disorder and mechanical risk factors include use of rigid stylet, inadequate intubation tube size, cuff over - inflation, emergent intubation, and intubation by non - anesthesiologists. emergency intubation and delayed diagnosis have been identified as independent risk factors for mortality after post - intubation tracheal injury. initial presentation is most often characterized by subcutaneous emphysema, pneumothorax, persistent air leak and hemoptysis - less commonly pneumomediastinum, angina, hypotension and shock [2, 4 ]. ecmo management for isolated tracheal injury has been previously described, in 10 published reports - 4 pediatric patients and 6 adults (table 1). ards = acute respiratory distress syndrome ; ecmo = extracorporeal membrane oxygenation ; na = not available ; va = venoarterial ; vv = venovenous ; hfov = high frequency oscillatory ventilation. early reports utilized veno - arterial cannulation, but the majority of patients had isolated pulmonary failure secondary to tracheal tear, requiring only vv ecmo. the majority of iatrogenic injuries resulted in a distinct longitudinal injury to the membranous portion of the trachea, as opposed to blunt chest trauma that resulted in transverse injury with irregular borders. blunt chest trauma usually required surgical repair, likely due to the nature of tracheal injury especially if anticoagulation and ecmo is required for support [7, 9,10,11,12 ]. in these papers although there is likely publication bias, the results from these isolated reports show ecmo to be a promising strategy for tracheal injury with potential for positive outcomes. retrospective review has shown a two - fold increase in mortality for surgical management of tracheal injuries detected outside the operating room. conservative management strategies include low tidal volume ventilation, permissive hypercapnia, endotracheal tube fixation in the distal trachea, double lumen intubation, daily bronchoscopy, hfov, and even ecmo, as in our case. however, current strategies have shifted to reserve surgery only for cases that have failed conservative management - signified by worsening mechanical ventilation requirements, uncontrolled air leak, and active endobronchial bleeding [3, 4 ]. conservative therapy is particularly successful in small injuries, less than 2 cm, with minimal non - progressive symptoms, and no air leakage on spontaneous breathing. vv ecmo provides oxygenation and ventilation allowing for minimal ventilatory support and reduced associated baro- and volu - trauma to the injured bronchial tree. failed oxygenation on vv ecmo may require transition to va ecmo in order to fully rest the lungs and bronchial tree. in our case, va ecmo was not ideal due concern to increased infectious risk with femoral cannulation in an morbidly obese patient. in combination with vv ecmo, rescue ventilation therapies may further minimize barotrauma to the injured trachea [6, 11 ]. important adjunct therapies to aid in the healing of the tracheal injury in our patient were prone position ventilation and high frequency oscillatory ventilation. a recent randomized control trial showed the benefit of prone positioning on survival in ards, but evidence for use with hfov and concomitant tracheal injury is limited. tracheal injury, especially in the setting of underlying severe lung injury, is rare and has a high mortality rate. the management has evolved over time, with a movement toward conservative management due to the high morbidity and mortality associated with surgical repair. here we present a conservative management strategy that incorporates the newest advances in pulmonary critical care, and the first report of successful management of an adult patient with concomitant ards, mssa super - infection and post - intubation tracheal injury with vv ecmo, hfov and prone position ventilation. | tracheal injury is a rare but highly morbid complication of endotracheal intubation. recent reviews have advocated conservative management of these injuries without operative intervention. extracorporeal membrane oxygenation may be a useful tool in non - operative management of tracheal injury in the setting of severe respiratory failure and need for prolonged intubation. we present a morbidly obese 33 year - old - female with h1n1 influenza pneumonia complicated by acute respiratory distress syndrome and bacterial super - infection who sustained a post - intubation tracheal injury. concomitant tracheal injury and acute lung injury pose a difficult ventilation dilemma. this patient was successfully managed by venovenous extracorporeal membrane oxygenation, high frequency oscillator ventilation, proning position and tube thoracostomy. the venovenous extracorporeal membrane oxygenation and ventilator management were essential for this patient s recovery. |
mirizzi syndrome, first described in 1948, is where there is repeated inflammation of the gallbladder from a gallstone impacted in either the cystic duct or gallbladder neck. this leads to the formation of adhesions from the gallbladder to the common bile duct resulting in anatomic distortion of these structures. mirizzi syndrome is now classified into two types : in type i there is external compression of the common bile duct by a stone impacted in either the cystic duct or gallbladder neck resulting in inflammation in the triangle of calot ; in type ii the severity of inflammation is greater, resulting in pressure necrosis between the cystic duct and common bile duct resulting in a cholecystocholedochal fistula. symptoms are similar to that of acute and chronic cholecystitis, with or without jaundice. preoperative knowledge of the mirizzi syndrome can be extremely helpful because the aberrant anatomy can predispose to common bile duct injury. a 70-year - old male who had experienced mild mid - epigastric pain with dark urine and pruritis was admitted to the medical service. the patient 's medical history was significant for cholecystitis, cholelithiasis, diabetes mellitus and atrial fibrillation. on physical examination pertinent laboratory findings included a white blood cell count (wbc) of 7.9 k / ul, total bilirubin of 6.4 mg / dl, and alkaline phosphatase of 426 u / l. the patient underwent an ercp which showed a normal common bile duct and pancreatic duct (figure 1). the cystic duct contained stones ; the cystic duct, common bile duct junction was not clearly delineated. based on this information, it was felt that there would be significant inflammation in the triangle of calot to preclude safe laparoscopic cholecystectomy. ercp showing poorly defined cystic duct, common bile duct junction a 64-year - old male with a past medical history significant for cholecystitis was having increasingly frequent attacks of biliary colic. ultrasound (us) of the gallbladder showed cholelithiasis and a normal - sized common bile duct. laboratory values revealed a wbc of 7.6 k / ul, total bilirubin of 1.5 mg / dl, and otherwise normal liver function tests. after these were taken down a stone was found to be impacted in what was thought to be the cystic duct. after the duct was transected distal to the stone, further dissection revealed this to be part of the common bile duct. postoperatively the patient did well and is doing well at 20 months follow - up. a 70-year - old male who had experienced mild mid - epigastric pain with dark urine and pruritis was admitted to the medical service. the patient 's medical history was significant for cholecystitis, cholelithiasis, diabetes mellitus and atrial fibrillation. on physical examination pertinent laboratory findings included a white blood cell count (wbc) of 7.9 k / ul, total bilirubin of 6.4 mg / dl, and alkaline phosphatase of 426 u / l. the patient underwent an ercp which showed a normal common bile duct and pancreatic duct (figure 1). the cystic duct contained stones ; the cystic duct, common bile duct junction was not clearly delineated. based on this information, it was felt that there would be significant inflammation in the triangle of calot to preclude safe laparoscopic cholecystectomy. a 64-year - old male with a past medical history significant for cholecystitis was having increasingly frequent attacks of biliary colic. ultrasound (us) of the gallbladder showed cholelithiasis and a normal - sized common bile duct. laboratory values revealed a wbc of 7.6 k / ul, total bilirubin of 1.5 mg / dl, and otherwise normal liver function tests. the patient underwent elective laparoscopic cholecystectomy and dense adhesions were found surrounding the gallbladder. after these were taken down a stone was found to be impacted in what was thought to be the cystic duct. after the duct was transected distal to the stone, further dissection revealed this to be part of the common bile duct. postoperatively the patient did well and is doing well at 20 months follow - up. the principal abnormality in mirizzi syndrome starts with an inflammatory response to an impacted gallstone in hartmann 's pouch or the cystic duct. repeated bouts of cholecystitis causes inflammation and fibrosis, mirizzi syndrome type i. the recurrent inflammation results in pressure necrosis of the common bile duct and resultant cholecystocholedochal fistula, mirizzi syndrome type ii. ultrasound can reveal a dilated biliary ductal system with a gallstone impacted in the gallbladder neck. an ultrasound may also reveal compression and narrowing of the common hepatic duct. mirizzi syndrome has been diagnosed by computerized tomography (ct - scan) in one published report. ct - scan will help to differentiate biliary, pancreatic and hepatic malignancies, but is not the best imaging modality to use to identify aberrant biliary anatomy. ercp and percutaneous transhepatic cholangiography (ptc) are the most useful tests in evaluating biliary ductal anatomy and pathology. in this manner ercp and ptc can identify common bile duct obstruction from impacted stones and a resultant cholecystocholedochal fistula, although the cholecystocholedochal fistula may not be evident, as in our case. since these findings can also be seen with hepatic, gallbladder, and ductal malignancies, ercp and ptc may allow biopsy of any masses. nonetheless, operative exploration remains the only way to accurately identify the disease process. for patients with jaundice and elevated liver function tests, as in our first patient, we recommend preoperative ercp to evaluate and clear the common bile duct and define any aberrant anatomy. if the diagnosis of mirizzi syndrome is made intraoperatively, a cholangiogram is needed to define ductal anatomy. classification of the mirizzi syndrome has evolved from the original description in 1948 to the two types classified by mcsherry to the four types classified by csendes : type i : external compression of the common bile duct.type ii : a cholecystocholedochal fistula involving less than one - third of the circumference of the common bile duct.type iii : a cholecystocholedochal fistula involving less than two - thirds of the circumference of the common bile duct.type iv : a cholecystocholedochal fistula destroying the entire wall of the common bile duct. type ii : a cholecystocholedochal fistula involving less than one - third of the circumference of the common bile duct. type iii : a cholecystocholedochal fistula involving less than two - thirds of the circumference of the common bile duct. type iv : a cholecystocholedochal fistula destroying the entire wall of the common bile duct. types two, three and four in csendes ' classification system are a further sub - division of mcsherry 's type ii classification. this further sub - division is important to recognize since the extent of the cholecystocholedochal fistula can have implications as how to best surgically correct it. surgical management of the mirizzi syndrome when a cholecystocholedochal fistula is present is difficult because the inflammation distorts the anatomy in the area of dissection, increasing the risk of injury to the common bile duct. often, the resulting inflammation has already injured the common bile duct and further iatrogenic division of the common bile duct is unavoidable or planned during its repair. when the diagnosis is made intraoperatively, a cholangiogram must be performed after any gallstones are removed from the decompressed gallbladder. although with obliteration of the cystic duct, a cholangiogram becomes more difficult to perform laparoscopically through the gallbladder. if no cholecystocholedochal fistula is identified a sub - total cholecystectomy with or without common duct exploration can be performed (mirizzi syndrome type i). this can be performed laparoscopically if the operation hasn't yet been converted to an open one. surgical options in the presence of a cholecystocholedochal fistula include : suture repair of the cholecystocholedochal fistula ; choledochoplasty with the gallbladder remnant ; endoscopic biliary stent placement ; end - to - end anastomosis over a t - tube ; and biliary enteric anastomosis. stricture is common after choledochoplasty and end - to - end anastomosis over a t - tube, as in our first case ; and bile leaks have been reported with lesser procedures. therefore, we recommend biliary enteric bypass in the setting of inflammation and a cholecystocholedochal fistula. sub - total laparoscopic cholecystectomy with or without common duct exploration can be performed in mirizzi syndrome type i. postoperative ercp and sphincterotomy may be used for retained common duct stones in this setting. but in the presence of a cholecystocholedochal fistula, mirizzi syndrome type ii, we believe that conversion to an open procedure with common duct exploration and biliary enteric anastomosis is the safest procedure with the least morbidity. | mirizzi syndrome type ii is an uncommon cause of obstructive jaundice caused by an inflammatory response to an impacted gallstone in hartmann 's pouch or the cystic duct with a resultant cholecystocholedochal fistula. two cases of mirizzi syndrome type ii are presented. clinically only one patient had jaundice and endoscopic retrograde cholangiopancreatogram (ercp) established a preoperative diagnosis of mirizzi syndrome. the other patient 's diagnosis of mirizzi syndrome was made intraoperatively.it is important to properly identify the anatomy at the time of surgery to avoid compromising the common bile duct. operative treatment of mirizzi syndrome type ii includes laparoscopic or open subtotal cholecystectomy ; placement of a t - tube with either laparoscopic or open cholecystectomy ; or creation of a hepaticojejunostomy with cholecystectomy. although there is a report of laparoscopic treatment of this syndrome without long term follow - up, we believe that once there is any question of injury to the common bile duct, safety demands that the laparoscopic procedure be converted to an open one with implementation of appropriate therapy. |
mir132 is a creb induced microrna involved in dendritic spine plasticity. we observed that visual experience regulates histone post - translational modifications at a cre locus important for mir212/132 cluster transcription and mir132 expression in the visual cortex of juvenile mice. monocular deprivation reduced mir132 expression in the cortex contralateral to the deprived eye. counteracting mir132 reduction with infusion of chemically modified mir132 mimic oligonucleotides completely blocked ocular dominance plasticity (odp). |
|
sleeve cages were constructed in two sizes, 10 by 40 cm and 60 by 100 cm, from standard white polyester voile (hancock fabrics, lexington, ky) and from white nylon mesh (70 m thread diameter and 161 m mesh opening, dynamesh, west chicago, il) sewn on three sides using polyester thread to form a bag. five healthy eastern hemlock trees (2.5 m) were selected from a hemlock garden at the university of kentucky s spindletop research farm (fayette co., ky). three small branches (35 cm) were chosen from the top third of each tree and three large branches (1 m) were chosen mid - height, all facing northwest. selected branches were caged on 5 november 2010, and one small and one large branch per tree remained open and uncaged. thus, each tree had a polyester caged branch, a nylon caged branch, and an uncaged control branch of both small and large sizes. sleeve cages were slipped over the terminal end of each selected branch and closed with thin wire at the basal end of the branch. temperature data loggers (ibuttons, maxim integrated products, sunnyvale, ca) were placed in small plastic water - proof bags secured to caged branches with thin wire in the middle of each sleeve cage. temperatures were recorded at 3 h intervals 5 november 2010 to 4 february 2011, and 9 june 2011 to 6 july 2011. in november 2010, relative humidity was measured with three indoor / outdoor hygro - thermometers (extech instruments corp., nashua, nh) installed on each tree for 48 h. one experimental tree was randomly selected and the hygrothermometer sensor was placed on the middle of a preselected branch, either inside the cage or open to ambient conditions on a control branch. readings were taken for 48 h and were completed for the large set of cages on all five trees before moving to the small branches. cages were visually inspected every 2 d for the first 30 d, intermittently for the next 4 mo, and a final time following cage removal. cage condition was rated based on the following system : 1) no damage or change in condition ; 2) fabric worn, loose threads ; 3) small holes or tears less than 5 mm ; 4) holes or tears greater than 5 mm, no longer able to contain small insects. cages remained in place for 18 mo (5 november 20107 may 2012). at the time of cage removal, each small branch was visually observed and all branch tips, considered potential sites for new growth, were counted. sites of new growth were counted and their length measured with calipers. after removing large cages, each large branch was marked at the terminal 50 and 25 cm. all branch tips and sites of new growth were counted on the terminal 50 cm, and all new growth was measured on the terminal 25 cm. each branch was photographed with a reference grid and all cages were inspected for damage. three weeks of temperature data were selected to represent fall, winter, and summer seasons (table 1). for each season, average daily temperature readings were compared across cage material and cage size using a repeated measures analysis of variance (sas 9.2, cary, nc). minimum and maximum temperature and relative humidity readings collected from the hygrothermometers were compared across cage treatment using analysis of variance and blocking by tree. all but three maximum relative humidity readings were 99%, so this dependent variable was excluded from the analysis. the percentage of new growth on each branch was calculated by dividing the number of tips with new growth by the total number of branch tips. arcsine square root transformed percent growth data and the average length of the new growth were analyzed with anova, blocking by tree. the independent variables were cage size and cage material, and the interaction between the two was tested. cage condition was compared across material and cage size at nine time points using a repeated measures analysis of variance. table 1.temperature data from selected 1-wk periods representing fall, winter, and summer seasons, used to evaluate microclimatic variation within sleeve cages enclosing eastern hemlock branchesseasondatesmean daily temperature (c)maximumminimumfall6 nov. 20115.514.4summer29 june 20115 july 201129.119.7 temperature data from selected 1-wk periods representing fall, winter, and summer seasons, used to evaluate microclimatic variation within sleeve cages enclosing eastern hemlock branches the cost of material per cage was calculated based on the october 2010 retail price of the polyester voile (us$1.82/m ; us$4.97 per linear yard of 118-inch wide material, in lexington, ky) and the online bulk purchase price of the nylon mesh (us$4.62/m ; us$4.84 per linear yard of 45-inch wide material). there was no difference in the average daily within cage temperature between polyester and nylon cages and uncaged control branches within seasons (table 2). maximum daily temperature occurred at 1500 hours (3:00 p.m. eastern time) for each season, and the minimum temperature occurred at 0600 hours in the fall and summer, and at 0900 hours in the winter (fig. average daily within cage temperature did vary with cage size (table 2). temperatures were higher inside small cages compared to large cages at each time interval for each season (fig. 2). there was no interaction between cage size and cage material with respect to average daily temperatures within seasons (table 2). 1.average temperature at 3 h intervals over 7 d on eastern hemlock branches in sleeve cages of polyester (------) and nylon (), relative to uncaged branches (), during (a) fall (612 nov. 2010), (b) winter (1723 jan. 2011), and (c) summer (29 june5 july 2011). fig. 2.average temperature at 3 h intervals in small (400 cm) () and large (6000 cm) (------) sleeve cages on eastern hemlock branches over 7 d during (a) fall (612 nov. 2010), (b) winter (1723 jan. 2011), and (c) summer (29 june5 july 2011). table 2.effects of sleeve cage construction material (polyester and nylon) and size (400 and 6000 cm) on average within - cage temperatures of enclosed eastern hemlock branches relative to uncaged control branches across three seasons. small cages were located in the upper third of the tree, while large cages were placed mid - heightseasonmaterialsizesize materialfallf2,24 = 2.18 ; p = 0.14f1,24 = 4.50 ; p = 0.04f2,24 = 0.08 ; p = 0.92winterf2,24 = 0.29 ; p = 0.75f1,24 = 23.2 ; p 5 mm, no longer able to contain small insects.small : 10 by 40 cm ; large : 60 by 100 cm.materials only, us$ per m. degradation of polyester and nylon sleeve cages of two sizes installed on eastern hemlock branches for 18 mo. cage degradation differed by size (f = 8.73 ; df = 1, 16 ; p = 0.01) and by material (f = 13.74 ; df = 1, 16 ; p = 0.002), with a significant size material interaction (f = 9.38 ; df = 1, 16 ; p = 0.007) degradation rating (n = 5) 1 : no damage or change in condition, 2 : fabric worn, loose threads, 3 : small holes or tears 5 mm, no longer able to contain small insects. small : 10 by 40 cm ; large : 60 by 100 cm. materials only, us$ per m. sleeve cages are standard tools for evaluating trophic interactions under field conditions and minimizing within - cage microclimatic effects is essential for realistic evaluations of tritrophic interactions and natural enemy efficacy. the data showed that exclusion sleeve cages of polyester and nylon had only a minimal abiotic impact on the microhabitat of eastern hemlock branches. temperature and relative humidity within cages made of either material did not differ from ambient control branches, but within - cage light penetration was not measured. (2005) ; they placed dataloggers inside and outside a sleeve cage on one hemlock branch at three sites and found no difference in temperature. average temperatures were higher inside small cages relative to large cages ; these differences were most evident during the winter and may be attributable to cage position. the smaller cages were located in the upper third of the canopy and, therefore, subjected to more direct sunlight and greater radiant energy. of necessity, the small cages also enclosed smaller branches and therefore less foliage, reducing the modulating effects of foliar metabolism. potential effects of the host plant itself in modulating temperature and humidity fluctuations can not be discounted ; within - cage microclimatic variation may be greater in plants with different morphology, physiology, or growth form. caging did affect t. canadensis growth ; the proportion of new branch tips was lower on branches caged in polyester relative to uncaged controls, and the length of t. canadensis new growth was negatively affected by both cage material and cage size. these results contrast with a previous study measuring microclimatic effects inside cages on malus domestica borkh. 1994), which found that tree growth was not affected by cages, and that tree performance, as measured by shoot growth, increased inside cages relative to controls. however, lawson. (1994) were utilizing whole - tree enclosures on a fast - growing fruit tree, whereas we utilized branch sleeve cages on a slow - growing conifer. while there was no direct change in microclimate due to caging material, alterations in host plant quantity these alterations in plant performance could affect herbivore performance, directly through decreases in available resources, or indirectly by influencing plant physiology and host plant quality (price. the hemlock woolly adelgid prefers to settle and feed on new hemlock tissue (young. 1995), so decreased t. canadensis plant health negatively affects a. tsugae performance (mcclure 1991). these experiments were conducted over a relatively long period (18 mo) on eastern hemlock, an extremely slow - growing, shade - tolerant conifer. long - term caging studies are useful to evaluate host plant suitability for sedentary herbivores or predator prey dynamics through several generations. the data indicate, however, that large polyester cages lose their ability to effectively hold / exclude insects after 75 d. smaller polyester cages and cages made from nylon material are more durable and may be effective enclosures / exclosures for up to 18 mo. (2005) used nylon sleeve cages on eastern hemlock branches in experiments lasting 56 mo, but lamb. (2006) used polyester cages when data was collected just 10 d after caging. both studies used appropriate caging materials for their respective experimental durations, and likely experienced minimal caging effects. wallace and hain (2000) performed field cage experiments on t. canadensis lasting 7595 d but no mention is made of cage material. t. canadensis growth was affected by cages after 18 mo, but shorter term caging experiments may show no detectable effect on host plant quality. similarly, effects on deciduous or herbaceous plants, or on more rapidly growing species, may differ. lack of data in this study for the spring season is unfortunate, since spring is a crucial period for many insect plant systems and an especially critical time for emergence and settlement of a. tsugae progrediens nymphs on eastern hemlock. however, the adelgid is bivoltine in north america, and data collection coincided well for development of the sistens generation. polyester cages were found to be more prone to degradation than their nylon counterparts ; they were also more difficult to construct and manipulate in the field. the softer threads of the polyester material made the fabric limp and difficult to hold in place when sewing the cages and inserting them on branches. while nylon caging material is 2.5 times more expensive, it is also more resilient to damage and uv degradation, and has minimal effects on within - cage microclimate and plant growth. the data in this study suggest that nylon mesh is more resilient in long - term studies and its use in cage exclusion studies minimizes impacts on plant performance which could potentially affect herbivore and predator behavior (price. 1980, scriber and slansky 1981), thus effectively facilitating studies evaluating trophic interactions. | sleeve cages for enclosing or excluding arthropods are essential components of field studies evaluating trophic interactions. microclimatic variation in sleeve cages was evaluated to characterize its potential effects on subsequent long - term experiments. two sleeve cage materials, polyester and nylon, and two cage sizes, 400 and 6000 cm2, were tested on eastern hemlock, tsuga canadensis (l.) carrire. temperature and relative humidity inside and outside cages, and the cost and durability of the cage materials, were compared. long - term effects of the sleeve cages were observed by measuring new growth on t. canadensis branches. the ultimate goal was to identify a material that minimizes bag - induced microclimatic variation. bagged branches whose microclimates mimic those of surrounding unbagged branches should have minimal effects on plant growth and may prove ideal venues for assessing herbivore and predator behavior under natural conditions. no differences were found in temperature or humidity between caging materials. small cages had higher average temperatures than large cages, especially in the winter, but this difference was confounded by the fact that small cages were positioned higher in trees than large cages. differences in plant growth were detected. eastern hemlock branches enclosed within polyester cages produced fewer new growth tips than uncaged controls. both polyester and nylon cages reduced the length of new shoot growth relative to uncaged branches. in spite of higher costs, nylon cages were superior to polyester with respect to durability and ease of handling. |
type 1 diabetes mellitus (t1 dm) is the most common endocrine - metabolic disorder of childhood and adolescence that has important consequences for physical and emotional development. appropriate management of the disease and maintenance of blood glucose level in the normal range could reduce the rate of complications. factors that impair blood glucose level could lead to poor metabolic control and increased rate of complications. in recent years, eating disorder (ed) has been found to be one of these factors. an association of ed with diabetes mellitus may be more hazardous than each one alone and could lead to a serious lack of metabolic control, higher mortality rate, and higher rate of complications, in particular, retinopathy. in the adolescent period, adolescents are worried about their body shape, which in girls is followed by an ed. it is estimated that 10% of adolescent girls suffer from some types of eds ; half of these are bulimia behaviors. adolescent girls with type 1 diabetes are at higher risk for disturbed eating behaviors than their non - diabetic peers. effects of chronic disease on body image, low self - steam due to chronic disease, limited dieting, and gaining weight due to insulin injections are probably the mechanisms for occurrence of eds in young women with type 1 diabetes. first, they must cope with their specific lifestyle and, on the other hand, ed could lead to other disorders. with regard to the importance of early diagnosis and treatment of these disorders and complexity of both, and because there is no information about the frequency of disturbed eating behaviors in iranian population with t1 dm, the present study was conducted to evaluate disturbed eating behaviors in adolescent girls with t1 dm and compare its frequency with that of non - diabetic peers. in this cross - sectional comparative study, 126 adolescents and young females with t1 dm aged between 12 and 22 years and 325 healthy peers were enrolled. diabetic cases were selected using the convenience sampling method from the patients databases of the outpatient clinic of diabetes mellitus in isfahan endocrine and metabolism research center and isfahan social security organization from october to november 2010. having diabetes mellitus type 1 (dmt1) for at least 1 year without any history of other chronic mental or physical disorders was our main eligibility criterion. recruited patients had received diet and physical activity education and were under metabolic control by using insulin twice to thrice daily. three hundred and twenty - five healthy, 12- to 22-year - old females were chosen as the control subjects by random two - stage cluster sampling method, with probability proportional to the size of each cluster. the clusters were middle and high schools, and faculties of local universities in isfahan city whose list was obtained from the local department of education. the cases were interviewed individually, but the control girls were approached as a group during a class. after enrollment in the study, all participants were handed a self - report structural questionnaire including demographic data, the eating attitudes test (eat-26), and children 's depression inventory (cdi). original versions of the aforementioned standardized inventories were translated into persian language and then retranslated into english, and incoherencies were discussed and rectified. data for laboratory tests were retrieved from each patient 's records. in order to corroborate the diagnosis of t1 dm, all of the eligible cases were visited by a collaborating endocrinologist. a broadly used standardized measure, eat-26, has been designed to serve as an economical first step for the screening of eds. this questionnaire includes three subscales with the following items : (a) dieting scale including 13 items, (b) bulimia and food preoccupation scale including 6 items, and (c) oral control subscale including 7 items. eat-26 questions are scored according to the frequency of a behavior or concern. in items 125, always, usually, and often are given scores of 3, 2, and 1, respectively ; while the answers sometimes, rarely, or never a total score of 20 or above is indicative of the presence of problematic eating behaviors and/or concerns, whereas a score below 20 does not rule out the probability of having eds. body mass index (bmi) was calculated using the metric height and weight measurements and the standard equation (kg / m). cdi is a reliable and valid clinical research instrument for school - aged children and adolescents. as a self - report instrument it includes 27 items ; each of them is assigned a numerical value from 0 to 2, with the higher values corresponding to clinically more severe behavior. total score is calculated by the summation of separate item scores (54) with a cut point of > 15. data are reported as number (%) and mean (sd) where appropriate. comparisons between groups were made using independent t - test for continuous variables and chi - square test for discrete variables. the univariate relations between diabetes status and eat-26 and cdi scores were examined by logistic regression and presented as odds ratio (or) with 95% confidence intervals (95% cis). adjustment for age data were entered using epi info, version 6 (centers for disease control, atlanta, ga, usa) and analyzed by means of spss software, version 15 (spss inc., chicago, il, usa). a 2-tailed p value of 0.05 is considered statistically significant in all the analyses. ethical approval for conducting this study was obtained from the ethics committee of the isfahan university of medical sciences, isfahan, iran, and an informed written consent was obtained from each participant or her parent (in under - aged individuals). in this cross - sectional comparative study, 126 adolescents and young females with t1 dm aged between 12 and 22 years and 325 healthy peers were enrolled. diabetic cases were selected using the convenience sampling method from the patients databases of the outpatient clinic of diabetes mellitus in isfahan endocrine and metabolism research center and isfahan social security organization from october to november 2010. having diabetes mellitus type 1 (dmt1) for at least 1 year without any history of other chronic mental or physical disorders was our main eligibility criterion. recruited patients had received diet and physical activity education and were under metabolic control by using insulin twice to thrice daily. three hundred and twenty - five healthy, 12- to 22-year - old females were chosen as the control subjects by random two - stage cluster sampling method, with probability proportional to the size of each cluster. the clusters were middle and high schools, and faculties of local universities in isfahan city whose list was obtained from the local department of education. the cases were interviewed individually, but the control girls were approached as a group during a class. after enrollment in the study, all participants were handed a self - report structural questionnaire including demographic data, the eating attitudes test (eat-26), and children 's depression inventory (cdi). original versions of the aforementioned standardized inventories were translated into persian language and then retranslated into english, and incoherencies were discussed and rectified. data for laboratory tests were retrieved from each patient 's records. in order to corroborate the diagnosis of t1 dm, all of the eligible cases were visited by a collaborating endocrinologist. a broadly used standardized measure, eat-26, has been designed to serve as an economical first step for the screening of eds. this questionnaire includes three subscales with the following items : (a) dieting scale including 13 items, (b) bulimia and food preoccupation scale including 6 items, and (c) oral control subscale including 7 items. eat-26 questions are scored according to the frequency of a behavior or concern. in items 125, always, usually, and often are given scores of 3, 2, and 1, respectively ; while the answers sometimes, rarely, or never a total score of 20 or above is indicative of the presence of problematic eating behaviors and/or concerns, whereas a score below 20 does not rule out the probability of having eds. body mass index (bmi) was calculated using the metric height and weight measurements and the standard equation (kg / m). cdi is a reliable and valid clinical research instrument for school - aged children and adolescents. as a self - report instrument it includes 27 items ; each of them is assigned a numerical value from 0 to 2, with the higher values corresponding to clinically more severe behavior. total score is calculated by the summation of separate item scores (54) with a cut point of > 15. data are reported as number (%) and mean (sd) where appropriate. comparisons between groups were made using independent t - test for continuous variables and chi - square test for discrete variables. the univariate relations between diabetes status and eat-26 and cdi scores were examined by logistic regression and presented as odds ratio (or) with 95% confidence intervals (95% cis). adjustment for age data were entered using epi info, version 6 (centers for disease control, atlanta, ga, usa) and analyzed by means of spss software, version 15 (spss inc., chicago, il, usa). a 2-tailed p value of 0.05 is considered statistically significant in all the analyses. ethical approval for conducting this study was obtained from the ethics committee of the isfahan university of medical sciences, isfahan, iran, and an informed written consent was obtained from each participant or her parent (in under - aged individuals). during the recruitment period, 114 out of 126 eligible selected diabetic individuals returned signed consent forms and were enrolled in the study. due to incompleteness of the questionnaires, as illustrated in table 1, although our diabetic cases were older than the control group (17.24 3.53 vs. 15.59 2.62 years, p < 0.001), they had no significant differences in weight and bmi from controls. parents education level and occupation status differed significantly between the groups. in comparison to controls, diabetic subjects were less probable to have fathers (13.9% vs. 30.2%) and mothers (8.3% vs. 25.9%) with academic qualifications. their fathers were more likely to be unemployed, retired, or deceased (p < 0.001), while their mothers were mostly housewives (91.7% vs. 80.2%, p = 0.049). characteristics of the study sample overall cdi score was averagely high in both the groups, with a significantly higher value in diabetic girls (p = 0.006). also, 81.6% of girls with t1 dm passed the cdi threshold and were classified as having potential depression in contrast to 70.5% of non - diabetic participants (p = 0.03). analysis of data from eat-26 questionnaires revealed that a significantly higher percentage of diabetic girls are likely to have eating disturbances (p = 0.01). cases acquired higher scores in both dieting and bulimia scales, which supports a role for t1 dm in inducing the symptoms [table 1 ]. ors of depression and eating disturbances with t1 dm in our sample are presented in table 2. as shown in the table, compared to unaffected individuals, diabetic girls were at a 78% increased risk of having depressive symptoms (or = 1.78, 95% ci : 1.082.12). regarding the eating disturbance symptoms, our findings have shown that having t1 dm can increase the risk more than double. although significant in the crude model, the risk of eating disturbance was intensified after adjustment for age (or = 2.17, 95% ci : 1.353.57). moreover, according to the adjusted model, diabetic girls had an increased probability of getting higher scores in all three eat-26 subscales. in the present study, the frequencies of disturbed eating behaviors in adolescent girls with and without t1 dm were evaluated by eat-26 questionnaire, and the results indicated that with a cutoff score, a significantly higher percentage of diabetic girls are likely to have eating disturbances. also, diabetic subjects obtained significantly higher scores in both dieting and bulimia scales, and had an increased probability of getting higher scores in all three eat-26 subscales. in a cross - sectional study on 71 adolescents with t1 dm (aged 1022 years ; 41 females and 29 males) who were matched to a group of non - diabetic adolescents, found that adolescent females with t1 dm scored significantly higher in bulimia subscale than adolescent taiwanian females without t1 dm. in their study, however, there were no group differences among adolescent females dieting subscale, oral control subscale, and eat-26 total scores. this difference may be due to difference in the cost of sugar - free foods in iran compared to taiwan or because iranian population may include more diabetic substitutes in their meal plan than taiwanians. in the present study, diabetic girls had more than double the risk of eating disturbance symptoms compared to unaffected individuals. pinar found that disordered eating meeting the eat cutoff criterion is approximately four times as common in diabetic adolescents as in their non - diabetic peers, which is higher than our results. this difference may be due to the cross - cultural differences in the prevalence of eds between turkish population and iranian population. in their investigation about the frequency of risk behaviors for ed in patients with type 1 diabetes, found that patients with diabetes are at the risk of having ed. these findings are presented in several other previous studies and support a role for t1 dm in inducing the ed symptoms. analyses of data from cdi revealed that diabetic girls had significantly higher mean score of depression than non - diabetics. according to the adjusted model, they had a 78% increased risk of having depressive symptoms (or = 1.78, 95% ci : 1.082.12). depression may be a cause of susceptibility for developing disturbed eating behavior. in a study among girls with t1 dm who were interviewed for symptoms of depression and disturbed eating behavior, eating disorder examination scores were significantly higher in girls with depression. therefore, it is important to pay attention to the signs and symptoms of depression in diabetic girls and treat depression as a means of treating eds. increased body weight is a known risk factor in diabetic patients to develop ed. this finding may be related to a low rate of intensive insulin use in our subjects (mostly two times a day). however, more studies are necessary in this field. in the present study, small sample size and simple convenient method of sampling for diabetic cases in addition, data on eating disturbance and unhealthy weight control behaviors among adolescents with type 1 diabetes should be interpreted cautiously. in the present study, small sample size and simple convenient method of sampling for diabetic cases limit the generalizability of the results to other samples. in addition, data on eating disturbance and unhealthy weight control behaviors among adolescents with type 1 diabetes should be interpreted cautiously. as far as could be ascertained, this is the first study investigating the risk of developing eating disturbance in a sample of iranian patients with diabetes and comparing it with that of non - diabetic peers. based on the findings, it is suggested that special attention should be directed toward adolescent girls with poor metabolic control. finally, healthcare professionals, especially diabetic nurses, should be aware of the potential effects of subclinical and clinical eating behaviors on adolescents with t1 dm. it is recommended that other studies should be done by use of diagnostic scales to evaluate the frequency of both disturbance in eating behaviors and ed criteria in patients with t1 dm. | background : an association of eating disorder with diabetes mellitus may lead to a serious lack of metabolic control, higher mortality and morbidity. there is no recent study conducted in the iranian population about eating disorder and its variants. the aim of the present study is investigation of frequency of disturbed eating behaviors in adolescent girls with type 1 diabetes mellitus (t1 dm) compared to non-diabetics.materials and methods : in this cross - sectional study, disturbed eating behavior were evaluated and compared in two groups of 1222 year old adolescent and young females (126 with diabetes and 325 without diabetes). a self - report questionnaire including demographic data, children 's depression inventory (cdi), and eating attitude test (eat-26) was used for data gathering. independent t - test, chi - square test, and logistic regression [odds ratio (or) ] were used for data analyses in spss 15.results:findings revealed that higher percentage of diabetic girls are likely to have eating disturbances (67.9% vs. 53.8%, p = 0.01). diabetic group obtained higher scores in both dieting (14.95 6.28 vs. 11.79 5.62, p < 0.001) and bulimia scales (4.9 3.13 vs. 4.12 2.89, p = 0.017), which supports a role for t1 dm in inducing the symptoms. diabetic girls were at more than double the risk of developing eating disturbance.conclusions:the results indicate that a significantly higher percentage of diabetic girls are likely to have eating disturbances. also, diabetic subjects had an increased probability of getting higher scores in all three eat-26 subscales. therefore, healthcare professionals, especially diabetic nurses, should be aware of the potential effects of the subclinical and clinical eating behaviors on adolescents with t1 dm and evaluate them for these disturbances. |
spinal meningocele is associated with spina bifida cysts and may occur at any age. however, intrapelvic meningocele is rare and, without spinal compression, this type of meningocele does not cause any discomfort. for this reason, intrapelvic meningocele has not attracted much attention for a long time. here, we report a case of an asymptomatic intrapelvic meningocele found incidentally during a sigmoidectomy due to megacolon in a 30-year old male patient. a 30-year - old male, admitted because of constipation, was scheduled to undergo sigmoidectomy. preoperative magnetic resonance (mr) scan indicated that a cyst was in front of the third sacral vertebrae (s3) (fig. after sigmoidectomy, this cyst was resected. however, on the first postoperative day, 150 ml of amber liquid was drained from pelvic drainage tube. over the following several days 1c and 1d). because the patient had just undergone sigmoidectomy, conservative treatment consisting of three main steps was considered : drainage, anti - infection therapy (cefpiramide combined with tinidazole) and posturing by raising the position of the lumbosacral region to reduce liquorrhoea. at the beginning, we drained the cerebrospinal fluid (csf) via a pelvic drainage tube. however, because the volume still exceeded 150 ml / d, we placed another drainage tube into the subarachnoid space. on the first day, approximately 300 ml csf drained from the subarachnoid tube, and 50 ml drained from the pelvic cavity. over the following three days, the volume of liquid from the pelvic cavity began to reduce generally. the subarachnoid drainage tube was removed on the fourth day and there was no liquorrhoea over the next two days. mr scan reveals the presence of a cyst 3 cm in diameter (arrow) in front of s3 in a 30-year - old male patient (a : coronal section ; b : median sagittal section). histological examination (c : 40 ; d : 100) showed that the cyst was mixed with nerve collagen tissue (h&e). intrapelvic meningocele is defined as a csf - filled sac within the spinal meningeal wall which protrudes into the intrapelvic cavity through an enlarged intervertebral foramen or bone defect. acquired meningocele is relatively common as a laminectomy complication, while congenital meningocele is commonly associated with neurofibromatosis,. the clinical manifestation of an intrapelvic meningocele is closely related to its size and relationship with surrounding structures. it may include back pain, urinary and fecal incontinence, and lower limbs weakness or paralysis. a small lesion may be asymptomatic and discovered incidentally, as it was in our case. for small- and medium - sized lesions, the most common surgical management is resection of the meningocele and repair of the dural defect through laminectomy,. in this case, surgery was performed with removal of the meningocele pouches and shunting of the cyst to the subarachnoid region. however, liquorrhoea occurred after the operation. although liquorrhoea is a common occurance with cystectomy, it may result in infection of the central nervous system. specific posture and drainage in combination with anti - infection therapy were performed instead of surgery. this conservative method can also treat liquorrhoea effectively and at the same time help patients avoid a second operation. | asymptomatic intrapelvic meningocele is rare. here, we report the case of a 30-year - old chinese man who underwent sigmoidectomy due to megacolon. during the operation, an intrapelvic cyst was found and resected. meningocele was confirmed by histological examination. the patient recovered well postoperatively with the exception of liquorrhoea. conservative therapy was initiated, including draining, anti - infection and specific posture maintenance. during the following week, liquorrhoea was generally relieved and the patient was discharged. this is the first known report of liquorrhoea associated with intrapelvic meningocele resection successfully treated by conservative therapy. our case indicates that conservative treatment may be considered for similar cases so that a second surgery is avoided. |
spontaneous intracranial hypotension (sih) is an uncommon cause of sudden and persistent headache and patients typically present with postural or exertional headaches that can be temporarily relieved by lying in a supine or recumbent position. associated symptoms are common, among which there are cranial nerve palsies, frequently resulting in ophthalmoplegia [38 ], especially of the abducens nerve. clinical symptoms are usually accompanied by magnetic resonance imaging (mri) findings related to cerebrospinal fluid (csf) depletion including subdural fluid collections, enhancement of the pachymeninges, engorgement of venous structures, pituitary hyperemia and sagging of the brain. the present case, reporting the association with an isolated third nerve palsy, shows that a deep knowledge of sih clinical presentation may avoid misdiagnoses. we report a case of a 21-year - old man, admitted to our hospital, for a sudden onset of a severe holocranial pain and diplopia. the headache was continuous, and changing position, particularly orthostatism, caused worsening of symptoms which conversely were relieved by lying flat. the patient did not complain about phonophobia, vertigo or tinnitus and vomiting, but reported photophobia and nausea. neurological examination was normal other than for cranial nerves evaluation that showed diplopia due to mild restricted adduction of the left eye toward right and ipsilateral partial ptosis. pupils were equal and reactive to light (both directly and consensually) and accommodation. diplopia disappeared within 2 h. saccadic eye movements and ocular examination were normal with visual fields full to confrontation. the patient did not experience head or neck trauma and fever or rashes were not present. to exclude a possible subarachnoid hemorrhage (sah), the patient underwent a brain ct scan which was negative for hemorrhage. to rule out a diffuse inflammatory disease or neoplastic processes, routine blood, rheumatic and autoimmune tests, paraneoplastic markers, serum levels of angiotensin - converting enzyme, thoracic radiography and abdominal ultrasound, brain and spine magnetic resonance imaging (mri) without contrast revealed a mild descent of the brainstem with mild cerebellar tonsillar herniation and flattening of pontine surface, dilated sagittal sinus and enlargement of the pituitary gland (fig. 1a), associated with a subdural hematoma, surrounding bilaterally the fronto - parietal and temporo - polar regions. another subdural fluid collection was present in the anterior section of the spinal cord (at c5d1 level) with a consequent posterior dislocation. in addition, symmetrically dilated vascular structures, with abnormal epidural venous engorgement, were again seen anterior to the cervical cord without cord compression, from c4 level up to atlanto - occipital junction (fig. after gadolinium, mri showed diffuse pachymeningeal enhancement in supratentorial and infratentorial regions (fig. 1a sagittal t1-weighted brain mri, b sagittal t2-weighted spinal mri, c coronal t1-weighted brain mri post - gadolinium contrast administration, d mr myelogram of upper and lower spinal subdural space a sagittal t1-weighted brain mri, b sagittal t2-weighted spinal mri, c coronal t1-weighted brain mri post - gadolinium contrast administration, d mr myelogram of upper and lower spinal subdural space mr myelography showed no signs of spreading cerebrospinal fluid (csf) at the level of the cervical and dorsal root pockets (fig. according to the international headache society (ihs) ichd - ii criteria, the mri findings and the clinical history were consistent with a diagnosis of headache attributed to low csf pressure. although ichd - ii comments suggest that dural puncture should be avoided in patients with positive mri signs, such as meningeal enhancement with contrast we performed csf analysis to corroborate our diagnostic hypothesis. csf opening pressure was of 5 cmh2o and a lymphocytic pleocytosis (20 cells / ml) was detected. initially, the case was managed by bed rest, hydration and steroidal therapy, but after 3 weeks of conservative treatment with limited benefit on the orthostatic headache, the sih syndrome was successfully managed with the application of lumbar epidural blood patch (ebp) using approximately 28 ml of autologous blood, resulting in immediate relief of clinical symptoms. after 6 months, in contrast, mri findings were substantially unmodified, showing only a mild reduction of brain sagging, with persistent subdural fluid collection in the same regions, epidural venous engorgement and diffuse meningeal enhancement in supratentorial and infratentorial regions (images not shown). to our knowledge, this is the first report of a transient and isolated third nerve palsy as the presenting sign of sih. csf exerts a necessary buoyant force on the cranial contents, suspending the brain and cranial nerves and protecting them from downward traction. when the csf volume decreases, the burden on the vascular and/or dural pain sensitive structures, subjected to traction and distortion, may cause the headache. a relatively low csf volume may result by either post - traumatic or spontaneous dural laceration.. the second one can be frequently due to micro ruptures of the dura occurring at weak points along the spinal root sleeves (especially in the presence of connective tissue disorder) resulting in a syndrome known as sih. orthostatic, diffuse or dull headache that worsens within 15 min after sitting or standing and that can be temporarily relieved by lying in a supine or recumbent position, is the main manifestation of sih. other common signs and symptoms include tinnitus, hypoacusia, vertigo, photophobia, nausea and neck stiffness. a variety of cranial nerve palsies is frequently associated with sih (3035%) resulting in ophthalmoplegia and visual disturbances. abducens nerve palsy is the most common occurring in about 80% of reported patients with sih - related ophthalmoplegia. although less common, both unilateral and bilateral paresis of the third and fourth cranial nerves might occur with sih. ferrante. reported a woman with a paresis of the right third combined to sixth cranial nerves. moreover, warner described an isolated, partial third cranial nerve palsy due to sih, although eighth cranial nerve involvement was present in the form of intermittent whistle in the ear. pathophysiology of cranial nerve paresis in sih is not completely understood and potential causes include traction on cranial nerves due to downward displacement of cerebral structures and cranial nerve compression or might be due to secondary brainstem compression and transitory ischemia in the acute phase of sih. we believe that a deep knowledge of clinical presentation of sih may avoid misdiagnoses, especially with sah. indeed, the presence of third cranial nerve palsy (alone or in association with other cranial nerves involvement) with sudden onset orthostatic headache should prompt a possible diagnosis of sih which must be considered only after sah has been carefully ruled out. usually after ebp procedure, clinical symptoms recede together with the disappearance of mri features, however, in line with the present case, a clinical radiological dissociation in which clinical syndrome improved, while mri features did not, has been already reported. | spontaneous intracranial hypotension is an uncommon cause of sudden and persistent headache : associated symptoms are common, among which there are cranial nerve palsies, especially of the abducens nerve. we report a case of a 21-year - old man with a transient and isolated third nerve palsy due to spontaneous intracranial hypotension. to our knowledge, there are only few reports in the literature of such association. |
a 52-year - old healthy man presented with intermittent ocular pain of indistinct duration in his right eye. his best - corrected visual acuity (bcva) was 20/20, and the intraocular pressure in the right eye was 10 mmhg. slit - lamp and gonioscopic examination of the right eye showed an irregularly - shaped pigmented mass at the temporal iris root (fig. ultrasound biomicroscopy showed a ciliary body mass with extension into the iris root and medium internal reflection (fig. the basal diameter of the mass was 1.5 mm and the height was 1.3 mm. magnetic resonance imaging of the head and orbit was unremarkable, and positron emission tomography of the ciliary body identified no significant fluorodeoxyglucose uptake in the orbit or the imaged body to suggest malignancy. 2b), and the tumor was positive for melanocytic markers (melan a and hmb-45). a macrophage marker (cd 68) confirmed the presence of melanophages in a scattered pattern. the proliferative activity, estimated by the ki-67 labeling index, was less than 1.0%, implying a benign tumor. histopathologic features were consistent with melanocytoma of the ciliary body with extension into the iris root. slit - lamp photography taken on postoperative day 7 showed a small iridectomy site with good overall cosmesis (fig. the patient 's bcva remained 20/20 with an intraocular pressure of 12 mmhg. during one year of follow - up, no signs of tumor recurrence were seen, and the patient reported resolution of the intermittent ocular pain in the involved eye. melanocytoma of the ciliary body is typically identified at a late stage, as its location behind the iris eludes early detection with routine ophthalmic examination. only after ciliary body melanocytomas extend into the iris root can they be visualized on anterior segment examination. in a report of ten patients with ciliary body melanocytomas, including a review of 30 additional cases, 85% of patients displayed extension into the iris root or the trabecular meshwork, but only 12% had elevated intraocular pressure. our patient exhibited extension of his ciliary - body melanocytoma into the iris root, but his preoperative intraocular pressure was within the normal range. in this series of ten patients, three were symptomatic, one of which reported soreness of the involved eye. likewise, our patient presented with intermittent ocular pain, which could have been related to the presence of tumor in the ciliary body. the differential diagnosis of a pigmented tumor of the ciliary body includes adenoma, adenocarcinoma, medulloepithelioma and, most importantly, malignant melanoma. although melanocytoma can usually be distinguished histopathologically, it can be difficult to clinically differentiate before surgery, especially from a malignant melanoma. advised surgical removal rather than observation for management of pigmented lesions of the ciliary body due to both the difficulty in clinically distinguishing a melanocytoma from a malignant melanoma and the frequent occurrence of necrosis (36%) seen in ciliary body melanocytomas. if serious intraocular complications are not present, such as massive necrosis of a large tumor, severe destruction of chamber angle structures, or massive hemorrhage, and if technically feasible, iridocyclectomy under lamellar scleral flap seems an apt choice for the surgical treatment of ciliary body tumors. in summary, melanocytoma of the ciliary body is a rare tumor that can invade chamber angle structures and present as a pigmented mass at the iris root. we present a case of ciliary body melanocytoma which presented as an iris mass with intermittent pain that was successfully managed with an iridocyclectomy. | we report a case of ciliary body melanocytoma in a korean patient, which presented as an intermittently painful pigmented iris mass and was successfully managed by iridocyclectomy. a 52-year - old healthy man presented with an irregularly - shaped and heavily - pigmented mass at the iris root of his right eye. visual acuity of the right eye was 20/20 with normal intraocular pressure. ultrasound biomicroscopy showed a 1.5x1.3-mm ciliary - body mass with extension into the iris root. iridocyclectomy with scleral resection under a lamellar scleral flap was performed, and the histopathologic features of the resected tissue were consistent with melanocytoma of the ciliary body. the patient 's visual acuity remained 20/20 with good postoperative cosmesis. during one year of follow - up, no signs of tumor recurrence were seen, and the patient reported resolution of the intermittent ocular pain in the involved eye. |
tobacco use is among the most prevalent, albeit preventable, human carcinogen exposures. cigarette smoking causes up to 90% of lung cancer, the most common cause of cancer death in the united states, resulting in a projected 159,480 deaths in 2013. tobacco - specific nitrosamines (tsna) are among the most significant tobacco carcinogens ; multiple studies clearly document their strong carcinogenicity in laboratory animals as well as the occurrence of substantial amounts of these carcinogens in both unburned tobacco and tobacco smoke. one of the most prevalent of these compounds, 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (nnk, 1), is a remarkably effective lung carcinogen in laboratory animals, inducing lung tumors in rodents independent of the route of administration. results of numerous investigations indicate that nnk is a causative agent for lung cancer in smokers. exposure to nnk may also be causally related to nasal, oral, liver, pancreatic, and cervical cancers. nnk together with the related nitrosamine nnn have been classified as group 1 carcinogens by the international agency for research on cancer (iarc). therefore, the risk of lung cancer in smokers may be affected by the relative extent of nnk metabolic activation and detoxification, with those who activate nnk more extensively being at higher risk. studies in laboratory animals show that nnk is metabolized by three major routes : carbonyl reduction, pyridine oxidation, and -hydroxylation. carbonyl reduction produces 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol (nnal, 2) (scheme 1), which undergoes metabolic transformations similar to those of nnk, except for the formation of nnal - glucuronides (nnal - glucs), an important pathway of nnk and nnal detoxification. the sum of nnal and its glucuronides can be measured in urine as total nnal, which is an established biomarker of nnk exposure in humans. nnal can also be partially converted back to nnk ; however, the nnk - nnal equilibrium favors nnal in rodents, primates, and humans. the second process, pyridine - n - oxidation, is a minor metabolic pathway in humans and, therefore, is not expected to play an important role in the relative balance of metabolic activation and detoxification of nnk. the third major route, -hydroxylation, leads to the formation of dna methylating and pyridyloxobutylating intermediates, and thus represents metabolic activation of nnk and nnal (scheme 1). formation of dna adducts from the reactive pyridyloxobutyl metabolite has been well established ; some of these adducts have miscoding properties and can activate oncogenes. the major end products of the nnk and nnal -hydroxylation pathway are 4-oxo-4-(3-pyridyl)butanoic acid (keto acid, 3) and 4-hydroxy-4-(3-pyridyl)butanoic acid (hydroxy acid, 4) ; urinary excretion of these metabolites has been shown in rodents, primates, and humans. thus, the balance between urinary nnal - glucs, as a biomarker of nnk exposure and detoxification, and the sum of urinary 3 and 4, as a biomarker of nnk metabolic activation, could potentially provide a useful index for the relative efficiency of these major pathways in individual smokers. adapted with permission from ref (38). copyright 2008 american association for cancer research. the main obstacle to using 3 and 4 as biomarkers of nnk metabolic activation is nicotine in cigarette smoke, which also generates these metabolites and is present at more than 1,000-fold higher levels than nnk. therefore, in our previous study we developed a novel approach to specifically identify nnk - derived 3 and 4 by using deuterium - labeled nnk. in that study, we added [pyridine - d4]nnk ([d4]1) to a commercial cigarette, which originally contained significantly lower levels of nnk than regular brands, and then analyzed urine samples collected from individuals who smoked these cigarettes. after treating urine with nabh4 to convert 3 to 4 tandem mass spectrometry (lc - esi - ms / ms) to distinguish the [d4]1-derived urinary [pyridine - d4]hydroxy acid ([d4]4) from the corresponding unlabeled metabolite and demonstrated for the first time that nnk is metabolically activated in smokers. future application of our unique methodology can potentially provide important insights into the role of interindividual differences in nnk metabolic activation in cancer risk. however, the analytical procedure for the analysis of ([d4]4) in our original study of 20 smokers was not optimized for robust application in larger trials. therefore, our purpose in this study was to develop an improved lc - esi - ms / ms method for the quantitation of total [d4]4 in human urine. [pyridine - d4]nnk ([d4]1) is carcinogenic and mutagenic and should be handled with extreme care, using personal protective equipment in a well - ventilated hood at all times. compounds 3 and 4 were purchased from toronto research chemicals (toronto, on), and [pyridine - d4]ethyl nicotinate and [c6]ethyl nicotinate were purchased from cambridge isotope laboratories (tewksbury, ma) and moravek biochemicals (brea, ca), respectively. all aqueous solutions were prepared using h2o purified from a 0.22 m millipore system (billerica, ma). briefly, [pyridine - d4]ethyl nicotinate or [c6]ethyl nicotinate (0.75 mmol) was added to a suspension of nah (3.7 mmol, 60% dispersion in mineral oil) in 5 ml of refluxing benzene. after the addition of ethanol (0.5 ml), diethyl succinate (3.75 mmol) was added into the stirred refluxing mixture dropwise, and the reaction was allowed to take place for 45 min. the mixture was then cooled in an ice bath, and 0.5 ml of 5 m hcl was added slowly with constant stirring, which was continued for another 10 min after the addition was completed. the aqueous phase was extracted with benzene and, after discarding the organic layer, adjusted to ph 9 by the addition of nh4oh and extracted again with chloroform. the chloroform layer was then dried over na2so4 and concentrated under diminished pressure to obtain the crude diethyl -nicotinyl succinate as a brown oil. this crude product was heated under reflux in 2 ml of 5 m h2so4 for 36 h. after the solution was cooled to room temperature, naoh was added to adjust the ph to 45, and the precipitated crude [d4]3 or [c6]3 was collected for further purification by hplc using a linear gradient from 100% 15 mm nh4oac to 20% 15 mm nh4oac and 80% ch3cn over 50 min, at 0.7 ml / min. a luna c18 column (250 4.6 mm, 5 m particle size, phenomenex) was used, and the uv detector was set at 254 nm. the products were collected at 17 min, as determined by the retention time of unlabeled 3. the products were treated with nabh4 to produce [d4]4 and [c6]4, which were purified using the same hplc system and collected at 15 min, based on the retention time of unlabeled 4. the solvent in the collected hplc fractions was removed by rotary evaporation, and the products were dried overnight under vacuum yielding [d4]4 and [c6]4 [0.6 mg of each (11%) ]. co - injection on hplc of each product with 4 gave only one peak, and the purity of each was determined to be approximately 98%. ms analysis (20 ev) of each product in the positive esi mode further confirmed their identity : [d4]4, m / z 186 [m + h ] (relative intensity 52%) and m / z 168 (100%) ; and [c6]4, m / z 188 [m + h ] (63%) and m / z 170 (100%). briefly, 1.13 mg (6.10 mol) of [d4]4, synthesized as described above, was incubated in 1 ml of 3% (v / v) concentrated h2so4 in meoh at room temperature overnight. samples were then loaded onto 5 ml chemelut cartridges (agilent tech.), and the [d4]4 methyl ester was eluted with 25 ml of ch2cl2. after the removal of solvent, 100 l of 50 mg / ml dmap solution in toluene and 500 l of hexanoic anhydride were added, and the second esterification reaction was allowed to take place at 70 c for 20 min. after cooling to room temperature, 1.5 ml of hexane / etoac (90:10) was added, and the product was extracted thrice with 1 ml of 1 n hcl. the aqueous phase containing the product was neutralized (nahco3), and the ester was extracted with 3 5 ml hexane / etoac (90:10), concentrated, and purified by preparative hplc, yielding [d4]6 (27%) 95% pure, ms (in the positive esi mode) m / z 298 [m + h ] (15%), m / z 182 (100%), and m / z 122 (27%) ; h nmr (cdcl3, no tms added, 500 mhz) : 0.88 (3h, t, j = 7.0 hz, 6-ch3), 1.231.34 (4h, m, 4-ch2, 5-ch2), 1.61 (2h, m, 3-ch2), 2.122.29 (2h, m, 3-ch2), 2.312.40 (4h, m, 2-ch2, 2-ch2), 3.67 (3h, s, coo ch3), 5.82 (1h, dd, j = 8.2, 5.5 hz, 4-ch). the same method as that described for [d4]6 was used for the preparation of [c6]6 (36%), 95% pure, m / z 300 [m + h ] (5%), m / z 184 (100%), and m / z 124 (82%). [d4]6 and smokers urine samples analyzed here were collected from subjects recruited for a chemoprevention trial that will be described elsewhere. the study and the urine sample collection were approved by the university of minnesota institutional review board (study # 0712m22651). as part of the trial design, subjects were asked to stop smoking their usual cigarettes and switch to the study cigarettes to which [d4]1 was added. the cigarettes were prepared as previously described, and their use was approved by the us food and drug administration (ind 74037). subjects were asked to collect a 24-h urine sample after a 7-day period of smoking cigarettes containing [d4]1 and bring the sample to the tobacco research programs clinic at the university of minnesota ; these urine samples were analyzed here. study subjects kept urine at room temperature during the 24-h collection and delivered it to the clinic the next day. an experiment in which urine of a study subject was incubated overnight at 37 c showed no degradation of hydroxy acid. in the laboratory, subjects further followed the trial protocol, which will be described elsewhere along with data on additional biomarkers including creatinine. additional samples collected by the subjects in the study were not analyzed for this report. five microliters of 0.1 ng/l [c6]4 internal standard solution was added to 3 ml of urine, followed by 0.6 ml of 1 m naoh solution and 0.3 ml of basic nabh4 solution (7.2 mg nabh4 in 0.3 ml of 0.1 m naoh). the sample was mixed by vortexing and allowed to stand for at least 2 h at room temperature to convert all [d4]3 to [d4]4. excess nabh4 was destroyed by adding 1 m hcl dropwise, and the ph of the sample was adjusted to 6.57.5. the volume was reduced to 1 ml (speedvac), and the sample was applied to a 200 mg/3 ml strata - x cartridge (phenomenex) activated with 2 ml of meoh. the cartridge was washed with 1 ml of h2o (which was shown not to remove the analyte), and [d4]4 was eluted by applying another 5 ml of h2o to the cartridge. on the next day, 1 ml of freshly prepared 3% (v / v) concentrated h2so4 in meoh was added to the dry residue, followed by sonication and vortexing to completely dissolve the sample. the mixture was allowed to stand at room temperature for at least 2 h to convert [d4]4 to its methyl ester. then, 2 ml of 50 mg / ml nahco3 was added dropwise to adjust the ph to 7.08.0. the sample was loaded onto a 5 ml chemelut cartridge (agilent tech.), and the [d4]4 methyl ester was eluted with 2 8 ml of ch2cl2. the eluant was concentrated on a speedvac for 1.5 h, and 500 l of ch2cl2 was immediately added to the dry residue. this was applied to a ch2cl2-activated bondelut cartridge (agilent tech.), which was washed with 1 ml of ch2cl2 and 1 ml of ch2cl2/etoac (50:50) sequentially. the [d4]4 methyl ester was finally eluted with 2 ml of 100% etoac and dried by speedvac. immediately after drying, 10 l of dmap (50 mg / ml in toluene) and 50 l of hexanoic anhydride were added. after sonication and vortex mixing, the mixture was incubated at 70 c for 20 min, producing [d4]6. to extract the product into the aqueous phase, 0.5 ml of hexane / etoac (90:10) and 0.5 ml of 1 n hcl were added sequentially with thorough vortex mixing (30 s) after each addition. the mixture was centrifuged at 500 g for 2 min, and the aqueous phase containing the analyte was separated. this extraction was repeated once, and the aqueous phases from both extractions were combined and applied to an activated 60 mg oasis mcx cartridge (waters corp.), which was washed with 3 ml of 1 n hcl, 3 ml of meoh/1 n hcl (40:60), and 3 ml of h2o / meoh / nh4oh (80:15:5), sequentially. the hexanoate [d4]6 was then eluted with 10 ml of h2o / meoh / nh4oh (30:65:5) and dried overnight (speedvac). the residue was dissolved in 2 100 l of ch3cn, filtered on a spin - x centrifuge tube filter (0.45 m, corning life sciences), and transferred to a 300 l fused lc autosampler vial with insert. the sample was finally dried on a speedvac and kept frozen at 20 c until lc - esi - ms / ms analysis. the dried sample was redissolved in 12 l of h2o and analyzed on a tsq vantage system (thermo scientific) interfaced with an agilent 1100 capillary hplc system and an agilent 1100 micro autosampler. a zorbax eclipse pah column (150 0.5 mm, 3.5 m particle size) was maintained at 40 c throughout the separation. the chromatography was performed with a ch3cn and 15 mm nh4oac solvent system at a flow rate of 10 l / min. a linear gradient started with 60% aqueous phase and 40% ch3cn and changed to 44.3% aqueous phase and 55.7% ch3cn over 22 min. the gradient was then ramped to 35% aqueous phase and 65% ch3cn over 3 min, and returned to the initial condition in 2 min. the mass spectrometer was operated in the positive ion electrospray mode with selective reaction monitoring (srm). the transitions m / z 298 [m + h ] m / z 122 [m(ch3(ch2)4coo + cooch3 + h) ] and m / z 298 [m + h ] m / z 182 [m ch3(ch2)4coo ] were used for [d4]6, and the corresponding transitions m / z 300 m / z 124 and m / z 300 m / z 184 were used for [c6]6. the collision energy (c.e.) was 30 ev for m / z 298 m / z 122 and m / z 300 m / z 124 transitions, and 20 ev for m / z 298 m / z 182 and m / z 300 m / z 184 transitions. the heated capillary temperature was 285 c, and the spray voltage was 3000 mv. the purpose of this study was to develop a sensitive and reproducible assay for the analysis of [d4]4 in the urine of smokers who smoked cigarettes containing [d4]1. overall, our method includes the reduction of urinary [d4]3 to [d4]4, followed by conversion of the highly polar [d4]4 to a stable methyl ester hexanoate ([d4]6, figure 1), which can be further purified and analyzed by lc - esi - ms / ms with excellent separation efficiency and ionization selectivity. carbons that covalently bond to hydrogens are labeled to assign nmr peaks for 6. the lc - esi - ms / ms conditions were developed using standard aqueous solutions containing [d4]6 and [c6]6. the product ion spectra of [d4]6 were obtained by collision - induced dissociation of the ion at m / z 298 [m + h ] as shown in figure 2. we examined a range of collision energy values to investigate the fragmentation pattern. the protonated molecular ion (m / z 298) that was observed at 10 ev (figure 2a) decreased at 20 ev (figure 2b) and was barely observed at 30 ev (figure 2c). a base peak with m / z 182 [m ch3(ch2)4coo ] was observed at 20 ev and a base peak with m / z 122 [m ch3(ch2)4coo cooch3 h ] was observed at 30 ev. the transition m / z 298 m / z 182 (20 ev) was chosen for quantitation because of the overall better peak shape and sensitivity both in nonsmokers urine samples to which [d4]4 was added and in smokers urine. the transition m / z 298 m / z 122 (30 ev) was monitored to confirm the identity of the analyte in urine samples. the corresponding transitions for [c6]6 are m / z 300 m / z 184 and m / z 300 m / z 124. product scan of [d4]6 at different collision energy values used in the method development : a, 10 ev ; b, 20 ev ; and c, 30 ev. the calibration curve for the quantitation of [d4]6 was built by preparing a series of standard mixes containing varying ratios of [d4]6 to [c6]6 (internal standard). as can be seen from figure 3, which shows the calibration curve constructed from five standard mixes (six measurements performed for each on different days), excellent linearity was observed for the analyte in the range of 0.84 fmol 84 fmol [d4]6. calibration curve for the quantitation of [d4]6 by lc - esi - ms / ms. the amount of [c6]6 (internal standard) was maintained at 51.1 pmol on column, while the amount of [d4]6 ranged from 0.84 fmol to 84 fmol on column. the y axis plots the peak area ratio from the corresponding transitions, m / z 298 m / z 182 and m / z 300 m / z 184. each data point represents the average of six measurements performed on different days with the error bars indicating standard deviation. to determine precision, accuracy, recovery, and limit of detection of the assay, we used a nonsmoker s urine to which a known amount of [d4]4 was added. a typical lc - esi - ms / ms trace obtained in this analysis is shown in figure 4a. the intraday precision of the assay was assessed by analyzing six aliquots of a nonsmoker s urine mixed with [d4]4 at 360 fmol / ml urine. the measured mean level of [d4]4 was 342 8 (sd) fmol / ml (coefficient of variation (cv) = 2.1%). the interday precision was determined by analyzing positive controls, aliquots of a nonsmoker s urine mixed with [d4]4 at 225 fmol / ml urine, with six sets of assays performed during method characterization. the concentration of [d4]4 in positive controls averaged 226 10 (sd) fmol / ml (cv = 4.6%). assay accuracy was determined by analyzing a nonsmoker s urine to which increasing amounts of [d4]4 were added, ranging from 11.3 fmol / ml to 1.12 pmol / ml. the accuracy of the measurements ranged from 99.0% to 115.8%. as demonstrated in figure 5, the added and measured levels of [d4]4 were highly correlated (r = 0.9983). this experiment was performed at the method development step and was further included with each set of smokers urine samples analyzed later in the study. for the 20 sets of accuracy analyses performed in total, the average accuracy was 100.1% 14.7% (n = 100), and the average recovery of the [c6]4 internal standard was 32.1% 27.6% additional accuracy experiments with each sample us to determine the precision of the assay at [d4]4 levels that are lower than those used in the initial precision test and in the positive controls. at 11.3 fmol / ml [d4]4 addition, which is below the lowest level measured in smokers urine samples, the coefficient of variation was 14.2%. at the next [d4]4 addition level, 56.6 fmol / ml urine, the coefficient of variation was 5.8%, similar to that determined for the positive controls. at a 3:1 signal - to - noise ratio, the limit of detection (lod) was 10 fmol / ml in nonsmokers urine to which [d4]4 was added. the limit of quantitation (loq) at a 5:1 signal - to - noise ratio was 25 fmol / ml and was established based on smokers urine analyzed by this method. typical lc - esi - ms / ms chromatograms obtained upon analysis of a, a nonsmoker s urine (3 ml) to which 168 fmol of [d4]4 was added, and b, urine of a study subject who smoked cigarettes containing [d4]1. relationship between added and measured levels of [d4]4 in a nonsmoker s urine : method accuracy analysis. the method was applied to the analysis of [d4]4 in the urine of 87 smokers who smoked at least 10 [d4]1-containing cigarettes per day for at least 1 week. during sample preparation, a negative control, a positive control, and the accuracy test samples, all nonsmoker s urine with or without [d4]4, recovery of [c6]4 was similar in nonsmokers and smokers urine, indicating that the high levels of unlabeled 4 that are present in smokers urine do not interfere with the analyses. small peaks with retention time and m / z values matching [d4]4 were occasionally observed in the nonsmoker s negative control samples and also in a pooled urine sample from smokers who did not smoke [d4]1 ; however, the level of this background interference in all cases was below lod (1/3 lod). in smokers who smoked [d4]1-containing cigarettes, urinary [d4]4 concentrations ranged from 25 fmol / ml to 390 fmol / ml urine, averaging 130 fmol / ml. results for individual urine samples are summarized in supporting information, table s1. a typical trace from an analysis of a smoker s the distribution of the measured [d4]4 concentrations in these urine samples is illustrated in figure 6. histogram demonstrating the distribution of [d4]4 levels in 87 urine samples from study subjects who smoked cigarettes containing [d4]1 for 1 week. for the levels in individual samples evaluation of the metabolic activation of the tobacco - specific lung carcinogen nnk in individual smokers may potentially provide important insights for understanding interindividual variation in the risk of developing lung cancer due to exposure to tobacco products. the addition of [d4]1 to special study cigarettes followed by the measurement of urinary total [d4]4 in people who smoke these cigarettes is a promising novel approach that can be used for this purpose. this approach requires a reliable and sensitive methodology for the measurement of the deuterium - labeled urinary biomarkers. in this study, we developed a sensitive and highly reproducible lc - esi - ms / ms method for the analysis of [d4]4 in human urine. the method is characterized by excellent sensitivity, precision, accuracy, and recovery. the original method for the analysis of [d4]4 that was used in our previous study included the conversion of the acid to its methyl ester to enable a purification step that can not be applied without the esterification ; this was followed by hydrolysis of the ester back to [d4]4, which was analyzed by lc - esi - ms / ms. the resulting chromatographic traces were characterized by relatively high background noise and variable recovery of the analyte. in this study, we modified our protocol by including the second derivatization step after the conversion of [d4]4 to its methyl ester, thus producing [d4]6, a stable methyl ester hexanoate. this additional esterification decreases the polarity of the resulting product, allowing for more efficient removal of the multitude of polar interfering compounds present in the urine matrix, which ultimately results in better chromatography. furthermore, the ionization efficiency in the esi source is improved due to both decreased compound polarity and reduced matrix suppression. the second esterification also increases the molecular weight of the analyte by 98 amu, which increases the selectivity in the ms detection since most interfering compounds from the urine matrix have lower molecular weights. another important modification is that in the new protocol, we applied the isotope dilution approach by using [c6]4 as the internal standard, instead of 5-methylhydroxy acid (5, figure 1) which was used in our previous assay. this approach ensures more accurate quantitation of the analyte as compared to the use of a surrogate internal standard. as shown in figure 4, the analysis of both the nonsmoker s urine to which [d4]4 was added and the urine of a smoker who switched to [d4]1-containing cigarettes, produced clean chromatograms with well - resolved peaks for [d4]6 and [c6]6. the concentration range of urinary total [d4]4 obtained in the current study for the 87 subjects who smoked [d4]1-containing cigarettes for 1 week is lower than that reported previously. thus, in our previous study, the levels of urinary total [d4]4 ranged from 0.43 to 8.7 pmol / ml urine, averaging 2.8 pmol / ml in 20 smokers who smoked cigarettes to which [d4]1 was added at the same level as in the present study. this could be due to differences in the analytical procedures and internal standards used in the two studies, as well as the differences in the brand of study cigarettes used (marlboro virginia blend in this study vs quest cigarettes in the previous study), which may have affected the resulting smoking rates (21 vs 28 cigarettes per day in the current and the previous study, respectively), and other potential differences between the two studies and/or subject characteristics. we applied our new method to reanalyze a small set of urine samples that were available from the previous study and stored at 20 c since its completion. we selected samples that, according to our previous analyses, contained high levels of [d4]4 : 3.5, 4.2, and 8.8 pmol / ml urine. reanalysis of these samples by the new method produced 1.4, 1.7, and 3.1 pmol / ml [d4]4, respectively. while there are discrepancies in urinary [d4]4 levels measured by the two methods, which could be due to a combination of the method differences and the prolonged storage of the samples from the previous study (at least 6 years), the levels determined by the new method in the urine collected in the previous study are still higher than those measured in the current study. importantly, the method presented here has been thoroughly characterized and shows a broad dynamic range of accurate [d4]4 quantification, making it applicable in future studies. nnk intake in smokers, nonsmokers exposed to secondhand smoke, and in smokeless tobacco users has been extensively analyzed by measuring urinary total nnal, the end - product of the nnk carbonyl reduction pathway. it was also shown that pyridine - n - oxidation is only a minor metabolic pathway in humans. in contrast, the information on the extent of nnk -hydroxylation in humans is extremely limited. it has been established that some of the adducts produced by pyridyloxobutylation of dna or globin release 4-hydroxy-1-(3-pyridyl)-1-butanone (hpb). while several studies detected and quantified hpb - releasing dna and globin adducts in humans, it is not clear how much of the total measured level of these adducts is derived from nnk versus the related tobacco carcinogen n-nitrosonornicotine, which shares common metabolic pathways with nnk and leads to the formation of the same adducts. moreover, it is not clear how dna or globin adduct levels can be compared to the urinary products of nnk detoxification, in order to estimate the balance between the two pathways in the same individual. therefore, availability of a specific urinary biomarker of nnk metabolic activation offers practical advantages for investigation of the relative extent of nnk metabolic activation and detoxification in humans. our previous study developed a unique approach that provided such a biomarker, and our current report describes a sensitive and reproducible assay for the measurement of this biomarker in future studies. a limitation of this study is that we did not quantify [d4]3 and [d4]4 separately. however, the sum of the keto and hydroxy acids is an informative aggregate biomarker for the quantitation of the total efficiency of the nnk and nnal -hydroxylation pathways, and is expected to be used in future large - scale studies. the separate analysis of [d4]3 and [d4]4 can be easily achieved by measuring [d4]4 in the same urine sample without the nabh4 reduction and then subtracting the measured amount from the total [d4]4 determined by the method described here. it is also important to note that, because the levels of natural nnk in regular cigarettes are higher than the levels of [d4]1 added to study cigarettes, the amount of the nnk - derived hydroxy acid in the urine of regular smokers may be higher than the levels of [d4]4 measured in people who smoke cigarettes containing [d4]1. however, the ultimate goal of the [d4]1 approach is not to provide absolute quantification of nnk metabolic activation but to compare the relative ratio of biomarkers reflecting metabolic activation and detoxification pathways within an individual. in summary, we have developed a sensitive and robust assay for the quantitation of total [d4]4 in smokers urine. the assay incorporates a two - step derivatization procedure and lc - esi - ms / ms analysis to achieve excellent precision, accuracy, recovery, and limit of detection. analysis of smokers urine indicated that levels of [d4]4 as low as 26 fmol / ml can be quantified. the results of this work further confirm that [d4]4 could be used as the urinary biomarker to study nnk metabolic activation. the broad dynamic range of this assay will be very useful in large studies, especially those that may deal with potentially lower efficiency of nnk metabolic activation in smokers due to polymorphisms in nnk metabolizing genes or in chemoprevention trials. | 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (nnk, 1) is a potent tobacco - specific lung carcinogen believed to play a key role in the development of lung cancer in smokers. metabolic activation of nnk to dna damaging reactive intermediates proceeds via -hydroxylation pathways. the end products of these pathways are excreted in the urine of smokers as 4-oxo-4-(3-pyridyl)butanoic acid (keto acid, 3) and 4-hydroxy-4-(3-pyridyl)butanoic acid (hydroxy acid, 4). the sum of these biomarkers (after nabh4 treatment), referred to as total hydroxy acid, could potentially be used to measure the extent of nnk metabolic activation in smokers. however, the same metabolites are formed from nicotine ; therefore, there is a need to distinguish the nnk- and nicotine - derived keto and hydroxy acid in smokers urine. we previously developed a unique methodology based on the use of [pyridine - d4]nnk ([d4]1), which metabolizes to the correspondingly labeled biomarkers. in this study, we developed a sensitive and reproducible assay for the detection and quantitation of total [pyridine - d4]hydroxy acid ([d4]4) in human urine. a two - step derivatization approach was used to convert [d4]4 to [pyridine - d4]methyl 4-hexanoyl-4-(3-pyridyl)butanoate ([d4]6), and an lc - esi - ms / ms method was developed for the analysis of this derivative with excellent sensitivity, accuracy, and precision. the robustness and reproducibility of the assay was further confirmed by its application for the analysis of urine samples from 87 smokers who smoked [d4]1-containing cigarettes for 1 week. the measured level averaged 130 fmol / ml urine. the developed assay can be used in future studies that may require evaluation of the relative efficiency of nnk metabolic activation in humans. |
diabetes is a growing epidemic affecting more than 346 million people worldwide (13). the metabolic abnormalities associated with diabetes lead to altered platelet, endothelial cell, and smooth muscle cell function (47). together, these changes promote systemic atherosclerosis and lead to the traditional micro- and macrovascular complications commonly observed in diabetes. morbidity and mortality in the population with diabetes are largely due to complications of atherosclerosis. furthermore, vascular disease in one arterial bed increases the risk for concomitant vascular disease in other arterial territories (8,9). vascular disease in the peripheral arteries presents a significant burden to health care expenditure and represents a major cause of myocardial infarction, stroke, and limb morbidity (1012). in addition, both diabetes and disease in the peripheral vasculature are associated with increased long - term mortality (1316). however, the peripheral neuropathy associated with diabetes masks symptoms of atherosclerosis, making the true prevalence of disease in the peripheral arteries difficult to ascertain without additional testing and presenting a challenge to early identification and prevention of disease progression (12,17). given the known clustering of traditional cardiovascular risk factors and coronary heart disease with diabetes, this study sought to investigate the independent association between diabetes and the presence and severity of vascular disease in the peripheral arteries. while several studies have evaluated the association between diabetes and lower extremity peripheral artery disease (pad), few studies have explored carotid artery stenosis (cas) or abdominal aortic aneurysms (aaa) in populations with and without diabetes, and no study to date has evaluated the association between diabetes and all three major vascular disease subtypes in a large unselected population. in this study, we aim to evaluate the association between diabetes and the presence and severity of pad, cas, and aaa in more than 3 million subjects. a total of 3,696,778 primarily self - referred people participated in the life line screening (lls ; independence, ohio) vascular survey at more than 20,000 screening sites, representing all 50 states and broad geographical and socioeconomic characteristics, between 2003 and 2008. as noted previously, the prevalence of different cardiovascular risk factors in this population database is similar to that of the general u.s. census data linked by the subject s zip code, we categorized individuals based on income and education and found fairly good representation across different levels of socioeconomic status (19). a variety of costs was incurred by the individuals based on the package of tests purchased. all lls sites use identical protocols and are subject to a quality control program (18). in accord with the office for human research protections, this study is exempt from review by an institutional review board (20). participants completed a two - page questionnaire, providing their demographic information, height and weight, and medical and surgical history, including cardiovascular risk factors, physical activity, nutrition, and family history of cardiovascular disease. obesity was identified as bmi 30 kg / m, and tobacco use was defined as use of at least 100 cigarettes during their lifetime and currently smoking (current) or not currently smoking (former). hypertension was defined as systolic blood pressure of 140 mmhg in either upper extremity or self - reported physician diagnosis or medication use. history of coronary artery disease was defined as having a history of myocardial infarction, percutaneous coronary intervention, or coronary artery bypass graft. presence of pad was assessed with the bilateral ankle - brachial pressure index (abi), defined as systolic blood pressure in the left and right ankle (measured in the posterior tibial artery or dorsalis pedis artery if a posterior tibial artery doppler signal was inaudible) divided by the highest of the two systolic blood pressures in the left or right arm (brachial artery). in the overall population, 5.6% (n = 207,818) pad was defined as either left or right abi 0.9 or history of peripheral arterial intervention. pad was defined as symptomatic if participants had a prior revascularization procedure or answered yes to, do you have aching or pain in the legs that is worse with walking or running or degree of pad was categorized as normal (abi 0.911.4), mild (abi 0.810.90), moderate (abi 0.610.80), severe (abi 0.60), or unable to compress artery (abi > 1.4) (17). presence of cas was assessed using duplex ultrasound, and in the population of interest, 2.9% (n = 107,318) did not have carotid ultrasound results recorded. symptomatic cas was defined as participants with a prior stroke, transient ischemic attack, or operation on the carotid arteries. the degree of cas was categorized as moderate for 5069% stenosis or severe for 70% stenosis. all participants had abdominal aortic ultrasound results recorded, and aaa was defined as presence of an infrarenal abdominal aortic diameter of 3 cm on ultrasound (the greater of the anteroposterior or transverse measurement was used) or prior surgical or special procedure to repair an aaa. each individual was assigned a unique identifier, and the investigators had access only to de - identified data. baseline characteristics and the presence of pad, cas, and aaa between participants with and without diabetes were compared using the test for proportions and a two - sided independent sample t test for continuous variables. odds ratios (ors) and 95% cis were assessed using a logistic regression model to examine the strength of association between diabetes and pad, cas, and aaa. in addition to unadjusted or, model 1 adjusted for age, sex, and race, whereas model 2 adjusted for age, sex, race, bmi, hypertension, hyperlipidemia, tobacco use, coronary artery disease, and stroke or transient ischemic attack. in sex - specific analysis, the strength of association between diabetes and pad, cas, and aaa was evaluated using the logistic regression model in model 2. the wald test was used for testing interaction between the presence of diabetes and sex for the presence of each of the vascular disease subtypes. chicago, il), sas (version 9.12 ; sas institute inc., cary, nc), and the r package (r development core team ; available from http://www.r-project.org/). a total of 3,696,778 primarily self - referred people participated in the life line screening (lls ; independence, ohio) vascular survey at more than 20,000 screening sites, representing all 50 states and broad geographical and socioeconomic characteristics, between 2003 and 2008. as noted previously, the prevalence of different cardiovascular risk factors in this population database is similar to that of the general u.s. census data linked by the subject s zip code, we categorized individuals based on income and education and found fairly good representation across different levels of socioeconomic status (19). a variety of costs was incurred by the individuals based on the package of tests purchased. all lls sites use identical protocols and are subject to a quality control program (18). in accord with the office for human research protections, this study is exempt from review by an institutional review board (20). participants completed a two - page questionnaire, providing their demographic information, height and weight, and medical and surgical history, including cardiovascular risk factors, physical activity, nutrition, and family history of cardiovascular disease. obesity was identified as bmi 30 kg / m, and tobacco use was defined as use of at least 100 cigarettes during their lifetime and currently smoking (current) or not currently smoking (former). hypertension was defined as systolic blood pressure of 140 mmhg in either upper extremity or self - reported physician diagnosis or medication use. history of coronary artery disease was defined as having a history of myocardial infarction, percutaneous coronary intervention, or coronary artery bypass graft. presence of pad was assessed with the bilateral ankle - brachial pressure index (abi), defined as systolic blood pressure in the left and right ankle (measured in the posterior tibial artery or dorsalis pedis artery if a posterior tibial artery doppler signal was inaudible) divided by the highest of the two systolic blood pressures in the left or right arm (brachial artery). in the overall population, 5.6% (n = 207,818) pad was defined as either left or right abi 0.9 or history of peripheral arterial intervention. pad was defined as symptomatic if participants had a prior revascularization procedure or answered yes to, do you have aching or pain in the legs that is worse with walking or running or degree of pad was categorized as normal (abi 0.911.4), mild (abi 0.810.90), moderate (abi 0.610.80), severe (abi 0.60), or unable to compress artery (abi > 1.4) (17). presence of cas was assessed using duplex ultrasound, and in the population of interest, 2.9% (n = 107,318) did not have carotid ultrasound results recorded. symptomatic cas was defined as participants with a prior stroke, transient ischemic attack, or operation on the carotid arteries. the degree of cas was categorized as moderate for 5069% stenosis or severe for 70% stenosis. all participants had abdominal aortic ultrasound results recorded, and aaa was defined as presence of an infrarenal abdominal aortic diameter of 3 cm on ultrasound (the greater of the anteroposterior or transverse measurement was used) or prior surgical or special procedure to repair an aaa. each individual was assigned a unique identifier, and the investigators had access only to de - identified data. baseline characteristics and the presence of pad, cas, and aaa between participants with and without diabetes were compared using the test for proportions and a two - sided independent sample t test for continuous variables. odds ratios (ors) and 95% cis were assessed using a logistic regression model to examine the strength of association between diabetes and pad, cas, and aaa. in addition to unadjusted or, model 1 adjusted for age, sex, and race, whereas model 2 adjusted for age, sex, race, bmi, hypertension, hyperlipidemia, tobacco use, coronary artery disease, and stroke or transient ischemic attack. in sex - specific analysis, the strength of association between diabetes and pad, cas, and aaa was evaluated using the logistic regression model in model 2. the wald test was used for testing interaction between the presence of diabetes and sex for the presence of each of the vascular disease subtypes. chicago, il), sas (version 9.12 ; sas institute inc., cary, nc), and the r package (r development core team ; available from http://www.r-project.org/). consistent with prior observations, participants with diabetes were older, more frequently male, less frequently white, and more likely to have other cardiovascular risk factors. subjects with vascular disease had a higher prevalence of risk factors than subjects without vascular disease. subjects with aaa were more likely to be men and had a higher prevalence of heart disease and stroke than subjects with pad or cas (supplementary table 1). among the 3,696,778 participants in the study, 422,501 participants had any vascular disease ; 233,958 participants had pad, 193,734 participants had cas, and 73,443 participants had aaa. participants with diabetes had a higher prevalence of any vascular disease (unadjusted or 1.98 [95% ci 1.962.00 ] ; p 5-cm - diameter aneurysm). proportion of survey participants with lower extremity pad (a), cas (b), and aaa (c) by disease severity in the population with and without diabetes (dm). 2 shows the prevalence of vascular disease stratified by symptoms in participants with and without diabetes. participants with diabetes were more likely to have both asymptomatic disease and symptomatic disease. to minimize recall bias in our analysis, we excluded subjects with symptomatic disease. results were not greatly altered, with increased odds of pad (adjusted or 1.54 [95% ci 1.501.57 ] ; p 5-cm - diameter aneurysm). proportion of survey participants with lower extremity pad (a), cas (b), and aaa (c) by disease severity in the population with and without diabetes (dm). 2 shows the prevalence of vascular disease stratified by symptoms in participants with and without diabetes. participants with diabetes were more likely to have both asymptomatic disease and symptomatic disease. to minimize recall bias in our analysis, we excluded subjects with symptomatic disease. results were not greatly altered, with increased odds of pad (adjusted or 1.54 [95% ci 1.501.57 ] ; p 2 million). one report of 9,342 women did demonstrate a six - times lower prevalence of aaa in women than men but did not comment on the prevalence of aaa by diabetes status (31). in addition, one meta - analysis of more than 15,000 patients from 18 studies, the majority of which consisted of more than 80% men, demonstrated that female sex was not associated with aneurysm growth ; however, it did not comment on the association between female sex and the prevalence of aaa (32). the underlying mechanism for the sex disparities noted in the prevalence of aaa, and particularly in subjects with diabetes, needs further elucidation. there are several limitations to this study, including those inherent to a retrospective observational study design. first, participants were provided access to the lls measures for a fee ; therefore the cohort may underrepresent people from lower socioeconomic backgrounds. second, the diagnosis of diabetes was based on participant self - report and was not verified by medical records. nonetheless, we found that the prevalence of diabetes was 10.8%, which is similar to the prevalence of diabetes noted in more representative populations (e.g., nhanes [9.7% ] and 2013 american heart association heart disease and stroke statistics [11.8% ]). third, while abi was measured during pad screening in this survey, the toe brachial pressure index could be used to establish the diagnosis of pad in people in whom pad is clinically suspected, but abi tests are unreliable because of noncompressible vessels, such as in people with long - standing diabetes or advanced age. however, this population comprises only 1.2% of the total cohort with available abi data and is therefore unlikely to have a significant effect on the differences detected. in addition, in this study, abi was measured using the posterior tibial artery ; the dorsalis pedis artery was used only when the posterior tibial artery was inaudible. the highest of the dorsalis pedis or posterior tibial artery pressures at the ankle traditionally is used to form the calculation (17). however, a recent report compared this traditional method with an alternative method using the lower of the two ankle artery pressures, and both methods had similar diagnostic and predictive accuracy for all - cause and cardiovascular mortality, suggesting the utility of the alternate method in identifying a clinically meaningful population with pad (33). fourth, severe pad is defined in this study as abi 0.6, whereas some definitions use abi 0.4 to define severe pad. we did evaluate the population with abi < 0.4 and demonstrated similar results (adjusted or 2.23 [95% ci 2.072.41 ] ; p < 0.001). finally, while a small percentage (7.5%) of individuals did not have abi calculated, did not receive carotid ultrasound screenings, or both, subjects excluded because of incomplete data were similar to the subjects included in the final analyses. despite these limitations, this is the largest evaluation of the relationship between vascular disease in the peripheral arteries and diabetes, as well as the only study to examine all three major vascular subtypes in one cohort. in a large contemporary survey, after adjustment of demographics and traditional risk factors, the presence of diabetes is associated with higher odds of pad and cas but lower odds of aaa. future studies exploring this difference in vascular subtype and assessing the risks versus benefits of screening for pad and cas in asymptomatic people with diabetes are needed. there are several limitations to this study, including those inherent to a retrospective observational study design. first, participants were provided access to the lls measures for a fee ; therefore the cohort may underrepresent people from lower socioeconomic backgrounds. second, the diagnosis of diabetes was based on participant self - report and was not verified by medical records. nonetheless, we found that the prevalence of diabetes was 10.8%, which is similar to the prevalence of diabetes noted in more representative populations (e.g., nhanes [9.7% ] and 2013 american heart association heart disease and stroke statistics [11.8% ]). third, while abi was measured during pad screening in this survey, the toe brachial pressure index could be used to establish the diagnosis of pad in people in whom pad is clinically suspected, but abi tests are unreliable because of noncompressible vessels, such as in people with long - standing diabetes or advanced age. however, this population comprises only 1.2% of the total cohort with available abi data and is therefore unlikely to have a significant effect on the differences detected. in addition, in this study, abi was measured using the posterior tibial artery ; the dorsalis pedis artery was used only when the posterior tibial artery was inaudible. the highest of the dorsalis pedis or posterior tibial artery pressures at the ankle traditionally is used to form the calculation (17). however, a recent report compared this traditional method with an alternative method using the lower of the two ankle artery pressures, and both methods had similar diagnostic and predictive accuracy for all - cause and cardiovascular mortality, suggesting the utility of the alternate method in identifying a clinically meaningful population with pad (33). fourth, severe pad is defined in this study as abi 0.6, whereas some definitions use abi 0.4 to define severe pad. we did evaluate the population with abi < 0.4 and demonstrated similar results (adjusted or 2.23 [95% ci 2.072.41 ] ; p < 0.001). finally, while a small percentage (7.5%) of individuals did not have abi calculated, did not receive carotid ultrasound screenings, or both, subjects excluded because of incomplete data were similar to the subjects included in the final analyses. despite these limitations, this is the largest evaluation of the relationship between vascular disease in the peripheral arteries and diabetes, as well as the only study to examine all three major vascular subtypes in one cohort. in a large contemporary survey, after adjustment of demographics and traditional risk factors, the presence of diabetes is associated with higher odds of pad and cas but lower odds of aaa. future studies exploring this difference in vascular subtype and assessing the risks versus benefits of screening for pad and cas in asymptomatic people with diabetes are needed. | objectivethe aim of this study was to investigate the relationship between diabetes and different phenotypes of peripheral vascular disease (lower extremity peripheral artery disease [pad ], carotid artery stenosis [cas ], and abdominal aortic aneurysm [aaa]).research design and methodsprevalence of vascular disease was evaluated in 3,696,778 participants of the life line screening survey between 2003 and 2008. pad was defined as ankle - brachial pressure index < 0.90 or prior revascularization, cas as 50% stenosis or prior revascularization, and aaa as infrarenal aortic diameter 3 cm or prior repair. odds ratios (ors) and 95% cis were assessed using logistic regression modeling.resultsdiabetes mellitus was present in 10.8% of participants (n = 399,884). prevalence of pad, cas, and aaa was significantly higher (p < 0.0001) in participants with compared with those without diabetes. after multivariate adjustment for baseline demographics and clinical risk factors, a significant interaction existed between diabetes and vascular disease phenotype (p < 0.0001). diabetes was associated with increased odds of pad (or 1.42 [95% ci 1.411.4 ] ; p < 0.0001) and cas (1.45 [1.431.47 ] ; p < 0.0001) but decreased odds of aaa (0.86 [0.840.88 ] ; p < 0.0001). the strength of association increased with increasing severity of disease in each vascular phenotype, and this association persisted in the population with asymptomatic vascular disease.conclusionsin a large population - based study, the association between diabetes and vascular disease differed according to vascular phenotype. future studies exploring the mechanism for these vascular - specific differences are needed. |
nonunion of a fracture can pose a significant challenge in terms of skeletal stability, soft tissue biomechanics and potential limb loss. they most commonly occur as a consequence of infection, mal - alignment, metabolic and endocrine abnormalities. however, in otherwise healthy young individuals, such etiologies are rare and alternative pathological factors should be considered. herein, we present the first reported and successfully treated case of tibal fracture nonunion as the result of posterior tibial artery (pta) pseudoaneurysm. a 20-year - old man with no past medical history presented to the emergency department with non - displaced and closed transverse fracture of the left mid - tibial shaft and an intact fibula induced by a tackle during a football match. on examination, he had no neurovascular deficit and all crural pulses were palpable. his fracture was treated conservatively with a non - weight bearing above knee plaster cast later replaced by a below knee cast for a total period of 6 months. upon examination during his attendance to the facture clinic, the subsequent magnetic resonance imagining (mri) confirmed a nonunion of the fracture along with an ovoid 2.7 cm posterior compartment vascularized mass causing bowing of the interosseous septum with no evidence of avascularity of the bony margins (fig. 1). an endovascular approach was adopted, and the pseudoaneurysm was injected with 2 ml of thrombin, filled with multiple coils and deployment of an angiography balloon (in the sac) (4 mm 6 cm) for 7 min (fig. 2). this resulted in complete cessation of the pseudoaneurysm with normal flow in the pta (fig. follow - up x - ray (6 months) demonstrated complete union of the fracture site with no associated complications. figure 1:mri images demonstrating the site, size and the origin of the pta pseudoaneurysm. figure 2:angiographic image, demonstrating the site of the nonunion, coil insertion to the pseudoaneurysm and extravasated contrast. mri images demonstrating the site, size and the origin of the pta pseudoaneurysm. angiographic image, demonstrating the site of the nonunion, coil insertion to the pseudoaneurysm and extravasated contrast. pseudoaneurysms of the pta are rare, and they mainly occur following sudden acceleration and/or deceleration type injury, open fractures and, in few cases, can be iatrogenic (manipulation of fracture, surgery and ilizarov k - wire) [2, 3 ]. currently, no report in the literature suggests a single isolated and close fracture of tibial bone to be responsible for pseudoaneurysms of pta. they are mainly asymptomatic and present as a pulsatile lump but in their deeper anatomical course could result in tibial nerve compression causing paresthesia, neuralgia and weakness of the foot and toe muscles. in 39% of reported series, they present with signs and symptoms of lower limb ischemia following pseudoaneurysms thrombosis and/or distal embolization [4, 5 ]., the patient did not exhibit any neurovascular deficit, and it was an incidental finding following investigations for the tibial fracture nonunion. furthermore, fracture nonunion in a healthy young individual without any risk factor is rare and should raise suspicions about alternative and infrequent pathologies. the management of pseudoaneurysms of pta is varied, and they depend on the individual 's symptomatology and the subsequent course of the pseudoaneurysm. currently, there is no consensus on their overall management ; therefore, indications for their open versus endovascular repair are subjected to various debates. open repair (ligation and/or excision and interposition vein grafting) in deep anatomical areas may subject the patient to extensive dissection, longer operative time and higher incidences of morbidity (motor and sensory nerve damage, prolonged recovery, deep vein thrombosis). endovascular repair is another acceptable option, but this approach has its own limitations. the deployment of any type stent for exclusion of pseudoaneurysm from the main artery in the infra popliteal region is known to possess low patency and thrombotic incidences. the use of thrombin, coils and glue remains another alternative, but this mainly depends on the pseudoaneurysm neck size, as wider necks fail to contain the above and can result in failure of the procedure and thrombosis of the remaining artery. overall, the approach should be tailored according to the patient 's arterial status and features of the pseudoaneurysm. to the best of our knowledge, deployment of angiography balloon (as an occlusive technique) in addition to thrombin and coil for the exclusion of pta pseudoaneurysm has not been reported in the literature. the use of this novel technique could be beneficial in exclusion of wider neck pseudoaneurysms and limitations of the damage to the main vessel as reported in the current case report. in the reported case, the individual did not exhibit any signs and symptoms of pseudoaneurysms and similarly did not raise any suspicion of such pathology till nonunion was detected. once suspected, the best investigative modality is computed tomography angiography (cta) followed by magnetic resonance imaging (mri). both of these modalities have sensitivity and specificity of more than 90% for detection of isolated entities. in conclusion, nonunion of fractures in young healthy individuals should raise the suspicion of pseudoaneurysms, despite the absence of clinical signs and symptoms of vascular disruptions. clinicians should have low threshold for cta and/or mri in such circumstances, and the surgical method of repair (open versus endovascular) should be in accordance with the patient 's best interest. written informed consent was obtained from the patient for publication of this case report and accompanying images. | pseudoaneurysm of the posterior tibial artery (pta) is uncommon, and they mainly occur following high - velocity trauma, open fractures and can be iatrogenic in nature. to the best of our knowledge, this is the first reported and successfully treated case of pta pseudoaneurysm identified as a consequence of tibia fracture nonunion in an otherwise healthy young individual 6 months following the original incident with a novel intraoperative technique. |
patients were selected for inclusion in this study from different cohorts tested on either family - based wes, targeted resequencing or high - resolution melting analysis (table 1). clinical evaluation was performed by at least one expert clinical geneticist. written informed consent for inclusion in the study was obtained for all patients and consent for the publication of photographs was obtained for patients 1, 2, 4, 5, 6 and 8. pcr was performed using gotaq polymerase (promega, madison, wi, usa) on dna from peripheral blood and on cdna from lymphoblastoid cells, using standard protocol. capillary electrophoresis sequencing (abi 3130 genetic analyzer ; applied biosystems, carlsbad, ca, usa) was performed using the abi bigdye terminator v3.1 cycle sequencing kit (applied biosystems, carlsbad, ca, usa), following standard protocol. data was analysed in clc dna workbench (clc bio, aarhus, denmark). patient 1 was detected in a family - based wes study (unpublished data (ch, gv, filip van nieuwerburg, nvda, rfk)). patient dna was fragmented using covaris m220 focused - ultrasonicator (covaris, ma, usa), followed by truseq dna sample preparation (illumina inc, san diego, ca, usa), enrichment using the seqcap ez human exome library v3.0 kit (nimblegen, roche, penzberg, germany), and sequencing on hiseq 2000 (illumina inc, san diego, ca, usa), all following standard protocols. data analysis was performed using galaxy (see urls). variants were filtered by variantdb (see urls, manuscript in preparation) to exclude variants with (1) low quality, using thresholds based on correlation between ngs data and snp - chip genotyping ; (2) intronic or intergenic location, except splice sites ; and (3) inheritance from the parents. wes was performed using illumina technology (illumina inc, san diego, ca, usa), and sequence data was returned and analysed using software supplied from oxford gene technology. presence of reported (de novo) mutations were confirmed by an independent technique such as sanger sequencing. raw sequence data will be uploaded in the european genome - phenome archive (embl - ebi) database. patients 7, 8 and 9 were discovered from a mip based screen of 2743 probands with intellectual disability and/or asd). patient 10 was included from a mip based screen of 2446 autism patients from the simon simplex collection (ssc). the mip screening and analysis was performed as previously described, and mip probe sequences for adnp are available in oroak, 2012. 192 control chromosomes were screened for the presence of the mutations identified in the 10 patients using hrm. primers were designed using the hrma assay design module of beacon designer 8.10 (premier biosoft, ca, usa). hrm was performed on a lightcycler 480 (roche, penzberg, germany) with the lcgreen incorporating dye (idaho technology inc., was identified using the same protocol, as part of the cohort of 148 probands with idiopathic asd, for which microarray analysis did not reveal any abnormalities. mrna expression was examined by an optimized three - step real - time quantitative pcr assay following the protocol described before. besides adnp itself, adnp2 was included based on the reported correlation of expression in human brain tissue. tmpo, ccnc and plagl2 were reported to be significantly downregulated in homozygous adnp knockout mice embryos, while abcf3 was reported to be upregulated in heterozygous adnp knockout mice embryos. qpcr primers were selected from literature, the rtprimerdb or designed using an in - house automated pipeline (see urls), conforming to requirements of intron - spanning location, no snp content, no dimer formation at the 3 end of the primers, and low amplicon folding, with no folding in primer binding sites. the amplification efficiency of the different primers was assessed and confirmed to be above 1.85. expression values of two cdna syntheses originating from two different rna isolations per patient were compared to the values obtained from eight control individuals. statistical testing was performed using linear mixed models in order to investigate significant differences in expression levels of the patients compared to controls. patients were selected for inclusion in this study from different cohorts tested on either family - based wes, targeted resequencing or high - resolution melting analysis (table 1). clinical evaluation was performed by at least one expert clinical geneticist. written informed consent for inclusion in the study was obtained for all patients and consent for the publication of photographs was obtained for patients 1, 2, 4, 5, 6 and 8. pcr was performed using gotaq polymerase (promega, madison, wi, usa) on dna from peripheral blood and on cdna from lymphoblastoid cells, using standard protocol. capillary electrophoresis sequencing (abi 3130 genetic analyzer ; applied biosystems, carlsbad, ca, usa) was performed using the abi bigdye terminator v3.1 cycle sequencing kit (applied biosystems, carlsbad, ca, usa), following standard protocol. data was analysed in clc dna workbench (clc bio, aarhus, denmark). patient 1 was detected in a family - based wes study (unpublished data (ch, gv, filip van nieuwerburg, nvda, rfk)). patient dna was fragmented using covaris m220 focused - ultrasonicator (covaris, ma, usa), followed by truseq dna sample preparation (illumina inc, san diego, ca, usa), enrichment using the seqcap ez human exome library v3.0 kit (nimblegen, roche, penzberg, germany), and sequencing on hiseq 2000 (illumina inc, san diego, ca, usa), all following standard protocols. variants were filtered by variantdb (see urls, manuscript in preparation) to exclude variants with (1) low quality, using thresholds based on correlation between ngs data and snp - chip genotyping ; (2) intronic or intergenic location, except splice sites ; and (3) inheritance from the parents. wes was performed using illumina technology (illumina inc, san diego, ca, usa), and sequence data was returned and analysed using software supplied from oxford gene technology. presence of reported (de novo) mutations were confirmed by an independent technique such as sanger sequencing. raw sequence data will be uploaded in the european genome - phenome archive (embl - ebi) database. patients 7, 8 and 9 were discovered from a mip based screen of 2743 probands with intellectual disability and/or asd). patient 10 was included from a mip based screen of 2446 autism patients from the simon simplex collection (ssc). the mip screening and analysis was performed as previously described, and mip probe sequences for adnp are available in oroak, 2012. 192 control chromosomes were screened for the presence of the mutations identified in the 10 patients using hrm. primers were designed using the hrma assay design module of beacon designer 8.10 (premier biosoft, ca, usa). hrm was performed on a lightcycler 480 (roche, penzberg, germany) with the lcgreen incorporating dye (idaho technology inc., was identified using the same protocol, as part of the cohort of 148 probands with idiopathic asd, for which microarray analysis did not reveal any abnormalities. mrna expression was examined by an optimized three - step real - time quantitative pcr assay following the protocol described before. besides adnp itself, adnp2 was included based on the reported correlation of expression in human brain tissue. tmpo, ccnc and plagl2 were reported to be significantly downregulated in homozygous adnp knockout mice embryos, while abcf3 was reported to be upregulated in heterozygous adnp knockout mice embryos. qpcr primers were selected from literature, the rtprimerdb or designed using an in - house automated pipeline (see urls), conforming to requirements of intron - spanning location, no snp content, no dimer formation at the 3 end of the primers, and low amplicon folding, with no folding in primer binding sites. the amplification efficiency of the different primers was assessed and confirmed to be above 1.85. expression values of two cdna syntheses originating from two different rna isolations per patient were compared to the values obtained from eight control individuals. statistical testing was performed using linear mixed models in order to investigate significant differences in expression levels of the patients compared to controls. | despite a high heritability, a genetic diagnosis can only be established in a minority of patients with autism spectrum disorder (asd), characterized by persistent deficits in social communication and interaction and restricted, repetitive patterns of behavior, interests or activities1. known genetic causes include chromosomal aberrations, such as the duplication of the 15q11 - 13 region, and monogenic causes, such as the rett and fragile x syndromes. the genetic heterogeneity within asd is striking, with even the most frequent causes responsible for only 1% of cases at the most. even with the recent developments in next generation sequencing, for the large majority of cases no molecular diagnosis can be established 2 - 7. here, we report 10 patients with asd and other shared clinical characteristics, including intellectual disability and facial dysmorphisms caused by a mutation in adnp, a transcription factor involved in the swi / snf remodeling complex. we estimate this gene to be mutated in at least 0.17% of asd cases, making it one of the most frequent asd genes known to date. |
ocular burns constitute true ocular emergencies, and both thermal and chemical burns represent potentially blinding ocular injuries. recovery of ocular surface burns depends upon the causative agent and the extent of damage to corneal, limbal, and conjunctival tissues at the time of injury.1 developments in the management of ocular surface burns, such as amniotic membrane transplantation (amt), have been used in the treatment of several ophthalmic disorders and conditions.2 however, even amniotic membrane (am) grafts, which work largely by providing a substrate for epithelial cells to grow on, fail when there are no surviving epithelial, conjunctival, or limbal cells. in this article, we report an unusual case of full - thickness corneal regeneration in a patient with an acute acid burn. a 32-year - old male reported painful discomfort, redness, photophobia, and a decrease in visual acuity in the left eye after a unilateral burn with ammonium defluoridate and sulfuric acid. the patient was referred to the cornea service of san paolo ophthalmic center (san antonio hospital, padova, italy). the patient was initially treated with irrigation of saline to normalize the ocular surface ph, and for removal of remaining particulate matter, prophylactic topical antibiotics, lubricants, steroids, and cycloplegics were used. three days after primary accident, slit - lamp examination revealed massive corneal involvement with an extensive necrotic / degenerative corneoconjunctival tissue covering the entire surface and obscuring both the iris details and anterior chamber. after an informed written consent was obtained, the patient underwent accurate surgical debridement (video s1). the necrotic corneoconjunctival tissue was excised from the entire corneal surface under surgical microscopy. during this procedure, a clear and perfect corneal tissue was shown (90% of corneal stroma was removed by curettage, leaving descemet s membrane clearly seen in the central area ; figure 1b). multilayered amt was performed in order to preserve the exposed corneal tissues and to stimulate both reepithelialization and regeneration of the corneal architecture. a sutureless am was arranged in multiple layers so that the entire ocular surface was covered, as well as the peripheral corneal limbal surface. am patch was then covered by a full - thickness conjunctival flap, including tenon s capsule.3 the rationale of this procedure was to control corneal inflammation and pain, as well as to ensure protection and healing efficacy. penetrating keratoplasty was considered either as a surgical procedure at the time of flap removal or as a separate event in an eye with visual potential. postoperative treatment consisted of topical eyedrops (dexamethasone 0.15% and ofloxacin 0.3%) four times daily. steroids were slowly tapered, while topical antibiotics were discontinued after a 4-week follow up period. am flap retraction occurred spontaneously, leaving the ocular surface free during the follow - up (45 months). the cornea appeared clear and 90%100% corneal stromal thickness was regained (figure 2a). optical coherence tomography showed a central corneal thickness of 508 m measured at the apex of the corneal surface. to evaluate the changes in cell morphology in regenerated tissues, corneal epithelium was evaluated from the central area of regenerated cornea using confocal microscopy (figure 2b). the flattened surface and smaller basal epithelial cells were normal in morphology and layer numbers also. anterior keratocytes and stroma were unevenly distributed, with bright nuclei and signs of opacity (figure 2c). a residual peripheral vascularized corneal pannus diffusion in three quadrants of the cornea, without involvement of the optic axis, was shown. a detailed explanation of the treatment was given to the patient, and informed written consent was obtained before any procedure. this protocol was approved by the institutional review board of the san paolo ophthalmic center, san antonio hospital. a detailed explanation of the treatment was given to the patient, and informed written consent was obtained before any procedure. this protocol was approved by the institutional review board of the san paolo ophthalmic center, san antonio hospital. recovery of ocular surface burns depends upon the causative agent and the extent of damage to corneal, limbal, and conjunctival tissues at the time of injury.1 several procedures would be considered in order to manage such an event. procedures including amt, autolimbal transplantation, and allolimbal transplantation have been reported in several studies.2,4,5 some of these describe a partial and/or complete recovery of the stroma in patients who underwent amt for corneal perforation and point out that amt might influence the proliferation and migration of neighboring keratocytes, leading to stromal substance synthesis.4,5 am undergoes subsequent progressive modification after integration because of the biological interactions that influence tissue healing and scar formation with incomplete clearing of the residual tissue, although a partial recovery of the am tissue transparency, once integrated, is achieved. we describe an unusual and complete restoration of the entire stromal thickness without reflectivity reduction in a patient exposed to acute burns caused by acid agents. we hypothesize a remodeling of the stroma with new collagen formation and repopulating with corneal stroma - derived cells, fibroblasts, and myofibroblasts that layered down new collagen. unknown trophic and regenerative factors might have induced mitotic effects on quiescent corneal keratocytes, which first underwent replication and then secreted normal corneal stroma components, including keratin sulfate and collagens (essential to build up new corneal stroma in a patient where only the descemet s membrane was preserved). because it is a well - established fact that corneal stroma has minimal or no regenerative properties (sporadic corneal stroma in human restoration is anecdotal), the observation that, in some animal models, the cornea can regenerate does have scientific significance.6 indeed, we can not also exclude the potential of human keratocytes to repopulate stromal tissue without scarring.7 keratocytes might not conform to the classic definition of terminal differentiation, and at least some cells in the stroma may respond and regenerate transparent corneal tissue.7 our report has several limitations. first, we were not able to demonstrate that some healthy residual corneal tissues were spared during chemical burning. second, we were also unable to obtain complete corneal tissue thickness measurements before surgery. given the severity of the original injury, it seems also surprising that limbal stem cell deficiency did not occur. it is hard to imagine how the limbus escaped significant injury, while the whole thickness of the stroma was destroyed. both transient and limited limbal ischemia occurred soon after the injury but recovered in the ensuing days.1 surviving limbal stem cells are capable to recover, multiply, and repopulate the area. whether multiple layers of amnion transplantation in combination with the conjunctival flap might be able to provide a scaffold for the formation of corneal stroma, or for migration and repopulation with derived keratocytes, can not be determined at this stage. this case report describes an unusual event, in which a full - thickness regeneration occurred after extensive corneal burning. any evidence of the hypothesized regenerative properties of human corneal stroma during corneal wound healing would have vast and impressive implications and justifies future studies. | purposewe describe a case of full - thickness corneal restoration after an acute corneal burn with an acid agent.methodsa 32-year - old male reported painful discomfort, redness, photophobia, and a decrease in visual acuity in the left eye after a unilateral burn with an acid agent. slit - lamp examination revealed massive corneal melting involving necrotic sequestrum of the entire corneal surface. surgical approach was carried out in order to preserve residual ocular tissues.resultsextensive corneal conjunctival layer curettage of the necrotic tissue was performed showing perfectly clear undamaged deep lamellar corneal layers. the patient underwent multilayered amniotic membrane transplantation and total capsular conjunctival flap in order to preserve ocular tissue from further melting or corneal perforation. a complete and spontaneous restitutio ad integrum of the corneal layers was shown during the follow - up. the cornea was perfectly clear with restored normal anatomical architecture.conclusionin this case, a spontaneous full - thickness corneal tissue restoration occurred after an acute chemical burn. studies about the mechanisms whereby different cells interact and replicate within the stroma may unveil the biology behind corneal regeneration and transparency. |
resistance exercise using weight machines or body weight builds muscle strength, helps rehabilitate athletes, prevents injuries, and improves health in typical adults1. resistance exercises can be categorized biomechanically into open kinetic chain (okc) and closed kinetic chain (ckc) exercises. okc exercises result in isolated movement at a given joint and are effective when isolated strengthening for selected muscle groups is desired. in contrast, ckc exercises cause co - contraction of agonist and antagonist muscle groups2, 3. okc and ckc exercises are applied directly to everyday physical activities and exercise, and combined okc and ckc training is recommended for treatment and rehabilitation1. thus, combined training is required not only for muscle strength improvement but also for muscle stabilization. meanwhile, resistance training increases oxygen supply and blood flow to skeletal muscles when they are scarce ; this stimulates the growth of capillaries within the muscles and is called angiogenesis4, 5. angiogenesis factors include vascular endothelial growth factor (vegf), angiopoietin 1 (ang 1), and angiopoietin 2 (ang 2). the major functions of vegf are to increase the growth and movement of vascular endothelial cells6 and to regulate capillaries within skeletal muscles7. ang 1 participates in stabilization of blood vessels9, whereas ang 2 participates in destabilization and remodeling10. in addition, the skeletal muscle growth protein follistatin has a positive effect on muscle growth by suppressing myostatin activity11. acute and regular aerobic exercise is reported to upregulate angiogenesis factors10, 12, 13. however, there are still only a few reports clarifying the effects of regular resistance exercise on angiogenesis factors. thus, it is essential to investigate the effects of combined okc and ckc training, which can selectively strengthen muscle groups and improve muscle coordination, to determine whether such training is effective for rehabilitation and improves the quality of physical activity. hence, the aim of the present study was to investigate the effects of combined okc and ckc training on muscle strength, anaerobic power, and blood levels of angiogenesis factors. twenty male college students with no medical problems were randomly divided into pulley training (pt, n=10) and control (co, n=10) groups. to obtain valid results, the subjects were advised against participating in excessive physical and nonroutine social activities on the day before the experiments. food intake was prohibited after 21:00 h on the day before the experiments, and fasting for more than 12 h was required for all subjects. body composition, including height, weight, body mass index (bmi), percentage of body fat, and lean body mass (lbm), was assessed at the dong - a university laboratory using an established bioelectrical impedance method with a venus 5.5 body composition analyzer (jawon medical, gyeongsangbuk - do, korea). three days before the experiment, one repetition maximum (1rm) was performed to test the experiment by indirect methods14. all volunteers underwent medical screening, including a health status interview and physical examination. written informed consent the study was approved by dong - a university hospital s institutional review board, and conducted in agreement with the declaration of helsinki. the exercise program is shown in table 1table 1.combined open kinetic chain and closed kinetic chain training programs using pulley exercise machinesitemcontentstime (min)warm upstretching10 minokc (60% 1rm, 10 rep, 2 sets) and ckc (10 rep, 2 sets) pulley trainingchest press40 minshoulder presspulley curlpush downlat pull downknee extensionreg curlcool downstretching10 min. the training in this study was performed using pulley exercise machines (well - tech, busan, korea) that can be used for okc and ckc training. okc exercise was performed for 8 weeks at 60% of 1rm, and the value of 1rm was recalibrated every 2 weeks. the order of exercise was 2 sets of 10 repetitions of okc exercise, followed by 2 sets of 10 repetitions of ckc exercise. all subjects performed a warm - up and cool - down 3 times to calibrate the measuring equipment. isokinetic strength testing for extension and flexion of the trunk (60/s) and knee (60/s) was performed with humac norm dynamometer (csmi, stoughton, ma, usa). anaerobic capacity was measured using a wingate test on a plate - loaded and friction - braked bicycle ergometer (monark, vansbro, sweden). the items measured were average power (ap), peak power (pp), peak pedaling speed (pps), and peak attainment time (pat). blood (10 ml) was collected from subjects via the antecubital vein for analysis of serum samples after a 12-h overnight fast. each blood sample was centrifuged for 15 minutes at 3,500 rpm at 4 c. the supernatant was decanted and stored in a deep freezer at 80 c until analysis. serum total cholesterol (tc), high - density lipoprotein cholesterol (hdl - c), free fatty acid (ffa), and triglyceride (tg) concentrations were assayed using an enzyme - linked immunosorbent assay (elisa) kit. low - density lipoprotein cholesterol (ldl - c) level was calculated with the following equation15 : ldl - c = tc hdl - c tg/5.0 (mg / dl). vegf, ang 1, ang 2, and follistatin levels were analyzed using an elisa kit (r&d systems, minneapolis, mn, usa). first, 100 l of capture antibody was incubated overnight at room temperature and washed 3 times. the samples and then, streptavidin - horseradish peroxidase and substrate solution were added, the reaction was terminated with the stop solution, and results were immediately obtained by optical density of each well using microplate reader set to 450 nm16. the mean and standard deviation of data obtained in our study were calculated using the spss statistics package for windows version 20.0 (spss, armonk, ny, usa). pre- and post - data were analyzed using the paired t - test within - group differences and the independent t - test for differences between the groups. changes in body composition of subjects are shown in table 2table 2.physical characteristics of the subjectsvariablecoptprepostprepostheight (cm)173.2 2.5173.5 2.5173.7 1.78174.1 1.6weight (kg)66.5 2.767.5 2.868.8 2.769.5 2.6bmi (kg / m)22.3 1.222.6 1.222.8 0.822.9 0.9body fat (%) 17.4 2.017.9 2.219.5 1.617.9 1.6lbm (kg)54.7 1.355.0 1.255.0 1.256.8 bmi : body mass index ; lbm : lean body mass ; co : control group ; pt : pulley training group. after 8 weeks of training, the results of the serum lipids test (table 3table 3.lipid profilesvariablecoptprepostpreposttc (mg / dl)154.4 8.2153.9 8.5158.8 13.9149.5 8.3tg (mg / dl)75.6 5.470.8 4.972.2 3.855.2 2.4#ffa (eq / l)466.8 59.7512.9 74.1471.1 69.0499.6 38.1hdl - c (mg / dl)51.6 2.551.7 1.950.6 1.447.5 1.6ldl - c (mg / dl)87.7 8.688.0 9.993.7 13.888.9 9.3values are meanse.co : control group ; pt : pulley training groupp<0.05 vs. pre, # p<0.05 vs. co) were as follows : there was no significant difference according to time or group for tc, ffa, hdl - c, and ldl - c, but tg decreased significantly after the exercise (p<0.05). the results for isokinetic muscle strength after 8 weeks of training are shown in tables 4 and 5table 4.the results for trunk (60/s) muscle strength after 8 weeks of trainingvariablecoptprepostprepostfpt (nm)224.2 30.1218.2 25.9227.8 17.7298.7 19.7#fpt%bw (nm)291.8 20.5277.1 10.1274.8 19.9362.4 16.3#fwr (nm)139.7 10.9143.9 12.9143.2 13.4186.2 7.8#fwr%bw (nm)215.6 18.0196.3 12.4195.9 13.4261.3 15.3#ept (nm) 250.9 8.1247.8 8.8232.3 9.6287.3 11.0#ept%bw (nm)329.9 19.2323.6 20.5362.8 19.2406.5 19.2#ewr (nm)249.9 12.8255.3 11.5256.5 11.3292.2 13.5#ewr%bw (nm)340.4 24.7317.8 23.4364.4 24.4422.1 19.0#values are meanse. fpt : flexor peak torque ; fpt%bw : fpt per body weight ; fwr : flexor work per repetition ; fwr%bw : fwr per body weight ; ept : extensor peak torque ; ept%bw : ept per body weight ; ewr : extensor work per repetition ; ewr%bw : ewr per body weight ; co : control group ; pt : pulley training grouptable 5.the results for knee (60/s) muscular strength after 8 weeks of trainingvariablecoptprepostprepostfpt (nm)88.8 8.382.2 10.283.2 6.8105.3 5.8#fpt%bw (nm)129.0 11.1120.7 13.9123.2 9.6154.3 9.2#fwr (nm)109.4 8.0107.8 9.7109.6 8.5130.2 9.2#fwr%bw (nm)161.2 12.8154.9 12.4162.6 11.2198.1 11.6#ept (nm)161.4 13.8166.6 7.4168.5 10.2197.9 8.1#ept%bw (nm)242.1 15.1244.4 14.2245.2 9.3277.5 9.2#ewr (nm)182.9 7.9183.2 9.5184.5 8.5224.4 11.4#ewr%bd (nm)264.7 14.9266.7 16.7268.1 11.5303.7 12.4#values are meanse.fpt : flexor peak torque ; fpt%bw : fpt per body weight ; fwr : flexor work per repetition ; fwr%bw : fwr per body weight ; ept : extensor peak torque ; ept%bw : ept per body weight ; ewr : extensor work per repetition ; ewr%bw : ewr per body weight ; co : control group ; pt : pulley training group.p<0.05 vs. pre, # p<0.05 vs. co. after 8 weeks of training, muscle strength in the flexors and extensors of the trunk (60/s) and knee (60/s) were improved (p<0.05). the anaerobic power of each group is shown in table 6table 6.the anaerobic power of each groupvariablecoptprepostprepostap (w)535.1 16.2540.9 19.9557.8 17.2597.6 12.8pp (w)672.8 32.2696.2 34.7675.7 21.3741.3 21.8pps (rpm)138.8 6.9142.4 5.1134.3 3.8146.3 4.9pat (s)6.6 0.66.5 0.710.8 1.58.09 ap : average power ; pp : peak power ; pps : peak pedaling speed ; pat : peak attainment time ; co : control group ; pt : pulley training group. ap, pp, and pps increased significantly for the pt group after training compared to before training (p<0.05). the changes in angiogenesis factors and follistatin after 8 weeks of training are shown in table 7table 7.the changes in angiogenesis factors and follistatin after 8 weeks of trainingvariablecoptprepostprepostvegf (pg / ml)47.0 1.347.7 0.950.3 3.052.8 4.0ang 1 (pg / ml)403.9 29.2504.7 24.0 0.716.3 0.7follistatin (pg / ml)22.2 3.824.9 2.823.7 3.429.1 3.9values are meanse. vegf : vascular endothelial growth factor ; ang 1 : angiopoietin 1 ; ang 2 : angiopoietin 2 ; co : control group ; pt : pulley training group. ang 1 increased 25% in the co group (p<0.05) and 48% in the pt group (p<0.05) after training. vegf and follistatin also increased significantly after training in the pt group (p<0.05). bmi : body mass index ; lbm : lean body mass ; co : control group ; pt : pulley training group. p<0.05 vs. pre co : control group ; pt : pulley training group p<0.05 vs. pre, # p<0.05 vs. co values are meanse. fpt : flexor peak torque ; fpt%bw : fpt per body weight ; fwr : flexor work per repetition ; fwr%bw : fwr per body weight ; ept : extensor peak torque ; ept%bw : ept per body weight ; ewr : extensor work per repetition ; ewr%bw : ewr per body weight ; co : control group ; pt : pulley training group fpt : flexor peak torque ; fpt%bw : fpt per body weight ; fwr : flexor work per repetition ; fwr%bw : fwr per body weight ; ept : extensor peak torque ; ept%bw : ept per body weight ; ewr : extensor work per repetition ; ewr%bw : ewr per body weight ; co : control group ; pt : pulley training group. p<0.05 vs. pre, # p<0.05 vs. co values are meanse. ap : average power ; pp : peak power ; pps : peak pedaling speed ; pat : peak attainment time ; co : control group ; pt : pulley training group. vegf : vascular endothelial growth factor ; ang 1 : angiopoietin 1 ; ang 2 : angiopoietin 2 ; co : control group ; pt : pulley training group. muscle strength and function are affected by muscle atrophy with aging, musculoskeletal disorders, sedentary living, and bed confinement17, 18. however, regular resistance exercise improves muscle function, increases strength after damage, and prevents decline in muscle strength despite aging19, 20. in particular, combined okc and ckc training can be considered essential for muscle strength improvement and stabilization. hence, the present study analyzed the effect of using pulley exercise machines that enable combined okc and ckc training on muscle strength anaerobic power and angiogenesis factors. eight weeks of this combined training was effective in significantly increasing muscle strength in the flexors and extensors of the trunk and knee (p<0.05). this is consistent with previous studies reporting that resistance exercise increases muscle strength12, 21,22,23. anaerobic exercise capacity refers to the muscle endurance and contractile strength that results from anaerobic metabolism and is highly correlated with strength and endurance24. a 30-s wingate anaerobic exercise capacity assessment method is widely used to determine anaerobic power. in this study, the anaerobic ap and pp results after 8 weeks of combined ock and ckc training using pulley exercise machines improved significantly in the pt group compared to the co group (p<0.05). these results are consistent with previous reports that the 30-s wingate anaerobic test increased pp values after resistance training25. the density and ratio of capillaries in muscle of vegf - deficient mice were reportedly lower26. previous studies reported that angiogenesis in human and animal muscle tissue was induced by exercise27,28,29,30. gavin.31 reported that acute knee extensor exercise at an intensity of 6080% increased blood vegf mrna and vegf protein levels between 2 and 4 h after exercise. yeo.16 reported that resistance exercise for 8 weeks at 60% or 90% intensity increased serum vegf level in both groups. the present study showed that blood vegf levels increased significantly after 8 weeks of combined okc and ckc training using pulleys (p<0.05), which was consistent with previous studies. the stability of capillaries is reportedly promoted when the concentration of ang 1 is higher than that of ang 2 and is reduced when the concentration of ang 2 is higher than that of ang 132, 33. ang 2 levels in this study did not change in either group. however, ang 1 increased in the pt group. therefore, 8 weeks of combined okc and ckc training can increase ang 1 and may be more effective in promoting capillary stability compared to the co group. follistatin increase muscle mass and promotes muscle growth by neutralizing myostatin, which has a negative effect on mass and growth34, 35. muscle mass increased in follistatin - overexpressing transgenic mice and reduction in follistatin caused a decrease in gastrocnemius mass36. acute knee extension in postmenopausal women increased follistatin levels in skeletal muscle, and resistance training at 8590% intensity increased serum follistatin levels and muscle strength37. the results of the present study showed a significant increase in follistatin in the pt group (p<0.05) after 8 weeks of combined training. the results of this study indicate that 8 weeks of combined okc and ckc training using pulley exercise machines increased serum vegf, ang 1, and follistatin and improved ap and pp in tests of anaerobic capacity. the training also improved flexor and extensor strength in the trunk and knee. hence, 8 weeks of combined training effectively increased biochemical factors that are closely related to muscle growth and improved muscle strength in the trunk and knee. future studies are needed to perform histological analysis of neuromuscular activation, muscle hypertrophy, and angiogenesis factors following combined training. | [purpose ] this study investigated the effects of combined open kinetic chain and closed kinetic chain training using pulley exercise machines on muscle strength, anaerobic power, and blood levels of angiogenesis factors. [subjects and methods ] twenty male university students were equally divided between control and pulley training groups. the pulley - training group underwent 8 weeks of combined training. open kinetic chain training consisted of 2 sets of 10 repetitions at 60% of one repetition maximum ; closed kinetic chain training consisted of 2 sets of 10 repetitions of resistance exercise using the subject s own body weight. isokinetic strength (trunk and knee), anaerobic power, vascular endothelial growth factor, angiopoietin-1, angiopoietin-2, and follistatin were analyzed. [results ] after 8 weeks, flexor and extensor muscle strength significantly increased in the trunk and knee ; average and peak power also increased significantly. angiopoietin 1 increased 25% in the control group and 48% in the pulley training group ; vascular endothelial growth factor and follistatin increased significantly in the pulley - training group after 8 weeks. [conclusion ] eight weeks of combined training using pulley exercise machines effectively increased biochemical factors related to muscle growth, as well as muscle strength in the trunk and knees. |
rotator cuff tears are very common injuries ; ruptures generally occur within the tendon or as an avulsion from the greater tuberosity [1, 2 ]. musculotendinous ruptures are common both in the upper and in the lower extremities ; ruptures of the rotator cuff through the musculotendinous junction are exceptional. we describe a case of traumatic supraspinatus rupture at the musculotendinous junction in a 23-year - old woman, its clinical presentation, and the successful conservative treatment performed. a healthy 23-year - old woman presented to our emergency department after a fall on her outstretched left arm, which was forced posterior to her back., there was tenderness over the supraspinatus fossa, no pain on palpation of the scapular body spine or the proximal humerus, and a full passive range of motion (rom) ; passive abduction was painful > 90. active abduction and forward flexion were impossible due to pain. orally administered analgesics were prescribed, the arm was immobilized in a sling, and a magnetic resonance imaging (mri) to evaluate the rotator cuff was planned, which showed a complete lesion of the supraspinatus at the musculotendinous junction (fig. a t1 short - tau inversion - recovery - weighted coronal view shows disruption of the musculotendinous junction of the supraspinatus with hematoma and edema involving the entire muscle belly ; the intramuscular septum is inhomogeneous and slackened (arrow). b proton density fat - saturated sagittal imaging at the level of the scapular y view shows a intramuscular hematoma in the posterior portion of the muscle belly and perimuscular edema. c the intramuscular septum is clearly slackened on proton - density fat - saturated axial view (arrow) magnetic resonance imaging performed 1 day after trauma. a t1 short - tau inversion - recovery - weighted coronal view shows disruption of the musculotendinous junction of the supraspinatus with hematoma and edema involving the entire muscle belly ; the intramuscular septum is inhomogeneous and slackened (arrow). b proton density fat - saturated sagittal imaging at the level of the scapular y view shows a intramuscular hematoma in the posterior portion of the muscle belly and perimuscular edema. c the intramuscular septum is clearly slackened on proton - density fat - saturated axial view (arrow) the patient was treated conservatively with the arm immobilized in a sling at 45 of abduction and neutral rotation of the shoulder. at day 1, the simple shoulder test (sst) score was 2 (range 012) and constant score was 44. after 25 days, passive elevation, abduction, and circumduction of the shoulder, active abduction and forward elevation to 100 was attained : sst score was 8 and constant score 57. the patient started eccentric strengthening exercises. at day 60, she had full rom, including complete abduction ; at this time, a repeat mri showed disappearance of the perimuscular edema and partial reorganization of the muscular architecture (fig. 2).fig. a t1 short - tau inversion recovery coronal and b proton - density fat saturated sagittal views show reduction of the intra- and perimuscular edema, but a persistent small intramuscular area of high signal compatible with edema remained in the site of the lesion. c proton - density fat - saturated axial view shows a more homogeneous and stretched intramuscular septum (arrow) magnetic resonance imaging performed 60 days after trauma. a t1 short - tau inversion recovery coronal and b proton - density fat saturated sagittal views show reduction of the intra- and perimuscular edema, but a persistent small intramuscular area of high signal compatible with edema remained in the site of the lesion. c proton - density fat - saturated axial view shows a more homogeneous and stretched intramuscular septum (arrow) at day 80, the strength of the supraspinatus was restored to normal, sst score was 12, and constant score was 100. mri performed 29 months after the trauma showed no edema and a restored intramuscular tendinous septum, but a hypotrophic muscle with a grade 1 fatty infiltration according to fuchs was visible (fig. 3). at that time, the patient was healthy, without limitation in her activities, and maintained an sst score of 12 and a constant score of 100. a t1 short - tau inversion - recovery coronal image shows complete disappearance of edema, even though the muscle is hypotrophic. b proton - density fat - saturated sagittal and c axial view confirms the reduction of muscle volume and shows a small intramuscular scar in the posterior side of the musculotendinous junction. d grade 1 fatty degeneration clearly visible on t1 sagittal view (arrow) magnetic resonance imaging performed 29 months after trauma. a t1 short - tau inversion - recovery coronal image shows complete disappearance of edema, even though the muscle is hypotrophic. b proton - density fat - saturated sagittal and c axial view confirms the reduction of muscle volume and shows a small intramuscular scar in the posterior side of the musculotendinous junction. to our knowledge, in the peer - reviewed literature there are only six cases of a traumatic rupture of the supraspinatus at the musculotendinous junction [4, 5 ]. our patient is the youngest reported with a rupture of the supraspinatus at the musculotendinous junction. mean age of the six previously reported cases is 40 years ; anyway lower than the mean 55 years old found for a supraspinatus tendon tear or the mean 49 years old found for a musculotendinous rupture of the infraspinatus [2, 6 ]. musculotendinous injuries are common in the extremities but rare in the rotator cuff ; musculotendinous lesions of the supraspinatus are exceptional. grade 3 injuries are complete rupture of the muscle fibers and generally occur at the musculotendinous junction. the acute phase of such lesions is characterized by widespread intra- and extramuscular edema and hematoma and complete disruption of the muscle ; these lesions heal with scar formation and generally muscle weakness. rupture of the musculotendinous junction may occur at different strain rates according to muscle architecture and elongation. consequently, their fibers are designed for force production rather than excursion : they are short and produce near - maximal active tension over a narrow range of sarcomere length. glenohumeral stability must be provided also with the muscles at rest or in extreme joint position ; for this reason, muscle fibers have long resting sarcomere lengths to produce adequate passive tension. the combination of short fibers and long resting sarcomere length make the rotator cuff muscles relatively sensitive to stretch because of the low rate of myofilament overlap. pennate muscle, such as the infraspinatus, are more susceptible to such injury ; for muscles with similar pennation angles but with differing fiber lengths, imposing a given stretch across the muscle will lengthen each sarcomere in a short fiber to a greater extent compared with those in a long fiber. this finding is in agreement with the fact that musculotendinous rupture of the infraspinatus, a pennate muscle, is a recognized injury when rupture of the supraspinatus, a parallel - fibered muscle, is rare ; it remains to be understood. in our case, supraspinatus rupture at the musculotendinous junction could have been caused by a sudden passive stretching of the supraspinatus because of the position of the arm during the fall. when the arm is forced backward and adducted, the supraspinatus fibers are already maximally lengthened and passively stretched, so myofilament overlap is too low to permit muscle contraction. it is well known that reflex muscle contraction is a defense mechanism to prevent or reduce the amount of damage caused by a given injury. therefore, muscles that are actively contracting, particularly if eccentric, can resist to a greater force before musculotendinous unit failure than can passively stretched muscles. another explanation for the rupture may be an acute inlet impingement at the acromioclavicular joint during the fall with the arm outstretched and forced backward. the shape of the patient s acromion, type 2 according to bigliani, could support this mechanism, but absence of acromioclavicular osteoarthritis could make this mechanism unlikely. due to the unique case reported here, we are unable to recommend a treatment strategy for this type of lesion. in our case, conservative treatment showed a satisfactory outcome, leading to complete restoration of supraspinatus function in 80 days and an asymptomatic grade 1 fatty degeneration of the muscle belly on mri after 29 months. this is in contrast with the previous study in which conservative treatment of full - thickness lesion led to the patient s dissatisfaction and grade 4 fatty infiltration on mri follow - up. | the vast majority of rotator cuff tears occur within the tendon or as an avulsion from the greater tuberosity. supraspinatus injury at the musculotendinous junction is a very uncommon event. we describe a case of supraspinatus rupture at the musculotendinous junction, with successful conservative treatment. it occurred in a 23-year - old woman, the youngest patient with this uncommon type of injury. to our knowledge, this is the first case of rupture of the supraspinatus muscle at the musculotendinous junction in a young woman and the second in a woman. |
the american heart association s (aha s) strategic planning task force and statistical committee recently implemented 2020 impact goals for cardiovascular health promotion called life s simple 7 (1). these goals are based on the current understanding of modifiable risk factors for cardiovascular disease (cvd) and provide up - to - date goals for optimal cardiovascular health. the goals comprise four health behaviors and three health factors : a physically active lifestyle ; healthy diet ; healthy bmi ; avoiding smoking ; and lower blood pressure, fasting glucose, and total cholesterol (1). current aha guidelines recommend achieving the seven goals to maintain optimal cardiovascular health. to date, several studies have examined the association of achievement of these goals with risk of cvd and other cvd - related end points, including kidney disease, depression, and mortality (25). however, no published studies have examined the association of the goals with incident diabetes, which is associated with high cvd risk (6). the overarching goals of life s simple 7 are to improve the cardiovascular health profiles of all americans and reduce deaths from cvd by 20% by 2020 (1). moreover, the life s simple 7 strategic plan highlights racial disparities in cardiovascular health in the u.s. and emphasizes the importance of promoting life s simple 7 in minority populations. although diabetes is a leading risk factor for cvd and mortality for all americans, the burden of diabetes in american indian (ai) communities is particularly troubling (7). ais are 2.5 times more likely to have diabetes than non - hispanic whites of similar age (8). in the strong heart family study (shfs), the prevalence of diabetes among ais (median age 37 years) was 31% in 2009. additionally, as in other ethnic groups, obesity, physical inactivity, poor diet, and smoking are common in ai communities (9,10). previous studies in primarily white populations have shown that a low - risk cardiometabolic health profile, including regular physical activity, a healthy diet, abstinence from smoking, moderate alcohol use, and a healthy bmi, is associated with a lower risk of diabetes (1113). however, many of these behaviors are largely culturally determined (14,15), and the generalizability of the findings to other ethnic groups with high rates of obesity and diabetes remains unclear. thus we examined the combined effect of a low - risk health profile on diabetes risk among ais, a population with high rates of diabetes and cvd. the purpose of this analysis was to examine the associations of low - risk health behaviors and factors, as defined using the life s simple 7 goals, with incident type 2 diabetes among ais who participated in the shfs. the shfs offers a unique opportunity to assess the relationship of the life s simple 7 goals with incident diabetes because of its large size and availability of rigorously collected risk factors and outcome measures. the shfs is a population - based longitudinal study of the genetic, metabolic, and behavioral risk factors for cvd in 13 ai communities in arizona, north dakota, south dakota, and oklahoma. both exams included a standardized personal interview, physical examination, medication review, laboratory testing, and a 1-week pedometer log for ascertaining physical activity levels. the institutional review boards from each indian health service region and all 13 communities approved the study, and written informed consent was obtained from all participants at each exam. there were 2,458 shfs participants who did not have diabetes at the baseline examination in 20012003 and had a follow - up examination in 20072009. we excluded those with a history of myocardial infarction, stroke, or heart failure or who were currently pregnant (n = 115) at baseline, because these conditions may influence other health behaviors, such as diet or physical activity. participants missing baseline glucose measures, family information, physical activity data, smoking information, or bmi measures or who were 12 months ], intermediate [former 12 months ], poor [current ]), 5) cholesterol (ideal [12 months ], intermediate [former 12 months ], poor [current ]), 5) cholesterol (ideal [< 200 mg / dl without medication ], intermediate [200239 mg / dl or treated to < 200 mg / dl ], poor [240 mg / dl ]), 6) blood pressure (ideal [< 120/<80 mmhg, without medication ], intermediate [systolic blood pressure (sbp) 120139 mmhg or diastolic blood pressure (dbp) 8089 mmhg or treated to < 120/<80 mmhg ], poor [sbp 140 mmhg or dbp 90 mmhg ]), and 7) fasting glucose (ideal [< 100 mg / dl, without medication ], intermediate [100125 mg / dl or treated to < 100 mg / dl ], poor [not applicable by design since participants with diabetes at baseline were excluded from analyses ]). aside from the physical activity metric, the above classifications are taken directly from the life s simple 7 impact goals (1). the life s simple 7 goals classify physical activity levels based on total activity time (minutes per day), but in the shfs, physical activity was assessed with pedometers (steps per day). as several studies suggest that individuals who accumulate at least 10,000 steps per day have a decreased risk of obesity and hypertension and better glucose tolerance and lipid profiles compared with individuals who accumulate fewer steps per day (2024), accumulation of 10,000 + steps per day was considered an ideal level of activity. we created a composite metric of low - risk cardiovascular health status based on achievement of ideal status for each of the individual health metrics. although the life s simple 7 only consider individuals who achieve status for all 7 health metrics as low risk, we chose categorization of 01, 23, and 4 + for the composite to most closely represent the distribution of below average, average, and above average goal achievement in the shfs population and to be consistent with the three - tiered classification scheme for the individual health metrics. incident diabetes was defined using 2003 american diabetes association criteria, including use of insulin or oral antidiabetes medication or with a fasting plasma glucose level 126 mg / dl at the second exam. because type 1 diabetes is rare in ai populations and all shfs participants were at least 18 years of age at baseline, we assumed that all new occurrences of diabetes were type 2. to account for potential correlation between members of the same family within the data, generalized estimating equations with an independence working correlation structure and sandwich ses were used to examine whether achievement of 01, 23, or 4 + goals was associated with diabetes risk (25). additionally, we examined whether achievement of the health behavior goals (01 vs. 2 +), health factor goals (01 vs. 2 +), or individual health behavior or health factor goals (poor vs. intermediate or ideal) influenced diabetes risk. odds ratios (ors ; 95% ci) were calculated comparing participants who achieved 23 or 4 + goals (or 2 + goals for the health behaviors or health factors analyses), using those who achieved 01 goals as the referent group. for the analyses of the individual goals, ors (95% ci) were calculated comparing participants who achieved intermediate or ideal status, using those with all models were adjusted for a priori confounders, including age, sex, site, education, and family history of diabetes. because the associations of goal achievement with diabetes risk may differ by sex or age, we examined the interaction of each goal (and the combined goals) with sex and age on risk of diabetes. wald s tests were used to evaluate the statistical significance of the multiplicative interaction term in each model. as the association of the life s simple 7 goals and diabetes risk may differ among older versus younger individuals, we stratified the analyses at the median age in sensitivity analyses. all statistical analyses were conducted using stata version 9.0 (stata corp., college station, tx). of the 1,639 shfs participants who comprised the analytic cohort, 63% were women, and the mean age at the baseline examination was 38 years. there were 71% of participants with cholesterol levels < 200 mg / dl without medication and 40% of participants with blood pressure less than < 120/80 without medication at the baseline exam. additionally, 57% of study participants were classified as never smokers or quit at least 12 months ago. there were 18% of participants with bmi < 25 and 12% of study participants who accumulated 10,000 + steps per day. no study participants achieved 4 + dietary guidelines based on the life s simple 7 dietary criteria. in total, 25% of participants achieved 4 + of the 7 life s simple 7 goals and 16% of participants achieved only 01 goals. achievement of each life s simple 7 goal was only modestly correlated with diabetes ; the spearman correlation coefficient for achievement of the fasting glucose goal and diabetes was 0.33, while the correlation coefficients of all other individual goals with diabetes were small (less than 0.15 in absolute values [data not shown ]). distribution of low - risk health metrics among 1,639 shfs participants aged 1874 years free of cvd and diabetes 92% of shfs participants met 01 dietary goal, and 8% of participants met 2 dietary goals. whole - grain intake was estimated from a food frequency questionnaire using the criterion that whole grains contain 1.1 g fiber per 10 g carbohydrate. during a mean follow - up of 5 years (range 48 years), the ors of diabetes according to the number of low - risk health metrics the participants achieved at baseline are shown in table 2. compared with participants who achieved 01 goals, participants who achieved 23 goals or 4 + goals had a lower risk of diabetes, with or = 0.40 (95% ci 0.290.56) and or = 0.11 (0.050.21), respectively. the lower risk of diabetes was attributable to both health behaviors (or comparing participants who achieved 2 + to 01 health behavior goals = 0.54 [95% ci 0.320.92 ]) and health factors (or comparing participants who achieved 2 + to 01 health factor goals = 0.26 (95% ci 0.190.37 ]). ors of diabetes according to number of low - risk health metrics achieved among 1,639 shfs participants aged 1874 years total low - risk health metrics achieved, number of low - risk health metrics achieved, and number of low - risk health factors achieved represent independent regression models. model includes age, sex, site, education (years), and family history of diabetes. includes all life s simple 7 goals, including achievement of physical activity, diet, bmi, smoking, total cholesterol, fasting glucose, and blood pressure goals. includes only health behavior goals, including achievement of physical activity, diet, smoking, and bmi goals. includes only health factor goals, including achievement of total cholesterol, fasting glucose, and blood pressure goals. in general, participants were more likely to achieve the health factor goals than the health behavior goals. more than 70% of study participants achieved the fasting glucose and total cholesterol goals, while less than 20% achieved the bmi, physical activity, or dietary goals. the ors of diabetes comparing levels of the individual health metrics are shown in table 3. lower bmi was associated with lower odds of developing diabetes. comparing the ideal category (bmi < 25 kg / m) to the poor category (bmi 30 + kg / m), the or was 0.12 (95% ci 0.050.30). in addition, higher levels of physical activity and lower levels of blood pressure were associated with lower odds of diabetes. contrasting the intermediate or ideal activity categories with the poor category for accumulated steps per day, the ors for diabetes were 0.73 (95% ci 0.520.98) and 0.65 (95% ci 0.381.11), respectively. for blood pressure, compared with participants with poor blood pressure (sbp 140 mmhg or dbp 90 mmhg), participants with ideal blood pressure (< 120/<80 mmhg without medication) had a lower odds of developing diabetes (or = 0.42 [95% ci 0.260.69 ]). because the outcome of interest for this analysis was incident diabetes, participants with poor levels of fasting glucose at baseline (126 mg / dl) were excluded by design. however, compared with participants with intermediate fasting glucose (100125 mg / dl), participants with ideal fasting glucose (< 100 mg / dl) had a lower odds of developing diabetes : or = 0.14 (95% ci 0.100.20). we found no association of diet, smoking, or total cholesterol with diabetes risk (table 3). ors of diabetes according to life s simple 7 metrics among 1,639 shfs participants aged 1874 years each health behavior or factor represents an independent regression model. each adjusted model includes age, sex, site, education (years), and family history of diabetes. in secondary analyses, modeling the life s simple 7 risk score linearly (07 goals achieved) did not materially alter reported ors (data not shown). there were also no statistically significant interactions of each health metric with sex when assessing risk of diabetes (data not shown). in sensitivity analyses, omitting fasting glucose from the combined health metrics and the health factors analyses slightly attenuated reported ors, while omitting bmi from the health behaviors analysis largely attenuated the observed association (data not shown). associations of the life s simple 7 goals with diabetes incidence were similar in analyses stratified by median age (data not shown). participants who achieved at least two of the life s simple 7 goals had a lower risk of diabetes than participants who met one or none of these criteria. this effect was graded across the metrics where participants achieving 23 or 4 + goals had a 60% and 89% lower risk of diabetes when compared with participants who only achieved 01 goals. when the health behaviors and health factors were examined separately, however, the association of health factors with diabetes was largely explained by differences in baseline fasting glucose. although no participants achieved all seven goals, goal achievement was similar to that in other cohort studies and the national health and nutrition examination survey (25,2629). the health factors goals were more likely to be achieved than the health behaviors goals, and the dietary goal was the least likely to be achieved. developing strategies to encourage the american population to achieve optimal diet, physical activity, and more research is needed to better understand if the current life s simple 7 health behavior thresholds represent realistic health targets for the american population at large or if promoting less aggressive (or incremental) changes in health behaviors better stimulates behavioral change (31). to our knowledge, this is the first study that has examined the association of low - risk health behaviors and factors with incident diabetes using life s simple 7 goals. the results of these analyses are comparable with two published observational studies that have examined the association of lifestyle factors and incident diabetes in other populations using different criteria. in the nurse s health study and the cardiovascular health study, participants with a healthy lifestyle including physically active nonsmokers with low / moderate alcohol use and diets high in fiber and the ratio of polyunsaturated to saturated fat, and low in trans fat and glycemic load had a 89% lower risk of developing diabetes when compared with less healthy study participants (11,12). our results complement these studies and suggest that a healthier lifestyle and low - risk health factors are associated with a lower risk of diabetes among ais. in the present analyses, dietary factors were not associated with diabetes risk. because 92% of the cohort achieved 2 of the core dietary goals and only 210 participants developed diabetes during follow - up, we had limited ability to adequately assess this relationship. because we had no participants who met the criteria for ideal diet, and diet quality is a major determinant of diabetes risk (32,33), our results are likely an underestimation of the association of achievement of the life s simple 7 criteria and incidence of diabetes. however, as smoking in this population often involves intermittent smoking and rarely exceeds 10 cigarettes per day, we had limited ability to evaluate this association. strengths of this study include detailed information on health behaviors and factors for all study participants and 48 years of follow - up. additionally, this is the only large multitribal longitudinal study of chronic disease among ais. although ais have a particularly high burden of obesity and diabetes, the risk factors for diabetes are similar across ethnic groups, and we expect these findings to be generalizable to other populations with similar risk profiles although physical activity was assessed using an objective measurement tool, shfs participants may have altered physical activity patterns during the days that the pedometer was worn. physical activity, diet, smoking, bmi, fasting glucose, total cholesterol, and blood pressure may also be associated with other unmeasured behaviors, such as access to medical care, compliance with medical advice, and other unmeasured elements of behavior that likely influence diabetes risk. the life s simple 7 criteria comprise a crude additive scoring method based on achievement of 07 of the health behavior and factor goals ; however, the magnitude of the association of each individual health behavior or metabolic factor is not the same, and the life s simple 7 scoring may oversimplify the association of the goals with diabetes risk (27). finally, the life s simple 7 criteria were designed as a broad public health metric to promote cardiovascular health and prevent deaths from cvd. although there is overlap between risk factors for cvd and diabetes (e.g., physical inactivity, diet, bmi, smoking, and fasting glucose), dyslipidemia and hypertension are more closely related to cvd than diabetes. the results of this study suggest that achievement of as few as two or three of the life s simple 7 goals is associated with a lower risk of diabetes in ais, an underserved group with a high risk of cardiometabolic diseases. this study adds to the growing body of evidence demonstrating the health benefits of achieving healthy lifestyle goals as summarized in the aha life s simple 7 and specifically suggests the potential impact of achievement of a modest number of these goals on metabolic health. | objectivethe american heart association s recommendations for optimal health, summarized in life s simple 7, have been associated with reduced risk of cardiovascular disease (cvd)-related end points, but no studies have examined the association of these goals with incident type 2 diabetes, which is associated with high risk for cvd. the purpose of this analysis was to examine the associations of life s simple 7 goals with incident diabetes among american indians, a population at high risk of cardiometabolic diseases.research design and methodsstrong heart family study participants without diabetes (n = 1,639) at baseline and who participated in a follow - up examination were included in the analysis. risk scores ranging from 0 to 7 were created using physical activity, diet, bmi, smoking, blood pressure, fasting glucose, and cholesterol metrics in accordance with life s simple 7 goals. diabetes was defined using 2003 american diabetes association criteria, including use of insulin or oral antidiabetes medication or a follow - up fasting plasma glucose level 126 mg / dl. generalized estimating equations were used to examine the association of risk scores with incident diabetes.resultsduring a mean 5-year follow - up (range 48 years), we identified 210 cases of incident type 2 diabetes. compared with participants who achieved 01 goals, those who achieved 23 or 4 + goals had lower odds of diabetes, with odds ratios = 0.40 (95% ci 0.290.56) and 0.11 (95% ci 0.050.21), respectively.conclusionsthe adoption of as few as two or three life s simple 7 goals is associated with a lower risk of diabetes. |
it is the definitive management option for thyroid malignancies and also for benign diseases such as multinodular goiter symptomatic of compression. in the hands of an experienced surgeon, it is a safe procedure. main postoperative complications include bleeding, recurrent laryngeal nerve injury, and hypocalcemia depending on the extent of surgery and experience of the surgeon. the incidence of transient hypocalcemia, defined as hypocalcemia occurring within 6 months of surgery, has been variedly reported to be 13%38%. it occurs because of transient hypoparathyroidism due to parathyroid gland manipulation or impairment of its blood supply. the development of postoperative hypocalcemia after tt is unfavorable not only since it is a cause of morbidity but also because it occurs 2472 h postoperatively and hence necessitates repeated biochemical testing and prolonged in - hospital stay. many risk factors have been identified for postoperative hypocalcemia including age > 50 years, female gender, thyroid malignancy, grave 's disease, lymph node dissection, nonidentification of parathyroid glands intraoperatively, reoperation, and vitamin d deficiency. the prediction of patients who can be discharged early or those who would require close monitoring and postoperative calcium and vitamin d supplementation is difficult. although 1-h and 4-h postoperative intact parathormone (ipth) testing has been shown to stratify patients into high- and low - risk for hypocalcemia and expedite an early discharge after tt, rapid ipth measurement facility is not routinely available in many resource - poor settings and is hence not feasible. a high prevalence of vitamin d deficiency has been demonstrated in some north indian states, and is a known risk factor for postoperative hypocalcemia after tt. to prevent postoperative hypocalcemia, routine vitamin d supplementation as a standard protocol merits consideration. although routine postoperative oral calcium and vitamin d supplementation has been shown to prevent the development of hypocalcemia after tt and facilitate an early discharge, the role of preoperative supplementation has seldom been tested. we hypothesize that a 1-week preoperative vitamin d and calcium supplementation to a cohort of patients belonging to an area endemic to vitamin d deficiency, continued 1 week into postoperative period, would reduce the rates of hypocalcemia and associated morbidity. the aim of the present randomized controlled trial was to ascertain the usefulness of pre- and post - operative calcium and vitamin d supplementation in prevention of hypocalcemia after tt. this prospective randomized controlled study was performed, from february 2013 to august 2014, on sixty consecutive patients who underwent total or near tt in the department of general and minimal invasive surgery in collaboration with endocrinology department. prior ethical committee approval was sought and each patient gave an informed written consent before being enrolled in the study. preoperatively, patients were randomly divided into two groups, group 1 received oral calcium and vitamin d and group 2 did not receive supplementation. patients in the supplemented group were given oral calcium 500 mg every 6 h and calcitriol 0.25 g every 6 h (shelcal ct, elder pharma., mumbai india) starting 7 days before surgery and continued for 7 days postoperatively. patients who did not receive any supplement were given therapy only when symptomatic hypocalcemia developed. the symptoms and signs of hypocalcemia that were monitored included paresthesia of fingertips and perioral area, tetany, neuropsychiatric manifestations, chvostek and trousseau signs, and electrocardiogram evidence of prolonged corrected qt interval by bazett 's formula. this monitoring was done by the surgical team. if severe hypocalcemia symptoms developed, intravenous calcium gluconate was given. tt was performed by experienced surgeons who were blinded as to which group the patients belonged. this was done so as to avoid bias in reporting and treating symptomatic hypocalcemia. during the surgical procedure, if all four parathyroid glands could not be observed during surgery, then the tt specimen was postoperatively examined for the missing gland. four patients in whom vascularity of parathyroid glands was compromised, parathyroid autotransplantation was done in the sternocleidomastoid muscles. the parathyroid glands were cleaned off all fat, sliced into pieces of size 1 mm 3 mm, placed in saline, and finally implanted into the muscle pockets. three to four slices of parathyroid tissue were grafted into single pocket and closed with a silk suture. serum calcium, magnesium, phosphate, albumin, creatinine were measured pre- and post - operatively at 6, 12, 24, 48, 72 h and then on follow - up on 30 day. all these biochemical measurements were done by beckman coulter au680 laboratory analyzer by standardized technique. this study needed minimum 3 days of hospitalization of patients to perform required tests. after being discharged from the hospital, patients were followed at day 30 of surgery at which time serum calcium and phosphate levels were again measured. paired t - test was used for comparison of paired samples, the student 's t - test was used for comparison of continuous variables between different groups, and chi - square test was used for categorical data analysis. p value was calculated as two - tailed and value < 0.05 was considered as statistically significant. in another analysis, pearson 's correlation coefficients were calculated between serum calcium at 24 h postoperatively and age, sex, weight, body mass index, grade of goiter, type of thyroid disease, and preoperative serum calcium level. of those variables found to be significantly associated with 24 h postoperative serum calcium, a multiple linear regression model was constructed and independently associated variables were ascertained. all analyses were performed by statistical package for social sciences statistical software version 20 (ibm spss statistics for windows, version 20 armonk, ny : ibm corp). paired t - test was used for comparison of paired samples, the student 's t - test was used for comparison of continuous variables between different groups, and chi - square test was used for categorical data analysis. p value was calculated as two - tailed and value < 0.05 was considered as statistically significant. in another analysis, pearson 's correlation coefficients were calculated between serum calcium at 24 h postoperatively and age, sex, weight, body mass index, grade of goiter, type of thyroid disease, and preoperative serum calcium level. of those variables found to be significantly associated with 24 h postoperative serum calcium, all analyses were performed by statistical package for social sciences statistical software version 20 (ibm spss statistics for windows, version 20 armonk, ny : ibm corp). the mean age, sex ratio, type of thyroid disease, surgical procedure performed, and preoperative calcium profiles were comparable between the two groups. twelve patients from group 2, and 3 patients from group 1 [table 2 ] developed symptomatic hypocalcemia (p < 0.01). laboratory hypocalcemia within postoperative 24 h was comparable between two groups, but more patients of group 2 compared to group 1 developed hypocalcemia at 48 h (6 and 13 respectively ; p = 0.04) and at 72 h after surgery (5 and 14 respectively ; p = 0.01) [figure 1 ]. intravenous calcium was given to four patients who developed tetany and all these belonged to group 2. hypercalcemia or other side effects did not develop in any of the patients receiving oral calcium and vitamin d. total calcium levels were lower in the group who did not receive any supplement than in the supplemented group [table 2 ]. in another analysis, we found that 24 h postoperative serum calcium level was significantly associated with grade of goiter, preoperative calcium level, and nature of thyroid disease (benign or malignant). the association was negative for grade of goiter and malignant disease while it was positive for preoperative calcium. the pearson 's correlation coefficients and two - tailed p values are depicted in table 3. on multiple linear regression analysis, preoperative serum calcium was the only independent significant variable in the development of 24 h post - tt hypocalcemia (standard coefficient = 0.62 ; p < 0.001) while grade of goiter approached significance (= 0.226 ; p = 0.056). the risk of 24 h post - tt hypocalcemia was increased 2.78-fold for patients who had a preoperative calcium < 9.00 mg / dl (odds ratio 8.14 ; 95% confidence interval 1.4745.18). baseline characteristics of supplemented (group 1) and not supplemented (group 2) postoperative calcium levels and hypocalcemia in supplemented (group 1) and not supplemented (group 2) number of patients developing hypocalcemia in the two groups correlation between 24 h postoperative calcium and other parameters in this randomized controlled study, we have shown that 7 day preoperative oral calcium and vitamin d supplementation continued into the postoperative period after tt significantly reduced laboratory and symptomatic hypocalcemia. moreover, the need for intravenous calcium administration due to carpopedal spasm was completely eliminated in the supplemented group while four patients of the control group required the same. although the improvement in calcemia at all tested post - tt time points was modest, it did not reach statistical significance. this may be explained by the small sample size and it would be constructive to include more patients in each group to elicit statistically significant results. hence, our study suggests the role of routine pre- and post - operative oral calcium and vitamin d supplements in decreasing the incidence and severity of hypocalcemia after tt although it does not completely eliminate the occurrence of postoperative hypocalcemia. the literature is replete with studies evaluating the effect of post - tt calcium and vitamin d supplementation on hypocalcemia. moore administered calcium at a dosage of 5 g / day to patients after bilateral thyroid resection and found that only 4 of 124 patients developed hypocalcemia and one required administration of intravenous calcium. hence, he recommended prophylactic use of oral calcium to reduce the risk of hypocalcemic crisis and increase the likelihood of early hospital discharge. conducted a prospective control study and reported that only 3 of 26 patients (11%) receiving oral calcium supplement (3 g / day) had symptoms related to hypocalcemia after tt, whereas 11 of 27 patients (40%) not receiving calcium supplement had symptoms. they also showed that the addition of vitamin d to oral calcium supplements was associated with significantly higher serum calcium concentrations on postoperative day 2 and 3, with a lower incidence of hypocalcemia. therefore, they recommended the early use of vitamin d in addition to calcium supplement in patients undergoing tt. these studies suggest that hypocalcemia after thyroidectomy can be prevented by routine administration of calcium supplements. a systematic review and meta analysis on nine such studies also showed a significant decrease in postoperative hypocalcemia in patients who received routine supplementation of oral calcium or vitamin d. the incidence decreased even more with the combined administration of both supplements. supplemented fifty consecutive patients undergoing tt with pre- and post - operative calcium and vitamin d. they found the incidence of symptomatic hypocalcemia to be 6% and that of laboratory hypocalcemia to be 10%. this study was poorly conceived in that no control group was included in it. in another prospective study, patients with graves disease managed over a 9-month period took 1 g of calcium carbonate three times a day for 2 weeks before tt. postoperatively, patients with untreated graves disease had lower serum calcium levels than pretreated patients or control subjects without graves disease. this study had a disadvantage that population was limited to patients with graves disease only. given these limitations, we designed the current study, whereby a control group with comparable attributes to the study group was chosen, patients had different indications of undergoing thyroidectomy, and the study group was supplemented with 7 day pre - tt calcium and vitamin d. the dosage and duration of calcium and vitamin d intake are also of concern. in the study by moore, patients were given oral calcium on an empirical basis as 5 g / day for 2 weeks. on this dose, one elderly patient became lethargic and developed hypercalcemia. in the trial conducted by bellantone., the dosage of calcium was 3 g / day and vitamin d was 1 g / day for 7 days after surgery and it did not lead to any complication. in our study, oral calcium 2 g / day and calcitriol 2 g / day were given preoperatively for 1 week and continued 1 week postoperatively. we found that 24 h postoperative serum calcium level was significantly associated with grade of goiter, preoperative calcium level, and nature of thyroid disease (benign or malignant). however, pre - tt serum calcium was the only independent association of 24 h post - tt hypocalcemia. it is likely that low normal calcium levels were the result of vitamin d deficiency, which itself has been shown to be one of the factors associated with post - tt hypocalcemia. the idea central to the inception and implementation of this study was the simplicity of its design and thus its applicability to resource - poor settings where ipth and 25-hydroxy vitamin d tests are not routinely available. although ipth testing has been shown to stratify patients into high- and low - risk for hypocalcemia and expedite an early discharge after tt, its role in prevention of hypocalcemia is not clear. we consider ipth measurement to be of limited utility in evaluating the efficacy of routine perioperative calcium and vitamin d supplementation for prevention of hypocalcemia. we also did not measure vitamin d in our patients given the fact that the prevalence of its deficiency is reported to be as high as 83% in our population. we intended to test the protocol of its routine perioperative supplementation and its side effects if any. the results of this study indicate that routine pre and post tt calcium and vitamin d supplementation can significantly reduce post operative hypocalcemia. we, therefore, suggest the same in the prevention of post tt hypocalcemia, which ultimately can also decrease prolonged hospitalization of patients and costs associated with multiple blood sampling. although the cause of hypocalcemia after tt is hypoparathyroidism, we did not test for pth to document it. moreover, role of vitamin d deficiency in causation of hypocalcemia after surgery is not clear from the present study as we did not measure vitamin d levels either. although the cause of hypocalcemia after tt is hypoparathyroidism, we did not test for pth to document it. moreover, role of vitamin d deficiency in causation of hypocalcemia after surgery is not clear from the present study as we did not measure vitamin d levels either. | background : total thyroidectomy (tt) is a commonly performed surgery and postoperative hypocalcemia is a major detriment to early discharge. the aim of this randomized controlled trial was to ascertain the usefulness of routine pre- and post - operative calcium and vitamin d supplementation in prevention of hypocalcemia after tt.materials and methods : sixty consecutive patients who underwent total or near tt from february 2013 to august 2014 were included in the study. they were randomly divided into two groups - group 1 received oral calcium (500 mg every 6 h) and vitamin d (calcitriol 0.25 mcg every 6 h) 7 days before and 7 days after the surgery ; and group 2 did not receive supplementation. symptoms and signs of hypocalcemia were monitored. calcium profile was measured pre- and post - operatively at 6, 12, 24, 48, 72 h, and on 30th day. hypocalcemia after surgery was either symptomatic or laboratory documented. serum calcium level 8.5 mg / dl was considered as laboratory hypocalcemia.results:twelve patients from group 2, and 3 patients from group 1 developed symptomatic hypocalcemia (p < 0.01). laboratory hypocalcemia within postoperative 24 h was comparable between two groups, but more patients of group 2 compared to group 1 developed hypocalcemia at 48 h (6 and 13, respectively ; p = 0.04) and at 72 h after surgery (5 and 14, respectively ; p = 0.01). twenty - four hours postoperative serum calcium level was significantly associated with grade of goiter, preoperative calcium, and nature of thyroid disease (benign or malignant). on multiple linear regression analysis, preoperative serum calcium was only independent variable significantly associated with development of 24 h post - tt hypocalcemia.conclusion:routine pre- and post - tt calcium and vitamin d supplementation can significantly reduce postoperative hypocalcemia. |
non - accidental ingestion of foreign bodies rarely occurs in adults but should be recognized as a risk factor in those with psychiatric illnesses or learning difficulties. we report a case of multiple magnet ingestion in an adult with learning difficulties, to highlight the associated abdominal complications. a 28-year - old man with learning difficulties presented with a 5-day history of abdominal pain and loss of appetite. there has been associated vomiting and diarrhoea. he lives with his mother, who is partially sighted and is his main carer. on admission, his white cell count was 14 10/l and c - reactive protein was 231. he was commenced on intravenous antibiotics and was planned for a diagnostic laparoscopy with the working diagnosis of appendicitis. frank pus was encountered from the umbilical laparoscopic port and prompted conversion to a midline laparotomy. a very tiny caecal perforation with inter - loop abscesses was seen. on further examination, a fistula tract was noted between ileum and hepatic flexure with a magnetic stick bridging the fistula. five magnetic sticks and one magnetic ball from the geomag toy were retrieved (fig. 1). the fistula tract was detached and the bowel was stapled with tlc 75 linear stapler. the caecal pole perforation was also dealt with tlc 75 linear stapler, without compromising the ileocaecal valve. a normal appendix was demonstrated but was removed to avoid future diagnostic difficulty considering the background of learning difficulties in this patient. the appendicular orifice was used to retrieve the magnetic sticks and balls. on - table x - ray screening revealed a further smooth circular magnet ; however, this was irretrievable. we left the single magnetin situ assuming that it would pass because of its smooth surface and that there were no other magnetic foreign bodies seen with the on - table screening. the patient made an uneventful recovery and passed the remaining magnet per rectum on the fifth postoperative day. a 28-year - old man with learning difficulties presented with a 5-day history of abdominal pain and loss of appetite. there has been associated vomiting and diarrhoea. he lives with his mother, who is partially sighted and is his main carer. on admission, his white cell count was 14 10/l and c - reactive protein was 231. he was commenced on intravenous antibiotics and was planned for a diagnostic laparoscopy with the working diagnosis of appendicitis. frank pus was encountered from the umbilical laparoscopic port and prompted conversion to a midline laparotomy. a very tiny caecal perforation with inter - loop abscesses was seen. on further examination, a fistula tract was noted between ileum and hepatic flexure with a magnetic stick bridging the fistula. five magnetic sticks and one magnetic ball from the geomag toy were retrieved (fig. the fistula tract was detached and the bowel was stapled with tlc 75 linear stapler. the caecal pole perforation was also dealt with tlc 75 linear stapler, without compromising the ileocaecal valve. a normal appendix was demonstrated but was removed to avoid future diagnostic difficulty considering the background of learning difficulties in this patient. the appendicular orifice was used to retrieve the magnetic sticks and balls. on - table x - ray screening revealed a further smooth circular magnet ; however, this was irretrievable. we left the single magnetin situ assuming that it would pass because of its smooth surface and that there were no other magnetic foreign bodies seen with the on - table screening. the patient made an uneventful recovery and passed the remaining magnet per rectum on the fifth postoperative day. foreign body ingestion is an uncommon problem in adults and without the relevant clinical history, a preoperative diagnosis may be difficult. however, psychiatric illness remains a significant risk factor for foreign body ingestion and clinicians should have a high index of suspicion for this even in the adult age group. abdominal x - ray was not performed in view of the potential clinical diagnosis of appendicitis. in hindsight, this would have helped in making the diagnosis of foreign body but would not have changed the management pathway in terms of surgical intervention due to raised inflammatory markers and peritonism. in our case, the patient has ingested multiple magnetic components of a children 's toy set branded geomag. the two opposite poles of the magnetic sticks were attracted to each other causing pressure necrosis and fistula formation between colon and small bowel. the same mechanism should have been the reason for the perforation of the caecum with subsequent migration of the magnets due to peristalsis. whilst multiple magnets can lead to complications such as intestinal obstruction, fistulation and perforation, we have also demonstrated that a single magnet can pass through the gastrointestinal tract without sequelae. in conclusion, multiple magnets within the gastrointestinal tract are shown to be associated with significant complications and approach considerations should differ to ingestions of other foreign bodies. in younger patients, we may perform magnetic resonance imaging of the abdomen instead of computerized tomography scan owing to the radiation risk. however, a magnetic resonance imaging scan would have been a disastrous investigation if we are not aware of these magnetic foreign bodies. this case highlights the routine need for abdominal x - ray in those with learning difficulties. multiple magnets may not pass spontaneously through the gastrointestinal tract and approach considerations should differ to ingestions of an isolated magnet or other foreign bodies.psychiatric illness and learning difficulties are risk factors for foreign body ingestion and preoperative diagnosis requires high index of suspicion.routine abdominal x - rays are required if the clinicians are planning an magnetic resonance imaging scan in this group of patients. multiple magnets may not pass spontaneously through the gastrointestinal tract and approach considerations should differ to ingestions of an isolated magnet or other foreign bodies. psychiatric illness and learning difficulties are risk factors for foreign body ingestion and preoperative diagnosis requires high index of suspicion. routine abdominal x - rays are required if the clinicians are planning an magnetic resonance imaging scan in this group of patients. | non - accidental ingestion of foreign bodies rarely occurs in adults. we report a case of multiple magnet ingestion in an adult with learning difficulties to highlight the associated abdominal complications. multiple magnets may not pass through the gastrointestinal tract spontaneously and approach considerations should differ from those who had ingested an isolated magnet or other foreign bodies. |
esophageal intramural pseudodiverticulosis (eipd) is a rare disease of unknown origin which was first described by mendl in 1960. in the majority of cases dysphagia, which sometimes slowly progresses, eipd is often associated with gastroesophageal reflux, chronic alcohol abuse, diabetes and candida infection, but its etiology and pathogenesis remain obscure [2, 3 ]. it often complicates severe stricture, which makes double contrast esophagogram and computed tomography more useful than esophagogastroduodenoscopy (egd) in diagnosing eipd. the former two procedures reveal multiple, small, flask - shaped outpouchings in the wall of the esophagus, which are the characteristics of eipd. almost all cases of eipd are benign and responds well to medical treatment for inflammation and to endoscopic dilatation of the esophagus [2, 3 ]. we here report a suggestive case of a severe form of eipd whose dysphagia was ameliorated not by endoscopic dilatation therapy but by oral administration of anti - fungal medicine. a 59-year - old man suffered from dysphagia since 1995, but he did not consult any hospital until the symptom worsened in 2008. when he consulted a nearby hospital, egd revealed severe constriction in the thoracic esophagus, and he was referred to our hospital for treatment. he had undergone subtotal gastrectomy with billroth ii reconstruction for gastric ulcer when 40 years old. physical examination showed no unusual findings, but laboratory data showed anemia (hb : 10.1 g / dl), low serum albumin (3.5 g / dl) and slight increase of tumor marker scc (1.9 ng / ml ; normal limit 01.5 ng / ml). the esophageal lumen was slightly dilated on the oral side of the narrowing, where several sac - like barium collections (up to 12 cm in diameter) protruded. the barium barely thread through a 5- to 6-cm - long segment of severe narrowing, and the anal side of the narrowing only slightly appeared on the radiography (fig. esophagoscopy revealed a severe, fibrotic stenosis 26 cm from the incisors. on the oral side of the stenosis a thin - caliber endoscope (6-mm outside diameter ; olympus xp260n) barely passed through this narrowed region where the esophageal mucosa was not ulcerated (fig. then a large number of tiny orifices corresponding to pseudodiverticula were identified along the anal side of the stenotic region (fig. computed tomography revealed wall thickening and small gas collection, which corresponded to pseudodiverticula, in the wall of the upper to middle thoracic esophagus. as endoscopic examination revealed a severe fibrotic stenosis, endoscopic mechanical dilatation therapy was applied to this patient rather than medical treatment in expectation of prompt resolution of symptoms. we repeatedly performed endoscopic balloon dilatation (ebd) for the esophageal constriction, but the effect was very limited, and the dysphagia relapsed with esophageal re - stenosis shortly after the treatments. we then tried making an incision in the esophageal mucosa endoscopically using an it knife. this treatment improved his symptom and radiography also showed improvement of the constriction, but the dysphagia gradually worsened, and 6 months after the treatment, egd revealed re - stenosis of the esophagus. he showed progressed malnutrition due to severe dysphagia and had lost 5 kg of body weight during 6 months. since a white, thick, creamy liquid suggestive of pus emerging from the orifices was sometimes detected endoscopically (fig. 3a, b) and candida albicans was detected in pas staining of the biopsy specimen, we began giving this patient an anti - fungal medicine in addition to performing ebd therapy, and these treatments greatly improved his dysphagia. egd revealed significant improvement of the esophageal constriction and disappearance of the pus, although multiple small depressions remained in the entire esophagus (fig. radiography showed significant improvement in the flow of swallowed barium, although there still remained a clumped filling defect in the upper thoracic esophagus (fig. it was also revealed by repeated radiography that very small (13 mm), multiple, flask - shaped outpouchings were diffusely distributed in the esophagus on the anal side of the narrowing (fig. the patient required continuous anti - fungal medicine because his symptom quickly worsened after temporary discontinuation of the medication. it is now 24 months since we began anti - fungal treatment, and he is still symptom - free with no severe constriction detected on egd. eipd is characterized by the development of multiple, epithelium - lined cysts within the esophageal wall ; each cyst connects to the esophageal lumen via a narrow ostium. the cysts connected to the esophageal lumen result from ductal dilatation of the esophageal submucosal glands and excretory ducts, displaying multiple pseudodiverticula radiologically [2, 3 ]. in the present case, characteristic, multiple, tiny, flask - shaped outpouchings were identified in the esophagus along the anal side of the narrowing. on the other hand, the esophageal mucosa on the oral side of the narrowing showed greater barium collection as occurs in fistula formation, which is somewhat unusual for eipd and could have resulted from the branching or bridging between adjacent diverticula. the long period before receiving medical care and concomitant candida infection could be responsible for the unusual shape of eipd in this case. since the first case report of eipd in 1960, there have numerous case reports and reviews concerning this rare esophageal disorder [2, 3, 5 ], but the present case could represent a most advanced condition of eipd, considering that the swallowed barium barely thread through the stricture and esophagoscopy revealed a stiff, fibrotic stenosis. previous reports documented that, while oral administration of medication is employed for patients with eipd accompanied by esophagitis or esophageal candidiasis, ebd has been carried out for patients with severe constriction [2, 3 ]. our case was resistant to endoscopic mechanical dilatation therapy, although previous reports consistently described that endoscopic dilatation of the stricture usually gives immediate and long - lasting relief of dysphagia in eipd [2, 3, 6, 7 ]. in addition, this was the first attempt to treat severe stenosis of eipd with endoscopic incision therapy, which has been successfully applied for the dilatation of benign strictures of the esophagus due to other causes, but this therapy also showed only a limited effect for resolution of the dysphagia in our case. remarkably, in spite of failures with endoscopic mechanic dilatation treatments for the severe stricture, oral administration of anti - fungal medication turned out to be effective in the treatment of eipd, leading to long - lasting resolution of the dysphagia in the present case. re - examination by radiography and egd during the anti - fungal medication showed that the constriction of the esophagus had also improved, although the tiny diverticula did not resolve after the treatment. subsequently, the patient required continuous anti - fungal medication for sustained improvement of the dysphagia. the first is an obstruction of the ducts due to inflammatory cells or desquamated epithelium, and the second is compression of the ductal orifices due to periductal infiltrates and/or fibrosis [2, 3, 9 ]. previous reports showed that c. albicans infection is frequently present in eipd, and such infection may be involved in the etiology of eipd in either mechanism [2, 3 ]. the clinical course of our case also suggests a significant contribution of candida infection in the exacerbation of the eipd. in the present case, in addition to pre - existing chronic fibrosis of the esophageal wall, concomitant inflammatory cellular infiltration triggered by candida infection may have worsened the stricture of eipd, possibly by enhanced intramural pressure in the narrowed esophagus. in conclusion, we experienced a case of an advanced stage of esophageal stricture derived from eipd, which was resistant to endoscopic mechanical dilatation therapy. even in such a severe case, anti - fungal medication was still effective in relieving the persistent dysphagia. an important lesson of this case is that anti - fungal medication, rather than endoscopic dilatation therapy, could be considered as a first - line therapy against dysphagia and constriction in eipd regardless of the severity of the esophageal constriction. | esophageal intramural pseudodiverticulosis (eipd) is a rare disease of unknown etiology that displays multiple pseudodiverticula radiologically, leading to benign esophageal stricture. dysphagia, which sometimes slowly progresses, is the main symptom in the majority of cases. we here report a 59-year - old male eipd patient who suffered from severe dysphagia. radiography and endoscopy of this patient disclosed a severe constriction in the upper thoracic esophagus. although we tried several endoscopic procedures including frequent endoscopic balloon dilatation (ebd), the effect was very limited and his dysphagia relapsed shortly after the treatments. during the procedures, we noticed some white, thick, creamy liquid emerging from the orifices of eipd, and pas staining of biopsy specimens revealed infection with candida albicans. hence, the patient was given anti - fungal medicine in addition to ebd. the additional treatment with anti - fungal medicine dramatically improved his symptoms and the esophageal constriction. this case suggests that anti - fungal treatment is an effective first - line therapy even against a severe form of esophageal constriction in eipd. |
severe sepsis, septic shock, and the resulting multiple organ failure / dysfunction syndrome represent an ongoing challenge in intensive care units [15 ]. with mortality ranging from 40% to 70%, septic shock is the most common cause of death in intensive care medicine [2, 6 ]. despite intensive basic research and clinical studies, inflammation leads to oxidative stress because of the production of reactive oxygen species (ros). oxidative stress is a major contributing factor to the high mortality rates associated with several diseases such as endotoxic shock. immune cells therefore need adequate levels of antioxidant defenses in order to avoid harmful effects of an excessive ros production and to keep a well - balanced redox homeostasis. in this context, two substances have recently become of great interest : (1) macrophage migration inhibitory factor (mif), a proinflammatory protein, which is released by immune cells and shows elevated levels in sepsis syndrome, as well as (2) human thioredoxin-1 (trx1), a potent antioxidant that modulates inflammation, cell growth, and apoptosis, which seems to counteract the proinflammatory and pro - oxidant effects of mif [79 ]. therefore, these two biomarkers appear to be central hubs in the inflammatory setting and are therefore of great interest. however, no sufficient knowledge exists about the role of these key mediators in severe sepsis or septic shock. the aims of this study were therefore twofold : (1) to assess the plasma levels of each parameter in different inflammatory settings (healthy volunteers, postoperative, and septic patients) and (2) to establish whether plasma levels of trx1 and mif correlate with each other. the observational clinical study was approved by the local ethics committee and was conducted in the surgical and medical intensive care units of the university hospitals of heidelberg and mannheim, germany. all study and control patients or their legal designees signed written informed consent. in total, 61 individuals in three groups were enrolled in the study (table 1). the three groups included 15 patients with severe sepsis or septic shock (referred to as the septic group), 28 patients after major abdominal surgery (the postoperative group), and 18 healthy volunteers (the volunteer group). the 15 patients were classified as having severe sepsis or septic shock based on the criteria of the international sepsis definitions conference. in contrast, patients with an onset of sepsis syndrome > 24 hours were excluded from the study. the management of patients with severe sepsis or septic shock in the intensive care unit included early goal - directed therapy (according to rivers and colleagues), elimination of the septic focus, and broad - spectrum antibiotics [12, 13 ]. the second group included 28 patients undergoing major abdominal surgery, with negative parameters for systemic inflammatory response syndrome (table 1). as a control group, we chose 18 healthy young volunteers without any signs of infection (table 1). blood samples from patients with severe sepsis were collected within 24 hours after the diagnosis of sepsis, and also 24 and 48 hours later. in the septic group, severity of illness was estimated using the acute physiology and chronic health evaluation (apache) ii score as well as the sequential organ failure assessment (sofa) score and the simplified acute physiology score (saps) ii. patients with sepsis were re - evaluated for survival 90 days after enrollment in the study. this evaluation was performed using available hospital records. in case of the patient 's discharge from the hospital, the family doctor was contacted. if necessary, we furthermore got in contact with the patient himself. blood samples from the postoperative group were collected once immediately after surgery, and the samples from the volunteer group were taken one time. after blood collection, plasma of all study participants was immediately obtained by centrifugation, transferred into cryotubes, and stored at 80c until further processing. human interleukin-6 (il-6) was measured in order to determine the ongoing inflammatory response. therefore, we measured plasma levels of human thioredoxin-1 (trx1) and macrophage migration inhibitory factor (mif). we used elisa kits to determine plasma concentrations of interleukin-6 (il-6, r&d systems, minneapolis, mn, usa), human thioredoxin-1 (human trx1, labfrontier co., ltd, seoul, korea), and macrophage migration inhibitory factor (human mif, raybiotech, inc., norcross, ga, usa) according to the manufacturers ' instructions. all assays were performed in duplicate. the resulting study data were entered into an electronic database (microsoft excel 2002, microsoft corporation, redmond, wa, usa) and evaluated using spss software (statistical product and services solutions, version 16.0, spss inc, chicago, il, usa). categorical data were summarized by means of absolute and relative frequencies (counts and percentages). quantitative data were summarized using the number of observations, mean and standard deviation, minimum, median with quartiles, or differences of the quartiles and maximum. wherever appropriate the kolmogorov - smirnov test was applied to check for normal distribution. due to abnormally distributed data, nonparametric methods for evaluation were used (chi - square test for categorical data, mann - whitney u - test as well as wilcoxon test for continuous data). correlation analysis was performed using two - sided spearman 's rank correlation test as well as pearson 's product - moment correlation test. a p value <.05 was considered statistically significant. concerning symbolism and higher orders of significance : p <.05 :, p <.01 :, p <.001:. age and sex of patients in the septic (61 years ; 9 male sex) and postoperative (62 years ; 15 male sex) groups were comparable (table 1). in the septic group, patients who survived or died showed no significant differences in their demographic data (data not shown). in contrast, healthy volunteers (35 years ; 10 male sex) were significantly younger compared with the septic and postoperative groups (table 1). in the septic group, 8 of 15 patients (53.3%) survived (table 1). the primary site of infection in the septic group was the gastrointestinal tract (6 patients, 40.0%). furthermore, the septic focus was found to be in the respiratory tract (3 patients, 20%) or dedicated as a surgical complication (3 patients, 20%) (table 1). a positive culture from the site of infection was obtained in 67% of all septic patients. in these patients, cultures were found to be gram - negative in 70% and gram - positive in 30%. patients in the postoperative group primarily underwent surgery of the pancreas, whereas surgeries of the colon, liver, and the genitourinary tract were less frequent (table 1). septic patients were considered to be severely injured during the entire study period, as assessed by the apache ii, sofa, and saps ii score, but showed no significant differences between the surviving and nonsurviving subgroups of septic patients (table 2). plasma levels of il-6 were significantly elevated at the onset of sepsis compared with the postoperative and the volunteer groups (figure 1 and table 3). furthermore, plasma levels of il-6 were significantly elevated in the postoperative group compared with healthy volunteers (figure 1 and table 3). in the septic group, the level of il-6 decreased significantly within 24 hours after sepsis onset (t0 t24 : p =.021, t24 t48 : p =.225, t0 t48 : p =.075), but still remained significantly higher than the volunteer group (t24 : p <.001, t48 : p <.001) (figure 1). il-6 levels did not differ between the surviving and nonsurviving subgroup of septic patients at any time (table 2). the plasma levels of trx1 were significantly elevated at the time of diagnosis of sepsis, compared with levels in the postoperative and volunteer groups (figure 2 and table 3). trx1 plasma levels decreased significantly within 48 hours after sepsis onset (t0 t24 : p =.046, t24 t48 : p =.715, t0 t48 : p =.028), but still remained significantly elevated than the volunteer group (t24 : p =.114, t48 : p =.042). in comparison to the postoperative group, trx1 plasma levels of septic patients failed scarcely to show a significant difference at t24, as well as t48 (t24 : p =.061, t48 : p =.069) (figure 2). trx1 plasma levels did not differ between the postoperative and volunteer groups (trx1 : p =.458) (figure 2 and table 3). furthermore, between the surviving and nonsurviving subgroups of septic patients, trx1 plasma levels did not show any significant difference (table 2). the plasma levels of mif were significantly elevated at the time of diagnosis of sepsis, compared with levels in the postoperative and volunteer groups (figure 3 and table 3). mif plasma levels decreased significantly within 48 hours after sepsis onset (t0 t24 : p =.050, t24 t48 : p =.893, t0 t48 : p =.028), but still remained significantly elevated than the volunteer group (t24 : p =.030, t48 : p =.048) and the postoperative group (t24 : p =.023, t48 : p =.069) (figure 3). mif plasma levels did not differ between the postoperative and volunteer groups (mif : p =.954) (figure 3 and table 3). furthermore, between the surviving and nonsurviving subgroups of septic patients, mif plasma levels did not show any significant difference (table 2). a correlation analysis using two - sided spearman 's rank correlation test, as well as pearson 's product - moment correlation test, indicated a strong correlation between trx1 and mif plasma levels in patients with severe sepsis or septic shock especially at the onset of sepsis syndrome (t0 : rsp = 0.720, = 0.698) and 24 hours later (t24 : rsp = 0.771, = 0.949) (figure 4). in contrast, between trx1 and il-6 plasma levels as well as between mif and il-6 plasma levels in septic patients, no significant correlations could be observed at the onset of sepsis (trx / il-6, t0 : rsp = 0.143, = 0.106 ; mif / il-6, t0 : rsp = 0.029, = 0.127) and 24 hours later (trx / il-6, t24 : rsp = 0.107, = 0.087 ; mif / il-6, t24 : rsp = 0.310, = 0.232). the present study demonstrates that proinflammatory/~oxidative (macrophage migration inhibitory factor, mif) as well as anti - inflammatory/~oxidative (human thioredoxin-1, trx1) agents are significantly raised in patients with severe sepsis and septic shock. positive correlations between these two mediators may suggest a linked role in the pathophysiology of sepsis. severe sepsis as well as septic shock and related multiple organ dysfunction syndrome is still the most common cause of death in intensive care medicine [16 ]. not surprisingly, different markers of systemic inflammation (e.g., il-6) and mediators involved in the redox homeostasis (e.g., trx1, mif) are significantly elevated during ongoing sepsis, whereas only il-6 differed between patients after major abdominal surgery and healthy volunteers. this reflects generalized infection during sepsis, while patients after major abdominal surgery experience only a mild activation of their inflammatory system. concentrations of il-6 peak 24 hours after the surgical procedure and return to the baseline value in a few days in noninfected patients. in accordance to our investigation, il-6 peak concentrations the highest il-6 serum / plasma concentrations are reached during sepsis, therefore it appears to be a good marker of the severity of infection [20, 21 ]. (human) thioredoxin-1 (trx1) is an anti - inflammatory agent, whose anti - inflammatory effects are not yet completely understood. trx1 is a redox - sensitive molecule that has pleiotropic cellular effects, functioning as a protective cellular antioxidant and regulator of transcription factor activity [2227 ]. together with the trx - reductase and nadph, trx1 represents a major intracellular reducing agent containing a redox - active disulfide / dithiol within the conserved active site sequence cys - gly - pro - cys, and therefore protecting cells from oxidative stress [2227 ]. beside these antioxidative effects, trx1 plays an important role in the modulation of the immune system by regulating dna binding of several transcription factors (e.g., p53, nfkappab, activator protein-1) [2830 ]. several investigations have shown that extracellular levels of trx1 are increased in conditions of oxidative stress and inflammation [7, 3039 ]. in accordance to these investigations, the present study was able to demonstrate that plasma trx1 levels were significantly higher in patients with sepsis compared to healthy volunteers and postoperative patients. the elevated plasma levels of trx1 then most likely reflect the increased oxidative stress in septic patients. in the literature, it was demonstrated that increased trx1 plasma levels induced resistance to harmful conditions in animal models (e.g., lps - induced acute hepatitis, cecal ligation, and puncture) [4047 ] due to the ability of trx1 to relieve local oxidative stress and to modulate neutrophiles extravasation into sites of inflammation. furthermore, trx1 seems to be able to counteract the proinflammatory and pro - oxidant effects of macrophage migration inhibitory factor (mif). mif is another member of the trx superfamily, but functions as a classical proinflammatory cytokine. macrophage migration inhibitory factor (mif) activates t - cells and macrophages, amplifies the production of other proinflammatory cytokines, and upregulates the expression of toll - like receptor-4 (tlr-4) by phagocytes. because of the prevention of p53-dependent apoptosis of activated macrophages, high concentrations of mif result in sustained inflammatory responses accordingly, we were also able to demonstrate significantly higher mif - levels in patients of the septic group in comparison to patients of the postoperative or volunteer groups. mif is secreted by leukocytes, and its synthesis is induced by bacterial endo- and exotoxins and several proinflammatory mediators (tumor necrosis factor-/tnf-, interferon-/ifn-, complement factor 5a / c5a). for the acute phase of sepsis, it has been demonstrated that high plasma levels are harmful and correlate with sepsis severity. the neutralization of mif results in an attenuation of the inflammatory response and improved survival in experimental sepsis [8, 50 ]. in the light of these observations, the relationship between trx1 and mif in sepsis is of great interest. to our knowledge, only little work has been done so far in simultaneously determining plasma levels of trx1 and mif in human sepsis or septic animal models. in accordance to the results of leaver and colleagues, we were able to show raised plasma levels of trx1 and mif in patients with sirs / sepsis, whereby plasma levels of trx1 and mif showed a unique correlation. unfortunately, neither trx1 nor mif showed significant differences between the surviving and nonsurviving subgroups of the septic patients and therefore could not be used as an early predictor for survival in patients with severe sepsis or septic shock. this may be due to the small cohort of septic patients, so a re - evaluation in a larger cohort of septic patients needs to be performed. furthermore, the detailed mechanisms of interaction between trx1 and mif are not yet completely understood. recently suggested that cell surface trx1 serves as one of the mif binding molecules or mif - receptor components and inhibits mif - mediated inflammatory signals. as a possible limitation of this investigation, the significant lower age of healthy volunteers in comparison to the postoperative group as well as the septic group has to be stated. at last, we are not able to estimate exactly the influence of patients ' age on the redox marker measurements in the different study groups. unfortunately, many previously published investigations dealing with these parameters are afflicted with the same problem [47, 51 ]. nevertheless, it remains unlikely that the factor age might have considerably influenced the presented study results, since trx1 and mif plasma levels showed significant differences in patients of the same age (postoperative cohort versus septic cohort) and were comparable in patients of significant different ages (healthy volunteers versus postoperative cohort). due to the positive correlations of trx1 and mif, our investigation supports a linked role of these two mediators in the pathophysiology of sepsis. this has important implications for further research on the pathogenesis of severe sepsis or septic shock. in summary, our results suggest that substances involved in the redox homeostasis (e.g., trx1, mif) represent central hubs in the septic inflammatory response, as assessed by significantly elevated plasma levels of these mediators in patients with severe sepsis or septic shock. proinflammatory/~oxidative and anti - inflammatory/~oxidative agents show a high correlation in order to maintain a redox homeostasis and to avoid harmful effects of an excessive inflammatory / oxidative response. for this reason, the detailed mechanisms of the trx1 and mif interaction, as well as their use as possible targets for therapeutic manipulation, represent areas for further research. | background. redox active substances (e.g., thioredoxin-1, macrophage migration inhibitory factor) seem to be central hubs in the septic inflammatory process. materials and methods. blood samples from patients with severe sepsis or septic shock (n = 15) were collected at the time of sepsis diagnosis (t0), and 24 (t24) and 48 (t48) hours later ; samples from healthy volunteers (n = 18) were collected once ; samples from postoperative patients (n = 28) were taken one time immediately after surgery. in all patients, we measured plasma levels of il-6, trx1 and mif. results. the plasma levels of mif and trx1 were significantly elevated in patients with severe sepsis or septic shock. furthermore, trx1 and mif plasma levels showed a strong correlation (t0 : rsp = 0.720, = 0.698/t24 : rsp = 0.771, = 0.949). conclusions. proinflammatory/~oxidative and anti - inflammatory/~oxidative agents show a high correlation in order to maintain a redox homeostasis and to avoid the harmful effects of an excessive inflammatory / oxidative response. |
one of the goals of occupational therapy is to help improve the performance of functional tasks in daily life1. in particular, hand and upper extremity activities play an important role in tasks of daily living such as dressing, using a keyboard, eating and so forth2. one of the important systems involved in functional tasks of the hand and upper extremity is the mobility of the wrist. the wrist uses various movements such as flexion, extension, ulnar deviation, and radial deviation ; pronation and supination may also be used in coordination with the elbow joint4. the complicated structure and high mobility of the wrist often results in various types of disorder. wrist joint restriction affects the movement of other joints and causes subsequent problems such as pain. such problems affect the upper extremity functional activities, which are important goals of occupational therapy. hence, it is necessary to objectively evaluate the changes in mobility that might take place due to wrist joint restriction during upper extremity functional activities. the % isolation method can be implemented to examine the pattern of muscle changes due to wrist joint restriction. since muscle activation may result from reflex activity and fatigue as well as muscle contraction5, measuring the changes in % isolation of muscles demonstrate how wrist joint restriction changes muscle patterns during upper extremity functional activities. this study measured the % isolation in upper extremity functional movements related to wrist joint restriction in order assess changes in mobility of the shoulder, forearm and wrist. the purpose and procedure of the study were fully explained to students at s college, suncheon, jeonnam. we then included 20 individuals (15 women and 5 men) in the study who agreed to participate in the experiment and signed the consent form. the chosen subjects were all right - handed, and had neither congenital malformation of the upper extremity nor past functional disorder of the wrists or upper extremities. they had no medical history in terms of orthopedics, neurology, or pathology. all the participants read and signed an informed consent form, and the inje university ethics committee for human investigations gave ethical clearance prior to their participation. this study was performed from february 25, 2012 to march 10, 2012. milan, italy), a surface wireless electromyography system was used to measure muscle activation. it has eight electromyogram (emg) channels and uses wi - fi technology for wireless data transmission. to examine the muscle activation with and without wrist joint restriction, electrodes were attached to the upper trapezius, middle deltoid, biceps brachii, triceps brachii, flexor carpi radialis, and extensor carpi radialis6. in attaching the surface electrodes, the procedures used by cram, kasman and holtz7 were adopted at the electrode locations. hair was removed using a razor blade to minimize skin resistance to electromyographic signals, and the area was washed with disinfectant alcohol twice or three times to remove the horny layer. the wrist orthosis used for wrist joint restriction was a commercially available, portable, short - wrist orthosis (sp-872) which is used to minimize wrist joint movement to prevent and heal pains generated by various wrist disorders (special protectors co., inc. this study employed manipulation activities that directly involve the wrist joint in the manual function test (mft) to evaluate upper extremity functional activities. mft is a standardized tool that was developed to evaluate damaged motion functions of the upper extremity and objectively analyze the recovery process8, and it is the most frequently used tool of its kind in korea9. the evaluation order and instructions were based on the standardized method of the mft. the % isolation indicates the role of each muscle as a percentage of the total activity of all the muscles used in the task. for example, if the % isolation value of the upper trapezius was 100%, it would mean that the other muscles did not work at all during the task. spss 12.0 version was used for the statistical processing for the data analysis in this study. wilcoxon s test was employed to analyze changes in % isolation between with and without wrist joint restriction in the mft tasks. in the grasping task, changes in % isolation of the muscles were shown between with and without wrist joint restriction (table 1table 1. % isolation for the grasping task (unit : % isolation)musclewithout restrictionwith restrictiongraspingupper trapezius35.5740.93middle deltoid11.4911.95biceps brachii6.906.68triceps brachii6.806.64extensor carpi radialis22.7515.19flexor carpi radialis16.4918.61p<0.05). without wrist joint restriction, the % isolation of the upper trapezius was 35.57 12.21%, and it increased significantly to 40.93 19.78% (p<0.05) with wrist restriction. in contrast, the % isolation of the extensor carpi radialis decreased significantly from 22.75 11.39% without wrist joint restriction to 15.19 7.04 with wrist joint restriction (p<0.05). in the pinching task, changes in the % isolation of muscles were observed between with and without wrist joint restriction (table 2table 2. % isolation for the pinching task (unit : % isolation)musclewithout restrictionwith restrictionpinchingupper trapezius25.2839.77middle deltoid13.9313.57biceps brachii6.046.35triceps brachii9.949.57extensor carpi radialis17.038.8flexor carpi radialis27.7821.94p<0.05). without wrist joint restriction, the % isolation of the upper trapezius was 25.26 20.06%, whereas with wrist joint restriction, it significantly increased to 39.72 32.69% (p<0.05). in contrast, the % isolation of the extensor carpi radialis without wrist joint restriction changed significantly from 17.03 8.17% to 8.84 5.16% with wrist joint restriction (p<0.05). in the carrying a cube task, there were changes in the % isolation of the muscles between with and without wrist joint restriction (table 3table 3. % isolation for the carrying a cube task (unit : % isolation)musclewithout restrictionwith restrictioncarrying a cubeupper trapezius24.7939.28middle deltoid7.7513.29biceps brachii7.996.94triceps brachii10.915.93extensor carpi radialis18.8812.2flexor carpi radialis29.6822.06p<0.05). without wrist joint restriction, the % isolation of the upper trapezius was 24.76 16.19%, and it increased to 40.25 28.17% in the presence of wrist joint restriction. in contrast, the % isolation of triceps brachii, extensor carpi radialis, and flexor carpi radialis changed from 10.91 11.71%, 18.88 8.02%, and 29.68 18.16%, respectively, in the absence of wrist joint restriction to 5.93 4.18%, 12.50 5.33%, and 22.09 16.66%, respectively, in the presence of wrist joint restriction. the decreases were statistically significant (p<0.05). in the peg - board task, there were changes in the % isolation of muscles between with and without wrist joint restriction (table 4table 4. % isolation for the peg - board task (unit : % isolation)musclewithout restrictionwith restrictionpeg - boardupper trapezius31.9341.82middle deltoid11.2313.47biceps brachii6.547.75triceps brachii5.894.39extensor carpi radialis18.4813.96flexor carpi radialis25.9318.61p<0.05). without wrist joint restriction, the % isolation of the extensor carpi radialis was 18.48 8.27% ; this changed to 13.96 5.64% with wrist joint restriction. the % isolation of the flexor carpi radialis changed from 25.93 19.58% without wrist joint restriction to 18.61 12.89% with wrist joint restriction. in the grasping, pinching, and peg - board tasks, % isolation of the upper trapezius increased significantly. in the carrying a cube task, this is in line with the results of various other studies, which showed that restricted wrist joints increase shoulder movement and muscle fatigue11,12,13. mobility of the elbow and hand joints is essential for the effective use of the hand, as well as the stability of the shoulder and elbow joints14,15,16. thus, it is thought that wrist joint restriction significantly decreases the stability of the shoulder joints. in the grasping and pinching tasks, finger flexors include extrinsic muscles extending from the forearm as well as intrinsic muscles within the palm17. in the grasping and pinching tasks, the wrist creates a flexion phenomenon because the finger flexor ligaments contract with the finger flexor18. in this process, the wrist extension muscles are activated to resist wrist flexion in order to maintain wrist stability19. thus, it is thought that wrist joint restriction significantly decreases the % isolation of the wrist extension muscles when grasping and pinching motions are carried out. in the carrying a cube task, in particular, the triceps brachii showes increased muscle activity with pronation of the forearm21 ; for example, picking up and holding objects above a desk, requires pronation of the forearm at 459522. in other words, forearm pronation increases the muscle activity of the triceps brachii, and wrist joint restriction results in restricted pronation ability of the forearm. as a result, shoulder abduction and elevation increases, whereas the % isolation of the triceps brachii decreases. first, the study was conducted with healthy subjects, not persons with wrist joint restriction. disorders that may cause wrist joint restriction pose other risks in addition to wrist joint restriction alone. second, this study was limited to subjects who were in their 20 s, and biomechanics may change with age23. the fact that disorders of the wrist might affect different age categories was not considered in this study. one of the major factors that may affect wrist joint restriction is wearing an orthosis. a wrist orthosis is frequently used to provide wrist stability to those with various musculoskeletal system disorders. it is also indicated that compensation frequently occurs in relation to the use of wrist orthoses. since those with musculoskeletal system disorders such as arthritis, fracture and carpal tunnel syndrome can return to their daily routine with the aid of an orthosis, it is necessary for the wearers to learn how to manage compensation by themselves. the results of this study may be used as a treatment and education tool, as they provide information on changes in muscle patterns and compensation related to functional activities. using such information, therapists can predict whether mobility should be facilitated or restricted in order to help and improve the quality of life of those with wrist joint restriction through treatment and educational sessions. | [purpose ] this study measured % isolation and investigated whether it shows a difference between the presence and absence of wrist joint restriction, as well as changes in muscle activity patterns. [methods ] twenty subjects performed upper extremity functional movement in the manual function test (mft) with and without wrist restriction, and the muscle activities of the trapezius, middle deltoid, biceps brachii, triceps brachii, extensor carpi radialis, and flexor carpi radialis were recorded. when there were differences in muscle activation, % isolation was implemented and the changes in the muscle activity patterns were noted. [results ] in the grasping and pinching tasks, there was a significant increase in % isolation of the upper trapezius and a significant decrease in % isolation of the extensor carpi radialis. carrying a cube task, % isolation of the upper trapezius and middle deltoid significantly increased, whereas % isolation of the triceps brachii and extensor carpi radialis significantly decreased. in the pegboard task, the % isolation values of the extensor carpi radialis and flexor carpi radialis significantly decreased. [conclusion ] the data of this study should be useful for therapists, who can employ the information as material for the education and treatment of patients with wrist joint restriction. therapists may thus look for ways to improve the quality of mobility by predicting the complement mobility depending on the activity performed and then determine whether to facilitate or restrict mobility. |
as in most other developing nations, critical care medicine as a specialty has developed very slowly and only recently in india. the coronary care units were developed in the early to mid-1970s. perhaps the main pioneer of the field of critical care in india was farokh e udwadia, a brilliant physician with international training in pulmonology. in the mid 1970s, udwadia developed the first respiratory care units in the country in two hospitals in mumbai a community hospital and a private one. the most major achievement of these units was not only to bring down the mortality of tetanus, but also to open the eyes of society to the need for critical care services. organized critical care training or programmes did not materialize, however, and it was left to individual interested trainees to go abroad and receive training. although the speciality was being practiced in isolated foci of hospital practices, the first few ripples in this field were created by consultants returning to india after training abroad in the united kingdom, in the united states, and in australia. the initial centres of such activity were mumbai, pune and chennai, and they still remain the centres of academic creativity and administrative ability. these few enthusiastic, trained consultants came together in 1992 to discuss critical care on a common platform, and they formed the national indian society of critical care medicine (isccm). the society had its teething troubles and has now established itself very firmly as a representative body of critical care consultants in india. the current practice of critical care in india is a matter of as much diversity as the country itself. there are three types of hospitals in india that are delivering patient care in india. community hospitals are mostly run by the government and essentially result in no cost to the patients. critical care is a branch that involves a lot of technology and therefore is dependent on finances. hence, there have been limitations to the growth of this branch in community hospitals. additionally, there are more than 1000 district hospitals. only a small proportion (< 10%) of all these hospitals, however, patients are levied a charge for these services that is proportional to their income ; there are also a small percentage of beds that are provided for free. as per the current estimation, icus in private tertiary care hospitals are usually very well equipped and thus form the most major contributor to the critical care facilities in the country, albeit at a higher cost to the patient. finally, an interesting segment of health care facilities in india consists of small hospitals or nursing homes. modestly equipped, and managed mostly by medical professionals themselves, these are realities representing the vast middle and lower classes, and they contribute about 40% of available beds for the country. the need and the viability of facilities for critical care are being acknowledged by this segment, and currently the facilities are on the upswing. the certificate course in critical care, the first organized training activity in critical care medicine, was started 4 years ago by the isccm and has been evolving well. a number of hospitals have developed training modules, and more students are coming out of this training programme regularly. the isccm has also been very active in interacting with various medical councils in india. as a result, the postdoctoral fellowship in critical care medicine conducted by the national board of examinations has recently been announced. with this, the first steps for training in critical care on a national level curriculum are now being taken. the training of nurses, technicians, and therapists has begun in some isolated foci but has not evolved into a meaningful training activity. the patterns of medical problems seen in indian icus are dissimilar to those seen elsewhere. a number of tropical infections such as malaria, leptospirosis, tuberculosis, salmonellosis, etc. form a significant proportion of the patients. playing its part in the development of this new speciality, the isccm has taken the lead in the development of a number of other related issues. the cpr training project and the development of an independent, dedicated organization like the resuscitation council of india has been felt by many who have been working in this field. along with other like - minded societies, development of guidelines for the working of icus has been another important issue that the isccm has taken up. the guidelines are currently being formulated. for a country that has it own set of problems the indian journal of critical care medicine is the official journal of the society and is the only mouthpiece of the organization. the society has redesigned and activated its website (), so one can now have access to all the latest news on isccm activities the annual national conference in critical care, conducted by the isccm, has been the high point of academic activities in this field. held in different important cities, this event has been attracting not only the who - is - who in critical care in india, but also many international stalwarts over the past 8 years. good quality original work has now started emerging, and is being accepted for publication by the prestigious international journals. at the recently held world congress, a multicentre study on scoring systems was presented on behalf of the isccm, and indian icus are now being included in the upcoming international simplified acute physiology score (saps)iii study. for the first time, india will be represented on the executive committee of the world federation of societies of intensive and critical care medicine. one hopes that all the efforts will lead to a humane, scientific and meaningful service for the multitude of critically ill patients. the ' icus worldwide ' series is created in collaboration with the world federation of societies of intensive and critical care medicine (wfsiccm). | critical care practices in india have evolved significantly over the past decade. critical care initially began as a service in major hospitals, but with the formation of the indian society of critical care medicine the development of this speciality has been very rapid. regular conferences, updates, continuing medical education programmes and workshops have emerged, and postdoctoral training programmes have been developed. scientific publications have begun to appear and in spite of the diverse problems and standards, meaningful speciality - related activities have begun. future challenges include the development of guidelines, the consolidation of training activities and research on the outcome of critical tropical problems. |
secondary surgery of the neck for persistent or recurrent thyroid cancer (tc) is still the subject of debate. the advocated extent of the salvage neck dissection (nd) has not been established yet. subsequent procedure for the central compartment (cc) carries the risk related directly to the anatomy of this region. upper mediastinum (level vii) and supraclavicular fossa (level iv) remains challenging even in the primary approach. in patients with tc, the balance between the risk of morbidity from secondary nd and the risk of untreated cancer disease still remains an unresolved issue. previous articles have evaluated the feasibility and efficacy of reoperations in thyroid cancer (in persistent or recurrent disease), but authors had focused on well differentiated thyroid cancer (wdtc) and surgeries limited to the central compartment [35 ]. in most cases, thyroid cancer recurrences in cervical lymph nodes can be visualized with ultrasound examination, what helps to arrange further therapeutic procedures. the aim of the study was (1) to assess the feasibility of secondary neck dissections (nd) in well differentiated thyroid cancer, medullary cancer (mtc) and poorly differentiated thyroid cancer (pdtc), (2) to evaluate the influence of nd extent on morbidity and (3) to describe the biochemical and clinical outcomes with special regard to lower neck levels (iv, vi, vii). the study group consisted of 51 consecutive patients with persistent / recurrent thyroid cancer (32 females and 19 males). all patients enrolled to the study had been previously operated for tc in 11 different general surgery units and then followed - up in the department of endocrinology, metabolism and internal medicine of poznan university of medical sciences. treatment failures had been subsequently referred to the department of otorhinolaryngology, head and neck surgery, poznan medical university. the recurrent or persistent thyroid cancer neck disease was defined as : positive imaging on ultrasound, computed tomography or radioiodine whole body scan, increased thyroglobulin (tg) or calcitonin levels. the age of the patients at the onset of disease ranged from 16 to 76 years (mean 48 years). 46 patients had previously undergone one surgical procedure for tc and 5 patients two or more. histological appearance of the primary lesion was determined according to the world health organization histological classification and was as follows : 33 cases of wdtc, 15 cases of mtc, 3 cases of pdtc. staging was performed according to the american joint committee on cancer classification (ajcc) cancer staging manual revised in 2009. the advancement of the primary tumor was as follows : t1 in 6 cases, t2 in 16 cases, t3 in 18 cases and t4 in 11 cases. nodal disease at the first presentation was n0 in 36 (60.8 %), and n+ in 15 (39.2 %) patients respectively. the time between the primary surgery and reoperation ranged from 7 months to 16 years (median 2 years). thyrotropin (tsh) stimulation had shown increased tg level (> 2 ng / ml) in 31/33 patients with wdtc. the values ranged from 2.32 to > 900 ng / ml. the supraphysiological thyroid hormone replacement was introduced in this group to achieve tsh suppression (10 pg / ml) and ranged from 13 pg / ml to over scale measurements > 480 pg / ml. the indirect laryngoscopy and stroboscopy were performed before and after the reoperation (on the 1st, 7th day and 6 months later if needed). the mean follow - up time after the neck reoperation was 3.4 2.3 years. vii neck levels. the choice of the procedure depended on rn advancement, macrometastases location and tumor histology. the radical neck dissection (rnd) included the lateral node compartment : jugular chain nodes (levels i, ii, iii, iv), posterior neck (level v), from the skull base to the subclavian vein and laterally to the trapezius muscle. in all cases the sternocleidomastoid muscle and jugular vein were dissected in strictly chosen cases (in patients with lymph nodes metastases > 3 cm adjacent to the vessel wall). selective neck dissection (snd) most often cleared levels iia, iii and iv. dissection of the central compartment (cc) included level vi nodes extended vertically from the hyoid bone to the thoracic inlet and horizontally between the carotid sheaths (prelaryngeal, pretracheal and paratracheal nodes). the extension of the secondary nd and patients data concerning neck relapse are presented in table 1.table 1the types of thyroid cancer, localization of the excised nodes and the complications of secondary neck dissectionno.follow up time (years)no. of complicationsrlnhpotherwdtc332.68126medullary cancer151.3383poorly differentiated thyroid cancer31.3222neck levels i iii only62.7220neck level vi, vii only21111neck level iv only15000neck level iv, vi, vii+ other141.1685 total 51 1.8 13 22 11 rln recurrent laryngeal nerve injury (both persistent and transient), hp persistent hypoparathyroidism the types of thyroid cancer, localization of the excised nodes and the complications of secondary neck dissection rln recurrent laryngeal nerve injury (both persistent and transient), hp persistent hypoparathyroidism rnd was performed in 22 patients (43.1 % ; 15-wdtc, 6-mtc, 1-pdtc) and snd in 29 patients (56.9 % ; 18-wdtc, 9-mtc, 2-pdtc). cc (level vi) was cleaned in 14 patients (27.5 % ; 9-wdtc, 4-mtc, 1-pdtc)in two as the main procedure and in 12 as complementary to lateral node compartment dissection. level vii (upper mediastinal nodes) were dissected in 10 patients (19.6 % ; 7-wdtc, 1-mtc, 2-pdtc), levels i, ii, iii, iv and v in 3, 36, 40, 41 and 21 patients respectively. all together lower neck reoperation (iv, vi, vii) was performed in 46 cases (90.2 %). 11 patients were operated more than once (4 patients with wdtc, 6-mtc, 1-pdtc). total amount of neck dissections was 66. in our study group the localization of recurrence (level i iii, iv, v, vi, vii) and the time between the primary surgery and the recurrence did not depend on patients gender, age or the type of thyroid cancer. in three patients very aggressive course of the recurrent disease was observed : in two cases gross infiltration of the larynx and esophagus requiring total laryngectomy with partial esophagectomy. the number of removed lymph nodes ranged from 1 to 42. in the majority of patients data of the neck dissection specimens including number of metastatic nodes end extracapsular spread (ecs) was presented in table 2.table 2histopathological results of the neck dissection specimenneck levelno. of nodes removedno. of patientspn+ecsi / ii / iii only34680iv only1111iv, vi, vii + other16714946vi, vii only112101 ecs extra capsular spread histopathological results of the neck dissection specimen ecs extra capsular spread the number of metastatic nodes ranged from 1 to 28. single metastatic lymph nodes were found in 11 patients (21.6 %), 2 metastatic lymph nodes in 10 patients (19.6 %), three in 1 patient (2 %), 4 in 3 patients (5.9 %) and 5 or more in 25 patients (47.1 %). metastases were confirmed in all 14 cc and all 10 mediastinal specimens ; thus in levels vi and vii there were no false negative results. out of 59 lateral neck specimens metastases were found in the levels ii and iii in 37 cases (72 %) and in the level iv in 35 cases (68 %). the occurrence of bilateral metastases did not depend on the type of thyroid cancer, but was often observed in younger patients (p = 0.07) and in patients with primary surgery performed at younger age (p = 0.049). furthermore, these two groups more frequently required radical neck dissection (p 30 ng / ml. none of the patients with mtc achieved calcitonin level lower than 10 pg / ml. nine patients developed distant metastases in 1016 months time (lung metastases in 7 patients, bone metastases in 3 patients). none of the patients with poorly differentiated thyroid cancer achieved tg level 30 ng / ml. none of the patients with mtc achieved calcitonin level lower than 10 pg / ml. nine patients developed distant metastases in 1016 months time (lung metastases in 7 patients, bone metastases in 3 patients). none of the patients with poorly differentiated thyroid cancer achieved tg level < 2 ng / ml). one patient developed disseminated lung and bone metastases and is still under control of our clinic (4 years after neck dissection). distant metastases were observed more frequently in patients with mtc and pdtc (p = 0.007). the american thyroid association (ata) and national comprehensive cancer network (nccn) recommends treatment options for recurrent or persistent wdtc : radioiodine therapy for radioiodine sensitive disease and surgery for clinically significant disease. secondary surgery in cc has been approved in the literature [4, 9, 10 ], although is associated with high risk of complications and moderate possibilities of tumor eradication. therefore, the question is, how to obtain the balance between the cure and complication rates and whether the patient will benefit from the surgery. in patients with medullary cancer the sites frequently involved in recurrent or persistent disease include retrocarotid nodes, nodes deep to laryngeal recurrent nerve, retroclavicular nodes, retrosternal nodes and nodes running along the superior thyroid vascular pedicle medial to the carotid bifurcation. leaving positive nodes in tracheoesophageal groove may expose the patient to risk of tracheal, esophageal or even laryngeal invasion.. found nodal metastases in central and bilateral central compartment in 86.7 and 42.2 % cases respectively but little attention was devoted to the neighboring iv level. metastasizing pattern in our group revealed pn+ in level iv, vi and vii in 41, 16 and 10 patients respectively ; in the ivth level over 70 %, in cc 100 % of taken nodes were pn+ ; 17 % of patients had metastases bilaterally. comparing primary and recurrent disease distribution stated, that there was no difference in frequency in levels i, ii, iii and v but level iv was more common in the recurrent cases. salvage neck surgery in our group confirmed the necessity of clearing all lower neck basins. in our group it is important to confront the surgical feasibility and morbidity in patients with recurrences in the lower neck anatomical region. the previous studies demonstrated that there is no additional morbidity in secondary procedures and complication rate is similar to initial surgical procedure, if performed by experienced surgeon [2, 14 ]. numerous authors described the cc salvage surgery as safe and efficient oncological procedure exhibiting minimal morbidity [1, 4, 5, 10, 15 ]. on the other hand, hartl and travagli underlined additional morbidity when central nd is performed as secondary procedure. although the boundaries and the anatomical structures that require dissection are the same, the scar tissue and neovascularization complicates the access to this region ; the sternohyoid and sternothyroid muscles are adherent to the trachea in dense scar tissue. thus, reoperative surgery of the cc is associated with higher risk of vocal folds paresis. according to mirghani cc nd can be performed with minimal morbidity, when recurrent laryngeal nerve is not invaded. in our group in 3/15 medullary cancers the nerve was intentionally sectioned, in 4/33 wdtc detached from the tumor. in eight cases (15.7 %) permanent vocal cord paresis was observed ; in three (5.9 %) tracheotomy had to be maintained. it has been stated, that parathyroid glands are at increased risk for injury and permanent hypoparathyroidism is the most common adverse event in cc secondary surgery. permanent hypoparathyroidism has been reported to range between 2.7 and 9 %. in our study long - term follow - up revealed permanent hypoparathyroidism in 22 patients (43.1 %). the outcomes of reoperative surgery for wdtc can be categorized as the absence of biochemical disease or clinically detectable disease. in our center the required tg level assessed on tsh stimulation was determined to be lower than 2 ng / ml. according to hughes. biochemical complete response obtained in 26 % of patients may be concentrated on locoregional control of disease to prevent complications due to local invasion rather than elimination of biochemically active cancer. in our study stimulated tg < 2 mg / ml was observed in seven patients with wdtc directly after reoperative procedure (21.2 %) and in ten patients in the follow - up (30.3 %). six patients with wdtc developed distant metastases. in mtc or pdtc the final results of secondary surgery were poor. none of the patients with mtc achieved calcitonin level lower than 10 pg / ml and none of the patients with pdtc achieved biochemical remission. it should be therefore concluded, that mtc and pdtc need more rigorous preoperative work up to ensure that distant metastases are excluded, otherwise the prognosis will be unfavorable despite successful neck dissection. our study reports the large cohort of patients undergoing secondary nd due to thyroid cancer. surgical approach and possibility of complications in this group present a challenge. in mtc and pdtc the long - term results were unsatisfactory (calcitonin / tg still elevated, frequent distant metastases). in wdtc the secondary neck dissection should be performed in cases in which there are strong indications for surgical procedure. metastases localization in levels vi, vii, iv was connected with high complication rate. on the other hand total clearance of these basins proved to be crucial for the satisfactory oncological outcomes. | the purpose of the study was to assess the feasibility of secondary neck dissections (nd) in different types of thyroid cancer (tc), to evaluate the influence of nd extent on morbidity and to describe biochemical and clinical outcomes. 51 patients previously operated for tc (33-well differentiated tc - wdtc, 15 medullary tc - mtc, 3 poorly differentiated tc - pdtc) presenting detectable nodal disease. reoperations covered i vii neck levels. radical neck dissection was performed in 22 patients, selective neck dissection in 29 patients. 14 central compartment (cc), 10 mediastinal and 41 level iv excisions were performed. postoperative complications occurred in 13 patients : 4 chyle leaks, 3 massive bleedings, 8 permanent vocal cord pareses, hypoparathyroidism in 22 patients (43.1 %), 2 patients expired in perioperative period. in wdtc : in seven patients thyroglobulin level normalized directly after nd, in ten patients in the follow - up ; six patients developed distant metastases. none of the patients with mtc achieved calcitonin level < 10 pg / ml ; nine patients developed distant metastases. none of the patients with pdtc achieved tg < 2 mg / ml ; two patients died, the third developed distant metastases. secondary nd in tc present a challenge by means of surgical approach and possibility of complications. in mtc and pdtc the long - term results were unsatisfactory. in wdtc, the secondary nd should be performed due to strong indications. metastases localization in levels iv, vi, vii were connected with high complication rate, but these surgeries were crucial for satisfactory oncological outcomes. |
the spondyloarthritides (spa) are a group of inflammatory rheumatic disorders related by clinical symptoms and genetic predisposition. they include ankylosing spondylitis (as), psoriatic arthritis (psa), reactive arthritis, inflammatory bowel disease- (ibd-) related spa, and undifferentiated spa. they share a number of axial manifestations (sacroiliitis and spinal involvement), peripheral musculoskeletal abnormalities (arthritis, dactylitis, and enthesitis), extra - articular symptoms (e.g., uveitis), and genetic characteristics (hla - b27 and familial clustering). the prevalence of spa shows considerable differences among ethnic groups and populations and depends on the prevalence of the hla - b27 gene in the population studied. estimates of the prevalence of spa vary from 0.31% in france and 0.49% in greece to 0.9% in the usa [1, 6, 7 ]. there are currently very few data available on the prevalence of spa in the middle east. it has been reported that the prevalence of spa in the middle east is low ; a study from iran estimated a prevalence of 0.23%, and an earlier study in north pakistan reported a prevalence of 0.1%. part of the variation in prevalence is probably explained by differences in quality and bias of the methodological approaches used in epidemiological studies. the variation in incidence and prevalence of spa can also partly be attributed to geographic variation in the prevalence of hla - b27. the hla - b27 antigen is associated with spa [3, 4 ], particularly with as, and is one of the factors predicting radiographic progression [10, 11 ]. however, in general, the association of hla - b27 with as appears to be weaker in most arab countries than in western european populations [5, 12, 13 ]. associations of between 25% and 75% have been reported in middle eastern countries, compared with > 90% in western europe. for example, one study found a prevalence of hla - b27 of 2.4% among healthy jordanians and of 71% and 73% among as patients in jordan and qatar, respectively. however, a stronger association has been reported in iran, with a prevalence of approximately 2.5% in the general population and 92% (23/25) in as patients. early detection of axial spa before radiographic sacroiliitis is present can be challenging in settings where access to specialist mri facilities is limited and awareness among patients and physicians is low. an approach to screening and referral for possible axial spa in patients with chronic back pain, based on the presence of inflammatory back pain or hla - b27 positivity and without the need for imaging, has been proposed. international and regional guidelines recommend the use of tnfi therapy in spa patients with persistently high disease activity despite treatment with two nonsteroidal anti - inflammatory drugs (nsaids) for at least 2 weeks each [16, 17 ]. however, widespread use of tnfi agents in the middle east may be hampered by their high cost and increased risk of infections such as tuberculosis (tb). the risk of tb can be reduced by screening for latent tb infection and treating accordingly. a study by tayel. published in 2012 characterized the functional status, treatment use, and quality of life in a cohort of 75 egyptian spa patients ; in this study (64% had as, of whom 59% were positive for hla - b27), 84% of patients were male, and 5% had uveitis. almost half (47%) of the patients were unemployed, and 14% were receiving tnfi therapy. the current paper reports on a cross - sectional observational study that expands on the egyptian study by tayel., and we herein report the current status of spa and its management across a wider region. to our knowledge, this is the first study of this type to be conducted in the middle east. this was a multicenter, observational, cross - sectional study conducted in four centers in four countries (egypt, kuwait, qatar, and saudi arabia). participating physicians recorded the following data using a specially designed form for all their patients sequentially seen between march 22, 2013, and july 9, 2013, with spa (as, psa, ibd - related spa, reactive arthritis, and undifferentiated spa). the protocol for the research project was approved by a suitably constituted ethics committee of the institution within which work was undertaken, conforming to the provisions of the world medical association 's declaration of helsinki and patient anonymity has been preserved : demographics age, gender, ethnicity, country of birth, smoking status, and family history of rheumatologic disease;diagnosis type of spa, date of onset of symptoms, date of diagnosis, disease pattern (predominantly axial, predominantly peripheral, and mixed axial and peripheral);employment status (full - time, part - time by choice, part - time as a result of disease status, unemployed by choice, and unemployed as a result of disease status);laboratory features hla - b27 status, erythrocyte sedimentation rate (esr), and c - reactive protein (crp);radiographic data (as patients)radiographic sacroiliitis, mri features of sacroiliitis;clinical disease measures (as patients)ankylosing spondylitis disease activity score (asdas), bath ankylosing spondylitis disease activity index (basdai), and bath ankylosing spondylitis functional index (basfi);patient - reported outcome measures (as patients)ankylosing spondylitis quality of life (asqol) score;comorbidities data uveitis, ibd, psoriasis, cardiovascular disease, hepatitis b and c, tuberculosis, hiv, and other complications;treatment type of treatment (nsaids, disease - modifying antirheumatic drugs (dmards), and biologics), duration of treatment, and data on eligibility for biologic but either contraindicated or unaffordable. demographics age, gender, ethnicity, country of birth, smoking status, and family history of rheumatologic disease ; diagnosis type of spa, date of onset of symptoms, date of diagnosis, disease pattern (predominantly axial, predominantly peripheral, and mixed axial and peripheral) ; employment status (full - time, part - time by choice, part - time as a result of disease status, unemployed by choice, and unemployed as a result of disease status) ; laboratory features hla - b27 status, erythrocyte sedimentation rate (esr), and c - reactive protein (crp) ; radiographic data (as patients)radiographic sacroiliitis, mri features of sacroiliitis ; clinical disease measures (as patients)ankylosing spondylitis disease activity score (asdas), bath ankylosing spondylitis disease activity index (basdai), and bath ankylosing spondylitis functional index (basfi) ; patient - reported outcome measures (as patients)ankylosing spondylitis quality of life (asqol) score ; comorbidities data uveitis, ibd, psoriasis, cardiovascular disease, hepatitis b and c, tuberculosis, hiv, and other complications ; treatment type of treatment (nsaids, disease - modifying antirheumatic drugs (dmards), and biologics), duration of treatment, and data on eligibility for biologic but either contraindicated or unaffordable. data were collected on a total of 169 consecutive patients, 59% were male and 64% were of arab race, and the mean age was 41.4 years (sd 10.5). two - thirds of the patients were nonsmokers, and 25% had a family history of rheumatologic disease. just over half of the patients were in full - time employment ; 10% were working part - time as a result of their disease status, and 5% were unemployed for the same reason. patients ' clinical and disease characteristics, comorbidities, and treatment are summarized in table 2. forty - four percent of all patients had as and 36% had psa, whilst smaller proportions had ibd - related spa, reactive arthritis, or undifferentiated spa. the average age at onset of symptoms was 32.3 years (sd 9.9), and the average age at diagnosis was 34.9 years (sd 9.8). the mean time delay in diagnosis from the onset of symptoms was 2.8 years (sd 4.2). this delay was longest for as patients, at 4.9 years (sd 5.1), compared with those with psa at 1.1 years (sd 2.2), ibd - related spa at 1.6 years (sd 2.7), reactive arthritis at 0.2 years (sd 0.2), and undifferentiated spa at 1.3 years (sd 1.9). a high proportion of as patients (74%) had a disease pattern with predominantly axial involvement, whereas most non - as patients had predominantly peripheral involvement (values ranging between 58% and 100%). radiographic data show that 82% of as patients had radiographic sacroiliitis at the time of enrolment in the study. for 35% of as patients, the diagnosis was made by the presence of sacroiliitis in mri and, of these patients, 30% had not previously met the new york criteria for radiographic sacroiliitis. of all patients, 70/169 (41%) of the 99 patients whose hla - b27 status was known, 65% (64/169) were positive. of the 73 as patients with known hla - b27 status, 51 (70%) were hla - b27 positive ; of the 26 patients with all other forms of spa with known hla - b27 status, 13 (50%) were hla - b27 positive. the mean esr was 34.5 mm / h (sd 17.8, range 2.096.0), and the mean crp was 19.5 mg / l (sd 25.1, range 0.6197). among as patients, mean asdas was 2.2 (sd 0.9, range 0.83.9), mean basdai was 3.3 (sd 1.6, range 0.48.0), and mean basfi was 4.1 (sd 1.7, range 0.67.6). as patients reported an average asqol score of 9.2 (sd 4.3, range 0.018.0). with regard to comorbidities, 15.4% of all patients (25.7% of as patients) had uveitis, 4.1% had hepatitis c, 1.8% had cardiovascular disease, and 0.6% had hepatitis b ; no patients had tuberculosis or hiv (table 2). during the study period, in addition, 21% of patients were being treated with methotrexate, 14% with sulfasalazine, and 4% with leflunomide. thirty - four percent of patients were currently receiving biologics that included adalimumab (11%), certolizumab (0.6%), etanercept (15%), golimumab (1%), infliximab (5%), and ustekinumab (2%). nineteen percent of patients were reported to be eligible for biologics but not receiving them due to financial limitations. compared with the previously described egyptian sample, the percentage of male patients in this sample from four middle eastern countries was much lower (59% versus 84%) and the mean age was slightly higher (41.4 versus 37.4 years). the reported male to female ratio among spa patients worldwide shows great variation, from 0.5 : 1 in the usa and 0.72 : 1 in turkey to 5.5 : 1 in greece and 7 : 1 in the azores. the proportions of patients with as, psa, and reactive arthritis were similar to those in the egyptian study (44% versus 45%, 36% versus 31%, and 3% versus 3%, resp.), but more patients in the current study had diagnoses of ibd - related spa (6% versus 1%) and undifferentiated spa (11% versus 0%). the authors of the egyptian study speculated that the absence of undifferentiated spa patients may have been due to the long delay between symptom onset and diagnosis, allowing specific diagnoses to emerge, or simply due to underdiagnosis of undifferentiated spa. in a spanish registry including 1379 spa patients, the proportion with as was higher (61%) and the proportion with psa was lower (21%) in comparison to the egyptian study and the current study, while only about 1% had reactive arthritis and 15% had undifferentiated spa. the proportion of as patients who were positive for hla - b27 was higher in the present study than in the egyptian study (69% versus 59%). however, this is within the 2575% range reported for middle eastern countries, compared with > 90% in western europe. comorbidities are common in spa. in one study in belgium, almost half of patients with as had extra - articular manifestations, the most common being uveitis (seen in 27% of patients). other comorbidities included psoriasis, crohn 's disease, and ulcerative colitis. in a study of as patients in norway, delay in diagnosis and higher disease activity (as measured by crp) were independent predictors of mortality. there is some evidence that uveitis is more common in as patients who are positive for hla - b27, while psoriasis and ibd are more frequent in hla - b27-negative patients [5, 22 ]. in the current study uveitis was reported three times more often than in the egyptian study (15% versus 5%), with a similar rate to that seen in the spanish study (16%). the rate of uveitis in patients with a diagnosis of as was slightly higher than that found in the spanish study (26% versus 22%). the prevalence of other comorbidities was comparable between the current study and the spanish study (psoriasis 33% versus 25% ; ibd 5% versus 4% ; and cardiovascular disease 1.8% versus 1.2%). disease severity appeared to be fairly similar to the egyptian study findings, with a similar mean esr (34.5 versus 36.8 mm / h) and slightly lower mean basdai (3.3 versus 4.2) and basfi (4.1 versus 5.1) scores. the mean esr in the spanish study was lower at 18.5 mm / h, while the mean basdai and basfi scores in as patients were comparable at 4.1 and 3.6. about 15% of patients were either working part - time or unemployed as a result of their disease status. the mean delay between onset of symptoms and diagnosis of as was almost 5 years, while the delay was less than 2 years for the other spa diagnoses. this delay is shorter than those reported in the spanish registry (8 years) and in various studies in europe, iraq, and burkina faso, west africa. diagnosis of as has traditionally been made by the presence of radiographic sacroiliitis ; however, this can take several years to evolve [10, 13 ]. the presence of inflammation on sacroiliac joint mri has a high sensitivity and specificity, but this can be challenging in the middle east region. clinical symptoms of inflammatory back pain in patients presenting with low back pain increase the likelihood of as. hla - b27 positivity increases the likelihood still further, but this is less useful in populations with low association between hla - b27 and as ; the 70% positivity rate in the present study suggests that this could have a role in the diagnosis of as. clinicians in the region need to take all these factors into account when assessing patients with chronic low back pain. the proportion of spa patients treated with nsaids, dmards, and biologics were not dissimilar to those seen in the spanish sample. most patients in this study were being treated with nsaids, with many also taking methotrexate or (to a lesser extent) sulfasalazine. most methotrexate use (81%) was in patients with a diagnosis of psa, while sulfasalazine was most commonly used by patients with as (39% of use) or ibd - related spa (30%). thirty - four percent of patients were receiving biologic drugs, with the highest biologic use amongst patients with psa (53% of use) and as (35%). almost a fifth of patients were assessed as needing biologics but not receiving them due to financial constraints ; a similar finding was reported by tayel. in egypt. the pan arab rheumatology society has published recommendations for the use of biological agents for the treatment of rheumatic diseases, which include as and psa. it is likely that most clinicians in the region follow the asas / eular recommendations, but the cost of biologics means that not all eligible patients receive them. the percentage of patients using biologics in this study does not reflect the actual number of patients using these agents in this area of the world because the patients were recruited from selected university and government hospital clinics where the biologics are available at no cost to the patients or at subsidized prices. the high cost of biologics and unavailability of funds to cover these drugs in many government hospitals and the low income of large percentages of the population in the middle east make the management of patients with spondyloarthritis in this part of the world less than optimum. the increased risk of tb associated with tnfi agents also presents a potential barrier to their use. chest x - rays and tuberculin skin test and/or an interferon - gamma release assay should be used to screen tnfi candidates for latent tb infection and prophylactic anti - tb therapy initiated in patients with a high suspicion of infection [13, 17 ]. in the absence of regional registries of spa patients, the data presented here provide a rare snapshot of the characteristics, disease burden, and treatment of spa patients in the middle east. the future challenge is for more centers in more countries to collaborate to include larger patient numbers and extend the available data across the middle east region. | data on spondyloarthritis (spa) from the middle east are sparse and the management of these diseases in this area of the world faces a number of challenges, including the relevant resources to enable early diagnosis and referral and sufficient funds to aid the most appropriate treatment strategy. the objective was to report on the characteristics, disease burden, and treatment of spa in the middle east region and to highlight where management strategies could be improved, with the overall aim of achieving better patient outcomes. this multicenter, observational, cross - sectional study collected demographic, clinical, laboratory, and treatment data on 169 consecutive spa patients at four centers (egypt, kuwait, qatar, and saudi arabia). the data collected presents the average time from symptom onset to diagnosis along with the presence of comorbidities in the region and comparisons between treatment with nsaids and biologics. in the absence of regional registries of spa patients, the data presented here provide a rare snapshot of the characteristics, disease burden, and treatment of these patients, highlighting the management challenges in the region. |
population aging has increased public interest in maintaining a healthy and high - quality life1. methods to prevent the functional disorders of the elderly, lengthen the span of their healthy lives, and reduce their social and economic burdens are needed2, 3. in recent years, customized exercise methods for the elderly, which can maintain and improve appropriate muscular strength, muscular endurance, and cardiopulmonary functions, have drawn attention as opposed to passive methods, such as medication4, 5. however, the rural elderly show low rates of participation in sports activities due to poor access to sports centers or other amenities that provide exercise programs, and heavy economic burdens. in particular, the rural elderly often experience physical pain in the back and knees due to farming for long periods. therefore, opportunities are urgently required to encourage them to improve their physical abilities and quality of life6,7,8. the purpose of this study was to examine the effects of regular exercise on changes in the physical functions and quality of life of the rural elderly by designing an exercise program for them that is appropriate for their physical condition and can be easily performed at home. the subjects of this study were 46 elderly people (8 males, 38 females) aged 65 or older, who resided in a rural area. on average, the subjects were 73.418.77 years of age and had engaged in farming for 36.0815.73 years. selection criteria were : subjects aged 65 or older who managed their daily lives independently, who were capable of verbal communication, and had the cognitive ability to listen to and follow explanations about the exercises. before participation, the procedures, risks, and benefits were explained to all the participants, who gave their informed consent. the participants rights were protected according to the guidelines of the university of hanseo. the exercise program was conducted 16 times in 80 minute sessions over an eight - week period from june 25 to august 20. the exercise program consisted of exercises to improve upper and lower - extremity muscular endurance and balance based on exercises using thera - bands. the program was conducted in a local community hall and included a warm - up of ten minutes, main exercises lasting 65 minutes, and a cool - down of five minutes. among the senior fitness test items for the elderly developed by rikli and jones, arm curls, 30-second standing up from a sitting position on a chair, and two - minute step in place test were used to evaluate the physical abilities of the participants9. in addition, the distance between the two hands of each subject was measured during his / her back scratching to measure flexibility. one - leg standing with the eyes open and closed, and functional reach were also measured to assess balance. in addition, the timed up and go test, tandem walk test, and foot stepping were performed to examine lower - extremity agility10. the korean version of the world health organization quality of life (whoqol)-bref questionnaire was used to assess the effects on quality of life of the changes in the physical abilities of the elderly11. the evaluation items were divided into four main areas of physical health, psychological relations, social relations, and environment, which were further segmented into 26 lower - level items. quality of life scores were measured and recorded based on the subjects subjective perceptions of their quality of life in the 26 lower - level items. the experimental results were statistically analyzed using spss 22.0 ko (ibm, il, usa). frequency analysis and descriptive statistics were employed to identify the general characteristics of the subjects. changes in the physical abilities and the quality of life after completion of the exercise program were analyzed using the paired t - test with a statistical significance level of = 0.05. after the intervention the physical abilities of the subjects were compared with their pre - intervention values. it was found that muscular endurance showed improvements in arm curls, sitting and standing up from a chair, and two - minute step in place test, and balance ability (one - leg standing, functional reach) and agility (foot stepping) also improved (p<0.05) (table 1table 1.a comparison of the physical abilities of the subjects before and after the exercises (n=46)itemsexercise programpre - trainingpost - trainingstrengthen muscular endurancearm curl - dominant side (times)46.322.164.826.3sitting and standing up from a chair (times)39.718.449.723.4 2-minute step in place test (times) 94.937.0130.041.2balance one - leg standing- eyes open (sec)19.621.127.324.2one - leg standing- eyes closed (sec)5.36.88.410.5functional reach- dominant side (mm)302.892.4372.973.8upper - extremity flexibility back scratch (mm)147.7116.8132.8110.9lower - extremity agility timed up and go (sec)9.82.89.23.5foot stepping (times)21.47.324.78.4tandem walk (sec)9.94.69.04.6meansd, p<0.05). the overall quality of life score increased by 7.31 points after the intervention and more specifically the scores of psychological and social relations, and environment exhibited statistically significant improvements after the exercises (p<0.05) (table 2table 2.a comparison of the quality of life of the subjects before and after the exercises (n=46)domainexercise programpre - trainingpost - trainingphysical health 20.45.421.45.9psychological 17.84.519.83.9social relationships10.31.611.21.7environment23.64.726.93.9total72.013.479.412.8meansd, p<0.05). this study conducted an exercise program for the rural elderly two times each week over an eight - week period. the resistance exercises using an elastic band effectively improved the physical abilities and the quality of life of the rural elderly. after the exercises, the subjects showed improvements in their physical abilities : left and right upper - extremity arm curls showed improvements, and the score for sitting and standing up from a chair also increased. in addition, lower - extremity balance was enhanced, as shown by improvements in the two - minute step in place test, one - leg standing time with eyes open, and functional reach. the above results agreed with the outcome of the study by so.12, in which dumbbell exercises were performed by the elderly for 12 weeks, twice each week. they reported statistically significant improvements in the two - minute step in place test, sitting and standing up from a chair, and 244 cm walking back and forth after the exercises. the present study found there were statistically significant improvements in arm curls, sitting and standing up from a chair, two - minute step in place test, one - leg standing time, functional reach, and foot stepping. therefore, the subjects may have improved their upper - extremity muscular endurance, general endurance, balance, and agility. the results were also similar to the findings of the study by yu.13, in which resistance exercises were performed using an elastic band for 12 weeks, three times each week, leading to improvements in muscular endurance (sitting and standing up from a chair) and balance (functional reach). however, the results were contrary to those of the study by kazumasa.14, in which an easy and simple resistance exercise program was implemented for the elderly of a local community. the eight - week exercise program conducted in the present study was found to be effective at enhancing the physical functions of the elderly. the assessment of changes in the quality of life using the whoqol - bref questionnaire before and after the exercises found there was an overall improvement in qol after the intrvention. in particular, the quality of life scores in the areas of psychological and social relations, and environment improved after the intervention. however, although the quality of life score in the area of physical health was improved after the exercises, this result was not statistically significant. the exercise program employed in this study was conducted in a community hall to increase the social participation and performance of the elderly. therefore, the participation of the elderly in physical activities such as flexibility exercises performed to their favorite music and muscle strengthening exercises may have influenced their psychological and social relations and quality of life. the results of the present study may support the conclusions of existing research that the participation of the elderly in exercise programs is effective at changing their psychological and social relations. the present study had the limitation that it targeted elderly people in a rural area, and thus the results can not be generalized to all age groups or elderly people. despite this, this study confirmed that an exercise program was effective at changing the physical functions and the quality of life of the rural elderly. most of the elderly in rural areas are facing threats to their health, such as musculoskeletal diseases, due to their lifestyle of farming for long periods of time. moreover, they have fewer opportunities to participate in exercise programs than do the elderly in urban areas. in this regard, based on the findings of the present study, more diverse studies should be carried out in the future to help the rural elderly improve their physical functions and social participation. | [purpose ] the purpose of this study was to examine the effects of a muscle strengthening exercise program using an elastic band on changes in the physical abilities and quality of life of the rural elderly. [subjects ] the subjects of this study were 46 elderly people (8 males, 38 females) aged 65 or older, who lived in a rural area and managed their daily lives independently. [methods ] the study s exercise program was conducted 16 times for 80 minutes each session over an eight - week period. this program consisted of several exercises to strengthen muscular endurance and improve balance ability based on exercises using thera - bands. the physical abilities of the subjects were divided into muscular endurance, upper - extremity flexibility, balance, and low - extremity agility. each ability was measured to compare the effects of the exercise program. in addition, the korean version of the world health organization quality of life (whoqol)-bref questionnaire was used to examine changes in the subjects quality of life. [results ] the subjects showed improvements in muscular endurance, balance, and low - extremity agility. they also exhibited an overall statistically significant improvement in quality of life scores after the exercise program. in terms of the main items, changes were observed in the areas of psychological relations, social relations, and environment. [conclusion ] the community - centered muscle strengthening exercise program using the elastic band was found to improve muscular endurance, balance, agility, and quality of life of rural elderly subjects. |
sebaceous carcinoma, first described by allaire in 1891 accounts for less than 1% of all cutaneous malignancies. it is a rare but aggressive malignant neoplasm that arises from sebaceous glands with a tendency for both local recurrence and distant metastases. we report a case of an extraocular type of sebaceous carcinoma of the scalp with no distant metastases. a 65-year elderly man presented with a large asymptomatic swelling over the vertex of the scalp, which gradually progressed over a period of twelve months. examination showed a large swelling of 15 12 5 cm size situated over the vertex of the scalp extending to the occipital and tempero - parietal regions.the tumor showed focal ulceration with yellowish malodorous seropurulent discharge [figure 1 ]. clinically, a differential diagnosis of cylindroma, angiosarcoma, deep fungal infections, nocardiosis, mycobacterial or atypical mycobacterial infections were considered. a large multi- lobulated swelling with ill - defined margins and irregular surface showing focal ulceration and yellow sero - purulent discharge the culture of the seropurulent discharge revealed staphylococcus aureus and acinetobacter baumanni suggestive of secondary bacterial infection. afb stain and culture for both mycobacteria and atypical mycobacteria and fungal culture were negative. ct scan of the brain showed only age related cerebral atrophy, and there was no evidence of extension of the tumour or metastatic deposits. histopathology revealed an infiltrating neoplasm in the dermis composed of cells arranged in lobules separated by fibrovascular stroma. [figure 2 ] neoplastic cells were round having moderate amount of eosinophilic to vacuolated cytoplasm and large nuclei with prominent eosinophilic nucleoli. dermis showing a neoplasm composed of cells arranged in lobules separated by fibrovascular stroma (h and e, 4) neoplastic cells having moderate amount of eosinophilic to vacuolated cytoplasm and large nuclei with prominent eosinophilic nucleoli and increased mitoses (h and e, 40) immunohistochemical marker study showed diffuse strong positivity for cytokeratin and focal positivity for epithelial membrane antigen (ema) [figure 4 ]. sebaceous carcinoma is a rare malignant neoplasm, often occurs in adults with a slight male preponderance this malignancy can occur as peri - ocular and extraocular types and the former variant contributes to 75% of sebaceous neoplasms. the upper eyelid is affected two to three times more often than the lower eyelid due to greater number of meibomian glands extraocular sebaceous carcinoma which constitutes 25% of the sebaceous neoplasms has been reported more commonly on the head and neck areas followed by trunk, salivary glands, genitalia, breast, ear canal, and the intra - oral cavity. the most frequent clinical presentation is a painless subcutaneous nodule but it can also present as pedunculated lesions, irregular mass or diffuse thickening of the skin. this protean appearance frequently masquerades as other benign tumors or inflammatory conditions thereby leading to delay in diagnosis, inappropriate treatment, increased morbidity, and mortality. the morphological hall mark of sebaceous differentiation is the detection of sebaceous cells and demonstration of fat in vacuolated tumor cells. special stains such as oil red o may be helpful in confirming the presence of fat, but requires frozen section. other differential diagnosis includes basal cell carcinoma with sebaceous differentiation for poorly differentiated sebaceous cell carcinoma. our case did not show poorly differentiated basaloid cells and other features of basal cell carcinoma. sebaceous carcinoma cells express immunohistochemical markers such as cytokeratin, epithelial membrane antigen (ema), cam5.2 and anti - breast carcinoma associated antigen-225 antibody. the current case showed diffuse strong cytokeratin expression and ema was focally positive in cells with sebaceous differentiation. considering the morphological, histopathological and immunohistochemical marker study findings we favoured a diagnosis of sebaceous carcinoma. the common associations of sebaceous carcinoma are muir - torre syndrome, an autosomal dominant condition comprising of sebaceous neoplasm with one or more low - grade visceral malignancies and nevus sebaceous of jadassohn. distant metastases and recurrence rates are more common in the ocular type of sebaceous carcinoma when compared to extraocular sebaceous carcinoma as seen in our case. recurrence rates of ocular sebaceous carcinoma ranges from 11% to 30% with distant metastases occurring in 3% to 25% though extraocular sebaceous carcinoma is less aggressive, a study with 91 cases of extraocular sebaceous carcinoma showed a recurrence rate of 29% with 21% developing metastases. wide excision and selective use of radiotherapy is the ideal treatment of choice. in summary, this tumor should suggest the possibility of muir - torre syndrome and alert the clinician to search for occult malignancies. | extra ocular sebaceous carcinoma is a rare malignancy when compared to peri ocular variant and these are derived from sebaceous gland epithelium. the aggressive types of extra ocular sebaceous neoplasm are reported with lymph node and visceral metastasis associated with poor prognosis. here we report a case of extensive cutaneous extra ocular sebaceous cell carcinoma confined to large area of scalp proven by immunohistochemistry without intra cranial involvement, distant metastases or evidence of muir - torre syndrome. |
parkinson s disease (pd) is the second most frequent age - associated brain degeneration disorder, affecting about 1 % of the population over 65 years of age. the pd - specific progressive movement deficit is mostly due to the severe affliction and cell death of midbrain nigrostriatal dopaminergic neurons. surviving neurons in vulnerable regions exhibit aggregates predominantly consisting of the protein alpha - synuclein, which are visualized as lewy neurites and lewy bodies, both in sporadic late - onset and most familial early onset pd variants. autosomal dominant pd with early clinical manifestation was observed in rare families, leading to the identification of alpha - synuclein (snca) protein missense mutations such as a53 t (termed the park1 variant) and of snca gene duplication / triplication events (park4 variant) as the strongest causes of this pathology [3, 4 ]. further recruitment of parkinson s families enabled identification of a list of disease genes responsible for monogenic pd. in addition, recent characterization of very large collectives of late - manifesting sporadic pd cases through genome - wide allele association studies (gwas) identified two regions on chromosome 4 (snca and gak / cplx1 loci) that contain genetic variants predisposing to multifactorial pd. variations in the snca gene 3-untranslated region (3-utr) and its promoter correlated strongly with pd risk. it is associated with the lipid membranes of synaptic vesicles and interacts with synaptobrevin, a component of the snare complex, mediating vesicle exocytosis and neurotransmitter release. its toxic gain - of - function leads over time to impaired synaptic vesicle release and synaptic failure [9, 10 ]. current investigations aim to elucidate alpha - synuclein - triggered pathology, concentrating on disease stages before the occurrence of irreversible cell loss, when neuroprotective therapies might still be efficacious. here, we focused on two independent mouse lines of inbred fvb / n background with ~1.5-fold overexpression of human a53t - alpha - synuclein in nigrostriatal dopaminergic neurons under control of the heterologous neuron - specific prion - promoter. a53t - alpha - synuclein overexpression in these mice occurs in presynaptic nigral dopaminergic neurons and presynaptic cortical glutamatergic neurons, but not in postsynaptic striatal neurons. these mice display apparently normal movements at age 6 months, but progress to significantly impaired spontaneous locomotion by age 18 months, despite the absence of neuronal loss in the nigrostriatal projection. previous expression profiling in these mice identified a homer-1a transcript dysregulation throughout the brain and a 14 - 3 - 3 epsilon protein upregulation selectively in the striatum as molecular effects of alpha - synuclein triggered pathology. the alterations in these signalling molecules were temporally correlated with reduced striatal dopamine release and deficient long - term depression [1214, 9 ]. to gain insight into the mechanisms underlying the impairment in vesicle exocytosis and neurotransmitter release, we surveyed progressive expression changes in midbrain / brainstem tissue using genome - wide unbiased transcriptome profiling. previously documented (geo database gse20547, see also) global transcriptome data from striatum, midbrain / brainstem and cerebellum of human a53t - alpha - synuclein overexpressing mice were filtered. we selected those significant changes at age 18 months relative to age 6 months, which were midbrain / brainstem - specific and were consistent between both transgenic mouse lines (prpmta and prpmtb). further selection prioritized those transcripts with no corresponding significant changes in wild - type midbrain / brainstem and in wild - type / transgenic striatum and cerebellum, resulting in the identification of 49 candidate effects of synucleinopathy (table 1). among the progressive upregulation effects, the increase of foxp1 mrna levels by a53t - alpha - synuclein overexpression was particularly interesting in view of our previous finding that foxp1 (encoding forkhead box p1) is downregulated in alpha - synuclein knockout mouse. thus, the midbrain - identity - mediating transcription factor foxp1 appears to depend in its brain levels both on the gain - of - function and the loss - of - function of alpha - synuclein. among the progressive downregulation effects, the decreased levels of cplx1 (encoding complexin-1) selectively in the mutant midbrain / brainstem were especially interesting, in view of the co - localization of alpha - synuclein and complexin-1 at the snare complex. other midbrain / brainstem - selective significant dysregulations of vesicle endocytosis / exocytosis pathway factors included the downregulation of rabl2a transcript and the upregulation of rabgef1, in good agreement with previous observations that alpha - synuclein disrupts cellular rab homeostasis. more ubiquitous dysregulations were detectable for three 14 - 3 - 3 isoforms (table 1 bottom), which are established downstream targets of alpha - synuclein function. 14 - 3 - 3 family isoforms heterodimerize to protect phosphoserine - phosphothreonine groups and are (1) sequence homologous to alpha - synuclein, (2) putative direct interactor proteins of alpha - synuclein, (3) expression - modulated by alpha - synuclein, (4) sequestered into the lewy bodies, (5) able to change their levels in response to pathogenic alpha - synuclein mutations and thereby modulate neurotoxicity [1720 ]. thus, at least seven of the expression changes are credible in the light of their function and of previous knowledge about alpha - synuclein. all information per animal including age and sex with the resulting microarray data discussed in this publication is deposited in the ncbi 's database gene expression omnibus (geo) and is accessible through geo series accession number gse20547. validation studies of cplx1 mrna expression in independent tissues by qpcr confirmed the significant downregulation in midbrain / brainstem of prpmta mice (fig. 1).table 1global transcriptome analysis of mice with nigrostriatal overexpression of human a53t - alpha - synuclein showing significant changes from age 6 to 18 + monthsthe upper rows show all 49 genes with known functions, which exhibited significant and consistent progression changes in both transgenic midbrain / brainstem tissues, but not in wild - type midbrain / brainstem or striatum or cerebellum. grey background with bold gene symbol and comments were used to highlight the most promising novel expression effect of synucleinopathy, cplx1 (encoding complexin-1). the lower rows show known expression effects of synucleinopathy for comparison, highlighting the best previously established transcript ywhae (encoding 14 - 3 - 3epsilon). column (a) documents the affymetrix probeset i d ; (b, c) the relative expression (re) values for transgenic lines prpmta and prpmtb, respectively, highlighting changes > 1.7 or 1.7 or 1.7 or 1.7 or < 0.6 in bold letters ; (d) the adjusted p value to judge significance after correction for multiple testing ; (e g) the lack of significant changes (0) in striatum (s) of wild type (wt) and the two transgenic lines (a and b), respectively ; (h j) the lack of significant changes in wt compared to significant upregulations (1) or downregulations (1) in midbrain / brainstem (mb) tissue of two transgenic lines a and b, respectively ; (k m) the lack of significant changes in cerebellum (c) of wild type and two transgenic lines a and b, respectively ; (n) the gene symbol to access genecards and ncbi online databases using different background colours to emphasize functional pathways in common between individual genes ; (o) authors summaries on the functions of each gene product with respect to synaptic failure, according to genecards and pubmed online databases. the rows of the upper table part were ordered from top in descending significance quantitative real - time reverse transcriptase pcr demonstrates reduced mrna levels of complexin-1 in the midbrain / brainstem of mice with a53t - alpha - synuclein overexpression. tbp was always used as loading control, and mrna level ratios were normalized to wt. complexin-1 transcript was specifically detected by a custom - made taqman assay, using midbrain / brainstem extracts from the transgenic line prpmta versus wild type (wt) (n = 18 versus 15) at age 18 months, demonstrating a significant downregulation in prpmta tissue we focused on the downregulation of midbrain / brainstem cplx1 mrna as a novel and promising effect, since the encoded protein complexin-1 is involved in the stimulus - dependent control of secretory vesicle exocytosis through the snare complex [21, 22 ]. alpha - synuclein was also shown to modulate snare assembly and vesicle clustering, so this expression effect might constitute a very direct and early consequence of alpha - synuclein mutations. densitometric analysis of immunoblots revealed a significant increase of complexin-1 protein levels in the midbrain / brainstem of aged a53t - alpha - synuclein overexpressing mice (fig. the alterations were readily apparent by ecl detection of membranes, making more sophisticated approaches such as near - infrared immunoblot detection or quantification by elisa unnecessary.fig. 2quantitative immunoblots demonstrate dysregulated levels of complexin-1 and 14 - 3 - 3epsilon proteins in the midbrain / brainstem of mice with alpha - synuclein mutation. beta - actin was always used as loading control, and protein level ratios were normalized to wt. representative membranes are shown at the left, bar graph statistics of quantification at the right. p value < 0.05, p < 0.01 and p < 0.001. a complexin-1 and complexin-2 were detected with the antibody from sysy, using midbrain / brainstem protein extracts from the transgenic line prpmta versus wild type (wt) (n = 3 versus 4) at age 18 months, demonstrating significantly increased complexin-1 levels. b midbrain / brainstem protein from transgenic line prpmtb versus wild type (wt) (four vs. three) at age 18 months also showed significantly increased complexin-1 levels. c in comparison, selective detection of 14 - 3 - 3epsilon abundance change (five vs. five) as a repeatedly published molecular effect of alpha - synucleinopathy failed to reveal changes in protein levels, in spite of its significantly changed mrna levels in mouse midbrain / brainstem (table 1). d levels of complexin-1 and complexin-2 (antibody from sysy) were significantly increased in alpha - synuclein knockout mice (snca ko) at age 3 months (five ko vs. four wt), in inverse correlation to alpha - synuclein levels, demonstrating that complexin levels respond not only to the toxic alpha - synuclein gain - of - function / aggregation process but also to its loss - of - function. e significant downregulation of 14 - 3 - 3epsilon (five ko vs. four wt). these data indicate that 14 - 3 - 3epsilon protein levels are directly correlated to the loss - of - function of alpha - synuclein quantitative immunoblots demonstrate dysregulated levels of complexin-1 and 14 - 3 - 3epsilon proteins in the midbrain / brainstem of mice with alpha - synuclein mutation. beta - actin was always used as loading control, and protein level ratios were normalized to wt. representative membranes are shown at the left, bar graph statistics of quantification at the right. p value < 0.05, p < 0.01 and p < 0.001. a complexin-1 and complexin-2 were detected with the antibody from sysy, using midbrain / brainstem protein extracts from the transgenic line prpmta versus wild type (wt) (n = 3 versus 4) at age 18 months, demonstrating significantly increased complexin-1 levels. b midbrain / brainstem protein from transgenic line prpmtb versus wild type (wt) (four vs. three) at age 18 months c in comparison, selective detection of 14 - 3 - 3epsilon abundance change (five vs. five) as a repeatedly published molecular effect of alpha - synucleinopathy failed to reveal changes in protein levels, in spite of its significantly changed mrna levels in mouse midbrain / brainstem (table 1). d levels of complexin-1 and complexin-2 (antibody from sysy) were significantly increased in alpha - synuclein knockout mice (snca ko) at age 3 months (five ko vs. four wt), in inverse correlation to alpha - synuclein levels, demonstrating that complexin levels respond not only to the toxic alpha - synuclein gain - of - function / aggregation process but also to its loss - of - function. e significant downregulation of 14 - 3 - 3epsilon (five ko vs. four wt). these data indicate that 14 - 3 - 3epsilon protein levels are directly correlated to the loss - of - function of alpha - synuclein these data obtained in a53t - alpha - synuclein overexpressing midbrain / brainstem complement previous observations from alpha-/beta - synuclein double - null mice, which exhibit upregulated complexin-1 and downregulated 14 - 3 - 3 epsilon protein in the whole brain. to test whether alpha - synuclein or beta - synuclein is responsible for the observed changes, we studied midbrain / brainstem from mice with snca knockout in 129/svev background and demonstrated significant upregulation for complexin-1 and downregulation for 14 - 3 - 3epsilon protein (fig. isoform and complexin-1 protein levels respond not only to toxic gain - of - function mutations in alpha - synuclein but also to its loss - of - physiological function. our data confirm previous findings that alpha - synuclein abundance modulates the levels of 14 - 3 - 3 isoforms. it was previously known that cplx1 levels are altered in alpha + beta - synuclein double - knockout mice and that foxp1 mrna levels respond to the alpha - synuclein knockout. we now report novel findings that also pathogenic gain - of - function mutations of alpha - synuclein have a modulatory role on cplx1 and foxp1 in mice that showed no demonstrable alpha - synuclein aggregation in midbrain / brainstem during their lifespan and that cplx1 levels change in the alpha - synuclein single knockout mouse brain. this suggests that both cplx1 and foxp1 may be useful to monitor early stages of alpha - synuclein pathology. in contrast, cplx1 shows a more ubiquitous expression pattern, similar to alpha - synuclein. although both cplx1 and snca were mainly studied regarding presynaptic vesicle dynamics, their expression in brain is not much higher than in blood platelets, where they have a role in stimulus - dependent secretory vesicle exocytosis to control thrombus formation. thus, cplx1 might have potential as biomarker to monitor an alpha - synuclein gain - of - function in peripheral tissues like blood. although our experiments were focused on modelling monogenic alpha - synucleinopathy variants of pd (park4/1), we are confident that complexin-1 plays a role in the genetically heterogeneous common idiopathic pd. our data from alpha - synucleinopathy mouse models are consistent with a proteome survey of midbrain from sporadic pd patients, which reported significantly elevated levels for complexin-1 and a trend towards elevated levels of 14 - 3 - 3 epsilon. furthermore, the gak / cplx1 locus on chromosome 4 carries risk variants for sporadic pd in gwas studies. a plausible explanation might predict that excess alpha - synuclein at the snare complex interacts with cplx1 and impairs its degradation. this could occur as part of a sequestration process during the formation of alpha - synuclein oligomers and aggregates, reflecting incipient formation of inclusion bodies known as lewy neurites or it has been observed that this aggregation process starts in the presynapses and sequesters local proteins such as synapsin. overall, the transcriptomic profiling of our park1/park4 mouse model identified plausible molecular correlates of early nigrostriatal dopaminergic neurotransmission deficits previously observed in this mouse. in conclusion, the transcriptomic profiling of mouse midbrain / brainstem tissue with alpha - synuclein pathology has provided credible insights into early steps of pathogenesis, before the advent of neurodegeneration. complexin-1 may be a better read - out of alpha - synucleinopathy than the previous gold standard 14 - 3 - 3. mice were housed in accordance with the german animal welfare act, the council directive of 24 november 1986 (86/609/ewg) with annex ii, the ets123 (european convention for the protection of vertebrate animals) and the eu directive 2010/63/eu for animal experiments at the felasa - certified central animal facility (zfe) of the frankfurt university medical school. mouse breeding and characterization with brain dissection was carried out as described in the literature [28, 29, 24 ]. all studies of mouse mutants were in comparison with age- and sex - matched wt controls from the same inbred background line, which were bred and aged in parallel, under controlled light cycle, periodic health - monitoring, and individually ventilated cage housing. dissection of brain regions occurred rapidly after cervical dislocation, placing the brain in a sagittal view to perform a coronal section from the hypophysis stem towards the caudal end of the hippocampus. olfactory brain regions, the cerebral cortex, septal and thalamic tissue were removed from the ventral tissue block to isolate the striatum. to obtain midbrain / brainstem from the caudal tissue block, the cortical, dorsal thalamic and tectal tissues were removed, yielding the substantia nigra continuous with ventral tegmental area, red nucleus, mammillary nuclei and brainstem. for the dissection of the cerebellum all tissues were snap - frozen in liquid nitrogen and then stored at 80 c. the individual transcript expression validation on a steponeplus equipment (appliedbiosystems) employed taqman assays (appliedbiosystems) mm00447333_m1 (snca), mm01198853_m1 (cplx1) and mm00446973_m1 (tbp), with quantitative real - time reverse transcriptase polymerase chain reaction (qpcr) conditions as recommended for these assays. genome - wide transcriptomics of mouse brain regions was performed with affymetrix oligonucleotide microarrays as previously reported. frozen tissues were homogenized on ice in a glass - teflon douncer in ripa buffer with 50 mm tris hcl (ph 8), 150 mm nacl, 1 % np-40, 0.5 % na - deoxycholate, 0.1 % sds and protease inhibitor cocktail (roche). total lysates were briefly sonicated on ice, and cell debris was removed by centrifugation. sds page - separated proteins (20 g / lane) were blotted onto a pvdf membrane (bio - rad) and probed. the following primary antibodies for mouse alpha - synuclein (1:1,000 bd biosciences 610786), complexin-1 (1:500 acris ap51050pu - n and 1:1,000 sysy 122002), 14 - 3 - 3epsilon / eta / zeta / beta / gamma / theta (1:1,000 santacruz sc1020 and others from cellsignaling), beta - actin (1:1,000 sigma a5441) were used with their corresponding secondary antibodies (ge healthcare uk limited lna931v / ag for ecl - anti - mouse - hp from sheep and lna934v / ag for ecl - anti - rabbit - hp from donkey) for 1 h. the detection was made with supersignal west pico (thermo scientific), with varying exposure times to avoid film sensitivity or saturation problems as well as non - linear effects. the images were digitalized on a scanner (epson) and densitometry performed with the proprietary imagemaster total lab 2.00 software (amershampharmacia) or the public imagej software. after normalization of candidate protein values versus beta - actin values from the identical membrane in excel, the changes were evaluated in graphpad statistics and plotting. statistical analyses presented in bar graphs were performed by unpaired student s t tests and plotted with the prism 3 software (graphpad, la jolla, ca, usa). | as the second most frequent neurodegenerative disorder of the aging population, parkinson s disease (pd) is characterized by progressive deficits in spontaneous movement, atrophy of dopaminergic midbrain neurons and aggregation of the protein alpha - synuclein (snca). to elucidate molecular events before irreversible cell death, we studied synucleinopathy - induced expression changes in mouse brain and identified 49 midbrain / brainstem - specific transcriptional dysregulations. in particular complexin-1 (cplx1), rabl2a and 14 - 3 - 3epsilon (ywhae) downregulation, as well as upregulation of the midbrain - specific factor forkhead box p1 (foxp1) and of rabgef1, were interesting as early mrna level effects of alpha - synuclein triggered pathology. the protein levels of complexin-1 were elevated in midbrain / brainstem tissue of mice with a53t - snca overexpression and of mice with snca - knockout. the response of cplx1 and foxp1 levels to snca deficiency supports the notion that these factors are regulated by altered physiological function of alpha - synuclein. thus, their analysis might be useful in pd stages before the advent of lewy pathology. because both alpha - synuclein and complexin-1 modulate vesicle release, our findings support presynaptic dysfunction as an early event in pd pathology. |
holoprosencephaly (hpe) is a type of central nervous system malformation resulting from hypoplasia or aplasia of the most rostral end of the neural tube and premaxillary segment of the face. it is characterized by varying degrees of incomplete separation of the cerebral hemispheres and deep brain structures such as basal ganglia, thalamus, and hypothalamus. based on the severity of involvement, three categories have been described, namely alobar, semilobar, and lobar hpe. a fourth type of hpe, namely middle interhemispheric variant (mih) or syntelencephaly has been described, which is characterized by deficient interhemispheric fissure involving the high frontal convexity with normal interhemispheric separation of basal forebrain, anterior frontal and occipital lobes. a 5-year - old girl presented to our institute with poor mental and motor development. born by normal vaginal delivery at term, she had cried at birth and the neonatal period was uneventful. there was no history of in - utero exposure to infections, drugs, or radiation. there was no family history of brain malformations, developmental delays, facial abnormalities, or chromosomal abnormalities. on examination, the child had only partial neck control, reached for objects with immature grasp, could recognize only family members and vocalized meaningless vowel sounds. the child weighed 13.5 kg (<3 percentile) with a head circumference of 48 cm (515 percentile). dysmorphic facial features such as metopic prominence, bushy eyebrows with synophrys, broad nasal root, flat nasal bridge, telecanthus, and shallow philtrum were seen [figure 1 ]. neurological examination revealed normal cranial nerves, bilaterally symmetrical muscle bulk with increased tone in all the limbs, and generalized hyperreflexia. (a) frontal view shows metopic prominence, bushy eyebrows with synophrys, broad nasal root, telecanthus, and shallow philtrum, (b) lateral view shows metopic prominence with flat nasal bridge on magnetic resonance imaging (mri), deficient interhemispheric fissure was observed in posterior frontal and parietal regions with failure of separation of posterior frontal and parietal lobes. the anterior and posterior parts of the interhemispheric fissure were normally formed. sylvian fissures showed abnormal vertical orientation and were fused across midline over the vertex of brain. genu and splenium of corpus callosum were normally formed, and the body was absent in the region of interhemispheric connection. (a) axial t1-weighted image shows abnormal orientation of sylvian fissures (arrows), which are connected across the midline and nonseparation of posterior frontal and parietal lobes (arrowheads), (b) axial t2-weighted image at the level of basal ganglia shows normal separation of basal and anterior frontal lobes and occipital lobes. the frontal horns are hypoplastic with absent septum pellucidum, (c) sagittal t2-weighted image shows agenesis of body of corpus callosum (arrows) with normal splenium and genu, (d) parasagittal t2-weighted image shows vertical orientation of sylvian fissure (arrows) and vertical course of middle cerebral artery (arrowhead) the embryonic neural tube differentiates into various regions of brain parenchyma by means of ventral and dorsal patterning, which are induced by specialized cell groups in the neural tube. such cell groups form the floor plate in the ventral potion and roof plate in the dorsal portion of neural tube. mih has been postulated to result from a defect in the induction of embryonic roof plate unlike the classic types of hpe, which result from a defect in the induction of embryonic floor plate. mih is characterized by deficient interhemispheric fissure with failure of separation of posterior frontal and parietal lobes despite normal separation of anterior and posterior portions of the cerebral hemispheres. the basal ganglia structures are usually separated with variable fusion of thalami noted in 3050% of cases. sylvian fissures are characteristically oriented vertically and are connected across the midline over the vertex. the body of the corpus callosum is usually deficient in the region of interhemispheric nonseparation, whereas the genu and splenium are normally formed. other common associations include cortical dysplasias, heterotopias, azygos cerebral artery, and a dorsal interhemispheric cyst. in contrast, semilobar and lobar types of hpe are characterized by defective separation of anterior and rostral parts of the frontal lobes with normal interhemispheric cleavage posteriorly. variable degrees of fusion of basal ganglia are noted in both these conditions, whereas the thalami are separated in lobar and variably fused in semilobar type. in both these entities, the incidence of craniofacial anomalies is less severe and less frequent in mih, when compared with the classic types of hpe. endocrinopathies and choreoathetosis, which are commonly observed in other forms of hpe are relatively rare in syntelencephaly due to lack of involvement of basal forebrain structures. despite these differences in the clinical presentation and imaging findings, mih variant shares a common denominator with the classic forms of hpe in that there is nonseparation of a part of the supra - tentorial brain into two separate hemispheres. mutations involving the zic2 gene, located on human chromosome 13q32, has been postulated in the pathogenesis of hpe and syntelencephaly. it is expressed in the dorsal and ventral midline regions of the telencephalon unlike other genes identified in hpe, which are expressed predominantly in the ventral regions. in a study of 509 individuals with various types of hpe, mutations of the zic2 gene was observed in 16 cases. fifteen of them had alobar, semilobar, or lobar hpe ; and in the remaining one who had the mih variant, a comparatively mild mutation of the zic2 gene (in - frame deletion of 12 amino acids) was observed. it was suggested that the level of function of the protein determined the severity of hpe ranging from alobar to mih variant, which in turn was dependent on the severity of mutation of the gene. the mih variant of hpe or syntelencephaly has characteristic imaging findings and radiologists are often the first to diagnose this condition. familiarity with these findings can help in early diagnosis and prognostication of the affected children. | middle interhemispheric variant (mih) of holoprosencephaly (hpe) or syntelencephaly is a rare variant of hpe characterized by abnormal midline union of the posterior frontal and parietal lobes with variable fusion of thalami. it varies from classic hpe in embryopathogenesis, severity of fusion of brain structures, associated craniofacial anomalies and clinical presentation. we report a case of mih in a 5-year - old girl, who presented with severe developmental delay and discuss the features differentiating it from other more common forms of hpe. |
dry eye disease (des) is a major tear deficiency disorder which causes discomfort, visual disturbances, and tear film instability with potential damage to the ocular surface. the tear film and ocular surface form a complex and stable system that can lose its equilibrium through multiple disturbing factors. despite the gain in knowledge of pathogenic factors of des acquired in the past decades, there has been considerable discrepancy in the reported prevalence worldwide, mainly due to lack of consensus on appropriated diagnostic criteria and differences in the parameters and research methodology applied. two large population - based studies suggested that about 7.8% of american women and 4.7% of men aged 50 years and older had des [3, 4 ]. in a study conducted in melbourne, australia, des was diagnosed in subjects over 40 years old as 10.8% by rose bengal staining, 16.3% by schirmer 's test, 8.6% by tear breakup time, 7.4% with two or more signs, and 5.5% with severe symptoms of des not attributed to hay fever. risk factors for two or more signs included age and self - report of arthritis. a large study used questionnaires to investigate the prevalence of des in canada in all age groups. in the 13,517 returned questionnaires (55% aged 2150 years, 60.7% were women), 28.7% respondents reported des. those reporting severe des were predominantly women, with a ratio of 46 : 1. some population - based studies investigating the prevalence and risk factors of des in china have been published [718 ]. therefore, it is difficult to assess the overall prevalence of des in china. based on the current published data, the present study utilized systematic review and meta - analysis with an aim to estimate the overall pooled prevalence of des in china. the epidemic characteristics of des such as prevalence in different geographic regions, genders, and age groups were also explored. to obtain regional epidemiologic data, we searched medline (from january 1, 1946, to october 31, 2013), embase (from january 1, 1950, to october 31, 2013), the cochrane central register of controlled trials (up to 2013, issue 10), chinese biological medicine (january 1, 1978, to october 31, 2013), china national knowledge infrastructure (january 1, 1979, to october 31, 2013), wan fang data (january 1, 1982, to october 31, 2013), and chongqing vip database (january 1, 1982, to october 31, 2013) using the free combinations of the terms dry eye, the corresponding authors or first authors of the publications were contacted if additional information was needed, results were unclear, or relevant data were not reported. the review and analysis were guided to be conducted by the prisma statement for preferred reporting of systematic reviews and meta - analysis. reports potentially eligible for inclusion in this systematic review and meta - analysis had to meet the following criteria : population - based studies, authentic, written either in english or in chinese, and being able to provide sufficient information to estimate the pooled prevalence of and risk factors for des. population - based study needed to meet the following criteria : (i) the study populations need to be scrutinized with regard to all characteristics of the cohort before one can compare their results and (ii) the study populations need to be from special samples except hospital. if more than one study was based on the same population sample, the study with better quality was included. we excluded studies that were on the duplicate population groups but of lower quality and those that had participants drawn from a particular occupation or population and those that did not satisfy one or more inclusion criteria. the literatures were searched independently by two researchers (lei liu and yi - zhou sun). data were extracted from each article using a standardized form which included the first author, publication year, region or province, age range, sample size, diagnostic criteria, prevalence definition, response rage, and quality of the studies (in a score of 15) (table 1). odds ratio (or) was analyzed using revman version 5.0 (review manager, copenhagen : the nordic cochrane centre, the cochrane collaboration, 2010) statistical software package. multivariate analyses to test the individual association of each variable with the overall pooled prevalence estimate using meta - regression analyses were performed by comprehensive meta - analysis software version 2.0 (biostat, englewood cliffs, nj, usa). all meta - analyses were evaluated for heterogeneity using the chi - square based i test and q test. i estimated the percentage of the total variance in all of the data under consideration that was related to heterogeneity. if a moderate or high level heterogeneity was observed, random - effects meta - analysis was performed by the dersimonian and laird method, except when using fixed - effects models. assessment of publication bias was done by inspecting a funnel plot and using egger 's and begg 's test. the flow chart showing how the identified published studies were included in the meta - analysis was demonstrated in figure 1., only 12 studies [718 ] (table 1) met the inclusion criteria and were included in the meta - analysis. the pooled prevalence of des was 17.0% (95% ci : 9.9%27.4%) (i = 49.9%, q = 0.99, p < 0.001) in overall population (figures 2(a) and 2(b), table 2). the pooled prevalence rate in female individuals was significantly higher than that in males (21.6% versus 15.6%) (or : 1.41, 95% ci : 1.311.52, and p < 0.001) (figures 2(c) and 2(d), table 2). no significant difference was found in prevalence rate between urban china and rural china (15.3% and 21.3%, resp., or : 1.06, 95% ci : 0.971.17, and p = 0.205) (figures 3(c) and 3(d), table 2). the prevalence rates, however, were found to be remarkably variable in different geographic regions in china. northern china had significantly higher prevalence than southern china (17.9% versus 16.1%) (or : 1.97, 95% ci : 1.782.04, and p < 0.001) (figures 3(a) and 3(b), table 2). compared with central china which had a prevalence rate of 10.3%, eastern china and western china showed significantly higher prevalence rate (12.8% and 31.3%, resp.) (or : 2.62 and 1.38, resp., and p < 0.001) (table 2). the meta - analysis data covered eight provincial / municipality / autonomous regions as shown in figure 4. the pooled or was 3.34 (95% ci, 2.684.16) (i = 15%, p < 0.001) for elder age (60 years). the pooled or was 1.15 (95% ci, 1.041.27) (i = 12%, p = 0.005) for female gender. in addition, diabetes also showed a significant risk factor for des and the pooled or was 3.82 (95% ci, 2.685.46) (i = 10%, p < 0.001). there was no significant publication bias in this meta - analysis (p < 0.05 for both egger 's test and begg 's test). to our knowledge, the present study is the first meta - analysis of des in mainland china. population - based studies evaluating the prevalence of des differ in the definitions, diagnostic criteria for des, selection of the study population, and the methodology applied (questionnaires and/or objective tests). not surprisingly, there is a discrepancy in the prevalence between our data and findings in other asian regions and countries. the shihpai eye study found that 33.7% (459/1361) of individuals aged 65 years in taiwan were symptomatic, as defined by the reporting of one or more dry eye symptoms often or at all times. in yongin, korea, the adjusted prevalence of dry eye disease was 33.2% in 657 subjects aged 65 years or older. a japanese study found that 21.6% of the female individuals aged 40 years or over were diagnosed with dry eye disease or severe symptoms, significantly higher than their male counterparts (12.5%). report suggested that the prevalence of des increased with age, which is consistent with our meta - analysis. our findings verified that the elder population (over 60 years of age) had higher prevalence of des than the younger population. however, some published studies based on regional population in china did not find any prevalence difference between males and females [7, 1317 ]. the pooled prevalence in our study showed significantly higher prevalence in female subjects, consistent with majority of studies. a larger number of des cases were identified in individuals with diabetes, particularly those with type 2 diabetes. our meta - analysis illustrated significantly higher prevalence of des in diabetes patients, which is consistent with other studies [30, 31 ]. the prevalence of diabetes has been increased dramatically with the rapid economic growth and the improved quality of life in china over the last thirty years. much attention should be paid to prevent ocular surface disorder in the people with diabetes. other risk factors for des (e.g., alcohol, smoking, computer use, contact lens wear, and systemic or ocular medications) were initially included in the present study but were excluded because the pooled or was not able to be calculated as a result of insufficient information provided. western china and northern china had significantly higher prevalence when compared with central, eastern, and southern china, possibly because of the difference in the climate conditions and geographic characteristics in these regions. qinghai - tibetan plateau of western china is characterized with high altitudes, long hours of sunlight, and strong ultraviolet radiation, which may contribute to the high prevalence. other climate conditions including low humidity and draft were believed to be related to des, which may partially be an explanation of the higher prevalence in northern china. although the pooled prevalence in rural china seemed to be higher than in urban china, the difference was not statistically significant after meta - regression. further investigation is needed. because the findings in pooled prevalence of des had moderate i, we did meta - regression to analyze and verify the results to avoid substantial heterogeneity. although pooled prevalence of des in mainland china was derived in the present study, there are some limitations. firstly, the pooled prevalence data was estimated using meta - analysis, rather than prevalence in a single national population - based study. secondly, china is a vast country geographically with 34 provincial - level administrative units (23 provinces, 4 municipalities, 5 autonomous regions, and 2 special administrative regions). our study only included data from 12 units, which may be inaccurate to represent the pooled prevalence of the whole country. more regional epidemiologic studies are warranted, particularly those units with no published data, so that a more accurate picture of prevalence in china can be drawn. lastly, our data should be updated as a result of the emerging new data. compared with some of the other asian regions and countries, the pooled prevalence of des in mainland china was lower. there is remarkable discrepancy in the prevalence in different geographic regions in china, with western and northern china presenting higher prevalence, possibly because of the difference in the climate conditions and geographic characteristics. female, elder individuals, and patients with diabetes seemed to be more vulnerable to des. more studies focusing on chinese populations in regions without epidemiologic data are of great value. | purpose. to evaluate the pooled prevalence rate and risk factors of dry eye symptoms (des) in mainland china. methods. all the published population - based studies investigating the prevalence of des in china were searched and evaluated against inclusion criteria. a systematic review and meta - analysis were performed. results. twelve out of the 119 identified studies were included in the meta - analysis. the pooled prevalence of des in china was 17.0%. female individuals, subjects living in the northern and western china, and over 60 years of age had significantly higher prevalent rates (21.6%, 17.9%, 31.3%, and 34.4%, resp.) compared with their counterparts. patients with diabetes were also found to be more vulnerable to des. conclusions. the pooled prevalence rate of des in mainland china was lower than that in other asian regions and countries. a remarkable discrepancy in the prevalence in different geographic regions was noted. aging, female gender, and diabetes were found to be risk factors for des in china. |
on ageing, a nonmodifiable cardiovascular risk factor, hypertension becomes the most important modifiable risk factor for developing cerebrovascular disease, including stroke, cerebral small vessel disease (lacunar infarcts, white matter lesions, microbleeds), and cognitive impairment or vascular dementia. silent cerebral white matter lesions (wmls) are a common finding on brain magnetic resonance imaging (mri) in the elderly. however, in patients with hypertension, wmls tend to occur earlier in life and appear to be more severe. there is a body of evidence that supports the idea that wml in asymptomatic hypertensive patients should be considered a silent early marker of brain damage. cerebral wmls are an important prognostic factor for stroke, cognitive impairment, dementia, and death. although the pathogenesis of cerebral wml remains controversial, older age and hypertension are constantly reported to be the main risk factors [2, 3 ] (figure 1). hypertensive patients have a higher rate and extension of cerebral wml compared with normotensives [2, 4 ]. in addition, it has been shown that treated, controlled hypertensive patients have a lower prevalence of wml than both untreated and treated but not controlled hypertensive patients. data from interventional and prospective observational studies also suggest that appropriate antihypertensive treatment could efficiently prevent the development of wml and slow their progression [5, 6 ]. twenty - four hour ambulatory blood pressure monitoring (abpm) has become an important tool for improving the diagnostic and management of hypertension. it is known that abpm more closely correlates with hypertension - related organ damage and has a closer association with cardiovascular events than office blood pressure (bp). the information provided by 24-hour abpm includes daytime and nighttime bp profiles, day - night bp difference, morning blood pressure rise, and blood pressure variability. studies have found associations between 24-hour abpm parameters and hypertensive target organ damage, such as left ventricular hypertrophy, microalbuminuria, intima media thickness, retinal changes, pulse wave velocity, and silent brain damage (lacunar infarct, wml) (figure 2) [8, 9 ]. the association between hypertension and wml has been established in cross - sectional [2, 4, 1012 ] and longitudinal studies [1315 ]. however, some reports have suggested that this relationship is only evident when 24-hour abpm is used to assess bp. goldstein. found a correlation between wml and office systolic, but not diastolic, bp, in a group of elderly normotensive subjects. conversely, the severity of wml correlated with both systolic and diastolic bp measured by abpm. in a group of mixed normotensives, white coat hypertensives, and sustained hypertensives, shimada. found a correlation between the number of lacunae and periventricular hyperintensities with 24-hour bp, but not with office bp. found a correlation between wml and both clinic bp and 24-hour abpm in 66 untreated middle - aged hypertensive patients. in this study also higher bp values (including office, 24-hour, daytime were and nighttime estimates) in hypertensive patients with wml compared with those without found. in a recent study of 210 asymptomatic hypertensive patients (mean age : 52.5 12.5 years) it was found that higher 24-hour, daytime, and nighttime bp levels were independently associated with wml volume (mri semiautomatic volume quantification). wml volume and abp levels, whether daytime, nighttime, or 24-h, were continuous, without evidence of distinct thresholds, and continued down to bp levels within the normotensive range. the authors suggest that this dose effect of bp on wml, though cross - sectional, is supportive of a causal relationship between increasing bp levels and the development of wml. one longitudinal study assessed the bp - wml relationship using abpm in 155 healthy elderly individuals (range : 5579 years ; mean age : 66.2) who were followed for five years, at which time a second 24-hour abpm was performed in 121 subjects. the initial cross - sectional findings showed that in a sample of healthy subjects with relatively low bp levels (mean : 116.9/71.1 mmhg), men and women with casual bp in the upper ranges had a higher wml severity rating. subjects whose casual or waking systolic bp remained high for five years relative to the group were more likely to exhibit higher wml volume during both phases of the study than the remaining study subjects, especially those whose initial low bp remained low. some studies have also shown an association between higher pp values (including office and ambulatory 24-hour, daytime, and nighttime estimates), a measure of arterial stiffness, and wml [17, 20 ]. in addition, it has recently been shown that brachial bp is associated with wml in the elderly. the natural circadian bp rhythm typically includes a nocturnal decrease of 1020% in bp compared with daytime, waking values. however, there is a moderate - to - marked loss of this reduction in nighttime bp in between 25% and 35% of hypertensive patients, a phenomenon that has been associated with excessive cardiac, vascular, renal, and cerebrovascular target organ damage. yamamoto. studied 105 patients with lacunar infarcts who were followed for 3.2 2.6 years and found that a high mean ambulatory bp, especially nighttime bp, and a reduced nocturnal bp dip, adversely affected the development of silent ischemic lesions (lacunar infarcts and wml) and symptomatic stroke. in the aforementioned study by goldstein. of 144 healthy elderly individuals aged 5579 years, it was found that subjects with the highest wml severity rating had higher casual, waking, and sleeping systolic bp, higher waking diastolic bp, higher waking systolic bp variability, and a smaller nocturnal fall in systolic and diastolic bp than individuals with less severe wml ratings. sander. studied 227 healthy subjects aged > 55 years (44% hypertensive ; 12% diabetic patients) and found that subjects with wml were significantly older, had a greater frequency of a history of hypertension, and had an elevated mean systolic daytime bp, a reduced systolic circadian bp variation, and an increased incidence of pathological nighttime bp increases. they found a significant correlation between systolic circadian bp variation and the extent of wml. multiple regression analysis showed that this parameter was best correlated with the extent of wml. kario., in a study of 131 elderly hypertensives (aged 60 years), found that both nondippers and extreme dippers had significantly more silent cerebrovascular damage (measuring both lacunar infarcts and wml) than dippers. similarly, shimada., who studied asymptomatic elderly hypertensives, observed no differences in cerebral abnormalities (lacunar infarct and wml) between the normotensive group and the dipping hypertensive group. however, hypertensive dippers had higher ambulatory bp than normotensive individuals and a larger bp reduction from day to night than both the normotensive and hypertensive nondipping groups. these findings suggest that a dipping profile may inhibit the development of cerebrovascular abnormalities. one reason why marked nocturnal bp fall may be associated with cerebrovascular disease is that the lower bp limit of bp in the self - regulation of cerebral blood flow is shifted upward, especially in elderly hypertensive patients with brain damage. marked nighttime bp falls could lead to an excessive reduction in cerebral perfusion. in the study by kario., some patients had been treated before the study, and a greater fall in nocturnal bp due to antihypertensive medication might have accelerated brain ischemia. in the same study, although both nondippers and extreme dippers suffered more extensive cerebrovascular damage (lacunar infarcts and wml) than dippers, there were no significant differences between extreme dippers and dippers in terms of cardiac hypertrophy and renal damage, whereas these types of target organ damage were more frequent in nondippers than in dippers. therefore, as the authors suggest, sustained high bp over prolonged periods seems to be the most important determinant of hypertensive end - organ damage, whereas marked nocturnal bp falls may be more specifically related to cerebrovascular damage. birns. studied 88 hypertensive patients (mean age : 65 years) who were on antihypertensive therapy and optimally controlled, with preexisting hypertensive cerebrovascular disease (wml) and without a history of stroke, transient ischemic attack or syncope in the previous three months. mean daytime / nighttime systolic bp values were 136.2 mmhg and 127.8 mmhg, respectively, and mean daytime / nighttime diastolic bp values were 77.7 mmhg and 71.1 mmhg, respectively. in the study it was found that a physiological fall in nighttime bp in these hypertensives was associated with greater wml volume which, in turn, correlated with impairments in reaction time and verbal fluency. however, the cross - sectional design could not establish causality, and therefore further studies are necessary. in contrast, circadian rhythms were not related to wml in a small group of 66 middle - aged (mean age : 54 years) never - treated hypertensive patients, while in a group of 86 newly diagnosed hypertensive individuals (mean age 57.4 years ; range 4080), no relationship between diurnal bp rhythm and wml was found. it is clear that the relationships between office, waking, and sleeping bp and cerebral vascular disease vary according to patient characteristics (age, normotensive / hypertensive, asymptomatic / clinical cerebrovascular disease), the methodology used to evaluate wml volumes, and whether patients are receiving antihypertensive drug therapy. however, a body of evidence supports the idea that, in addition to increased daytime bp, raised sleeping bp and abnormal nocturnal bp reduction are associated with more severe wml. the studies mentioned have not determined whether nondipping is the cause or consequence of cerebrovascular disease. reductions in nocturnal bp falls might be secondary to site - specific cerebral injuries resulting in impaired central autonomic nervous system functioning. kario and shimada presented a 79-year - old hypertensive patient whose diurnal bp pattern changed after a minor ischemic stroke (small lacunar infarct), suggesting that abnormal diurnal bp might originate from minor cerebrovascular ischemia. some reports have shown that the level and variation of bp and/or heart rate might change in patients with overt cerebrovascular disease. studied 40 brain infarction patients and 5 healthy controls and found that, in addition to increased sympathetic activity, brain infarction also seems to cause parasympathetic hypofunction. goldstein. investigated diurnal bp variation and subcortical mri - t2 hyperintensities in 144 healthy individuals aged 55 to 79 years. individuals with a higher prevalence of hyperintensities in the insular subcortex, which plays an important role in cerebral self - regulation, had higher 24-hour bp. in a study of a homogeneous sample of never - treated hypertensive patients aged 5060 years, after exclusion for known risk factors for cerebrovascular damage such as diabetes or significant alcohol intake, it was found that subjects with wml had a blunted fall in nocturnal heart rate compared with those without wml. although some data seem to suggest that chronic ischemia caused by hypertension leads to disrupted diurnal bp variations through the impairment of cerebral self - regulation, resulting in nondipping in sleeping bp, most studies have been cross - sectional and, therefore, the direction of the relationship observed between some parameters and wml remains unclear. although bp variability has been associated with target organ damage in hypertension, the relationship with cerebral alterations remains unclear. goldstein. suggested a higher standard deviation of waking systolic bp in patients with more severe wml. in the aforementioned study by kario., it was found that extreme dippers had greater bp variability (standard deviation of waking systolic bp) and more wml and lacunar infarcts than dippers. in one study it was found that asymptomatic middle - aged hypertensives with wml had significantly higher values of long - term systolic bp variability (standard deviation of 24-hour bp) measured by continuous beat - to - beat monitoring and abpm, compared to those without wml. however, the differences were not independent of bp elevation and the significance was not maintained after adjustment for 24-hour systolic bp. there were no differences in short - term systolic bp variability or short - term or long - term diastolic bp variability in patients with and without wml. short - term bp variability was obtained by calculating the mean standard deviations of mean systolic and diastolic bp values for each 48 half - hour period (within half - hour standard deviation). long - term variability was calculated by obtaining the mean 48 half - hour systolic and diastolic bp mean values and calculating the standard deviation of the mean (among half - hour standard deviation). the two major determinants of bp variability are age and high bp, which are also major cardiovascular risk factors. therefore, the significant impact of bp variability on cardiovascular disease seems to depend partly on age and high bp. retrospectively reviewed computed tomography scans and 24-hour abpm in 79 patients (mean age : 83 years) and found that higher wml scores were associated with increased blood pressure variability. to evaluate short - term bp variation, they determined the variability of systolic and diastolic bp (within - subject standard deviation of all readings over a 24-hour period), the coefficient of variability (variability of bp / mean bp), and the maximal bp variation (difference between the maximum and minimum 24-hour bp). higher wml scores were associated with higher systolic bp in 24-hour, diurnal and nocturnal periods, higher maximal variation of systolic bp, greater variability of 24-hour diurnal and nocturnal systolic bp, and a greater coefficient of variability of systolic bp during sleep. they concluded that elevations and short - term variations in systolic bp may contribute to the pathogenesis of wml in the elderly. however, 50 of the 79 patients were suffering from dementia (30 alzheimer 's disease and 18 vascular dementia). the longitudinal epidemiological honolulu - asia aging study of the risk factors for cardiovascular disease showed that midlife office systolic bp variability was associated with wml detected in late life in 585 males. excess systolic bp variability was defined as greater than average increases in bp measurements from up to 3 examinations over 6 years. the authors suggest that a possible explanation could involve chronic periods of higher and lower systolic bp levels that overcome the self - regulation that maintains the blood flow in the cranial vessels. in fact, the deeper white matter tissues are supplied by terminal vessels in the brain and lack sufficient anastomoses with other vessels, and these tissues might be at higher risk from systolic bp variation. in healthy subjects, bp variation due to posture - dependent changes is minimal due to self - regulation. in most hypertensive patients without autonomic nervous dysfunction, orthostatic hypotension, often found in elderly hypertensives, is recognized as a risk for falls, syncope, cardiovascular events, and death [3438 ]. matsubayashi. studied 334 community - dwelling adults aged > 75 years and found that both postural hypotension and postural hypertension were closely related to wml and poorer neurobehavioral function scores. postural hypotension was defined as a reduction in systolic bp 20 mmhg and postural hypertension as an increase in systolic bp 20 mmhg using differences between the mean of two measurements of systolic bp while subjects were standing and supine, respectively. performed a head - up tilting test on elderly subjects with sustained hypertension as indicated by 24-hour abpm. they were classified as having orthostatic hypertension (orthostatic increase in systolic bp of 20 mmhg (n = 26)), orthostatic hypotension (orthostatic systolic bp reduction of 20 mmhg (n = 23)), or being normal (neither pattern (n = 192)). the results showed that silent lacunar infarcts were more common in patients with orthostatic hypotension and hypertension than in normal subjects. patients with orthostatic hypotension and hypertension had significantly greater bp variability (standard deviation of waking systolic bp) than normal subjects. the associations between orthostatic bp change and silent cerebrovascular disease remained significant after controlling for confounders, including ambulatory bp values. these u - shaped associations between orthostatic bp changes and the prevalence of silent lacunar infarctions are consistent with recent data from the prospective, population - based aric study, in which it was found that orthostatic systolic bp and diastolic bp reductions were associated with an increased incidence of thrombotic and cardioembolic strokes in a linear fashion. in addition, both orthostatic systolic bp reductions and increases were associated with an increased incidence of lacunar strokes. evaluated bp changes after a meal by 24-hour abpm in 70 hospitalized essential hypertensive patients aged 50 years. they found that the prevalence and severity of both lacunar infarcts and wml were significantly related to postprandial hypotension. normal morning bp surge is a physiological phenomenon, but an exaggerated morning bp surge is a cardiovascular risk. the association between the degree of morning bp surge and cardiovascular risk is not linear but rather has a threshold. cross - sectional studies have shown associations between target organ damage (left ventricular hypertrophy, microalbuminuria, intima media thickness, pulse wave velocity, silent lacunar infarcts) and morning surge in bp. vascular diseases of both the small and large arteries are considered to be not only consequences but also the leading cause of exaggerated morning bp surge, giving rise to a vicious cycle in the cardiovascular continuum. different pressor factors (aging, hypertension, glucose abnormality, alcohol intake, smoking, psychological stress, physical stress) are associated with morning bp surge. diurnal variation and activation of neurohumoral factors that regulate the vascular tonus and cardiac output, such as the renin - angiotensin and sympathetic nervous systems, are suggested to be involved in diurnal bp variation and morning bp surge. no studies have yet investigated the relationship between morning surge in bp and wml. however, in one study of 191 hypertensives (mean age : 76 years), an association between a higher morning surge in bp and silent lacunar infarcts, another form of hypertensive - cerebral small vessel disease was found. morning surge in bp was defined by subtracting mean systolic bp during the one hour with the lowest sleeping bp from mean systolic bp during the two hours after waking. subjects were classified into 2 groups according to the morning surge in bp, with a cutoff value of 55 mmhg. the study compared the incidence of silent brain infarcts and overt stroke between the two groups and found that the group with a higher morning surge group showed a higher prevalence of silent brain infarcts after matching for age and 24-hour ambulatory bp (70% versus 49% ; p = 0.01). in addition, patients were followed for a mean of 41 months, and a higher morning bp surge was associated with stroke risk independently of ambulatory bp, nocturnal bp falls, and silent infarct. in this study, when a combination of dipping status (extreme - dippers, dippers, nondippers, and risers) and morning surge in bp was included in the same cox regression analysis model, stroke risk was significantly associated with both morning surge in bp and with riser status. in the model, extreme dipper status was not significantly associated with stroke risk independently of morning surge. the authors suggest that the fall in bp during the night appears to be of less importance than the morning surge. the mechanism underlying the increased stroke risk of extreme - dippers might depend on either an excessive morning surge of bp or on cerebral hypoperfusion due to low nocturnal bp. on ageing, hypertension becomes the most important factor for cerebral wmls, which are an important prognostic factor for stroke, cognitive impairment, dementia, and death. strong evidence supports the idea that cerebral wmls in hypertensive patients should be considered a silent early marker of brain damage. the pathogenesis of wml remains unclear, but the main current hypothesis concerning the association between high bp and wml is that long - standing hypertension causes lipohyalinosis of the media and thickening of the vessel walls, with narrowing of the lumen of the small perforating arteries and arterioles that nourish the deep white matter. low bp has also been reported to be a risk factor for wml. as with other hypertensive target organ damage, in addition, in most studies an association between different forms of higher bp variability of bp and wml. however most of these studies have been cross - sectional has been found and, therefore, the relationship observed between some parameters and the presence of wml is an association whose direction remains speculative. various mechanisms may be involved in the association between bp variability and target organ damage and cardiovascular disease. in addition to augmented mechanical stress on the cardiovascular system, leading to cardiovascular remodeling, increased variability of blood flow due to augmented bp variability increases sheer stress on endothelial cells, thereby advancing atherosclerosis, as does sheer stress - induced platelet activation at atherosclerotic stenotic sites. neurohumoral activation, which is increased in subjects with increased bp variability, may also increase the risk of developing target organ damage and, therefore, cardiovascular disease. | silent cerebral white matter lesions (wmls) are a common finding on magnetic resonance imaging of the brain in the elderly. however, in patients with hypertension, wmls tend to occur earlier in life and appear to be more severe. there is a body of evidence that supports the idea that wmls in asymptomatic hypertensive patients should be considered a silent early marker of brain damage. it is known that ambulatory blood pressure monitoring (abpm) correlates more closely with hypertension - related organ damage than office blood pressure. this paper focuses on the associations between blood pressure parameters obtained by 24-hour abmp and cerebral wmls. |
across a very broad taxonomic range animals frequently respond differentially to close kin, even if those kin were previously unfamiliar. logically, this differentiation between individuals according to kinship requires well - defined mechanisms to allow recognition. and whereas animals may learn the cues of familiar individual kin during rearing, recognition of unfamiliar kin must really be recognition of genetic similarity - either to self or to other known kin. a challenge in this area lies in discovering the cues that animals use for genetic recognition of kin, and the genetic encoding of such cues. in many vertebrates, odors are key to the recognition process, and have been widely implicated as cues that allow genetic kin recognition in many species of fish, reptiles and mammals (figure 1). however, vertebrate scents are generally complex, and there have been few attempts to identify the specific scent components used in kin recognition or their genetic basis. in work published recently in bmc evolutionary biology, boulet and colleagues have advanced this field by demonstrating a significant correlation between genetic similarity (estimated from 11 - 14 microsatellite loci) in a captive population of ring - tailed lemurs (lemur catta) and similarity of volatile chemicals in their genital gland secretions, as assessed by gas - chromatography mass - spectrometry. the genetic similarity of two individuals is thus manifest in the odor profile (sometimes referred to as an ' odortype '). even more intriguing, although the genital glands of the two sexes are anatomically distinct (scrotal glands in the male, labial glands in the female), this covariance between genetic and chemical similarity is evident even between individuals of the opposite sex. while some components are expressed only by animals of one sex, more than half (about 170) were expressed by individuals of both sexes. to provide a simple estimate of chemical distance between a pair of individuals, boulet. used the relative abundance of each of these shared compounds to calculate the euclidean distance between the pair (derived from the pythagorean theorem, this sums the pairwise difference,, in abundance of all 170 compounds, such that chemical distance = sqrt(1 + 2 + 3 +.... 170). while there was a broad spread of chemical distances between male - female dyads that had intermediate genetic distance, dyads with low genetic similarity had low chemical similarity whereas those with a high genetic similarity had a higher chemical similarity. this relationship is consistent with the hypothesis that odors from genital secretions can be used to assess genetic relatedness, and maybe close kinship. of particular interest, these relationships were significant both within and between the sexes during the breeding season, but were much weaker or nonsignificant during the non - breeding season. odortype may be particularly important during the competitive breeding season to prevent inbreeding and/or to direct nepotistic behavior towards more closely related individuals. however, this study is still only a first step in establishing whether such odor signals could offer a reliable means of recognizing kinship among ring - tailed lemurs and the genetic basis of the cues used. if lemurs used a measure of chemical distance based on all volatile compounds that are shared within or between the sexes, it would only be of very limited value in assessing kinship because of the considerable range in that measure between individuals of intermediate genetic relatedness. although very closely related animals have similar odortypes, so do many individuals that are much less closely related. if odortype were used to avoid inbreeding, for example, the consequence would be exclusion as mates of many individuals that are not closely related, reducing choice without gaining any genetic benefit. it is likely, therefore, that animals use more specific markers within the odortype to distinguish close relatives reliably (figure 2). chemical distance between pairs of animals based on all volatile compounds in a scent correlates with genetic distance (a), but variance will be high for any particular genetic distance because some compounds are likely to be strongly influenced by non - genetic factors such as current hormone levels and bacterial flora. instead, selective assessment of specific semiochemicals within the scent that correlate strongly with genotype (b) will provide a much more reliable assessment of kinship. there has been surprisingly little progress in establishing the genetic and molecular markers used to recognize kin through scents in vertebrates. in part, this may be due to the molecular complexity of vertebrate scents, which are the product not only of an individual 's genes but also of hormonal and metabolic status, diet and microflora. for the past 30 years, the focus on genetic mechanisms underlying vertebrate kin recognition through odors has been on the major histocompatibility complex (mhc), which is often held to be the major genetic component apparently determining an individual 's scent. inbred laboratory mice have been a key model organism for manipulating mhc genes on a constant genetic background as proof that animals can detect mhc type through scent. as mhc is so highly polymorphic in natural populations, those that share the same mhc type (and mhc - based scent) are very likely to be closely related - mhc odors could be used as a marker of genetic relatedness. yet, despite the precise genetic control offered by laboratory rodent strains, chemical analyses of volatile profiles have found correlations of some volatile components with mhc type but have not yet discovered consistent differences in compounds that are regulated by mhc type [3 - 6 ]. in reality, complex interactions are found with genetic background, microflora and diet, all of which alter the odor profile [3,5 - 7 ]. this plasticity of mhc - derived odortype creates a conundrum. to be useful in natural populations, kin markers must be stable and readily recognized against the variable genetic and environmental background of normal outbred animals. our own studies of wild - derived mice with normal genetic variation in semi - natural populations provided clear evidence that wild mice do not use mhc to avoid inbreeding. in fact, mice showed a very strong avoidance of inbreeding with those sharing another very highly polymorphic marker in mouse scent, the major urinary proteins (mups), which have a strong influence on an individual 's scent profile regardless of other genetic and non - genetic variation. sharing of a single highly polymorphic marker, like mup or mhc type, can provide a reliable indicator of relatedness because only close relatives are likely to inherit both of the same alleles at a particular locus (or both of the same haplotypes in the case of clusters of closely linked genes like mup or mhc). however, this type of mechanism can only be partially effective for kin recognition. for any single locus, the number of alleles shared between two relatives is a matter of chance ; even very close relatives such as full siblings are as likely to share no alleles as they are to share both alleles at a particular locus. modeling alternative genetic mechanisms that could be used to discriminate full sibs from unrelated animals reveals that reliance on a single genetic locus will either fail to identify many relatives (if the requirement is that both alleles are shared) or will mistake many unrelated animals as sibs (if sharing of any allele is used). notwithstanding the theory, house mice do use sharing of mup type, encoded by a single tightly linked cluster of genes, to avoid inbreeding. this may be specific to house mice - there are insufficient data to assess whether such simple recognition systems are widespread. an alternative model is that instead of directly comparing the similarity of scents to self, imprinting on maternal scent encoded by several independent loci is employed to provide reliable recognition of all siblings and maternal half - sibs, because all offspring share with their mother one allele at every locus. laboratory cross - fostering studies in which newborn mouse pups were fostered onto a mother of different mhc type to their own have suggested that animals might imprint on the genotype of their mother and subsequently avoid ' inbreeding ' with those sharing the foster mother 's genotype rather than avoiding mates that match their own mhc type. however, maternal imprinting does not require recognition of the mother 's genotype for kin recognition ; instead animals must be able to recognize the separate haplotypes carried by the mother when these are combined with other unknown haplotypes. this recognition task is likely to be considerably more difficult given the complex effects that mhc type has on odors, particularly as the odors of mhc heterozygotes are not an additive combination of the two homozygous profiles. a key test would be whether mice (or other animals) can recognize the separate mhc haplotypes carried by a heterozygous animal when combined with other mhc haplotypes (for example, animals imprinted on the mhchaplotype must be able to recognize mhcor mhc) ; they also need to be able to do this on the randomly assorting genetic background of outbred animals. a recent study using inbred laboratory mice found that animals recognized non - genetic similarities in offspring from the same mother compared to those from another genetically identical female due to their shared maternal (in utero and postnatal) environment. the approach of relating genetic similarity to the global volatile profile of scent glands is a step towards the systems biology of complex behaviors. indeed, the application of global profiling methodologies to scents could be said to introduce the concept (but preferably not the term !) of ' semiomics '. as with many studies of this nature, the analyte mixtures are complex, and a major challenge is in unbundling the important semiochemicals from the entire volatile profile - although boulet and colleagues refer to a ' semiochemical profile ', it is likely that many of the constituent compounds will be ' silent ' in kin recognition. an attractive way forward is to use the combined datasets to identify those chemicals that show the greatest correlation with relatedness, focusing on differences in relatedness that can be discriminated behaviorally. the candidates can be examined in ' kin - shifting ' experiments such that when they are spiked into a distant sample, they elicit a response more ' akin ' to a close relative. indeed, similar experiments could be conducted using humans to establish the extent to which we too can discriminate our own kin based on genetically determined scents. the development of these ideas was supported by research grants from bbsrc (s19816, bbc603897) and nerc (neg018650). | a recent study in bmc evolutionary biology has shown that genetically similar individual ring - tailed lemurs are also more similar in their scent composition, suggesting a possible mechanism of kin recognition. theoretical and experimental studies reveal challenges ahead in achieving a true systems - level understanding of this process and its outcomes.see research article http://www.biomedcentral.com/1471-2148/9/281. |
alopecia can be a manifestation of mycosis fungoides (mf) ; however, the prevalence is unknown. alopecia is a typical consequence of folliculotropic variant of mf (f - mf), although due to the paucity of f - mf, data regarding detailed findings in these patients are limited. primary cutaneous t - cell lymphomas (ctcls) are a heterogeneous group of skin - homing t lymphocytes malignancies. the classic type of mf is characterized by infiltration of atypical t lymphocyte with cerebriform nuclei in the papillary dermis and evidence of epidermotropism (i.e., the presence of atypical t - cell lymphocytes in the epidermis without significant spongiosis). classic mf typically exhibits slow progression in 1 year after diagnosis and rarely progresses to extracutaneous involvement or disease - related death. alongside this classic type, three subtypes of mf have been recognized in the world health organization (who)-european organization for research and treatment of cancer (eortc) classification of ctcl : a superficial, pagetoid woringer - kolopp type ; a granulomatous slack skin disease ; and a folliculotropic variant of mf (f - mf). f - mf is considered less common variant of mf which is characterized histologically by atypical t lymphocytes that preferentially infiltrate the follicular epithelium and the interfollicular epidermis is usually spared. mucin deposition within the follicular epithelium (i.e., follicular mucinosis) may or may not be present in f - mf lesions. furthermore, one study concluded that there is no any difference in the clinical presentation and behavior of f - mf with or without associated follicular mucinosis. patients with conventional mf usually present with patch- or plaque - type lesions on sun - protected skin whereas patients with f - mf usually manifest with acneiform lesions, grouped follicular papules, and indurated plaques that preferentially involve the head and neck areas. f - mf is considered to have a worse prognosis and more aggressive disease course than conventional mf. due to the paucity of f - mf, these considerations are mainly based on case reports, and a few case series with limited follow - up times. to evaluate alopecia and f - mf among patients with mf, we studied hereon 157 patients with mf referred to our institution from 2002 to 2012. the study protocol was reviewed and approved by the tehran university of medical sciences research center. we conducted a retrospective analysis of 157 patients with biopsy - proven mf, who were evaluated at our cancer center from 2002 to 2012. clinical data collected included age at the onset of cutaneous symptoms leading to the diagnosis of mf, age at the onset of alopecia, sex, locations of alopecia, clinical presentation of alopecia, presence of lymphadenopathy and visceral involvement, and stage of mf at the time of diagnosis were also included. patients with alopecia due to chemotherapy or radiation therapy and patients suffering from androgenic alopecia were excluded from the study. histology slides from available biopsy specimens were stained by hematoxylin and eosin and were reevaluated by our dermatopathologists. the presence of atypical t lymphocytes within the follicular epithelium (i.e., folliculotropism) and the presence of mucin within the follicular epithelium (i.e. follicular mucinosis) were evaluated in biopsy specimens. in all, 157 patients (54 men and 103 women) with mf were evaluated for evidence of alopecia. lymphadenopathy was present in 62 patients ; however, visceral involvement was detected in only three patients. most of the patients were in stage iia and stage ib (36.9% and 27.4%, respectively). five (3.18%) patients with alopecia were identified from reviewing of 157 patients with mf. the male : female ratio was 3:2, and the mean age of patients was 42.8 years [table 1 ]. two of these patients showed patchy hair loss on scalp which was clinically identical to alopecia areata. in these patients, overt mf and f - mf lesions were not present within areas of baldness but were present elsewhere on their bodies and there were no epidermal changes in alopetic area except for mild erythema in one of them. in remaining three patients, hair loss was seen in areas of mf lesions and epidermal changes consisted of patch- and plaque - type lesions of mf, tumors and follicular lesions (f - mf) were also present [figure 1 ]. in two of these patients, tnm stages, histologic and ihc findings [figure 2 ] and other features of patients are summarized in table 1. basic information of patients with mycosis fungoides and hair loss clinical spectrum of hair loss in patients with mycosis fungoides. (a and b) indurated plaques in beard and brow region with localized alopecia, patient 1. (c and d) alopecia areata - like hair loss of scalp, patients 2 and 3. (e and f) patchy hair loss on shoulders and back region with follicular prominence and follicular erythema, patient 4. (g) acneiform lesions with alopecia in lower extremity, patient 5 lesional biopsy specimens : (a) prominent epidermotropism with the formation of small nests of atypical lymphocyte ; (b and c) follicular mucinosis characterized by basophilic granular material (mucin) within hair follicles accompanied by atypical perifollicular and intrafollicular lymphocytes (a : h and e, 100 ; b : h and e, 40 ; c : h and e, 400) in the recent who - eortc classification, f - mf has been determined as a rare variant of mf with distinct clinical and histological findings, treatment responses, and survival rates. the overall 5-year survival rate of f - mf has been estimated to vary from 60% to 87% compared with > 90% 5-year survival rate for the classic patch- or plaque - type mf. hair loss was identified in only 5 (3.18%) of 157 patients with mf in our study. although the prevalence of alopecia in mf was lower than expected, we distinguished two clinically different types of hair loss : (1) hair loss clinically similar to alopecia areata, (2) hair loss within localized mf lesions. regardless of the clinical presentation of alopecia, the existence of atypical t lymphocytes in the follicular epithelium or epidermis indicates that mf contributed to hair loss in these patients. in our study, patients with alopecia and mf were predominantly male (male : female, 3:2) and had a mean age of 52.2 13.4 years at diagnosis of mf, which is consistent with previous studies. however, we only selected f - mf patients among alopetic cases who had diagnosis of mf previously ; hence, the total number of patients was limited. the head and neck are usually spared in classical mf ; however, they are predilection sites for f - mf involvement. in our study, in patients with alopecia areata - like hair loss, scalp was the most common site of alopecia ; however, in other three patients, only one had scalp alopecia with concurrent plaque - type lesions and trunk was the predilection site for hair loss in regions of mf lesions. f - mf is clinically characterized by various cutaneous lesions such as follicular papules, alopetic plaques, acneiform or comedo - like lesions, excoriated nodules similar to prurigo nodularis, pustules, xanthomatous changes, and rarely diffuse erythroderma. in our series, 2 patients (1 male and 1 female) presented with alopecia areata - like hair loss and the only epidermal change was erythema in one of them. they were younger than patients with mf (mean age at diagnosis 46.5 12.2 years) and alopecia was detected within initial years of diagnosis of mf in these patients. therefore, alopecia may be a presenting sign of mf and multiple biopsies during the course of disease may help guide us to the correct diagnosis. in the study of bi., in the series of 38 patients, 34% had patchy hair loss clinically resembling alopecia areata with predilection in scalp region. in another three patients, indurated plaques were the most common findings along with other lesions such as tumors, follicular papules, and acneiform lesions. the mean age at the diagnosis of mf in these patients was 62.6 14.7 years and the male : female ratio was 2:1. the course of the disease before diagnosis of alopecia in this group was more prolonged compared to those with alopecia areata - like hair loss. in cases with alopecia areata - like hair loss, only limited lesions were observed on the scalp and face, but in other patients, scattered lesions were found on the trunk and extremities. these five patients included one patient with stage ib disease, three with stage iia, and one with stage iib. although, tnm classification does not meet exact staging criteria for f - mf patients. that is because of deeper infiltration in plaques of f - mf compared with classical mf. in our series, the classic pattern of folliculotropic infiltration of atypical t - cells was the most frequent pattern (80% of subjects) which is consistent with the study of demirkesen. although detection of atypical t lymphocytes within the follicular epithelium is the key pathologic feature for the diagnosis of f - mf, it should be kept in mind that nuclear atypia may be slight in some instances and these cells may be admixed with other inflammatory cells such as neutrophils, eosinophils, plasma cells, and even some multinucleated giant cells which may obscure the diagnosis of f - mf. the mucin deposition in follicular epithelium may be another diagnostic finding ; however, it is not a constant feature. prominent follicular mucinosis was seen in two of our patients with follicular papules and acneiform lesions. epidermotropism of interfollicular epidermis without follicular involvement was detected in one patient with tumoral mf, although because of multiple lesions in this patient, maybe folliculotropism could have been found with additional biopsies from cutaneous lesions in different sites of the body. the mechanism of hair loss in mf patients remains unclear ; however, inflammatory damage by atypical t lymphocyte and natural killer cells to the follicular keratinocytes along with alterations in cytokines productions has been speculated to be the main cause of alopecia. furthermore, antigen presentation may be important for t - cells activation, and interestingly, mf and alopecia areata are associated with similar human leukocyte antigen - antigen d related (hla - dr) and dq beta 1 (dqb) alleles, which could restrict antigen presentation. thus, t - cells in both disorders may be triggered by similar self - antigens or other agents. another controversial issue is that whether hair loss with or without f - mf can be a prognostic factor in mf. in the study of gerami., the 5- and 10-year overall survivals were comparable between f - mf and classic mf for disease stage less than or equal to iia, and in stages greater than or equal to iib, the overall survivals for classic mf and f - mf were also comparable. however, the 15-year overall survival was 91% and 41% for classic mf and f - mf, respectively. alopecia was recognized in only 3.18% of mf patients in our study which makes it a rare finding. the clinical presentation of alopecia included patchy hair loss resembling alopecia areata and localized hair loss within existent mf lesions. alopecia areata - like hair loss may occur during onset of mf ; hence, clinical suspicion of f - mf is warranted. the alopecia areata and f - mf may have a common pathogenesis mediated by folliculotropic t lymphocytes, whether or not they are multiclonal or oligoclonal atypical lymphocytes. alopecia was recognized in only 3.18% of mycosis fungoides (mf) patients in our study which makes it a rare finding. the clinical presentation of alopecia included patchy hair loss resembling alopecia areata and localized hair loss within existing mf lesions. alopecia was recognized in only 3.18% of mycosis fungoides (mf) patients in our study which makes it a rare finding. the clinical presentation of alopecia included patchy hair loss resembling alopecia areata and localized hair loss within existing mf lesions. alopecia was recognized in only 3.18% of mycosis fungoides (mf) patients in our study which makes it a rare finding. the clinical presentation of alopecia included patchy hair loss resembling alopecia areata and localized hair loss within existing mf lesions. | background : alopecia can be a manifestation of mycosis fungoides (mf) ; however, the prevalence is unknown.aims:we sought to describe the clinicopathologic presentation of alopecia in patients with diagnosis of mf.methods:a retrospective analysis of patients with biopsy - proven mf, who were evaluated at our cancer center from 2002 to 2012, was performed to identify patients with alopecia.results:five patients with alopecia were identified from reviewing of 157 patients with mf. the male : female ratio was 3:2, and the mean age of patients was 42.8 years. two of these patients showed patchy hair loss on scalp which was clinically identical to alopecia areata. in remaining three patients, hair loss was seen in areas of mf lesions, and epidermal changes consisted of patch- and plaque - type lesions of mf, tumors, and follicular lesions (follicular mf) were also present. in two of these patients, lymphadenopathy without any visceral involvement was detected.conclusions:alopecia was observed in 5 (3.18%) patients with mf, which makes it a rare finding, which included alopecia areata - like patchy loss in 2 and alopecia within mf lesions in 3. |
however, it has a higher frequency among patients younger than 40 years, patients with thrombophilia and patients that have foreign body such as catheter in their veins or arterial system. in this case report, we described the clinical and radiological findings of a patient who developed cerebral vein thrombosis post coronary artery bypass grafting secondary undiagnosed protein c and s deficiency which was precipitated by malposition of subclavian central catheter into internal jugular vein. we emphasis the importance of radiological veiw of central vein catheter position just after or at the time of cannulation of central vein, not at some hours later as in our case. central venous catheterization (cvc) via subclavian approach is a very common practice in cardiac surgery, in the view of simplicity, monitoring of blood volume, monitoring of cardiac status, vasomotor tone, management of prolonged surgery and rapid compensation of blood loss intra operatively or in post operative courses. (1) found that the most common malposition related to subclavian vein catheterization is entrance into the internal jugular vein. malposition of a cvp line in the jugular vein automatically has not any complication in the absence of hypercoagulable state. family histories or history of thromboembolism and an unusual site of thrombosis are emphasized for accurate diagnosis of thrombophilia in the post surgery state. however, the post surgical state could be considered as a hypercoagulable state in the absence of reduced serum level of protein c - s. although, there are some reports of jvt with extension to a subclavein vein or the right atrium and subsequent pulmonary artery emboli, but retrograde progression of thrombus from catheter site in jugular vein to cerebral venous system has not been reported in the medical literature (2,3,4). herein, we report a patient who developed cerebral vein thrombosis in post cabg secondary to undiagnosed protein c and s deficiency which was precipitated by malposition of subclavian central catheter into ijv. a 38 years old, 80 kg male patient with history of thrombophelebitis presented with left main coronary artery disease on angiocardiography. neurological examination was be normal and the patient did not have any signs and symptoms such as headache, lethargy, motor or sensory deficits, seizures, neck stiffness and fever. cervical murmur was noted with carotid auscultation, and the remainder of the physical examination was normal.there was no evidence suggestive of thrombus in the left ventricle.the patient was scheduled for off - pump coronary artery bypass grafting (opcab) with general anesthesia, central venous pressure (cvp) line and arterial monitoring. a (cvp) line was inserted via the right subclavian vein by seldinger technique (3) under aseptic precautions by the anesthesia registrar in the operating room. there was a good cvp waveform and good back flow of blood on aspiration from all the three lumens. anesthesia protocol included a combination of fentanyl and pancronium bromide supplemented with isoflurane to permit early extubation. stabilization of target arteries was accomplished with octopus stabilizer (medtronic, ts 300). intravenous heparin (1 mg / kg) was given to maintain activated clotting time (act) between 200 and 300 seconds. cvp readings were taken 30 min apart and each time a good back flow was noted. as part of routine protocol, a portable chest x - ray was performed next morning (12 hours) and, the cvp catheter was found to be internally rotated inside the right proximal internal jugular vein in the direction to cavernous sinus. however, blood could be aspirated from all the three lumen ports, cvp was measured with a normal cvp wave form and iv fluids / drugs could be infused via the same catheter ; we intended to pullout the line and re route it to right atrium. in icu,, he did not have the normal extremity movement or related awakening of the cerebral functions or spontaneous eye opening. the anti - brains edema therapy with steroid was started but the cerebral pathology was seen to persist at the fifth day of post operation. despite neurologist recommendation, the respiratory instability did not permit to transfer the patient for brain imaging safely. however early extubation failed on the eight postoperative day, but the patient was able to move his limbs although he was drowsy. on the twelve postoperative day, he opened his eyes and was able to obey commands ; however, he was not able to move his left arm. history of thrombophelebitis, young age, sub - acute presentation, focal neurologic sign and its rapid recovery urged to reconsider a mri venography and thrombophilia test for detection of cerebral veins pathology. complete blood count and blood biochemistry were within normal limits, except for prolonged erythrocyte sedimentation and areduced protein c and s level. the protein c level was 35% (normal : > 70), and protein s level was 55 % (normal : 65%). there were no abnormal values of antithrombin iii, lupus anticoagulant, and anticardiolipin antibodies. the other tests such as hla - b5, hla - b27, anti - nuclear antibody and rheumatoid factor were also negative. mri venoghraphy on the 18 day of hospital stay revealed thrombosis of cerebral dural vein with typical delta sign, effacement of brains sulcui and edema, but infarction or hemorrhage was not observed (figures 2, 3). central vein cathter going up to cerebral vein magneticresonance imaging showing duralvein thrombosis magnetic resonance imaging revealing empty delta sign protein c - s is a vitamin k - dependent, serine protease that is found in the blood plasma and synthesized in the liver. the active form of protein c - s can inhibit blood coagulation and stimulate fibrinolysis (1). svt has been often a multi factorial disease, i.e the identification of a risk factor or even of a cause should not deter a search for other causes (5,6). several studies, have described some of the well - established risk factors for svt that include inherited thrombophilia such as factor v leiden mutation, protein c and s deficiency, acquired prothrombotic state (pregnancy, purperium and postsurgical period), hepatic dysfunction, autoimmune disease (behet syndrome, systemic lupus erythematosus), malignancy (lung cancer, blood dyscrasia, systemic carcinoma), systemic infectious disease, local infection of the skull (e.g. otitis, mastoiditis) and use of oral contraceptives. other rare conditions predisposed to svt include, inflammatory bowel disease, spontaneous intracranial hypotension, demyelinating disease, down 's syndrome, idiopathic hypereosinophilic syndrome, evans syndrome (immune thrombocytopenia and autoimmune hemolytic anemia), bone marrow transplantation, high altitude, trivial trauma, jumping from a rock, surgical procedures, head trauma, brain tumors and arterial infarcts (714). nagesh kumar reported a case of a 35 years old male who presented to the emergency center with drowsiness and focal seizures leading to grand seizures and loss of consciousness. significantly low protein s (7% ; normal 54137%) and c (41% ; normal 72147%) levels were detected. the author concluded that advanced aids might be considered as an acquired hypercoagulable state (16). kuwahara described a 47 years old male who, despite anticoagulant therapy for thrombophlebitis for long time period, presented with mild left hemiparesis and ipsilateral hypesthesia. magnetic resonance (mr) imaging showed subacute thrombosis of both svt and a cortical vein in the right cerebral hemisphere. the diagnosis was svt and cerebral cortical venous thrombosis caused by congenital protein c deficiency. the patient was treated conservatively, and his clinical course was uneventful (17). singhal reported a case of hepatic failure caused thrombophilia by severe deficiency of protein c, protein s and antithrombin iii. lefebvre presented the combined occurrence of protein c and protein s deficiencies in a 32 years old woman who presented by focal neurological sign and symptom and manifested by extensive cerebral venous thrombosis (19). roos described a case of intracranial dural sinus thrombosis in the postpartum period related to the hypercoagulable state of pregnancy. the author report a patient who developed a superior sagittal sinus thrombosis in the second week postpartum, associated with a dysfunctional protein c and a decreased free protein s concentration (20). massons reported a 32 years old patient with protein c deficiency who presented with the endocranial hypertension syndrome and multiple hemorrhagic cerebral infarction. the author demonstrated the importance of considering protein c deficiency in the diagnosis of cerebral venous thrombosis in young adults (21). chung evaluated central venous catheter (cvc) blockage as a complication in pediatric oncology patients. this author investigated inherited thrombophilic states as a predisposing factors for cvc blockage in chinese children with cancer. the author concluded that inherited thrombophilic factors alone were not associated with cvc blockage in their, s pediatric cancer patient population (22). barker reviewed his cytic fibrosis center 's history of catheter - related events over 13 years and found five thrombotic events in four patients, two of whom carried the factor v leiden mutation. the author concluded that thrombophilic state was detected in 53% patients, and two out of four subjects with catheter related thrombosis carried a genetic defect. the author concluded that genetic risk factors for familial thrombophilia play an important role in the manifestation of catheter - related thromboembolism in children (24). wermes evaluated the clinical relevance of genetic risk factors of thrombosis in 137 paediatric patients with malignancy. all patients had central venous lines. no patient received heparin or any other anticoagulant. ten patients (7.3%), six with leukemia and four with solid tumors developed thrombosis. four of the six patients with leukemia and thrombosis (67%) but only 21% of leukemia patients without thrombosis had a genetic risk factor (p < 0.013, chi2). no genetic defect was found in the four patients with other solid malignancies and thrombosis (25). a prothrombotic risk factor or a direct cause often, a precipitating factor such as foreign body in venous system like cvp line, head injury or even surgical immobility causes sinus thrombosis in a person with a genetically increased risk such as thrombophilia state. our case had predisposing risk factors for svt such as history of dvt, post surgical period and mal position of cvp line, but cabg was performed by beating heart and without use of cpb or fibrinolytic drugs as predisposing factors to thrombosis. post - surgical state automatically did not predispose to svt in the absence of thrombophilia. some cases of svt in the pregnancy related surgical procedures were associated with hyper coagulable state and hormonal change of pregnancy. in our patient, central line was exactly malpositioned into the internal jugular vein. in non - thrombophilic patients, risk of thromboembolic sequels in temporary cvp malposition is probably very low, but in thrombophilic disorders such as protein c - s deficiency, this risk severely increased. ferro fund that at least one risk factor such as internal jugular vein cathterizem can be identified in more than 85% of patients with cerebral venous thrombosis and an aquired thrombophilia and inherited thrombophilia was noted in 34%, 22% of patients subsequently (26). inherited thrombophilias associated with cerebral venous thrombosis with or without foreign body include deficiencies of antithrombin, protein c - s deficency, factor v leiden mutation and the prothrombin gene mutation 20210 (27). the most probable explanation of svt in our patient with unusual course of cvp line in the jugular vein in proximity to cerebral veins was the presence of a background of protein c - s deficiency. angiography, magnetic resonance (mr) imaging, un - enhanced computed tomography (ct), mr venography and ct venography are particularly useful techniques for detecting cerebral venous and brain parenchymal changes that may be related to thrombosis. cvt may cause obstruction of venous drainage with increasing venous pressure in the affected region of the brain and causes parenchyma changes, secondary to cytotoxic edema, vasogenic edema, or intracranial hemorrhage. in contrast with arterial ischemic states, many parenchymal abnormalities secondary to venous occlusion are reversible. the direct signs of svt include demonstration of the thrombus on imaging or indirect, as when there are ischemic or vascular changes related to the venous outflow disturbance. indirect signs are not specific, such as parenchyma change by brain swelling, white matter edema, cortical sulci narrowing, loss of gray - white matter differentiation and hemorrhagic infarction as hemorrhagic spot in white matter edema (27.28). in conclusion, this case report aims to bring to attention the possibility of sagittal vein thrombosis associated with malposition and internal rotation of cvp line inside vessels in thrombophilic patient. careful literature search revealed that our case is the only reported case of thrombophilia induced svt predisposed by cvp line. we reiterate the importance of radiological verification of cvp catheter position just after or at the time of cannulation of central line, not at 12 hour later as in our case. | backgroundcerebral venous thrombosis is an uncommon disorder in the general population. however, it has a higher frequency among patients younger than 40 years, patients with thrombophilia and patients that have foreign body such as catheter in their veins or arterial system.case detailsin this case report, we described the clinical and radiological findings of a patient who developed cerebral vein thrombosis post coronary artery bypass grafting secondary undiagnosed protein c and s deficiency which was precipitated by malposition of subclavian central catheter into internal jugular vein.conclusionwe emphasis the importance of radiological veiw of central vein catheter position just after or at the time of cannulation of central vein, not at some hours later as in our case. |
for those patients presenting with symptoms of small - bowel obstruction, the list of differential diagnoses is vast, with numerous extramural, mural and luminal causes. in this report, we describe two cases that presented with a history and imaging suggestive of small - bowel obstruction. both had deranged clotting function as a result of excess anticoagulation. we present their subsequent management and emphasize the merit of conservative management for this rare cause of small - bowel obstruction. the first case we report is of a 62-year - old lady with a background of atrial fibrillation, hypertension and chronic obstructive pulmonary disease, who presented with a 2-day history of abdominal pain, distension and vomiting of bilious fluid. she had not passed stools or flatus. on examination she appeared uncomfortable, with an irregular pulse rate of 144, but she was maintaining her blood pressure at 116/70 mmhg. on palpation, her abdomen was distended with generalized tenderness ; she was maximally tender in the left iliac fossa. laboratory investigations revealed an international normalized ratio (inr) of 10 ; she was anticoagulated with warfarin due to her atrial fibrillation. initial imaging revealed dilated small - bowel loops on abdominal radiograph (fig. 1). a ct scan was performed that showed dilation of the proximal small bowel, with a long segment of thickened small - bowel loops that was reported as possible intussusception (fig. 2). the images were discussed further at the multidisciplinary surgical radiology meeting in the context of her haematology results. it was determined that the long segment of the thickened small bowel was, in fact, haemorrhage rather than intussusception. figure 2:post - contrast ct (sagittal plane) showing proximal small - bowel dilation and a thickened small - bowel segment (case 1). post - contrast ct (sagittal plane) showing proximal small - bowel dilation and a thickened small - bowel segment (case 1). the patient was managed conservatively with intravenous fluids, a nasogastric tube and bowel rest. her warfarin was withheld and her anticoagulation was reversed with fresh frozen plasma and vitamin k over the course of 4 days. she improved clinically and tolerated oral intake with the passage of stool. a small - bowel meal 4 days after admission revealed no residual evidence of obstruction and she was discharged home. the second case described is of a 57-year - old gentleman who presented with a 3-day history of abdominal pain, vomiting and absolute constipation. his past medical history of note was a metallic aortic valve, although he was unable to give an accurate drug history on admission. on examination, 3), and he was managed as a case of small - bowel obstruction, with intravenous fluid and a nasogastric tube. figure 3:abdominal radiograph showing dilated small - bowel loops (case 2). abdominal radiograph showing dilated small - bowel loops (case 2). the following morning on the post - take ward round he was peritonitic and a decision was made to take him for an exploratory laparotomy prior to further imaging. an inr was sent as a work - up for theatre, which returned at 12.6 ; drug reconciliation revealed that he was on warfarin. intraoperatively, there was a 30-cm segment of proximal jejunum with spontaneous intramural haemorrhage ; the bowel was viable with pulsatile vessels in the mesentery. there was no intraluminal bleeding or any other cause for obstruction ; therefore, washout and closure was performed without resection. postoperatively, he recovered well and was discharged on clexane, with the view to restarting warfarin in the community. the first case we report is of a 62-year - old lady with a background of atrial fibrillation, hypertension and chronic obstructive pulmonary disease, who presented with a 2-day history of abdominal pain, distension and vomiting of bilious fluid. she had not passed stools or flatus. on examination she appeared uncomfortable, with an irregular pulse rate of 144, but she was maintaining her blood pressure at 116/70 mmhg. on palpation, her abdomen was distended with generalized tenderness ; she was maximally tender in the left iliac fossa. laboratory investigations revealed an international normalized ratio (inr) of 10 ; she was anticoagulated with warfarin due to her atrial fibrillation. initial imaging revealed dilated small - bowel loops on abdominal radiograph (fig. 1). a ct scan was performed that showed dilation of the proximal small bowel, with a long segment of thickened small - bowel loops that was reported as possible intussusception (fig. 2). the images were discussed further at the multidisciplinary surgical radiology meeting in the context of her haematology results. it was determined that the long segment of the thickened small bowel was, in fact, haemorrhage rather than intussusception. figure 2:post - contrast ct (sagittal plane) showing proximal small - bowel dilation and a thickened small - bowel segment (case 1). post - contrast ct (sagittal plane) showing proximal small - bowel dilation and a thickened small - bowel segment (case 1). the patient was managed conservatively with intravenous fluids, a nasogastric tube and bowel rest. her warfarin was withheld and her anticoagulation was reversed with fresh frozen plasma and vitamin k over the course of 4 days. she improved clinically and tolerated oral intake with the passage of stool. a small - bowel meal 4 days after admission revealed no residual evidence of obstruction and she was discharged home. the second case described is of a 57-year - old gentleman who presented with a 3-day history of abdominal pain, vomiting and absolute constipation. his past medical history of note was a metallic aortic valve, although he was unable to give an accurate drug history on admission. on examination, 3), and he was managed as a case of small - bowel obstruction, with intravenous fluid and a nasogastric tube. figure 3:abdominal radiograph showing dilated small - bowel loops (case 2). the following morning on the post - take ward round he was peritonitic and a decision was made to take him for an exploratory laparotomy prior to further imaging. an inr was sent as a work - up for theatre, which returned at 12.6 ; drug reconciliation revealed that he was on warfarin. intraoperatively, there was a 30-cm segment of proximal jejunum with spontaneous intramural haemorrhage ; the bowel was viable with pulsatile vessels in the mesentery. there was no intraluminal bleeding or any other cause for obstruction ; therefore, washout and closure was performed without resection. postoperatively, he recovered well and was discharged on clexane, with the view to restarting warfarin in the community. spontaneous intramural haemorrhage is characterized by bleeding into the submucosal layer of the bowel in the absence of trauma. the jejunum is the most commonly affected site, followed by the ileum and then duodenum. this is in contrast to traumatic intramural haemorrhage primarily seen in the duodenum due to its retroperitoneal components. it occurs during a hypercoagulable state, excess anticoagulation due to warfarin therapy being the most frequent aetiology, but case reports also describe such a presentation in those with haemophilia, haematological malignancies and chemotherapy treatment. the symptoms are indistinguishable from other causes of small - bowel obstruction, although there may be a history of warfarin therapy or peripheral stigmata of excess anticoagulation. a contrast ct scan of the abdomen and pelvis is the imaging modality of choice, classically showing circumferential hyperdensity and wall thickening, with luminal narrowing and obstruction. the management of small - bowel obstruction secondary to intramural haemorrhage is predominantly conservative, including reversal of clotting factors. operative management may be indicated if diagnostic uncertainty remains or there is haemodynamic instability due to active bleeding. abbas. presented data from 13 cases of spontaneous intramural small - bowel haemorrhage, retrospectively analysed with regard to inpatient outcomes and long - term morbidity. eleven of the 13 patients were managed conservatively with no significant sequelae at a mean follow - up of 35 months ; the two patients who underwent laparotomy had a viable small bowel and no resections were undertaken. in an aging population, with a large number of patients anticoagulated for medical conditions such as atrial fibrillation, spontaneous intramural haemorrhage is a differential that must be considered. identification of hyperdense intramural bleeding, in the context of grossly deranged clotting, may avoid the morbidity of undergoing a potentially unnecessary laparotomy. | spontaneous intramural haemorrhage is a rare cause of small - bowel obstruction, occurring most commonly in those who are anticoagulated. we describe two cases that presented with a history and imaging suggestive of small - bowel obstruction ; both had international normalized ratios of above 10 on admission. the first case, a 62-year - old lady on warfarin for atrial fibrillation, was managed conservatively with good effect. in contrast, the second case, a 57-year - old gentleman on warfarin for his metallic aortic valve, underwent diagnostic laparotomy that revealed a 30-cm segment of proximal jejunum with spontaneous intramural haemorrhage. in this study, we emphasize the merit of conservative management for this rare cause of small - bowel obstruction. |
in accordance with the goals of this special issue of metal - based drugs, this article deems to fulfil a teaching and guiding role in new anticancer drug research. we hope it will spawn new ideas and new research in the field of anticancer therapy. in what follows, we first create an understanding of why new anticancer drugs are vigorously searched for by highlighting some of the problems associated with a typical chemotherapeutic agent, cisplatin. one possible way to minimise the negative side effects associated with chemotherapeutic agents is to make use of a synthetic polymeric drug delivery system. we explain how such systems may significantly enhance the therapeutic effectiveness of chemotherapeutic agents and highlight some of the structural features they must have. we then develop a general synthetic strategy an experimental chemist may follow to actually synthesise a polymeric drug delivering device and proceed to visualise this strategy utilising a literature example. the need for certain structural features in a delivering device is then motivated by a discussion of the biological mechanism of cell uptake and drug release from the drug carrying device. in conclusion, the synthesis and characterisation of a new example of a polymeric drug delivery system derived from aspartic acid and lysine is presented. many potentially good pharmaceutical agents are either dose limited, or excluded from use in clinical therapy due to insolubility in an aqueous medium, or because of the many severe side effects that they may exhibit. as far as cisplatin, the most successful metal - containing chemotherapeutic drug of recent times, is concerned, these side effects include inter alia : poor aqueous solubility;intensive damage to the linings of the intestines, which leads to the loss of appetite (anorexia) and eventually starving in the case of mice and rats ; severe nausea, vomiting, and audio toxicity ; high toxicity towards the kidneys and bone marrow ; being a moderate carcinogen itself. it can induce lung cancer, skin papillomas, and other carcinomas. in general, most if not all chemotherapeutic drug side effects are due to their general inability to differentiate between diseased and healthy cells. poor aqueous solubility ; intensive damage to the linings of the intestines, which leads to the loss of appetite (anorexia) and eventually starving in the case of mice and rats ; severe nausea, vomiting, and audio toxicity ; high toxicity towards the kidneys and bone marrow ; being a moderate carcinogen itself. even if a synthetic chemotherapeutic drug has few side effects, it does not imply success in clinical use. one must realize that chemotherapeutic agents usually are poisons, or at the very least, they are foreign to the body. the defence mechanism of the body, the reticuloendothelial system, recognizes them as such and tries to remove them as fast as possible. cisplatin, for example, is eliminated from the body in a biphasic excretion mechanism in such a way that 50% of the initial administered dose is excreted within 20 hours. after 110 hours, 70% of the initial administered amount of drug is removed from the body by the reticuloendothelial system. the principle mode of excretion in mice appears primarily to be through the urine, 90% of the injected dose being excreted within five days after injection. this quick excretion rate causes large drug concentration fluctuations in the body, and hence, also unpredictable therapeutic activity, a highly undesirable situation. the negative impact of such drug concentration fluctuations in the body becomes apparent when one relates it to 50% lethal dosages (ld50 values), optimum dosages, and a dosage having no influence on the diseased site at all. for cisplatin, the ld50 dosage applicable to mice is 14 mg / kg mass of test animal, the optimum dose is half of this, 7 mg / kg test animal, but 3 mg / kg mass of the test animal has absolutely no influence on the diseased site at all. with the excretion profile that cisplatin shows, it is clear that it is extraordinary difficult to maintain drug levels in a patient close to the optimum dose level, but still below the ld50 value for prolonged times. the initial required overdose of drug that is required to maintain useful drug levels in the body explains much of the negative side effects of chemotherapeutic drugs. a further point of consideration in developing and administering anticancer drugs is the development of drug resistance by a tumour after prolonged use. a neoplastic population of cells is not a static entity, but rather an ever - changing one. tumours display an amazing ability to escape or neutralize the actions of chemotherapeutic agents to which they were initially sensitive. some common examples of this evasive ability are as follows : the loss of specific receptors;down - regulation of tumour - associated antigens ; andshedding of antigens into the body fluids. the metastatic nature of cancer cells thus leads to the development of drug resistance after continued drug dosage [11, 12 ]. the loss of specific receptors ; down - regulation of tumour - associated antigens ; and shedding of antigens into the body fluids. one of the most fundamental barriers to selective drug delivery involves the so - called targeting problem. ideally, one would like a toxic agent that can discriminate between neoplastic and nonneoplastic cells. this approach presumes the existence of something to aim at, that is, some molecular characteristic that differs between target and nontarget cells. even if a target can be identified, or a cell need can be exploited, as has been done in vitro, the problem remains of actually bringing the pharmaceutical agent, in vivo, from the point of administering to the neoplastic growth. to achieve this, many physiological barriers including the reticuloendothelial system of the body have to be bypassed. consequently, to improve the treatment of cancer, research today focusses on developing new and better chemotherapeutic agents having less side effects (i.e., drugs that can zoom onto diseased sites), new methods of drug delivery are being researched, combination therapy is being investigated in the hope of finding synergistic effects, the scope of radiation therapy is broadened, and completely new methods of combating cancer are sought. new metal - based drugs include members of the titanocene and ferrocene family of compounds [13, 15 ]. a promising example of a new method of cancer treatment focusses on photodynamic therapy (pdt) [16, 17 ]. in pdt, the photo - active drugs in themselves are inactive towards both healthy and cancer cells. however, when light of the correct wavelength is shone on them, the drugs become photo - activated and give rise to conditions that kill the cells it is in contact with, normally via the generation of singlet oxygen. a good measure of selective cancer cell killing is therefore induced into the treatment of a patient merely by focussing light from a suitable laser source onto a tumourous growth. healthy cells will stay largely undamaged provided that light is not shone upon it. if cancer cells would selectively and preferentially absorb the pdt drug, this would lead to a further enhancement of selective cancer cell destruction. some of them were found to be distributed upto 90% selectively in cancer cells, and only 10% in healthy cells after a certain induction period. many detrimental properties and side effects of promising anticancer drugs may at least be partially overcome if the pharmaceutical agent is covalently anchored to a polymeric drug carrier. polymeric or macromolecular drug - carrying devices should be distinguished from sustained drug - release systems. sustained drug - release systems are normally associated with polymers ; frequently insoluble ; and in the form of powders, pellets, and capsules from which the slow release of an encapsulated drug from the container interior is possible. they normally do not represent systems that may affect target - specific drug delivery as much as they are devices for the continued release of drugs. the term polymeric drug carrier describes a polymer or macromolecule that contains covalent binding sites that are available to anchor active pharmaceutical units as terminal or pendent groups protruding from the side of the polymeric chain. the naturally occurring ones such as antibodies [19, 20 ] induce a high mode of selective drug action onto the polymeric drug - containing device, but usually suffer from a lack of large amounts of drug - anchoring sites. synthetic polymers on the other hand are more prone to suffer from immunogenic side effects, but this may be overcome by copolymerisation with ethylene glycol fragments. their big advantage is that they can be tailor - made to be suitable for almost any purposes and can be engineered to have a large amount of drug - anchoring sites. the clinical administration of a polymer bound drug, as compared to the free agent, may significantly enhance the therapeutic effectiveness in terms of the following : accelerated and unencumbered distribution in the aqueous central circulation system of the body (the blood), thereby reducing the risks of premature degradation and excretion ; they facilitate cell entry via endocytosis a cell membrane penetration mechanism generally unavailable to nonpolymeric compounds but highly desired for drugs operating intracellularly ; more precisely controlled drug serum levels (i.e., the restriction of the drug concentration to the gap between toxic and minimum effective levels) ; an enhanced depot effect through slow drug release from the polymer - drug conjugate. the structural features of the polymer - drug conjugate required to comply with these attributes include the following : a highly flexible linear main chain comprising structural entities that can provide water solubility;a sufficiently large molecular mass to prevent quick excretion from the body (the threshold for elimination via the kidneys is ca. 70 000 g mol1);a biodegradable carrier backbone prone to catabolic elimination of the spent polymer main chain after the payload of drug has been delivered to the target site ; a large amount of reactive functional groups as suitable binding sites for drug attachment, these sites should be distanced from the main chain by short (515 constituent atoms) spacer segments to diminish the steric bulk effect of the polymeric carrier backbone, and they should be sufficiently separated from each other along the backbone to prevent intramolecular multifunctional drug binding;the separation of binding sites on the polymeric backbone requires insertion of side chains on the main chain between active binding sites that lack drug - binding capabilities, but enhance other desirable properties. these may include enhancing the hydrophilic nature of the ultimate polymeric drug - carrying device, the incorporation of moieties that enhance drug - targeting capability (i.e., a tumour homing device), antispasmodic properties, or any other desirable physiological effect ; one or more biofissionable functions (amide, ester, urethane, disulphide, etc.) to be inserted into the carrier - drug connecting link. at least one of these must be sufficiently remote from the main chain to permit enzyme approach and cleavage action to result in effective drug release in a targeted biological compartment ; carrier backbones and spacers which are non toxic per se. they should especially possess absolute minimal immunogenicity so as to preclude carrier - induced pathological effects. akey component towards the success of polymeric drug - carrying devices centres around biodegradable bonds and their capability to home preferentially onto a neoplastic growth. apart from targeting fleeting receptors on a collection of metastatic neoplastic cells, the nutritional needs of such cells may be utilized to gain preferential neoplastic cell access. neoplastic cells grow much faster than healthy cells, and have a much higher demand for food in the form of amino acids and energy. hence copolymers constructed at least partially from amino acids are very attractive as polymeric drug delivery devices. sugar groups as a source of energy will especially enhance preferential uptake by neoplastic cells. other biodegradable groups that may be employed include disulphide bonds that may be reduced to thiol groups, or, since cell interior has a lower ph than blood plasma, for example, weakly acid - labile groups such as thio - ethers. accelerated and unencumbered distribution in the aqueous central circulation system of the body (the blood), thereby reducing the risks of premature degradation and excretion ; they facilitate cell entry via endocytosis a cell membrane penetration mechanism generally unavailable to nonpolymeric compounds but highly desired for drugs operating intracellularly ; more precisely controlled drug serum levels (i.e., the restriction of the drug concentration to the gap between toxic and minimum effective levels) ; an enhanced depot effect through slow drug release from the polymer - drug conjugate. a highly flexible linear main chain comprising structural entities that can provide water solubility ; a sufficiently large molecular mass to prevent quick excretion from the body (the threshold for elimination via the kidneys is ca. g mol1) ; a biodegradable carrier backbone prone to catabolic elimination of the spent polymer main chain after the payload of drug has been delivered to the target site ; a large amount of reactive functional groups as suitable binding sites for drug attachment, these sites should be distanced from the main chain by short (515 constituent atoms) spacer segments to diminish the steric bulk effect of the polymeric carrier backbone, and they should be sufficiently separated from each other along the backbone to prevent intramolecular multifunctional drug binding ; the separation of binding sites on the polymeric backbone requires insertion of side chains on the main chain between active binding sites that lack drug - binding capabilities, but enhance other desirable properties. these may include enhancing the hydrophilic nature of the ultimate polymeric drug - carrying device, the incorporation of moieties that enhance drug - targeting capability (i.e., a tumour homing device), antispasmodic properties, or any other desirable physiological effect ; one or more biofissionable functions (amide, ester, urethane, disulphide, etc.) to be inserted into the carrier - drug connecting link. at least one of these must be sufficiently remote from the main chain to permit enzyme approach and cleavage action to result in effective drug release in a targeted biological compartment ; carrier backbones and spacers which are non toxic per se. they should especially possess absolute minimal immunogenicity so as to preclude carrier - induced pathological effects. although models as those mentioned above for synthetic polymeric drug carriers have been in existence for some time, until recently only a few efforts were made to actually prepare such compounds. a review by neuse describes some of the most recent researches in this field. scheme 1 illustrates the synthetic approach to actually obtain such polymeric drug - delivering devices. the centre of scheme 1 serves to visualise the overall strategy. at the left and right ends of scheme 1 an example for an actual synthesis of a polymeric drug delivery system the use of the water - soluble polyaspartic acid drug carrier not only allowed the water - insoluble parent ferrocene - containing drug to be well soluble in water in concentrations exceeding 100 g dm3 but it also increased the cytotoxicity of the active drug as tested on murine emt-6 cancer cells from an ld90 value of 500 g / cm3 in the case of free 3-ferrocenylbutanoic acid to 80 g / cm3 drug content for the polymeric drug delivery device. at least two factors probably contribute to the enhanced activity of the above - mentioned polymeric drug delivery device. the first must be related to the enhanced aqueous solubility of the ferrocene drug. free ferrocene itself, which is insoluble in water, has been shown to be completely inactive as cytotoxic agent. the second factor centres around the use of aspartic acid as monomeric subunit in the main chain of the polymeric drug carrier. as the cancer cells have a large need for nutrients such as amino acids, the use of a polyamino acid as drug carrier may cause the drug carrying device to be absorbed faster and more efficiently by cancer cells than would be the case for the free drug. a key factor should be observed in the synthetic sequence shown in scheme 1. the use of tri- or higher - functional polymerization monomers is useful in the synthesis of polymeric drug carriers, as it provides a free arm where the drug may eventually be anchored. only two of the three or more monomer functionalities should be used to obtain a linear, highly flexible, and soluble monomer. however, normally the use of tri- or higher - functionalised monomers will lead to the formation of highly crosslinked, rigid, and insoluble polymers. in the case of aspartic acid, this did not happen because the formation of stable five - membered succinimide rings is thermodynamically highly favoured. it effectively masked the second carboxylic acid functional group of aspartic acid from unwanted crosslinking reactions. for other tri- or higher - functionalized amino acids, such as trifunctionalised lysine or tetrafunctionalised cystine, protection of the additional functional groups is required to prevent formation of pharmaceutically undesired crosslinked polymers. uptake by neoplastic (and healthy) cells of the soluble polymeric device, shown in scheme 1, probably occurs by endocytosis, in particular, by fluid - phase pinocytosis as described by duncan and kopeek. as shown in figure 1, polymers in solution are internalised by means of fluid - phase pinocytosis. cell internalisation may also occur if the polymeric drug delivery device binds to surface cell receptors by means of adsorptive pinocytosis. polymeric drug carriers with porphyrins or phthalocyanines attached to them will probably gain access to neoplastic cells by means of adsorptive pinocytosis as this would be consistent with the selective uptake of these macrocycles by cancer cells. it was found that pinocytotic uptake by cells of polymers bearing phenol - containing side chains was greatly enhanced. once internalized, fusion of the pinocytotic vesicles with primary lysosomes takes place to form secondary lysosomes. release of the drug from the polymeric drug carrier inside the secondary lysosomes occurs by enzymatic hydrolysis of the biodegradable amide bonds that link the drug, ferrocene in scheme 1, with the polymeric drug carrier, a polyaspartic acid derivative in scheme 2. primary lysosomes may contain more than 50 hydrolytic enzymes that are generated in the golgi apparatus. next, the drug and other useful low - molecular - mass degradation products like amino acids are released from the secondary lysosomes for use inside the cell nucleous. finally, the spent polymer main chain and any other nondegradable material leave the cell by exocytosis. no drug is released outside a living cell because these drugs are not in contact with appropriate hydrolytic enzymes. as the folding pattern of the polymeric drug carrier normally inactivates the drug while polymer - bound, it means no negative side effects can be induced by the drug prior to release from the polymeric main chain. in addition, if the polymeric drug delivery device could be designed in such a way that it is internalized selectively into only neoplastic cells, the negative side effects associated with chemotherapy could be circumvented completely. lysine, 1, introduces a new dimension into our discussion of the design of polymeric drug carriers. to prevent crosslinking reactions, one can either protect the - or the -amino group, scheme 2, to obtain lysine derivatives 3 or 4, respectively. only -amino trifluoroacetyl protected lysine, 3, is obtained by direct treatment of lysine with trifluoroacetic anhydride in trifluoroacetic acid because the -amino group is much more basic than the -amino group. the zwitter - ionic structure of lysine, 1, implies that the -amino group is mainly in the protonated form and thus well protected against acylation reactions. however, treatment of 1 with ethyl thioltrifluoroactetate under basic conditions according to the method described by schallenberg gave n - trifluoroacetyllysine, 4, in 33% yield after recrystallisation from hot water / ethanol in a 2 : 3 ratio. it is advantageous to use the -amino group rather than the -amino group eventually as the drug - anchoring site because it separates it far enough from the polymer main chain to allow easy enzyme approach to initiate cleavage of amide bonds to facilitate drug release from the eventual drug - carrying devices 1113. if the -amino group is protected for later drug - anchoring purposes, the steric bulk effect of the polymeric main chain may be so large that enzyme - induced drug release will become kinetically very slow. in addition, it was also previously demonstrated that drug - anchoring reactions of the type shown in scheme 2 to generate 1113 via amide bond formation proceed more effectively with compounds possessing longer side chains. we describe here the syntheses, from n - trifluoroacetyllysine 4, aspartic acid 5, and polymeric precursors 6 and 7 of polymeric drug carriers 8 and 9, scheme 2. we also describe how the ferrocenyl and phthalocyanine moieties may be covalently anchored to the carrier polymers 8 and 9 utilising the coupling agent 10 to obtain the polymeric drug delivery devices 11, 12, and 13. it was not very easy to predetermine reaction conditions to obtain a specific target x / y ratio in polymer 6 because of a tendency towards homopolymerisation by aspartic acid. in first experiments, 4 and 5 were thermally copolymerised in a monomer mole ratio of 1 : 10 (4 : 5) at 180c under nitrogen and atmospheric pressure in the presence of a polyphosphoric acid (ppa) mass fraction of 0.8 for 8 hours. the first was extracted with water, and after dialysis in an 8,000 molecular mass cutoff membrane tubing, 6 was isolated having an x / y = 2.6/1 ratio, and inherent viscosity inh = 0.06 dl g in 3% yield, m.p = 301c (dec.). the x / y ratio was established by comparing the h nmr signal integrals at 5.15.5 ppm (ch of imide, one proton per closed imide unit), 4.44.6 ppm (ch of aspartic acid, the integral values showed only 65% ring closure of the aspartic acid recurring unit occurred), with that of the combined,, and methylene protons of the lysine recurring unit (6 protons per lysine recurring unit) at 0.91.8 ppm. the remaining water - insoluble residue was dissolved in dmf and precipitated with ethanol to yield 56% polymer having inh(dmf) = 0.07 dl g, m.p = 286c (dec.) in this case, the x / y unit ratio was established by h nmr as 22/1. the remainder of material had molecular mass < 8,000 g mol1, and was dialysed away. when 4 and 5 were thermally co - polymerised in a monomer mole ratio of 1 : 6 = 4 : 5, other conditions still being the same, the water - soluble fraction was isolated in 8% possessing a monomer ratio of x / y = 1.4/1. the dmf - soluble fraction was isolated in 30% yield having a monomer ratio of x / y = 25/1. in another experiment, when the ppa mass fraction was lowered from 0.8 to 0.5, the water - soluble fraction was very small, but the dmf - soluble fraction was isolated in 50% yield having also a monomer ratio of x / y = 25/1. the above results showed that 4 and 5 have a tendency to homopolymerise. the low lysine content in each recovered fraction was attributed to the tendency of -amino acids to form 6-membered diketopiperazine rings upon heating. in the case of 4, this would result in termination of any polymerisation process, and account also for the large % of low - molecular - mass material that was lost upon dialyses. c nmr spectroscopy showed that the trifluoroacetyl protective group did not survive the polymerisation conditions. however, loss of the trifluoroacetyl protective group must have happened in the latter stages of polymerisation, since no insoluble portion was found in the workup of 6. crosslinking was, therefore, ruled out as the cause of the relatively moderate yields. further experiments focussed exclusively on a 1 : 2 = 4 : 5 monomer mole ratio in a ppa mass fraction of 0.5 at 180c for only 2.5 hours at pressures below 2 torr. these conditions resulted in almost no water - soluble fraction (< 1%), and a dmf - soluble fraction (18% yield, decomposition temperature = 269c) having a repeating unit ratio of x / y = 7/1 and 29% of aspartic acid fragments still c nmr showed that the trifluoroacetyl protective group remained intact when using these shorter reaction times. by substituting ppa with 85% ortho h3po4, repeated experiments gave products having recurring unit ratios ranging 2/1 < x / y the increase in yield and better recurring unit ratios probably arose because it is easier to mix 4 and 5 to a homogeneous distribution in ortho h3po4 than in ppa. lower reaction temperatures (140c) lowered yields substantially to only 6% and virtually the entire product became water - soluble, even after 7 hours of reaction time. the absence of any h nmr signals at 5.25 ppm, as well as the presence of the signal at 4.24.6 ppm showed that for this product, ring closure of the aspartic acid fragment did not occur. it had a repeating unit ratio of x / y = 4/1 as compared to the target of 2/1. c nmr showed that the trifluoroacetyl protective group remained intact under these conditions of decreased temperatures even though the reaction time was increased to 7 hours. nucleophilic attack of amines on the succinimide rings of polymeric precursor 6 takes place with ease, and the success rate is independent of x / y ratios. by choosing the correct nucleophiles, the solubility properties of choice may be introduced to the carrier polymer. here, the 3-aminopropyl morpholine unit was used to generate water - soluble 8 in 83% yield after stirring the intermediate product 7 with 2% naoh solution to remove the trifluoroacetyl protecting group and dialysis in 8,000 molecular mass cutoff membrane tubing. although intermediate 7 can be isolated en route to 8, this is not necessary. 2-phenylethyl amine was used to generate white, water - insoluble 9 in 90% yield after removal of the protective group and slow precipitation with water from a dmf solution. to demonstrate the carrier capabilities of 8 and 9, the antineoplastic ferrocenyl moiety and an example of the family of drugs that may be used in photodynamic cancer therapy, a phthalocyanine, have been anchored on these polymeric drug carriers. both ferrocene and phthalocyanine are insoluble in water when not functionalised, or as carboxylic acid derivatives. even as sodium carboxylates, they are poorly soluble in water. however, once anchored on the polymeric drug carrier 8, the ferrocene - containing derivative 11 was soluble in excess of 30 g / dm3, while the phthalocyanine derivative exceeded an aqueous solubility of ca. 5 g dm3 at ph s more extreme than those found in the gastrointestinal system (18.5) [32, 33 ]. however, prior to drug anchoring, the ferrocene and phthalocyanine fragments needed to be modified in such a way that coupling with the available amine active sites on the polymeric drug carriers 8 and 9 is possible. to generate a biodegradable bond between drug and polymeric carrier, formation of a peptide (i.e., amide), saccharide, or nucleotide bonds the amide bond was aimed for as a biodegradable bond linking carrier to drug. thus, 3-ferrocenylbutanoic acid and cobaltotetracarboxyphthalocyanine were prepared according to known procedures for later reaction with the amine - containing polymeric carrier devices 8 and 9. although polymers 8 and 9, the ferrocene - containing derivatives 11 and 13, and the phthalocyanine - containing derivative 12 are robust, frequently the drug moiety of interest (as opposed to the drug carrier) may be very labile. it is advantageous, therefore, to be able to anchor the drug onto the polymeric carrying device under very mild conditions in order to preserve labile moieties. also, coupling procedures need to be developed that will allow coupling in media in which both the water - soluble drug carrier, here 8 and 9, and poorly soluble or aqueous - insoluble drug may be partially dissolved or suspended. coupling with the aid of o - benzotriazolyl - n, n, n,n-tetramethyluronium hexafluorophosphate, 10, at room temperaturein dmf or dmso, sometimes with thf or water as cosolvent, satisfies this requirement. 24-hour reactions between tetracarboxyphthalocyanine and 8 with a x / y ratio of 3/1 in the presence of this coupling agent led to only ca. 10% phthalocyanine binding in 12 as ascertained by h nmr utilising the phthalocyanine phenyl aromatic proton signal (12 hours per phthalocyanine group) at ca. the closeness of the cooh functional group in the phthalocyanine moiety had two effects, both associated with an extremely slow coupling rate due to the closeness of the bulky phthalocyanine core (slow coupling reactions because of steric crowding have already been commented on, and are described in reference 25). firstly, it explains the low binding efficiency (z=0.1y) of cobaltotetracarboxyphthalocyanine to polymeric drug carrier 8. secondly, it explains why crosslinking reactions involving cobaltotetracarboxyphthalocyanine apparently did not take place to a noticeable extent. as ascertained by h nmr, no precipitate from the dialysis tubing other than free cobaltotetracarboxyphthalocyanine (i.e., unbound) could be found. in contrast, 3-ferrocenylbutanoic acid was anchored to a derivative of 8 having a x / y ratio of 2/1 ca. 7080% effectively (i.e., zaverage=0.75y) within 1 hour at room temperature to give 11 as product. this result was obtained by comparing h nmr signals (obtained in d2o) of the ch2o ch2 morpholine signals (4 hours per morpholine group) at 3.53 ppm with those of the ch3 substituent in 3-ferrocenylbutanoic acid at 1.1 ppm (it is a well - defined peak that can be uniquely identified next to the lysine signals), the combined,, and methylene protons of the lysine recurring unit (6 protons per lysine recurring unit) at 1.21.6 ppm, and the aspartate ch protons at 4.24.5 ppm. an atomic absorption iron elemental analysis for 11 with x / y = 2/1 showed an iron content of 4.8% which corresponds to z=0.67y. coupling of 3-ferrocenylbutanoic acid to a derivative of 9 with x / y ratio 3/1 to obtain 13 in dmf as solvent was more successful, probably because there was no solvent water present during the coupling reaction, see experimental. by comparing the integral values of the phenyl group h nmr signals (in dmso - d6x) at 7.15 ppm with those of the ch3 substituent in 3-ferrocenylbutanoic acid at 1.2 ppm (it is a well - defined peak that can be uniquely identified between the lysine signals) and the combined,, and methylene protons of the lysine recurring unit (6 protons per lysine recurring unit) at 0.91.6 ppm, it was ascertained that the ferrocenyl group was anchored 94% efficiently, that is, z=0.94y. an atomic absorption iron elemental analysis for 13 with x / y = 3/1 showed an iron content of 5.08% which corresponds to z=0.87y. the water - insoluble polymer 12 is of particular interest because it demonstrates two separate functional moieties can be supported on the same polymer drug carrier, here phenyl and ferrocenyl. this begs the question : can more than one antineoplastic group be anchored on the same polymeric drug carrier ? if this would be possible, combination therapy would be possible without administering more than one type of drug in separate doses to a patient. the synergistic effect usually associated with combination therapy [36, 37 ] would then be potentially obtainable in a single drug dose by binding to the carrier polymer all the drugs required. biological studies are at the moment in progress to determine if present lysine - containing polymeric drug - carrying devices 11 and 12 can compare in efficiency with previously described polyaspartic acid drug - delivering systems. chemicals were from merck & co., inc. (nj, usa) or sigma - aldrich and used without further purification. nmr measurements, at 298 k, were recorded on a bruker advance dpx 300 nmr spectrometer. chemical shifts are reported as values relative to sime4 at 0 ppm. infrared spectra were recorded on a hitachi 27050 infrared spectrometer in a kbr matrix. viscosity measurements were made in a cannon - fenske tube at 35.2c in water or dmf. iron analyses were performed on a varian techtron atomic absorption spectrometer at 272 nm. n - trifluoroacetyllysine, 4, and cobalto tetracarboxyphthalocynanine were prepared as described before. a representative example of the synthesis of polymer 6 : aspartic acid (1.331 g ; 10 mmol), n - trifluoroacetyllysine (1.211 g ; 5 mmol), and polyphosphoric acid (2.542 g) were thoroughly mixed in a 250 cm round - bottom flask. the flask was mounted on a rotating evaporator, and lowered (while rotating slowly) into an oil bath preheated to 180. the pressure was reduced after 5 minutes to below 2 torr with the aid of a mechanical pump. after 2.5 hours of slow rotation dialyses of the water extract for 16 hours gave after freeze drying only a negligible quantity of product. precipitation by ethanol afforded 0.38 g (18%) of 6 ; inh(dmf) = 0.08 dl g, x / y = 7/1 (see discussion text for conditions to obtain other x / y ratios) ; m.p. 295 c (dec.). h nmr (dmso - d6-x) : 0.91.8 (6h ;, and ch2 s of lysine) ; 2.1 (3.8 h ; ch2 of open aspartic acid fragment) ; 2.62.9 (4.8 h ; ch of succinimide) ; 3.03.4 (4.8 h ; ch of succinimide) ; 4.44.6 (1.9 h ; ch of aspartic acid fragment) ; 5.15.5 (4.8 h ; ch of succinimide). c nmr (dmso - d6-x) : 110122, q, cf3 ; 155 - 156, q, cocf3. ir : 1798, 1720 (c = o) ; 1219, 1189 (cf3). polymers 7, and 9 : a solution of 0.21 g [0.5 mmol, inh = 0.08 dl g, x / y = 3/1 ] of 6 and 2-phenylethyl amine (0.202 g ; 2 mmol) in 5 cm dmf was stirred for 5 hours at ambient temperature. the newly formed 7 was not isolated (although it can be by precipitation with ethanol or water), but stirred for 5 hours with 20 cm of a 2% naoh solution. the resulting clear reaction mixture was dialysed for 16 hours, and freeze dried to give 0.24 g (90% yield) of 9 as a white solid which would not redissolve in pure water, but was soluble in dmso and dmf ; inh(dmf) = 0.07 dl g ; x / y = 3 ; m.p 275c (dec.). polymer 8 : this polymer was obtained in exactly the same way as polymer 9, but by replacing 2-phenylethyl amine with 3-aminopropyl morpholine (0.289 g ; 2 mmol), and the x / y ratio of 6 was 2/1. characterisation data for 8 : yield = 83% ; inh = 0.06 dl g ; x / y = 2 ; m.p. 196c (dec.). unlike 9, this polymer remained water - soluble after dialysis and freeze drying. polymer 11 : to a solution of 0.2 g (0.24 mmol ; inh = 0.06 dl g ; x / y = 2) of 8 in 1 cm water was added (in the correct order) 0.035 g (0.35 mmol) triethylamine, a solution of 0.068 g (0.25 mmol) 3-ferrocenylbutanoic acid in 1 cm thf (the thf may be replaced with dmf) and 0.114 g (0.3 mmol) of o - benzotriazolyl - n, n, n,n-tetramethyluronium hexafluorophosphate, 10. the mixture was stirred for one hour at room temperature during which time the heterogeneous mixture homogenized. water (10 cm) was added to the reaction mixture before it was centrifuged, dialysed for 16 hours in an 8,000 molecular mas cutoff membrane tubing and freeze dried to give 0.11 g (44%) of 11 ; inh = 0.04 dl g ; x : y : z = 2.00 : 0.35 : 0.65 ; m.p. h nmr (d2o) : 1.01.2 (0.65 of 3h, ch3) ; 1.21.6 (6h ;, and ch2 s of lysine) ; 3.53 (8h, ch2o ch2 of morpholine), 3.94.2 (0.65 of 9h, c10h9fe) ; 4.24.6 (3h, ch of aspartate). ir / cm : 1660 (c = o) ; 1550 (nh). polymer 12 : the same procedure was used as for 11 except that the solvents were all dmf, 3-ferrocenylbutanoic acid was replaced with an equivalent amount of cobalto tetracarboxyphthalocyanine and the reaction time was increased to 24 hours. characterisation data : 44% yield ; inh = 0.04 dl g ; x : y : z = 2.0 : 0.9 : 0.1 ; m.p. 194c (dec.) ; h nmr (d2o) : 1.21.6 (6h ;, and ch2 s of lysine) ; 3.53 (8h, ch2o ch2 of morpholine) ; 4.24.6 (3h, ch of aspartate) 7.38.3 (0.1 of 12h, phthalocyanine aromatics) ; ir / cm : 1720, 1660 (c = o) ; 1550 (nh). polymer 13 : the same procedure was used as for 12, except that 8 was replaced by an equivalent amount of 9, tetracarboxyphthalocyanine was replaced with a solution of 0.068 g (0.25 mmol) 3-ferrocenylbutanoic acid dissolved in 1 cm dmf and the reaction was allowed to proceed for 1 hour only. characterisation data : 64% yield ; inh = 0.04 dl g ; x : y : z = 3.00 : 0.13 : 0.87 ; m.p. h nmr (dmso - d6-x) : 1.2 (0.87 of 3h, ch3) ; 0.91.6 (6h ;, and ch2 s of lysine) ; 4.1 - 4.2 (0.87 of 9h, c10h9fe) ; 4.24.6 (4h, ch of aspartate). ir / cm : 1655 (c = o) ; 1553 (nh). in summary, it was shown that upon using the thermal polymerisation technique, aspartic acid and n - trifluoroacetyllysine both have a tendency to homopolymerise. this tendency becomes stronger as reaction conditions become harsher, such as higher temperatures, longer reaction times, or lowering of pressures. ring closure of the aspartic acid fragment becomes progressively less efficient when milder reaction conditions are employed. it was also shown that the trifluoroacetyl protective group is less stable at elevated temperatures for prolonged periods of time. chemical removal of the trifluoroacetyl protective group was achieved under mild alkaline conditions to liberate free amino groups on side chains of lysine - containing potential polymeric drug carriers. coupling of a carboxylic acid - functionalised ferrocene with the amine - containing polymeric drug carrier was effectively achieved utilising o - benzotriazolyl - n, n, n,n-tetramethyluronium hexafluorophosphate as coupling agent. this was presumably due to the poor solubility of cobaltotetracarboxyphthalocyanine in the required solvents. | the general synthetic strategy towards water - soluble biodegradable drug carriers and the properties that they must have are discussed. the syntheses of water - soluble biodegradable copolymers of lysine and aspartic acid as potential drug - delivering devices, having amine - functionalised side chains are then described. covalent anchoring of carboxylic acid derivatives of the antineoplastic ferrocene and photodynamically active phthalocyanine moieties to the amine - containing drug carrier copolymers under mild coupling conditions has been achieved utilising the coupling reagent o - benzotriazolyl - n, n, n,n-tetramethyluronium hexafluorophosphate to promote formation of the biodegradable amide bond. even though the parent antineoplastic ferrocene and phthalocyanine derivatives are themselves insoluble in water at ph < 7, the new carrier - drug conjugates that were obtained are well water - soluble. |
regeneration of dentin - pulp complex is the long - term goal of endodontics and restorative dentistry. recently, there has been an increasing interest in applying the concept of tissue engineering to endodontics. the creation and delivery of new tissues to replace diseased, missing, or traumatized pulp potential technologies for regenerative endodontics include root canal revascularization, post natal stem cell therapy, pulp implant, scaffold implant, three dimensional cell printing, injectable scaffold and gene therapy. a growing body of evidence is demonstrating the possibility for regeneration of tissues within the pulp space and continued root development in teeth with necrotic pulps and open apexes. recent case reports from multiple authors support the feasibility of such regenerative endodontic procedures (rep 's). the future application of regenerative and tissue - engineering techniques to dentistry holds immense potential for meeting a variety of patient needs. the next decade of dentistry is speculated to see unparalleled advances in the field of regenerative endodontics. however, there is a need for translation of this novel therapy from labs to the clinics which requires high quality research coupled with collaboration between basic scientists and clinicians. for the same to occur, detailed knowledge of rep 's and adequate skills in performing them is of prime importance. conducted a survey to understand the attitude of the dental practitioners towards this new era of treatment. this study was limited to a small section of endodontists who were members of the college of diplomats of the american board of endodontics. more recently another similar survey was carried out amongst the us dentists training in different specialties by manguno. there is a need to survey health - care providers in other geographic locations also, that would help in understanding the global awareness on this topic. no evidence in the scientific literature exists that provides information about the opinions, understanding and attitudes of endodontists in india regarding the delivery of rep 's. this survey was thus designed similar to the earlier ones and was carried out on a much larger scale amongst the endodontic residents studying across all institutions in india. these residents are the upcoming generation of endodontists in the nation and form the bulk of potential practitioners and research associates in the next decade. hence, it is important to understand their opinions, level of awareness and potential acceptance towards this advancement in endodontics. this will also help in ascertaining if more emphasis needs to be given to teaching rep 's in the post graduate curriculum and alterations if any are required in the teaching curriculum of the residents pertaining to rep 's. indian council of medical research has established certain guidelines for stem cell research in which the ethics of using stem cell therapies for dental treatment have not been emphasized. the opinion of the residents might be useful in reframing the guidelines for the safety of regenerative endodontic treatments. after approval from the organizing committee, 200 copies of the questionnaire were circulated at the 26 federation of operative dentistry of india, and 19 indian endodontic society national conference 2011 held at new delhi, amongst the endodontic residents pursuing post - graduation in conservative dentistry and endodontics at various colleges across the country on the issue of rep 's. the first part contained questions regarding profile of respondents including year of study, age, sex, and demographics. the second part contained 23 questions regarding knowledge and opinions about the use of rep 's and their application in a clinical scenario. the questionnaire data was analyzed by the number of responses as a percentage of the total responses to gain an insight into the majority opinions of the participants as done previously by epelman. out of 200 copies of the questionnaire which were circulated 150 completed surveys were received yielding an overall response rate of 75%. some participants gave more than one reply to each question or did not reply to each question. a survey of attitude and opinions of endodontic residents of india towards regenerative endodontics all the participants were in the age group of 25 - 35 year. (41.3%) of students who participated were from south indian colleges, (24.6%) were from north india, (10%) of participants belonged to colleges from west india and only one respondent was from east indian college. remaining (23.3%) participants had not mentioned the location of their post - graduation study. the majority (93.3%) of endodontic residents devoted more than 20 h / week in clinics. half the participants (50.6%) had received continued education in stem cells and/or regenerative dental treatments. the majority of participants were of the opinion (86.6%) that regenerative therapy should be incorporated into dentistry. however, very few of them (14.6%) had used umbilical cord or other types of stem cell banking for themselves or a relative. most of the respondents (84.6%) believed that stem cell banking would be useful to regenerate dental tissues. more than two third of participants (70.6%) also thought that regenerative stem cell therapies will be used in dentistry within the next decade. more than one third of participants (41.3%) felt that it will be possible to implant new teeth grown in a laboratory in the next 11 - 20 years. majority of the participants (88%) were willing to attend training in rep 's. two third of participants (74.6%) thought the greatest obstacle to a patient accepting rep 's would be higher cost of treatment, (12%) thought it would be fear of stem cell therapy and the remaining (13.3%) thought it would be due to other reasons. the majority of participants (87.3%) were willing to save teeth and dental tissues for use as part of future rep 's. three fourth of participants (83.3%) thought that rep 's could be a more successful treatment than implants, (12.6%) were unsure, and remaining (6%) of the participant did nt consider that rep 's could be a better treatment than implant. majority of participants (83.3%) were of the opinion that rep 's should be tested on animals before clinical testing. most of the participants (85.3%) agreed that the dental professional association should regulate the use of stem cell therapies ; only (6.6%) participants did n't want regulation and (8%) were unsure. half of the participants (52.6%) were already using some type of regenerative therapy in their clinical practice, such as membranes, scaffolds or bioactive materials ; while the remaining (47.3%) had not used any regenerative therapies during their post graduate training. (46.6%) of participants responded that regenerative treatment would be successful, (45.3%) participants did not know if the outcome of rep 's would be successful ; few participants (8%) thought it would be unsuccessful. the majority of participants (77.3%) reported that the healing of periapical tissues could be enhanced by rep 's. (19.3%) of participants did not know if the healing of periapical tissues could be enhanced by tissue engineering, whereas only five participants (3.3%) thought it would not be enhanced. the participants felt the most valuable application of rep 's to be for the pulp tissue revitalization within a root canal (20%). the next would be continued root development in immature teeth as indicated by (9.3%) of participants. 13 (8.6%) agreed that rep 's could be used to heal periradicular bone and three (2%) participants thought this kind of treatment could be used to replace avulsed teeth. majority of participants (60%) however believed that rep 's could be applied to all the above mentioned clinical situations. almost half the participants (48.5%) reported that they come across necrotic immature teeth in 11 - 25% of their cases. (22%) participants indicated that necrotic immature teeth accounted for less than 10% of cases in their out - patient department (opd). (20%) responded that 25 - 50% of their cases involved necrotic immature teeth and 15 of them (10%) reported to have more than 50% of such cases in their opd. half of the participants (54%) reported that avulsed or traumatized teeth account for less than 10% of their opd cases. one third participants (38.6%) reported that periradicular lesion accounted for between 26% and 50% of cases seen in their opd. (28.6%) participants indicated that even more than 50% of cases in their opd involved periradicular lesions ; (22.6%) indicated such cases to be between 11% and 25%, while remaining 10% reported that occurrence of such cases to be less than 10%. more than half of the participants (54%) consider the application of calcium hydroxide followed by mineral trioxide aggregate (mta) apical plug and backfilling with obturation material to be the optimum treatment for necrotic immature teeth. only one eighth participants agreed that application of triple antibiotic paste and pulp regeneration would be the optimum treatment for necrotic immature teeth. majority of participants (76.6%) were willing to collect dental tissue for stem cell bank. most of the participants (50.6%) believe that the cost of rep 's should be more than current treatment. the majority of participants (53.3%) would recommend stem cell treatment and rep 's to their patients if it was the most effective treatment option. (41.3%) of students who participated were from south indian colleges, (24.6%) were from north india, (10%) of participants belonged to colleges from west india and only one respondent was from east indian college. remaining (23.3%) participants had not mentioned the location of their post - graduation study the majority (93.3%) of endodontic residents devoted more than 20 h / week in clinics. half the participants (50.6%) had received continued education in stem cells and/or regenerative dental treatments. the majority of participants were of the opinion (86.6%) that regenerative therapy should be incorporated into dentistry. however, very few of them (14.6%) had used umbilical cord or other types of stem cell banking for themselves or a relative. most of the respondents (84.6%) believed that stem cell banking would be useful to regenerate dental tissues. more than two third of participants (70.6%) also thought that regenerative stem cell therapies will be used in dentistry within the next decade. more than one third of participants (41.3%) felt that it will be possible to implant new teeth grown in a laboratory in the next 11 - 20 years. majority of the participants (88%) were willing to attend training in rep 's. two third of participants (74.6%) thought the greatest obstacle to a patient accepting rep 's would be higher cost of treatment, (12%) thought it would be fear of stem cell therapy and the remaining (13.3%) thought it would be due to other reasons. the majority of participants (87.3%) were willing to save teeth and dental tissues for use as part of future rep 's. three fourth of participants (83.3%) thought that rep 's could be a more successful treatment than implants, (12.6%) were unsure, and remaining (6%) of the participant did nt consider that rep 's could be a better treatment than implant. majority of participants (83.3%) were of the opinion that rep 's should be tested on animals before clinical testing. most of the participants (85.3%) agreed that the dental professional association should regulate the use of stem cell therapies ; only (6.6%) participants did n't want regulation and (8%) were unsure. half of the participants (52.6%) were already using some type of regenerative therapy in their clinical practice, such as membranes, scaffolds or bioactive materials ; while the remaining (47.3%) had not used any regenerative therapies during their post graduate training. (46.6%) of participants responded that regenerative treatment would be successful, (45.3%) participants did not know if the outcome of rep 's would be successful ; few participants (8%) thought it would be unsuccessful. the majority of participants (77.3%) reported that the healing of periapical tissues could be enhanced by rep 's. (19.3%) of participants did not know if the healing of periapical tissues could be enhanced by tissue engineering, whereas only five participants (3.3%) thought it would not be enhanced. the participants felt the most valuable application of rep 's to be for the pulp tissue revitalization within a root canal (20%). the next would be continued root development in immature teeth as indicated by (9.3%) of participants. 13 (8.6%) agreed that rep 's could be used to heal periradicular bone and three (2%) participants thought this kind of treatment could be used to replace avulsed teeth. majority of participants (60%) however believed that rep 's could be applied to all the above mentioned clinical situations. almost half the participants (48.5%) reported that they come across necrotic immature teeth in 11 - 25% of their cases. (22%) participants indicated that necrotic immature teeth accounted for less than 10% of cases in their out - patient department (opd). (20%) responded that 25 - 50% of their cases involved necrotic immature teeth and 15 of them (10%) reported to have more than 50% of such cases in their opd. half of the participants (54%) reported that avulsed or traumatized teeth account for less than 10% of their opd cases. one third participants (38.6%) reported that periradicular lesion accounted for between 26% and 50% of cases seen in their opd. (28.6%) participants indicated that even more than 50% of cases in their opd involved periradicular lesions ; (22.6%) indicated such cases to be between 11% and 25%, while remaining 10% reported that occurrence of such cases to be less than 10%. more than half of the participants (54%) consider the application of calcium hydroxide followed by mineral trioxide aggregate (mta) apical plug and backfilling with obturation material to be the optimum treatment for necrotic immature teeth. only one eighth participants agreed that application of triple antibiotic paste and pulp regeneration would be the optimum treatment for necrotic immature teeth. majority of participants (76.6%) were willing to collect dental tissue for stem cell bank. most of the participants (50.6%) believe that the cost of rep 's should be more than current treatment. the majority of participants (53.3%) would recommend stem cell treatment and rep 's to their patients if it was the most effective treatment option. the discovery of stem cells in the pulp of permanent and deciduous teeth raised the intriguing possibility of using dental pulp stem cells for tissue engineering. recent advances in the identification and characterization of dental stem cells, and in dental tissue - engineering strategies, suggest that within the next decade, bioengineering approaches may successfully be used to regenerate dental tissues and whole teeth. in order for this approach to reach clinical relevance in human, adequate interest and knowledge backed by research amongst the service providers is the prime requisite. this survey was hence conducted to collect data about the level of awareness, knowledge and present clinical status about stem cell therapies and rep 's amongst the endodontic residents of our country. the survey yielded a very enthusiastic response from the residents, wherein nine out of ten felt that regenerative therapy should be incorporated into dentistry. more than two third of participants were optimistic about its use in dentistry in the next decade, and nearly one third felt this new approach would be successful to the level of possibility of implanting laboratory grown teeth. this positive response could be due to the recent surge in public discussions on this topic through various forums including an increase in tissue engineering articles published in scientific journals, talks based on stem cell therapies and news dominating dental and medical tribunals. most residents were willing to save teeth and dental tissues through rep 's and preferred it over implants as a treatment option, however, almost all felt a need to attend training in rep 's, reflecting an underlying lack of knowledge. according to the majority of respondents another prerequisite to carry out rep 's would be proper ethical regulation by the respective professional associations. epelman. in their study also stressed on the importance of such regulations to come in place. for rep 's to become the mainstay of treatment modalities a strong research backing is warranted ; wherein most respondents felt that these should be tested on animals before clinical application. in spite of enthusiasm and willing attitude, only one fifth respondents had used stem cell banking for themselves or relatives. in fact, they felt that the biggest deterrent for patients to accept this treatment modality would be the fear of stem cells, followed by the high cost. in their opinions, rep 's should be priced such that it is equally affordable to patients as other standard procedures. in clinical practices, almost half of the residents were doing some type of rep 's, with a majority of these limited to use of membranes, scaffolds or bioactive materials. most of the residents were aware of other rep procedures but were unsure about its results. half of them were of the opinion that rep 's could be used in various applications like healing of periradicular bone, continued root development in immature teeth, pulp tissue revitalization within a root canal and tooth re - implantation. however, only one eighth respondents have found regenerative techniques valuable in treating necrotic immature teeth which constituted 20% of patients reporting to them. more than half of the participants still consider the application of calcium hydroxide followed by mta apical plug and backfilling with obturation material to be the optimum treatment for necrotic immature teeth. this gives an insight to the fact that the residents are not trained in performing advanced regenerative endodontic techniques. there is a need for continuing education and training programs related to all treatments that accomplish pulp - dentin regeneration from the simplest blood clot revascularization method to the most complex treatment, which involves creating tissue - engineered dental pulp constructs in the laboratory and implanting them into cleaned and shaped root canals. safeguards have to be in place to protect research participants receiving stem cell transplants, and patients at large from receiving unproven stem cell therapies. in india, indian council of medical research has taken an initiative to lay down the guidelines pertaining to stem cell research which were revised in march 2012. individual researchers, organizations, sponsors, oversight committees and others, associated with research on human stem cells and for their derivatives, both basic and clinical. however, there is a need for the creation of more expansive guidelines covering all rep 's in addition to these guidelines to protect patients and health care providers. the survey participants expressed general optimism and at the same time showed a consensus on the need for research and training towards rep 's. an impending need was felt amongst the residents for ethical regulation of rep 's and guidelines for protecting patients by local governing bodies. more survey research like this should be conducted amongst health - care providers in other geographic locations that would help in understanding the global awareness on this topic. | aim : the objective of this survey was to study the level of awareness, current state of knowledge and opinions towards regenerative endodontic treatments amongst the endodontic residents of india.settings and design : questionnaire based survey was designed.materials and methods : after approval from the organizing committee of 26th federation of operative dentistry of india and 19th indian endodontic society national conference 2011, 200 copies of the questionnaire were circulated amongst the endodontic residents in conservative dentistry and endodontics at various colleges across the country about regenerative endodontic procedures. the survey included profile of the respondents and consisted of 23 questions about their knowledge, attitude and opinions regarding use of these procedures as part of future dental treatment.results:the survey showed that half the participants (50.6%) had received continued education in stem cells and/or regenerative dental treatments. the majority of participants were of the opinion (86.6%) that regenerative therapy should be incorporated into dentistry, and most of them (88%) were willing to acquire training in learning this new treatment strategy. the results indicated that half of the participants (52.6%) were already using some type of regenerative therapy in their clinical practice ; however, with a majority of these limited to use of membranes, scaffolds or bioactive materials.conclusions:these results reflect that endodontic residents are optimistic about the use of regenerative endodontic procedures ; however, a need for more research and training was felt. |
radiology plays an important role in the diagnostic assessment of dental patients. for this reason, several imaging methods have been introduced and employed to improve the accuracy of diagnosis and treatment plans. cone - beam computed tomography (cbct) is a novel imaging technology that has been used in the craniofacial region since 1998. first studies that confirmed the accuracy of cbct in the oral and maxillofacial region was published in 2004. comparing with conventional ct, cbct has some advantages such as high performance, low cost and reduced radiation dose. cbct imaging provide a great chance for examining morphologic aspects of the craniofacial complex, including alveolar bone and can be used to quantitatively assess bone height and thickness with high accuracy. cbct offers images of the buccal and lingual bone plates, which are not apparent in conventional two - dimensional images due to superimposition. considering these benefits, a single 360 rotational scan provides cbct image data in a digital format. for image reconstruction, the obtained information is rendered into a 3-dimensional (3-d) image using an algorithm for volumetric tomography. these 3-d images made by cbct are composed of voxel, which is the smallest image unit and determines image resolution. the size of each voxel is determined by its height, width and thickness and the spatial resolution of cbct depends upon the voxel dimension. the smaller voxel dimension results in the greater image resolution ; however, higher radiation doses are needed for smaller voxel. in addition to the voxel size of the cbct scanner, several other factors including the properties of the bone itself, the skill of the examiner (the person making the measurements), the software used to view and measure the cbct images and the presence or absence of soft - tissue at and around the studied site may also potentially affect the accuracy of linear measurements of alveolar bone from cbct images. although a number of studies have demonstrated the precision of linear measurements performed on cbct images, it seems there is no study on the effects of the voxel size on measurement of mandibular thickness yet. in light of the above, the aim of this study was to evaluate the influence of different image acquisition protocols on the measurement of thickness of the mandible to find out whether voxel size could lead to different mandibular thickness measurement or not. this was a descriptive - analytical study performed in department of oral and maxillofacial radiology and torabinejad dental research center, school of dentistry, isfahan university of medical sciences between july 2012 and september 2012. after approval of the anatomy department of the isfahan university of medical sciences, 16 dried human mandibles with complete canine - to - canine permanent dentitions in the mandibular front were selected. mandibles included in this study had approximately medium size, u - shape arch, without any fracture or defect on alveolar processes. seven sites including midline region, bilateral canine regions, bilateral mental foramen regions and bilateral molar regions were marked on each mandible using 2 mm 1 mm strips of thin aluminum foil. two cbct scans with different settings were performed using a galileos cbct scanner (sirona dental systems gmbh, bensheim, hessen, germany). following image acquisition protocols were used for each mandible : protocol 1 : field of view (fov) of 15 cm, 85 kvp, 42 mas, 0.15 mm voxel, 14 s scan timeprotocol 2 : fov of 15 cm, 85 kvp, 10 mas, 0.30 mm voxel, 14 s scan time. protocol 1 : field of view (fov) of 15 cm, 85 kvp, 42 mas, 0.15 mm voxel, 14 s scan time protocol 2 : fov of 15 cm, 85 kvp, 10 mas, 0.30 mm voxel, 14 s scan time. measurement of the mandibular thickness was carried out on a multi - planar reconstruction screen using the sidexis xg software(sidexis next generation 2.4, sirona dental systems, bensheim, germany). in order to measure the buccal - lingual thickness of the mandible at each of the aforementioned sites, the cursor was moved exactly 10 mm toward the occlusal direction from the inferior border on the cross section. then, a line perpendicular to this line was drawn from the external limit of buccal / labial cortical plate to the external limit of the lingual cortical bone [figure 1 ]. a screenshot of the image that shows measurement of bone thickness in the molar region of one mandible using the sidexis xg software(sidexis next generation 2.4, sirona dental systems, bensheim, germany) data were imported and analyzed by statistical package for the social sciences version 20 (spss inc., all descriptive statistics are presented as means and standard deviations for mandibular thickness in each measurement. according to the type of variables, analysis of variance was used to analyze data. the level of significance was set at p 0.05) [table 1 ]. cbct dedicated to maxillofacial imaging introduces an innovation in maxillofacial imaging. since the advent of cbct scanners in the previous decades, there has been an explosion of interest in the application of these devices in various fields such as oral and maxillofacial surgery, orthodontics and dentistry. considering the increasing applicability of this imaging modality in dentistry, it is vital to determine an image acquisition protocol that provides 3-d views with the appropriate resolution for evaluation of different bony structures. it is well - known that spatial resolution of the image is inversely correlated with the voxel dimension and voxel size is also inversely correlated with the radiation dose. therefore, before selecting the image acquisition protocol, it is necessary to determine the cost - benefit ratio of the selected protocol according to the as low as reasonably achievable dose of radiation (alara) principles. alara principle suggests choosing the scanning protocol with the lowest possible radiation dose that provides an image with the adequate resolution for assessment of the structures. given the above, the important question is whether the higher image resolution leads to different measurement results or not. this study was performed to answer this question when cbct was employed to measure the mandibular thickness at different sites. to the best of our knowledge, it seems this is the first investigation that has measured and compared the mandibular thickness at different sites using different image acquisition protocols. present study demonstrated that although smaller voxel (high resolution) protocols have been reported to be associated with higher level of radiation exposure, using image acquisition protocols with smaller voxel size did not lead to different mandibular thickness measurements in all seven examined areas. the combination of these findings implies that using protocols with smaller voxel dimension only increases radiation - related risks with no additional benefits. a number of studies have investigated the influence of voxel size on imaging outcomes in different clinical settings. assessed the effect of cbct voxel size (0.1 mm, 0.2 mm, and 0.3 mm) on the diagnosis of occlusal caries. using in - vitro models, they concluded that at all voxel sizes, cbct images can be considered a tool for use in the diagnosis of occlusal caries with no significant difference in relative treatment effect values. wood also conducted an animal study to determine factors affecting alveolar bone height measurements from cbct images. although wood initially hypothesized that voxel size may have an impact on the measurements from cbct images, he concluded that the voxel - dimension factor had an insignificant impact on the measurements. performed a study on 10 dried mandibles to investigate the influence of voxel resolution on the linear accuracy of cbct surface models. they reported that an increased voxel resolution did not result in greater accuracy of the surface model measurements. in another study, liedke. viewed 59 teeth for external root resorption (err) following three protocols in which the variation was the voxel size (0.4, 0.3 and 0.2 mm). it was concluded that cbct is a reliable method for the investigation of simulated err, and a 0.3 mm voxel appeared to be the best protocol, associating good diagnostic performance with lower x - ray exposure. in contrast to the findings of present study, sun. have shown that voxel size may affect the accuracy of linear measurements and the diagnostic quality of cbct images. after evaluation of 11 maxillary specimens from 6-month - old pigs, they found that measurement inaccuracies of alveolar bone height were substantially improved after using protocols with smaller voxel size (from 0.40 mm to 0.25 mm). one of the major limitations of the present study was the use of dried mandibles without natural soft - tissue. we did not use soft - tissue equivalent such as water bath. using water bath may cause problems for positioning, and may damage dry mandibles. in addition, the mandibles we used did not move and had fiducial markers for measurement. the other limitation to this study was that the obtained protocol results were not compared with a gold standard. in summary, considering the insignificant differences of the mandibular thickness measurements using different voxel sizes, it would be more reasonable to use 0.30 mm voxel size instead of 0.15 mm voxel size to avoid unnecessary radiation exposure. | background : cone - beam computed tomography (cbct) is a new imaging technology that has been widely used in implantology, oral and maxillofacial surgery and orthodontics. this method provides 3-d images that are composed of voxel, which is the smallest image unit, and determines image resolution. smaller voxel is associated with the higher resolution and also greater radiation exposure. this study was aimed to find out the effect of voxel size on the measurement of mandibular thickness.materials and methods : using voxel sizes of 0.30 mm and 0.15 mm, two cbct protocols (protocol 1 : field of view (fov) of 15 cm, 85 kvp, 42 mas, 0.15 mm voxel, 14 s scan time ; protocol 2 : fov of 15 cm, 85 kvp, 10 mas, 0.30 mm voxel, 14 s scan time) were carried out on 16 dry human mandibles with permanent dentition. mandibular thickness was measured at seven different sites (midline region, bilateral canine regions, bilateral mental foramen regions and bilateral molar regions). analysis of variance was used for analysis of data using the statistical package for the social sciences version 20 (spss inc., chicago, il, usa). p 0.05).conclusion : considering the insignificant differences of the mandibular thickness measurements using different voxel sizes, it would be more reasonable to use 0.30 mm voxel size instead of 0.15 mm voxel size to avoid unnecessary radiation exposure. |
home testing for chlamydia and gonorrhea has high sensitivity (about 90%) and specificity (> 99%), and is well accepted in adolescent and young adult populations [13 ]. studies in the us and in denmark demonstrate that home testing significantly increases the likelihood that tests will occur [1, 2 ]. it is well established that office - based screening for chlamydia is a cost - effective intervention for sexually active young women [35 ], as is screening for gonorrhea in women with individual or population risk factors [6, 7 ], however screening in clinical settings is not performed as often as is recommended [8, 9 ]. home screening, while increasing test frequency, might decrease screening costs, by avoiding clinical facility and clinician fees. the indirect costs of clinic - based screening, such as time off work or school, childcare, transportation, and other costs resulting from a clinic visit, could also be averted. in this analysis, we use test frequency and cost data from a randomized trial of home testing for chlamydia and gonorrhea in high - risk young women to examine cost differences between home - based and clinic - based testing and the cost - effectiveness of a home testing intervention. the data source for this analysis was the detection acceptability intervention for std s in young women (daisy) study, a randomized controlled trial. briefly, 398 young women aged 1524 at high risk for std were recruited from clinics and surrounding communities, representing a group where frequent testing is recommended. women were randomized to an intervention group, who received home testing kits for chlamydia and gonorrhea by mail at 6, 12, and 18 months, or a control group, who received a postcard at 6, 12, and 18 months inviting them to attend one of the participating study clinics for a routine test for women s health infections at no cost. participants were urged to maintain their usual health patterns, including evaluation for genital symptoms or std s. women with positive home tests were notified, counseled about partner notification, and referred to a participating clinic for treatment at no cost. significantly more screening tests were performed in the home screening intervention group, and no differences in std incidence rates were seen between intervention and control groups over the study period. all participants completed a questionnaire at enrollment, which included questions about out - of - pocket costs for seeking or receiving care at the clinic, time off work or school due to clinic visits, and time donated by others to allow the participant to attend clinic. these questions and the number of tests performed in clinic and at home in the trial are the focus of this analysis. the direct and indirect costs of receiving screening tests were calculated for women randomized to the intervention (testing at home) and for those in the control group (clinic testing). direct costs of clinic - based testing were the costs for clinician time and for the test kit (nucleic acid amplification for chlamydia and gonorrhea), along with required supplies. the panel on cost - effectiveness in health and medicine recommends including the following as indirect costs of care : payments made by the patient in the course of seeking or receiving care, and time required by the patient and others to allow care to be received. in this analysis, indirect costs for the clinic visits included costs of parking or transportation and of babysitting or childcare. indirect costs for time missed from school or work to receive care and for time donated by others (e.g., for rides or babysitting) to allow care to occur were quantified based on patient responses, then valued based on the average hourly wage in 2005 for nonfarm workers in the us to avoid bias against intervention in this young population ; the effects of other time costs were examined in sensitivity analyses. direct costs for home screening were the cost of the test, packaging costs, and postage to and from the patient, costing a total of 25. testing cost alone (including materials and technician time) in either setting was 21. these costs were then applied to clinic - based and home - based tests as quantified in the daisy study, and costs compared between intervention and control groups. alternative values for all cost components, varied individually and collectively over plausible ranges, were examined in one - way and multiway sensitivity analyses. direct costs per subject for the intervention group and the control group were calculated as follows : direct cost (clinic test) clinic test frequency + direct cost (home test) home test frequency divided by the number of subjects in each group. cost - effectiveness calculations were performed to estimate the cost per additional test performed per subject, using the formula (1)total cost per subject (intervention)total cost per subject (control)tests per subject (intervention)tests per subject (control). the model assumes equal std incidence and diagnosis with home- and clinic - based testing, as seen in the daisy trial, and hence the advantage of home testing from a cost - effectiveness standpoint (if any) is that, compared to the clinic testing group, more tests are performed overall due to testing at home (at a relatively low cost) while fewer tests are performed in clinic (at higher cost). cost and time parameters were varied individually to examine effects on model results. in the probabilistic sensitivity analysis, these parameters were varied simultaneously, along with testing frequencies from the daisy study, through their 95% confidence intervals, with values for each parameter randomly chosen from distributions 10,000 times and cost - effectiveness ratios calculated for each parameter set chosen. uniform distributions, where all values in the range were equally likely to be chosen, were used for time cost per hour, nonclinician direct costs for clinic - based testing, and home - based testing costs. gamma distributions, based on daisy study mean and standard deviation (sd) data, were used for indirect monetary costs, time required to receive care, and for clinician costs. responses to these questions were similar regardless of randomization group, therefore results are reported for 388 subjects (10 of the original 398 subjects had no questionnaire data available). slightly more than one - fifth of subjects had no insurance, took more than 2 hours off school or work to attend clinic, or traveled more that 30 minutes to attend clinic ; more than a third paid for parking / transportation or had another person donate time so that care could be obtained. costs per test received are summarized in table 2. direct costs for clinic - based testing, including clinician and test costs, were estimated at 49 per test received. on average, subjects paid 2.97 for parking / transportation and childcare, and 3.7 hours were spent by the subject and others to allow care to be received per clinic visit. table 3 displays tests performed, testing costs, and cost - effectiveness results for all study subjects and for subgroups based on recruitment site. more tests and more asymptomatic tests were performed among the home screening group (p<.0001), with greater differences in testing rates seen in women recruited from neighborhoods. women recruited from clinics had high testing rates and a smaller differential between home and clinic - based testing. no difference in std incidence was noted between intervention groups (20.4 [home testing ] versus 24.1 [clinic testing ] per 100 woman - years, p=.28). considering total costs for all subjects and all testing, and assuming equal std detection between groups, the home testing intervention was cost saving, because fewer clinic - based tests were performed and the resulting cost savings were not completely offset by the costs of increased home testing (table 3). total testing costs per infection found were estimated at 702 in the intervention group and 717 in the control group. however, cost savings were not noted for the neighborhood recruitment subgroup, where each additional test obtained by the intervention group compared to the control group cost about 24.50, due to more frequent home - based testing and no decrease in clinic testing with the intervention. when only asymptomatic testing was considered in all subjects, the intervention cost was 12.51 per additional test performed, since the costs of increased home testing were not offset by the relativity small decreases in clinic - based testing in the intervention group. in one - way sensitivity analyses, four parameter values varied individually through their listed ranges (table 2) made the total cost per subject of all testing in the intervention group greater than the total cost per subject in the control group (table 4). the model was most sensitive to changes in home testing costs, with increases in this cost of 5 making the home testing intervention more expensive than clinic testing ; to have similar effects, time spent seeking / receiving care, the cost of that time, or clinic testing cost would need to decrease by about a third. most importantly, if infection detection frequency is not equal between groups, unlike the equal detection seen in the daisy trial and assumed in this analysis, between - group differences in infection costs and complication effects would need to be explicitly accounted for in the analysis. in the probabilistic sensitivity analysis, where all cost and testing parameters were varied simultaneously, the intervention was cost saving in 52% of model iterations when all testing was considered. when considering only asymptomatic testing, there was a 22% likelihood that the intervention would be cost saving. figure 1 illustrates the relationship of changes in testing rates to cost savings with a home testing program if infection detection rates are equal between groups. if per - patient clinic testing rates decrease by more than 22.5% of the increase seen in home testing rates due to program adoption, a home testing program will be cost saving. for example, if a home testing intervention increases home testing in a population by 1 test per patient per year and decreases yearly clinic testing by 0.4 tests per patient (denoted by the x in figure 1), then the intervention would be cost saving. however, with the same increase in home testing, if the clinic testing rate only decreases by 0.1 test per patient (denoted by the open square), then a home testing program is not cost saving. in this analysis of a program encouraging home testing for chlamydia and gonorrhea in a high - risk group of young women, we found that, when all costs and all tests were considered, a home testing program was cost saving in the daisy study, a randomized, controlled trial, while, at the same time, significant increases in all tests and in asymptomatic tests were seen. however, whether cost savings occurred with home testing depended on the patient group and clinical situation studied, based on changes in clinic - based testing resulting from the intervention when std detection is the same with either testing program. cost savings were seen in clinic - recruited subjects, a group that utilized clinic services more frequently, due to decreases in clinic - based testing resulting from the availability of home testing. in subjects recruited from neighborhoods surrounding the clinics, home testing was not cost saving, because of increased home testing without proportionate clinic testing reductions or std detection improvements. when only asymptomatic tests were considered, home testing was again not cost saving. finally, the indirect costs of seeking or receiving care, that is, monetary costs for childcare, parking, and other expenses ; time costs from missed work or school ; and time donated by others were considerable and could present barriers to receiving recommended testing and care. as suggested by this analysis and by the daisy study itself, the decision to implement a home testing intervention for chlamydia and gonorrhea is more complex than merely seeking to maximize tests performed or to minimize costs. home testing programs have been well demonstrated to increase testing volume [13 ], by decreasing some barriers to std testing through the use of a relatively expensive test. unless direct costs incurred by individual clinics could be decreased as a result of a home testing intervention, in times of budgetary limitations clinics would have no incentive or means to implement such an intervention. indirect cost savings (when the intervention is considered from the broader, societal standpoint) and the public health benefits of increased testing suggest that financial support for home testing would need to come from higher levels for these societal benefits to be obtained. for individual clinics with a high proportion of frequently utilizing patients, a home testing intervention could decrease the visit frequency by this patient group, increasing capacity for other needed services and patient groups. in different populations where care - related indirect costs might be higher, for example, due to clinic inaccessibility or unavailability, home testing might prove more useful from clinical and economic standpoints by increasing testing rates through decreasing individual disincentives for testing. cost savings were not seen when only asymptomatic tests are considered, implying that home testing for screening purposes may not be economically favorable. however, the distinction of symptomatic and asymptomatic testing might be somewhat artificial when a population is considered, since the availability of home tests could have benefits beyond those of screening. for example, delays in seeking care when symptomatic are common, and the availability of home testing may allow infections to be diagnosed sooner, potentially decreasing untreated illness burden and pid risk. no differences in infection detection were seen between randomization groups in the daisy study, where an urban population with relatively easy and frequent access to care was investigated ; populations with less access could benefit more from home screening. finally, few screening interventions are cost saving, with some cost per health benefit gained absorbed by society or payers based on the magnitude of screening costs and benefits gained. for example, hu. found that annual chlamydia screening cost 2350 per quality adjusted life year gained compared to no screening and thus would be considered very cost - effective compared to other health care interventions. in our analysis, where equal infection rates are seen between intervention groups, the cost per health benefit gained depends on the benefits of greater testing frequency for infected women and their partners. unfortunately, these benefits can not be estimated based on present data, a limitation of our analysis. a home testing intervention for chlamydia and gonorrhea, while increasing testing rates, has the potential to be cost saving when the direct and indirect costs of avoided clinic visits are considered. the cost equation depends in large part on whether changes in clinic testing frequency and std detection occur as a result. home testing effects on clinic testing frequency in other populations and on individual and population health in localities with more limited health services require further research. | home testing for chlamydia and gonorrhea increases screening rates, but the cost consequences of this intervention are unclear. we examined the cost differences between home - based and clinic - based testing and the cost - effectiveness of home testing based on the daisy study, a randomized controlled trial. direct and indirect costs were estimated for home and clinic testing, and cost - effectiveness was calculated as cost per additional test performed. in the clinic testing group, direct costs were 49/test and indirect costs (the costs of seeking or receiving care) were 62/test. home testing cost was 25/test. we found that home testing was cost saving when all testing for all patients was considered. however cost savings were not seen when only asymptomatic tests or when patient subgroups were considered. a home testing program could be cost saving, depending on whether changes in clinic testing frequency occur when home testing is available. |
replication stress is a well - characterized tumor characteristic and has recently been considered as a potential new hallmark of cancer (macheret and halazonetis, 2015). replication stress leads to the activation of the dna damage response (ddr), which is associated with the early stages of cancer development (bartkova., 2005, gorgoulis., hypoxia (low oxygen levels) is one of the most physiologically relevant driving forces of replication stress and is characterized by an increased number of stalled replication forks and significantly reduced replication rates. importantly, hypoxia - induced replication stress occurs in the absence of dna damage (olcina., hypoxia - induced replication stress is one of the factors proposed to contribute to the selection pressure to lose key components of the ddr, including p53 (gorgoulis., 2005, hammond., 2007, graeber., 1996) the degree of tumor hypoxia is an indicator of poor patient prognosis due to resistance to most current therapies and increased metastatic spread (begg., 2011, the importance of ribonucleotide reductase (rnr) lies in its unique ability to catalyze the rate - limiting step of the reduction of ribonucleotides (ndps) to the corresponding deoxyribonucleotides (dndps), the precursors of dna (kolberg. the large rrm1 dimer contains the catalytic site, whereas the smaller dimer (rrm2 or rrm2b) contains an oxygen - requiring di - iron tyrosyl - radical site, which is essential for catalysis (kolberg., 2004, rnr is highly regulated, as nucleotide imbalances can be detrimental to cell fate (aye., 2015). elevated deoxyribonucleotide triphosphate (dntp) pools have been correlated with increased mutagenesis, while insufficient dntps cause replication stress and promote genomic instability (bester. oxygen is essential for mammalian rnrs to oxidize the di - iron center found in the smaller subunit (rrm2 or rrm2b) (huang., 2014). this generates the tyrosyl radical, which via a long - range pathway, transfers an electron to the catalytic site of rrm1, enabling the reduction of ndps to dndps (lundin., 2015, kolberg. the mechanism by which iron is incorporated into the small subunit, and how oxygen activates the di - iron center for radical initiation, is still poorly understood and under intense investigation (huang. the oxygen dependency of the small rnr subunit has led to the logical assumption that rnr is inactive in severely hypoxic conditions, something that has been verified for the rrm1/rrm2 (r1/r2) version of the rnr enzyme (brischwein., 1997, chimploy., 2000, thelander., 1983, reichard, 1993, probst., 1989, nordlund and reichard, 2006). in contrast, we demonstrate that rnr is able to maintain dndp formation by switching subunits in hypoxic conditions (6 hr) (figure 1a). therefore, our hypothesis is that although uncoupling of the helicases and polymerases occurs in hypoxia, replication can proceed. using dna fiber analysis, we confirmed that dna replication is significantly slower in hypoxia (25% of normal rate) but is not completely abrogated (figure 1b). dntp incorporation assays were carried out in rko cells exposed to hypoxia and demonstrated that, although the dntp pools were disrupted (with the purines [dgtp, datp ] being more affected than the pyrimidines [dctp, dttp ]), there was nucleotide availability in hypoxic conditions (figures 1c and 1d). it has been suggested that pyrimidine levels persist due to compensatory activities of the pyrimidine salvage pathways or as a result of the deoxyuridine present in culture medium, which cells could uptake and phosphorylate, therefore contributing to pyrimidine levels, particularly dttp (eriksson. interestingly, the pyrimidine salvage pathway has been reported to be more efficient than the purine pathway, suggesting an explanation for why purine levels are more sensitive to hydroxyurea (hu) and potentially hypoxia (reichard, 1988). our data demonstrate sufficient nucleotide availability in hypoxia to allow replication to proceed, albeit at a compromised rate ; thus raising the possibility that rnr is able to retain some activity in hypoxia. expression analysis of the rnr complex showed that the rrm2b protein is significantly induced (2- to 3.5-fold, depending on cell line) in response to hypoxia in cell lines, including colorectal, osteosarcoma, glioblastoma, and esophageal cancer cells, whereas the rrm2 small subunit decreased over time and the rrm1 remained unchanged or showed a slight decrease (figures 1e, 1f, and s1c s1f). as rko cells showed the highest level of rrm2b expression, we chose it as a model line for the majority of our experiments (figure s1 g). rrm2b increased 4.6-fold after 24 hr in hypoxic conditions, whereas rrm2 and rrm1 mrna levels decreased 12.3- and 2.5-fold, respectively (figures 1 g and s1h). importantly, in silico tgca (the cancer genome atlas) analysis of colorectal adenocarcinoma patient cohorts demonstrated that rrm2b expression correlates significantly with the expression of a verified hypoxia signature (figure 1h), suggesting that the oxygen - dependent overexpression of rrm2b also occurs in vivo (li., 2014). in contrast, rrm1 and rrm2 expression did not correlate with the same hypoxic signature (figures s1i and s1j). interestingly, overexpression and genetic alterations in rrm2b correlated with worse overall and disease - free survival in colorectal cancer patients (figures s1k s1n). the transcription factor hif-1 (hypoxia - inducible factor 1) is known to mediate significant gene expression changes in response to hypoxia and has roles in dna replication, dna repair, and respiration (hubbi., 2013, fukuda., 2007, crosby., 2009). therefore, we investigated if the induction of rrm2b in hypoxia was dependent on hif-1 by utilizing rko and rko cells exposed to hypoxia (figures 2a, s2a, and s2b). interestingly, both the mrna and the protein levels of rrm2b were induced in hypoxia irrespective of hif-1 status, in contrast to the well - documented hif-1 target glut1. next, using rko cells exposed to either 2% or < 0.1% o2, we investigated the oxygen dependency of the induction of rrm2b protein. rrm2b was induced in response to the lower level of hypoxia (< 0.1% o2), where a robust p53 induction was also observed but did not increase in response to 2% o2 despite hif-1 stabilization (figure 2b). this finding is in agreement with our previous studies demonstrating that the lower level of hypoxia (< 0.1% o2) induces replication stress and that this is the signal that initiates the ddr (including p53 stabilization) (hammond., 2002, olcina., 2013). rrm2b was first characterized as a p53-regulated rnr subunit (p53r2) (tanaka., 2000). here, further analysis of the molecular pathways mediating rrm2b induction in hypoxia demonstrated that the hypoxic overexpression of rrm2b occurs in a p53-dependent manner (figures 2c, 2d, and s2c s2h). to rule out the possibility of an indirect mechanism of induction of rrm2b by p53, chromatin immunoprecipitation (chip) assays were carried out and demonstrated that p53 binds directly to the p53-response element at the rrm2b locus leading to transcriptional overexpression (figures 2e, 2f, and s2i s2k). interestingly, although p53 expression was increased in response to the dna damaging agent adriamycin, this did not correlate with increased p53 binding to the p53-response element in rrm2b (figures 2e and 2f). most importantly, analysis of the tcga colorectal adenocarcinoma patient cohorts showed that rrm2b expression significantly correlated with a recently identified group of hypoxia - inducible p53-dependent genes (leszczynska., 2015), suggesting that hypoxia- and p53-dependent expression of rrm2b occurs in human cancers (figure 2 g). interestingly, in p53 null cell lines (h1299, hct116) a mild (1.3- to 1.7-fold) increase in rrm2b protein levels was also observed in hypoxia (figures 2c and 2h). these findings suggest that additional post - translational p53-independent mechanisms exist for rrm2b stabilization and therefore the importance of rrm2b in hypoxic conditions. in order to investigate the biological significance of hypoxia - induced rrm2b, we first verified that it forms a complex with the rrm1 subunit to reconstitute the r1/r2b holoenzyme in < 0.1% o2. immunoprecipitation assays demonstrated that increased levels (5.3-fold) of rrm2b protein were bound to the rrm1 subunit in hypoxia whereas the levels of rrm2 bound to rrm1 decreased by 1.8-fold (figures 3a, s3a, and s3b). next, we asked if the hypoxia - formed r1/r2b enzyme was functional. small interfering rna (sirna)-mediated loss of rrm2b led to significantly lower intracellular dntp levels in hypoxia (50%55% less pyrimidines and 25%30% less purines compared to the control [sictl ]) (figures 3b and s3c). in contrast, the loss of rrm2b did not significantly affect the dntp pools in normoxic conditions (figure s3d). in addition, fluorescence - activated cell sorting (facs) analysis demonstrated that s - phase u2os cells lacking rrm2b incorporate 37.5% less brdu than the control - treated cells in hypoxia (figures 3c and s3e). these findings demonstrate that depletion of rrm2b in hypoxia leads to further disruption of the dntp pools and indicate that ongoing replication is disrupted. to further investigate the hypoxic role of rrm2b, we used crispr / cas9 technology to construct a rrm2b knockout cell line (rko) (figures s3f s3i). rrm2b - depleted rko cells (both knockout and sirna treated) showed a persistent formation of rpa foci during long (24 hr) exposures to hypoxia, suggesting an accumulation of ssdna and failure to complete dna replication (figures 3d and s4a s4c). furthermore, cells with reduced levels of rrm2b formed 53bp1 foci indicating the presence of double - strand breaks (dsbs) specifically in hypoxia (figures 3e, 3f, and s4d s4f). no evidence of elevated dna damage was observed in control cells or in cells lacking rrm2b in normoxia ; this was attributed to the rrm2-dependent supply of dntps when oxygen is abundant. the increased dsbs observed in hypoxic cells with depleted rrm2b correlated with (1) a significant loss of viability measured by colony survival assay (77% fewer cells survived after 24 hr of hypoxia when rrm2b was silenced in comparison to sictl) (figure 3 g) and (2) the induction of apoptosis as determined both morphologically and by induction of parp cleavage (figures 3h and s4 g). notably, xenograft tumors of rko and rko cells showed delayed tumor growth and increased radiosensitivity when rrm2b was lacking (figures 3i and s4h). additionally, a significant increase in apoptosis specifically in the hypoxic regions of the rrm2b tumors was observed (figures 3j3l) as determined by the presence of cleaved caspase-3 (apoptosis) in the pimonidazole (pimo)-positive (hypoxic) regions. increased apoptosis in the hypoxic fraction of the tumors offers a likely explanation for the increased radiosensitivity observed (figure 3i). the data presented so far suggest that the basal levels of dntps provided by r1/r2b (as opposed to r1/r2) are sufficient for ongoing replication in hypoxic cells, preventing the collapse of replication forks that would ultimately lead to dsbs and loss of viability. these data indicate that rrm2b contributes to the increased resistance of the most aggressive fraction of tumors ; therefore, we investigated the hypoxic adaptation of rrm2b by determining the enzymatic properties of both forms of rnr enzyme (r1/r2 and r1/r2b) in normoxia and hypoxia. rrm1, rrm2, and rrm2b recombinant proteins were overexpressed and purified from e. coli (figures s5a and s5b), without additional iron or reductants, to prevent the variability associated with in vitro assembly of the active cluster of the tyrosyl radical (cotruvo and stubbe, 2011). we quantified the iron bound to rrm2 and rrm2b using inductively coupled plasma (icp) mass spectrometry and found comparable iron incorporation between the two recombinant proteins (figure s5c). the level of iron incorporation was 10% of the level that has been reported in a fully loaded rrm2, which would in turn predict lower enzymatic activity (aye. the abilities of the two forms of the rnr enzyme (r1/r2b and r1/r2) to reduce cytidine diphosphate (cdp) (substrate) to deoxycytidine diphosphate (dcdp) (product) were assayed in normoxic and hypoxic conditions (< 0.1% o2). 0.1% o2 and normoxia with no statistically significant difference in the total amount of dcdp formed under either condition after 30 min (figure 4a). in fact, the r1/r2b enzyme continued converting cdp to dcdp for over 2 hr in hypoxia (figures 4b and s5d). in contrast, the r1/r2 enzyme did not sustain activity in hypoxia (figure 4c) and stopped producing dcdps after 15 min in < 0.1% o2 (figures 4d and s5d). importantly, we verified that the r1/r2 enzyme did not stop dcdp formation in hypoxia due to lack of available cdp (figure s5e). collectively, these data suggest that the compromised r1/r2 activity observed at < 0.1% o2 was a result of limited oxygen availability. it is important here to state that the oxygen does not affect the stability of the tyrosyl radical, and it is only required for tyrosyl radical formation (stubbe, 2003) once assembled, the tyrosyl radical can catalyze multiple turnovers until regeneration is necessary, with mammalian r1/r2 being stable for 1525 min in vitro (cotruvo and stubbe, 2011). the key difference observed between r1/r2b and r1/r2 in hypoxia offers a mechanistic explanation for why the r1/r2b form of rnr is preferred in hypoxic conditions. it should be noted that, as previously described, the overall activity of the rrm2b - containing rnr enzyme is significantly lower than that of the rrm2-containing rnr (shao., 2004) (figures 4b and 4d). therefore, although our data suggest that r1/r2b is the preferred rnr enzyme in hypoxia, the levels of available nucleotides are still reduced compared to normoxia, thus explaining the continued replication stress in these conditions (figure 1a). given the differences in normoxic and hypoxic activity between rrm2b and rrm2, we compared the potential oxygen accessibility for the proteins using a modeling approach. using the only available published structures of rrm2b (pdb : 3hf1) and rrm2 (pdb : 3vpn) (smith., 2009), we investigated the theoretical differences and/or similarities in the dynamics of oxygen diffusion between the two proteins using classical molecular dynamics (md) simulations. the intention of this study was to understand how molecular oxygen accesses the core of the protein and to probe whether any differences could be related to the activities of rrm2/rrm2b in normoxia versus hypoxia. our analysis revealed three principal oxygen cavity tunnels (t1t3) in both proteins, which could be employed as access points (figures 4e, 4f, and s5f). analysis of t1t3 suggested that rrm2b could act as a better oxygen - sequestering agent than rrm2. specifically, we found that the predicted oxygen - entering frequencies are greater for rrm2b (68% at monomer 1 and 22% at monomer 2) than for rrm2 (14% at monomer 1 and 0% at monomer 2) (table 1), which indicate differential oxygen - turnover susceptibilities between rrm2b and rrm2. t2, and t3 (figure s5 g) suggest that the origin of the selectivity between rrm2b and rrm2 for oxygen turnover resided primarily in tunnels t2 and t3, meaning that the energy barriers for oxygen to cross t2 and t3 are higher for rrm2 than for rrm2b. we then performed electron paramagnetic resonance (epr) spectroscopy to monitor the stability of the tyrosyl radical of the two proteins in hypoxic conditions (figures 4 g and 4h). strikingly, we observed that 66% 3.35% of the tyrosyl radical in rrm2b remained stable for 1 hr at 37c in < 0.1% o2, while in the same conditions, only 43% 4% remained stable in rrm2 (figure 4i). collectively, our results provide compelling evidence that rrm2b is able to retain activity in hypoxia while the activity of rrm2 is compromised and therefore highlight a specific role for rrm2b in the hypoxic stress response. despite the fact that rrm2 and rrm2b share 83% sequence homology, there are distinct functional and structural differences (shao., 2004, smith., 2009, zhou., 2010, xue., 2006, wang., 2009b). the switch of c202 in rrm2 to y164 in rrm2b results in an open phenylalanine channel specifically in rrm2b (smith., 2009), which is connected with oxygen t3 (figures s5f and s5h). it has been proposed that f183 in rrm2b versus y221 in rrm2 contributes to the differences in the enzymatic activity between the two proteins (zhou., 2010). in addition, rrm2b has unique antioxidant capabilities, which are partially due to the y241 and y331 residues (h279 and y369 in rrm2) (xue., 2006). finally, rrm2b through k37 and k151 (e76 and e190 in rrm2) exhibits greater crosstalk between its secondary structures, which stabilizes helix b in an open conformation (smith., 2009). based on these key differences between rrm2 and rrm2b (figure s6a) and in order to determine the regions of rrm2b responsible for hypoxic adaptation, we constructed, overexpressed, and purified seven recombinant rrm2b mutants : y164c, y164f, f183y, k37e / k151e, y241h, y331f, and q127k (figure s6b). the q127k mutant was generated as a negative control, as it diminishes enzymatic activity due to disruption of the stability of the radical cluster (zhou., 2010). the seven purified mutants showed the same secondary structure, determined by circular dichroism, as the wild - type rrm2b recombinant protein (figure s6c). the levels of iron incorporation were also similar for the mutant with the exception of q127k, as expected (figure s6d). sustained reduction of cdp to dcdp was observed for 2 hr for most mutants, except y164c and k37e / k151e, which both appeared to stop reducing substrate after 30 min in hypoxia, reminiscent of r1/r2 (figures s6e s6k). for these two mutants, we then compared dcdp formation in normoxia and hypoxia and found that the ability to reduce cdp to dcdp in hypoxia was compromised in both the k37e / k151e and y164c mutants (figures 5a and 5b). these results indicate that these specific residues are critical to the role of rrm2b in hypoxia and that without them, rrm2b activity is not sustained, similar to rrm2. to further probe the role of k37/k151 and y164, we observed that while most of the rrm2b mutants behaved as the wt - rrm2b, which retains 60%79% of its tyrosyl radical in hypoxia (figure s7a), the k37e / k151e mutant retained only 28% of its tyrosyl radical in these conditions (figures 5c and 5d). since k37/k151 residues affect helix b of rrm2b monomer 2, the bending angle of the helices was estimated and showed that helix b in rrm2b is in an open conformation (2025 bending angle), whereas in rrm2, it is closed (810) (figure s7b). interestingly, md simulations for the k37e / k151e variant showed a closure of helix b after 300 ns from 20 to 8 bending angle, therefore resembling the closed conformation of rrm2 (figures s7b and s7c). although these are theoretical studies that provide only indications of the protein conformation, the distortion of helix b in monomer 2 of the k37e / k151e mutant could suggest loss of the essential crosstalk between the two monomers, which may explain the loss of tyrosyl radical stability in hypoxia as demonstrated by our epr analysis. additionally, md simulations showed a 4.8-fold lower oxygen entering frequency for the y164c mutant in comparison to wt - rrm2b, while we did not observe any changes in the oxygen entering frequency for the k37e / k151e mutant (table 2). this could be explained by disruption of the y164-f197 and y164-f198 contacts in monomer 1 of rrm2b, which could cause side - chain rearrangement of f95 in the y164c mutant. this rearrangement may result in f95 moving closer to f197, leading to closure of the rrm2b specific phenylalanine channel (figures 5e and s5h), therefore explaining the lower oxygen - entering frequency in y164c mutant. finally, in order to demonstrate that our findings are relevant in cells experiencing hypoxia and that the hypoxic adaptation of rrm2b depends on the identified residues (y164 and k37/k151), we performed rescue experiments by transfecting our rko cells with the following constructs : prrm2b, prrm2b, prrm2b, and pcdna3.1 (ctl). as expected, when wt - rrm2b was reintroduced, a significant increase in the intracellular nucleotide levels was observed in hypoxia, whereas reintroduction of y164c and k37e / k151e showed significantly lower dntp levels compared to wt - rrm2b (figures 5f, 5 g, s7d, and s7e). additionally, by monitoring apoptosis, we observed that wt - rrm2b rescued the null phenotype from apoptosis, whereas loss of the key residues (y164 and k37/k151) abrogated this rescue (figures 5h and 5i), therefore validating our in vitro experiments and theoretical studies. overall, we demonstrate the critical importance of the hypoxic induction of rrm2b to mitigate replication stress and determine the molecular adaptations of rrm2b to hypoxia to support this function (figure 5j). we identified that in response to the physiological stress of hypoxia, rnr responds by isoform switching favoring rrm2b over rrm2. in hypoxia the activity of rrm2 is severely compromised due to the lack of available oxygen, leading to replication stress. rrm2b is able to retain its activity in hypoxia and is therefore induced to compensate and facilitate ongoing replication. this property of rrm1/rrm2b, although not sufficient to resolve replication stress, does preserve replication fork integrity and prevent the accumulation of dna damage in hypoxia. we verified that depletion of rrm2b results in lower dntp levels in hypoxic cells and that this has detrimental consequences for cell fate (failure to complete dna replication, dna damage, and loss of viability). importantly, loss of rrm2b in a xenograft model showed delayed tumor growth, increased radiosensitivity, and increased apoptosis specifically in hypoxic areas, further highlighting the biological importance of the hypoxic induction of rrm2b. our data suggest that rrm2b is capable of retaining activity in hypoxia through two mechanisms : (1) increased oxygen - entering frequency and (2) enhanced stability of the tyrosyl radical. our md analyses suggested that y164 could increase the oxygen - entering frequency through oxygen tunnel t3 in monomer 1 by keeping f95 an optimum distance from f197. we also found that through the k37/k151 residues, the rrm2b protein retains 66%70% of its tyrosyl radical in hypoxia. interestingly, monomer 2 of rrm2b showed a higher oxygen - entering frequency than rrm2 (22% and 0%, respectively), suggesting that the two monomers of the small rnr subunits could react differently in the overall production of the tyrosyl radical. it is possible that monomer 2 contributes more to the tyrosyl radical in rrm2b than in rrm2, possibly due to its helix b open conformation, and that this could be more relevant in hypoxic conditions. in support of this hypothesis, epr spectra of the double mutant, k37e / k151e, showed a marked reduction in the tyrosyl radical content in hypoxia, but not in normoxia. we propose that the tyrosyl radical of monomer 2 is better protected in rrm2b, therefore contributing to the prolonged activity of the enzyme in hypoxic environments. our proposed model, where both monomers contribute to tyrosyl radical formation, is in agreement with the established finding that the tyrosyl radical is equally distributed between each small subunit, suggesting the possibility of generation of two tyrosyl radicals per dimer (cotruvo and stubbe, 2011). it is important to note that our md simulations were carried out with the only currently available crystal structure of human rrm2b protein (pdb : 3hf1), which has limitations in its active site configuration and specifically in the iron center. however, we considered it unlikely that as a result of this, there would be large conformational changes in the global structure of the protein compared to its native state, at least to a degree that would influence our md analysis. indeed, this is supported by the results of our recombinant mutant analysis and, most importantly, our rescue experiments using our rrm2b knockout cell line. collectively, this work highlights the importance of y164, k37, and k151 for rrm2b activity in hypoxia. it is important to note that the recombinant proteins used in our biochemical assays were assembled without additional iron. the biochemistry of rnr, especially the reconstitution of the tyrosyl radical, is extremely complex and not fully understood. additional studies that also consider the relevant factors for accurate assembly are required and will likely further illuminate the role of rrm2b in both normoxia and hypoxia. to date, mammalian rrm2b has been primarily associated with dna repair and mitochondrial dna synthesis (wang. however, it is probable that rrm2b has been evolutionarily maintained in order to be used as the hypoxic - specific rnr small subunit, especially as variants of rrm2b protein have been found to be responsible for continued cell division in anoxia tolerant vertebrates (sandvik., 2012). here, we propose that one of the principal functions of rrm2b is to act as the hypoxic - specific rnr subunit in order to be able to react promptly when this physiologically relevant stress occurs. it is tempting to speculate that through antioxidant and catalase - like properties (xue., 2006), rrm2b might even play a role in increasing immediate oxygen availability. interestingly, a number of previous reports have demonstrated that rrm2b is frequently affected by copy - number changes, typically showing gains, in a broad range of cancers (chae. this has led to the suggestion that rrm2b is a tumor promoter (aye., 2015). our study demonstrates that increased rrm2b expression in hypoxia maintains replication and prevents dna damage, therefore providing a plausible explanation for why rrm2b is so often amplified in cancers. our data suggest that targeting r1/r2b enzyme specifically in hypoxic tumor cells might be an effective therapeutic strategy. rnr is a well - established therapeutic target, and a number of rnr inhibitors (such as gemcitabine, clofarabine, hydroxyurea, and triapine) are being used clinically (manegold., 2000, aye and, 1998, hehlmann., 1993, nutting., 2009). interestingly, delivery of sirna against rrm2 by phosphorothionate oligodeoxynucleotides (gti-2040) (lee., 2003) is in clinical trials for various solid tumors (juhasz., 2006, leighl., 2009, oh and park, 2009). it is tempting to speculate that if this approach was modified to target rrm2b and was employed alongside patient stratification to identify those with significant tumor hypoxia, it may be an effective way to target the most aggressive and treatment - resistant fraction of tumors. reagent or resourcesourceidentifierantibodiesgoat polyclonal anti - rrm1 (t-16)santa cruzcat # sc-11733goat polyclonal anti - rrm2 (n-18)santa cruzcat # sc-10844goat polyclonal anti - p53r2 (n-16) (rrm2b)santa cruzcat # sc-10840mouse monoclonal anti - chk1 (g-4)santa cruzcat # sc-8408mouse monoclonal anti - p53 (do-1)santa cruzcat # sc-126rabbit polyclonal anti - p53 (fl-393)santa cruzcat # sc-6243mouse monoclonal anti--actin antibody (ac-15)santa cruzcat # sc-69879mouse anti - human hif-1 clone 54bd transduction laboratoriescat # 610958mouse anti - brdu clone b44bd transduction laboratoriescat # 347580rat monoclonal anti brdu clone bu1/75 (icr1)bio - radcat # obt0030cxmouse monoclonal anti - rrm2 clone 1e1bio - radcat # mca3434zrabbit polyclonal anti - kap-1bethyl / universal biologicalscat # a300 - 274rabbit polyclonal anti - phospho kap-1 (s824)bethyl / universal biologicalscat # a300 - 767rabbit polyclonal anti - phospho kap-1 (s473)biolegendcat # 644602 rrid : ab_2241094rabbit polyclonal anti-53bp1novus biologicalscat # nb100 - 904rabbit polyclonal anti - phospho - p53 (ser15)cell signalingcat # 9284rat monoclonal anti - rpa32/rpa2 (4e4)cell signalingcat # 2208rabbit polyclonal anti - phospho - chk1 (ser296)cell signalingcat # 2349rabbit polyclonal anti - phospho - chk1 (ser317)cell signalingcat # 2344rabbit polyclonal anti - phospho - chk1 (ser345)cell signalingcat # 2341rabbit polyclonal anti - parpcell signalingcat # 9542rabbit polyclonal anti - cleaved caspase-3 (asp175)cell signalingcat # 9661anti - mouse igg, hrp - linkedcell signalingcat # 7076anti - rabbit igg, hrp - linkedcell signalingcat # 7074rabbit polyclonal anti - beta tubulin antibodyabcamcat # ab6046mouse monoclonal anti - pimonidazole clone 4.3.11.3)chemicon internationalcat # hp1 - 100alexa fluor 680 goat anti - mouse igg (h+l)invitrogencat # a21057alexa fluor 680 goat anti - rabbit igg (h+l)invitrogencat # a21076alexa fluor 680 donkey anti - goat igg (h+l)invitrogencat # a21084irdye 800cw donkey anti - rabbit iggli - corcat # 926 - 32213irdye 800cw donkey anti - mouse iggli - corcat # 926 - 32212alexa fluor 488-conjugated goat anti - rabbit igginvitrogencat # a11070alexa fluor 488-conjugated donkey anti - rabbit igginvitrogencat # a21206alexa fluor 488-conjugated goat anti - mouse igginvitrogencat # a11017alexa fluor 488-conjugated donkey anti - goat igginvitrogencat # a11055alexa fluor 594-conjugated goat anti - rabbit igginvitrogencat # a11072alexa fluor 594-conjugated goat anti - rat igginvitrogencat # a11007alexa fluor 594-conjugated goat anti - mouse igginvitrogencat # a11020alexa fluor 594-conjugated donkey anti - goat igginvitrogencat # a11058alexa fluor 555-conjugated goat anti - rat igginvitrogencat # a21434alexa fluor 488-conjugated goat anti - mouse f(ab)2 fragmentinvitrogencat # a11017pierce recombinant protein a / gthermo fisher scientificcat # 21186bacterial and virus strainsbl21-gold(de3) competent cellsagilent technologiescat # 230132one shot top10 chemically competent e. colithermo fisher scientificcat # c404010chemicals, peptides, and recombinant proteinshydroxyurea (hu)sigmacat # h8627doxorubicin hydrochloride (adriamycin)sigmacat # d15155-bromo-2-deoxyuridine (brdu)sigmacat # b5002propidium iodide (pi)sigmacat # s7109protease inhibitor cocktailrochecat # 04693159001cldu (5-chloro-2-deoxyuridine)sigmacat # c6891idu (5-iodo-2-deoxyuridine)sigmacat # i7125cytidine 5-diphosphocholine sodium salt dehydrate (cdp)sigmacat # c9755protein g sepharose, fast flowsigmacat # p3296isopropyl -d-1-thiogalactopyranoside (iptg)sigmacat # i6758deoxyadenosine 5-triphosphate, [8 - 3h(n) ] (datp - h3)perkin elmercat # net268250ucdeoxythymidine 5-triphosphate ((dttp) tetrasodium salt) (dttp - h3)perkin elmercat # net520a250uctrizol reagentthermo fisher scientificcat # 15596018dharmafect 1dharmaconcat # t-2001lipofectamine ltxthermo fisher scientificcat # 15338100prolong goldthermo fisher scientificcat # p36931critical commercial assayshypoxyprobe-1 kit for the detection of tissue hypoxiachemicon internationalcat # hp1 - 100real - time and dynamic monitoring of cell proliferation and viability for adherent cellsacea biosciences inc/ cambridge biosccat # 00380601050sybr green pcr master mixapplied biosystemscat # 4309155verso cdna synthesis kitthermo fisher scientificcat # ab1453bhistrap hp columnsge healthcarecat # 17 - 5248 - 02qiaprep spin miniprep kitqiagencat # 27106quickchange ii xl site - directed mutagenesis kitagilent technologiescat #, 1998rkorrm2b/this papern / aexperimental models : organisms / strainsmice : female balb / c nude were used for xenograft experimentscharles river, ukoligonucleotidessirna - rrm2b (sequence : ugaguuuguagcugacagauu)sigmapiao., 2009sirna#2 - rrm2b (sequence : ggaacaagcuuaaagcaga)ambion / life technologiess224156sirna - p53 (sequence : guaaucuacugggacggaa)ambion / life technologiesleszczynska., 2015allstars negative control sirnaqiagensi03650318primers for rrm2b forward - chip (sequence : cttgctgggaaatcttgacc)sigmatanaka. 2007primers used for site - directed mutagenesis table s1n / an / aprimers used for dntp incorporation assay table s1n / an / aprimers used for quantitative pcr (qpcr) table s1n / an / arecombinant dnaplasmids used in this work are listed in table s2n / an / asoftware and algorithms7500 fast real - time pcr thermocycler was used with v2.0.5 softwareapplied biosystemshttp://www6.appliedbiosystems.com / support / software/7500/the software caver 3.0 was used for the analysis of the evolution of lateral fenestrations during the md simulationsn / an / athe particle mesh ewald (pme) algorithm was used for evaluation of electrostatics interactionsdarden., 1993n / athe multi time step algorithm verlet - i / r - respa was used to integrate the equations of motiontuckerman., 1992, verlet, 1967n / athe pops (parameter optimsed surfaces) algorithm was used for calculation of the solvent - accessible surface area (sasa) of both proteins rrm2b and rrm2cavallo., 2003, fraternali and van gunsteren, 1996n / athe settle algorithm was used for constrained the lengths of covalent bonds involving hydrogen atomsmiyamoto and kollman, 1992n / aotherfor the analysis of rrm2b expression and genetic alterations in colorectal cancer datasets the cbioportal and prognoscanhttp://www.cbioportal.org/ ; http://www.abren.net/prognoscan/gao., 2013,, 2009gene expression omnibus ; smith., 2010https://www.ncbi.nlm.nih.gov / geoaccession number gse17536icp - ms was performed with icp - ms trace element analysishttps://www.earth.ox.ac.uk / research / services / geochemical - analysis / icpms / n / a further information and requests for reagents may be directed to, and will be fulfilled by, the lead contact, dr. ester m. hammond ([email protected]). source of cell lines used in the study is reported in the reagent and resource table. source of cell lines used in the study is reported in the reagent and resource table. cells were grown in dmem with 10% fbs, in a standard humidified incubator at 37c and 5% co2. rko was constructed in this work using crispr - cas9 technology as previously described (ran., 2013). rrm2b gene has three isoforms and in order to construct a full knock - out cell line two 20-bp target sgrna sequences were used targeting exon 1 : ttcggcggagtctgcgcgat (isoforms 1 and 3) and aaatgttattcgccgcggtc (isoform 2). lipofectamine ltx (invitrogen) was used for plasmid transfections according to manufacturer s recommendations (the plasmids used are listed in table s2). dharma - fect 1 reagent (thermo fisher scientific) was used for sirna knockdown according to manufacturer s instructions. rko or u2os cells were transfected with the sirna sequences reported in the reagent and resource table in a final concentration of 50 nm. hydroxyurea (hu) was used at a concentration of 2 mm for 6 hr. hypoxia treatments were carried out in a bactron ii anaerobic chamber (shell labs) or an in vivo2 400 (baker ruskinn) (for oxygen concentrations at 2%). for experiments at oxygen concentrations were periodically verified using an oxylite probe (oxford optronix, uk). for immunoblots, cells were lysed in utb (9 m urea, 75 mm tris - hcl ph 7.5 and 0.15 m -mercaptoethanol) and sonicated briefly. the odyssey infrared imaging technology was used (li - cor biosciences) and the odyssey analysis system was used for quantification of the immunoblots. in each case, experiments were carried out in triplicate and a representative blot is shown unless otherwise stated. the antibodies used in this study are listed in the reagent and resource table. for immunofluorescence, cells were seeded on autoclaved cover glasses (menzel - glaser). at the end of each experiment cells were fixed with 4% fixation buffer (4% (w / v) paraformaldehyde in pbs), lysed with 1% pbs - triton x-100 and then incubated with blocking buffer (2% (w / v) bsa in 0.1% pbs - triton x-100). incubation with the appropriate primary and then secondary antibody followed (diluted in 2% (w / v) bsa - 0.1% pbs - triton x-100) (antibodies used are listed in the reagent and resource table). at least 100 cells were counted per condition. due to the presence of 53bp1 foci in the nuclei of unstressed cells, induction of dna damage rna was prepared using trizol (invitrogen / life technologies). for qpcr expression analysis cdna was reverse transcribed from total rna using verso kit (thermo scientific). qpcr was performed using sybr green pcr master mix kit (applied biosystems) in a 7500 fast real - time pcr thermocycler with v2.0.5 software (applied biosystems). mrna fold change was calculated using a 2 method in relation to the 18s reference gene. facs analysis was performed as previously described (olcina., 2013). u2os cells were treated with either rrm2b sirna or negative control sirna and were placed in normoxia or < 0.1% o2 (3 hr). samples were pulsed with brdu (20 m) for 30 min before collection. sub confluent cells (50%60% confluency) were sequentially pulse labeled with 25 mm cldu and 250 mm idu for 20 min each and left at 21% o2 in a 37c incubator (normoxic samples). cells were washed once with fresh warm media before the addition of the second (idu) label. for hypoxic treated samples, cells were first placed for 2 hr in the hypoxic chamber (< 0.1% o2) and then treated with 25 mm cldu for the indicated times, followed by the addition of 250 mm idu for as long as needed for all samples to be in hypoxia for 6 hr in total. at the end of the treatment, labeled cells were lysed and spread with spreading buffer (200 mm tris - hcl, ph 7.4, 50 mm edta, 0.5% sds) in a tilting the slide. dna fibers were then fixed with methanol / acetic acid (3:1 ratio) and stained with rat anti - brdu monoclonal antibody (for detection of cldu labeled tracts) and mouse anti - brdu monoclonal antibody (for detection of idu labeled tracts). fibers were imaged using a bio - rad radiance or lsm780 (carl zeiss microscopy ltd) confocal microscope and analyzed using imagej software (nih). the length of the fiber tracts that had incorporated both labels (cldu and idu) was measured and replication rates were calculated with the following formula (vcldu (kb / min) = [(x 0.132 m) 2.59 kb / m ] / t (min), where x = length of cldu). dntp pool determination in whole - cell extracts was carried out as previously described (dangiolella., 2012). in brief, cells were seeded in glass dishes and treated either in < 0.1% o2 (for the indicated times) or with 2 mm hu (6 hr). the normoxic samples were processed immediately after the beginning of the hypoxic and/or hu treatment. samples were then boiled, centrifuged and the supernatant was dried by centrifugal evaporation and finally dissolved in h2o. for the preparation of each primer mix a different set of primers was used (listed in table s1) supplemented with either [3h]datp or [3h]dttp (perkinelmer). for dgtp and dctp determination 1 u of thermo sequenase dna polymerase (ge healthcare) was used ; for dttp determination 1.25 u klenow fragment (thermo fisher scientific) and for datp determination 0.625 u klenow fragment (thermo fisher scientific) was used. reactions were incubated for 1 hr either at 48c (for dgtp and dctp mixtures) or at room temperature (for dttp and datp mixtures). following incubation, the reaction mixture were spotted onto whatman de81 paper (ge healthcare) and let dry. the papers were then washed with 5% na2hpo4, followed by rinsing with distilled h2o and 100% etoh. after being dried, the radioactivity on the papers was measured in a ls 6500 multi - purpose scintillation counter (beckman coultertm) using 3.5 ml optiphase hisafe 3 (perkinelmer) counting fluid. data present percentage of dntp incorporation compared to the positive control of each experiment. in experiments where both sirna and hypoxia treatment were used, a normalization to each normoxic control was preceded the final analysis. briefly, rko cells were lysed in lysis buffer (100 mm nacl, 20 mm tris - hcl ph 7.4, 5 mm mgcl2, 0.5% np-40) with freshly added phosphatase / protease cocktail inhibitors (roche). the lysates were incubated with protein g sepharose beads (sigma) and the antibody of interest rrm1 (santa cruz biotechnology : sc-11733) or a control igg antibody (invitrogen : a10535) with agitation, at 4c overnight. antibodies used were : rrm1 (santa cruz biotechnology : sc-11733), rrm2b (santa cruz biotechnology : sc-10840), rrm2 (abd serotec, mca3434z) and for the detection of rrm2 the pierce recombinant protein a / g (thermo fisher scientific, 21186) secondary antibody was used. chip in rko cells treated as indicated in figure legend was carried out as previously described (leszczynska., 2015). for each sample 2 g of combined mouse p53 (do-1 ; sc-126) and rabbit p53 (fl-393 ; sc-6243) (santa cruz) antibodies were used for immunoprecipitation. combined non - specific mouse (7076) and rabbit (7074) (cell signaling) were used as control iggs. a no antibody control sample was also included in each experiment. bound fraction and input were analyzed by qpcr using specific primer set for the rrm2b locus : cttgctgggaaatcttgacc (tanaka., 2007). fold enrichment is expressed as a % of input and is normalized to total p53 in each sample. rko cells were treated either with rrm2b sirna or negative control sirna and exposed to normoxia or hypoxia (< 0.1% o2 for 24 hr). subsequently all cells were placed in normoxic incubator and left for 9 days to form colonies, which were visualized by crystal violet staining. apoptosis assay were performed as previously described (leszczynska., 2015). in brief, both adherent and floating cells were collected and fixed with 4% paraformaldehyde. samples were then washed and the nuclei were stained with prolong gold mounting medium with dapi (thermo fisher scientific). apoptosis was plotted as the percentage of cells with fragmented dna per field of view, with at least ten fields of view quantified per experiment. the xcelligence real - time cell analyzer (acea biosciences) dp instrument equipped with an e - plate was used for proliferation assays. the attachment, spreading and proliferation of the cells were monitored every 15 min for 60 hr. for quantification all animal procedures were performed in accordance with current uk legislation and were approved by the university of oxford biomedical services ethical review committee, oxford, uk. for the tumor growth curves (xenografts), female balb / c nude mice or female athymic nude mice (charles river, uk) were randomized and injected subcutaneously with 3 10 rko or rko cells in 25% (v / v) matrigel and serum - free dmem. tumor growth was monitored until they reached approximately 300 - 400 mm3 (volume = height x depth x width x / 6). for the irradiation experiment, the tumors in half of the animals were irradiated with 10 gy when tumor volumes reached 100 mm. tumors were measured regularly, and tumor growth was plotted as a mean of tumor volumes sem. mice were injected with 50 mg / kg of pimonidazole (pimo) 2 hr before the end of the experiment. tumors were split in half and either preserved in formalin for wax embedding or were snap frozen and embedded in optimal cutting temperature compound (oct)., tumors embedded in oct were sectioned (5 m) and froze down at 20c. sections were immediately fixed with 4% paraformaldehyde and then quenched with 50 mm nh4cl. blocking was performed with 1% bsa in tbs, followed by incubation with mouse on mouse (m.o.m.) blocking reagent (vector laboratories). the sections were stained with pimo and cleaved caspase-3 primary antibodies, followed by secondary antibodies (listed in the reagent and resource table) and mounted with prolong gold mounting medium with dapi (invitrogen / life technologies). raw rna - seq data for 382 colorectal adenocarcinoma tumors were downloaded from the tcga project (accessed through cbioportal : http://www.cbioportal.org/). to examine tumor - associated hif - activity (referred to as hypoxia signature), raw data for each sequenced gene were rescaled to set the median equal to 1, and hif - activity was quantified by averaging the normalized expression of 44 target genes, associated with hif activity (encoding adm, gfbp3, edn2, pfkfb4, flt1, tfr2, bnip3l, tgfa, bnip3, pgk1, egln1, ldha, egln3, cp, tgfb3, pfkfb3, hk1, tfrc, edn1, cdkn1a, ca9, hmox1, serpine1, lox, ndrg1, ca12, pdk1, vegfa, ero1l, rora, p4ha1, mxi1, slc2a1(glut1), stc2, mif, ddit4, eno1, cxcr4, plod1, p4ha2, gapdh, pgam1, tmem45a and pim1) (li., 2014). log10 conversion of the hypoxia signature was plotted against log10 conversion of raw data for rrm1, rrm2 and rrm2b. two - tailed p value shown on each graph for each pearson and spearman r (correlation coefficient). to examine tumor - associated p53-activity (referred to as p53 group), raw data for each sequenced gene were rescaled to set the median equal to 1, and p53-activity was quantified by averaging the normalized expression of 6 p53 target genes, associated with hypoxia - induced p53 activity (encoding btg2, cyfip2, inpp5d, kank3, phlda3 and sulf2) (leszczynska., 2015, log10 conversion of the p53 signature was plotted against log10 conversion of raw data for rrm2b (also rescaled to set the median equal to 1). two - tailed p value shown on each graph for each pearson and spearman r (correlation coefficient). for the analysis of rrm2b expression and genetic alterations in colorectal cancer datasets the cbioportal (http://www.cbioportal.org/) and prognoscan (http://www.abren.net/prognoscan/) tools were used on the 5th dec 2016 (gao., 2013, cerami., 2012, mizuno., 2009). using cbioportal the tcga (provisional) dataset was analyzed (rna seq v2 rsem) for alterations, including mutations, putative copy - number alterations, mrna expression, mutations and survival probability (629 cancer patients). for the prognoscan analysis, rrm2b expression was checked in all available colorectal cancer datasets and kaplan - meier graphs were extracted only for the statistically significant (p < 0.05) dependence between rrm2b expression (probe 223342_at) and survival probability. this analysis used the publicly available dataset at gene expression omnibus (https://www.ncbi.nlm.nih.gov/geo) with the accession number gse17536 (smith., 2010). the 6 his - tagged hrrm1 (pet28a - rrm1) was kindly provided by prof joanne stubbe (massachusetts institute of technology, cambridge, usa), expressed in e.coli bl21-gold (de3) competent cells (agilent technologies) and as previously described (ando., the 6 his - tagged hrrm2 and hrrm2b (pet28a - rrm2, pet28a - rrm2b) were kindly provided by dr. yun yen (beckman research institute at city of hope, duarte, usa). the proteins were expressed in e.coli bl21-gold (de3) competent cells (agilent technologies) and purified as previously described (shao., 2004) with minor modifications. specifically, an overnight culture of the transformed bacteria was diluted 80-fold in 600 ml of 2 yt medium containing 50 g / ml kanamycin. each culture was grown at 37c until od600 nm = 0.7 - 0.9 and then induced by 1 mm isopropyl-1-thio--d - galactopyranoside (iptg) and incubated overnight at 18c. cells were harvested by centrifugation and the pellets were lysed with appropriate amount (5 ml / gr of pellet) lysis buffer (50 mm nah2po4 ph 7.0 ; 0.1% triton x-100 ; 10 mm -mercaptoethanol ; freshly added edta - free protease inhibitors and dnase i) at 4c with vigorous agitation until the lysate was homogeneous. the lysate was then sonicated (60% amplitude 30 s on / 30 s off) and clarified by centrifugation at 48,000 g for 20 min at 4c. soluble lysate was passed through a his - trap hp purification column (ge healthcare), washed with at least 30-fold bed volume of wash buffer (50 mm nah2po4 ph 7.0 ; 800 mm nacl ; 50 mm imidazole ; 0.1% triton x-100 ; 10 mm -mercaptoethanol) and finally eluted with elution buffer (50 mm nah2po4 ph 7.0 ; 300 mm nacl ; 125 mm imidazole). the protein then underwent buffer exchange into 25 mm tris - hcl, ph 7.5 before being concentrated and stored at 80c. the apo - forms of rrm2 and rrm2b recombinant proteins used in icp - ms experiments were overexpressed and purified as previously described (wang., 2009a). site - specific mutations in rrm2b (y164c ; y164f ; f183y ; k31e / k151e ; y241h ; y331f and q127k) were generated by pcr, using the pet28a - rrm2b as a template and the quickchange ii xl site - directed mutagenesis kit (agilent technologies). expression and purification of the hrrm2b mutated proteins were performed in the same way as for hrrm2b. the enzyme concentration (r1/r2b or r1/r2) was the same in all cases and the limited factor was the presence or not of oxygen (normoxia versus hypoxia). specifically, a final concentration of 1.25 m of purified rrm1 was incubated with 2.5 m of either rrm2 or rrm2b protein. the reaction mixture contained 0.1 mm cdp, 50 mm hepes (ph 7.5), 6 mm dtt, 8 mm magnesium acetate, 2 mm atp and 1 mm nadph in a final volume of 400 l. the rnr proteins purified were active without reassembling the iron center (shao. (< 0.1% o2) the reaction mixture was assembled and the assay was carried out within an anaerobic chamber (bactron, shel labs). reactions were initiated by the addition of cdp, incubated at 37c and aliquots of 50 l were quenched by the addition of 10 l of 3% tricarboxylic acid over a time course of the reaction. graphs present either percentage of dcdp formation when normoxia and hypoxia were compared (data were normalized against the normoxic samples at 37c at 30 min where the dcdp formation was considered 100%) or in m when the accumulation of dcdp formed in < 0.1% o2 at a 0 - 120 min time course was examined. cdp and dcdp levels following rnr activity assays were determined by ion - pairing hplc with uv detection (270 nm). the column was an ace c 18, 3 m, 125 3 mm (hichrom) maintained at 35c. a gradient separation was achieved using 10% methanol, 10 mm kh2po4, 10 mm tbaoh, ph 6.9 (a) and 30% methanol, 50 mm kh2po4, 6 mm tbaoh, ph 7.0 (b), with a linear gradient of 25 47% b over 8 min, 47 80% b over 1 min, then returning to the started conditions 3 min. the flow rate was 0.6 ml / min and the running time was 16.5 min. circular dichroism (cd) spectra (chirascan cd / fluorimeter spectrometer (applied photophysics, uk) of hrrm2b and the mutants (0.2 mg / ml) were recorded in the wavelength range 260 to 185 nm in 100 mmol / l potassium phosphate buffer (ph 7.5). all measurements were carried out at 37c using a 0.1-cm path length quartz curette. the data pitch was 0.1 nm with a 1-nm bandwidth at a scan speed of 1.0 nm / s. all cd data were expressed as the mean residue ellipticity, [], degcmdmol. the thermo finnigan element 2 icp - ms was used for quantitation of iron content in the recombinant purified proteins (40 g of protein was used per 50 l of reaction). calibrations were obtained using external standards (a series of standards of known fe concentrations were prepared and analyzed to gain a calibration linear, prior to the measurement of the samples). an external standard was diluted and measured from a dilution of high purity standards 10 ppm icp - ms-68 a standard. all blanks, standards and samples were also spiked with 1 ng / g rh, so that any general instrument drift could be normalized. dilutions were made using a 2% hno3 solution, prepared using in - house distilled nitric acid and 18.2 mohm di water. all data results were first reported as elemental concentrations and then calculated in nm of fe per m of protein. cw - epr spectra were collected in the center for advanced esr (caesr) in the inorganic chemistry laboratory at the university of oxford. x - band measurements utilized a bruker - biospin micro emx spectrometer equipped with a premiumx microwave bridge, a cylindrical te011-mode resonator (shqe - w), an esr-900 liquid helium cryostat, and an oxford instruments itc-503 s temperature controller. measurements were performed within the limit of resolution by temperature, 40k, and under non - saturating conditions. the protein concentration for all epr samples was 200 m except for rrm2 protein, which was 70 m. the protein samples (rrm2b, rrm2 or rrm2b mutants) were diluted in 50 mm hepes, ph 7.5 and were incubated either at 37c for 5 min with oxygen present (normoxia) or at 37c for 60 min in a bactron ii anaerobic chamber (< 0.1% o2). at the end of each treatment 20% (v / v) glycerol was added for vitrification during the low - temperature recordings. samples were then transferred to epr tubes and quick - frozen by immersion in liquid nitrogen. spin quantitation was performed using the bruker spectrometer hardware spin calibration, given the input dimensions of the precision wilmad pq-706 tubes. the results were verified with a 1 mm cu edta in 50 mm hepes ph 7.5, 20% (v / v) glycerol that was measured under non - saturating conditions at 100 k with 50 w microwave power. system setup : md simulations of o2 transport on hrrm2b (pdb : 3hf1 ; resolution 2.60) and hrrm2 (pdb : 3vpn ; resolution 2.25) were performed (smith., 2009). the 3vpn x - ray structure is that of the e106d variant of native rrm2, and comprises residues m65 to m350. four simulations were performed in which 200 randomly chosen water molecules outside the solvated protein were replaced by 200 o2 molecules (0.5 m) termed the 100% oxygen level simulation. an additional two sets of simulations were performed to control for concentration effects ; the first set up has a tenfold reduction in oxygen concentration, termed 10% oxygen level simulation with effective concentration of 50 mm, for rrm2b and rrm2. the second set does not include any oxygen molecules, termed 0% oxygen level simulation. each system was solvated in a box of dimensions (80, 80, 92) using the solvate plug - in of vmd (humphrey., 1996), with the total system size comprising 61,000 atoms. in accordance with the uniprot sequence alignment two mutants of native rrm2b were prepared with the mutate plugin in vmd (humphrey., 1996), namely y164c and k37e / k151e. calculations were done with namd 2.9 (phillips., 2005), using the charmm 27 protein force - field (brooks., 2009) with the cmap correction (buck., 2006), together with the tip3p water model (jorgensen., 1983). oxygen lennard - jones parameters were taken from charmm (cohen., 2005, the iron centers were modeled using charmm 27 force - field, with iron lennard - jones parameters o = 0.00 kcal / mol and rmin/2 = 0.65. oxygen (o2) was modeled using charmm 27 lennard - jones parameters from heme oxygen, o = 0.12 kcal / mol and rmin/2 = 1.7, as well as bond spring constants and bond spring lengths for o2 as 1.23 and 600 kcal / mol /, respectively. rrm2b contains the same diiron / dityrosyl cofactor that rrm2 does, and both rrm2b and rrm2 are biologically active as homodimers. in rrm2b, the active site iron coordination environment in monomer-1 is a mono - iron site, and monomer-2 has a di - iron site. in rrm2b, the active site iron coordination environment after 1,000 steps of conjugate - gradient minimization, four classical molecular dynamics (md) simulations of the o2-containing solvated protein were carried out for 300 ns in the npt ensemble. the high oxygen concentration was necessary to ensure sufficient sampling of protein cavities by o2 on the accessible timescale of current simulations. the particle mesh ewald (pme) algorithm was used for evaluation of electrostatics interactions beyond 12, with a pme grid spacing of 1, and namd defaults for spline and values (darden., 1993). a cut - off at 12 was applied to non - bonded forces, both electrostatics and van der waals forces were smoothly switched off between the cut - off distance of 12, and the switching distance of 10, using the default namd switching function. a verlet neighbor list with pairlist distance of 14 was used to only evaluate non - bonded neighboring forces within the pairlist distance (verlet, 1967). the lengths of covalent bonds involving hydrogen atoms were constrained by the settle algorithm (miyamoto and kollman, 1992) in order to be able to use a 2-fs time - step. the multi time step algorithm verlet - i / r - respa (tuckerman., 1992, verlet, 1967) was used to integrate the equations of motion. non - bonded short - range forces were computed for each time step, while long - range electrostatic forces were updated every 2 time steps. the pressure was kept at 1 atm by the nos - hoover langevin piston (langevin, 1908, nos, 1984a, nos, 1984b), with a damping time constant of 50 fs and a period of 100 fs. the temperature was maintained at 300 k by coupling the system to a langevin thermostat, with a damping coefficient of 1 ps. the standard mpi version 2.9 of the md simulation code namd was employed (phillips., 2005). a free license can be obtained at http://www.ks.uiuc.edu / research / namd/. version 1.9 of visual molecular dynamics (vmd) was employed for analysis, with license obtained at http://www.ks.uiuc.edu / research / vmd/. the solvent - accessible surface area (sasa) of both proteins rrm2b and rrm2 was calculated using the pops (parameter optimsed surfaces) algorithm (cavallo., 2003, fraternali and van gunsteren, 1996). the bending angle of helices was estimated using bendix in vmd (dahl., 2012). the diffusion - reaction model (wang., 2013) presented in equation (1) was adopted to describe the diffusion of o2 into the rnr active site:(1)enz+gaskoutkin[o2]enzgas. this is a kinetic two - step model consisting of an initial diffusion step of the gas molecule, followed by a metal - gas molecule chemical reaction step (wang., 2011, wang and blumberger, 2012). here, a classical force - field (ff) was employed, and only the diffusion and binding of o2 gas molecules to the rnr iron center were modeled:(2)rnr(fe)+o2k1k+1rnr(fe)o2. the simulation of o2 diffusing in the solvated rnr enzymes yields diffusion statistics that enable the construction of a probability density map of the o2-distribution within rnr (rrm2b or rrm2). this distribution is then divided into a set of m discrete protein cluster states that correspond to the probability maxima. first, a distance criterion is established to determine when an oxygen molecule has entered into the active site of hrrm2b and hrrm2, defined as the difference between the center - of - mass (com) of the iron ion and the o2 molecule. second, cut - off criteria of 8, 9 and 10 were employed to generate statistics of the o2 entering. an o2 molecule is counted as having entered the cluster if dcom (o2-fe) < c where c is 8 or 9. as previously described, o2 entry into wt rrm2b and rrm2 was identified to occur primarily through tunnels t1, t2 and t3. based on this assignment, equilibrium adaptive - biasing force (abf) md simulations (chipot and pohorille, 2007, darve and pohorille, 2001, darve., 2008, van gunsteren, 1989) were performed on oxygen entry into tunnels t1, t2 and t3 in monomer-1 to determine relative differences in the thermodynamics of oxygen entry into rrm2b and rrm2. in total, six abf simulations per rnr were performed, totalling 0.5 s of md simulation dynamics. each abf simulation was performed with a force bias on a single oxygen molecule meaning these simulations constitute single - molecule biased md simulations, using the collective variable center - of - mass (com) distance between fe(iii) and o2, (rn)=d(o2fe(iii)), with ranging from 3 to 15, in bins of width 0.25. each abf simulation obtains ergodic sampling by applying every 500 timesteps a biasing force fabf (3) onto the newtonian equations of motion, whose value is updated on - the - fly (den otter, 2000, den otter and briels, 1998) from the result, free - energy gradient along, the potential of mean force (pmf) along is obtained from numerical integration of the gradient.(3)fabf=ra=f()r(4)(dg()d)=u(rn)1in|j|=f(). tunnel t1 in monomer-1 extends for 30 and connects the two faces of the protein. it was simulated as two separate tunnels of length 15 in monomer 1, denoted tunnel t1 and t1, and was compared to a single simulation of tunnel t1 in monomer 2. the software caver 3.0 was used for the analysis of the evolution of lateral fenestrations during the md simulations, using 100 evenly chosen snapshots from the md simulations, which is every 2 ns. the outer surface of the protein is calculated by rolling a large spherical probe around the surface of the protein and then internal cavities are identified using a smaller spherical probe (a radius of 0.8 was used here, and 12 probe spheres used). all identified tunnels are grouped into clusters based on relative proximities and with an 8 cut off for each cluster node, meaning that tunnels differing from the node by more than 8 are excluded. the values for shell radius and depth (15) influence the definition of the protein molecular surface. the statistical significance of differences between datasets was determined assessed by using the following test. student s t test (two - tailed paired, except for dntp incorporation assays, where a two - tailed unpaired test was applied) was used in all experiments where two means were compared. one - way analysis of variance (anova) was used to compare several means and two - way anova was used for determination in a response that is affected by two factors (one- or two - way anova analysis is indicated at the figure legends). statistical significance was assumed if p < 0.05 or lower and is noted in the figures. error bars represent mean standard error of the mean (s.e.m.). i.p.f. conceived, designed, performed, and interpreted the majority of the experiments and wrote the manuscript. k.b.l. performed the xenografts, immunohistochemistry (ihc), some experiments, and tcga analysis. e.m.h. conceived the project ; conceived, designed, and interpreted the majority of the experiments ; and wrote the manuscript. | summarycells exposed to hypoxia experience replication stress but do not accumulate dna damage, suggesting sustained dna replication. ribonucleotide reductase (rnr) is the only enzyme capable of de novo synthesis of deoxyribonucleotide triphosphates (dntps). however, oxygen is an essential cofactor for mammalian rnr (rrm1/rrm2 and rrm1/rrm2b), leading us to question the source of dntps in hypoxia. here, we show that the rrm1/rrm2b enzyme is capable of retaining activity in hypoxia and therefore is favored over rrm1/rrm2 in order to preserve ongoing replication and avoid the accumulation of dna damage. we found two distinct mechanisms by which rrm2b maintains hypoxic activity and identified responsible residues in rrm2b. the importance of rrm2b in the response to tumor hypoxia is further illustrated by correlation of its expression with a hypoxic signature in patient samples and its roles in tumor growth and radioresistance. our data provide mechanistic insight into rnr biology, highlighting rrm2b as a hypoxic - specific, anti - cancer therapeutic target. |
a liberian man 47 years of age living in the united states traveled to liberia in january 2010. he arrived in monrovia, then spent 5 days traveling throughout nimba county in north - central liberia, bordering guinea and cte divoire. he reported sleeping nightly in his rural native village in a dwelling infested with rats and recalled several rat carcasses on the bedroom floor. on the day of his departure from liberia, he developed fever, chills, joint pain of the knees and ankles, anorexia, sore throat, diffuse skin tenderness, and mild shortness of breath ; he began taking amoxicillin and chloroquine before departing liberia. the patient s symptoms persisted upon arrival in the united states, prompting him to seek medical attention on day 5 of his illness. when he sought treatment, he had fever of 103f, pulse of 99 beats / min, respiratory rate of 15 breaths / min, and blood pressure of 120/80 mm hg (table a1). his physical examination was notable for posterior cervical adenopathy and a palpable spleen tip (table). he had no evidence of conjunctival, nasal, or oral petechiae ; no skin rashes ; and no signs of hemorrhage or other lesions. initial laboratory data showed leukopenia and thrombocytopenia and minimal transaminase elevations (table a1). antigen testing was negative and thick and thin blood smears showed no evident parasitemia. by the next day, mild pharyngitis with slight tonsillar exudates had developed. lassa fever was considered in the differential diagnosis ; contact precautions and, subsequently, airborne precautions were taken. because of noted clinical improvement, he was not given empiric intravenous ribavirin. on day 5 of hospitalization, lassa virus was identified by real - time pcr by using samples collected 2 days earlier, and sequencing of the amplified fragment yielded a unique sequence similar to sequences from previous lassa virus isolates from liberia. subsequent samples confirmed lassa fever diagnosis on the basis of real - time pcr, viral culture, and serology (table). after 2 successive negative blood real - time pcr results, he was discharged from the hospital on day 21 of his illness with instructions to avoid unprotected sexual intercourse for 2 months. no hearing abnormalities were noted at the time of discharge or during telephone conversations 2 weeks and 2 months later. a contact investigation was undertaken by the hospital and local, state, federal, and international health agencies. exposed persons were identified as any persons who potentially came into contact with the patient or his body fluids during his illness. because no contacts had direct exposure to body fluids (other than the patient s wife in africa with whom he had sexual intercourse before becoming ill and who remained well, according to telephone follow - up with the patient), no patient contacts were considered high risk for secondary transmission (10). in total, 140 persons, including the patient s family in the united states, co - workers, and hospital workers who had contact with him (but did not have direct contact with bodily fluids) were identified as low - risk contacts. health communication materials were developed on the basis of previous lassa fever contact tracing activities (10). all hospital and community contacts were provided a lassa fever fact sheet and asked to seek medical consultation if fever or other signs and symptoms of lassa fever appeared. upon completion of 21 days of follow - up, the spectrum of lassa fever can run from asymptomatic seroconversion to severe hemorrhagic fever with multiple organ failure and death (1,2,6). factors supporting the diagnosis of lassa fever in returning travelers include relevant epidemiologic exposure (travel to rural west africa), signs and symptoms consistent with lassa fever, and the absence of other infectious agents that can account for the illness. although this patient did not seek treatment for hemorrhagic signs, his fever, pharyngitis, chest pain, and diarrhea (1,6), as well as thrombocytopenia and elevated transaminases, were consistent with lassa fever (6,12). early institution of ribavirin can dramatically decrease death rates among patients with severe lassa fever if given within the first 6 days of illness (12) ; therefore, empiric ribavirin should be considered for an ill patient suspected of having lassa fever. as in this case, early suspicion of lassa fever should prompt isolation measures to avoid secondary transmission ; laboratory testing should be limited to essential tests, and all laboratory specimens should be handled with appropriate biosafety precautions to avoid aerosolizing the virus (13). experience in regions where lassa virus is endemic suggests human - to - human transmission occurs through direct contact with blood and body fluids or large - particle inhalation ; transmission through viral aerosolization is not seen ; and generally, when universal precautions are undertaken, transmission is unlikely (14). nonetheless, aerosol in addition to contact precautions were undertaken once lassa fever was suspected, given the theoretical potential for acquiring infection through inhalation of airborne virus from respiratory secretions or, in this case, copious diarrhea. the patient described in this report represents the sixth known occurrence of lassa fever imported to the united states. clinicians treating recent travelers to west africa who are febrile should obtain detailed histories from patients to determine whether they have traveled into rural areas in which the potential for exposure to rodents exists. the symptoms, signs, and laboratory abnormalities of lassa fever are nonspecific and can overlap with other tropical infections. therefore, efforts should be made to promptly diagnose or rule out other infectious agents in a patient who has the appropriate travel and exposure history so that further diagnostic studies and empiric therapy with ribavirin can be undertaken rapidly. moreover, as soon as lassa fever is suspected, patients and their specimens should be handled with adequate precautions, the local health department and centers for disease control and prevention should be notified, and specimens should be sent for specific diagnostic testing. | we report a case of lassa fever in a us traveler who visited rural liberia, became ill while in country, sought medical care upon return to the united states, and subsequently had his illness laboratory confirmed. the patient recovered with supportive therapy. no secondary cases occurred. |
some penicillins have been reported to cause occupational diseases, including bronchial asthma (1, 2), anaphylaxis (3), contact urticaria (4), contact dermatitis (5), and hypersensitivity pneumonitis (6), in pharmaceutical workers and health care professionals. occupational contact urticaria and anaphylaxis induced by cephalosporins have often been reported (7). with regard to piperacillin, there is only one published report of occupational asthma, rhinitis, and urticaria in a pharmaceutical worker (1). however, to our knowledge, there has been no report of occupational anaphylaxis induced by piperacillin. furthermore, no evidence of a serum ige antibody response to piperacillin has been published. this is thus the first report of occupational anaphylaxis due to piperacillin and detection of a serum ige response to a piperacillin - hsa conjugate. the subject was a 24-yr - old female nurse who worked in the intensive care unit at a university hospital. eighteen months later (october 2004), she experienced generalized urticaria with onset immediately and repeatedly after she had administered piperacillin. nevertheless, she continued to work and finally experienced chest tightness, dizziness, sweating, generalized urticaria, abdominal pain, and diarrhea 10 min after giving a piperacillin injection in april 2005. her blood pressure was 80/50 mmhg with a pulse rate of 104 beats / min. she had a previous history of atopic dermatitis, and her hand eczema had become exacerbated after she had begun to work at the hospital. skin prick tests using 80 common inhalant and food allergens (bencard, brentford, uk) were all negative. we did not perform a skin prick test with piperacillin / tazobactam because of the risk of anaphylaxis (8). serum total ige, measured using an immuno - cap system (phadia, uppsala, sweden), was 283 iu / ml. to assay piperacillin - specific serum ige and igg, we prepared piperacillin - human serum albumin (hsa) conjugates in our laboratory and performed an elisa as described previously (11). piperacillin - specific ige and igg levels in an initial serum sample and the ige level in a serum sample obtained 5 yr later (may 2010) were measured. in brief, the wells of a 96-well elisa microplate (corning, new york, ny, usa) were coated by incubation with piperacillin - hsa conjugate at 10 g / ml in phosphate - buffered saline (pbs) overnight at 4. after the wells were washed four times with 350 l of pbs containing 0.05% tween 20 (pbs - t ; sigma - aldrich, st. louis, mo, usa), nonspecific binding sites were blocked by incubation with 200 l of 10% fetal bovine serum (fbs ; gibco / invitrogen, carlsbad, ca, usa) in pbs at room temperature for 2 hr. after washing four times with 0.05% pbs - t, 50 l of diluted serum (1:3) were added to each well, followed by incubation for 2 hr at 37. the plate was washed four times with 0.05% pbs - t, then 100 l of goat anti - human ige antibody (kirkegaard & perry laboratories, inc., gaithersburg, md, usa) diluted 1:1,000 with 10% fbs - pbs were added to each well, and the plate was incubated for 1 hr at room temperature. after washing four times with 0.05% pbs - t, 100 l of alkaline phosphate - conjugated rabbit anti - goat igg antibody (reserveaptm ; kirkegaard & perry laboratories) diluted 1:500 with 10% fbs - pbs were added to each well, and the plate was incubated for 1 hr at room temperature. pnpp (p - nitro - phenyl phosphate ; sigma - aldrich) substrate was added, and the reaction was stopped by the addition of 1 n naoh. the optical density of the solution in each well was measured at 405 nm using a microplate reader (synergy ht ; bio - tek, winooski, vt, usa). the final absorbance value of piperacillin was determined by subtracting the absorbance value of a control crosslinker - hsa conjugate, which was obtained using a procedure identical to that described above, except that a crosslinker - hsa conjugate was used in place of piperacillin - hsa conjugate. the positive cutoff value was determined as the mean plus three standard deviations of the absorbance values in serum samples from 11 unexposed, non - atopic healthy controls. for the inhibition elisa, increasing amounts (1 - 100 g / ml) of free piperacillin, piperacillin - hsa conjugate, and hsa alone, dissolved in 10% fbs - pbs, were incubated with serum overnight, and an elisa was performed as described above. the percentage inhibition was calculated as follows : % inhibition = (1 - absorbance with inhibitor / absorbance without inhibitor) 100. for the elisa of piperacillin - specific serum igg levels, alkaline phosphate - conjugated rabbit anti - human igg antibody (kirkegaard & perry laboratories) was used instead of goat anti - human ige antibody and alkaline phosphate - conjugated rabbit anti - goat igg antibody. a high level of specific ige antibody to piperacillin - hsa conjugate was detected in the initial serum sample from the subject ; however, this had decreased markedly after 5 yr (fig. 1). significant inhibition by both free piperacillin and piperacillin - hsa conjugate occurred in a dose - dependent manner, with minimal inhibition by hsa alone (fig. high levels of piperacillin - hsa conjugate - specific igg were also detected in the initial serum sample (data not shown). based on these findings, the subject was diagnosed with occupational anaphylaxis and urticaria caused by piperacillin. the subject was transferred to a different department and has not again experienced anaphylaxis or urticaria. skin prick tests using 80 common inhalant and food allergens (bencard, brentford, uk) were all negative. we did not perform a skin prick test with piperacillin / tazobactam because of the risk of anaphylaxis (8). serum total ige, measured using an immuno - cap system (phadia, uppsala, sweden), was 283 iu / ml. to assay piperacillin - specific serum ige and igg, we prepared piperacillin - human serum albumin (hsa) conjugates in our laboratory and performed an elisa as described previously (11). piperacillin - specific ige and igg levels in an initial serum sample and the ige level in a serum sample obtained 5 yr later (may 2010) were measured. in brief, the wells of a 96-well elisa microplate (corning, new york, ny, usa) were coated by incubation with piperacillin - hsa conjugate at 10 g / ml in phosphate - buffered saline (pbs) overnight at 4. after the wells were washed four times with 350 l of pbs containing 0.05% tween 20 (pbs - t ; sigma - aldrich, st. louis, mo, usa), nonspecific binding sites were blocked by incubation with 200 l of 10% fetal bovine serum (fbs ; gibco / invitrogen, carlsbad, ca, usa) in pbs at room temperature for 2 hr. after washing four times with 0.05% pbs - t, 50 l of diluted serum (1:3) were added to each well, followed by incubation for 2 hr at 37. the plate was washed four times with 0.05% pbs - t, then 100 l of goat anti - human ige antibody (kirkegaard & perry laboratories, inc., gaithersburg, md, usa) diluted 1:1,000 with 10% fbs - pbs were added to each well, and the plate was incubated for 1 hr at room temperature. after washing four times with 0.05% pbs - t, 100 l of alkaline phosphate - conjugated rabbit anti - goat igg antibody (reserveaptm ; kirkegaard & perry laboratories) diluted 1:500 with 10% fbs - pbs were added to each well, and the plate was incubated for 1 hr at room temperature. pnpp (p - nitro - phenyl phosphate ; sigma - aldrich) substrate was added, and the reaction was stopped by the addition of 1 n naoh. the optical density of the solution in each well was measured at 405 nm using a microplate reader (synergy ht ; bio - tek, winooski, vt, usa). the final absorbance value of piperacillin was determined by subtracting the absorbance value of a control crosslinker - hsa conjugate, which was obtained using a procedure identical to that described above, except that a crosslinker - hsa conjugate was used in place of piperacillin - hsa conjugate. the positive cutoff value was determined as the mean plus three standard deviations of the absorbance values in serum samples from 11 unexposed, non - atopic healthy controls. for the inhibition elisa, increasing amounts (1 - 100 g / ml) of free piperacillin, piperacillin - hsa conjugate, and hsa alone, dissolved in 10% fbs - pbs, were incubated with serum overnight, and an elisa was performed as described above. the percentage inhibition was calculated as follows : % inhibition = (1 - absorbance with inhibitor / absorbance without inhibitor) 100. for the elisa of piperacillin - specific serum igg levels, alkaline phosphate - conjugated rabbit anti - human igg antibody (kirkegaard & perry laboratories) was used instead of goat anti - human ige antibody and alkaline phosphate - conjugated rabbit anti - goat igg antibody. a high level of specific ige antibody to piperacillin - hsa conjugate was detected in the initial serum sample from the subject ; however, this had decreased markedly after 5 yr (fig. 1). significant inhibition by both free piperacillin and piperacillin - hsa conjugate occurred in a dose - dependent manner, with minimal inhibition by hsa alone (fig. high levels of piperacillin - hsa conjugate - specific igg were also detected in the initial serum sample (data not shown). based on these findings, the subject was diagnosed with occupational anaphylaxis and urticaria caused by piperacillin. the subject was transferred to a different department and has not again experienced anaphylaxis or urticaria. although we did not perform provocation and skin prick tests with piperacillin, we diagnosed this patient with occupational anaphylaxis because : 1) the temporal correlation between handling piperacillin and anaphylaxis ; 2) a history of recurrent urticaria after handling piperacillin ; and 3) detection of piperacillin - specific ige in the serum. the complete disappearance of anaphylaxis and the reduction of serum ige after avoidance of piperacillin further support this diagnosis. these findings suggest that occupational exposure to piperacillin induced ige - mediated anaphylaxis in this subject. piperacillin can induce allergic reactions such as bronchial asthma, rhinitis (1), urticaria, anaphylaxis (9, 12), immune hemolytic anemia (10), maculopapular exanthem (13, 14), acute generalized exanthematous pulstulosis (15), and drug hypersensitivity syndrome (16). several reports used skin prick, provocation, and serologic tests to demonstrate that piperacillin induced these reactions (1, 9, 10). a previous study reported that two of 311 tertiary hospital nurses showed a positive skin prick test to piperacillin (0.6%) (17). two studies attempted to measure piperacillin - specific ige levels in serum (1, 9). one involved a case of anaphylaxis, urticarial, and angioedema after intravenous piperacillin injection in an acute bronchitis patient, and the other was a case of occupational asthma, rhinitis, and urticaria induced by piperacillin powder exposure in a pharmaceutical worker. in those reports, a radioisotope test was used to detect ige levels, but the assay failed. in the present study, we successfully detected piperacillin - hsa conjugate - specific serum ige by elisa in a patient with suspected piperacillin - induced occupational anaphylaxis. furthermore, the binding specificity of the ige was confirmed by inhibition elisa. as significant inhibition by both free piperacillin and piperacillin - hsa conjugate was detected, it is likely that the hapten component of piperacillin is the antigenic determinant. high serum piperacillin - hsa conjugate - specific igg levels were also detected in this patient, while levels in controls were minimal (data not shown). although one study has sought to evaluate penicillin - specific igg levels in the sera of patients with penicillin allergies, the significance of igg levels remains unclear (18). further studies are needed to investigate the role of specific igg or its subclasses in occupational allergic diseases induced by piperacillin. nontherapeutic exposure to antibiotics, including penicillins, can occur by various routes (3). contact with spilled drugs and inhalation of powder or foam are the most common routes. exposure by the contact route usually induces contact urticaria (4), anaphylaxis (19), or dermatitis (5), whereas the inhalation route induces most commonly asthma or rhinitis (2, 20). piperacillin, an intravenous antibiotic, is provided as a powder in a bottle and should be dissolved prior to administration. when dissolved, piperacillin develops little foam, but emits a more obvious odor than other intravenous antibiotics. the subject in the present report sometimes suffered from urticaria without direct contact with the solution, suggesting that inhalation of evaporated piperacillin may be the major route of sensitization. however, considering the reported exacerbation of hand eczema that occurred prior to the anaphylaxis, we speculate that exposure by direct contact with piperacillin solution may also have been a factor. in conclusion, we report a case of a nurse with anaphylaxis and generalized urticaria caused by piperacillin and mediated by an interaction of ige with the hapten of piperacillin. sensitization was suspected to have occurred through inhalation of piperacillin vapor. given that an elisa was capable of detecting piperacillin - specific serum ige, this system could be used for detecting piperacillin - hsa conjugate - specific ige in the serum of occupational anaphylaxis or asymptomatic sensitized patients. | this is the first reported detection of serum ige antibody to piperacillin - human serum albumin (hsa) conjugate in a patient presenting with anaphylaxis that developed after occupational exposure. a 24-yr - old nurse, who had worked at a university hospital for 2 yr, experienced chest tightness, dizziness, generalized urticaria, abdominal pain, and diarrhea 10 min after administering a piperacillin injection. she had previously suffered from atopic dermatitis. a skin prick test for common inhalant allergens was entirely negative ; in contrast, her serum total ige was elevated (283 iu / ml). a high level of piperacillin - specific serum ige was detected by elisa using piperacillin - hsa conjugate. significant inhibition upon addition of both free piperacillin and piperacillin - hsa conjugate was detected by inhibition elisa. these data suggest that piperacillin exposure in the workplace can induce occupational anaphylaxis and urticaria mediated by an interaction of ige with the hapten of piperacillin. |
an electrical storm (es) in ischaemic heart disease usually manifest as recurrent ventricular arrhythmias that are resistant to the antiarrhythmic drugs. we report an incident of es in a patient, which was treated with left stellate ganglion block (lsgb) under ultrasound guidance followed by left cardiac sympathetic denervation (lcsd) under general anaesthesia. a 52-year - old male, weighing 55 kg, received stents in left anterior descending artery (lad) and first diagonal artery and a permanent pacemaker (vdd) following anteroseptal myocardial infarction (mi) with complete heart block 2 years ago. postoperative course was complicated with recurrent ventricular tachycardia (vt) and syncopal attacks requiring hospitalization and dc cardioversion on four occasions. cardiology evaluation revealed pulse rate of 70/min and systemic blood pressure (bp) of 100/70 mmhg. findings on transthoracic echocardiography were a dilated left ventricle with a very low ejection fraction (20%), akinesia of lad territory and grade-1 mitral regurgitation. preoperative medication consisted of oral amiodarone 300 mg and sustained release metoprolol 50 mg once and twice a day respectively. during electrophysiological studies, vt could be easily induced, and the vt circuits were mapped and ablated at the anterobasal left ventricle. after an arrhythmia - free interval of 24 hours, he started having repeat episodes of monomorphic vt, degenerating into polymorphic vt and vf, requiring frequent cardioversions [figure 1 ]. monomorphic ventricular tachycardia at 220 bpm with positive concordance of qrs complexes and inferior axis are seen in the precordial leads. these episodes soon degenerated into polymorphic vt and ventricular fibrillation hypokalemia, hypomagnesemia and hypothyroidism were excluded as triggering factors for arrhythmias on laboratory investigations. severe hypotension and episodes of transient loss of consciousness warranted ventilatory therapy and inotropic support with epinephrine 0.1 mcg / kg / min. the trachea was intubated after administration of 200 mcg of fentanyl, 3 mg midazolam, 30 mg propofol and muscle relaxation with vecuronium 10 mg. sedation was maintained using infusions of midazolam 1 mg / hour and fentanyl 60 mcg / hour. as the vt was resistant to treatment with magnesium, amiodarone and lidocaine lsgb was performed under ultrasound guidance using a 7.5 mhz probe (site - rite ultrasound system, bard access, inc. a 23-g 4-cm long needle was advanced through the prevertebral fascia till its tip was placed in the longus colli muscle. injection of 6-ml 0.25% bupivacaine solution resulted in bulging of the longus colli compartment and caudad and cephalad spread, which was verified on ultrasound. warming of left upper limb and left horner 's syndrome confirmed the success of lsgb. patient remaining arrhythmia - free for 2 hours immediately after the blockade and incidents of vt were dramatically reduced subsequently for 12 hours. considering the benefits of lsgb toward pacifying the es, we decided to perform lcsd under general anaesthesia via supraclavicular surgical approach. placing high thoracic epidural catheter and video - assisted thoracoscopy (vat)-guided ablation of left upper thoracic sympathetic ganglia were other options, which, however, were considered inappropriate given the unstable hemodynamic condition of patient and deranged left ventricular function. upon arrival in the operation suite, his heart rate and systemic blood pressure were 78 bpm and 90/68 mmhg, respectively. monitoring essentially consisted of electrocardiogram (leads ii and v5) and invasive arterial blood pressure. since the endotracheal tube was in situ, anaesthesia was deepened with bolus administration of fentanyl 200 mcg, midazolam 2 mg, propofol 25 mg and vecuronium 6 mg and maintained with sevoflurane adjusting concentration to maintain bis between 50 and 60. cervicothoracic sympathectomy was performed through neck excising left stellate ganglion and second thoracic ganglion with sympathetic chain. no further deterioration occurred in the intraoperative period and the patient was transferred back to the icu for elective ventilation. trachea was extubated 8 hours after surgery and inotropic support was tapered off over next 24 hours. he was discharged in a hemodynamically stable condition and remained symptom - free without any incident of vt for past 8 months. an es is defined as recurrent hemodynamically unstable vt and/or ventricular fibrillation (vf), thrice or more in 24 hours, requiring intervention of the defibrillator (anti - tachycardia pacing or shock). ongoing myocardial ischaemia or reentrant circuits in an old infarct scar are considered causative factors for es, which are associated with augmented sympathetic activity and increased propensity for ventricular arrhythmias.recurrent vt or vf may result in left ventricular systolic dysfunction and myocardial injury exacerbating heart failure. identifying and reversing the causative factors is important during treatment. specific precipitants include acute myocardial ischaemia, heart failure, hypokalemia, hypomagnesemia, arrhythmogenic drug therapy, hyperthyroidism, infection and fever. treatment options for es include correcting the causative factors, providing hemodynamic support, instituting antiarrhythmic therapy, placing implantable cardioverter - defibrillator (icd), achieving cardiac sympathetic denervation and interrupting the reentrant arrhythmia pathways using radiofrequency ablation. nademanee., reported that cardiac sympathetic blockade is superior to the antiarrhythmic therapy in treating es and have advocated lsgb for reducing the sympathetic surge. there are a few publications on efficacy of the lsgband thoracic epidural anaesthesia (tea)in lowering the incidents of ventricular arrhythmias during es. these therapeutic approaches reduce adrenergic tone that is most likely responsible for the reported efficacy. lsgb also reduces the risk of cardiac arrhythmias by shortening the qtc interval. the antiarrhythmic effect of lsgb lcgb provides distinct but transient abolition of es which can be utilized as the therapeutic test for sympathetic denervation. lcsd interrupts the major source of norepinephrine released in the heart, increases the threshold for vf and ventricular refractoriness. wilde., described that surgical lcsd in three young adults with polymorphic ventricular tachycardia resulted in postoperative cessation of symptoms. icd is another treatment option, which, however, may worsen the arrhythmias in catecholaminergic vt. repeated shocks delivered through the icd may aggravate sympathetic stimulation, ventricular arrhythmias and initiate a series of more shocks and es.the lcsd may complement the use of an icd, because the denervation markedly decreases the catecholaminergic load on the heart, which may facilitate smooth functioning of the icd in interrupting vf and restoring the sinus rhythm. performing lsgb under the ultrasound guidance volume of local anaesthetic solution is an important concern during the cervicothoracic ganglion blockade against the likelihood of toxicity. wulf. observed toxic plasma levels of bupivacaine in 30% of patients given injection of 10 ml of 0.5% bupivacaine during sgb. a large volume of local anaesthetic, as much as 20 ml may be required to achieve desired blockade during blind injection as uncertainty exist over the placement of needle tip in the vicinity of the stellate ganglion. on the contrary, 5 - 6-ml solution may be sufficient to block the ganglia as it can be injected precisely in the longus colli muscle under the ultrasound guidance. success rate of the blockade technique is enhanced by visualizing distention of the longus colli compartmental space under the pretracheal fascia, directly under the ultrasound imaging. blind landmark technique of lsgb is fraught with complications like accidental injection into the vertebral artery and injury to superior thyroid artery leading to hematoma formation in 25% of patients. esophageal injury and pneumothorax sympathetic denervation in the presence of es poses a challenge to the anaesthesiologist, as the stress of surgery may further derange the cardiac function and aggravate the arrhythmia storm. although high tea may lower the cardiac sympathetic tone, the unstable hemodynamic condition precluded us from inserting the catheter as turning the patient in lateral decubitus or sitting position would have worsened the situation. surgical lcsd involves excision of cervicothoracic and upper thoracic ganglia along with the intervening sympathetic chain, which may be accessed via video - assisted thoracoscopy (vat) or through a supraclavicular incision following an extrapleural approach without performing thoracotomy. vat sympathectomy demands changing over the endotracheal tube with a double lumen endobronchial tube for one - lung ventilation and turning the patient in right lateral decubitus, which would have deteriorated hemodynamic and respiratory parameters in our patient. hence we preferred to perform the lcsd via supraclavicular approach. avoiding sympathetic stimulation arising from light anaesthesia, tachycardia, hypothermia, hypoxaemia and hypercapnia electrolyte imbalances like hypokalemia, hypomagnesaemia, and hypocalcaemia can contribute to delayed myocardial repolarization and should be treated promptly. short - acting anaesthetics such as propofol and benzodiazepines have been found to successfully convert and suppress occurrence of vt during es. lsgb followed by surgical lcsd is an effective treatment modality to reduce the incidents of malignant ventricular arrhythmias. lsgb may serve a simple bedside tool to identify the patients who are likely to respond to the more definite but more invasive modality of lcsd. the ultrasonography during lsgb enhances the success rate of the technique, reduces the quantity of local anaesthetic required to produce desired effects and prevents technical complications. supraclavicular surgical access to the upper thoracic sympathetic chain obviates the necessity for one lung ventilation and lateral decubitus during surgery in a hemodynamically unstable patient. | an electrical storm is usually associated with catecholaminergic surge following myocardial ischaemia and manifest as recurrent ventricular arrhythmias, requiring frequent dc shocks. delivering repeated dc shocks induces myocardial damage and further worsens the arrhythmias, which are resistant to the antiarrhythmic drugs. cardiac sympathetic blockade abates the excessive catecholaminergic drive and help pacifying the malignant ventricular arrhythmias. we treated the electrical storm in a 52-year - old male with ultrasound - guided left sympathetic ganglion block followed by surgical left cardiac sympathetic denervation. the patient remained symptom - free without any incident of ventricular arrhythmias for 8 months after the surgery. the ultrasonography during blockade of the stellate ganglion enhances the success rate of the technique, reduces the quantity of local anaesthetic required to produce desired effects and prevents technical complications. supraclavicular surgical access to the upper thoracic sympathetic chain obviates the necessity for one lung ventilation and lateral decubitus during surgery, when the patient is in hemodynamically unstable condition. sympathectomy can be performed under general anaesthesia taking cautions to avoid sympathetic stimulation in intraoperative period. |
there is currently no vaccine available for any form of leishmanias, including visceral leishmaniasis (vl), which if left untreated is almost always fatal. vl results from systemic infection with l. infantum (also known as l. chagasi) which occurs in europe, north africa, south and central america, and l. donovani, which is found throughout east africa, india, and parts of the middle east. infection is initiated by the bite of an infected sand fly vector and parasites disseminate from the site of infection in the skin to reside and multiply within macrophages of the liver, spleen, and bone marrow. vl, also known as kala - zar, is associated with fever, weight loss, enlargement of the spleen and liver, and anaemia. leishmaniasis has strong links with poverty and is considered one of the most neglected tropical diseases. each year there are approximately 500,000 new cases of vl with over 90% of cases arising in india, bangladesh, nepal, sudan, and brazil. vl has become a frequent coinfection in hiv - positive individuals in endemic areas and is associated with enhanced onset of aids - related illness and increased vl treatment failure. current vl therapy is based on the long - term parenteral administration of pentavalent antimonials, which, despite being expensive and highly toxic, has been the standard treatment for over 50 years. following l. donovani infection some individuals develop post - kala - azar dermal leishmaniasis (pkdl), a complication that occurs either during or after treatment. during pkdl parasites reappear in the skin resulting in an array of small skin lesions, and patients are considered a significant infection reservoir because of the large number of parasites accessible to sand fly bites. thus the treatment and control of pkdl are an important public health measure for controlling vl and must be considered in the development of vl vaccine strategies. host resistance to leishmania infection is mediated by cellular immune responses leading to macrophage activation and parasite killing. antileishmanial immunity is mediated by both innate and adaptive immune responses and requires effective activation of macrophages, dendritic cells (dcs), and antigen - specific cd4 and cd8 t cells. although strong humoral responses are induced by vl infection, antibodies play no role in protection and are often associated with disease exacerbation. effector cd4 t cells are responsible for the production of cytokines critical for the activation of macrophages and are required for optimal host response to infection. cytotoxic cd8 t cells also play a host protective role, and are required for the effective clearance of parasites and the generation of memory responses. interestingly, 80 to 90% of human infections are subclinical or asymptomatic, and this asymptomatic infection is associated with strong cell - mediated immunity. only a small percentage of infected individuals develop severe disease, and patients who recover from vl display resistance to reinfection. this suggests the development of clinical immunity and provides a biological rationale for the development of vl vaccines that impart a strong cellular immunity. humans are the only known hosts for l. donovani ; however l. infantum is primarily a zoonotic disease and canine species are the main animal reservoir. canine visceral leishmaniaisis (cvl) affects millions of dogs in europe, asia, north africa, and south america and has been associated with outbreaks of human vl. both symptomatic and asymptomatic leishmania - infected dogs act as a source of parasites for vl transmission, and cvl represents a significant public health issue. a current approach to breaking the vl transmission cycle is the development of cvl vaccine, which may be crucial for controlling vl infection in human populations. historically cl has been the focus of vaccination attempts, as it has been known for centuries that people who resolve a primary cl skin lesion are protected from further infections. it is generally acknowledged that human vl trials will follow on from any successful cl immunization programme. the recent comparative genomic analysis of three leishmania species, which cause distinct disease pathologies, showed that l. major, l. braziliensis, and l. infantum genomes are highly conserved and have very few species - specific genes. the level of amino acid conservation within coding regions is also high between species, suggesting that the major leishmania antigens are conserved and that a pan species vaccine may be achievable. however there is a high degree of variability in the cross - protective immunity induced by infection with different leishmania species [12, 13 ] and vl - specific vaccines may provide a more successful intervention. experimental infection models are used to screen and evaluate vl vaccines, and several animal species have been used including mice, hamsters, monkeys, and dogs. however no single in vivo model accurately reflects all aspects of human vl disease, which has been a major limitation in the development of vl vaccines. the precise immune mechanisms underlying human vl are still not fully understood, and the responses necessary for protection by vaccination in experimental infection models may not reflect those required for efficacy in endemic areas. the profile of an antileishmanial vaccine would need to incorporate several important features, such as safety, ease of production at a low cost in endemic countries, the induction of robust, long - term t cell responses, and both prophylactic and therapeutic efficacy. ideally, such vaccine would offer cross - species effectiveness against cl and vl. as this might not be feasible, the development of a vl - specific vaccine remains an important global health priority. the only successful intervention against leishmaniasis is inoculation using virulent parasites, a process known as leishmanization (lz). this ancient practise involves the administration of cutaneous leishmania parasites to a discrete skin location, allowing a self - healing lesion to form. lz was traditionally practised by directly transferring infectious material from cutaneous lesions to uninfected individuals. however the establishment of an in vitro culture system in the early 20th century led to the large - scale production of promastigote forms of leishmania for expanded clinical use. lz induces a controlled, but full, infection and was successfully used as a prophylaxis throughout the soviet union, asia, and the middle east, with reported efficacy levels up to 100% [16, 17 ]. however lz was largely abandoned due to safety issues associated with the use of live vaccines. also, standardisation of the inoculum proved difficult as parasites used for lz experience a dramatic loss of infectivity when subject to repeated subculturing. infection with live leishmania also causes immunosuppression, which resulted in reduced immune responses to childhood vaccines and threatened the efficacy of immunization programmes [19, 20 ]. currently only one country, uzbekistan, employs the use of lz, where a mixture of live and dead l. major is licensed as a vaccine for high - risk populations. as lz is the only vaccine strategy against leishmania with proven efficacy in humans, efforts are being made to improve the safety of this practise. the inclusion of killed parasites in the inoculum and the use of adjuvants that promote rapid immune responses reduce the severity of primary lesions and accelerate wound healing during lz [16, 22 ]. research into first - generation vaccines based on whole - cell, killed leishmania parasites dates back to the late 1930s, when pioneering work by brazilian scientists demonstrated that killed parasites showed efficacy as both therapeutic and prophylactic vaccines. over the ensuing decades numerous preparations of killed parasites were tested, either alone or in combination with a variety of different adjuvants. although displaying well - tolerated safety profiles, to date no first - generation vaccine using killed parasites has demonstrated sufficient efficacy as a prophylactic vaccine to be used in widespread control programmes. most vaccine studies focus on cl, and there have been no clinical trials of first - generation vaccines produced from vl leishmania species. due to the strongly conserved genomes of the leishmania species, it is anticipated that human vl trials will follow any successful cl immunization program. whether the same vaccine can show efficacy against both cl and vl remains to be determined. interestingly, killed parasite vaccines using an alum - precipitated autoclaved l. major (alm) given with a bcg adjuvant have shown promise as vaccines for vl and pkdl. when given to patients with persistent pkdl in combination with antimonial therapy this vaccine showed enhanced cure rates and lower incidence of relapse as compared to antimonial treatment alone. based on these initial studies, recommendations have been put forward for expanded trials to examine the prophylactic and therapeutic effects of the alum - alm + bcg vaccine for pkdl and vl. evidence from experimental animal models supports the development of first - generation vl vaccines. complete soluble antigen (csa) from an attenuated l. donovani strain was effective as both a therapeutic and prophylactic vaccine in susceptible mice, without the use of an adjuvant. importantly, csa immunization was effective against both pentavalent antimony sensitive and resistant strains of l. donovani. vaccination with purified excreted - secreted antigens from l. infantum promastigotes (liesap) fully protected dogs from experimental challenge and induced a long - lasting cell - mediated immunity. a major advantage of first - generation vaccines is that they are conceptually simple and relatively easy to produce in leishmania endemic countries at low cost. however standardization of vaccines derived from cultured parasites is difficult, and this has hindered commercial development efforts. the route of administration, formulation, and adjuvant are also important considerations in the development of whole - parasite vaccines, and optimisation is essential for the induction of protective immune responses. the most recent clinical trials of first - generation vaccines have demonstrated a good safety profile but have not conferred significant levels of protection for use as prophylactic vaccines. however promising results from trials using therapeutic vaccination in combination with chemotherapy warrant further investigation. the development of second - generation vaccines for leishmania has included recombinant proteins, polyproteins, dna vaccines, liposomal formulation, and dendritic cell vaccine delivery systems. a variety of different molecules have been tested to date with varying degrees of efficacy (table 1). in general vl vaccination studies the natural combination of dogs and l. infantum and l. donovani in golden hamsters reproduces many features of human vl. the canine model is particularly useful in evaluating vaccine candidates since successful vaccination of dogs might control the spread of disease to humans in endemic areas where the dog is the reservoir of the parasite. however, both models suffer from lack of immunological reagents and assays needed for the characterisation of immune responses. therefore, the mouse model of vl has been widely used to assess vaccine candidates. while experimental vl infection in mice does not fully reproduce the disease observed in humans, mice are competent hosts for both l. donovani and l. infantum and exhibit organ - specific pathology in the liver and spleen. other major advantages of the mouse model are that it is amenable to genetic manipulation to create mutants with specific deficiencies in the immune system and a wide range of immunological reagents is available. only a small number of recombinant proteins have been tested against vl in murine models. early studies showed that promastigote - derived membrane protein dp72 protected mice against l. donovani infection [59, 82 ], but there has been no further advance on the use of this antigen for the development of vaccines. the l. donovani amastigote lcr1 protein containing 67-amino - acid repeats homologous to repeats in a trypanosoma cruzi flagellar polypeptide recombinant protein led to partial protection against l. infantum challenge, while immunization with bcg - lcr1 elicited better protection. vaccine efficacy was influenced by the site of immunization with subcutaneous administration superior to intraperitoneal inoculation. recombinant hydrophilic acylated surface protein b1 (haspb1), a member of a family of proteins expressed only in metacyclic and amastigote stages, has shown efficacy in an experimental mouse model of vl. this vaccine did not require the use of adjuvant, and protection was associated with the induction of antigen - specific, ifn- producing cd8 t cells, a mechanism similar to dna vaccination. immunization with the l. donovani a2 cysteine proteinase delivered as recombinant protein or as dna also afforded protection against experimental challenge infection [60, 61 ]. other antigens tested include amastigote cysteine proteases (cps), kinetoplastid membrane protein-11 (kmp-11), amastigote lcr1, leishmanial antigen orff, and nh36, a main component of the fucose - mannose ligand. apart from defined single molecules, multicomponent vaccines have been shown to protect against vl in experimental infection systems. recombinant q protein formed by fusion of antigenic determinants from four cytoplasmic proteins from l. infantum (lip2a, lip2b, p0, and histone h2a) coadministered with live bcg protected 90% of immunised dogs by enhancing parasite clearance. to date, only one multicomponent vaccine, leish-111f, has been assessed in clinical trials. leish-111f is a single polyprotein composed of three molecules fused in tandem : the l. major homologue of eukaryotic thiol - specific antioxidant (tsa), the l. major stress - inducible protein-1 (lmsti1), and the l. braziliensis elongation and initiation factor (leif). there is some evidence that the leish-111f vaccine can also induce partial protection against vl in animal models ; however, it failed to protect dogs against infection and did not prevent disease development in a phase iii vaccine trial in dogs. an optimized version, known as leish-110f, has recently demonstrated strong immunogenicity and some protective efficacy against l. infantum in mice. the leish-111f vaccine is moving forward into clinical trials as leishf1 and is being trialled in combination with the mpl - se adjuvant. this adjuvant consists of monophosphoryl lipid a, a potent tlr4 agonist, formulated with the antigen as a stable emulsion. a recent small - scale clinical trial in a l. donovani endemic area showed leish - f1-mpl - se was safe and well tolerated in people with and without prior vl exposure and induced strong antigen - specific t cell responses. in addition to recombinant proteins, dna has been extensively tested as means of vaccine delivery. the induction of th1 responses leading to strong cytotoxic t cell immunity is a general property of dna vaccines, and a growing body of evidence implicates cd8 t cells in protective antileishmanial responses. the paple22 antigen, which is recognised by t cells from vl patients, was administered as a dna vaccine and led to a marked decrease in parasite burden in immunised hamsters. however stimulation of peripheral blood mononuclear cells from vl - infected individuals with recombinant paple22 induced il-10 production, which is associated with vl pathogenesis in humans. the leishmania homologue for receptors of activated c kinase (lack) is the most extensively studied dna vaccine against both cutaneous and visceral leishmaniasis, but has shown inconsistent outcomes. dna vaccination with a plasmid harbouring the lack gene coadministered with, or without, il-12 induced robust, long - lasting protection against l. major challenge in mice, which was dependent on cd8 t cells [9092 ]. in a heterologous system, priming with l. infantum lack followed by a vaccinia booster afforded protection against l. major infection. the prime - boost regimen was also employed to immunise dogs against l. infantum infection and elicited protective responses in 60% of vaccinated animals, but this positive outcome has been overshadowed by studies where immunisation with lack offered no protection. in an experimental mouse model the lack dna vaccine induced strong th1 responses, but failed to protect against l. donovani challenge. other studies in the l. infantum mouse model confirmed that lack dna vaccination does not confer protection against vl despite the presence of th1 responses ; however, a strategy using a heterologous prime - boost vaccination using dna and vaccinia viruses has shown some efficacy. the heterologous dna - prime protein - boost approach has also shown success for other vl vaccine antigens such as orff and cysteine proteinases. heterologous prime - boost with gp63 antigen with cpg - odn as adjuvant provided durable protection against l. donovani challenge in an experimental mouse model and was associated with robust cellular immune responses. as gp63 is a major surface protein present on both amastigote and promastigote forms and shows a high homology between vl species it is an attractive target for further vaccine development. insights into the role of the innate immune system, in particular dendritic cells (dcs), have provided the impetus for the use of dcs as a delivery system for leishmania antigens [9799 ]. dcs loaded with l. donovani soluble extract and expressing high levels of il-12 induced protection in the mouse model of vl when used as a therapeutic vaccine. moreover, coadministration of dcs with antimonial therapy resulted in complete clearance of parasites from the liver and spleen, unlike dc immunisation alone which was not able to clear the infection from these organs. liposome formulations have been adopted as leishmania drug delivery systems, and liposomal amphotericin b is the current preferred drug treatment for vl in resource - rich settings. vesicle delivery systems are also being considered for vl vaccines and have been shown to adjuvant protein antigens and induce sustained th1 immune responses. these delivery systems have shown some protection against l. donovani infection in experimental mouse models and provide a new approach to the development of vl vaccines. recently, peters. demonstrated that sand fly transmission of parasites abrogates vaccine - induced protective immunity. while mice vaccinated with killed parasites were refractory to a needle challenge, they were susceptible to the sand fly inoculum implying that the protective responses in vaccinated mice were either not generated or not maintained. these data provide a rationale for the inclusion of sand fly saliva components, which are specific to natural infection, in vaccine design. the sand fly injects leishmania parasites in the presence of saliva, which contains a range of pharmacologically active molecules that can modulate host 's immune and inflammatory responses and facilitate establishment of infection. for a number of years salivary gland antigens have been targeted as potential candidates for antileishmanial vaccine development, primarily against l. major. nevertheless, it has been shown that children who underwent anti - vl delayed - type hypersensitivity (dth) conversion also had increased titers of antibodies directed to sand fly saliva suggesting that mounting an effective antileishmanial response might be linked to neutralization of saliva components. eliminating animal reservoirs has been an essential public health tool for the control of many zoonotic diseases, such as rabies and brucellosis. canines, particularly domestic dogs, are the main reservoir for vl species and are considered the main source of zoonotic transmission to humans. the development of an effective canine visceral leishmaniasis (cvls) vaccine represents a cost - effective tool for interrupting the transmission cycle and controlling zoonotic vl infection in humans. cvl is widespread throughout south america and the mediterranean where l.infantum is the most significant causative agent of disease. l. donovani is considered to be zoonotic, but as yet there has been no clear identification of the reservoir host animal. asymptomatic infection is common in dogs, and as a large reservoir of parasites are present in the skin, asymptomatic animals are a major source of infection for vector transmission. human vl is an emerging disease in many areas of the world, including northern europe and north america, and the spread of vl into nonendemic areas is often preceded by increased incidence of canine infection. there is concern that increased mobility of dogs and changes in vector habitat will result in increased transmission of human vl in previously nonendemic areas. treatment of cvl shows low efficacy with drugs successfully used for human vl chemotherapy, and drug treatment of dogs rarely results in cure. control programmes for cvl have a demonstrated capacity to reduce the prevalence of human vl disease following interventions that target dog populations in endemic regions. however these public health campaigns are often complex and expensive to maintain, leading to varying degrees of efficacy. the use of insecticide - impregnated collars can reduce the risk of contracting cvl, but is costly and difficult to implement at a national level. the culling of seropositive dogs has long been recommended in brazil ; however this approach has not lead to a reduction in the number of human vl cases and may be of limited value. therefore the development of vaccines against cvl is an attractive approach to controlling infection in dogs, reducing the parasite reservoir and thus reducing the risk of transmission of vl to human populations. immunological characterisation of cvl reveals cellular and humoral immune responses comparable to human infection, including immune dysregulation and increased il-10 which is associated with disease manifestation and progression. disease resistance is associated with strong th1-type immune responses, including ifn- expression by antigen - specific t cells. thus, analogous to a human vl vaccine, an effective cvl vaccine needs to induce strong and long - lasting cell - mediated immunity. adjuvant choice must be carefully considered for cvl interventions, as live bcg is not appropriate for use in dogs and the identification of appropriate and effective adjuvants will be essential for safe and effective cvl vaccines. reactive antibodies to two sand fly saliva components (lulo - d7 and lulo yellow) were identified in infected dogs and proposed as possible vaccine candidates against cvl. evaluation of a killed leishmania vaccine containing sand fly saliva extract indicated that the vaccine is highly immunogenic and provided support for further development of saliva components as candidates for anti - vl vaccine. this is supported by vaccination studies using the hamster vl model, showing that salivary protein ljm19 was able to protect hamsters from fatal infection with l. infantum. in addition, immunization with salivary proteins ljm17 and ljl143 induced strong cellular and humoral responses in dogs and might be an advantageous addition to anti - cvl vaccine. currently there are two commercially available cvl vaccines, leishmune and leishtec, and new vaccines under development include recombinant antigen vaccines and both live and killed whole - cell vaccines. the leishmune vaccine was the first commercially licensed vaccine for cvl, produced by fort dodge animal health and has been available in brazil since 2004. this vaccine consists of the fucose mannose ligand (fml) isolated from l. donovani plus a saponin adjuvant. fml is a glycoprotein mixture, and the surface glycoconjugate gp36 is the major immunogen component. this vaccine induced a significant and strong protective effect during phase iii trials in dogs living in a vl - endemic area in brazil with a vaccine efficacy as high as 80% [77, 126 ]. this protection lasted up to 3.5 years following vaccination, indicating induction of a long - lasting immunity. as leishmune - vaccinated dogs showed a complete absence of parasites, this renders them noninfectious and contributes to the breakdown of the zoonotic vl transmission cycle. during phase iii trials of leishmune there was a concomitant reduction in human vl cases in districts where dogs were vaccinated demonstrating that cvl vaccination interrupts the transmission of disease to humans. fml antigens are present on the surface of leishmania parasites throughout the life cycle, and antibodies raised in vaccinated dogs prevented the binding of procyclic promastigotes to the sand fly midgut. thus leishmune acts as a transmission blocking vaccine by clearing parasites from the animal reservoir and preventing survival of the parasite in the sand fly vector. currently the leishmune vaccine is used as a prophylactic and is recommended for asymptomatic noninfected dogs. however studies show that leishmune is effective as a therapeutic vaccine for naturally infected dogs, particularly when given in combination with chemotherapy. emerging wide - scale field studies reveal that leishmune decreases the incidence of both human and canine visceral leishmaniasis after dog vaccination with leishmune. a second vaccine, known as leish - tec, is being commercially developed by the hertape calier sade animal and consists of adenovirus expressing the l. donovani a2 antigen. whilst the results from phase - iii trials of leish - tec are yet to be published it is known that immunization with a recombinant a2 protein elicits protection against the onset of clinical vl in experimental dog infections. the recombinant adenovirus encoding the a2 gene was capable of inducing strong th1-type immune responses in vaccinated mice and reduced parasite burdens following challenge with vl parasites. together these studies indicate that a2 is an important candidate antigen for the development of cvl vaccines, and future studies should report on the impact of this intervention on both canine and human vl infection. as many of the clinical and immunological features of cvl are similar to those observed in human vl, experimental challenge in dogs represents a useful system for evaluating the efficacy of vaccine candidates. the leish-111f + mpl - se vaccine is a leading vaccine candidate from human vl and has shown therapeutic efficacy in recent cvl trials. live attenuated parasites vaccines are also being explored in canine models, including a drug - attenuated line of l. infantum established by culturing promastigotes under gentamicin pressure. the attenuated l. infantum vaccine strain did not induce clinical symptoms of vl in dogs and provided protection from subsequent challenge with live virulent l. infantum. the elimination of human vl will be difficult to achieve in the presence of persisting animal reservoirs, and veterinary intervention is an important tool for reducing the global burden of human vl disease. the identification of measurable and reliable biomarkers of immunogenicity and protection induced by cvl vaccines may also be informative for human vl vaccine efforts. historically the most successful vaccines against intracellular pathogens have been based on live attenuated organisms. vaccination strategies using live attenuated leishmania parasites are attractive as they closely mimic the natural course of infection and may elicit clinically protective immune responses. a live attenuated vaccine strain would present a full complement of leishmania antigens to the host immune system along with appropriate pattern - recognition molecules for the parasite. live vaccines also deliver antigens to the correct cellular and tissue compartments for appropriate processing and presentation to the host immune system. together, this enhances the capacity of live attenuated vaccines to promote antigen - specific effector and memory immune responses that confer long - lasting protective immunity. the development of robust in vitro culture systems for growth and differentiation of leishmania promastigote and amastigote life cycle stages has enabled the production of attenuated vaccine strains. it should be noted that most research in this area has utilized cl strains, such as l. major ; however the attenuation techniques are broadly transferrable to vl causing species. it is has been known for some time that long - term in vitro culture of promastigote parasites leads to a loss of virulence in vivo. studies in experimental mouse models of cl have shown that infection with cloned avirulent lines provides clear protection against a virulent challenge infection. avirulent strains of the vl species l. donovani and l. infantum have been generated by repeated in vitro subculture of promastigotes in the presence of gentamicin. these drug - attenuated promastigotes were able to invade macrophages but could not survive as intracellular amastigote forms. drug - attenuated l. infantum was avirulent in an experimental canine model, induced strong cellular immunity production and protection against challenge with live virulent l. infantum. early experiments showed that -irradiation rendered leishmania parasites nonpathogenic and infection protected against challenge in a cutaneous leishmania model. protection depended on the presence of viable irradiated parasites, suggesting that transformation into amastigote forms is required for efficacy. interestingly the underlying mechanism of protection may relate more to the induction of tolerization rather than immunization in this system. other approaches to the generation of attenuated parasites include chemical mutagenesis screens selecting for temperature sensitive cl strains which are avirulent during infection and significantly protect against subsequent challenge. the major concern regarding these approaches to attenuation is that the underlying genetic mechanisms are not defined. this creates safety concerns as the stability of parasite attenuation is uncertain and parasites could revert to a virulent form. conversely, a progressive loss of virulence may occur, resulting in parasite lines that are incapable of establishing infection or inducing protective host responses. a loss of parasite virulence due to long - term in vitro culture has been demonstrated in both human patients undergoing leishmanization and experimental mouse models. thus in the absence of a clear genetic profile, nonspecific parasite attenuation is not acceptable for the development of a human vl vaccine. over the last few decades the development of a powerful l. donovani and l. infantum parasites can be stably transfected using integrating expression constructs that target genes for disruption by homologous recombination. as leishmania organisms are diploid throughout their lifecycle, the production of null mutants requires each allele of a gene to be targeted individually with genetic constructs containing two different and independent selectable markers. the recent availability of leishmania genome sequences has facilitated the identification and in - depth analysis of parasite genes crucial for infection and virulence. comparative genomics studies of leishmania species have shown a highly similar gene content and gene order and annotation studies have revealed only a few species - specific genes. increased knowledge of potential parasite virulence factors and a greater understanding of the antigens involved in the acquisition of immunity have generated much interest in the development of genetically attenuated parasite vaccines. to date, there have been two general approaches to the genetic attenuation of leishmania parasites. first, by deletion of genes encoding virulence factors or the enzymes responsible for their synthesis and second, by targeting genes essential for intracellular survival. gene targeting aims to produce parasites that are capable of being produced and manipulated in vitro, usually in promastigote form, but incapable of sustaining virulent infection in the host, in amastigote form. the first genetically attenuated parasite vaccine was the l. major dihydrofolate reductase - thymidylate synthase (dhfr - ts) knockout, which targeted an essential metabolic gene. this null mutant was able to establish a persistent infection in experimental mouse models, but remained avirulent with respect to disease. importantly vaccination with dhfr - ts knockout parasites elicited substantial protective immunity, as mice were resistant to subsequent challenge with virulent l. major. although further experiments in nonhuman primate models failed to show protection these initial studies provided proof of principle for the safety and immunogenicity of live attenuated leishmania vaccines. drug - sensitive leishmania mutants containing suicide genes [139141 ] are also being developed for use during leishmanization, and inducible suicide mutants in l. amazonensis have shown protective efficacy in an experimental hamster model. to date, only a small number of studies have focused on generating attenuated forms of the vl species l. infantum and l. donovani as a route to the production of an attenuated vl vaccine. one approach has targeted the transporters for the metabolic precursors of the folate pathway, as leishmania parasites are auxotrophic for folate and pterin. l. donovani parasites lacking the main biopterin transporter (bt1) showed a marked reduction in infectivity in an experimental mouse model, and this attenuated strain conferred protection to subsequent challenge with wild - type l. donovani. parasites incapable of intracellular reproduction were produced by targeting centrin, a calcium binding cytoskeletal protein. a loss of centrin from l. donovani parasites did not affect the growth of promastigote forms, but null mutants were unable to survive as axenic amastigotes or in human macrophages in vitro. immunization of mice and hamsters by infection with centrin deficient l. donovani protected against virulent homologous challenge. importantly the centrin null vaccine strain elicited parasite - specific th1 responses which strongly correlated with sustained protection and also induced a level of cross protection against l. braziliensis infection. deletion of one allele of the l. infantum silent information regulatory 2 (sir2) locus was sufficient to prevent amastigotes from undergoing intracellular replication in macrophages. immunization with l. infantum lacking one sir2 gene copy elicited strong parasite - specific t cell responses and conferred complete protection against virulent challenge in a vl mouse model. other approaches to developing live attenuated parasites as vl vaccines have utilised nonpathogenic leishmania species, an approach comparable to the use of bcg as a vaccine against mycobacterium tuberculosis infection. the lizard protozoan parasite l. tarentolae has never been found to be associated with any human leishmaniasis and is considered nonpathogenic. whilst l. tarentolae is capable of infecting mammalian cells and transforming into amastigotes, the parasite does not cause clinical symptoms of disease in either mouse or hamster models. in experimental vaccine trials l. tarentolae elicited a strong th1-driven protective immune response and conferred protection against infectious challenge with l. donovani in a susceptible mouse strain. the use of l. tarentolae as a vaccine vector to deliver specific leishmania antigens in the context of a live infection has also been explored. the l. donovani a2 antigen was expressed in l. tarentolae, which normally lacks this protein and used as a vaccine strain in an experimental mouse model. vaccination protected susceptible mice against l. infantum challenge and was associated with the production of high levels of ifn- production. the use of live attenuated vaccines provides a promising vaccination strategy for vl ; however safety issues regarding the use of genetically attenuated parasites as vaccines still need to be addressed. many of the proposed live attenuated vaccines induce long - lasting immunity to reinfection by maintaining a low level asymptomatic infection. the establishment of subclinical infection is particularly valuable as the persistence of antigen is thought essential for the generation of effective memory responses to leishmania. however reactivation of leishmania has been observed in patients who are immunocompromised, such as following hiv infection, thus the safety of attenuated parasites that induce a subclinical infection will need to be carefully assessed. transgenic parasites provide an enticing lead for vaccine development. a continuing synergy between molecular and immunological approaches to in addition, transgenic parasites are invaluable tools for understanding host - parasite interactions and inform vaccine design by providing insight into immunity and pathogenesis during vl. preventive vaccines are recognized as the best and most cost - effective protection measure against pathogens and save millions of lives across the globe each year. leishmania vaccine development has proven to be a difficult and challenging task and is hampered by an inadequate knowledge of disease pathogenesis, the complexity of immune responses needed for protection, and the cost of vaccine development. the burden of vl is concentrated in resource poor nations, and a lack of political will and philanthropic investment further aggravates the situation. however, the rise of biotechnology industries in endemic countries, such as india, may provide an impetus for vl vaccine development and investment. a recent clinical trial in india assessed the safety and immunogenicity of the leish - f1+mpl - se vaccine which is the only second - generation vaccine currently in clinical development for human vl. there are currently several new european - based vl vaccine efforts including a synthetic vaccine rapsodi (http://www.fp7-rapsodi.eu/), a dna - based leishdnavax (http://www.leishdnavax.org/), and an adenovirus vectored therapeutic vaccine (paul kaye, personal communication). new adjuvants are also being developed, and there are several clinical vaccine trials in progress and in planning. given the rapid progress in the fields of parasite immunology and genomics, a successful anti - leishmania vaccine should be achievable sooner rather than later. there is a clear need for greater investment in research and development to move promising vaccine leads along the development pathway toward an effective, affordable vl vaccine. | leishmaniasis is a neglected disease resulting in a global morbidity of 2,090 thousand disability - adjusted life years and a mortality rate of approximately 60,000 per year. among the three clinical forms of leishmaniasis (cutaneous, mucosal, and visceral), visceral leishmaniasis (vl) accounts for the majority of mortality, as if left untreated vl is almost always fatal. caused by infection with leishmania donovani or l. infantum, vl represents a serious public health problem in endemic regions and is rapidly emerging as an opportunistic infection in hiv patients. to date, no vaccine exists for vl or any other form of leishmaniasis. in endemic areas, the majority of those infected do not develop clinical symptoms and past infection leads to robust immunity against reinfection. thus the development of vaccine for leishmania is a realistic public health goal, and this paper summarizes advances in vaccination strategies against vl. |
dynamic rna nanotechnology based on programmable hybridization cascades with small conditional rnas (scrnas) offers a promising conceptual framework for engineering programmable conditional regulation in vivo. while single - base substitution (sbs) somatic mutations and single - nucleotide polymorphisms (snps) are important markers and drivers of disease, it is unclear whether synthetic rna signal transducers are sufficiently programmable to accept a cognate rna input while rejecting single - nucleotide sequence variants. here, we explore the limits of scrna programmability, demonstrating isothermal, enzyme - free genotyping of rna sbs cancer markers and snps using scrnas that execute a conditional hybridization cascade in the presence of a cognate rna target. kinetic discrimination can be engineered on a time scale of choice from minutes to days. to discriminate even the most challenging single - nucleotide sequence variants, including those that lead to nearly isoenergetic rna wobble pairs, competitive inhibition with an unstructured scavenger strand or with other scrnas provides a simple and effective principle for achieving exquisite sequence selectivity. |
|
the formation of cysts in the jaws possesses unique features regarding their pathology and implicates the odontogenic tooth - forming apparatus. in most classification schemes odontogenic cysts are divided in two major categories, namely the developmental cysts and the cysts that are initiated in areas of acute or chronic inflammation, with odontogenic keratocysts (okc) and periapical or radicular cysts (pacs) as the most common types, respectively. the world health organization (who) reclassified okc in its 2005 edition of histological classification of odontogenic tumours and according to this reclassification, the okc is now considered as a kcot. it is defined as a benign uni- or multicystic, intraosseous tumour of odontogenic origin, with a characteristic lining of parakeratinized stratified squamous epithelium that bears the potential for aggressive, infiltrative behaviour, a term that better reflects its neoplastic nature. several factors form the basis of this decision : a. the clinical behaviour of the lesion, since kcot is locally destructive and highly recurrent, b. the histopathologic characteristics, considering that the basal layer of the kcot budding into connective tissue, in addition to the mitotic figures that are frequently found in the suprabasal layers [1,3 - 5 ], and finally c. genetic alterations, are the most important parameters. they occur most commonly in the mandible, especially in the posterior body and ramus regions. it may be solitary or multiple and the latter is usually characterizing the inherited nevoid basal cell carcinoma syndrome nbccs. kcots have a high recurrence rate, ranging between 25% and 60% while when associated with nevoid basal cell carcinoma syndrome nbccs or gorlin - goltz syndrome, the recurrence rate is about 82%. so far, there is only limited evidence regarding the pathogenesis of the developmental cystic neoplasms of the jaws and for this reason they are considering of unknown aetiology. the endoplasmic reticulum (er) is an organelle with a major role in the synthesis of lipid and proteins and leads many cellular processes such as organogenesis, transcriptional activity, stress responses, and apoptosis [10 - 14 ]. er is responsible for the proper folding of the newly synthesized proteins that is facilitated with the assistance of various er chaperones. unfolded or malfolded proteins are disposed by mechanisms implicating er - associated protein degradation (erad). when the amount of unfolded protein exceeds the folding capacity of the er, human cells activate a homeostatic defence mechanism designated as the upr that follows er stress [11 - 16 ]. among the various consequences of upr is also the upregulation of bip / grp78 and of other chaperones that is considered diagnostic for the induction of er stress in a given tissue [16 - 18 ]. bip / grp78 binds to the hydrophobic region of unfolded proteins via a substrate - binding domain and facilitates folding through conformational change evoked by the hydrolysis of atp by the atpase domain. high mannose type oligosaccharide is attached en bloc to most proteins synthesized in the er, and then trimmed sequentially [21 - 23 ]. when two glucose residues are trimmed by glucosidase i or ii and the protein contains only one glucose residue, calnexin and calreticulin bind and fold the client protein. when the last glucose residue is trimmed by glucosidase ii, the client is released from calnexin and calreticulin, and binds to udp - glucose - glycoprotein glucosyltransferase. if the protein is folded properly, it is released from the enzyme and transported to the golgi apparatus. if it is not folded appropriately, udp - glucose - glycoprotein glucosyltransferase attaches one glucose residue and returns it to calnexin and calreticulin. calnexin and calreticulin share a similar molecular structure and function, although they are transmembrane and luminal proteins, respectively. considering the neoplastic nature of kcots, in combination with their poorly defined aetiology we explored if er stress is involved in disease development. specifically, we evaluated the expression of the chaperones, bip / grp78 and calnexin in a panel of kcots as compared to pacs and fbs. both of these markers is considered to accurately reflect the induction of er stress which has been associated with neoplastic development. paraffin - embedded tissue specimens of kcots (24 cases), pacs (9 cases) and fibromas (5 cases) were randomly selected from the archives of the department of oral pathology, of the national and kapodistrian university of athens, dental school spanning the years 2006 - 2011 and were analyzed by immunohistochemistry. we have analyzed the expression of chaperones bip / grp78 and calnexin in a panel of 24 kcots and 9 pacs. in addition we have also included in our analysis 5 fbs as controls since they represent lesions of the connective tissue devoid of pathological findings in the epithelium. details of ethics approval no ethical issues are related to this study since only paraffin - embedded archival material has been used and no data related to the patients clinical records have been disclosed. therefore the study did not require review by the institutional review board of the university of athens. immunohistochemistry was carried out in formalin fixed, paraffin embedded tissue specimens. the antibodies used were monoclonal rabbit anti - bip (c50b12), by cell signaling technology ; 1:100 and monoclonal mouse anti - calnexin (sc-46669), by santa cruiz biotechnology, santa cruz, ca, usa ; 1:75. immunostaining was performed by using the superpicture polymer (dab) kit (novocastra), following the manufacturer s instructions. before evaluation specimens were evaluated blindly from two authors of the study (i.c., pathologist and s.m. the positive immunohistochemical staining, was graded semiquantitatively by using a 5-tier scoring system and classified according to the intensity of the labelling as : negative (-), marginal (+ /-), mild (+), moderate (+ +) and intense (+ + +). in all specimens analyzed and for both antigens, immunopositivity was relatively homogenous among cells and varied only in terms of intensity. as shown in table 1, bip / grp78 immunopositivity was detected in 18 out of 24 (75%) kcots.) in one sample, mild (+) in 10, moderate (+ +) in 6 and very intense (+ + +) in one specimen. with the exception of 3 specimens exhibiting moderate or very intense immunopositivity and at which bip / grp78 expression was primarily localized in the upper layers of the epithelium (figure 1a), in all other cases bip / grp78 immunopositivity spanned full thickness of the epithelium (figure 1b). as opposed to kcots, pacs exhibited bip / grp78 immunopositivity in only 1 out of 9 (13%) cases (figure 2a) while all five fbs were negative for bip / grp78 expression (figure 2b) suggesting that the overexpression of bip / grp78 in kcots was statistically significant (p < 0.001, x - test). immunohistochemical expression of bip / grp78 in keratocystic odontogenic tumours (x10). (a) brown colour (dab) indicates staining in the upper layers of the epithelium or (b) in the full thickness with stronger intensity in the upper layers. weak counterstaining with haematoxylin was performed in all samples following immunostaining (original magnification x20). the microphotograph shows negative staining for bip / grp78 in the epithelium of periapical cyst (a) and negative staining for calnexin in the epithelium of a fibroma (b). weak counterstaining with haematoxylin was performed in all samples following immunostaining (original magnification x20). our results that are summarized in table 1 show that calnexin expression is significantly higher (p < 0.001, x - test) in kcots since it was expressed in 11 out of 24 kcots (46%) but only one out of 9 (13%) pacs and none of the 5 fbs analyzed.) in 5, mild (+) in 5 and moderate (+ +) in one specimen while the single pac that was positive for calnexin expression exhibited marginal immunopositivity. expression levels and localization of bip / grp78 and calnexin in kcots, pacs and fbs kcots = keratocystic odontogenic tumors ; pacs = periapical or radicular cysts ; fbs = fibromas ; ft = full thickness of the epithelium ; ul = upper layers ; ft / ul = full thickness with stronger intensity in the upper layers. in all but 3 cases that exhibited mild immunopositivity and was localized in the upper layers of the epithelium (figure 3a), calnexin expression was spanned the full thickness of the epithelium (figure 3b). (a) brown colour (dab) indicates staining in the upper layers of the epithelium or (b) in the full thickness. weak counterstaining with haematoxylin was performed in all samples following immunostaining (original magnification x20. considering that calnexin and bip / grp78 are both indicators of er stress we asked if their expression is correlated in the same specimens. indeed, out of the 38 specimens subjected to our analyses, 29 were either positive or negative for both antigens while only 9 exhibited expression for either bip / grp78 or calnexin. this observation confirms that bip / grp78 and calnexin are co - expressed (p < 0.001, x - test). in order to better understand the pathogenic mechanisms that underline the development of kcots we have hypothesized that er stress and the resulting upr may be associated with their onset. in order to test this hypothesis a bank of kcots specimens were analyzed by immunohistochemistry for the expression of bip / grp78 and calnexin, two widely used chaperones that are considered diagnostic for cells undergoing er stress [19 - 21,23 ]. the expression of bip / grp78 and calnexin in the kcots were compared to that in pacs that are cysts with distinct pathologic features and pathogenetic mechanism from that of kcots as well as in fbs at which the cell type affected does not involve the epithelium but rather the stroma. our results show a strong overexpression of the er stress markers bip / grp78 and calnexin in the kcots but not in the pacs and the fbs. furthermore, these two chaperones were frequently co - expressed in the same specimens, an observation that implies that the overexpression of bip / grp78 and calnexin was not coincidental but rather indicative for er stress induction and execution of the upr. it is conceivable that this feature of the kcots, namely the misexpression of keratin, is causatively associated with er stress. for reasons not yet well understood commitment to this keratinocyte differentiation program, may induce er stress and activate the upr. whether this is due to the ectopic overexpression of a specific protein such as keratin(s) or it is related to the perturbation of tissue homeostasis due to aberrant differentiation however, since neither pacs nor fbs display evidence of er stress it is likely that the latter is linked to kcots pathogenesis. consistently with this notion, recent findings showed that in the skin, at which keratinization represents a normal and physiological process, er stress - related chaperones bip / grp78 and hrd1 was elevated in cells of normal human epidermis that contain keratinocytes undergoing differentiation. these findings suggest that keratinization, either in its physiological context such as in the skin or in abnormal context such as in the kcots, are associated with er stress induction. furthermore, in the same study it has been demonstrated that pharmacological interference with the execution of the upr affected the differentiation of keratinocytes in vitro, providing further clues regarding the causative link between er stress and keratinocyte differentiation. our results are consistent with these findings and suggest that er stress is induced in the odontogenic epithelium when cells are committed to the keratinocyte differentiation program, during kcot development. this is also supported by the observation that especially bip / grp78 and to some extent calnexin immunopositivity was frequently more intense in the upper layers of the epithelium at which keratinization is more prominent. studies comparing the involvement of er stress to parakeratinized normal tissues, hyperplastic and precancerous / dysplastic lesions of the oral epithelium would bestow insightful understanding if bip / grp78 or calnexin may be involved in parakeratinization. indeed, a variety of diseases associated with aberrant keratinization, such as hereditary keratoses, including darier s disease, keratosis linearis with ichthyosis congenita and keratoderma syndrome, erythrokeratoderma variabilis, and ichthyosis follicularis with atrichia and photophobia syndrome, have been linked to upr. it could be argued that keratinization and thus er stress induction is irrelevant to the oncogenic stimulus that induces kcots development. however, to the extent that keratinization reflects aberrant differentiation of the cells and considering that neoplastic development is indeed a disease of aberrant differentiation, er stress is causatively linked to the disease development. the results of the present study may provide clues regarding the pathogenesis of kcots. which specific branches of upr are activated during kcot development and whether its inhibition is sufficient for the reversal of keratinization and regression of kcots remains to be explored. furthermore, it would be of particular interest to investigate the involvement of epithelial to mesenchymal transition - associated markers in the pathogenesis of kcot and their potential link to er stress. in view of recent findings linking mutations in ptch1 gene to kcots development, and considering that the ptch1 gene s product is a secreted ligand this is also supported by the ability of ptch1 to act on post er smo and to modulate its activity without affecting its overall expression levels. the detection of er stress and activation of the upr may have diagnostic value for kcot characterization especially in cases at which diagnosis is not clear especially in inflamed kcots at which infiltration of the epithelium by inflammatory cells masks their typical histopathologic characteristics, raising issues of differential diagnosis. more importantly, considering that er stress influences keratinocyte differentiation we may postulate that inhibition of upr may have adjuvant therapeutic value for the management of kcots, particularly those with aggressive behaviour and often recurrences, at which surgery is the treatment of choice. indeed, recently developed chemical chaperones that can inhibit specific branches of the upr may be beneficial for the therapy of kcots patients. this is the first demonstration of the involvement of endoplasmic reticulum stress in the pathogenesis of keratocystic odontogenic tumours. understanding the precise mechanism by which endoplasmic reticulum stress is involved the development of keratocystic odontogenic tumours may find application in the diagnosis and management of the disease. this study was supported by a research grant from the empeirikion foundation (granted to i.c.). | abstractobjectives odontogenic keratocysts (okcs) are developmental cysts that have been reclassified according world health organization (who), to keratocystic odontogenic tumours (kcots), a term that better reflects their neoplastic nature. the aim of present study is to evaluate the induction of stress of the endoplasmic reticulum and execution of the resulting unfolded protein response in keratinocystic odontogenic tumours.material and methodswe analyzed by immunohistochemistry the expression of the chaperones bip / grp78 and calnexin in 24 cases of kcots. as controls, we have used 9 cases of periapical or radicular cysts (pacs) and 5 cases of fibromas (fbs). the pacs and the fbs were included in the analysis, as pacs are the most common type of inflammatory odontogenic cysts of and fbs, as lesions of the connective tissue with unaffected epithelium.resultsanalysis revealed a strong association between both bip / grp78 and calnexin expression and kcots : 18 out of 24 (75%) kcots expressed bip / grp78 as opposed to 1 out of 9 (13%) pacs, and none of 5 fbs evaluated (p < 0.001, x2-test). calnexin was expressed in 11 out of 24 kcots (46%) but only one out of 9 (13%) pacs, and none of the 5 fbs analyzed (p < 0.001, x2-test).conclusionsstudy results imply that induction of endoplasmic reticulum stress maybe of diagnostic value in keratocystic odontogenic tumours characterization. in addition to recent findings suggesting that endoplasmic reticulum stress plays a causative role in keratinization of epithelia, pharmacological interference with the execution of the unfolded protein response should be considered for the management of keratocystic odontogenic tumours. |
predominantly found in the tendon sheaths or joints of the fingers and toes, and rarely in larger joints such as the knee or ankle.12 although localized nodular synovitis involving the infrapatellar fat pad has been occasionally reported,34 mechanical symptoms such as locking or restricted knee motion are rare, with vague anterior knee pain being the most common symptom.5 localized nodular synovitis of the knee is usually easily identified using arthroscopy and can usually be removed arthroscopically via conventional anterior portals.6 the present report describes a case of localized nodular synovitis arising from the infrapatellar fat pad. the lesion caused extension limitation due to impingement by the mass along the patellofemoral joint. arthroscopy required a superior - superior triangulation approach to identify and remove the mass because the mass and a thickened infrapatellar plica obstructed the anterior portal. a 24-year - old male presented with a 2-year history of pain in the left knee joint on terminal extension and extension limitation. the symptoms developed insidiously without any antecedent trauma. he reported discomfort when ascending stairs, and no pain at rest or in bed at night, nor any constitutional symptoms. an initial clinical examination revealed mild effusion but no clicking or localized joint line tenderness. tests for lachman 's sign, anterior drawer, pivot shift, and posterior drawer were all negative, indicating there was no knee instability. the knee joint was able to reach full flexion, but extension was restricted by 20. attempts to reach full extension resulted in severe anterior knee pain. sequential magnetic resonance image (mri) scans were performed, and t1-weighted images revealed an oval shaped well - defined mass of intermediate signal intensity that lay superior to the infrapatellar fat pad and in between the distal half of the retropatellar region and the distal femur trochlea [figure 1a ]. t2-weighted images showed that the mass was inhomogeneous and had relatively high signal intensity with hypointense areas. the mass was connected to a fibrotic thickening of the infrapatellar plica which traversed the fat pad [figure 1b ]. (a) t1 weighted image showing the well - defined oval - shaped mass with intermediate signal intensity located superior to the infrapatellar fat pad and between the distal half of the retropatellar region and the distal femur trochlea. (b) t2 weighted image showing that the mass appears as inhomogeneous, and with relatively hyperintense signal intensity with hypointense areas. note the fibrotic thickening of the infrapatellar plica (white arrows) which traverses the fat pad and connects to the mass an arthroscopic examination and excision biopsy were performed. however, we found it very difficult to insert the arthroscope into the joint via those portals due thick soft tissue. we suspected that an extensively hypertrophied infrapatellar plica had adhered to the mass. to overcome the problems associated with those obstructions the superolateral portal view revealed a well - encapsulated, round pan - shape nodular brownish mass that extended upward and entered the patellofemoral joint upon joint extension so as to prevent full extension. that mass retracted when the joint was flexed greater than 30 [figure 2a and b ]. those arthroscopic findings were consistent with the severe pain experienced on terminal extension and the extension limitation of the joint. we observed no damage to the cruciate ligament or menisci, nor did we observe articular cartilage without villous fronds. to remove the mass, we placed the knee at maximum extension such that the mass entered the patellofemoral joint, and then excised it using superior triangulation (i.e., a superolateral viewing portal and a superomedial working portal, or vice versa). after excision, we assessed whether the knee could be moved through a full range of movement, and simultaneously confirmed via arthroscopy that there was no longer any mass impingement into the joint or any joint locking signs. arthroscopic view showing the round, pan - shape nodular brownish mass impinged in between the patellofemoral joint at full extension (a) which then retracted when the knee was flexed at greater than 30 (b) peroperative photograph showing the gross appearance of the resected mass, with yellowish and fibrous cut surfaces histopathological examination of the mass revealed that it was composed of an admixture of osteoclast - type giant cells and mononuclear cells in a collagenous stroma. nuclear pleomorphisms and mitotic figures were rare, and there were no villous projections of the synovium, either macroscopically or microscopically [figure 4 ]. there were no postoperative complications, and the patient was discharged on postoperative day 2. at a 22-month followup, the patient was found to be pain - free and had a full range of knee motion with no evidence of recurrence. the patient was informed that data concerning the case would be submitted for publication, and he consented. note the admixture of osteoclast - type giant cells and mononuclear cells in a collagenous stroma. the present report describes the diagnosis and treatment of localized nodular synovitis in the infrapatellar fat pad which caused extension limitation and knee joint pain. the extension limitation appeared to be due to an infrapatellar fat pad mass being caught in the patellofemoral joint. the mass was identified and excised arthroscopically using superior - superior triangulation because access via standard anteromedial and anterolateral portals was obstructed by adhesions and hypertrophied soft tissue around the mass. localized nodular synovitis has often been identified as a giant cell tumor of the tendon sheath (gctts) since the two conditions share similar pathology. although some vagueness remains regarding the features that distinguish those two conditions, a review of the literature indicates that gctts is considered as an isolated discrete lesion found predominantly in the tendon sheaths or joints of the fingers and toes, whereas localized nodular synovitis is considered as a solitary intra - articular nodule arising from an area of abnormal synovium of a large joint such as the knee.78 those two disease entities differ from diffuse - type pigmented villonodular synovitis (pvns) which shows more aggressive pathology findings (i.e. diffuse frond - like projections of the synovium and abundant hemosiderin deposition3) and requires a complete synovectomy as well as mass excision as it has a higher recurrence rate compared to localized nodular synovitis or gctts. a retrospective review of 26 cases of localized nodular synovitis of the knee by dines.5 demonstrated that vague pain was the most common presentation complaint (92% of patients), whereas mechanical symptoms such as locking or restricted knee motion were rare. mechanical symptoms were found to occur more commonly in cases involving localized nodular synovitis of a large size that was sandwiched into a small space between joint structures such as the infrapatellar fat pad.4 however, although the infrapatellar fat pad is a common site for localized nodular synovitis,3 a large localized nodular synovitis in the fat pad does not always result in mechanical symptoms because the fat pad can tolerate significant volume changes such as those which occur during knee motion.9 if a meniscal tear can be completely excluded, the intra - articular cause of knee extension limitation associated with anterior knee pain or swelling usually originates from lesions of the infrapatellar fat pad area. possible differential diagnoses of our patient included a benign mass, such as an intraarticular [osteo ] chondroma, localized nodular synovitis, or fibroma of the tendon sheath ; a malignant mass such as a synovial sarcoma ; or hoffa 's disease.1011 our patient showed extension limitation and pain on full extension. an mri showed localized nodular synovitis located in the superior infrapatellar fat pad, and between the distal half of the retropatellar region and the trochlea of the distal femur. we believe that this site could be quite narrow at knee extension, and this may cause a bottleneck phenomenon since the contact area of the patellofemoral joint moves distally as extension increases.12 although patients with localized nodular synovitis have a better prognosis than patients with diffuse - type pvns, due to a much lower recurrence rate, the recurrence rate of localized nodular synovitis is still 10 - 20%.13 the major predictor of recurrence is the completeness of surgical excision.1 other potential risk factors include cell type, mitotic activity and radiological osseous erosion.14 recently, arthroscopic excision has been preferred to arthrotomy unless the mass is exceptionally big or is located in areas difficult to access arthroscopically.15 others report arthroscopic excision of localized nodular synovitis around the infrapatellar fat pad via a conventional anterior portal.1617 however, in our case, it was difficult to insert the arthroscopic camera through the anterolateral portal and locate the mass due to obstruction by a thickened edematous infrapatellar plica and an hypertrophied fat pad which adhered to the mass. although an arthroscopic approach through multiple portals can be utilized for complete excision, this approach is associated with a significant risk of inadequate excision and subsequent recurrence, particularly for lesions in the posterior compartment of the knee. therefore, open excision is more advisable for recurrent lesions.18 in conclusion, the present report shows that limitation of knee extension can be caused by the displacement into the patellofemoral joint of a localized nodular synovitis on the infrapatellar fat pad. in addition, we found that superior - superior triangulation can be a valuable approach for locating and excising an infrapatellar fat pad mass that is difficult to identify and excise via a conventional anterior portal due to an obstructed visual field. | we report a case of localized nodular synovitis of the infrapatellar fat pad impinging on the patellofemoral joint causing limitation of extension. arthroscopy involved use of a superolateral portal because location of lesion hindered access via a conventional anterior portal. the infrapatellar mass impinged in the patellofemoral joint upon knee extension and retracted upon flexion. superior - superior triangulation allowed for complete excision of the mass. |
malignant tumors of the exocrine pancreas occur mainly in adults in their sixth or seventh decade of life. they commonly present with late - stage disease, and have poor prognosis, even in cases with primary resectable disease. less frequent histologies include intraductal papillary mucinous neoplasms with transition to an invasive carcinoma, serous cystadenocarcinomas or acinar cell carcinomas. in children, malignant pancreatic tumors are exceedingly rare, and only few reports are available [1, 2, 3 ]. pediatric pancreatic tumors arise from embryonic precursor cells of ductal and acinar cells, and are termed pancreatoblastoma [3, 4 ]. due to the stem cell origin of the tumor cells, pancreatoblastomas can subsequently differentiate to various histologic tumor cell types. patients with pancreatic tumors often present with weight loss, jaundice, and varying abdominal symptoms due to the tumor mass effect. the treatment algorithm chosen usually depends on the type and stage of the respective tumor. an aggressive approach with complete tumor resection whenever possible seems to be the best primary option [2, 6, 7 ]. primary systemic chemotherapy may be useful to reduce the tumor mass and allow subsequent secondary resection. a 15-year - old boy presented in november 2009 with a 3.2-cm tumor of the head of the pancreas and multiple diffuse liver metastases (fig. liver and kidney function tests were within normal limits, serum alpha - fetoprotein (afp) was elevated (400 u / ml). biopsy of the liver mass revealed a malignant tumor with acinar cell differentiation, bringing up the differential diagnosis of acinar cell carcinoma, or a mixed tumor with acinar cell differentiation including pancreatoblastoma. chemotherapy was initiated with two cycles of cisplatin and doxorubicin (plado regimen), resulting in a partial response of the primary tumor and the liver metastases. based on the good response, a whipple duodenopancreatectomy and simultaneous wedge resection of the metastases of the left liver with ligation of the right portal vein were performed in march 2010. the metastases of the right liver lobe were resected by hemihepatectomy of the right liver, any other lesions in the remnant liver were removed by wedge resection. in addition, focally infiltrated parts of the diaphragm were also resected. altogether, this accounted for a surgical tumor reduction of about 90%. surgical pathology confirmed a mixed histology with differentiation of both, acinar cell carcinoma and ductal adenocarcinoma. some morphologic features of the primary liver biopsy also resembled an embryonic tumor, but the pathognomonic squamoid differentiation of pancreatoblastoma was missing. immunostaining was focally positive for afp in accordance with the initially elevated afp serum levels. tumor regrowth in the liver was observed on positron emission tomography / computed tomography (pet / ct) scan already 1 month after the second surgery. after subsequent second - line chemotherapy with two cycles of ifosphamide, carboplatin and etoposide (ice regimen), a partial remission of the liver lesions was documented. a living donor liver transplantation (right hemiliver) from his brother was performed in november 2010. due to a severe bile leak with abscess formation and finally hepatic artery thrombosis, the former was subsequently tapered within 3 months, and tacrolimus was changed to everolimus. in april 2011, multiple new lung metastases were detected while no tumor relapse was seen in the abdomen. therefore, in may 2011 a new chemotherapy treatment with oxaliplatin, irinotecan, leucovorin and 5-fluorouracil (folfirinox regimen) was started. the new treatment was tolerated well apart from neutropenia and thrombocytopenia up to grade 4, resulting in dose reductions of the applied compounds. after six biweekly cycles, pet / ct showed a complete metabolic and partial morphologic remission of all lung lesions (fig., we decided to consolidate with tandem high - dose chemotherapy using carboplatin, etoposide and paclitaxel as conditioning regimen with subsequent autologous stem cell transplantation (asct). hematopoietic progenitor cells were successfully mobilized with filgrastim, and high - dose chemotherapy was performed in november 2011 and february 2012. due to transiently elevated liver enzymes after the first high - dose treatment, etoposide was omitted in the second treatment to reduce the toxicity for the transplanted liver. in august 2012, a progression of the pulmonary lesions was documented in a routine follow - up pet / ct. treatment with folfirinox was once again initiated, resulting in a very good metabolic and morphologic remission after another six cycles until december 2012. chemotherapy was continued for 3 additional months. while all lesions except one remained responsive to the treatment, the latter lesion was treated with stereotactic irradiation using 3 12 = 36 gy. as of today, the patient has a sustained metabolic remission of the known lung lesions and no new lesions developed with repeated use of folfirinox. he is currently in excellent general condition and has no limitations of his quality of life. no standard treatment for exocrine pancreatic tumors in pediatric patients has been defined due to the rarity of this disease. accordingly, treatment decisions were based on guidelines and recommendations of the children 's cancer and leukaemia group (cclg) on the management of rare tumors like hepatoblastoma and pancreatoblastoma, as well as on treatment algorithms used in adult patients with pancreatic cancer. surgical resection of large tumor masses seems to be the best first - line therapy in resectable tumors, even when microscopically incomplete. recently, a successful treatment with high - dose chemotherapy and asct of a young patient with a pancreatoblastoma has been reported after incomplete primary resection. the few reported cases of high - dose chemotherapy and asct in young patients suggesting a benefit from aggressive multimodality treatment prompted us to perform tandem transplantation in our patient after observing good tolerability and an excellent response to initial standard dose chemotherapy [11, 12, 13 ]. predominantly, the primary tumor in the pancreas and most of the liver metastases showed a mixed acinar and ductal cell differentiation, while some liver lesions were predominantly of acinar cell type. in addition, some morphologic features of the liver lesions resembled pancreatoblastoma, although a typical squamoid differentiation of the tumor cells was lacking. one can speculate that this heterogeneous tumor may well have been a pancreatoblastoma with differentiation along various cell types, which could finally not be diagnosed due to the regressive changes of the tumor morphology after neoadjuvant chemotherapy. recently, the phenotype of a pancreatic carcinoma showing combined acinar cell and ductal differentiation was described and discussed as a possible distinctive tumor entity with an aggressive clinical course. irrespective of the diagnostic label, the tumor was regarded as malignant with mixed differentiation including acinar cell carcinoma, ductal adenocarcinoma, and blastomatous components, each associated with different biological behavior, respectively. firstly, despite the fact that advanced and metastatic pancreatic tumors are generally considered to have a dismal prognosis, an aggressive multimodal treatment strategy in young and fit patients may result in improvement of quality of life and survival. in addition, treatment with high - dose chemotherapy and subsequent asct was possible even after orthotopic liver transplantation. our patient is now in excellent condition without showing any clinical symptoms related to the tumor almost 4 years after the initial diagnosis. secondly, the repeated use of folfirinox may be highly active also in pancreatic tumors other than ductal adenocarcinoma. in our patient, the best response to systemic chemotherapy was achieved with folfirinox, although only given as third - line chemotherapy and despite the pretreatment with various other compounds. convincing data have been reported for the folfirinox treatment of adult patients with ductal adenocarcinoma of the pancreas in the first - line setting, but no data exist in pretreated patients with other rare tumor entities. our patient showed an excellent response even after repeated use of this treatment combination. in conclusion, folfirinox has proven to be a highly active chemotherapy regimen in this heavily pretreated patient and may be a very good alternative to older and more toxic regimens for the treatment of pediatric patients presenting with rare pancreatic tumors. | pancreatic tumors are rare in children and adolescents. here, we report the case of a 15-year - old boy who presented with a mixed acinar cell carcinoma / ductal adenocarcinoma with blastomatous components. he received multimodal treatment including various chemotherapy regimens and multistep surgery including liver transplantation. introduction of folfirinox after relapse repeatedly achieved a durable metabolic and clinical response with good quality of life. |
over the last 15 years, laparoscopy has been inexorably integrated into urologic practice. however, during this transition period, urologic training programs are only now beginning to provide systematic and fundamental minimally invasive surgery (mis) training to residents. additionally, there remains a significant proportion of practicing urologists who have limited laparoscopic experience, but who wish to add this to their therapeutic armamentarium. the road to laparoscopic expertise involves a steep and prolonged learning curve, which may discourage physicians from undertaking this challenge [1, 2 ]. with the advent of modern technology, surgical robotics have come of age and now represent a viable solution to technically complex mis [35 ]. the benefits of robotic assistance over conventional laparoscopy including increased degrees of freedom, elimination of tremor, 3d visualization, and motion scaling have proved so advantageous as to introduce the possibility of mis without laparoscopic training [6, 7 ]. in a similar vein, the impact of advanced surgical technologies on surgeons of varying mis skills has not been evaluated previously. just as laparoscopy has been integrated into training programs, as surgical robotics becomes more common, the question of how these advanced platforms influence surgical education for future trainees needs to be addressed. with the proliferation of robotic technology, should trainees expect to learn robotic skills rather than conventional laparoscopy ? in the personal computer world, we have come to expect technological leaps at every quarter, as advances in miniaturization and engineering efficiency continue apace. computational speed does not equal power, however, as architecture and design have been found to be significant and limiting factors, and more evidence - based metrics were developed to suit these purposes. analogous to this phenomenon, surgical robotics is a burgeoning field with limitless potential for the future. standard, validated, objective evaluations have not yet been widely adopted to evaluate their performance, and this remains a limiting factor in their comparisons. as well, task - specific robotics further complicates comparisons, as one robot may not be suited to all tasks. in an effort to evaluate the surgical performance of different advanced surgical platforms in standardized tasks we compared standard laparoscopy, zeus (computermotion, sunnyvale, ca) surgical robot and davinci (intuitive surgical, sunnyvale, ca) surgical performance across varying operator skill levels. between april 2004 and june 2005, 12 participants were recruited to the study : four staff surgeons with laparoscopic expertise (laparoscopic aneurysm repair, pyeloplasty, cholecystectomy), four senior level postgraduate trainees (pgy) with moderate levels of laparoscopic training, and four laparoscopic nave medical student interns (msi). thirty - minute acclimation sessions on each platform were allowed prior each study trial for all study groups. each participant was required to complete four trials each of two standardized drylab modules : suturing and knot tying with 5 - 0 prolene sutures (fig. 1) on each of the three test platforms (lap, zeus, davinci). the suture task consisted of driving the needle through dots spaced 3 mm apart on a latex sheet, then running the suture six passes through consecutive dot series. the knot - tying task consisted of an identical setup ; however, instead of running the suture, the participants were required to throw three half hitches to knot the prolene suture. introduction to the tasks were allowed, as were informal practice task runups to the trial. following completion of the task on each platform, participants filled out surveys designed to subjectively score system performance in eight domains : visualization, fluidity, efficacy, precision, dexterity, tremor, tactile feedback and coordination. this survey was developed in - house through review of the current literature as well as interviews with experts in the field. cstar is currently working towards validating this tool for future minimally invasive clinical trials. participants were required to pass a 5 - 0 prolene suture immediately into and out of the adjacent marked dots spaced 3 mm apart on a latex sheet, and run six passes through consecutive dot series. setup is identical for knot - tying tasks ; however, participants are required to drive one pass of a 5 - 0 prolene suture through adjacent marked dots, followed by three throws of a half - hitch knot drylab module setup for suturing skills. participants were required to pass a 5 - 0 prolene suture immediately into and out of the adjacent marked dots spaced 3 mm apart on a latex sheet, and run six passes through consecutive dot series. setup is identical for knot - tying tasks ; however, participants are required to drive one pass of a 5 - 0 prolene suture through adjacent marked dots, followed by three throws of a half - hitch knot a standard black box laparoscopic simulator was used for these experiments consisting of a plexiglass enclosure with three ports on the angled upper surface for one laparoscope and two working ports. for conventional laparoscopy zeus and davinci trials were conducted in a similar fashion, placing the robotic laparoscope and working elements through their respective ports on the simulator. a hollow aluminum block with one face cut off an ic chip was recruited for the template to generate the target rows of ink dots on the latex sheet. twelve - centimeter lengths of 5 - 0 prolene suture were used for all tasks in this study. endowristed continuous variables were analyzed using single - sided unpaired student 's t - tests, and categorical variables from likert scales were analyzed using kruskal all participants completed all tasks for the study. overall platform performance times and errors are illustrated in fig. 2a, b. zeus robot - assisted tasks demonstrated significantly inferior performance compared to conventional laparoscopy and davinci platforms in both task times (suturing : 485.7 s vs 302.0 vs 156.7 s ; knot tying : 456 s vs 183.7 s vs 93.5 s, respectively) and task errors (suturing : 12 vs 5 vs 2 ; knot tying : 12 vs 4 vs 1, respectively ; p < 0.05). fig. 2 a overall platform performance times for suturing and knot - tying modules. zeus assisted task times were significantly longer compared to conventional laparoscopy and davinci platforms for both suturing and knot - tying tasks. a trend towards significance was demonstrated in task performance times between davinci and laparoscopy (p < 0.05, p < 0.05). zeus - assisted task errors were significantly more numerous compared to conventional laparoscopy and davinci platforms for both suturing and knot - tying tasks. a trend towards significance was demonstrated in task performance errors between davinci and laparoscopy (p < 0.05, p < 0.05) a overall platform performance times for suturing and knot - tying modules. zeus assisted task times were significantly longer compared to conventional laparoscopy and davinci platforms for both suturing and knot - tying tasks. a trend towards significance was demonstrated in task performance times between davinci and laparoscopy (p < 0.05, p < 0.05). zeus - assisted task errors were significantly more numerous compared to conventional laparoscopy and davinci platforms for both suturing and knot - tying tasks. a trend towards significance was demonstrated in task performance errors between davinci and laparoscopy (p < 0.05, p < 0.05) when stratified by skill level, suturing task performance paralleled overall platform performance in that zeus robotic - assisted procedures were lengthy and introduced more task errors than either the laparoscopic or davinci platforms. these findings were most significant at the msi skill level, and incremental loss of significance between platforms was observed with increasing skill level (fig. the zeus robotic platform demonstrated significantly inferior times compared with laparoscopic and davinci platforms across skill levels. however, with increasing surgeon skill, there is an incremental loss of significant performance time benefit seen with laparoscopic and davinci platforms (p < 0.05, p < 0.05). the zeus robotic platform demonstrated significantly higher error rates compared with laparoscopic and davinci platforms across skill levels. in a similar fashion as to performance times, surgical experience appears to blunt the significance of platform dependence (p < 0.05, p < 0.05) a suturing task performance times stratified by skill level of participant. the zeus robotic platform demonstrated significantly inferior times compared with laparoscopic and davinci platforms across skill levels. however, with increasing surgeon skill, there is an incremental loss of significant performance time benefit seen with laparoscopic and davinci platforms (p < 0.05, p < 0.05). b suturing task performance errors stratified by skill level of participant. the zeus robotic platform demonstrated significantly higher error rates compared with laparoscopic and davinci platforms across skill levels. in a similar fashion as to performance times, surgical experience appears to blunt the significance of platform dependence (p < 0.05, p < 0.05) in a similar analysis, knot - tying task performance stratified by skill level again demonstrated the inferiority of the zeus platform compared to conventional laparoscopy and davinci. with knot - tying task times, significant differences were observed across skill levels ; however, knot - tying errors demonstrated significance with msi and pgy trainees only (fig. davinci robotic - assisted knot - tying times were significantly shorter compared to laparoscopic and zeus - assisted platforms (p < 0.05, p < 0.05). b knot - tying errors stratified by skill level of participant. this trend was maintained across msi and pgy skill levels, but lost when staff surgeons performed this task a knot - tying task times stratified by skill level of participant. davinci robotic - assisted knot - tying times were significantly shorter compared to laparoscopic and zeus - assisted platforms (p < 0.05, p < 0.05). b knot - tying errors stratified by skill level of participant. this trend was maintained across msi and pgy skill levels, but lost when staff surgeons performed this task overall subjective assessment by platform demonstrated a significant benefit to the davinci platform versus both zeus and conventional laparoscopy. analysis of subjective data by individual domains grouped by skill level is shown in fig. the degree of conformity of the data across platforms increased except for the domain tactile feedback, which increases in disparity. fig. 5 a c subjective assessment of surgical platform across eight domains stratified by platform type for msi, pgy, and staff study participants. note that likert scores ranged from 0 to 10 where 0 was the worst possible score, and 10 was the best (p < 0.05) a c subjective assessment of surgical platform across eight domains stratified by platform type for msi, pgy, and staff study participants. note that likert scores ranged from 0 to 10 where 0 was the worst possible score, and 10 was the best (p < 0.05) as technology continues to be refined in the setting of advanced mis platforms, the previously daunting task of introducing laparoscopic approaches into established practices is becoming increasingly facile. the question of whether increasing surgical experience can facilitate this process while foregoing formal laparoscopic training has so far been unanswered. additionally, although a single surgical robotic platform dominates the market at this point, head - to - head comparisons of existing technologies across surgical skill levels has not been examined [1012 ]. we show in this study that not all robotic platforms are created equal in their impact on surgical performance and surgeon preference. the davinci robotic assistant outperformed both zeus and conventional laparoscopy in all task times and error rates as well as proving subjective superiority. the increased degrees of freedom, enhanced visualization provided by binocular laparoscopic vision, smooth motion scaling and translation, as well as ergonomically superior controls combined to provide a stable, consistently efficacious platform for task performance regardless of skill level. the zeus robotic platform scored subjectively and objectively worse in all areas than the davinci platform or laparoscopy. with increasing surgical experience, however, the negative effects associated with zeus assistance were reduced. conventional laparoscopy fell somewhere in between these results with most participants yielding better performance than with the zeus platform and inferior performance than with the davinci platform in all tasks. the finding that msi participants performed worse in zeus trials versus conventional laparoscopy is interpreted as a result of removing two degrees of freedom, a lack of tactile feedback, and 2d visualization with inexperienced surgeons. additionally, the zeus operating platform provides restrictions on arm movement in terms of radii that are traversable at each joint, a generally unrefined human - machine interface, and poor visualization. the combination of these factors seems to impact the operator more if the subject lacks surgical experience, as it represents additional complexities to be overcome in completing the task at hand. operator compensation can occur for deficits of platform functionality as seen in correlating pgy and staff trials, but this appears to be a learned behavior. machine interface is a crucial component of any new surgical technology, as the inability to realize the full potential of the technology at hand will result in frustration and poor adoption. all subjective scoring in the msi group demonstrated davinci superiority across domains except in tremor reduction and coordination, although a trend towards significance was found. the lack of surgical experience may have led to the finding of non - significance in the domain of tactile feedback in the msi group who may not yet appreciate the subtleties of surgery. the pgy group demonstrated significant differences across all subjective domains in favor of the davinci platform, except in tactile feedback in which laparoscopy was superior. this was the predicted result of senior pgy trainees who were operating on a daily, continuous basis with some sensitivity to the tools of the trade. finally, experienced staff surgeons were indifferent as to platform preference except in demonstrating a preference for laparoscopy in the domain of tactile feedback. again, this is the expected result as experienced surgeons likely had the technical knowledge to surpass deficiencies of platform dependence noting only the most obvious of inequalities. historically, surgeons have relied on the sense of touch to provide invaluable direction during surgery ; however, current robotic systems do not yet have integrated haptics to provide feedback to the surgeon at the console. while this deficiency is observed in the results of the subjective scoring in this study, it is not borne out in the objective results of task times or errors. this is likely because the in vitro model is too simplistic in nature to mimic the tissue planes, tensile fragilities, and their complex interactions found in vivo. even without the ability to provide force - feedback, the davinci robot excelled at suturing and knot tying without increased error rates secondary to tearing of the latex membrane. the effect of surgical experience was also examined in this study and demonstrated globally improved performance with increasing experience. if the gold standard is considered the staff experience with each platform, then we can see that the graduation of surgical experience from msi to pgy to staff decreases the learning curve of the skill, whereas the platform type dictates the overall difficulty level of the task. analysis of performance trends across repeated trials again demonstrated quicker skills acquisition and earlier plateau with increasing surgical experience. the most inexperienced participants produced more random results with respect to skills adaptation, an indicator of the steep learning curve, confirmed by the correspondingly prolonged task times. our study suggests that increasing surgical experience can negate the significant effects of platform advantage, which explains why highly proficient surgeons whether in open, laparoscopic or robotic arenas may report equivalent results of similar surgeries with different approaches. our study also implies that experienced laparoscopic surgeons can recruit the davinci platform with a short learning curve and utilize it to facilitate more complex procedures not otherwise feasible through pure laparoscopy. even with procedures currently performed through pure laparoscopic means, we support the possibility that in experienced hands, davinci robotic assistance can facilitate or improve on these operations as well. in terms of surgical education, this study demonstrates the significant benefits of davinci robotic assistance in task performance across trainee skill levels. it also highlights the fact that while performance is enhanced, there is a narrow range in which the most technologically advanced platform is superior to conventional laparoscopy. while some might argue that with increasing task complexity, one would see a concomitant increase in the difference between these two systems, in all likelihood there remains a baseline performance function for each platform, for which surgical experience alone may make up the difference. a search of the current literature regarding surgical robotics elicits numerous studies comparing laparoscopy to one or another robotic platform, but few which compare all three directly in terms of task performance [1315 ]. as well, results from these studies are at odds with each other with similar platform comparisons. this is likely a function of the fact that the zeus surgical system has undergone several revisions since its introduction, and as a result, its performance has likely been improved. however, as mentioned previously, this model may be overly simplistic to account for the multifactorial environment of operating in vivo. as well, subjective scoring was carried out using an in - house developed survey, which was constructed in a standard manner, however, not validated on a separate dataset. our group in the canadian surgical technology and advanced robotics (cstar) facility at our center is currently constructing a validated subjective tool to assess platform performance. additionally, the results of this study only imply that robots may benefit the experienced surgeon in practice who is laparoscopically nave. as senior residents were used as the comparator to trained mis surgeons, this remains a limitation of this study. in summary, we confirm the results of previous literature documenting the inferior performance of zeus robotic surgical system versus laparoscopy as well as demonstrate that the davinci surgical platform is superior to conventional laparoscopy for both task performance and usability. in fact, in finding the zeus platform inferior to conventional laparoscopy, this reinforces the notion that as new technologies are introduced into the surgical armamentarium, each must be carefully and comprehensively evaluated in the provision of benefit over established means. | laparoscopy has found a role in standard urologic practice, and with training programs continuing to increase emphasis on its use, the division between skill sets of established non - laparoscopic urologic practitioners and urology trainees continues to widen. at the other end of the spectrum, as technology progresses apace, advanced laparoscopists continue to question the role of surgical robotics in urologic practice, citing a lack of significant advantage to this modality over conventional laparoscopy. we seek to compare two robotic systems (zeus and davinci) versus conventional laparoscopy in surgical training modules in the drylab environment in the context of varying levels of surgical expertise. a total of 12 volunteers were recruited to the study : four staff, four postgraduate trainees, and four medical student interns. each volunteer performed repeated time trials of standardized tasks consisting of suturing and knot tying using each of the three platforms : davinci, zeus and conventional laparoscopy. task times and numbers of errors were recorded for each task. following each platform trial, a standardized subjective ten - point likert score questionnaire was distributed to the volunteer regarding various operating parameters experienced including : visualization, fluidity, efficacy, precision, dexterity, tremor, tactile feedback, and coordination. task translation from laparoscopy to zeus robotics appeared to be difficult as both suture times and knot - tying times increased in pairwise comparisons across skill levels. |
testicular microlithiasis (tm) is an uncommon pathologic condition that is commonly diagnosed by scrotal ultrasonography. the characteristic ultrasound (us) appearance of tm involves multiple bright foci, 1 to 2 mm in diameter, that are limited to the testicles. there is little or no acoustic shadowing, and microliths are either randomly distributed throughout the testicle or limited to only part of the testicle. tm has been seen in patients with testicular malignancy or various nonmalignant entities such as cryptorchidism, varicoceles, testicular torsion, klinefelter 's syndrome, pulmonary alveolar microlithiasis, neurofibromatosis, aids, intratubular germ cell neoplasia, and most frequently, infertility. the clinical importance of tm arises from its possible association with testicular cancer and infertility [3,5 - 8 ]. priebe and garret first reported the phenomenon in 1970, after seeing bilateral, diffuse testicular calcification on a pelvic x - ray of a 4-year - old boy. since then, other authors have tried to link pathological findings of testicular calcification in testicular tumors and infertility to the us diagnosis of tm. despite these reports, however, the relationship between tm and testicular cancer and infertility has been largely anecdotal and without predictive value. the lack of current proven follow - up strategies for patients with tm basically stems from ignorance of the exact prevalence of symptomatic and asymptomatic populations and ambiguity in the cause - effect relationship of tm with other potentially associated conditions. the objectives of the present study were as follows : (1) to report the prevalence of tm in a symptomatic population from the republic of korea who were undergoing testicular ultrasonography ; (2) to identify associated pathologic entities, especially testicular cancer and infertility ; (3) to evaluate the role of further tm grading in the prevalence of associated testicular cancer ; and (4) to study the seminal profile of tm patients. scrotal ultrasonography was done in longitudinal and transverse sections by using a scanning device with a high - frequency linear array transducer and a center frequency of 14 mhz (siemens acuson sequoia 512 system, germany). in patients without infertility, the indications for us were scrotal signs and symptoms such as palpable mass, pain, and swelling. all pathologic entities of patients who had undergone us were recorded. to identify possible associations with tm, analysis was performed by retrospective review of the medical records and us images. we defined tm as multiple (more than 2) calcifications smaller than 2 mm (no acoustic shadowing) inside the testicular parenchyma on us. the presence of tm, the number of lesions, the involvement of both testicles in relation to symptoms, and the coexistence of other lesions were studied. patients with tm were divided as follows : 3 or 4 microliths = limited (fig. we also recorded laterality of tm in addition to grade. in cases of testicular cancer accompanying tm, this analysis included sperm count, motility, morphology, and white blood cell (wbc) count. categorical variables were compared by chi - square test and a student 's t - test was used for comparison of seminal profile. of the 1,439 patients (mean age, 19.120.2 years ; range, 0 - 87 years) who underwent scrotal us during the study period, various pathologic findings were found such as testicular cancer (n=57, 4.0%), hydrocele (n=547, 38.0%), cryptorchidism (n=310, 21.5%), epididymitis (n=199, 13.8%), varicocele (n=143, 9.9%), testicular atrophy (n=46, 3.2%) including epididymal cysts or dilation, testicular fibrosis, and normal manifestation (table 1). the mean age of these patients was 26.217.9 years (range, 0 - 74 years). among them, testicular cancer (n=15, 17.2%), hydrocele (n=31, 35.6%), varicocele (n=14, 16.1%), cryptorchidism (n=7, 8.0%), epididymal cysts (n=6, 6.9%), epididymitis (n=6, 6.9%), fibrosis, atrophy, inguinal hernia, and epididymal dilation were found. of the 87 patients with tm, 18 (20.7%) were found to have limited tm, 16 were grade 1 (18.4%), 26 were grade 2 (29.9%), 27 were grade 3 (31.0%), and unilateral and bilateral tms were detected in 28 (32.1%) and 59 (67.8%) patients, respectively. all detected tms were ipsilateral to the associated abnormalities. in 15 patients with testicular cancer and tm, the histopathologic diagnosis was classic seminoma in 6 patients, 6 mixed germ cell tumors, 2 teratomas, and 1 yolk sac tumor. all 15 patients with testicular cancer and tm had classic tm, which meant more than five microliths per transducer field. applying this to the grading system, it was found that there was no limited tm in testicular cancer with tm. of the 15 patients with testicular cancer and tm, grades 1, 2, and 3 consisted of 3 (20%), 7 (46.7%), and 5 (33.3%) patients, respectively (fig. there was no significant difference in the prevalence of testicular cancer between grades (p=0.72). among the us examinations performed in 60 patients, all established pathologic entities, only testicular cancer was meaningfully associated with tm (table 2). the prevalence of tm in testicular cancer was 26.3% (15/57) compared with 5.2% (72/1,382) in patients without testicular cancer (p<0.001). in 60 cases of infertility (mean age, 33.74.6 years ; range, 27 - 45 cases), 33 had varicocele (55%) and the rest had testicular atrophy, epididymal cysts, testicular fibrosis, and other afflictions. all patients showed abnormal semen quality in semen analysis according to world health organization criteria. among them, 10 cases were accompanied by tm, a prevalence rate of 16.7% (10/60) compared to 5.6% (77/1,439) in others (p=0.002) (table 2). of the 10, 5 were found to be limited tm, 1 was grade 1, 2 were grade 2, and 2 were grade 3 tm. there was no significant difference in the presence of other pathologies in those with or without tm (p=0.68). furthermore, seminal profiles (sperm count, motility, morphology, and wbc count) were not statistically different between infertile men with and without tm (table 3). testicular microlithiasis is a rare, asymptomatic finding suggested to be associated with various benign and malignant urological pathologies and genetic anomalies that are usually found incidentally during unrelated us examinations. doherty reported the first use of real - time us to diagnose tm. in the current study, the reported prevalence of tm has varied widely and has been generally presented as 0.5% to 9%. in their retrospective review of 1710 scrotal us scans, hbarth documented 11 cases of tm (0.6%) in a population undergoing examination for varicocele, hypogonadism, and epididymal cysts. in their retrospective review of 1,100 us scans performed for infertility, pain, or masses, ganem found tm in 2%. middleton reviewed us data from 1,079 patients at their institution and found a prevalence of 0.68%. this wide range partially comes from the recent introduction of high - frequency probes and the sensitization of radiologists and urologists to the problem. but much more importantly, the vast majority of studies have investigated patients examined for testicular pathology. virtually no true screening test for tm in an asymptomatic population has ever been performed except in two published reports. peterson performed screening us scans on 1,504 healthy nonsymptomatic males and reported a prevalence of 5.6%. more recently, serter found the prevalence of tm in an asymptomatic population to be 2.4% after screening 2,179 us scans. despite these findings, although the true incidence of tm is not yet known, tm has become a concern for the practicing urologist because of its possible correlation with testicular cancer. the coexistence of many benign and malignant pathologies with tm has been reported, and some authors have recognized that tm may be associated with a variety of nonneoplastic conditions, such as cryptorchidism, chromosomal anomaly, and atrophy. however, the most commonly held views in the literature are those that support a correlation between tm and testicular cancer. we retrospectively reviewed all us cases and evaluated whether there was any possible significant association between tm and pathologic entities. of all detected testicular pathologies, only testicular cancer showed a significant difference in prevalence. previous ultrasonography studies showed a prevalence of tm ranging from 16.9% to 48.3%. in our study, we found 15 cases with tm out of 57 (26.3%) testicular cancers versus 72 cases with tm out of 1,382 (5.2%) patients without testicular cancer (p<0.001). historically, frequently reported testicular cancer subtypes have been seminoma, teratoma, and mixed germ cell tumors in decreasing order. however, we found six patients with seminoma and another six with mixed germ cell tumors. the association between tm and malignancy was first highlighted in 1982 by ikinger, who examined testicular specimens from 92 postoperative patients (43 with malignant and 49 with nonmalignant disease). microcalcifications were found in 32 (74%) tumor specimens but only 8 (16%) benign specimens. hbarth found tumors coexisting with tm in 44% of the 42 cases of tm. backus, in a cross - sectional retrospective study, reviewed 42 cases of tm and their association with identified intratesticular abnormalities. they noted that 40% of patients with tm on us had associated tumors. in a larger series, otite reviewed the records of 3,026 patients who had undergone scrotal us thirty percent of their patients with tm were diagnosed with testicular tumors. on the other hand, song reviewed 1,088 patients who underwent ultrasonography. in that study, tm was found in 6% and 5.8% of the testicular cancer patients and the noncancer controls, respectively, in the children 's group (p=0.152). in the adult group, 11.6% and 3.3% of the patients in the respective groups were found to have tm (p=0.001). to overcome the limitations of the majority of published reports, which have been retrospective in nature, several authors have performed prospective follow - up studies of patients with tm. although many published reports found subsequent testicular cancer development in men who had been previously diagnosed with tm, the relationship between tm and testicular cancer remains unresolved due to several drawbacks of those studies. the majority of the prospective studies that have reported subsequent tumor occurrences were performed in a relatively small group (mostly less than 40) and involved short follow - up periods (mostly less than 4 years). more importantly, by carefully analyzing the reports that found subsequent tumor occurrence in patients with tm, most cases had other predisposing factors for the development of testicular tumors, such as cryptorchidism, testicular atrophy, or previous contralateral testicular tumors. another important aim of our study was to evaluate the impact of grading on the prevalence of tm. because there has been no accurate prevalence and a lack of agreed upon clinical importance of tm, further classifying was suggested to help to understand the nature of tm. generally, tm has been accepted as classic tm when at least one image shows five or more microliths. patients who have at least one microliths and do not meet the criteria for classic tm have been considered to have limited tm. further classification of tm as done in our study was also suggested by backus. presently, the number of microliths required to obtain a diagnosis of tm has been agreed upon at five and above for each sonographic plane. however, in cases with smaller numbers of microliths that were associated with malignancy, we documented all microliths except 1 or 2 that could be an incidental finding without pathological significance. as we investigated the further grading of tm according to the number of microliths per us image, we found no difference in the prevalence between grades 1, 2, and 3 in accordance with the reports by sanli. in that study, they reviewed 4,310 cases with classic tm and further graded tm as in the present study ; however, there was no significant difference between grades. bennett compared the rates of testicular cancer in patients with 5 to 10 microliths per image (grade 1) with those having more than 10 microliths per image (grade 2 and 3) and reported no significant difference between the two groups. therefore, we concluded that further grading of tm is not essential in patients with tm. but this should be carefully interpreted because the relatively small number of cases of testicular cancer with tm may limit the power of this result. because there were only five bilateral tm cases in 15 tumor cases with tm, we could n't determine the clinical significance of laterality with respect to tm. several other studies have shown that bilateral tm is associated with the pre - invasive stage of germ cell testicular cancer more so than unilateral. testicular microlithiasis, which is frequently seen with testicular cancer, may be associated with infertility [5 - 8 ]. theoretically, decreased fertility could be expected because 30% to 60% of seminiferous tubules can be obstructed by intratubular concretions, which is considered to be a pathogenesis of tm. infertile patients with tm may have significant reductions in sperm migrations and motility compared with those with minimal microcalcification. however, although some authors have reported abnormal semen parameters in infertile men with tm, others have found no significant difference among infertile men with or without tm. in the present study, we found a prevalence rate of tm of 16.6% (10/60) in the infertile group, which fits into the currently reported prevalence (0.8 to 20%) and confirms a significant co - occurrence (p=0.002). there were no significant differences in sperm count, motility, or morphology in terms of sperm function between infertile men with or without tm. our results suggest that, although there is a significant association between tm and infertility, it seems unwise to expect an adverse effect of tm on seminal profile. we also assume that the relatively low grade of tm in the infertile group might have affected the seminal profile comparison. thomas reported that cases with minor degrees of calcification generally had better sperm count and sperm migration tests than did those with marked calcification. there may therefore be a relationship between the degree of calcification and poor sperm function. on the other hand, in the study by sakamoto, which showed a similar seminal profile comparison result as in the present study, the authors mentioned that the degree of subfertility in patients with tm was variable and may reflect underlying testicular dysgenesis or concomitant intrascrotal abnormality. apart from the adverse effect on seminal profile, tm itself might be a risk factor for testicular cancer in infertile men who are already in a high - risk group. in a study of 263 subfertile men by de gouveia brazao, the authors demonstrated that carcinoma in situ (cis) was present in 20% of infertile men with bilateral tm. skakkebaek interpreted this increased risk for developing malignancy as the so - called testicular dysgenesis syndrome. those authors suggested that in men with tm, or other criteria for testicular dysgenesis such as testicular maldescent, atrophy, low sperm count, or inhomogeneous us appearance, the risk for cis should be examined. testicular microlithiasis, infertility, and testicular cancer all therefore seem to be interlinked. under these circumstances, it seems convincing that particular attention should be paid to tm patients who already have significant risk factors for the development of testicular cancer, such as infertility, cryptorchidism, or infertility, especially in diffuse bilateral cases. first, it was a retrospective review and was based on a preselected population undergoing us for myriad conditions that have the potential for increased incidence of germ cell tumors, which limits the power of the results. second, we presented the prevalence of tm on the basis of a symptomatic population. together with the retrospective nature of the present study, this makes it difficult to determine the true incidence and natural course of tm. to the best of our knowledge, only two prospective studies are available to determine the incidence and natural history of tm in a healthy asymptomatic population. the prevalence of tm in the symptomatic population in our study was found to be 6.0%. our study indicates the significant co - occurrence of tm, testicular cancer, and infertility. even if a true cause - effect relationship between tm and testicular cancer exists, further grading of tm does not seem to be essential with regard to the detection of patients with testicular cancer and tm. furthermore, tm showed no significant impact on seminal profiles in infertile men in the present study ; however, it should be carefully interpreted with respect to other accompanying pathologies. despite a significant pool of knowledge, the natural history and clinical significance of tm are not well understood. to reach a definitive conclusion about tm, further larger prospective and collaborative studies are required. | purposetesticular microlithiasis (tm) is an uncommon pathologic condition that is commonly diagnosed by scrotal ultrasonography. indirect evidence suggests that this syndrome may be associated with an increased risk of testicular malignancy and infertility.materials and methodsa total of 1,439 patients undergoing scrotal ultrasound during a 6-year, 5-month period (january 2003 to may 2009) were retrospectively reviewed. any possible association of tm with pathologic findings was assessed. among patients with tm, further grading of tm with testicular cancer and semen analysis of the infertile group with tm were also performed.resultstm was diagnosed in 87 patients (6.0%) out of a total of 1,439. of all established pathologic entities, only testicular malignancy and infertility were meaningfully associated with tm. there was no significant difference in the prevalence of testicular cancer between each grade. seminal profiles (sperm count, motility, morphology, and white blood cell count) were not found to be statistically different between infertile men with and without tm.conclusionsthe prevalence of tm in symptomatic men was found to be 6.0% with significant co - occurrence of tm, testicular cancer, and infertility. further grading of tm does not seem to be essential with regard to the detection of patients with testicular cancer and tm. tm showed no significant effect on the seminal profiles of infertile men. |
17-estradiol (e2) is a member of the family of steroid hormones which controls many aspects of mammalian physiology. although its ability to stimulate breast cell proliferation is one of e2 normal roles, it increases the risk of breast cancer [1, 2 ]. classically, e2 actions are mediated upon binding on two intracellular nuclear receptors, estrogen receptor (er) alfa and er beta, which bind to dna and control gene expression. like other steroid hormones it is well known that e2 has direct and indirect effects on the thyroid, and this subject has been recently reviewed. although many studies have shown the expression of er in thyroid cancer, there is no study associating aggressiveness of thyroid cancer and absence of er, as it is seen in breast cancer. a novel 7-transmembrane g - protein - coupled receptor, which responds to e2 stimulation with rapid cellular signaling, including erk activation, pi3k activation, calcium mobilization, and camp production, has been extensively studied. this receptor was named g - protein estradiol receptor 30 (gpr30), g - protein estradiol receptor (gper), and, more recently, g - protein estradiol receptor 1 (gper1). it has been shown to be expressed in many estradiol - responsive tissues, and some studies have proposed a potential use of selective antagonists of gper1 as a new targeted therapy for cancer [8, 9 ]. gper1 expression was described in thyroid carcinoma cell lines [10, 11 ] but has not been studied yet in normal or benign thyroid tissues or cells. the knowledge of the expression of this receptor in normal and nonmalignant thyroid could be a potential tool to better understand the nongenomic effects of e2, contributing to developing targets to treatment of diseases. so, the aim of this study was to evaluate the expression of gper1 in human normal thyroid and goiter. the project was submitted to, and approved by, the research ethics committee of the hospital de clnicas de porto alegre (hcpa), porto alegre, rs, brazil. a written informed consent from the participants was considered unnecessary by the institutional review board of the hcpa. in accordance with the resolution hcpa 02/97, based on the resolution cns 196/96 of the national health council, brazil, and guideline 9 of the international ethical guidelines for biomedical research involving human subjects (cioms, who, geneva, 1993), there was no need to obtain informed consent of the patients, because only after the surgical procedure the researchers would know if a tissue sample would be available, they would not know the identity nor have access to the files of the patients, and the tissue samples would be discharged by the pathologists, so there was no interference with these exams. all tissue samples were considered medical waste and all data was anonymized (permit number : 12 - 0272). thyroid samples were obtained from 16 normal thyroid and 19 goiter patients who underwent total thyroidectomy as part of treatment for differentiated thyroid cancer in hcpa. after macroscopic and frozen sections evaluation of surgical specimens by two pathologists, normal thyroid or goiter tissue, which would be discharged, was frozen in liquid nitrogen and stored at 80c until further processing. the pattern used to confirm the presence of goiter was a well - defined fibrous capsule with a mixture of macrofollicles and microfollicles and, in some cases, some degenerative changes such as fibrosis and hemorrhage. total rna was isolated from thyroid tissues using trizol reagent (sigma - aldrich, st. louis, mo, usa) and quantified using a nanodrop nd-1000 (thermo fisher scientific, wilmington, de) via absorbance measurements at 260 and 280 nm. only samples that presented a260/a280 ratios between 1.80 and 2.04 were used in this study. cdna was synthesized from 2 g of total rna in a 20 l reaction using oligo - dt primers and the superscript iii reverse transcriptase (invitrogen) according to the manufacturer 's guidelines. gper1 and -actin genes were amplified in parallel using applied biosystems stepone real - time pcr system (invitrogen life technologies) and kit platinum sybr green qpcr supermix - udg (invitrogen life technologies). the reaction for both genes was initiated by preheating at 95c for 10 s, followed by 40 cycles of denaturation for 15 s at 95c, annealing for 30 s at 58c min, and extension for 30 s at 72c. primer pairs used were described previously by maggiolini. for gper1 and by souza. the specificity of the products was verified by melting curve analysis and 2.0% agarose gel electrophoresis containing 0.025 g / ml ethidium bromide. the gper1 and -actin quantification in samples was performed based on amplification of a standard curve with five successive tenfold dilution points of a pool of cdna samples. thyroid tissues were homogenized in ripa buffer containing 20 mm (ph 8.0) tris - hcl, 150 mm nacl, 5 mm edta, 10% glycerol, plus 1 ug / ml aprotinin, 1 ug / ml leupeptin, and 0.1 mm phenylmethylsulfonyl fluoride (pmsf). lysates were centrifuged at 12.000 g for 30 min at 4c, and supernatants were used for the assay. protein content was measured by the bradford assay, and 100 micrograms of protein was separated in a 12% sds - polyacrylamide gel with a standard molecular weight marker (spectra multicolor broad, thermo fisher scientific inc, rockford, il, usa). proteins were transferred to immobilon - p polyvinylidene difluoride (0.45 m, pvdf) blotting membrane with a semidry transfer cell (bio - rad trans - blot sd, hercules, ca, usa). afterwards, membranes were blocked by incubation with tris - buffered saline containing 0.1% tween 20 and 3% nonfat dry milk for 2 h at room temperature. thereafter, membranes were incubated with rabbit anti - gpr30 antibodies (1 : 500, santa cruz biotechnology), or with mouse anti--tubulin antibody (1 : 1.000, invitrogen) overnight at 4c. membranes were then incubated in horseradish peroxidase - conjugated anti - rabbit or anti - mouse immunoglobulin (1 : 7.500, santa cruz biotechnology). antigen - antibody complexes were detected by chemiluminescence and exposed to kodak medical x - ray processor 102 (eastman kodak, rochester, ny, usa). films were scanned and the optical density of each specific band was analyzed using the image station 4000 mm pro (rochester, ny, usa). comparisons between the two groups were performed by the mann - whitney test ; using spss statistical significance was established at p values of < 0.05. gper1 mrna was present in all samples studied (figure 1) ; normal and goiter samples were obtained from the same patient in 9 cases. results from rt - qpcr are shown as the ratio of gper1 expression versus -actin expression in arbitrary units (au), and data are shown as median [percentile 25/percentile 75 (p25/p75) ]. gper1 mrna was less expressed in goiter than in normal thyroid with median (p25/p75), respectively, 0.8620 (0.09/4.68) and 9.6085 (0.44/16.12). gper1 protein levels were evaluated in 15 samples of normal thyroid and 13 samples of goiter ; normal and goiter samples were obtained from the same patient in 7 cases. the presence of a band with a molecular weight of ~38 kda (figures 2(a) and 2(b), upper panel) indicated the presence of gper1. all normal thyroid samples expressed gper1 protein, while it was not expressed in four of the goiter samples (28%). densitometric scanning of the 38 kda band showed lower expression of gper1 protein levels in goiter when compared with normal thyroid (p = 0.002), with median (p25/p75), respectively, 0.3332 (0.09/0.88) and 1.5804 (0.81/2.43). as female sexual hormones could be directly involved in the pathogenesis of multinodular goiter, we studied gper1 gene and protein expression in 35 samples of normal thyroid and goiter. likewise, gper1 protein levels were higher in normal thyroid than goiter, but the presence of gper1 protein was not observed in all samples of goiter. this was the first time gper1 gene expression was studied in goiter ; nevertheless, gombos. observed previously a lower expression of this gene, as measured by high - density oligonucleotide array, confirmed by rt - qpcr, in benign and malignant thyroid tumors, when compared to normal thyroid. similarly, kumar., studying papillary (n = 2) and follicular (n = 1) carcinoma cell lines, identified very low or absent levels of gper1 gene expression. on the other hand, vivacqua. were able to prevent estradiol - induced transduction pathways using specific inhibitors for gper1 in follicular (n = 1) and anaplastic (n = 2) thyroid carcinoma cell lines. in other tissues, gper1 mrna has also been evaluated. reported that gper1 mrna levels were significantly downregulated in breast cancer tissues in comparison with their matched normal tissues. interestingly, the receptor expression levels were lower in tumor tissues from patients who had lymph node metastasis, when with tumors without this condition. equally, gper1 gene expression was observed to be lower in infiltrating ductal carcinoma than in nontumor mammary tissues and also lower in the polycystic ovary syndrome group than in normal group. on the other hand, gper1 mrna levels were higher in malignant than benign ovarian endometriotic cysts (eaoc) and correlated with matrix metallopeptidase 9 (mmp-9) expression, suggesting that the abnormal expression of this receptor may be involved in malignant transformation, invasion, and metastasis of eaoc. although there are no studies concerning the functional activity of gper1 neither in normal thyroid cells nor in goiter, the lower gene and protein expression in goiter suggests a role of this gene in its pathogenesis. demonstrated by immunohistochemistry that gper1 was positive in all samples of normal breast, while in primary breast cancer only 42% were gper1 positive. however, in endometrial carcinoma, lung tumors, epithelial ovarian cancer, and uterine leiomyomas, the expression of this protein was higher when compared with their matched normal or benign tissues [2326 ]. although the effect of e2 in activating the growth of thyroid cells has been shown to be an action directly mediated by er, manole. described nongenomic mechanisms mediating estradiol effect in thyroid growth. the pathophysiological implications of the lower gper1 gene and protein expressions in goiter are unknown. nevertheless our data, although preliminary, suggest that gper1 abnormal gene and protein expressions could be involved in the pathogenesis of goiter as either a cause or a consequence of it. | goiter is more common in women, suggesting that estrogen could be involved in its physiopathology. the presence of classical estrogen receptors (er and er) has been described in thyroid tissue, suggesting a direct effect of estrogen on the gland. a nonclassic estrogen receptor, the g - protein - coupled estrogen receptor (gper1), has been described recently in several tissues. however, in goiter, the presence of this receptor has not been studied yet. we investigated gper1 gene and protein expressions in normal thyroid and goiter using reverse transcription quantitative polymerase chain reaction (rt - qpcr) and western blot, respectively. in normal thyroid (n = 16) and goiter (n = 19), gper1 gene was expressed in all samples, while gper1 protein was expressed in all samples of normal thyroid (n = 15) but in only 72% of goiter samples (n = 13). when comparing gper1 gene and protein levels in both conditions, gene expression and protein levels were higher in normal thyroid than in goiter, suggesting a role of this receptor in this condition. further studies are needed to elucidate the role of gper1 in normal thyroid and goiter. |
transfusion - dependent -thalassemia major (-tm) is a type of inherited blood disorder resulting in severe and chronic anemia. multi blood transfusion regimen is the first effective measure in prolonging life among these patients ; however, excessive iron overload caused by repeated blood transfusions can result in multi - organ failure. for this reason, iron chelation therapy is vital for -tm patients with iron overload. currently, three main iron chelators are available for clinical use : deferoxamine (dfo), deferiprone (dfp), and deferasirox (dfx). dfo was the first iron chelator introduced in the 60s to treat iron overload ; it is to be used as a continuous subcutaneous or intravenous solution, while dfp is an oral iron chelator. imported brands of dfo and dfx are available in iran, and all three - iron chelators are made by iranian pharmaceutical companies. in iran, dfp is made by avicenna pharmaceuticals, and dfx is made by the osvah pharmaceutical company as osveral, which has been used to successfully treat iranian patients. the choice of medication is made together by the physician and the patient and depends on many factors, such as the degree of iron overload, the age of the patient, the cost of the medication, and tolerability of the medication. some patients have a large amount of iron in their body, and one iron chelator, even in the maximum recommended dose, is not enough to induce a negative iron balance. in these cases, two iron chelators are prescribed. combination of dfo and dfp is a classic combination now and is most recommended for severe iron overload of the heart and has been tried in our center this study was a review of the medical records of 6 patients with -tm using the combination treatment of dfx and dfp in 2016. patients were included if they had high serum ferritin levels or severe iron overload, as determined by magnetic resonance imagining (mri) t2 values, in spite of their maximum dosages of monotherapy with dfo or dfx. patients were excluded if they were allergic to dfx or dfp or if they did not consent to the study. the included patients ages, genders, histories of splenectomy, iron intakes from blood transfusions, durations and doses of iron chelation therapy, and serum ferritin levels were extracted from their medical records. as almost 250 mg of iron is contained in each prbc (packed red blood cell) packed, we calculated the iron intake from blood transfusions in mg / year as follows : 250 the number of units given during one year. the patients monthly cbc (complete blood count), blood urea, creatinine, aspartate aminotransferase, alanine aminotransferase, uric acid, ferritin, and 24-hour urine protein levels were measured during treatment. the patients were asked about any of their experienced clinical side effects, including skin rashes and gastrointestinal symptoms, during their monthly visits. patients degrees of iron overload were assessed by serial measurements of their serum ferritin levels and their mri t2 values in the heart and liver. the liver iron concentration (lic) as mg / gr / dry weight of the liver was also compared between the patients. spss18 software was used to conduct statistical calculations, and a paired t - test was used to calculate the difference between each before - and - after pair of measurements in order to determine the means of the changes. a total of 6 patients (5 males and 1 female) with a mean age of 23.85.8 years (ranging from 17 to 31) received a combination treatment of dfp and dfx. 6 patients were receiving regular blood transfusions (15 ml / kg of filtered packed cells) every 3 - 4 weeks. all patients had been treated with dfo, dfp, or dfx in the past for various lengths of time. the demographics, clinical states, and cardiac and liver mri values of the patients are shown in tables 1 and 2. their serum ferritin levels were 28001900 and 34001600 ng / ml before and after treatment, respectively (p < 0.6). their cardiac and liver mri t2 values were 16.6915.35 vs 17.385.74 and 2.120.98 vs 3.031.51 milliseconds (ms) before and after treatment, respectively (p < 0.9 and p < 0.01, respectively). there was a significant difference in lic after combination therapy with dfp and dfx (7.593.16 vs 5.412.22 mg / g / dry, p < 0.01). the changes in the cardiac and liver t2 values, lic, and serum ferritin levels before and after treatment are shown in figures 1 - 4. one of the patients (case 6) experienced a drop in his cardiac mri t2 value after combination therapy with dfp and dfx ; however, the cardiac status of this patient was in the normal range both before and after therapy. two patients (33.33%) discontinued treatment due to neutropenia and diarrhea. currently, three patients (50%) continue treatment and have not experienced any complications. the main objective of this study was to demonstrate the effects of dfp and dfx combination treatment on cardiac and liver mri values in iron - overloaded -tm patients. however, the change in this patient s cardiac mri t2 value was in the normal range, and the patient did not have cardiac siderosis according to mri. although there was no significant difference between the cardiac mri t2 values before and after treatment statistically (p < 0.05), the cardiac mri t2 values improved after combination therapy with dfx and dfp in the majority of the patients. further, our findings showed that the liver t2 values and lic were improved after treatment. in addition, patient 5 had a remarkable increase in their cardiac mri t2 value after 10 months of dfx and dfp combination therapy. we believe that this considerable change was caused by more compliance with the new regimen over the course of the patients first year of its use. the doses of dfp and dfx used in our study were 53.922.2 and 29.36.8 mg / kg / day, respectively. we utilized dfp and dfx combination therapy in various doses according to the patient s clinical situation and laboratory data. the drugs doses used in the literature were 75 mg / kg / day for dfp and 30 mg / kg / day for dfx). the use of this combination (dfp and dfx) was more effective to clear the heart and the liver from iron siderosis. this is likely a result of the synergistic effects and ability of dfx and dfp to enter cells and chelate intracellular iron. evidence on the co - administration of dfx and dfp has only been provided by a few studies. there are some case reports on the successful combined oral chelation therapy of dfx and dfp in -tm patients. a case study reported a 25-year - old -tm female patient who received dfx and dfp combination therapy. then, 3 doses of dfp at 75 mg / kg / day were added to the treatment. the patient s serum ferritin levels decreased from 4200 to 1596 ng / ml after 1 year of treatment. moreover, their cardiac and liver mri - t2 values increased from 10.3 to 15 ms and 1.7 to 6.78 ms, respectively. a reduction of serum ferritin was observed after 8 months of combined therapy (less than 100 ng / ml before month 8). in our study, the patients serum ferritin levels raised in all cases expect in patient 1. several studies show that serum ferritin can provide information regarding the total iron store of patients ; however, the association is not very strong. although serum ferritin is traditionally measured in all centers for this reason, mri is the most sensitive method for the appraisal of excess iron accumulation in the liver and heart of -tm patients. we speculate that ferritin may increase following other events, such as inflammation or infection, during dfp and dfx combination therapy. gomer. used dfx and dfp combination therapy in 15 -tm patients for 12 months. the patients serum ferritin levels, urinary iron excretion, and mri t2 values were compared before and after the intervention. in addition, a randomized open - label trial demonstrated that dfx and dfp combination therapy improved heavily iron - overloaded -tm patients cardiac t2 values after one year of treatment with 2 doses of dfp at 75 mg / kg / day and 1 dose of dfx at 30 mg / kg / day. a previous study evaluated the safety and efficacy of dfp and dfx combination treatment in 36 patients with -tm with a mean age of 136.9 years. their mean serum ferritin level dramatically decreased to 3275618 g / l after 1 year (p < 0.001). the mean doses of dfp and dfx were 84.45.2 (61 - 100 mg / kg / day) and 33.45.2 (20 - 40 mg / kg / day), respectively. of the 36 patients, 30 experienced transient gastrointestinal complications, joint problems, increased serum transaminases and creatinine, and/or transient proteinuria. the study found that oral combination therapy with dfp and dfx is effective for patients with a suboptimal response to monotherapy. in the study, patients serum ferritin levels decreased after combination therapy with dfx and dfp in contrast to the results of our study. however, the researchers did not evaluate the patients heart and liver mri values, which is the most reliable method to estimate the intracellular iron stores of these organs. another previous work evaluated the efficacy of dfx in 407 patients with transfusion - dependent tm in 9 different centers. the mean dose of dfx prior to treatment was 23.54.9 mg / kg, and the maximum dose was 40 mg / kg. in the study, a significant decrease in the mean serum ferritin level occurred after one year of dfx monotherapy. of the participants, 148 patients (36.37%) experienced at least one side effect, such as raised serum transaminase or creatinine levels. the main causes of withdrawal included an unsatisfactory response in 24 patients (5.8%), poor compliance in 21 patients (5.1%), and adverse effects in 13 patients (3.1%). some limitations of our study included our small number of patients included and our short study period ; a large - scale cohort study is required to confirm our findings. more studies are also expected to define the optimal dosing, duration, safety, and cost effectiveness of dfx and dfp combination therapy in iron - overloaded patients with -tm. combination therapy with dfx and dfp is a new regimen for -tm patients with a heavy iron overload. our study showed that heart and liver mri t2 values and lic were improved after combination therapy with dfx and dfp in -tm patients. alternative therapy with dfx and dfp could be considered to alleviate cardiac and liver iron loading in these patients. the authors conclude that, while these results are encouraging, future studies should include a larger number of participants. | there are few papers on the combination therapy of deferiprone (dfp) and deferasirox (dfx) in iron - overloaded patients with transfusion - dependent -thalassemia major (-tm). a total of 6 patients with -tm (5 males and 1 female) with a mean age of 23.85.8 years (ranging from 17 to 31) used this treatment regimen. the mean doses of dfp and dfx were 53.922.2 and 29.36.8 mg / kg / day, respectively. the duration of treatment was 11.54.6 months. their serum ferritin levels were measured to be 28001900 and 34001600 ng / ml before and after treatment, respectively (p<0.6). their cardiac magnetic resonance imaging (mri) t2 values were 16.6915.35 vs 17.385.74 millisecond (ms) before and after treatment, respectively (p < 0.9). although there was no significant difference between their cardiac mri t2 values before and after treatment statistically, the values improved after combination therapy with dfp and dfx in most of the patients. liver mri t2 values were changed from 2.120.98 to 3.031.51 ms after treatment (p < 0.01) ; further, their liver t2 values and liver iron concentration (lic) were improved after treatment. our study found that cardiac mri t2 values, liver mri t2 values, and lic were improved after combination therapy with dfp and dfx in -tm patients and that dfp and dfx combination therapy could be used to alleviate cardiac and liver iron loading. |
bifid mandibular condyle is an uncommon anomaly with an unclear origin, which was first described in 1941 by hardlicka. the condylar head is divided into two partially or completely separated lobes by a rift or a deep groove. the separating groove can be oriented anteroposteriorly or mediolaterally to determine the spatial relationship of the heads. several theories exist about the origin of bmc, mainly suggesting traumatic or developmental origin [24 ]. if so, the broken condylar head will be displaced anteriorly due to the function of the lateral pterygoid muscle. gradually, a new head will grow up over the mandibular neck, in response to the functional demands with an anteroposterior orientation between the two heads. some believe that extended remaining of a fibro - vascular tissue over the developing condyles during the fetal period may result in bmc formation. although the mediolateral type of bmc is considered to be developmentally formed, some exceptions with traumatic origin have been reported. there is also a concept that only anteroposterior division of the condyles can be considered as a true bmc ; bmc is believed to play a role in some cases of temporomandibular joint disorder (tmd), and joint symptom. on the other hand, radiographic appearance of bmc can mimic vertical condylar fractures, which confuses the physicians in cases of trauma to the face. thus, differential diagnosis is important in cases of trauma to the face and tmd. most cases of bmc are discovered accidentally during routine dental radiographic examinations, more commonly on panoramic views taken for other dental purposes [2,3, 10 ]. there is still a need for more epidemiologic research on the incidence and probable role of bmc in general health. considering the availability of only a few reports on bmc three - dimensionally, this study was designed to evaluate the incidence of bmc in a south iranian population using cbct since cbct typically imposes a lower dose to patients compared to conventional radiography and computed tomography. this cross - sectional study was performed to assess the frequency of bmc and condylar head orientation on the transverse plane based on 425 cbct scans of paranasal sinuses in shiraz, iran. these cbct scans had been ordered as part of preoperative records for patients seeking rhinoplasty in an otolaryngology clinic. all cbct scans were obtained in upright position, using a newtom vgi scanner (qr srl, verona, italy), in a 1515 field of view (fov) and standard resolution mode (0.3 mm voxel size). presence of space occupying lesions within the tmj area and lack of demographic information were considered as the exclusion criteria. only the cases in whom, both condyles were within the fov of cbct scans were included. the cbct scans were reviewed in nnt station (qr srl, verona, italy) by an experienced oral and maxillofacial radiologist. horizontal angulations of each condyle were determined by measuring the angle between the long axis of the condyle in the axial cross - section with the largest mediolateral dimension and an imaginary horizontal line (fig. the left and right condylar heads were evaluated for presence of bifidity separately in the axial, coronal and sagittal planes. considering the condylar head orientation, true sagittal and coronal cross - sections were prepared at a thickness of 1 mm with 0.5 mm interval, over the largest mediolateral dimension of the condyle in the axial plane. the ethics committee of shiraz university of medical sciences approved the study and informed consents were obtained of all the participants. horizontal angle of a bifid left mandibular condyle on a transverse plane based on the axial cross - section. ab : horizontal line ; ac : the long axis of condyle spss software version 17.0 (chicago, il, usa) was used for data analysis. p - value less than 0.05 was considered statistically significant. frequency of bmc was compared between the left and right sides and between males and females using t - test. spss software version 17.0 (chicago, il, usa) was used for data analysis. p - value less than 0.05 was considered statistically significant. frequency of bmc was compared between the left and right sides and between males and females using t - test. the cbct records of 309 patients including 170 females (55%) and 139 males (45%) with a mean age of 29.439.7 years were entered in the study. the bmc was detected in 14 of them (seven females and seven males), which comprised 4.53% of the total population (figs. 2 and 3). coronal cross - sections (0.5 mm thickness) of the cases with (a) unilateral and (b) bilateral bifid mandibular condyles (a) axial, (b) corrected coronal and (c) corrected sagittal cross - sections of a case with right condylar head bifidity there was no significant difference in the incidence of bmc between males and females. eleven bmcs (3.56% of the population) were unilateral, while bilateral condylar head bifidity was detected only in three cases. five unilateral cases were detected on the right side and six in the left side. the mean horizontal angulations of the condyles in normal individuals were calculated to be 22.66 versus 24.024.33 in bmc cases, implying no significant difference (p=0.64). similarly, there was no significant difference in the mean horizontal angulation values between men (23.25.8) and women (22.215.96). since bmc may play a role in tmds or be mistaken for a condylar fracture, its differential diagnosis is of great importance. many epidemiologic studies have been conducted to estimate the real incidence of bmc all over the world, with a wide variability in results. most of the researches on bmc incidence were conducted on panoramic views, since it is a wide - spread, low cost, relatively low radiation dose, and easy to access radiographic technique, which visualizes a large volume of dental and supporting structures, including the rami and condyles. besides, a large number of people have already taken panoramic views for dental purposes, which can be used in epidemiologic studies as a pre - existing sample source. unfortunately, there are some serious limitations with the panoramic technique in this regard. due to superimpositions partial bmcs are hard to detect on panoramic views and mediolateral bmcs may be seen as anteroposterior ones, if the condyles horizontal angulations are large enough. the great discrepancy in the results of studies performed on panoramic views cho and jung believed that panoramic views either under- or over - estimated the incidence of bifidity. on the other hand, there is no universally accepted protocol to diagnose bmc on panoramic views, and judgments are subjective. since the introduction of cbct, dental imaging improved by versatile abilities of this three - dimensional imaging modality. yet, relatively low doses of radiation are delivered to patients and images are prepared in a really short time by a single rotation of the machine. deleting superimpositions brings the chance to observe the anatomical structures of interest precisely, and multi - planar images enable the physician to evaluate the interested structure in proper plane. as the operator can observe the condyles conspicuously, the probability of false positive and false negative diagnoses is significantly reduced, although the need for a standard scale to classify the severity of separations of the heads still exists. the cbct imaging is not used as widely as the panoramic views because of the nature of this technique. thus, the existing source of cbct records is slightly different from the normal population compared with panoramic images. the incidence of bmc in the current study was slightly higher than that in previous reports on the same population, but considering the advantages of three - dimensional imaging, it is negligible. most researchers believe that the incidence of bmc is increasing, as more radiographic examinations of higher quality are becoming available [35,7 ]. about 78% of cases were unilateral, and female to male ratio was 3 to 1. evaluated 10,200 panoramic views and reported an incidence of 0.3% for bmc in a turkish population. reported the prevalence of bmc to be 0.52% in turkey, using panoramic radiographies as the screening tool. later, employing ct scan images, they reported a higher rate of about 1.82% in the same population. using cbct records, cho and jung compared the prevalence of bmc in asymptomatic and symptomatic subjects with tmj problems and no traumatic history and found no significant difference between them. they concluded that the presence of bmc would not lead to any tmj symptoms or cause osseous changes. we have already reported a high rate of bmc (3.5%) in an iranian population while in the current study, we found that 4.53% of cbct records revealed bmc in patients of the same population. the new rate, this difference can be attributed to the advantages of cbct that eliminates superimpositions in the images of the condyles. this finding is in accordance with the results of sahman, who reported a higher rate for bmc in ct records compared to panoramic images in the same country. it is worthy to mention that the lack of conspicuous criteria to diagnose bmc on panoramic images may be less important for cbct scans, because of higher reliability of multi - planar images provided by this modality. similarly, we believe that this will improve the agreement between different observers, and reduces the need to employ multiple observers in such studies, which requires the inter - observer agreement to be in an acceptable level. in most studies, the ratio of unilateral cases of bmc to bilateral form is about 3 to 1. the results of the current study are compatible with this ratio, using a three - dimensional imaging modality (nearly 4 to 1). our results (seven females and seven males), are also in accordance with the afore - mentioned mean female to male ratio for bmc prevalence, which is about 1.3 to 1.0. however, menezes. reported a much higher prevalence in females (3.5 to 1.0). finally, we believe that panoramic views face some limitations in detection of bmcs although they provide opportunities for screening purposes. oblique forms and partial bifid condyles are hard to discover using panoramic and other conventional imaging techniques. should the angulations of the condyle in the transverse plane are large enough, the mediolateral form of bmc may be diagnosed as an anteroposterior type. more advanced imaging techniques should be ordered, at least for symptomatic cases of bmcs or when treatment plans are to be conducted [3,4, 7 ]. last but not least, cbct imaging may be an invaluable modality, considering its low dose of radiation (compared to ct scan), the short time needed (compared to magnetic resonance imaging), and high reliability of the produced images. the prevalence of bmc in the studied population was 4.53%, which was slightly higher than that in previous reports. no significant difference was detected between males and females, sides and condylar horizontal angulations of patients with normal and bifid condyles. | objectives : differential diagnosis of bifid mandibular condyle (bmc) is important, since it may play a role in temporomandibular joint (tmj) dysfunctions and joint symptoms. in addition, radiographic appearance of bmc may mimic tumors and/or fractures. the aim of this study was to evaluate the prevalence and orientation of bmc based on cone beam computed tomography (cbct) scans.materials and methods : this cross - sectional study was performed on cbct scans of paranasal sinuses of 425 patients. in a designated nnt station, all cbct scans were evaluated in the axial, coronal and sagittal planes to find the frequency of bmc. the condylar head horizontal angulations were also determined in the transverse plane. t - test was used to compare the frequency of bmc between the left and right sides and between males and females.results:totally, 309 patients with acceptable visibility of condyles on cbct scans were entered in the study consisting of 170 (55%) females and 139 (45%) males with a mean age of 39.439.7 years. the bmc was detected in 14 cases (4.53%). differences between males and females, sides and horizontal angulations of condyle of normal and bmc cases were not significant.conclusion:the prevalence of bmc in the studied population was 4.53%. no significant difference was observed between males and females, sides or horizontal angulations of the involved and uninvolved condyles. |
twelve partial hydatidiform moles, 12 complete hydatidiform moles, 12 choriocarcinomas, and 14 first - trimester nonhydropic spontaneous abortions (control group) diagnosed previously in the qhaem and imam reza department of pathology, mashhad university of medical sciences were included in the study after reevaluation of each case to confirm the diagnosis by two pathologists. in order to differentiate phm from chm the histological features of the specimens multiple 5-m - thick sections of representative formalin - fixed, paraffin - embedded tissues were cut for immunohistochemical studies. a polymer - based technique was used for the detection of ki-67 (clone mib-1, n1633, dakocytomation, glostrup, denmark) and p63 (clone 4a4, 1:100 dilution, dakocytomation, glostrup, denmark). normal prostatic tissue was used as the positive control for p63 and reactive lymph node was used as the positive control for ki-67. all immunostained sections were examined by the same two observers with a 400 objective under the light microscope (olympus b50 ; olympus optical co, ltd, tokyo, japan) for evaluation of ki-67, and p63 expressions. in the abortion and hydatidiform mole specimens ki-67 and p63 expression for villous stromal cells, cytotrophoblasts, and syncytiotrophoblasts p63 and ki-67 expression was quantitatively assessed as 0 (no stained cells), + (less than 10% positive cells), + + (10 - 50% positive cells), and + + + (more than 50% positive cells). the intensity was scored as 0 (absence), + (weak), + + (moderate), or + + + (strong). in the choriocarcinoma specimens 100 cytotrophoblastic and 100 syncytiotrophoblastic cells were counted in each case, and ki-67 and p63 expression and intensity were assessed by the same criteria noted above. the results obtained from each case groups were compared in pairs for all the parameters included in the study (p63 and ki-67 labeling index, distribution of ki-67 and p63 immunostaining, intensity of ki-67 and p63 immunostaining) by means of the student t test, x analysis, and the mann - whitney u test. statistical significance was determined at p 50%) (figure 2). immunohistochemical staining with ki-67 antibody in spontaneous abortion (a), partial (b) and complete(c) hydatidiform moles, and choriocarcinoma (d). in order to analyze these data, the four groups of complete and incomplete diagnosed hydatidiform moles, spontaneous abortions and choriocarcinomas were matched in pairs and evaluated according to the p63 and ki-67 expression. ki-67 labeling index (% of positively stained nuclei / total number of nuclei counted) in abortion and lesions of villous trophoblasts p63 labeling index (of positively stained nuclei / total number of nuclei counted) in abortion and lesions of villous trophoblasts distribution of ki-67 immunoreactivity in abortion and lesions of villous trophoblasts distribution of p63 immunoreactivity in abortion and lesions of villous trophoblasts intensity of p63 immunoreactivity in abortion and lesions of villous trophoblasts intensity of ki-67 immunoreactivity in abortion and lesions of villous trophoblasts results of statistic analysis to compare p63 expression between choriocarcinoma and abortion, partial hydatidiform mole and complete hydatidiform mole results of statistic analysis to compare ki-67 expression between choriocarcinoma and abortion, partial hydatidiform mole and complete hydatidiform mole results of statistic analysis to compare ki-67 expression between abortion and partial hydatidiform mole, abortion and complete hydatidiform mole, and partial hydatidiform mole and complete hydatidiform mole results of statistic analysis to compare p63 expression between abortion and partial hydatidiform mole, abortion and complete hydatidiform mole, and partial hydatidiform mole and complete hydatidiform mole gestational trophoblastic disease is defined as a spectrum of abnormal gestations and neoplasm arising from villous or extravillous trophoblast that are associated with pregnancy. it takes several forms, each with its own risk of mortality and responsiveness to chemotherapy. studies have recently shown that immunohistochemistry for various markers is useful for confirming the diagnosis. in a study done by cheville jc growth fraction (number of positive cells / total number of cells) of ki-67 in cytotrophblastic cells was useful in separating complete mole from partial moles but not partial moles from hydropic abortion.19 in this study growth fraction on stromal cells did not differ among these three entities. these findings correlate with present results that growth fraction of ki-67 in syncytiotrophoblastic cells is useful in separating partial moles from hydropic abortion but not complete mole from partial moles and the distribution of ki-67 in cytotrophblastic cells was also useful in separating these three entities. according to present results, intensity of ki-67 immunostaining may be useful in separating hydropic abortion from complete mole (but neither hydropic abortion from partial moles nor partial mole from complete mole) in only cytotrophblastic cells group. in summary, it seems that among these three groups of cells (cytotrophblasts, syncytiotrophoblasts, stromal cells) and among these three indexes (ki-67 labeling index, ki-67 distibution, ki-67 intensity of immunostaining) ki-67 labeling index and ki-67 disribution of immunostaining in cytotrophblastic cells are the best indexes in separating these three entities. in other studies however, in this study ki-67 expression was observed in syncytiotrophoblastic cells in abortion, partial hydatidiform mole, complete hydatidiform mole and choriocarcinoma. in addition, ki-67 labeling index was useful in separating choriocarcinomas from nonhydropic abortion, partial mole and complete mole.2021 kale showed the expression of ki-67 was significantly higher in hydatidiform moles (complete, partial and invasive) than in the control group (abortion) 22 which means that these findings are parallel to present results. a study done by shih showed all of choriocarcinomas were diffusely labeled with ki-67 (> 50%).18 these findings correlate with present results. in addition, according to present results, none of abortions and partial moles were diffusely labeled with ki-67 (> 50%). present results suggest that the distribution of ki-67 may be useful in separating choriocarcinomas from nonhydropic abortion, partial mole and complete mole. in one study ramalho did not find any p63-positive cells in choriocarcinomas.23 they concluded that p63 might be useful to differentiate a choriocarcinoma from other gestational trophoblastic diseases and might have a role in malignant transformation of gestational trophoblastic diseases but shih showed that six of eight choriocarcinomas (63%) analyzed by them were positive for p63. in present study, all of choriocarcinomas were positive for p63. according to literature data, choriocarcinomas express several proteins that antagonize apoptosis 2425 and p63 is one of these proteins. also in a study that was done by ramalho there statistical difference was observed in distribution of p63 positive cytotrophoblastic cells between hydropic abortion and choriocarcinoma, partial hydatidiform mole and choriocarcinoma and complete hydatidiform mole and choriocarcinoma. however, according to present results, p63 labeling index and distribution of p63 immunostaining are useful in separating choriocarcinoma from hydropic abortion and partial hydatidiform mole but not from complete hydatidiform mole. in the study mentioned above none of moles (complete, partial) expressed p63 in syncytiotrophoblastic cells. however, according to present results p63 may be expressed in syncytiotrophoblastic cells in this type of lesion. in addition, p63 labeling index and distribution of p63 immunostaining may be useful in differentiation of choriocarcinoma from partial hydatidiform mole and complete hydatidiform mole. however, according to present results no difference was found between partial hydatidiform mole and choriocarcinoma. briefly it seems that among these two groups of cells (cytotrophblasts, syncytiotrophoblasts) and among these three indexes (p63 labeling index, p63 distibution, p63 intensity of immunostaining) none of indexes is able to differentiate between hydropic abortion and choriocarcinoma, as well as between partial hydatidiform mole and choriocarcinoma and complete hydatidiform mole and choriocarcinoma. by reviewing the above mentioned results it seems that ki-67 is a better marker than p63 to attain this goal. according to present results, thus, p63 may be an ideal marker in separating abortion from mole in doubtful cases. in a study done by ramalho no statistical difference was found in distribution of p63 positive cytotrophoblastic cells between hydropic abortion and partial hydatidiform mole, hydropic abortion and complete hydatidiform mole, and partial hydatidiform mole and complete hydatidiform mole. however, in present study distribution of p63 in cytotrophoblastic cells is useful in separating all of these three entities. in the study mentioned above, a difference was observed in the intensity of p63 immunostaining between hydropic abortion and partial hydatidiform mole, hydropic abortion and complete hydatidiform mole but not between partial hydatidiform mole and complete hydatidiform mole. p63 labeling index in syncytiotrophoblastic cells is also useful in separating partial moles from hydropic abortion, complete mole from partial moles and hydropic abortion from complete mole. according to present results, distribution and intensity of p63 in syncytiotrophoblastic cells are also useful in separating partial moles from hydropic abortion and hydropic abortion from complete mole but not complete mole from partial mole. present results show that p63 labeling index in stromal cells is useful in separating hydropic abortion from complete mole but not partial moles from hydropic abortion and complete mole from partial moles and distribution of p63 immunostaining was not useful in separating these three entities. intensity of p63 in stromal cells was useful in separating partial moles from hydropic abortion and hydropic abortion from complete mole but not complete mole from partial mole. in summary, it seems that among these three groups of cells (cytotrophblasts, syncytiotrophoblasts, stromal cells) and among these three indexes (p63 labeling index, p63 distibution, p63 intensity of immunostaining) p63 labeling index in cytotrophblastic and syncytiotrophoblastic cells are the best indexes in separating these three entities. in summary ki-67 labeling index in cytotrophoblastic cells is the best index to differentiate between abortion and subgroups of lesions of villous trophoblasts as well as between different subgroups of lesions of villous trophoblasts. the results of this study show that the evaluation of expressions of p63 in the cytotrophoblastic cells contributes to a reliable discrimination between spontaneous abortions and hydatidiform mole. p63 is negative in cytotrophoblastic cells in all of abortions. because of anti - apoptotic role of this protein, reduced expression of this protein might have a pathogenic role in abortion. the significance of these alterations in the pathogenesis of abortion, however, merits further investigation. to the best of our knowledge this is the second study to investigate the expressions of p63 for the diagnosis of spontaneous abortions and hydatidiform moles. as mentioned above there was some discrepancy between present results and results of previous study. so it is wise to investigate the expression of p63 in these lesions in another study with greater number of cases. me carried out the design and coordinated the study, participated in most of the experiments and prepared the manuscript. ns provided assistance in the design of the study, coordinated and carried out all the experiments and participated in manuscript preparation. | background : despite well - described histopathologic criteria, the distinction of spontaneous abortion from hydatidiform mole and complete hydatidiform mole from partial hydatidiform mole remains a problem because of interobserver and intraobserver variability. the aim of this study was to evaluate the value of two immunohistochemical markers in the differential diagnosis of subgroups of lesions of villous trophoblasts and spontaneous abortions.methods:immunohistochemistry with the p63 and ki-67 antibody was performed in formalin - fixed paraffinembedded samples of non hydropic abortion (n = 14), partial hydatidiform mole (n = 12), complete hydatidiform mole (n = 12) and choriocarcinoma (n = 12). the ki-67 and p63 labeling index (number of positive nuclei / total number of nuclei) for villous stromal cells, cytotrophoblasts and syncytiotrophoblasts were evaluated separately by counting 100 cells of each population. statistical analysis was carried out by 2 analysis, and the mann - whitney u test. statistical significance was determined at p < 0.05 on the basis of 2-tailed tests.results:none of nonhydropic spontaneous abortions analyzed exhibited positive cytotrotrophoblastic and syncytiotrophoblastic cells for p63. the syncytiotrophoblastic cells were negative for p63 in all of choriocarcinomas. all of choriocarcinomas analyzed exhibited severe expression of ki-67 in cytotrotrophoblastic cells. none of abortions and partial moles was diffusely labeled with ki-67.conclusions:ki-67 labeling index in cytotrophoblastic cells is the best index to differentiate between abortion and subgroups of lesions of villous trophoblasts as well as between different subgroups of lesions of villous trophoblasts. ki-67 is a better marker than p63 to attain this goal. |
monocytes / macrophages play a critical role in managing innate and adaptive immunity - including inflammatory processes by secreting proinflammatory molecules (eg. tumor necrosis factor (tnf)-, and nitric oxide (no)). the activation of macrophages and monocytes is mediated by activation of various receptors including toll like receptor-(tlr-) 4 and their counter molecules such as lipopolysaccharide (lps) derived from bacteria or virus. in parallel, the activation of these cells triggers various cellular responses such as cell migration, adhesion, extravasation, and infiltration to induce effective movement of these cells into inflamed tissue by adhesion molecules such as 1 (cd18) or 2 (cd29) integrins and their ligands such as vascular cell adhesion molecule-(vcam-) 1 or intercellular adhesion molecule-(icam-)1. the molecular interaction between surface receptors and counter molecules seen in various cellular inflammatory responses generates a series of complex signaling events composed of numerous intracellular enzymes such as phosphoinositide-3-kinase (pi3k), phosphoinositide - dependent kinase 1 (pdk1), akt (protein kinase b), and mitogen - activated protein kinases (mapks) such as extracellular signal - regulated kinase (erk), c - jun n - terminal kinase (jnk), and p38 [4, 5 ] linked to actin cytoskeleton rearrangement for modulating cellular activation or the proinflammatory gene expression by mediating with transcription factors like nf-b and ap-1. recently, inflammatory responses by monocytes and macrophages were reported to be a critical pathological event in triggering various acute or chronic diseases such as septic shock, cancer, autoimmune diseases, cardiovascular diseases, obesity, and diabetes [7, 8 ]. it is therefore considered that development of promising regulators of monocyte / macrophage - mediated inflammatory responses without side effects could be useful for prevention of, or as the therapeutic remedy for, various inflammation - mediated diseases. cinnamaldehyde (ca ; figure 1(a)), a major bioactive compound isolated from the leaves of cinnamomum osmophloeum kaneh [10, 11 ], has been known to trigger apoptosis through mitochondrial permeability transition in human promyelocytic leukemia hl-60 cells, by activating the proapoptotic bcl-2 family proteins. treatment of cultured mouse splenocytes with ca in a dose - dependent manner blocked the proliferation of lymphocytes induced by concanavalin a and lps. this compound was also found to suppress nf-b activation within macrophage - like raw264.7 cells. it has been demonstrated that ca is capable of blocking inducible nitric oxide synthase (inos) and no production by mediation of nf-b activation blockade in lps - stimulated raw264.7 cells. moreover, the production of pge2 was also reduced by ca exposure in cultured rat cerebral microvascular endothelial cells. these results strongly suggested that ca can be applied as an anti - inflammatory drug. however, the pharmacological target and inhibitory mechanism of ca, and its activity on various cellular events such as cell adhesion and migration commonly seen in the functional activation of monocytes / macrophages, have not been examined yet. thus, in this study, we investigated the detailed regulatory roles of ca on monocyte / macrophage - mediated immune responses and its potential target enzyme. ca was kindly supplied from the aging tissue bank (pusan national university, busan, south korea). lps, phorbol 12-myristate 13-acetate (pma), fitc - dextran, 1,4-dithiolthreitol (dtt), l - cysteine, and tnf- were obtained from sigma chemical co. (st. louis, mo). raw264.7 and tlr4-expressing hek293 cells were purchased from american type culture collection (rockville, md) and invivogen (san diego, ca). phospho - specific antibodies to p85, pdk1, akt, and ib were obtained from cell signaling (beverly, ma). cell - cell adhesion - inducing antibodies to cd29 (mem 101a, purified igg1), cd43 (161 - 46, ascites, igg1), and p5d2 were used as reported previously [18, 19 ]. antibodies to costimulatory (cd80, cd86, cd40, and cd69) and adhesion (cd29, cd43, and cd18) molecules were from bd biosciences (san diego, ca). antibodies to pattern recognition receptors (dectin-1, tlr2, tlr4, sr, and cr3) were purchased from serotec (raleigh, nc). suntide, a peptide sequence derived from akt (protein kinase b), was synthesized by peptron (daejeon, south korea). raw264.7 and tlr4-expressing hek293 cells were cultured in rpmi1640 medium supplemented with 10% heat - inactivated fetal bovine serum (gibco, grand island, ny), glutamine, and antibiotics (penicillin and streptomycin), at 37c with 5% co2. raw264.7 cells (2 10 cells / ml) were incubated with lps (1 g / ml) in the presence or absence of ca for 24 h. supernatants were assayed for no and tnf- contents using griess reagent. since raw264.7 cells are not easily transfected with certain types of dna constructs, tlr4-expressing hek293 cells (1 10 cells / ml) were used to be transfected with 1 g of plasmid with nf-b and -galactosidase by using the calcium phosphate method in a 12-well plate. luciferase assays were performed using the luciferase assay system (promega). to measure the phagocytic activity of raw264.7 cells, a previously reported method was used with slight modifications. raw264.7 (5 10) cells pretreated with ca were resuspended in 100 l pbs containing 1% human serum and incubated with fitc - dextran (1 mg / ml) at 37c and 0c for 30 min. the incubation was stopped by the addition of 2 ml ice - cold pbs containing 1% human serum and 0.02% sodium azide. the cells were washed three times with cold pbs - azide and analyzed by flow cytometry. briefly, u937 cells maintained in complete rpmi1640 medium (supplemented with 100 u / ml of penicillin 100 g / ml of streptomycin, and 10% fbs) were preincubated with ca for 1 h at 37c and further incubated with aggregation - inducing (agonistic) antibodies (1 g / ml) in a 96-well plate. after a 50 minute incubation, cell - cell clusters were determined by homotypic cell - cell adhesion assay using a hemocytometer and analyzed with an inverted light microscope equipped with a cohu high - performance ccd (diavert) video camera. for the cell - fibronectin adhesion assay, ca - treated u937 cells (5 10 cells / well) were seeded on a fibronectin - coated (50 g / ml) plate and incubated for 3 h. after removing unbound cells with pbs, the attached cells were treated with 0.1% crystal violet for 15 min. the od value at 540 nm was measured by a spectramax 250 microplate reader. raw264.7 cells (2 10 cells / ml) were incubated with ca for 30 min. after scratching the cultured cells with a pipette, the cells were further incubated for 48 h. the images of the cells in culture were obtained using an inverted phase contrast microscope attached to a video camera. surface levels of adhesion molecules (cd29, cd43, and cd18) in u937 and co - stimulatory molecules (cd69, cd80, cd40, and cd86) and pattern recognition receptors (dectin-1, tlr2, tlr4, sr, and cr3) in raw264.7 cells were determined by flow cytometric analysis as reported previously. stained cells were analyzed on a facscan device (becton - dickinson, san jose, ca). the total rna from the ca and lps - treated raw264.7 cells was prepared by adding trizol reagent (gibco brl), according to manufacturer 's protocol. the primers (bioneer, daejeon, south korea) were used as previously reported. raw264.7 cells (5 10 cells / ml) were washed 3 times in cold pbs with 1 mm sodium orthovanadate and lysed in lysis buffer (20 mm tris - hcl, ph 7.4, 2 mm edta, 2 mm ethyleneglycotetraacetic acid, 50 mm -glycerophosphate, 1 mm sodium orthovanadate, 1 mm dithiothreitol, 1% triton x-100, 10% glycerol, 10 g / ml aprotinin, 10 g / ml pepstatin, 1 mm benzimide, and 2 mm pmsf) for 30 min with rotation at 4c. the lysates were clarified by centrifugation at 16,000 g for 10 min at 4c and stored at 20c until needed. proteins were separated on 10% sds - polyacrylamide gels and transferred by electroblotting to polyvinylidene difluoride (pvdf) membrane. membranes were blocked for 60 min in tris - buffered saline containing 3% bovine serum albumin, 20 mm naf, 2 mm edta, and 0.2% tween 20 at room temperature. the membrane was incubated for 60 min with specific primary antibody at 4c, washed 3 times with the same buffer, and incubated for additional 60 min with horse radish peroxidase-(hrp-) conjugated secondary antibody. the total and phosphorylated levels of p85, pdk1, akt, ib, and -actin were visualized using the ecl system (amersham, little chalfont, buckinghamshire, uk). cyano-4-hydroxycinnamic acid (20 mg) (bruker daltonics, bremen, germany) was dissolved in 1 ml acetone : ethanol (1 : 2, v / v), and 0.5 l of the matrix solution was mixed with an equivalent volume of sample. mass spectra were first calibrated in the closed external mode using the peptide calibration standard ii (bruker daltonics), sometimes using the internal statistical mode to achieve maximum calibration mass accuracy. the student 's t - test and one way anova were used to determine the statistical significance between values of the various experimental and control groups. monocytes / macrophages are the prime immune cells managing inflammatory responses, which contribute to development of number of diseases such as cancer, diabetes, and atherosclerosis [30, 31 ]. this view led us to develop novel immunoregulatory drugs based on the functional activation of monocytes and macrophages without side effects to prevent such diseases. in this context, medicinal plants that have traditionally been used for long time are considered as attractive biopharmaceutical candidates. with this goal, therefore, we have attempted to develop macrophage function regulators using naturally occurring compounds or plants for a decade. the regulatory effect of ca on lps - induced macrophage immune responses was initially examined. upon nontoxic concentrations (0 to 40 m) (figure 1(b)), ca strongly suppressed the production of no (figure 2(a)) and the surface upregulation of costimulatory (cd80 and cd69) and pattern recognition (tlr2 and cr3) molecules (figure 2(b)). moreover, ca protected cells from lps - induced cytotoxicity and apoptosis, mainly induced by the no produced (figure 2(c)). the inhibition of no release occurred at the transcriptional levels, according to figure 3. thus, ca blocked mrna expression of inos as well as other proinflammatory cytokines such as tnf- and il-1 as much as 80 to 95% (figure 3). because transcriptional downregulation of inflammatory mediators by ca has been reported to inhibit nf-b activation [16, 32 ], reporter gene assay for nf-b and immunoblotting analysis of upstream signaling were further conducted. as figure 4(a) shows, ca blocked nf-b - mediated luciferase activity induced by lps treatment, similar to previous papers [15, 32 ]. this compound suppressed the phosphorylation of ib, akt, and pdk1 but not p85, a regulatory subunit of pi3k (figure 4(b)), suggesting that the pharmacological target of ca may be pi3k or pdk1 in lps - mediated macrophage immune responses. unlike lps - induced inflammatory responses, fitc - dextran - induced phagocytic uptake of raw264.7 cells, a major response found in innate immunity, was not negatively modulated by this compound (figure 5), which suggests that ca can not regulate all macrophage functions but modulates meanwhile, ca also strongly suppressed cell - cell adhesions induced by proaggregative antibodies to cd29 and cd43 up to 85% (figures 6(a) and 6(b)). however, adhesion of u937 cells to fibronectin, an extracellular matrix protein acting as a cd29 ligand, was not suppressed by this compound (figure 6(c)), indicating that adhesion between cells but not cell and extracellular matrix could be blocked by ca. however, ca did not suppress the surface levels of adhesion molecules such as cd18, cd29, and cd43 even at 40 m (figure 6(d)), while ca diminished the migration of raw264.7 cells in an in vitro wound healing assay, compared to normal (figure 6(e)). considering that cell - fibronectin adhesion only requires simple activation of cd29, and while intracellular signaling (erk, p38, and protein kinase c) and actin cytoskeleton change are important factors in cell - cell adhesion events [24, 25 ], ca seems to modulate intracellular signaling events rather than the blockade of a direct interaction between cd29 and fibronectin. in particular, these signaling events targeted to ca seem to be involved in modulating cell migration commonly seen in both cell - cell adhesion (figure 6(a)) and wound healing assays (figure 6(e)). cd29-mediated cell - cell adhesion is an essential phenomenon for survival and activation of immune cells, particular for an interaction between antigeny presenting cells (apc) and t lymphocytes or nk cells. therefore, antiaggregative effect of ca may contribute to the regulation of monocyte / macrophage roles as apc requiring their adhesion responses. similarly, since pi3k / akt inhibition by ly294002 and wortmannin suppressed cd29-mediated cell - cell adhesion, ca inhibition of adhesion and migration events seems to occur at the level of pi3k / pdk1, as in the case of lps signaling. since thiol compounds such as dtt and l - cysteine are reported to block ca inhibition, we finally examined whether this pattern can be observed under the same conditions. as expected, pretreatment of l - cysteine (200 m) or dtt (300 m) before ca treatment abrogated the inhibitory activity of ca in both no production (figure 7(a)) and nf-b - mediated luciferase activity (figure 7(b)), suggesting that thiolation is the major chemical mechanism of ca inhibition. up to date, we have not been able to locate the exact thiolation site on the target protein by ca. however, recent findings revealing that an adduct formation of hydroquinone with the sulfhydryl group of cys-310 in akt is able to block the phosphorylation of both thr-308 and ser-473 seem to suggest that a target cysteine sequence of pi3k or pdk1 can serve as a thiolation site affecting their phosphorylation and activation. indeed, we failed to detect an adduct formation between ca and suntide, a peptide fragment containing cysteine-310 designed according to akt amino acid sequence (figure 7(c)). because identification of ca target thiolation site is an important step to understand the exact molecular mechanism of ca inhibition, we are currently undertaking further analysis using other peptide sequences containing cysteine residues from pi3k and pdk1. in conclusion, we found that ca was able to suppress the production of no and upregulation of surface levels of costimulatory molecules such as the surface upregulation of both costimulatory (cd80 and cd69) and pattern recognition molecules (tlr2 and cr3). in addition, ca also blocked both cell migration and cell - cell adhesion induced by cd29 and cd43, but not cell - fibronectin adhesion. the ca inhibition was likely due to the inhibition of pi3k and pdk1, important for nf-b activation of signaling components, according to immunoblotting analysis. in particular, l - cysteine and dtt strongly interfered ca - mediated inhibition of no production and nf-b activation. therefore, our results suggest that ca can act as a strong regulator of monocyte / macrophage - mediated immune responses, possibly by the induction of thiolation at cysteine residues in the target enzyme (pdk1 or pi3k). to prove a detailed inhibitory mechanism, identification of molecular targets of ca | cinnamaldehyde (ca) has been known to exhibit anti - inflammatory and anticancer effects. although numerous pharmacological effects have been demonstrated, regulatory effect of ca on the functional activation of monocytes and macrophages has not been fully elucidated yet. to evaluate its monocyte / macrophage - mediated immune responses, macrophages activated by lipopolysaccharide (lps), and monocytes treated with proaggregative antibodies, and extracellular matrix protein fibronectin were employed. ca was able to suppress both the production of nitric oxide (no) and upregulation of surface levels of costimulatory molecules (cd80 and cd69) and pattern recognition receptors (toll - like receptor 2 (tlr2) and complement receptor (cr3)). in addition, ca also blocked cell - cell adhesion induced by the activation of cd29 and cd43 but not cell - fibronectin adhesion. immunoblotting analysis suggested that ca inhibition was due to the inhibition of phosphoinositide-3-kinase (pi3k) and phosphoinositide - dependent kinase (pdk)1 as well as nuclear factor-(nf-) b activation. in particular, thiol compounds with sulphydryl group, l - cysteine and dithiothreitol (dtt), strongly abrogated ca - mediated no production and nf-b activation. therefore, our results suggest that ca can act as a strong regulator of monocyte / macrophage - mediated immune responses by thiolation of target cysteine residues in pi3k or pdk1. |
progressive systemic sclerosis (pss) is an inflammatory disease of connective tissue, with onset as edema that continues with fibrosis, induration, and skin atrophy, followed by attacks on the joints, internal organs, and secondary proliferation of connective tissue (1). other attacked organs besides the skin are : esophagus, lungs, heart, muscles, etc. changes in the blood vessels begin with proliferation in intima, edema of media, activation of platelets and fibroblasts, formation of their deposits that cause obliteration of blood vessel and consecutive ischemia of a tissue supplied by damaged blood vessels (2). first clinical sign is edema, skin thickening on the proximal and metacarpo - phalangeal articulations, and raynaud phenomenon is almost always positive. epidemiological surveys indicate 10 - 16 new cases per 1 million people (3). frequency of this condition is 3.5 4 times higher among females than in males, while in reproductive phase the frequency is even higher. prevalence of scleroderma is 10 20 persons in 100.000 people, whereas incidence is 1 3 persons in 100.000 people per year. the role of genetic factors still remains unclear, though there are families with high number of members who suffer from pps (4). numerous researches have indicated connection of systemic sclerosis with hla - dr1, hla - dr3 and hla - dr5 among cases with manifestations in the skin and internal organs, whereas in pulmonary hypertony is present hla - dr 6. metabolic and vascular alterations of collagen and derangement of immune factors are blamed for the onset of illness. immunological and cyto - pathological studies have confirmed that cells of the blood vessel intima are not proliferating, on contrary we have a significant increase of collagen. thus, basic pathogenetic changes are large proliferation of connective tissue fibrogenesis, and excessive activation of fibroblasts with their depositions (6). both vascular and immunological theories were unable to explain the whole etiology, but however they should be taken into consideration (7). despite all efforts, pss remains the least researched systemic inflammatory disease so far. lots of doubts yet remain whether systemic sclerosis is an autoimmune disease due to little findings in serological markers, particularly of specific antibodies (8). electronic search in internet (yahoo) and search of medical literature published to date in the medical database (pub med) did nt give any research related to the incidence, prevalence and clinical manifestation of systemic sclerosis in the dukagjini plain. its size is 4326 km, makes 39.7 % of total size of kosova, composed of 3 large regions (prizren, peja and gjakova), it has 12 municipalities and a total of 545 settlements. the last census held in 2011 revealed 698450 resident citizens, males 349476, females 348974, all caucasoid race. clinical manifestation of systemic sclerosis includes a range of changes from skin to internal organs and the whole body. raynaud phenomenon is a skin manifestation that is always present in the skin of fingers, nose, earlobe, etc. onset of raynaud phenomenon is arteriolar spasm due to influence of cold or other impacts, followed by pallor and lividness, whereas the patient feels numbness, pain and cold, followed by flaccidity of blood vessels wall, its color turns from pale to dark, followed by dilation of blood vessel, restitution of circulation, redness of fingers and finally normalization of temperature (10). if these changes are protracted, they may cause holes in fingers, ulcers and gangrene (11). changes in the skin occur with finger edema, skin thickening and its fixation to the base. skin is fixed, can not be removed from the base and no accessories are present (skin hair and glands). we notice changes of skin, muscles and glands that make sharp feature of nose, mimics are lost, microstomia, and radial wrinkles around the mouth. after the loss of elasticity in soft tissues, articulations get contracted and this is mostly seen on the hands (12). muscles are damaged in all length and volume which adds to the stunning and contractures of articulations. features of raynaud phenomenon in the body surface are associated with same alterations in the internal organs. damages to esophagus are associated with dysphagia, gastroesophageal reflux, progressive atrophy of mucous wall and finally with mucous ulcerations (14). alterations are notices in other digestive organs too : stomach, and in small and large intestines. these changes are manifested with pain, abdominal cramps, constipation and diarrhea (15). we have decreased volumes in functional pulmological tests, the most severe alterations are characterized with pulmonary fibrosis and pulmonary hypertension (16 - 17). pulmonary hypertension is a severe complication secondary to the pulmonary damages. diffusing capacity of the lung for carbon monoxide measurement is an important measurement value for estimation of pulmological alterations. (18) alterations in heart are featured with myocardial fybrosis with subsequent arrhythmias ranging from atrial fibrilation to the most severe types such as ventricular rhythm derangement. rare alterations are congestive heart insufficiency, endocarditis (acute, subacute -infective and non - infective) and pericarditis (non - calcified and calcified. (19) fibrosis of renal arteries and activation of renin angiotensin system causes the increase of renal pressure and in certain cases may provoke scleroderma renal crisis. symptoms of renal derangements in systemic sclerosis include wide spectrum of symptoms, such as headache, fatigue, vertigo, neurological disorders, and in very rare occasions renal insufficiency. this stady aimed to : assessment of the prevalence, incidence and distribution of pss in municipalities of dukagjini (figure 1).evaluation of clinical manifestations and serological results of the pss, creation of a data bank for pss for the purpose of evalution the present situation, prognosis and planing pss flow interference in dukagjini. assessment of the prevalence, incidence and distribution of pss in municipalities of dukagjini (figure 1). evaluation of clinical manifestations and serological results of the pss, creation of a data bank for pss for the purpose of evalution the present situation, prognosis and planing pss flow interference in dukagjini. this retrospective study covers researched medical documents of patients diagnosed with pss during the 2005 - 2010 period, and all patients with active illness during the last 18 - 60 months have been registered in accordance with eustar - it (european scleroderma trial and research) criteria (22). of they had different ages age median was 44.2 10.1. their diagnosing is completed based on the revised acr criteria (23). score assessment in cases with systemic sclerosis is done in accordance with eustar : cardiovascular system affected 2 points, skin 2 points, erythrocytes sedimentation > 30 during the first hour -1.5 points, rodnan s modified cutaneous test > 20 1 point, decrease in the level of complement 1 point, hand fingers distal necrosis 0.5 point, as well as diffusing capacity of the lung for carbon monoxide dlco lower than 80%1 point. have not been included 4 patients with pss, but were not resident citizens of the above - mentioned region. incidence and prevalence assessment has been conducted with 95% confidence interval, based on the binomial distribution. level of statistical accuracy is 95% (p<0.05). for the purpose of statistical analysis analysis of medical documentation covering the period 2005 - 2010 have found 51 patients of caucasoid race that are diagnosed in accordance with the revised acr criteria for the progressive systemic sclerosis. (table 1,2,3,4,5,6). based on the 51 patients resident citizens of dukagjini plain, the calculated prevalence is 14.61/100.000 (95%confidence interval ci), and the annual incidence is the same 2.8/100.000 cases (c i 95%). general features of patients, profile of their antibodies, as well as findings in the clinical manifestations are the following. all of our patients come from municipalities of dukagjini plain which in the last census revealed this number of population : (figure 2,3,4,5). even though istog municipality is inhabited by 5.8 % of total number of dukagjini plain population, it has larger number of patients with pss. this is the largest prevalence of pss not only in the republic of kosova, but also in balkan peninsula, and even wider. several centuries and many years have passed by since 1753, when italian physician carlo curcio described for the first time a 17 year old person with pss. interest, researching and treatment of pss ever since has been always in the focus of scientific and medical community. in spite of this, pss is the least explored pathology. in comparison to known data from completed and published researches, our data are in line with incidence, prevalence, gender, group age, clinical manifestations and antibodies in all municipalities and dwelling places of dukagjini plain, with exception of istog, where the incidence and prevalence have the highest rates in the republic of kosova, balkan peninsula, and even broader. patients from istog municipality have more intense clinical features and course of illness with rapid onset of serious complications in lungs (pulmonary hypertension) and kidneys (sclerotization and renal crises). during research we have noticed several features that make istog municipality diff erent from other municipalities in dukagjini plain : istog is the location with largest number of water and termomineral waters resources in kosova (24).nowhere else in balkan peninsula winds are more frequent and devastating than in istog and its vicinity (25).inhabitants of this municipality are naturally born beautiful individuals (tall, handsome) and in all beauty pageants (miss and mister) give the highest numer of fi nal competitors for both gender despite the fact this municipality in comparison to overall kosova population has small number of inhabitants istog is the location with largest number of water and termomineral waters resources in kosova (24). nowhere else in balkan peninsula winds are more frequent and devastating than in istog and its vicinity (25). inhabitants of this municipality are naturally born beautiful individuals (tall, handsome) and in all beauty pageants (miss and mister) give the highest numer of fi nal competitors for both gender despite the fact this municipality in comparison to overall kosova population has small number of inhabitants in this abovementioned quartet of elements : water, air, earth and inheritance we should search for the reasons of incidence and prevalence of pss among adults in istog municipality, but other factors as well shall not be overlooked. we have noticed a slight increase of antibodies against topoisomerase i anti scl-70. neuralgias are spotted for the higher occurrence in general, and in particular trigeminal neuralgia s occurrence among our patients is higher in comparison to data from the literature. there is a need for a multidisciplinary cohort study for investigating the reasons of asymmetrical occurrence of patients with pss in dukagjini plain, particularly in istog municipality. with this study we have confirmed presence, distribution and clinical manifestations of progressive systemic sclerosis in the dukagjini plain. highest numbers of patients are from istog, followed by mamusha and rahovec, whereas the lowest numbers of patients come from dragash. incidence and prevalence of pss in the dukagjini plain correspond with the data from literature, with excption of istog where we have found highest incidence and prevalence (figure 6). largest number of cases is in the group age 35 - 44 year old, followed by the group age 45 - 54 year old. (in the skin), lungs, digestive tract, the least affected are kidneys. a slight increase is noticed in neuralgia, particularly of n. trigeminus, which is higher in comparison with literature and other studies. additional scientific studies are needed to find out reasons for assymetrical distribution of patients with spp in the municipalities of dukagjini plain, to examine geographical and other factors that have impact in the progressive systemic sclerosis. findings on pss in this study must be compared with findings from the other parts of the republic of kosova. limitations of the study were : delays in patients referrals, objective inabilities to conduct capillaroscopy of patients, several patients were diagnosed abroad and we had a little possibility to follow up their pathology. | introduction : progressive systemic sclerosis (pss) is an inflammatory disease of connective tissue, with onset as edema that continues with fibrosis, induration, and skin atrophy, followed by attacks on the joints, internal organs, and secondary proliferation of connective tissue.purpose:to research in which residence locations and among which group age is the most frequent incidence, prevalence and clinical manifestations of systemic sclerosis in dukagjini plain which is inhabited by 698450 resident citizens.material and methods:51 patients with progressive systemic sclerosis were studied, out them 44 were females (86.3%) and 7 males (13.7%) respectively, during the period from 2005 to 2010. their illness was active from 18 to 60 months in accordance with eustar criteria. they are of different age, median age is 44.2 10.1. their diagnose is determined based on revised acr criteria. prevalence of patients with pss was 14.61/100.000, while the incidence was 2.8/100.000, whereas ci (confidence interval) or limit of accuracy was 95%.results : largest number of patients per 100.000 citizens has istog municipality which has the largest number of patients with pss. it is followed by mamusha and rahovec municipalities. the largest examined group age is 35 - 44 year old, 41.2% respectively.conclusion:additional studies are necessary to carry out in order to find the reasons of asymmetrical distribution of patients with systemic sclerosis in the municipalities of dukagjini plain. |
isotretinoin (13-cis - retinoic acid), a synthetic analog of vitamin a, is used primarily for severe cystic acne and acne that has not responded to conventional treatments. they include abnormal meibomian gland secretion, blepharoconjunctivitis, corneal opacities, decreased dark adaptation, decreased tolerance to contact lens, decreased vision, increased tear osmolarity, keratitis, meibomian gland atrophy, myopia, ocular discomfort, ocular sicca, and photophobia. we herewith report a rare case of extraocular myopathy which was most likely caused by isotretinoin intake for a prolonged period. a 31-year - old male presented to our oculoplasty clinic with chief complaints of gradual outward deviation of left eye and double vision in right gaze for the past 2 years. there was no history of pain, trauma, diurnal variation, diminution of vision, vomiting, or headache. he was not a known case of diabetes mellitus, hypertension, thyroid disorder, or any other chronic disease. extraocular movements in left eye revealed complete limitation of adduction and mild limitation of depression [figure 1 ]. a differential diagnosis of thyroid eye disease and ocular myasthenia gravis was considered and a thyroid function test (serum free t3, serum free t4, and serum thyroid stimulating hormone assay) and serum acetylcholine receptor antibody were ordered. external photograph of the patient showing left exotropia and complete limitation of adduction and mild limitation of depression in the left eye thyroid function test was within normal limits and serum acetylcholine receptor antibody was negative. magnetic resonance imaging (mri) of the brain and orbit showed hyperintensity in the belly of left medial and inferior rectus. there was no enlargement of the muscles and orbital fat content was normal [figure 2a and b ]. the features on mri were neither suggestive of thyroid eye disease nor idiopathic orbital inflammation. (a) magnetic resonance image, axial cut, t2 sequence showing hyperintensity in left medial rectus belly. (b) magnetic resonance image, coronal cut, t2 sequence showing hyperintensity in left medial rectus and inferior rectus belly (arrow). the muscle belly is smooth without any enlargement on further inquiry, the patient gave history of isotretinoin intake for 3 months (1 mg / kg / day) for cystic acne just before the symptoms started and continued the drug for next 5 months. a provisional diagnosis of isotretinoin - induced myopathy was made and the patient was asked to stop isotretinoin. the patient was also started on a course of oral steroid in tapering fashion to take care of any associated inflammatory pathology. there was no improvement in extraocular motility after 3 months of oral steroids, and a repeat mri showed no improvement, suggesting fibrosis. it has been shown to induce apoptosis in various cells of the body including sebaceous glands, and thereby helping in the treatment of acne vulgaris. one study suggests that the drug amplifies production of neutrophil gelatinase - associated lipocalin in the skin, which has been shown to reduce sebum production by inducing apoptosis in sebaceous gland cells while exhibiting an antimicrobial effect on propionibacterium acnes. the drug decreases the size and sebum output of the sebaceous glands. about 15% of patients treated with isotretinoin have developed musculoskeletal symptoms and on rarer occasions increased creatine kinase (ck) activities. there are reports of clinical and electromyographic evidence of muscle damage during treatment with isotretinoin. myalgia and muscle stiffness have been reported in 16%51% of patients treated with isotretinoin while elevated serum ck levels have been found in up to 41% of patients. there have been several reports of severe and debilitating muscular symptoms due to isotretinoin where ck levels were normal. in such patients, myopathy or a disorder of myoneural junction the exact mechanism of isotretinoin - induced myopathy has not yet been elucidated ; however, it has been hypothesized that all therapeutic as well as adverse effects of isotretinoin are caused by its the latter are proteins that are involved in regulating gene expression in a variety of conditions including inflammatory and immune - mediated processes. regarding the patient presented in this case report, there is a possible relationship between isotretinoin intake and his extraocular myopathy. drug - induced myositis is a condition which implies the exclusion of other entities responsible for myositis such as infectious or autoimmune diseases or idiopathic cause. the three strong differentials in the present case were thyroid - related ophthalmopathy, ocular myasthenia gravis, and idiopathic orbital inflammatory disease. the thyroid eye disease was ruled out in view of normal thyroid levels, absence of ocular signs of thyroid eye disease, and no evidence of increase in size of extraocular muscles or orbital fat on mri. ocular myasthenia gravis was ruled out by the absence of diurnal variation in the symptoms, symptoms being stable for the past 2 years without any variability, and a negative serum acetylcholine receptor antibody assay. idiopathic orbital inflammatory disease commonly presents with pain and the imaging shows diffuse irregular enlargement of extraocular muscles involving the whole length of the muscle. the present case did not have any pain and the mri showed a smooth hyperintensity in the muscle belly without any enlargement. thereby, considering the clinical and radiological findings, the most likely diagnosis in this case was an isotretinoin - induced myopathy. isotretinoin has been reported to have some immunomodulating effects that may induce some autoimmune diseases such as crohn 's disease, immune - mediated diabetes, and guillain barr syndrome. there has been a case report regarding possible association between isotretinoin intake and concomitant autoimmune thyroiditis and ocular myasthenia gravis. there is considerable evidence in the literature that isotretinoin can induce an autoimmune reaction resulting in various autoimmune conditions ; we presume that a similar mechanism would have been responsible to produce an autoimmune thyroid eye disease - like condition in the present case. stopping the drug will result in cessation of the inflammatory response but the fibrosis induced by the inflammation would result in residual limitation of extraocular movements as in the present case. we conclude that though rare, isotretinoin - induced extraocular myopathy should be considered in the differential diagnosis of any patient presenting with diplopia and extraocular motility restriction, with concomitant isotretinoin intake. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. the authors certify that they have obtained all appropriate patient consent forms. in the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal. the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity can not be guaranteed. | isotretinoin a synthetic analogue of vitamin a is primarily used for cystic acne not responding to conventional treatment. several ocular side effects including blurring of vision, decreased dark adaptation, corneal opacities and meibomian gland atrophy have been reported with prolonged use of isotretinoin. there have been reports of muscular damage caused by isotretinoin. extra ocular myopathy as an adverse effect of long term used of isotretinoin has never been mentioned in literature. we report a case of a young male who presented to us with complaints of diplopia after using isotretinoin for a prolonged period. he was diagnosed as a case of presumed isotretinoin extraocular myopathy after imaging and other blood investigations. |
although spontaneous spinal epidural haematoma (sseh) is a low incidence condition, it is widely recognised throughout the literature as a cause of myelopathy [5, 15 ]. the relationship between sseh and anticoagulant therapy is well known and the probable cause of bleeding is thought to be the rupture of the venous epidural plexus during a sudden elevation of thoracic or abdominal pressure [4, 6, 8, 10, 11, 13, 15 ]. radicular involvement is very rare and, when it appears, it mostly affects the lumbar spine, producing ciatalgia [1, 3, 11 ]. although the currently suggested approach is an urgent surgical decompression [9, 10 ], conservative treatment is recommended when there is an objective improvement of the neurological status [2, 11, 12 ]. in general, the originality of this report arises in three points : the case involved the cervical spine producing simple radiculopathy.it was solved spontaneously.anticoagulation therapy was not discontinued. a 64-year - old white man undergoing anticoagulant therapy because of cardiac valve prosthesis arrived at the emergency room of our hospital suffering from a sudden onset of cervical pain and a left c5 brachial pain and weakness. based on the suspicion that it was a case of disc herniation with left c5 root involvement, symptomatic treatment by means of non - steroid anti - inflammatory drugs and painkillers was indicated. a cervical mri was scheduled and the patient was invited to undergo further examination at the spinal surgery unit. owing to the fact that the first physician was not a spinal surgeon and therefore not aware of the relationship between anticoagulation and sseh, discontinuation of anticoagulant therapy was not indicated. two days later, when the patient was examined by the spinal surgery unit, the pain had been completely relieved and the weakness had also decreased. the mri revealed a left posterolateral ovoid mass compatible with a haematoma extending from c4 to c5 (fig. 1). once the specialist knew the real cause of the radicular syndrome, the haematologist was consulted and they preferred not to suspend the anticoagulant therapy (despite an adequate level of anticoagulation, inr 2,7) in order to prevent thromboembolism.. a, c isointense appearance of the haematoma on the mri t1-weighted sagittal and axial images. b, d hyperintense appearance of the haematoma on the mri t2-weighted sagittal and axial images mri 2 days after the onset of symptoms. a, c isointense appearance of the haematoma on the mri t1-weighted sagittal and axial images. b, d hyperintense appearance of the haematoma on the mri t2-weighted sagittal and axial images seven days later, the patient was free of weakness and the mri showed a decrease in the haematoma size (fig. 2). successive mri results were obtained 1 month (fig. 3) and 1 year later on (fig. the haematoma is smaller nevertheless it is located at the same c4c5 level mri 1 month later : disappearance of the haematoma mri 1 year later : normal mri groen and van alphen reported that 4.5% of a series of 320 sseh cases treated surgically presented radiculopathy ; all cases affecting the lumbar spine. recently, groen reported that 9% of a series of 64 sseh cases treated conservatively presented an isolated radicular compromise ; only one of his cases was located on the cervico thoracic spine. our case adds little in terms of number but the fact that it may be the only report of its kind on purely cervical radiculopathy due to sseh, which may be considered anecdotic, as well as interesting. although the spreading of the haematoma throughout the epidural space is the most likely hypothesis proposed for spontaneous recovery in case of neurological impairment [7, 14 ], our case does not support that theory because the haematoma did not spread throughout the epidural space. conservative management is currently indicated in uncommon situations or when neurological symptoms improve before medical evaluation. geographic isolation, initial inaccurate diagnosis, neurological improvement pending an adequate coagulation level prior to surgery, high surgical risks and several other reasons had been referred to as the likely causes that led to the opportunity for spontaneous recovery [4, 7, 9, 11, 16 ]. our case can be categorised as wrong diagnosis initially, but we have to admit that the first non - specialised consultation spared our patient from the operation. if the patient had first consulted a more skilled specialist, following the state of the art, he would have probably been operated on, thus obtaining a good result and a proud surgeon. finally, the main interest of our case would be focused on the controlled maintenance of the anticoagulant therapy in patients with mild neurological compromise such as radiculopathy due to sseh in order to avoid thromboembolic risk. | introduction : spontaneous spinal epidural haematoma (sseh) is widely recognised throughout the literature as a cause of myelopathy, radicular compression being very rarely reported. surgical management is almost always recommended, especially in the cases of spinal cord compression. conservative treatment is reported as a curiosity and only in the case of spontaneous improvement. this report presents the particular case of a 64-year - old patient undergoing anticoagulant therapy that had a cervical radiculopathy due to a sseh confirmed by mri. the patient improved spontaneously and symptoms were solved with unconventional conservative treatment and without stopping the anticoagulant therapy. conclusions : spontaneous epidural haematoma must be kept in mind when patients undergoing anticoagulant therapy have a sudden onset of cervicobrachialgia. even though most spinal surgeons advocate surgical treatment, a conservative approach may lead to a complete recovery and may be considered as a good option in the case of radicular involvement. discontinuation of the anticoagulant therapy may not always be needed, especially when the clinical syndrome improves spontaneously. |
to provide maximal efficacy in preventing cardiovascular events, -blockers should be present at sufficient strength over the entire 24-h day.this modeling study showed that bisoprolol and metoprolol succinate provide comparable overall blood pressure - lowering activity.however, there are differences between the two drugs in the diurnal pattern of their antihypertensive effects, with metoprolol succinate providing greater efficacy toward the end of the 24-h day. cardiovascular (cv) events, such as acute coronary syndromes, stroke, and sudden cardiac death, show time - varying incidence ranging over the 24-h day and according to the season of the year. the reasons for this variation are not fully understood, but it is known that the adrenergic neurohormonal system is one important factor [1, 2 ]. consequently, it is believed that the prophylactic effect exerted by -blocking drugs on the incidence of cv events can be explained by these drugs anti - adrenergic effects [3, 4 ]. it also follows that to be maximally effective, the -receptor blocking effect should be present at sufficient strength over the entire 24-h day. in recognition of the advantages of improved compliance and the need for day - long efficacy, modification to prolong the elimination of a drug is one approach to make once - daily administration feasible. bisoprolol fumarate attains once - daily dosing because of slow receptor dissociation, while metoprolol cr / zok (metoprolol succinate) exemplifies the controlled - release path for once - daily dosing [5, 6 ]. metoprolol cr / zok and bisoprolol are both (with various national limitations) approved for control of hypertension, ischaemic heart disease, heart failure, and reduction of the risk of cv events associated with these conditions [7, 8 ]. however, because of their differing pharmacokinetic profiles, there may be diurnal differences in cardioprotective effects between the two drugs. to further explore this possibility, an in silico model of 24-h blood pressures was developed, making use of published data. data on the pharmacokinetic and blood pressure effects of bisoprolol were obtained as summary data from the published literature [6, 918 ]. corresponding published information on metoprolol cr / zok was available on the individual subject level [5, 19 ]. ambulatory blood pressure measurement (abpm) values for untreated hypertensive patients were also obtained on the individual level. the ovid medline and embase databases were queried for publications in the english language with abstracts on metoprolol and bisoprolol, using both substance names and product labels. papers with abstracts informing on blood pressure, abpm, or pharmacokinetics were further studied, and those providing 24-h data in numerical formats were used. all data from clinical trials were obtained from studies that had obtained ethics approval. in an initial step, hourly systolic blood pressure (bpsys) values for 266 untreated hypertensive subjects (aged 55 9.4 years ; 103 of whom were female) were derived as the means of three measurements per hour for a 24-h day (from 1000 hours to 1000 hours). as a second step, corresponding mean hourly bpsys values were calculated and adjusted to the plasma concentration curves for bisoprolol (as published) and metoprolol cr / zok, on the basis of a steady - state situation, with dosing being simultaneous with the start of the blood pressure recording. thirdly, two sets of random data for bisoprolol and metoprolol cr / zok, respectively, were generated, representing hourly bpsys values in 266 subjects, and aligned to the calculated mean hourly values. this operation was based on bpsys values following a normal distribution (truncated to > 75 to 75 to 0.1) for the simulated bisoprolol and metoprolol data, respectively. the estimated overall difference between the two groups, when controlled for the time effect, was 2.7 mmhg (95 % confidence interval 0.3 to 5.7 mmhg).table 2estimates of changes in systolic blood pressure (bpsys) valuesbisoprolol versus baselinemetoprolol versus bisoprololtime of day (hours)bpsys 95 % confidence limittime of day (hours)bpsys 95 % confidence limitlowerupperlowerupper114.16.12.1112.10.74.8124.77.22.2124.00.57.5136.18.83.4131.22.65.0148.911.76.0143.80.27.9154.57.41.6151.35.42.8164.97.91.9162.76.91.4174.47.41.4171.15.33.1182.45.40.6187.111.32.9193.56.50.4195.39.61.1204.87.81.8203.27.41.1217.010.04.0212.56.81.8228.711.75.6222.46.71.9239.312.46.3233.07.21.3009.412.46.4006.110.41.9017.110.14.0017.611.93.3026.910.03.90210.114.45.8037.911.04.9037.812.13.50410.613.67.6045.29.50.9057.010.04.0053.78.00.5066.39.33.2062.97.21.3072.95.90.1073.67.90.7081.91.14.9084.28.40.1097.34.310.4093.67.90.7baseline133.4131.2135.5 estimates of changes in systolic blood pressure (bpsys) values the data for bisoprolol display a bimodal pattern, and those for metoprolol cr / zok display a unimodal one (fig. 2). temporal differences in blood pressure - lowering effects are seen, with bisoprolol being more effective around its maximum plasma concentration, and metoprolol cr / zok being more effective during the latter two thirds of the 24-h day (fig.. 4estimates (95 % confidence intervals) of changes in systolic blood pressure (bpsys) values. a bisoprolol. b metoprolol versus bisoprolol plasma concentrations at steady state over the 24-h dose interval : bisoprolol and metoprolol succinate estimates (95 % confidence intervals) of changes in systolic blood pressure (bpsys) values. b metoprolol versus bisoprolol the overall group effect and effects by time point were all within the range of the estimates of the 100 repeat samples. in a robust model for simulation of 24-h abpm, diurnal differences in reduction of bpsys were demonstrated in the comparison of bisoprolol and metoprolol cr / zok, though the average blood pressure reductions were the same for the two groups. the demonstrated temporal discrepancies indicate the potential for differences in the impact on the prevention of cv events and the risk of adverse effects between the two treatments. it is, however, obvious that it is caused by interference with the adrenergic system and the antagonistic effect these drugs have on the 1-receptors. thus, the effects of -blockers are dependent on the degree of receptor antagonism, which, in turn, ultimately depends on pharmacokinetic properties. the characteristic pharmacokinetic properties of bisoprolol are rapid absorption and, as consequence of delayed receptor dissociation, protracted elimination [6, 1418 ]. these two properties are well reflected in the effects of the drug, with an early peak corresponding to the maximal concentration and immediate uptake, followed by a gradual tapering off until the next dose. the pharmacokinetics of metoprolol cr / zok are dominated by a protracted uptake period extending over > 10 h and (in comparison with bisoprolol) rapid elimination, with the net result of a more flat plasma concentration curve and a less varying effect profile [5, 19 ]. thus, when compared with bisoprolol, metoprolol cr / zok is likely to have a temporally less varying blood pressure - lowering effect over the 24-h day. the average 24-h effect will be the same for the two compounds, with bisoprolol being more effective during the initial hours after drug intake and metoprolol cr / zok showing a greater impact during the latter part of the dose interval [20, 21 ]. the predilection of cv events to occur during late night and early morning periods makes it attractive for a -blocker drug to have an effect during those hours, and is an important reason why some -blockers that are efficacious as once - daily treatments for uncomplicated hypertension need to be administered twice daily in patients with ischemic heart disease. with regard to isolated blood pressure lowering, it would appear to be of value for a drug to have a pronounced effect during the early and mid - daytime to counteract the blood pressure - raising effects of daytime activities. two related factors may, however, increase the risk of adverse reactions : (1) associated -receptor - dependent adverse reactions, such as bradycardia, can contribute to symptoms such as dizziness, fatigue, and syncope ; and (2) to achieve a 24-h effect with once - daily dosing, higher doses are required, with the potential for excess effects in the hours following administration. the possibility of bisoprolol being associated with these negative effects might be suggested by results from the cibis - eld trial, where dose escalation is reported to have been hampered by bradycardia [22, 23 ]. various measures based on abpm, such as the trough - to - peak ratio and smoothness index, have been suggested as a means to assess sufficient blood pressure - lowering effects over the full 24-h dose interval. these single - item variables appear to have lost much of their attractiveness because of the undesirable properties inherent in abpm. some of these can be appreciated through the present simulation. despite a crossover model and a fairly large study emulation, some time point recordings fall outside the expected range, which, in a real study, can depending on when the random outlier occurs have important effects on the interpretation of the results. it has been suggested that smoothing by combination of measurements over several hours should be employed to mitigate these kinds of outliers [2, 4 ]. that approach, however, has the significant drawback of reducing the information on the temporal effects of the drug under investigation. alternatively, the number of pressure recordings per hour can be increased to allow for smoothed hourly values. this modality runs the risk of disturbing the diurnal blood pressure pattern of patients, particularly during the night, as the repeated cuff inflations may interfere with rest and sleep. the likely outcome is elevated pressures due to discomfort from the inflations. a second consequence of the variance of abpm recordings is shown by the bootstrapping model. both the overall between - groups effect, as well as the time point estimates, vary over wide ranges, indicating the need for large sample sizes if robust comparisons between active substances are to be obtained. an important contributor to the potential issues with abpm can be seen from simulations of individual subjects blood pressures. these outlier results will, in most instances, have to be included in the analyses, despite being unreasonable and heavily contributing to the error margins. apart from not being a prospective clinical trial, this simulation has some shortcomings that need to be taken into consideration. no raw data were available for bisoprolol, and no major abpm study has been conducted with metoprolol cr / zok. this necessitated the use of summary data for simulation, which is the common situation in many simulations. however, blood pressure has a well described distribution, and the use of individual raw data as seeds in the data generation is believed to have provided sufficient background for the generation of sufficiently representative data values. the reported variances generally reflected office blood pressure recordings or smoothed values from abpm. as these variance values were smaller than those observed in abpm of untreated patients, the variances were expanded by normally distributed random values to better emulate the distribution of observed abpm. finally, the validation bootstrap used subsamples and not full sets. this was done to make the computational process more manageable and is not believed to have had a significant impact on the reliability of the validation. in this simulation study of the effects of bisoprolol and metoprolol cr / zok on 24-h bpsys, the mean effects were the same, while the diurnal patterns differed between the two treatments. this difference may be of clinical relevance, given the recognized diurnal pattern of cv events. | objectiveto compare the effects of bisoprolol and metoprolol cr / zok (metoprolol succinate controlled release) on systolic blood pressure (bpsys) over a 24-h period in an in silico model.methodson the basis of the observed data from ambulatory blood pressure measurements (abpm), a model with an appropriate distribution and correlation structure was derived for simulation of 24-h bpsys patterns during treatment with commonly studied doses, assumed to be equipotent, of bisoprolol and metoprolol cr / zok. input into the simulations was aligned with the available data on the diurnal efficacy and pharmacology profiles of these substances. the validity of the model was tested in a bootstrap model.resultsthe simulation model reproduced the observed data with high congruence (p = 1.0). the mean 24-h bpsys values did not significantly differ between the two simulated groups (estimated overall change in bpsys [bpsys ] for metoprolol versus bisoprolol = 2.7 mmhg [95 % confidence interval 0.3 to 5.7 mmhg ] ; p = 0.08). there were clear diurnal differences, with bisoprolol being more effective earlier and metoprolol cr / zok being more effective later in the 24-h day. a validity test with 100 repeated samples gave an overall mean group difference of 1.4 3.59 mmhg (p = 0.63 relative to simulation).conclusionin a robust model for the simulation of 24-h abpm, comparisons between bisoprolol and metoprolol cr / zok indicate a comparable overall blood pressure - lowering effect but different diurnal patterns, consistent with the pharmacokinetics of the two drugs. this difference may be of clinical relevance, given the recognized diurnal pattern of cardiovascular events. |
recent advances in high - throughput sequencing technologies have enabled us to determine many genomic sequences quickly and cheaply. the use of biological sequence information has greatly facilitated the r&d process in the pharmaceutical, agricultural, medical and chemical industries (1). sequences patent owners can gain tremendous value and control over the exploitation of the sequences (2). over the past several decades, the number of patent applications containing nucleic acid or amino acid sequences has been increasing rapidly. for patent - related biological sequences, there are both public and commercial databases that provide patent information (3). public efforts are represented by genbank (4), the european molecular biology laboratory (embl) (5) and the dna database of japan (ddbj) (6). genbank obtains patent sequences from the patents issued by the us patent and trademark office (uspto). the websites of these three public databases offer patent sequence data downloading, simple keyword searching and alignment searching. in addition, patgen (7), an integrated database containing sequence data from public resources, provides access to non - redundant sequence information, as well as an abstract service. the commercial sector is led by chemical abstract service () and derwent () with their corresponding databases : cas registry and derwent geneseq. although these patent databases provide good information on patent - related sequences, they have little biological information on the sequences, except for their organism information. the mapping of the sequences and biological resources, such as gene and disease, will provide an opportunity for understanding of bio - resources ' patentable targets (8). especially, patent - related gene information can be used to identify whether a particular gene has been patented or published and to reveal if a patent has been infringed upon (9). recently, jensen and murray (10) reported that 20% of human genes have been claimed as us intellectual property from the analysis of the sequences in us patents with bioinformatical methods. however, they used only the sequences at genbank, and their analysis was focused on human genes. according to their knowledge, no attempt has been made to annotate the biological sequences in patents or applications thoroughly and to analyze them from a biological perspective. in this report, we describe patome, a database server containing the patent - related biological sequences and their analysis data. to build patome, we downloaded sequence data from publicly available databases and created a non - redundant sequence set. the non - redundant sequences were annotated with refseq (11) and associated with entrez gene (12), the online mendelian inheritance in man (omim) (13) and gene ontology (go) (14). the annotation results and the analysis data were integrated into a relational database and served via web - based user interfaces. we downloaded the sequences from the patent divisions of genbank (), embl (), and ddbj (). sequence data were also obtained from the world intellectual property organization (wipo) () and the publication site for issued and published sequences (psips) database () maintained by uspto. as psips does not provide a conventional ftp service, we downloaded sequence listings one - by - one from the psips search interface. all the sequences obtained were derived from the sequence listings disclosed in the issued patents or published patent applications mainly in usa, japan, europe and by wipo. we created a non - redundant sequence set by removing the redundancy in the five databases. if the sequences had the same publication number and the same seqid, they were considered duplicates. as on june 1, 2006, the number of non - redundant sequences were 38 151 115, including 34 762 740 nucleic acid sequences and 3 388 375 amino acid sequences. in the non - redundant sequences, there is a large number of short fragments, which are mostly primers or synthetic constructs. therefore, we excluded the nucleic acids (80% of that of the matched refseq sequence. the partial - length type is defined if an alignment length is > 95% of that of the query sequence, except full - length types. blast alignments should be either full - length or partial - length type to go through the filtering. from the filtered blast results, the sequence function was assigned with the best refseq hit. of the 8 471 504 nucleic acid sequences, 1 075 764 (13%) were annotated with refseq mrnas or microbial mrnas. of the 2 470 671 amino acid sequences, 1 486 625 (50%) were annotated with refseq proteins. the filtered blast results were saved as an annotation table that consists of the patent information (publication and seqid) and the annotation information (refseq number, alignment length, alignment coverage and type, and e - value). refseq numbers of the annotation table served as a bridge to link the disclosed sequences and gene information, whose association can be represented as a gene patent table that contains genes and their related patent sequence information. to build the gene patent table, we extracted linking information between the sequences and the corresponding refseq number from the annotation table, and their relationship was translated to a gene entrez gene also has cross - link information to other biological databases represented by gene2go and mim2gene files. for example, if two sequences from a seqid 39020 of wo0171042 and a seqid 20352 of us6703491 are assigned a refseq number, nm_143536, in the annotation table, it means that the refseq number, nm_143536, was linked to the two sequences. as the refseq number, nm_143536 was cross - linked with a geneid 43614 in the gene2refseq, we can conclude that the geneid, 43614 was disclosed twice in issued patents or patent applications. from the analysis of the sequences, we found that 55% of the human genes were associated with patents or patent applications, the highest percentage among organisms. oryza sativa (rice) ranked second with 25% (12 045 genes). the summary of patent - related genes in the major organisms is shown in table 1. for the gene patent analysis, it is necessary to distinguish sequences of granted patents from those of patent applications (18). in this study, the sequences were derived from either issued patents or published patent applications. accordingly, it can not be guaranteed that the genes appearing in the gene patent table are patented. summary of patent - related genes in the major organisms the number of genes is from ncbi entrez gene. we downloaded the sequences from the patent divisions of genbank (), embl (), and ddbj (). sequence data were also obtained from the world intellectual property organization (wipo) () and the publication site for issued and published sequences (psips) database () maintained by uspto. as psips does not provide a conventional ftp service, we downloaded sequence listings one - by - one from the psips search interface. all the sequences obtained were derived from the sequence listings disclosed in the issued patents or published patent applications mainly in usa, japan, europe and by wipo. we created a non - redundant sequence set by removing the redundancy in the five databases. if the sequences had the same publication number and the same seqid, they were considered duplicates. as on june 1, 2006, the number of non - redundant sequences were 38 151 115, including 34 762 740 nucleic acid sequences and 3 388 375 amino acid sequences. in the non - redundant sequences, there is a large number of short fragments, which are mostly primers or synthetic constructs. therefore, we excluded the nucleic acids (80% of that of the matched refseq sequence. the partial - length type is defined if an alignment length is > 95% of that of the query sequence, except full - length types. blast alignments should be either full - length or partial - length type to go through the filtering. from the filtered blast results, the sequence function was assigned with the best refseq hit. of the 8 471 504 nucleic acid sequences, 1 075 764 (13%) were annotated with refseq mrnas or microbial mrnas. of the 2 470 671 amino acid sequences, 1 486 625 (50%) were annotated with refseq proteins. the filtered blast results were saved as an annotation table that consists of the patent information (publication and seqid) and the annotation information (refseq number, alignment length, alignment coverage and type, and e - value). refseq numbers of the annotation table served as a bridge to link the disclosed sequences and gene information, whose association can be represented as a gene patent table that contains genes and their related patent sequence information. to build the gene patent table, we extracted linking information between the sequences and the corresponding refseq number from the annotation table, and their relationship was translated to a gene patent table by using a gene2refseq file from the entrez gene database. entrez gene also has cross - link information to other biological databases represented by gene2go and mim2gene files. for example, if two sequences from a seqid 39020 of wo0171042 and a seqid 20352 of us6703491 are assigned a refseq number, nm_143536, in the annotation table, it means that the refseq number, nm_143536, was linked to the two sequences. as the refseq number, nm_143536 was cross - linked with a geneid 43614 in the gene2refseq, we can conclude that the geneid, 43614 was disclosed twice in issued patents or patent applications. from the analysis of the sequences, we found that 55% of the human genes were associated with patents or patent applications, the highest percentage among organisms. oryza sativa (rice) ranked second with 25% (12 045 genes). the summary of patent - related genes in the major organisms is shown in table 1. for the gene patent analysis, it is necessary to distinguish sequences of granted patents from those of patent applications (18). in this study, the sequences were derived from either issued patents or published patent applications. accordingly, it can not be guaranteed that the genes appearing in the gene patent table are patented. summary of patent - related genes in the major organisms the number of genes is from ncbi entrez gene. patome database server is composed of a web interface and an mysql database management system. the web interface is implemented in static html pages, java server pages (jsp) () and servlet () programs for database searching. mysql is used to store the disclosed sequence information and their annotation and analysis data. the querying interface allows the user to search against the patent sequence data and their analysis data. the patent sequence data can be searched by patent (or application) number, genbank accession number and title. the search results consist of sequence information (length, type, organism, sequence), annotation information (refseq, gene, go, omim, coverage) if it exists and the same sequences information as a query. the analysis data search interface allows the user to search for the gene name (or symbol), entrez gene i d and refseq number. in addition, the logical operators, or () and and (&), can be used to combine search words in the title and gene searches. (b) output of both patent (or application) number and seqid search. the display of search results also contains outgoing links to external databases for sequences and patents. for example, patent (or application) numbers are linked to the uspto database () for us patents or applications, and the esp@cenet patent database server () at the european patent office for the others. gene names in the search output are linked to entrez gene and reactome (19). the data are presented in simple tab - delimited text file (for easy parsing of the data). this includes the national (including wipo), length and organism distributions of the sequences. we also present statistics on gene - associated patents of major organisms in the homepage. | with the advent of automated and high - throughput techniques, the number of patent applications containing biological sequences has been increasing rapidly. however, they have attracted relatively little attention compared to other sequence resources. we have built a database server called patome, which contains biological sequence data disclosed in patents and published applications, as well as their analysis information. the analysis is divided into two steps. the first is an annotation step in which the disclosed sequences were annotated with refseq database. the second is an association step where the sequences were linked to entrez gene, omim and go databases, and their results were saved as a gene patent table. from the analysis, we found that 55% of human genes were associated with patenting. the gene patent table can be used to identify whether a particular gene or disease is related to patenting. patome is available at ; the information is updated bimonthly. |
since the special quartz fiberoptic transmission system was developed, it is possible to apply laser energy through a flexible fiber endoscope. after the first use of the endoscopic laser for the treatment of active gastrointestinal bleeding in 1975, by fruhmorgen, endoscopic laser therapy has been widely used, not only for the treatment of acute gastrointestinal bleeding and non - bleeding gastrointestinal angiodysplasia, but also for the treatment of gastrointestinal neoplasm. in our experience, the use of the endoscopic nd - yag laser for the removal of protruding, broad - based polyps of the stomach is efficient and safe. twelve patients with broad - based gastric polyps which protruded submitted to the removal of the polyps with an endoscopic nd - yag laser (table 1). the quartz fiber with a polyethylene sheath was guided through the biopsy channel of a prototype panendoscope, gif - q10, and gif-2 t. a filtering lens was attached to the eyepiece of the endoscope to prevent damage to the operator s eye from the laser beam. multiple 0.5 sec pulse irradiation of the nd - yag laser (medilas yag, germany), with a power of 60 watts, at the tip of the quartz fiber were utilized. the flexible light guided assembly was quartz fiber with a diameter of 600 m, a length of 34 m, and a divergence angle of 8. the application number of laser energy was from 6 to 58 depending on the location and size of the lesion (table 1). after the laser application, an h2 receptor antagonist (ranitidine) for laser - induced ulcers was administered perorally for four weeks routinely, and all patients except one were submitted to a follow - up gastroscopy 1 week and 5 weeks after the laser application (table 2). from january to november 1985, endoscopic nd - yag laser treatment was utilized to eradicate gastric polyp in 12 patients. the male to female ratio was 1:1.4 (male : 5, female : 7), and ranging, in age from 34 to 70 with a mean of 50 years (table 1). the most frequent presenting symptoms initiating the diagnostic work up were epigastric discomfort, indigestion or nausea. the presence of gastric polyp was confirmed by endoscopy and by upper gastrointestinal contrast study. the most frequent location for the polyp was in the antrum (7 cases) and followed by the fundus (5 cases). multiple polyps were noted in two cases and they were located in the body or antrum of the stomach. the number of polyps of type i (yamada classification) was 7, type ii, 5 ; type iii, 2 ; and type iv, 1 (table 1). the size of the lesions treated with the laser ranged from 0.2 cm to 1.0 cm in diameter. the application number of laser energy was from 6 to 58, while the small lesions of the 10 patients were completely ablated by the first endoscopic laser therapy, the other two lesions of the two patients required repetitive laser treatment to achieve complete ablation of the lesion (table 2). during and after endoscopic laser therapy, no complication were encountered except for mild bleeding and occasional mild epigastric burning pain in the case of two of the patients. follow - up endoscopy in all patients, which was done at the ends of the first and fifth weeks after the laser application, revealed no new polyp formation or recurrence. all patients had residual ulcers at the end of the first week postopolypectomy, but all ulcers were healed by the end of the fifth week of follow - up (table 2). with the development of a flexible fiberoptic system, diagnostic and therapeutic endoscopy is playing a major role in the management of gastrointestinal polyps. a review of several studies has revealed the incidence of adenomatous polyps of the stomach to be 0.4% to 0.7%. although the term gastric polyp has been used to refer to any protrusion into the gastric lumen, recent experience has led to classification schemes based on topographic, histologic, and vital staing criteria. the most frequently encountered gastric polyp, hyperplastic or regenerative polyp, is reported to contain malignancy rarely. the incidence of malignant change in adenomatous polyp has been reported to be from 6 to 75 percent. the malignant potential appears to be related to the size of the polyp, with larger adenoms (particularly those greater than 2 cm) having a greater potential for malignant change. at the mayo clinic, patients were offered endoscopic polypectomy if the gastric polyps had been diagnosed and they met one of the following criteria. unchanged or enlarging gastric polyp on serial upper gastrointestinal contrast studies.expected noncomplaint patient follow-up.previous gastric surgical procedure with the presence of a new polyp.a gastric polyp in a patient known to have pernicious anemia. unchanged or enlarging gastric polyp on serial upper gastrointestinal contrast studies. previous gastric surgical procedure with the presence of a new polyp. a gastric polyp in a patient known to have pernicious anemia. one of the known procedures for the ablation of gastric polyps by endoscope is electro - coagulation with a snare. the complications that can ensue from this snare excision method are bleeding, perforations and ulceration, and broad based, protruding polyps (such as the yamada classification type i or type ii lesions) are technically difficult to excise by this method. in the last few years, the use of endoscopic laser for the therapy of gastrointestinal disease has grown exponentially, due to its therapeutic benefit and safety. the nd - yag lasers are no longer thought of as being investigational for therapy. there are 3 main indications for their use : acute gastrointestinal bleeding.non-bleeding gastrointestinal angiodysplasia.gastrointestinal neoplasm, where palliation is needed. acute gastrointestinal bleeding. the application of the nd - yag laser in the treatment of gastrointestinal disorder is still in an evolutionary process. one area of interest is the treatment of inoperable neoplasm of the esophagus, stomach, duodenum, and colon. palliative therapy with an nd - yag laser is indicated for obstructing symptoms, bleeding from the malignancy, and tumor bulk. the patients with polyps of the gastrointestinal tract, also, have been successfully treated with it. the number of serious complications, which can occur during therapy with laser energy, have been impressively few. rosch and fruhmorgen have reported the efficacy of using the endoscopic argon laser for the gastric borderline lesions and early, protruding gastric carcinoma. however, there is a tendency toward using the nd - yag laser because of its greater power output. anthony a. goossens and his fellow investigators reported that the argon laser emits a beam which has lower surface absorption and tissue healing than other lasers, making it ideal for ophthalmological work where high surface tissue absorption is not desired and thermal coagulation at shallow depth is, but since nd - yag lasers emit a beam which has low surface absorption and penetrates tissue to more depth than the argon laser beam does, there is enough energy to overcome the dynamic condition of tissue to allow more deep thermal coagulation, tissue destruction, and tumor removal (table 3). osamu kato and his associates reported a case of broad - based, protruding gastric borderline lesions, which was successfully treated, using the endoscopic nd - yag laser. we ablated broad - based, protruding gastric polyps of 12 patients without complications, such as the bleeding or perforations, which can ensue from snare excision. we, therefore, emphasize that endoscopic nd - yag laser therapy is an effective and safe method of treatment for ablation of broad - based, protruding polyps of the stomach. however, long term follow up study should be done, because laser therapy precludes a total biopsy. | with the development of a special quartz fiberoptic transmission system, the application of laser energy through an endoscope became possible. now, endoscopic laser therapy is widely used for gastrointestinal bleeding, and gastrointestinal neoplasm, and we have removed broad - based gastric polyps using an endoscopic nd : yag laser in 12 patients between january and december 1985.the size of the polyps ranged from 0.2 cm to 1.0 cm in diameter. the most frequent location for the polyp was in the antrum (7 cases) and followed by the fundus (5 cases).the application number of laser energy was from 6 to 58 and the small lesions of the 10 patients were completely ablated by the first endoscopic laser therapy.follow-up endoscopy in all patients revealed no new polyp formation, but all patients had a residual ulcer at the end of the first week post polypectomy, and ulcers were healed by the fifth week of follow up. |
metabolic pathway models consist of enzymatic reactions described by their stoichiometry, the enzymatic rate laws, and their kinetic constants (such as, for instance, equilibrium constants or catalytic constants). the more we know about these quantities, the more reliably we can simulate the metabolic dynamics. kinetic laws of individual enzymes have been studied experimentally for about 100 years,(1) and metabolic control theory,(2) a theoretical apparatus for the analysis of metabolic systems, has been developed since the 1970s. recently, comprehensive web databases, advances in high - throughput experiments, and inexpensive computing power have led to a new interest in metabolic modeling. in particular, the numerous large - scale metabolic networks reconstructed from sequenced genomes call for automatic routines that can fill these networks with enzymatic rate laws and turn them into dynamic models. unfortunately, the enzymatic mechanisms and the rate laws of most enzymes are unknown, and it is laborious to determine them exclusively by enzyme assays. a pragmatic solution is to substitute missing kinetic laws by standard rate laws, such as mass - action kinetics, generalized mass - action kinetics,(6) or linlog kinetics. here, we will use the common modular rate law,(9) a generalized version of the reversible michaelismenten rate law, suitable for any reaction stoichiometry and accounting for various types of allosteric regulation. once a metabolic network and enzymatic rate laws have been chosen, we need numerical values for the kinetic constants. this can be a challenge, especially for large networks. modelers can find known kinetic constants in published models, in the literature, or in public web resources such as sabio - rk,(10) brenda,(11) and nist. as pointed out by alberty,(14) varying conditions such as ph or salt concentrations can be taken into account by describing biochemical reactants and reactions in terms of transformed thermodynamic quantities. in the future, automated enzyme assays might provide more kinetic data, but they will still not reach the speed at which metabolic networks are reconstructed from newly sequenced genomes. available kinetic data may not be suited for a model if they are contradictory or measured under inappropriate conditions (e.g., ph values and temperatures). furthermore, data collected from various sources are very unlikely to represent a thermodynamically consistent set. since incompleteness of the kinetic constants remains a major obstacle, methods for guessing unknown kinetic constants or adjusting the known values will become increasingly important. here, we present parameter balancing, an approach to infer complete and consistent sets of model parameters from incomplete, inconsistent kinetic data. this is only possible due to mutual dependencies between the kinetic constants and other model parameters, arising from their definitions or from thermodynamic laws (wegscheider conditions(15) and haldane relationships). in a simple approach, incomplete kinetic data sets could be complemented by inserting all available values into the model and adding other quantities that can be directly computed from them. however, this might leave parameters undetermined and would not eliminate inconsistencies between the original data values. as a better strategy, we determine parameter sets that are consistent by construction and resemble the original data as closely as possible. since these values may not be uniquely determined, we have to restrict them to plausible ranges and quantify the remaining uncertainties by error bars. we have previously suggested(16) implementing this parameter balancing approach in a bayesian statistical framework(17) and based on standard rate laws.(9) the critical step is to identify a set of independent model quantities that can be freely selected during parameter fitting, sampling, or optimization and from which all remaining quantities can be easily computed. after establishing this dependence scheme for a wide range of kinetic constants and metabolic quantities, we obtain a relatively general and simple data integration method that can guarantee consistent parameter sets. here, we use more general formulas and present an interactive online workflow for models in sbml format (systems biology markup language,(18)www.sbml.org), then illustrate its use with an example case. parameter balancing exploits the fact that kinetic model parameters often share mutual dependencies, either by their definition or because of thermodynamic constraints.(16) for kinetic models with modular rate laws(9) and many other rate laws, the model parameters can be split into two subsets : a set of independent basis quantities that can be chosen arbitrarily and a set of derived quantities that can be computed from linear combinations of the basis quantities. as a simple example, let us consider the concentration and the amount of a substance within a cellular compartment. the amount a can be computed from the concentration c and the compartment volume v by the formula a = cv. if we choose (e.g., guess, sample, fit, or optimize) all three model parameters independently, this dependence will be violated. of course, this problem is easy to avoid : we just need to treat a as a derived quantity to be computed from the basis quantities c and v. on a logarithmic scale, we obtain the simple linear dependence scheme ln a = ln c + ln v. in parameter balancing, we do exactly the same thing, but treat all quantities of a (possibly large) kinetic model at the same time. in addition, we consider not only dependencies arising from quantity definitions, as in this simple example, but also more involved dependencies arising from the laws of thermodynamics. the resulting dependence scheme consists of many linear equations, emerging from a thermodynamic and kinetic analysis of the rate laws. for practical calculations, these equations are represented by a large, sparse matrix to be constructed from the metabolic network. initially, the basis quantities are estimated from data by a linear regression model that follows directly from the dependence scheme. following this, the estimation is based on bayesian statistics, combining the data with prior distributions for all model parameters, which can be selected to incorporate general knowledge about plausible values. accordingly, parameter balancing yields not only point estimates but also posterior distributions, from which mean values, variances, correlations, and even random samples of all relevant quantities can be obtained. on the basis of our practical experience, we have extended the original parameter balancing approach in three major ways : (1) our model quantities comprise not only kinetic constants, but possibly also metabolite and enzyme concentrations for one or more metabolic states. from their values, we can derive other state - dependent quantities ; in particular, the chemical potentials and reaction affinities. the reaction affinities describe how strongly chemical reactions deviate from their equilibrium and predetermine the reaction directions. (2) in biochemical reactions, individual protonation states of a molecule (chemical species) are usually subsumed in a single reactant concentration. as pointed out by alberty, these reactants should be described by transformed thermodynamic quantities, which effectively depend on the ph value and on salt concentrations. in our approach, quantities such as equilibrium constants, gibbs free energies, and chemical potentials are given as transformed values, depending both on temperature and on ph. if experimental values stem from measurements under incompatible conditions, the discrepancies can be corrected during parameter balancing. (3) although prior distributions can help to define plausible ranges for the basis quantities, they are not applicable to the derived quantities. as a consequence, whenever few data on these quantities are available, their large uncertainties lead to unreasonable balancing results. we address this problem by augmenting the experimental data set with fictitious pseudo values, playing a role similar to the prior distributions. they allow the modeler to control the variance of the independent values and, thus, the reliability of the whole estimate. a detailed description of the original method and all new features is given in the supporting information. for practical use, we have implemented an interactive workflow for sbml models, allowing the user to balance the parameters and to replace or complete kinetic rate laws in the model. three kinds of information are needed as an input : the network structure, which is obtained from the sbml file, the mathematical rate laws, which are chosen from the list of modular rate laws,(9) and a table with collected kinetic constants and other relevant data (for an example, see figure 1 and table 1). in the model, enzymes and allosteric activators and inhibitors the quantity types are defined as in the systems biology ontology,(21) and the names of the reactions and species refer to ids in the sbml model. all this helps the process to run in an almost fully automated manner. for further details, the model structure is defined by the sum formula f6p + atp fbp + adp with the molecular species f6p (fructose 6-phosphate), fbp (fructose 1,6-bisphosphate), atp (adenosine triphosphate), and adp (adenosine diphosphate). in our parameter balancing workflow, the stoichiometry is provided as an sbml file, and kinetic constants (shown in flags) are read from a separate data file (see table 1). the constants shown suffice to define a common modular rate law,(9) which we use as a standard rate law. at the end of the workflow, kinetic rate laws with a set of balanced parameters are inserted into the sbml model. as a result of balancing, most parameters are represented by normal distributions of their logarithmic values. when converting these values back to nonlogarithmic scale, we obtain log - normal distributions and need to carefully distinguish between their arithmetic and geometric mean values. to insert the most probable parameter set into a model, we choose the median values of the nonlogarithmic parameters, which are identical to the geometric mean. in addition, we can sample additional logarithmic parameter sets from the normal distribution, convert them back by applying the exponential function, and insert them into the model. in the supporting information, we discuss a number of possible extensions, such as handling of identical species in different compartments, electrochemical potentials, cell compartments with different ph values, forward and reverse reaction rates, use of correlated priors, use of equilibrium constants as basis quantities, and prescribed reaction directions. the web site also contains the documentation and a number of example models, including the phosphofructokinase reaction discussed below. at the beginning of the workflow, the user uploads an sbml model,(18) defining the network structure (see figure 1) as well as a formatted data table (see table 1) listing the known kinetic constants and other quantities relevant for the model. after uploading both files, the data can be filtered for a specific source organism, and missing standard errors are completed by default values. then, a table of relevant model quantities is produced, with blank rows where data are missing and averaged values where more than one data point was available. the standard chemical potentials or equilibrium constants measured under different temperature or ph are not averaged, but kept as separate values. as a second source of information, we use prior distributions, describing our general expectation about the quantity types. such priors can be derived from the typical ranges of kinetic constants found in the literature. on the basis of the prior distributions and pseudo values chosen by the user, a set of model parameters, the user can also choose between several simpler methods for data completion : (i) completing all missing quantities by the prior means and widths (for missing basis quantities) or by pseudo values and their standard errors (for missing derived quantities), leading to complete, but inconsistent parameter sets ; (ii) completing all missing basis quantities by prior values and computing all derived quantities by the dependence scheme ; (iii) completing all missing derived quantities by pseudo values, followed by balancing without pseudo values ; or (iv) balancing without pseudo values. afterward, the user can choose a rate law from the list of modular rate laws(9) that will be inserted into the sbml file. the parameter values represent either median values or random samples from the posterior distribution. finally, the balanced quantities and the completed model are exported, respectively, as a data table and as a fully parametrized sbml file. we have tested parameter balancing with medium - scale models of central metabolism : yeast glycolysis models by teusink.(22) and hynne.(23) and a model of metabolism in pancreatic beta cells.(24) the original models, the collected data, and the balancing results for all models can be found at www.semanticsbml.org in the online documentation. for simplicity, we consider here a small model of the phosphofructokinase reaction, a key step in upper glycolysis : the enzyme phosphofructokinase (pfk), which transfers a phosphate group from atp (adenosine triphosphate) to fructose 6-phosphate (see figure 1), has been studied extensively, but the databases brenda,(11) nist,(13) and sabio - rk(10) do not contain a complete kinetic data set for a reversible rate law. therefore, we pretend that the kinetic law of pfk is unknown, apply parameter balancing to the pooled data from several organisms, and compare the results to parameters from published kinetic models for the baker s yeast saccharomyces cerevisiae. our sbml model for the pfk reaction, including miriam - compliant annotations, was automatically constructed from the kegg(27) reaction identifier r04779 with the tool semanticsbml(28) (accessible at www.semanticsbml.org). then, we collected data from the databases sabio - rk,(10) brenda,(11) nist,(13) and yeastgfp(29) and from publications by nissler.,(30) albe.,(31) and alberty.(20) the preprocessed data are shown in table 1. for the concentrations of fructose 6-phosphate and fructose 1,6-bisphosphate, we inserted pseudo values (arithmetic mean values arising from geometric mean values 0.5 and 1 mm, respectively, with a broad standard deviation of 0.5 for the decadic logarithms). some of the values were obtained by averaging over several data values measured in different organisms. the set of balanced parameters, obtained with the default workflow settings, is shown in table 2. for abbreviations, see figure 1. data taken from alberty,(20) yeastgfp,(29) nissler.,(30) nist,(13) brenda(11). a comparison with values from the literature and existing models the maximal velocity of the phosphofructokinase, mainly determined by a broad prior on catalytic constants and by an experimentally derived count number of the enzyme molecules, remains within a sensible range of the values from the literature (0.006 mm / s). we find the equilibrium constant to be much lower (0.072) than the one estimated by teusink.(22)(80), which is clearly due to the small input value (0.08) from nissler.(30) finally, the balanced inhibition constant for atp (0.376 mm) lies within a sensible range of the one found in sabio - rk(10) (1.09 mm), but is nonetheless a little lower, since the input data value (0.396 mm) is lower, as well. the equilibrium constants play a central role in parameter balancing and their numerical values primarily arise from measured values and from known standard chemical potentials. to incorporate their dependence on ph values, we reran the balancing with input data containing equilibrium constants measured at different temperatures and ph values (see table 5). instead of just averaging over them (as for other duplicate values), parameter balancing can adjust the values to a certain target temperature and ph value chosen by the user. the aim is, of course, to describe in vivo conditions considered in the model. when choosing a target temperature of 300 k and a target ph value of 7, we obtained a balanced equilibrium constant k = 0.19397. since the input measurement conditions (average ph, 7.7 ; average temperature, 303.82 k) differ from the desired conditions (ph, 7 ; temperature, 300 k), the input value for the equilibrium constant (k = 0.02923) changes significantly after parameter balancing. when we choose target conditions closer to the data measurement conditions (ph, 7.7 ; temperature, 304 k), the balanced value k = 0.19393 moves slightly closer to the data value. finally, we tested what would happen without any direct information on equilibrium constants. when we remove all data and pseudo values for the equilibrium constant, we obtain abnormally high values for the majority of the derived parameters. even though equilibrium constants can in principle be obtained from standard chemical potentials, this result indicates that the remaining uncertainty may be extremely large, and pseudo values are an efficient way to limit the ranges of balanced values. parameter balancing can also be applied to models of bigger size. due to the large amounts of data that are produced, the result tables are not included in this publication. instead, the detailed kinetic data for the models of teusink.(22) (17 reactions, computing time 0.29 s), hynne.(23) (24 reactions, computing time 0.50 s), and jiang.(24) (45 reactions, computing time 2.32 s) can be found, downloaded, and used on our web site www.semanticsbml.org. nevertheless, the rising resource demands of bigger models can be a limiting factor. in the supporting information the example of the phosphofructokinase reaction shows that parameter balancing can produce consistent estimates on kinetic constants in plausible ranges and close to available input data. in the spirit of bayesian statistics, we do not estimate the unknowns by averaging over the data, but by fitting the data with a statistical model ; in our case, produced from the dependence scheme. one advantage is that such a model can handle not only uncertainties of individual quantities, but also correlated uncertainties arising from parameter dependencies. of course, this approach strongly depends on the collected input data and on the chosen prior distributions. in situations when input data are missing as a side effect, balancing will shift all the values even if data are available for a certain quantity toward the center of the prior distribution and toward the pseudo values, as can be seen in the example shown in tables 3 and 4. if this effect is unwanted, there are two possibilities to avoid it : on one hand, experimental values can be fixed by assigning small standard errors to them ; on the other hand, our workflow also provides the possibility to replace unknown values by prior or pseudo values without further balancing. the median posterior values obtained from balancing can be used as point estimates, but we can also sample parameter sets from the posterior distribution. studying models with sampled parameters can be an emergency solution if few data are available, but it is also a convenient way to explore the dynamics in metabolic networks for a wide range of kinetic parameters and to discern the influences of network structure and kinetics on the dynamic behavior. parameter balancing is a general approach that could be applied to any physical model as long as all parameters fit into a linear dependence scheme. for kinetic models, we could establish linear dependencies for most relevant quantities, considering some of them on logarithmic scale. the choice of model parameters to be balanced is not fixed, but can depend on the specific situation (for a variety of possible variants, see the supporting information). in the scheme presented here, the equilibrium constants are derived from standard chemical potentials, which allows us to incorporate data or predictions of gibbs free energies of formation ; a general alternative, with even fewer parameters, would be to express all equilibrium constants by a set of independent equilibrium constants (see the supporting information). however, since model identifiability is guaranteed by the usage of prior distributions, keeping the number of parameters small is usually not crucial. some of the constants (for instance, the inhibition constants) are independent of all other parameters and could therefore be balanced separately, but as long as the parameter set is not too large, it turned out to be practical to account for all kinetic constants and metabolic data in one large dependence matrix. the reaction rates would be the most important target but do not fit into the scheme. in the future, their signs and the individual forward and once a subset of the flux directions have been predefined, available data on metabolite levels can directly contribute to the balancing of kinetic constants and thereby improve the estimation results. arguably, the most critical point in our approach is the use of heterogeneous data from different sources. ideally, all kinetic constants used in a model should stem from measurements under the same, standardized, nearly in vivo conditions. since such data are rarely available, modelers often need to utilize heterogeneous data collected from literature and databases, acknowledging that this may cause various problems. first, kinetic constants measured in vitro and in vivo differ due to different ph values, temperatures, salt concentrations, or other factors. although we attempt to take these conditions into account, it may be difficult to apply corrections, since the exact conditions in living cells are not known. second, most kinetic models neglect the complexity of the cell (e.g., molecular crowding, channeling, inhomogeneous localization of enzymes). since the kinetic parameters in such models describe an effective behavior (e.g., averaged over different cell compartments), they will differ from the values measured in vitro. third, there are different conventions for reaction formulas (e.g., h ions and h2o molecules may or may not be listed) and about the standard concentration c (in our case, 1 mm). since the definition of transformed equilibrium constants crucially depends on the reaction formulas, it is important that model and data sources use the same, appropriate conventions. finally, if kinetic constants are taken from existing models, their values may become invalid out of this specific context. thus, especially for poorly identifiable parameters, it is important to consider the uncertainties in the original estimations. facing these difficulties, parameter balancing follows a pragmatic approach : even if data have a low quality, we may still use them as clues about unknown parameters. if a quantity has been measured under the wrong conditions, we may account for this by increasing its standard error. on one hand, this will decrease the weight of this data point in the balancing process ; on the other hand, the uncertainty of all related balanced parameters will increase, reflecting our precautionary approach. in some cases, we may need to assign very small uncertainties to some of the input data. for instance, if an sbml model contains kinetic laws and we intend to replace only some of them, we have to make sure that the new rate laws are compatible with those pre - existing rate laws that will remain in the model. as a key precondition, all equilibrium constants in the resulting model need to satisfy the wegscheider conditions.(15) to ensure this, one can determine the equilibrium constants of the existing rate laws and use them as input data (with zero standard error) in parameter balancing. due to the large uncertainties in standard chemical potentials and metabolite concentrations, it is unlikely that models obtained from parameter balancing will directly show realistic stationary flux distributions. in the future, this could be enforced by a subsequent fit to omics data(16) or by predefining the signs of reaction affinities. these signs will induce dependencies between kinetic and metabolic quantities ; for instance, between the standard chemical potentials and the metabolite concentrations. if several metabolic states are treated within the same dependence scheme, the resulting method would resemble network - embedded thermodynamic analysis(32) and allow to use the results of previous fluxome and metabolome analysis (by flux - balance methods including thermodynamic constraints) as input data for parameter balancing. parameter balancing yields consistent and complete parameter sets for kinetic models, as a potential starting point for further modeling. it can integrate incomplete and contradictory input data and respects constraints implied by common modeling assumptions (standard rate laws ; reactants in ideal, dilute solution). if few input data are available, parameter balancing can help to quantify the remaining uncertainties, whereas with more and higher - quality data, the predictions become more trustworthy and precise. the resulting posterior distribution can be used to define parameter ranges, to sample possible parameter sets, or to be reused as a prior for following rounds of parameter balancing. | kinetic modeling of metabolic pathways has become a major field of systems biology. it combines structural information about metabolic pathways with quantitative enzymatic rate laws. some of the kinetic constants needed for a model could be collected from ever - growing literature and public web resources, but they are often incomplete, incompatible, or simply not available. we address this lack of information by parameter balancing, a method to complete given sets of kinetic constants. based on bayesian parameter estimation, it exploits the thermodynamic dependencies among different biochemical quantities to guess realistic model parameters from available kinetic data. our algorithm accounts for varying measurement conditions in the input data (ph value and temperature). it can process kinetic constants and state - dependent quantities such as metabolite concentrations or chemical potentials, and uses prior distributions and data augmentation to keep the estimated quantities within plausible ranges. an online service and free software for parameter balancing with models provided in sbml format (systems biology markup language) is accessible at www.semanticsbml.org. we demonstrate its practical use with a small model of the phosphofructokinase reaction and discuss its possible applications and limitations. in the future, parameter balancing could become an important routine step in the kinetic modeling of large metabolic networks. |
flaccidity appears during the early stage after stroke ; however, as time passes, it is accompanied by spasticity, which occurs in 90% of stroke patients. in particular, spasticity of the ankle plantar flexor disrupts static and dynamic balance, as well as the normal gait pattern1, 2. shortened calf muscles in individuals with hemiparesis cause ankle joint stiffness, increase its hypomobility and resistance to mobility, and decrease passive joint mobility, which ultimately causes limitation of the ankle joint3, 4. abnormal muscle tension and movement limitation due to muscle weakness of the ankle joint cause limitation of functional activities such as changing from a sitting position to standing, locomotion, and climbing stairs5. stroke patients have difficulty in standing up without help, and difficulties in negotiating obstacles start to emerge during walking6. one of the reasons for the decrease in gait speed and asymmetric gait in hemiplegic patients is the limitation of passive and active movements due to structural changes in the connective tissue and articular capsule around the ankle joint7. the motor function of the ankle joint greatly affects balance and walking abilities. in addition, improvement of walking ability is a major goal in patients undergoing stroke rehabilitation8. manual therapy is widely used and advocated for many aspects of peripheral joint dysfunction. mulligan s mobilization with movement (mwm) technique is commonly used in musculoskeletal physiotherapy. the recently developed manual therapy techniques include brian mulligan s widely used mwm for peripheral joint pain, which has been shown to improve range of motion and promote earlier return to function after lateral ankle sprain9, 10. the clinical efficacy of mulligan s mwm technique is also applicable to the mwm technique for talocrural dorsiflexion, which is frequently used to improve talocrural dorsiflexion deficits that often occur after lateral ankle sprain10. the mechanisms behind the effectiveness of mwms are based on mechanical dysfunction and therefore on positional fault correction12. thus, the purpose of this study was to verify whether mulligan s mwm technique improve the temporal and spatial variables of the gait of individuals who had a stroke. the study participants were chosen from among 24 stroke patients who were undergoing physical therapy at a rehabilitation hospital. the participant selection criteria were as follows : those who had hemiparesis due to stroke with onset at > 6 months, the ability to follow verbal instructions, the ability to communicate at a certain level, recovered the motor functions of their paretic lower limbs at brunnstrom stage 24, and a score of > 24 points on the mini - mental state examination - korean. patients were excluded if they had a neurological condition, orthopedic disease, or visual impairment. all the patients who participated in this trial provided their written informed consent after receiving a full explanation of the expected results and side effects of the intervention. the present study was approved by the sahmyook university institutional review board (syuirb2015 - 114). the 24 subjects were randomly assigned to either mulligan s mwm group (mwm ; n=12) or a weight - bearing with placebo mwm group (control ; n=12). the general characteristics of the 12 subjects in the experimental group were as follows : 6 males and 6 females ; a mean age of 41.58 years ; a mean height of 165.67 cm ; a mean weight of 62.42 kg ; and a mean time since stroke onset of 8.87 months ; right- and left - side hemiplegia in 8 and 4 cases, respectively. the characteristics of the 12 subjects in the control group were as follows : 6 males and 6 females ; a mean age of 53.0 years ; a mean height of 164.58 cm ; a mean weight of 60.67 kg ; and a mean time since stroke onset of 10.46 months ; and right- and left - side hemiplegia in 5 and 7 cases, respectively. the participants in the experimental group performed mulligan s mwm technique at 5 sets of 10 glides a day, 5 times a week for 4 weeks. the participants in the control group performed lunges in the same conditions as the experimental group. the participants in the control group were trained for 5 sets of 10 lunges a day, 5 times a week for 4 weeks. before the intervention, all the participants received conventional physical therapy for 30 minutes per day, 5 days per week over a 4-week period. each gliding involved 10 seconds of posterior talar glide with dorsiflexion and 5 seconds of resting between the gliding. the therapist applied a sustained posteroanterior glide to the tibia through the belt by leaning backward while the talus and forefoot were fixed in the space between the thumb and the second finger of the right hand. the other hand was positioned anteriorly over the proximal tibia to direct the knee over the line of the second and third toes. then, the participant was instructed to perform a slow dorsiflexion movement until the first onset of pain or end of range of motion without the heel lifting off the couch. gaitrite was used for the measurement of spatiotemporal parameters, including gait velocity, cadence, step length, and stride length13. a paired t - test was used to compare pretest and posttest measurements of gait function within the groups, and the independent t - test was used to compare the difference in gait function before and after training between the groups. a p value of < 0.05 was considered statistically significant. the mwm group showed significant improvements in velocity, which increased from 41.35 cm / s before training to 51.72 cm / s after training (p<0.001) ; cadence, step length, stride length, and single - support time of the affected side ; and step length and stride length of the non - affected side (p<0.05). in addition, the control group demonstrated significant improvements in step length and stride length of the non - affected side (p<0.05). the mwm group showed significantly greater improvements than the control group in terms of velocity, cadence, and single - support time of the affected side (p<0.05 ; table 1table 1.comparison of gait ability within and between the groups (n=24)parametersvalueschange valuesmwm (n=12)control (n=12)mwm (n=12)control (n=12)beforeafterbeforeafterbefore - afterbefore - aftervelocity (cm / s)41.35 (14.73)51.72 (15.42)49.69 (23.26)51.55 (22.20)10.37 (6.63)1.87 (7.13)cadence (step / min)70.25 (17.90)78.50 (14.59)78.45 (21.57)76.50 (19.04)8.25 (8.50)1.95 (7.71)a : step length (cm)36.35 (6.28)41.33 (7.04)35.80 (8.49)38.36 (9.79)4.97 (5.53)2.56 (5.49)a : stride length (cm)69.90 (13.77)78.14 (13.54)73.72 (17.52)78.45 (17.58)8.23 (7.93)4.72 (8.77)a : single - support time (% /gc)20.08 (5.81)23.33 (4.55)24.00 (6.53)23.20 (7.19)3.25 (4.79)2.51 (1.87)na : step length (cm)33.17 (8.60)36.57 (7.95)36.31 (9.11)39.43 (8.33)3.40 (3.38)3.11 (4.86)na : stride length (cm)69.60 (13.56)77.92 (13.32)72.63 (15.92)77.64 (17.22)8.32 (8.03)5.01 (7.32)data are presented as means (sd) ; p<0.05, p<0.001 : significant difference within each group ; p<0.05 : significant difference between the groups ; mwm : mulligan s mobilization with movement group ; a : affected side ; na : non - affected side). data are presented as means (sd) ; p<0.05, p<0.001 : significant difference within each group ; p<0.05 : significant difference between the groups ; mwm : mulligan s mobilization with movement group ; a : affected side ; na : non - affected side this study was conducted to assess the effects of mulligan s mwm techniques on the temporal and spatial variables of gait of individuals who had a stroke. the application of mulligan s mwm techniques effectively improved the gait function of the patients in this study. the pressure from weight bearing on the affected side of the lower extremity is decreased by up to 43%, which makes stroke patients prone to falls to the affected side because of loss of balance. they experience difficulty in standing without assistance, which impairs their ambulatory abilities6. for these reasons, gait and this training involves exercise of the ankle to improve gait and balance. in particular, problems with the dorsiflexors of the ankle were reported to be the highest risk factor of falls14, and tonic paralysis in the plantar flexors of the ankle disrupt the normal gait pattern15, 16. some treatments are available to resolve these problems, including neurodevelopmental techniques, functional electrical stimulation, biofeedback, strength training, and treadmill training. however, in this study, the efficacy of mulligan s mwm technique was verified. each gliding consisted of 10 seconds of posterior talar glide with dorsiflexion of the ankle joint and 5 seconds of resting between the gliding. the therapist applied a sustained posteroanterior glide to the tibia through the belt by leaning backward while the talus and forefoot were fixed in the space between the thumb and the second right - hand finger. the mwm group had significantly greater improvements in velocity, cadence, and single - support time of the affected side (p<0.05) than the control group, which suggests that mulligan s mwm technique could improve the gait ability of patients recovering from stroke. the symptoms of postural imbalance in stroke patients are evident during standing because of the increased weight bearing toward the non - paretic side. decreased standing balance and loss of the ability to shift weight toward the paretic leg therefore, limitations in movements can decrease the range and amount of physical activities that can be performed and could lead to further decreases in postural balance, which may ultimately result in the deterioration of physical health18. therefore, this study investigated a sustained posteroanterior glide to the tibia for improvement of weight shift in stroke patients. the mwm group showed a significant improvement in single - support time of the affected side, which increased from 20.08%/gait cycle (gc) before training to 23.33%/gc after training (p<0.05). for increasing the single - support time of the affected side, mulligan s mwm is more effective than the lunge position. muscle cooperation in the ankle joint puts the center of gravity on the ankle joint in the standing position. it requires normal range of motion of the ankle joint and muscular strength19, 20. the normal range of motion of the ankle joint in the standing position improved in the mwm group owing to the posteroanterior glide to the tibia. based on the findings of the present study, mulligan s mwm could increase the velocity, cadence, step length, stride length, and single - support time of the affected side, and the step length and stride length of the non - affected side. moreover, increased single - support time of the affected side will positively influence the motivation of patients during gc and weight bearing on the non - paretic side toward maintaining their bodies within the limits of stability. thus, the positive effect of mulligan s mwm on gait function and its effectiveness as a treatment regimen for improving the gc in stroke patients were confirmed. this study has limitations, including the lack of diversity in the dependent variables. in addition, mulligan s mwm technique is commonly used in musculoskeletal physical therapy ; however, it was used in this study to improve the gc in stroke patients. hence, further research on the efficacy of mulligan s mwm in stroke rehabilitation should be conducted. | [purpose ] we examined the effectiveness of mulligan s mobilization with movement (mwm) technique on spatiotemporal variables of gait in individuals who had a stroke. [subjects and methods ] twenty - four subjects were randomly divided into 2 groups : mulligan s mobilization with movement group (n=12) and weight - bearing with placebo mobilization with movement group (n=12). the subjects in the mobilization with movement group performed 5 sets of 10 glides a day, 5 times a week for 4 weeks. the mobilization with movement technique comprised grade iii movements that involved gliding and resting. the control group subjects performed lunges in the same conditions as those of the experimental group. gait function was measured in terms of spatiotemporal parameters to determine the effect of mobilization with movement. [results ] the mobilization with movement group showed significant improvements in velocity, cadence, stride length, single - support time, and step length of the affected side, and step length and stride length of the non - affected side. overall, the mobilization with movement group showed significantly greater improvements than the control group in terms of velocity, cadence, and single - support time of the affected side. [conclusion ] mobilization with movement can be used to improve the gait function of patients recovering from stroke. |
we report a case of a 63-year - old male who presented to the outpatient department with complaints of hoarseness of voice and throat pain of three months duration. clinical, otorhinolaryngological and cytological examination revealed squamous cell carcinoma of supraglotic larynx (stage t2 n1 m0, t = tumor, n = lymph node, m= metastasis). he was treated with radiotherapy to neck (field : 1 cm above mandible to clavicle, laterally vertical line through mastoid process) with a dose of 68 grey in 34 fractions over seven weeks with 6 mega volt photon. no evidence of disease could be detected clinically or by imaging at the first follow up. he presented two years following initial treatment with swellings over the left inguinal region and left side of neck of one month duration. pallor was present. examination of the left inguinal region revealed a 6 cm by 5 cm nontender swelling, firm to hard in consistency with irregular surface and margin. it was clinically suspected to be matted left inguinal lymph nodes (figure 1). level iii neck (jugulodigastric) lymph nodes on the left side were palpable, hard, and nontender. there was no evidence of the disease process on otorhinolaryngological examination. all the hematological indices were within normal limits except hemoglobin (8 gm / dl). a thorough work - up (chest rhoentgenogram, computerized tomography of brain, abdominal sonography, colonoscopy, gastrointestinal endoscopy and fibre - optic laryngoscopy) did not suggest any evidence of other metastases. fine needle aspiration cytology from left inguinal and cervical lymph nodes revealed metastatic poorly differentiated squamous cell carcinoma. the patient was admitted and cytotoxic chemotherapy with paclitaxel and cisplatin was instituted. unfortunately, the general condition of the patient deteriorated after completion of two cycles of chemotherapy and, despite the best available treatment, the patient expired. laryngeal carcinoma is staged according to the extent of the original tumor site and its local spread (t), lymph node involvement (n), and the presence of metastases (m). t1 is the tumor limited to one sub - site of supraglottis, such as ventricular bands, arytenoids, suprahyoid epiglottis, infrahyoid epiglottis, aryepiglottic folds, with normal vocal cord mobility. t2 includes the tumors invading mucosa of more than one adjacent aforementioned subsites of supraglottis. t3 includes the tumors limited to larynx with vocal cord fixation and/or to tumors invading either the postcricoid area or the preepiglottic tissues. t4 describes tumors invading the thyroid cartilage, and/or extends into soft tissues of the neck, thyroid, and/or esophagus. n1 means metastasis in a single ipsilateral lymph node, 3 cm or less in its greatest dimension. n2 includes metastasis in a single ipsilateral lymph node, more than 3 cm but less than 6 cm in greatest dimension, or in multiple ipsilateral lymph nodes, none more than 6 cm in the greatest dimension, or in bilateral or contralateral lymph nodes, none more than 6 cm in greatest dimension. m0 indicates no metastases, m1 indicates presence of distant metastasis such as lungs, brain, liver etc.1 supraglottic laryngeal carcinomas are common and have a good prognosis.1 relapse is uncommon in early stage presentation.2,3 advanced stage cancer do recur predominantly locally or locoregionally. contiguous spread to cervical lymph nodes, especially level iii and iv, can occur. the reported overall three - year survival rate of supraglottic cancer was 60% and the five - year survival rate was 51.2% with nodal metastases and 64% without.4,5 forty - five percent of the patients with histologically confirmed nodal metastases survived three years. the reported five - year relapse - free survival rate (rfs) is 53% and corrected survival (cs) rate is 83% for t2 tumors versus rfs of 39% and cs of 52% for t4 tumors.6 age more than 60 was associated with a 2.2 times higher risk of dying due to laryngeal cancer. a retrospective tumor registry analysis of patients with squamous cell carcinoma (scc) of the larynx and hypopharynx reported that the age, sex, and tumor differentiation did not affect the incidence of distant metastases.7 the overall incidence of distant metastases was 8.5% with the following distribution : glottis 4.4%, supraglottis 3.6%, subglottis 14%, aryepiglottic fold 16%, pyriform sinus 17% and posterior hypopharynx 17.6%.7 the overall five - year disease - specific survival for distant metastases was 6.4%. distant metastases were related to advanced local disease (t3 + t4), lymph node metastases at presentation, tumor location (hypopharynx) and locoregional tumor recurrence. a meta - analysis of variables that predispose to a higher incidence of distant metastases include tumor location (hypopharynx more than larynx), advanced primary disease (t3 + t4), regional disease, locoregional recurrences, and advanced regional metastases (n2 + n3). the most common site of distant metastasis via blood stream is the lung ; however, metastsases to the brain, the adrenal, and the liver have also been reported.8 metastasis to inguinal lymph nodes, as in our case, is very rare.9 the probable explanation of this metastasis is the retrograde lymphatic spread through thoracic duct, para - aortic lymphatic channels to inguinal lymph nodes. | head and neck cancers are common among men in developing countries. among head and neck cancers in the united states, supraglottic laryngeal cancer accounts for 12,500 new cases per year. it responds favorably to radiotherapy with or without chemotherapy depending on the stage of disease. recurrence is local or locoregional. we report a unique case of carcinoma of the larynx with rare distal recurrence in the left inguinal lymph nodes. |
severe epstein - barr virus (ebv) disease has been observed increasingly in immune deficient hosts having congenital immunodeficiency syndrome or acquired immune suppression. in an immune competent host, ebv may be eliminated by cytotoxic t cells evoked by the ebv antigen, or the virus can survive in the human body through a latent infection by maintaining a balance with the host. fulminant ebv diseases have been reported under various names including fatal ebv - associated hemophagocytic syndrome or severe chronic active ebv infection (1, 2). severe chronic active ebv infection commonly occurs in children or adolescents, but rarely in adults, and is characterized by chronic illness lasting more than 6 months and an elevated titer of ebv - associated antibodies, pancytopenia, hemophagocytosis, disseminated intravascular coagulation, hepatosplenomegaly, and lymphadenopathy (3). unlike classic infectious mononucleosis, t - lymphocytes or nk cells instead of the b - cell harbor the ebv genome, and some cases progress to t or nk - lymphoproliferative disease (4). we report a case of chronic active ebv infection occurring in a 61-yr - old korean woman with a reappraisal of the current diagnostic criteria. the patient was referred to the hemato - oncology department because of a fever of unknown origin. she had been suffering from chronic hepatitis c since 4 yr prior to her visit, when elevated ast / alt and positive hcv - rna of peripheral blood were noted. ifn- and two months prior to the transfer to our hospital, she had a fever that was not improved by discontinuation of ifn- and ribavirin. on admission, her body temperature was 38.5, her blood pressure 140/80 mmhg, and her respiration rate 20/min. blood findings were hb 7.9 g / dl, platelet 61,000/l, and wbc 3,900/l with differentials of segmented neutrophils 48.4%, lymphocytes 34.6%, and monocyte 14.9%. the reticulocyte count was 6.6% and esr 33 a liver function test revealed total bilirubin of 1 mg / dl, ast 46 l, alt 19 l, and -gt 36 l. total protein was 8.7 g / dl, globulin 6.3 g / dl, and albumin 2.4 g / dl. ldh was 1,030.4 iu / l, total iron binding capacity 168 g / dl, iron 13 g / dl, and ferritin 2,050 ng / ml. a blood coagulation test showed increased prothrombin time, fdp, and d - dimer. the results of the serologic test were anti - hbs ab (+), anti - hcv igg ab (+), ebv vca - igg (+), ebv vca - igm (-), ebna (+), and ea (-). bone marrow aspirate showed hypercellular marrow with the infiltration of many small and medium sized t - lymphocytes without significant atypia, plasma cells, and many histiocytes. pcr analysis for the tcr gene rearrangement followed by sscp showed a polyclonal pattern of the tcr gene. a ct scan of the abdomen revealed a huge spleen of 1714 cm in size and mild hepatomegaly. multiple enlarged lymph nodes, measuring up to 3.7 cm in diameter, were found in the porta hepatis, portocaval, retropancreatic, and aortocaval regions. on the 6th day of admission, steroid was administered under the impression of autoimmune hemolytic anemia, but hematologic findings were not improved. on the 23rd hospital day, splenectomy with a paraaortic lymph node biopsy was done. the spleen was 18167 cm and weighed 685 g. the cut surface showed multifocal infarcts involving about 30% of the parenchyma. microscopically, red pulp was markedly expanded with atrophic white pulp. in the red pulp, there was diffuse infiltration of histiocytes showing erythrophagocytosis in the splenic cord and sinusoids. a few histiocytes phagocytosed platelets. besides the histiocytes, many plasma cells had infiltrated the splenic cord. in some areas, extramedullary hematopoiesis and infarct of splenic tissue were observed. paraaortic lymph node displayed loss of lymphoid follicles and paracortical expansion by diffuse infiltration of polyclonal plasma cells. immunostaining revealed many t - lymphocytic infiltrations with a predominance of cd4-positive cells in the red pulp as well as in the white pulp. double procedure for cd3 immunohistochemistry and ebv in situ hybridization revealed numerous cd3-positive t lymphocytes harboring the ebv genome in their nuclei. the plasma cells in the bone marrow, spleen, and lymph nodes demonstrated a polyclonal light chain expression pattern. one week after the surgery, the patient manifested body edema with ascites and petechiae of the skin. she also showed hyperbilirubinemia and elevated ast / alt. under the diagnosis of chronic active ebv infection and dic, acyclovir was administered to the patient and chemotherapy was planned. on the 34th hospital day, after the insertion of a hickman catheter for chemotherapy, she complained of dyspnea. chest radiography revealed bilateral pleural effusion and diffuse increase of hazziness of both lung fields. a bronchoscopic examination and chest radiographic findings indicated acute respiratory distress syndrome with diffuse alveolar hemorrhage. ebv infection can cause a broad spectrum of diseases depending on the host 's immune status. primary infection in adolescent or early adult life can be manifested as a classic infectious mononucleosis characterized by fever, hepatosplenomegaly, lymphadenopathy, and an increase of activated cd8 t lymphocytes in the peripheral blood. fulminant ebv infection has been described under the name of fatal infectious mononucleosis and ebv - associated hemophagocytic syndrome in toddlers or young children. it is characterized by fever, hepatosplenomegaly, lymphadenopathy, hemophagocytosis in various tissues, and a tendency to pancytopenia, often leading to a fatal outcome (5, 6). some cases of fatal infectious mononucleosis are associated with x - linked lymphoproliferative syndrome (7). serologic profiles of those patients showed anti - vca igm, and igg - positive, and anti - ebna1-negative, which are diagnostic of a primary infection. some cases of fulminant ebv infection have been termed severe chronic active ebv infection (scaebv). the first patient described in 1978 was a 5-yr old girl with chronic infectious mononucleosis - like symptoms that had persisted for a long time. the patient also had extraordinarily elevated levels of igg antibody titers against vca and ea with ebna - positive cells in circulation (8). thereafter, some patients with a similar type of disease were reported, especially in the asia. in korea, only two cases have been described in the literature (9, 10). the life - threatening complications included hemophagocytic syndrome, interstitial pneumonia, lymphoma, coronary artery aneurysm, or central nervous system involvement. in 1988, straus. proposed the criteria of scaebv, which included severe illness lasting more than 6 months, histologic evidence of major organ involvement, abnormal ebv antibody titers, and increased quantities of ebv in affected tissues (11). using the straus. reviewed the clinicopathologic and laboratory findings of 26 patients previously reported in the english literature, as well as their 10 cases, and emphasized that all of the patients had extremely high antibody titers against the ebv (12). however, the cases reported afterward did not always satisfy the proposed criteria by straus. some patients showed a duration of illness of less than 6 months, and other patients lacked abnormal patterns of ebv - related antibodies. in 1995, ishihara. described the clinical and laboratory findings of 39 children with scaebv infection registered in japan. in their series, past histories of hypersensitivity to mosquito bites were identified in 31.3% of patients, and high anti - ebv titers were noted in 28.2% of patients for anti - vca igg and in 57.1% of patients for anti - ea igg (13). analyzed 30 patients with scaebv and identified high ebv - related antibody titers in only one third of the patients. they also noted high viral loads detected by real - time quantitative pcr in the peripheral blood (more than 102.5 copies/g dna) in all of the patients (14). suggested that virologic criteria for diagnosis may be altered to either or both extremely high antibody titers against ebv - replicative antigens and/or increased genome copies in tissues (15). in the present patient, quantitative analysis of anti - ebv antibody titer and viral load quantitated by real - time pcr was not performed, but a pathologic examination identified many ebv - infected t - lymphocytes that had infiltrated in the spleen, lymph nodes, and bone marrow. moreover, the patient showed fever, lymphadenopathy, and hepatosplenomegaly ; and she pursued an aggressive fulminant clinical course with hemophagocytic syndrome, which is a typical clinical feature of severe chronic active ebv infection. the short clinical course of 4 months from the onset of disease to death in the present patient does not satisfy the criteria of disease duration as given by previous authors, who emphasized an illness lasting more than 6 months ' duration (12). however, a careful review of previous reports revealed that a few patients showing typical clinical and laboratory findings died of the disease at less than 2 months after the onset of the disease (16). therefore, the present case suggests that the diagnosis of scaebv should be based on the constellation of clinical and laboratory findings and should not be limited by simple numerical criteria for disease duration or by laboratory parameters. the majority of patients with scaebv at the onset of symptoms have been children and adolescents. their average age was 8.3 yr. in the series by okano. and, only 2 of 56 patients were over 30 yr - old at the onset of the disease, and there were no patients who were more than 60 yr - old (12, 14). in consideration of serologic profiles showing detectable igg antibody titers to ebna along with high titers of igg anti - vca and anti - ea antibodies, most young patients with caebv appeared to have had active ebv infections and had already suffered from primary ebv infection at the onset of caebv. many cases of caebv in older patients may occur with the reactivation or reinfection of the ebv. in the present case, a double procedure for immunohistochemistry and eber in situ hybridization revealed that numerous cd3-positive t lymphocytes had harbored the ebv genome in their nuclei. unlike classical infectious mononucleosis in which ebv infects b cells via the ebv receptor on the cell surface, which are eliminated by ebv - antigen directed cytotoxic t cells, scaebv is characterized by persistent ebv infection into t or nk cells and the proliferation of these ebv - positive populations for long periods (17, 18). a recent study by kimura. demonstrated the clinical and virologic differences between the two subgroups of scaebv infecting the t or nk cell. the t cell type caebv tended to show high titers of anti - ebv - related antibodies and a tendency of early mortality compared to the nk cell type caebv (14). infection of the t - cell, instead the b - cell, by ebv is also observed in ebv - associated hemophagocytic syndrome (ebv - hps), which can be associated with acute ebv infection. in a study by kasahara., 4 patients with acute ebv - hps showed predominant cd8 + ebv infected t cells ; whereas dominant ebv - infected cells in patients with caebv were cd8 + t cells or cd4 + t cells or nk. the difference of predominantly infected cells between acute ebv - hps and caebv might be ascribed to the differences in the time of analysis after the onset of disease ; both the cd4 + and the cd8 + t cells became infected with the virus as the disease progressed (4). infectious mononucleosis is common in western countries, but the majority of the fulminant ebv infections including ebv - hps and scaebv infection has been reported in asia, including japan and taiwan. although the patients reported hitherto had no proven immune defects, it has been suggested that a defect in the gene essential for regulating lymphocyte activation and proliferation may exist. another suggestion is that the virus may escape from the immune surveillance by the host because of the mutation of the viral genes. in the present patient, chronic hepatitis c virus infection and inf- treatment might have caused the immune dysfunction ; however, the clinical course does not support a causal relationship between hcv infection and scaebv infection. in summary, although high antibody titers for ebv antigens and duration of illness are included in the diagnostic criteria, flexible application of those criteria is necessary in cases showing typical clinical and pathologic findings. | severe chronic active epstein - barr virus (ebv) infection is a rare and life - threatening illness. although the criteria for diagnosis include chronic or recurrent infectious mononucleosis - like symptoms lasting more than 6 months and high titers of anti - ebv antibodies, clinical and laboratory findings may be heterogeneous and flexible application of those criteria is necessary in cases showing typical clinical and pathologic findings. we report a case of severe chronic active ebv infection in a 62-yr - old female patient who showed classical clinical findings with infiltration of ebv - infected t lymphocytes in the bone marrow, spleen, and lymph nodes, and died four months after presentation. |
phytate - degrading enzyme (phytase, ec 3.1.3.8) preparations have a wide range of applications in animal and human nutrition. besides that, these enzymes have also attracted considerable attention from both scientists and entrepreneurs in the areas of environmental protection and biotechnology. phytases are of great interest in biotechnological applications, in particular for the reduction of phytate content in feed and food. phytases are capable of initiating the stepwise release of myoinositol and phosphoric acid, leading to the formation of myoinositol phosphate intermediates from phytate. most plant - origin foods have from 50% to 80% of their total phosphorus as phytate. phytate chelates essential minerals, binds to amino acids and proteins, inhibits digestive enzymes, and decreases the nutritive value of food. monogastric animals poorly utilized phytate - bound phosphorus, due to insufficient phytate - degrading activity in the gut. therefore, hydrolysis of phytate is desirable for releasing valuable nutrients for beneficial utilization. the addition of phytate - degrading enzymes can improve the nutritional value of plant - based foods by enhancing protein digestibility and mineral availability through phytate hydrolysis during digestion in the stomach or during food processing, thus reducing the phosphorus excretion of animals. only a limited number of bacterial phytases have been reported and studied. phytase has been isolated from bacteria such as escherichia coli, pseudomonas sp., anaerobic rumen bacteria, particularly selemonas ruminantium, megasphaera elsdenii, prevotella sp. numerous studies have shown the effectiveness of supplemental microbial phytases in improving the utilization of phosphate from phytate. naturally occurring phytases having the required level of thermostability for application in animal feeds have not been found. hence, the main objective of the present study was to characterize alkaline- thermostable phytase from alcaligenes sp., and possible application in in vitro digestion of plant phytate was evaluated. a study of this kind will improve our knowledge on the biotechnological application of phytase in feed industry. the bacterial isolate, alcaligenes sp., was obtained from the microbiology laboratory, centre for marine science and technology, m. s. university, rajakkamangalam, tamil nadu, india. sodium phytate (2%, w / v) was added as substrate in plate screening media. the alcaligenes sp. was grown on this solid medium and incubated at 37c for 48 h. phytase plate screening was carried out by washing the colonies with distilled water from the agar surface and flooding the plate with 2% (w / v) cobalt chloride solution and incubated for 30 min at room temperature. then replaced the cobalt chloride solution with a freshly prepared solution containing equal volume of 6.25% (w / v) ammonium molybdate and 0.42% (w / v) ammonium vanadate solution. following further 30 min incubation the solution removed and the plates were examined for zones of clearing which indicates phytase activity. phytase - secreting alcaligenes sp. was subjected for phytase production in the production medium (containing 1 litre : sodium phytate, 10 g ; (nh4)2so4, 1 g ; mgso47h2o, 0.1 g ; cacl22h2o, 0.1 g ; trace element solution, 1.0 ml ; kcl, 0.7 g ; glucose, 1 g ; d - mannose, 1 g). sodium phytate was filter - sterilized separately, and added after autoclaving, to the production medium. a loopfull of bacterial culture was transferred to 150 ml of phytase production medium in a 250-ml erlenmeyer flask, and the culture was incubated at 37c with shaking at 150 rpm. for the determination of the growth curve, 5 ml of the culture medium was withdrawn at regular intervals of 12 h and the cell density determined at 600 nm up to 120 h. to study the optimum incubation time for phytase production, the culture was withdrawn every 12 h and centrifuged at 10,000 g for 15 min. effect of ph on enzyme production was studied by adjusting the culture medium ph to 6.0, 7.0, 8.0, 9.0, and 10.0 by the addition of 1 n hcl / naoh prior to sterilization. to study the effect of carbon and nitrogen sources on enzyme production, the organism was grown in the production medium containing additional 1% (w / v) carbon (arabinose, dextrose, maltose, sucrose, trehalose, mannose, and starch) and nitrogen sources (urea, ammonium sulphate, peptone, ammonium chloride, and beef extract). a cell - free extract was prepared from 96h - old culture by centrifuging it at 10,000 g for 15 min. the culture supernatant was assayed for determining phytase activity, which was based on the estimation of inorganic phosphate released on hydrolysis of phytic acid, at 37c. one unit of enzyme activity was defined as the amount of enzyme that liberates 1 mol of inorganic phosphate per minute under standard assay conditions. the total protein content of the sample was estimated as described by lowry., and bovine serum albumin was used as the standard. the optimum ph for the enzyme activity was determined by using the following buffers (0.1 m) : citrate buffer (ph 4.0), succinate buffer (ph 5.0 - 6.0), tris - acetate buffer (ph 7.0), tris - hcl buffer (ph 8.0), and glycine - naoh buffer (ph 9.0). the stability of the enzyme at various ph was examined by incubating the enzyme solution in buffers ranging in ph from 4 to 9 at 37c for 30 min ; enzyme activity was assayed as described earlier. the temperature profile of the enzyme was determined by performing the routine enzyme assay at varying incubation temperatures (30, 40, 50, 60, and 70c). to determine the thermal stability of the enzyme, it was incubated for 3070c for 30 min before performing the routine enzyme assay. the effect of divalent ions and chemicals on enzyme activity was determined by incubating the enzyme with various divalent ions and chemicals (0.005 m), namely, ca, mn, zn, cu, mg, ethylenediaminetetraacetic acid (edta), dithiothreitol, and -mercaptoethanol for 30 min. the crude enzyme preparation (140 ml) was fractionated with ammonium sulphate (60% to 80% saturation) as suggested by fu.. the protein precipitate was dissolved in a minimal volume of double - distilled water and the resulting enzyme was dialyzed against the buffer a (tris - hcl buffer, 0.025 m, ph 8.0) overnight at 4c. the dialyzed sample was subjected to diethyl - aminoethyl cellulose (deae cellulose) chromatography (merck, bangalore, india) using buffer a, and the bounded protein was eluted with a linear gradient of nacl (0 - 1 m). the fractions having phytase activity were combined and concentrated using ammonium sulphate (80% saturation) and dialyzed against buffer b (tris - hcl buffer, 0.05 m, ph 8.0). the concentrated sample was loaded on a preequilibrated sephadex g-75 column (amersham biosciences, se-751 84, uppsala, sweden) and eluted with buffer b. sodium dodecyl sulphate - polyacrylamide gel electrophoresis (sds - page) was performed according to laemmli. the stacking gel was 5% (w / v) polyacrylamide, and the separating gel was 11% (w / v) polyacrylamide. after electrophoresis, the gel was treated and stained for phytase activity as described by yanke., with a cobalt chloride solution followed by an ammonium molybdate / ammonium vanadate solution. the gel was documented using a gel documentation system (syngene, cambridge, cb4 1tf, uk) and the molecular weight of the purified enzyme determined. an in vitro experiment was performed to study the hydrolysing efficacy of alcaligenes phytase on plant phytate. briefly, plant phytates from various sources, namely, chick pea, corn, green pea, groundnut, pearl pea, and chick feed named layer mash all materials were ground into coarse powder and sieved (0.2 - 0.3 mm). two grams of the above material were placed in a 50-ml conical flask. to this, 10 u crude enzyme and 5 ml of buffer b were added and the mixture was placed in an orbital shaker at 150 rpm for 30 min. a control experiment was carried out separately ; for this, 10 ml of buffer b alone was applied to the raw materials. to the reaction mixture, 10 ml trichloroacetic acid (15%) was added to stop the reaction. the isolate, alcaligenes sp. secreted alkaline phytase when it was grown on phytase screening medium. this organism produced a 2.0-mm zone around the colony after 48 h. this organism was used for further studies. the alcaligenes sp. attained maximum growth after 72 h of fermentation, and the absorbance was 1.972 0.036 at 600 nm. the absorbance declined to 1.728 0.027, 1.615 0.039, 1.619 0.781, and 1.407 0.033 at 84, 96, and 108 h of incubation, respectively. the isolate produced an interesting phytase when grown in minimal medium containing sodium phytate as the sole source of phosphorus. the enzyme secretion increased to its maximum of 6.202 0.082 u / ml at 96 h of fermentation. enzyme production was found to be 0.008 0.005, 1.811 0.221, 4.351 0.192, and 3.610 0.191 u / ml at 24, 48, 72, and 120 h of fermentation, respectively, (figure 1). in this organism the reduction in enzyme yield after the optimum period was probably due to the depletion of nutrients that are available to microorganism. effect of ph on enzyme production was studied by culturing the organism at various ph levels (6.010.0) using 1 n hcl / naoh. phytase production was 1.5 0.15, 2.96 0.16, 2.0 0.23, 1.7 0.10 u / ml at ph 6.0, 7.0, 9.0, and 10.0, respectively. enzyme production was found to be high at ph 8.0 (4.9 0.18 u / ml). at high ph level (9.0), higher ph, the metabolic action of the bacterium may be suppressed and thus enzyme production decreased. this result was in accordance with the observations made with mitsuokella jalaludinii by lan.. phytase production was found to be high (6.2 0.018 u / ml) in the production medium supplemented with 1% (w / v) maltose. enzyme production was 5.0 0.032, 4.33 0.01, 4.8 0.05, 3.47 0.09, and 3.07 0.008 u / ml in the production medium containing starch, dextrose, trehalose, sucrose, and arabinose, respectively. phytase production was high (6.5 0.026 u / ml) in the production medium containing beef extract (1%, w / v) as the sole source of nitrogen. enzyme production was 3.35 0.05, 3.0 0.03, 4.6 0.13, and 5.2 0.08 u / ml in production medium containing urea, ammonium sulphate, peptone, and ammonium chloride, respectively. this result was in accordance with the observation made with bacillus sp. khu-10. in alcaligenes sp. the relative enzyme activity was 0.9 0.13%, 3.4 0.18%, 44.5 3.4, 98 5.5%, and 40 2.2% at ph 4.0, 5.0, 6.0, 7.0, and 9.0, respectively. this enzyme was also highly stable at ph 8.0 at which the relative enzyme activity was 100%. the relative enzyme activity was 0.4 0.16, 40 0.21, 47 0.18, and 27 0.24%, at ph 4.0, 5.0, 6.0, 7.0, and 9.0, respectively, (figure 2). some bacterial phytases have broad ph optima but are shifted towards a more basic ph range [22, 23 ]. the effect of phytase activity was studied by incubating the reaction mixture at various temperatures (3070c). the alcaligenes phytase was highly active (100% activity) at 60c (figure 3). the relative enzyme activity was found to be high (100%) at 60. the relative enzyme activity was 59 1.6%, 68 2.7%, 92 3.4%, and 86 5.3% at 30, 40, 50, and 70, respectively. the relative enzyme activity was 64.7 4% at 70c (figure 3). this result shows that alcaligenes phytase is relatively thermo - stable and is preferable for use in feed industry. the effect of divalent ions on enzyme activity was investigated by allowing the divalent ions (0.005 m) to react with the phytase sample. however, it is difficult to determine whether the inhibitory effect of various metals is due to the direct binding of the metal ions to the enzyme, or whether the metal ions form poorly soluble complexes with phytic acid, thereby decreasing the active substrate concentration. among divalent, ca enhanced the relative enzyme activity (103 2.89%) when compared with the control (100%). mn, zn, cu, and mg inhibited the enzyme activity and the relative activity was 46 3.8%, 39 2.92%, 73 1.3%, and 21 0.8%, respectively. phytase was purified to homogeneity by sequential ammonium sulphate precipitation, anionic exchange chromatography, and gel filtration chromatography. the deae cellulose chromatography was still the major technique for purification of alcaligenes phytase, because majority of contaminating proteins were removed at this step. the recovery and purification were 7.07%- and 4.75-fold, respectively, after sephadex g-75 gel filtration chromatography. the molecular weight of the enzyme was found to be 41 kda (figure 4). a two - step chromatographic process, similar to that employed with aspergillus ficuum, was followed. homogeneity of the purified enzyme was revealed by sds - page which showed a single band with an apparent molecular mass of 41 kda (figure 4). this result similar with a molecular mass was reported in bacteria. in the present study various sources of plant phytates were used to investigate the effect of phytate, and the released inorganic phosphorus was measured. plant phytates, namely, chick pea, corn, green pea, groundnut, pearl pea, and chick feed named layer mash were chosen as the substrate for in vitro hydrolysis. the released inorganic phosphorus from these sources was significantly high (table 2) than other reported results. a similar finding this property of the alcaligenes phytase makes this a potential supplement in the animal feed industry. the plant phytate sources mentioned above are widely used as raw materials in the animal feed industry. phytase can not be fully used by agastric fish like carps, in which the ph of the digestive tract is about 6.58.4. thus, this phytase could be used effectively in the feed of monogastric animals and other organisms. it is clear that supplemental phytase can enhance the bioavailability of phosphorus and other minerals in plant - based feed. the alcaligenes phytase had an optimum ph at alkaline range (7.0 - 8.0) and, fortunately, the fish gut ph fell at this range. hence, this phytase could be used effectively to increase the bioavailability of phosphorus in feed. further investigation about phytase application in fish feed is needed to study in in vivo. overproduction of phytase can be achieved by physical, chemical methods of mutagenesis and through recombinant dna technology. | a bacterial isolate, alcaligenes sp. secreting phytase (ec 3.1.3.8), was isolated and characterized. the optimum conditions for the production of phytase included a fermentation period of 96 h, ph 8.0, and the addition of 1% (w / v) maltose and 1% (w / v) beef extract to the culture medium. this enzyme was purified to homogeneity and had an apparent molecular mass of 41 kda. the optimum ph range and temperature for the activity of phytase were found to be 7.0 - 8.0 and 60c, respectively. this enzyme was strongly inhibited by 0.005 m of mn2 +, mg2 +, and zn2 +. in vitro studies revealed that the phytase from alcaligenes sp. released inorganic phosphate from plant phytates. phytase released 1930 28, 1740 13, 1050 31, 845 7, 1935 32, and 1655 21 mg inorganic phosphate / kg plant phytates, namely, chick pea, corn, green pea, groundnut, pearl pea, and chick feed, respectively. |
globally, an anticipated difficult airway is managed most often with flexible fiberoptic bronchoscope (ffb)-guided tracheal intubation. in patients with restricted mouth opening, intubation is done through the nasal route, which is unpredictable in terms of the maximum tube size allowable. during ffb - guided intubation, if the preloaded tube is not able to negotiate the nose, most often, the scope is withdrawn to reload a smaller tube, and the procedure is reattempted. in certain situations we present the anesthetic management of five such cases, where we avoided redoing the procedure by using a j - tipped guide wire. we present the anesthetic management of five cases with temporomandibular joint (tmj) ankylosis posted for corrective surgery, who presented to our institute over a period of 6 months. all the patients were men in the age group of 1827 years. among the patients all patients had varying degrees of retrognathia, and the maximum thyromental distance recorded was three finger - breadth. nasal patency was judged by keeping a wisp of cotton in front of each nostril, and the nostril with a better air - flow was chosen for intubation. all the patients were asked to fast for 6 h before surgery, and a written, informed consent was taken for awake intubation in view of the difficult airway. in the operation theatre, standard monitors were applied, intravenous (iv) line was established, and premedication, consisting of metoclopramide 0.2 mg / kg, glycopyrrolate 5 mcg / kg, and midazolam 10 mcg / kg, was given iv. local anesthesia of the airway was established with a combination of 10% lidocaine spray, nebulization with 4% lidocaine, and superior laryngeal nerve blocks. a difficult airway cart, and equipment and personnel for rapidly establishing a surgical airway were also kept ready. all patients were provided conscious sedation with up to 70% nitrous oxide in oxygen, delivered via a nasopharyngeal airway connected to the anesthesia circuit. a jet ventilator, with its dedicated oxygen source, was kept ready to be connected to the working channel of the ffb and provide 100% oxygen, if required. a 7.5-mm internal diameter (i d) flexometallic endotracheal tube (ett ; lma fastrach ett) the ett was loaded onto the ffb, and after the successful negotiation of the ffb into the trachea, it was negotiated via the nostril, through the larynx and into the trachea, and finally positioned in front of the carina. in all patients, on attempting to rail - road the ett over the ffb, it was realized that, despite adequate lubrication, the ett could not negotiate the nasal structures. concerned with the difficulty expected in a repeat attempt at bronchoscopy, a 1-mm - thick, 145-cm - long, metallic j - tipped guide wire was threaded through the working channel of the ffb till the carina [figure 1 ], and the ffb was then withdrawn, keeping the guide wire in place. a 6.5-mm i d ett was then threaded over the guide wire and negotiated successfully through the nasal passage and other airway structures. after the confirmation of the intratracheal tube position with exhaled carbon dioxide, the ett was fastened, guide wire removed, and induction of anesthesia done. the ffb was used again for visualizing the carina to ensure the precarinal tube position. the patients were monitored for 5 days after the surgery for any airway - related complications and discharged thereafter. ffb - guided nasal intubation under local anesthesia, with the patient breathing spontaneously, is the most commonly performed procedure for airway management in patients with difficult airway, especially those with restricted mouth opening. in the nasal cavity, the widest space for tube passage is along the inferior meatus but this is sometimes encroached upon by a hypertrophied turbinate or deviated nasal septum. during winter months this prevents the passage of a nasal tube, which is otherwise appropriate for age. in case the nasal passage is found to be narrow during fiberoptic - guided intubation, the whole assembly has to be withdrawn to reload a smaller ett. this is undesirable as even minimal trauma during the first intubation attempt causes mucosal bleeding when the mucosa is edematous. we used a 145-cm - long, 1-mm - thick, metallic j - tipped guide wire to assist in rail - roading of the ett after being positioned in the trachea via the working channel of the ffb. the length is crucial and has to be at least 30 cm more than the length of the ffb (suction port to tip) to prevent the misplacement of the guide wire [figure 2 ]. the ffb with the j - tipped guide wire going down its working channel guide wires have played a variety of roles for assisting in tracheal intubation. they have also been inserted in an anterograde fashion through laryngeal mask airways for subsequent endotracheal intubation, and also through ett for changing from oral to nasal route, and for changing the type of ett. rodriguez. used a guide wire via the working channel of the ffb for rail - roading of the ett in a case of treacher have reported two cases with a difficult airway, where they left a guide wire in the trachea for assisting in rapid reintubation in the immediate postoperative period, if required. in all our cases, because of the limited mouth opening, the use of supraglottic devices was ruled out. we chose guide wire - aided intubation ahead of blind or light - guided nasal intubation, as we had experience of this technique in patients with a normal airway. if we had failed, we could have gone back to the original plan of attempting an ffb - guided intubation, or could have rapidly established a surgical airway. we feel that the uniquely beveled tip of the lma fastrach ett has a lesser tendency to impinge on the turbinates or the arytenoids, and hence requires adjusting maneuvers less often, apart from causing less trauma. an airway exchange catheter can also be used to reinforce the guide wire before rail - roading the tube to minimize displacement. | flexible fiberoptic bronchoscope - guided awake intubation is the most trusted technique for managing an anticipated difficult airway. even after successfully negotiating the bronchoscope into the trachea, the possibility remains that the preloaded tracheal tube might prove to be inappropriately large, and may not negotiate the nasal structures. in such a situation, the most obvious solution is to take out the bronchoscope, replace the tracheal tube with a smaller one, and repeat the procedure. unfortunately, sometimes the second attempt is not as easy as the first, as minor trauma during the earlier attempt causes tissue edema and bleeding, which makes the subsequent bronchoscopic view hazy and difficult. we present the anesthetic management of five cases with temporomandibular joint ankylosis where, after successful, though slightly traumatic, bronchoscope insertion into the trachea, the tube could not be threaded in. we avoided a repeat bronchoscopy by making an innovative change in the plan. |
synovial sarcoma (ss), though very rarely encountered, could also arise in this location [18 ]. around 80% of synovial sarcomas tumor size of 5 cm [1117 ] and completeness of resection [16, 18, 19 ] are the most consistent prognostic factors among previous reports. other factors, though less consistently identified, include bone or neurovascular invasion [14, 20, 21 ], high histologic grade [20, 21 ], and the histologic subtype [15, 19 ]. it is not clear if these prognostic factors retain their significance in cases of mediastinal ss. furthermore, the distinctive features that are unique to the mediastinal site of occurrence of those tumors as opposed to other sites, including the tendency to present with larger size, and their site within the mediastinum (anterior, middles, or posterior mediastinum) as well as the presence of pericardial invasion and effusions, make any application of the previously identified prognostic factors irrelevant. in the current paper, we attempt to provide a descriptive analysis of mediastinal ss and the patterns of failure following therapy. the following search terms were used : synovial, sarcoma, and " mediastinum. no restrictions were applied to the date of publication ; however, this search was limited to papers in english language. furthermore, reference lists of included studies were hand - searched to identify relevant missing publications. data pertaining to the age at diagnosis, gender, extent of disease at initial presentation (localized, locally advanced, or metastatic), location of the tumor inside the mediastinum (posterior, middle, and anterior), maximum tumor dimension, histologic subtype (monophasic or biphasic), presence of pericardial effusion, therapeutic modalities (surgery, chemotherapy, and radiotherapy), and completeness of surgical resection were extracted using a predefined datasheet. in addition, the status of patient at last follow - up and sites of any recurrence or progression (if any) were accurately documented. overall, twenty - two studies which included 40 patients form the basis of this review [18, 2235 ]. overall and event - free survival (efs) the influence of possible prognostic factors on survival was assessed and compared through the log - rank test. survival curves were plotted through the kaplan - meier method. a p value of 5 cm. it is likely that factors such as the small number of patients, the retrospective design, and the heterogeneity in chemotherapy regimens and patients ' and tumors ' characteristics are possible explanations. an important limitation of our analysis is that it was performed for patients whose outcomes were reported from different studies ; each one includes a limited number of patients, and as such, statistical tests of heterogeneity could not be performed to ensure the lack of heterogeneity among patients included from different studies. in addition, we can not reliably exclude the possibility of publication biases with the tendency to report the patients who survived longer and to underreport those with suboptimal outcomes. nevertheless, and given the rarity of mediastinal ss, no other formal attempt to analyze the influence of disease related factors on survival is realistically possible. consequently, the current analysis can be utilized with caution as a guidance emphasizing the importance of complete resection of those tumors, the possible need for multimodality adjuvant therapy, and as an approximate estimation of recurrence and survival outcomes. mediastinal ss have poor prognosis as they tend to present with large tumors and with advanced stage. completeness of resection is the only identified factor that influences survival and can result in outcomes similar to the outcomes following resection of ss arising primarily in the extremities. | background. the aim of this systematic review is to attempt to provide a descriptive analysis for cases of synovial sarcoma (ss) arising in the mediastinum and to analyze prognostic factors. methods. we performed pubmed database search in july 2013. twenty - two studies, which included 40 patients, form the basis of this review. demographic and disease - related factors were analyzed for possible influence on survival. findings were compared with extremity ss studies reported in literature. results. sixteen cases (40%) presented with locally advanced unresectable disease, 2 (5%) with metastatic disease, and 22 (55%) with localized resectable disease. median tumor size was 11 cm (range : 520 cm). thirty patients were assessable for survival and had a 5-year os of 36%. completeness of resection was the only factor associated with significant improvement in os (5-year survival of 63% and 0% in favor of complete resection, p = 0.003). conclusion. mediastinal ss is associated with poor prognosis as more cases are diagnosed at an advanced stage and with larger tumor size compared to extremity ss. complete surgical resection is the only identified factor associated with better prognosis and may result in survival outcomes that are comparable with those for localized ss of the extremity. |
the advent of laparoscopic surgery has led to great advances in the field of general surgery, including shorter hospitalizations, reduced postoperative pain, fewer wound infections, and improved cosmesis. however, laparoscopic techniques also have limitations, including an unstable camera platform, the limited motion of straight laparoscopic instruments, two - dimensional (2d) vision, and poor ergonomics for the surgeon. the da vinci surgical system (intuitive surgical, sunnyvale, ca, usa) was specifically designed to overcome the limitations of current laparoscopic technology. the skills required for robotic surgery are, therefore, different from those required for laparoscopic surgery. the surgeon sits at the console and views a three - dimensional (3d) image of the procedure through two viewing holes, while maneuvering the arms with two foot pedals and two hand controllers. specifically, the endo - wrist instruments allow maneuvering of the robotic arms in a manner that simulates fine human movements. these characteristics enable robotic surgery to overcome the technical limitations of laparoscopy by restoring vision and manual control of open surgery in a minimally invasive environment. we hypothesized that the laparoscopic experience does not affect robotic dexterity, because the techniques necessary for laparoscopic surgery and robotic surgery are different from each other. a dry lab using the da vinci surgical system is optimal for comparing robotic dexterity, but this is limited because the expensive robot can only be used for this study, when surgery is not being performed. the dv - trainer (mimic technologies, seattle, wa, usa) is a compact virtual reality platform that closely reproduces the experience of the da vinci surgical console. it is the only robotic simulator demonstrated to have face (degree of resemblance with the actual robot), content (usefulness as a training tool as viewed by experts), construct (degree to which the results on the simulator reflect the actual skill of the subject), and concurrent (equivalence between assessment on the simulator and assessment on an actual da vinci surgical system) validity in multiple studies. virtual reality simulations can be performed at any time, and they can provide a real - time, objective assessment of users performance. accordingly, surgical fellows experienced in laparoscopic surgery were compared with medical students using the well - validated dv - trainer. in february 2011, surgical fellows and medical students were invited to participate in this prospective study. all surgical fellows had > 3 years of experience as a surgeon or an assistant in laparoscopic surgery including laparoscopic appendectomy, cholecystectomy, gastrectomy, and colectomy, with no experience with the da vinci surgical system. all subjects in both groups had not previously used the dv - trainer. after a standardized introduction and 10 min of practice, each subject completed three virtual endo - wrist modules (pick and place, peg board, and match board) in sequence [figure 1 ]. pick and place consists of placing red, blue, or yellow objects in the corresponding colored boxes. peg board consists of grasping rings on a vertical stand with the left hand and then passing these to the right hand before placing them on a peg. match board consists of placing nine numbers and letters in specific squares on the board. three virtual endo - wrist modules : (a) pick and place, (b) peg board, (c) match board performance was recorded using a computerized built - in scoring algorithm created by the manufacturer. the measured variables included the time to complete the exercise (seconds), economy of motion (cm), number of instrument collisions, excessive instrument force (seconds), instruments out of view (cm), master workspace range (cm), and number of drops. a percentage score derived from a proprietary algorithm that combined a selection of these variables was also reported. after completion of all tests, the data were statistically evaluated using ibm spss version 20.0 (ibm, armonk, ny, usa). direct comparisons of surgical fellows and medical students were performed using an independent - sample t - test or the mann - whitney u - test depending on the data distribution. differences of p < 0.05 were considered as statistically significant. there was no significant difference between the groups in terms of the sex of the participants (male : female = 10:4 vs. 8:3, p = 1.000), but surgical fellows were significantly older than the students (age : 25.57 2.14 years vs. 35.63 2.25 years, p < 0.001). in the pick and place module, surgical fellows scored significantly a better in the number of instrument collisions (4.11 2.98 vs. 1.18 1.60, p = 0.016), and the number of drops (2.67 1.80 vs. 1.00 1.01, p = 0.028), but the percentage score was not significantly different in the peg board module (41.56 16.31 vs. 51.36 18.27, p = 0.239) [table 2 ]. no significant differences were found between surgical fellows and medical students in the match board module [table 3 ]. when the scores for all three modules were tallied, the mean score was 53.21 20.12 for the medical students and 54.61 19.58 for the surgical fellows (p = 0.764). the intensive training needed for laparoscopic surgery, and the demand for high technical standards may discourage surgeons, who perform open surgery from performing minimally invasive surgery. however, the advent of robotics has increased the interest in minimally invasive surgery among laparoscopically nave surgeons. nevertheless, the surgeons may be reluctant to perform robotic surgery, assuming that learning robotic skills will be difficult without laparoscopic experience. in a previous study, that evaluated the impact of laparoscopic experience on performance with the da vinci surgical system, the authors concluded that the laparoscopic experience was the strongest predictor of performance. they assessed robotic dexterity using three tasks performed with the da vinci surgical system : two of the three tasks involved creating a double knot and needle driving. however, these two tasks require an understanding of tying knots, and handling a round needle, skills that may have been lacking among the medical students participating in the previous study. we, therefore, assessed robotic dexterity using three endo - wrist modules of the dv - trainer, as these are not related to surgical skills and knowledge. construct validity is regarded as one of the most important aspects of simulator evaluation, because it determines whether a device can discriminate between experienced and inexperienced surgeons. perrenot. performed a large study of the validity of the dv - trainer and found that the pick and place and peg board modules offered good construct validity. conversely, the match board module has been associated with good construct validity in other studies. the current study used these three virtual endo - wrist modules, as they have been proven useful for comparing robotic skills. our results indicated that the laparoscopic experience is not strongly correlated with robotic dexterity when using the dv - trainer. for example, with the da vinci surgical system, a hand movement to the right outside the body causes the instrument inside a patient to be moved to the right. by contrast, during laparoscopy, the instrument tip moves in the opposite direction of the surgeon 's hand, and surgeons have to adjust their hand - eye coordination to translate their hand movements in this reverse environment. moreover, endo - wrist instruments are unique in that they allow seven - degrees of freedom of motion, which replicates the full range of motion of the surgeon 's hand. in addition, our results can also be affected by the fact that learning robotic skills is relatively easy. compared the efficacy of the da vinci surgical system using both the 3d and 2d view options with traditional manually assisted laparoscopic techniques for performing standardized exercises. the inexperienced students performed the tasks significantly quicker and with fewer errors, when assisted by the robot in the 3d and 2d view modes compared with traditional laparoscopic surgery. reported the initial experience of a surgeon without laparoscopic experience with robot - assisted radical prostatectomy. they concluded that a laparoscopically nave yet, experienced open surgeon could successfully apply open surgical skills to the minimally invasive environment in 8 - 12 cases using the da vinci surgical system. however, laparoscopic experience is clearly beneficial for some aspects of robotic surgery. in particular, laparoscopic experience is useful for access, not only for placement of ports but also for laparoscopically treatable adhesions that prevent the placement of the ports. in addition, when multi - quadrant abdominal access is needed, laparoscopic skills can be used to reduce docking time. for example, in rectal cancer surgery, colonic mobilization is laparoscopically performed by some surgeons before bringing the robot to the bedside for rectal dissection. the dv - trainer is a well - validated simulator of the da vinci system that can discriminate between expert and novice robotic surgeons. however, the instrument can not simulate the da vinci system completely, which results in instrument bias. surgical fellows outperformed medical students in some variables of the peg board module, but the percentage score was not significantly different between the groups. if the number of participants was larger, then the percentage score in the peg board module may have been significantly, different between the groups. our study found that scores of three virtual endo - wrist modules were not significantly affected by the operator 's laparoscopic experience. these results greatly suggest that the laparoscopic experience is not an important factor for learning robotic performance, although laparoscopic experience is beneficial for some aspects of robotic surgery so far. | background : different skills are required for robotic surgery and laparoscopic surgery. we hypothesized that the laparoscopic experience would not affect the performance with the da vinci system. a virtual robotic simulator was used to estimate the operator 's robotic dexterity.materials and methods : the performance of 11 surgical fellows with laparoscopic experience and 14 medical students were compared using the dv - trainer. each subject completed three virtual endo - wrist modules (pick and place, peg board, and match board). performance was recorded using a built - in scoring algorithm.results:in the peg board module, the performance of surgical fellows was better in terms of the number of instrument collisions and number of drops (p < 0.05). however, no significant differences were found in the percentage scores of the three endo - wrist modules between the groups.conclusion:robotic dexterity was not significantly affected by laparoscopic experience in this study. laparoscopic experience is not an important factor for learning robotic skills. |
blood glucose homeostasis can be disturbed by many clinical conditions such as pregnancy and obesity and cause -cell mass expansion to meet the increased demand of insulin [1, 2 ]. however, the mechanism of action underlying the expansion of -cells is currently unclear [36 ]. although glucose has been postulated to regulate cyclin d2 in pancreatic islet beta cells and play a dominant role in beta cell compensation, it is not yet clear how glucose controls cell cycle of islet beta cells [710 ]. a previous study showed that the suppression of both cdk - inhibitors p27 and p18, but not p27 alone, promotes endocrine tumour formation in rodents [11, 12 ]. similarly, although cyclin d is important for cell proliferation, its overexpression does not trigger beta cell replication. it suggests that adult islets are under multipoints control to regulate cell cycles for beta cell replication. our previous study revealed that primary islets of adult mice respond to chemical - mechanical digestion and purification procedures by markedly increasing cyclin b1 but reducing p27 protein level. during the following 7 days of cultivation, maintenance of high level of cyclin b1 but rapid restoration of p27 of islets cultured in medium containing high glucose the rapid restoration of p27 level of cultured islets may explain the reason why cell number did not increase for fetal rat islet beta cells that are cultured in a medium containing 200 mg / dl glucose for 7 days. since the p27 is an important g1/g0 checkpoint for the progression of cell cycle, it is interesting to study whether persistent suppression of p27 can enhance islet beta cell proliferation in a hyperglycaemic milieu. since data obtained from experiments using cell lines, fetal islets or islets of knock - out mice to elucidate the role of p27 and glucose on beta cell replication may not be suitable for applying to adult islets, in this study, we used primary islets of adult mice to investigate the complementary role of hyperglycemia and persistent p27 suppression on beta cell regeneration. chemicals including tris(hydroxyl - methyl)-aminomethane (tris), histopaque-1077, type xi collagenase, and antibody against -actin (ac-15) were obtained from the sigma chemical company (st. (grand island, ny, usa). antibodies against cyclin b1 (gns1), cyclin d1 (dcs-6), and p27 (dcs-72.f6) were obtained from thermo fisher scientific (fremont, ca, usa), and antibody against foxm1 (4g3) was purchased from millipore corporation (bilerica, mass, usa). male c57bl/6 mice (812 weeks old) were obtained from a local breeder and were administered a single intraperitoneal injection of streptozotocin 200 mg / kg body weight to induce diabetes. mice with whole blood glucose levels remaining at > 360 mg / dl for more than 2 weeks were used as diabetic recipients. three to 5 mice were housed in each cage and fed standard pelleted food and tap water ad libitum. the animal room had an automatic lighting cycle with 12 h of light and 12 h of darkness. the animals were treated humanely in accordance with the laboratory animal guidelines of chang - gung memorial hospital. pancreatic islets were isolated from c57bl/6 mice by collagenase digestion, enriched on a histopaque density gradient, and finally hand picked. briefly, after administering sodium amobarbital to the mice to induce anaesthesia, we distended the pancreas of each nonfasted healthy mouse with 2.5 ml rpmi-1640 medium containing 1.5 mg / ml collagenase and then excised and incubated these in a 37c water bath. the islets were purified using a density gradient and were hand - picked under a dissecting microscope. isolated islets with diameters of 150 m were collected and separated into groups of 50 islets per group. to minimize the influence of batch - to - batch variation in islet function on the experimental observations, each batch of islets isolated from 810 mice in a single day were separated into equal groups and transplanted into an equal number of mice in both the control and experimental groups on the same day. the islets were centrifuged (500 g for 90 seconds) in a pe-50 tube connected to a 200 l pipette tip. with the recipient mouse under amobarbital anaesthesia a capsulotomy was performed in the lower pole of the kidney, and the tip of the pe-50 tube (clay adams, parsippany, nj, usa) was advanced beneath the capsule toward the upper pole, where the islet graft was implanted using a hamilton syringe. we transduced islets with small hairpin rnas (shrnas) to silence p27 and used nontarget shrnas as controls and then examined the effect of p27 silencing on the adaptation of adult mice islets. briefly, freshly isolated islets, at a concentration of 50 islets per well, were plated in a 96-well tissue culture plate with 150 l of rpmi-1640 medium containing 8 g / ml of polybrene. lentivirus was then incubated with islets at 20 multiplicity of infection (moi) for 24 h at 37c. the next day, the islets were transferred to new plates, washed twice, and further cultured at 37c, with the medium being changed on a daily basis. at 72 h following isolation, the islets were collected for transplantation. p27 gene silencing was performed by infecting the islets with 4 clones of mission shrna lentiviral particles (sigma, saint louis, mo, usa) that are designed to target cyclin - dependent kinase inhibitor 1b (p27). these 4 clones were trcn0000071063, (ccggcgcaagtggaatttcgactttctcgagaaagtcgaaattccacttgcgtttttg) ; trcn0000071064, (ccggccggcatttggtggaccaaatctcgagatttggtccaccaaatgccggtttttg) ; trcn0000071066, (ccggcctttaattgggtctcaggcactcgagtgcctgagacccaattaaaggtttttg) ; trcn0000071067, ccggcccggtcaatcatgaagaactctcgagagttcttcatgattgaccgggtttttg. at 24 hours of transduction, equal batches of targeting and non - targeting islets (about 300 islets per batch) were washed 3 times with ice - cold phosphate - buffered saline and lysed with a buffer containing 150 mmol / l nacl, 0.2 mmol / l ethylenediamine - tetraacetic acid 20 mmol / l tris - hcl (ph 7.4), and 0.5% sodium dodecyl sulfate supplemented with complete protease inhibitor cocktail (roche diagnostic deutschland gmbh, mannheim, germany). after 20-minute incubation at 4c, the lysate was centrifuged at 13,000 g for 15 minutes at 4c, and the supernatant was collected as the total islet protein content. total islet proteins separated on a 12% sodium dodecyl sulfate polyacrylamide gel were electrophoretically transferred onto nitrocellulose membranes. after ponceau s staining to check transfer efficiency, the membrane was blocked for 2 hours at room temperature with 10% nonfat dry milk (nfdm) in tris - buffered saline (ph 7.4) containing 0.1% tween-20 (tbst). it was then incubated overnight at 4c in nfdm - tbst containing 2 g / ml each of antibodies against -actin (housekeeping), p27 (g1/g0 checkpoint), cyclin d1 (g1/s), cyclin b1 (g2/m), and foxm1, washed 3 times with tbst, and incubated for 1.5 h at room temperature with horseradish peroxidase - conjugated anti - rabbit immunoglobulin g antibody (0.1 g / ml nfdm - tbst). after 3 washes with tbst, the bound antibodies were detected by using the visglow chemiluminescent kit obtained from visual protein biotechnology (taipei, taiwan) and kodak biomax ms films. the cell cycle proteins were expressed as the ratio of band density of each protein over that of -actin in the same batch of total islet proteins. function of islets transduced with shrnas to silence p27 or the non - target shrna control were evaluated by glucose - stimulation insulin secretion. after 24 h of transduction and at 3 and 7 days of culturing, batches of 30 islets per well were sequentially exposed to different concentrations of glucose. after the medium was collected, the same batch of islets was then stimulated with 360 mg / dl of glucose for 60 min. the net insulin secretion from the glucose stimulation test (gsis) was calculated as the difference of the insulin content between the medium containing 360 mg / dl and medium containing 100 mg / dl glucose. the stimulation index (si) was considered as the ratio of insulin content of the medium containing 360 mg / dl of glucose over that of the medium containing 100 mg / dl of glucose for the same batch of islets. to study the short - term effect of p27 silencing on islet cell function and replication, mouse islets transduced with shrnas to p27or the non - target shrna control were transplanted to both normoglycemic healthy mice and mice with streptozotocin - induced diabetes. the relative number of cells in the islet graft undergoing replication was estimated by the relative numbers of cells with nuclei staining positive for ki67 for an average of 250 cells per graft (n = 4 per group). to study the long - term effects of p27 silencing on the function of islet grafts, mouse islets transduced with shrnas to p27or the non - target shrna control were transplanted to mice with streptozotocin - induced diabetes 24 hours after transduction and 48 hours after incubation in the culture medium. we transplanted 200 islets per recipient to study the effect of p27 silencing on islet function in vivo. after transplantation, the body weight and whole blood glucose level in blood samples drawn from a tail vein were measured 2 to 3 times a week for 12 weeks, and the duration of temporary hyperglycaemia was considered as the period of time between transplantation and 2 consecutive measurements of whole blood glucose level below 200 mg / dl. at the end of the 12-week observation period, all nephrectomized mice were kept alive for 2 weeks to confirm graft function, and then, the pancreas was removed for measuring the insulin content. insulin content in the pancreas remnant and the islet graft was determined by using the acid - ethanol method. briefly, the pancreas or graft - bearing kidney from nonfasted mice was removed randomly between 8 and 10 am on the indicated date, homogenized in an acid - ethanol solution, and stored overnight at 4c. after centrifugation at 2400 rpm for 30 min, the supernatant was collected and stored at 20c. the pancreas remnant and islet grafts were then homogenized again in a fresh aliquot of acid - ethanol solution and the insulin was re - extracted overnight. after centrifugation, the supernatant was collected and pooled with the first extracted sample. finally, the insulin concentration was measured using radioimmunoassay. statistical differences between means were analyzed using a paired or unpaired student 's t - test, as appropriate. the cumulative cure rate in groups of the long - term effect study was assessed using the kaplan - meier method. the log rank test was used to analyze differences in the cure rates between groups of mice. table 1 reveals that the lentivirus carrying p27-targeting shrna effectively decreased the expression of p27 protein in adult mouse islets at 54 and 96 h after infection and a representative western blot was shown in figure 1. the p27 protein content in cultured islets at 54 hours after viral infection was only 22% that in freshly isolated islets, and the suppression of p27 protein was maintained even after 96 hours of infection. table 1 shows that the suppression of p27 expression was accompanied by the increment in the levels of b1 and foxm1 proteins, which suggest that the reduced p27 expression allows islets cells to enter the cell cycle. the control islets infected with the non - targeting lentivirus had a p27/actin ratio of 0.56 0.11 (n = 6), 0.80 0.18 (n = 4), and 0.95 0.24 (n = 4) at 24, 54, and 96 hours after infection, respectively, in comparison with the ratios obtained for the freshly isolated islets. to study the effect of lentivirus transfection on islets function, the glucose - stimulated insulin secretion (gsis) and stimulation index (si) of islets were measured at 3 and 7 days after targeting and non - targeting viral infection. table 2 shows that the ratio and net difference of insulin secretion between 360 mg / dl and 100 mg / dl glucose of cultured islets with targeting did not differ from that of islets with non - targeting viral infection. to investigate the short - term effect of p27 silencing on islet cell proliferation, batches of 50 each of targeting and non - targeting transduced islets were implanted in the subcapsular space of the left kidney of normal healthy mice and b6 mice with streptozotocin - induced diabetes ; 6 days later, the grafts were removed and immunohistochemistry was performed. when the mice with streptozotocin - induced diabetes were used as recipients, the number of nuclei staining positive for ki67 was 0.35 0.12 and 0.12 0.07 (n = 4, p 0.05) at day 0 and 412 20 mg / dl and 429 46 mg / dl (n = 4, p > 0.05) at day 6 after implantation, respectively. the body weight for targeting and non - targeting mice in the diabetic recipient groups was 23.0 0.8 g and 23.3 1.3 g (n = 4, p > 0.05) at day 0 and 24.6 0.3 g and 24.2 1.0 g (n = 4, p > 0.05) at day 6 after transplantation respectively. to study the long - term effect of p27 silencing on islet graft function, batches of 200 isogeneic islets with targeting or non - targeting transduction were implanted in the subcapsular space of the left kidney of b6 mice with streptozotocin - induced diabetes, and the whole blood glucose and body weight were measured. as shown in figures 3(a) and 4, all treated diabetic mice that received 200 islets converted to normoglycemia, and the mice in the targeting group had significantly shorter temporary hyperglycaemia period than mice in the non - targeting group (16.5 2.9, n = 13 versus 25.9 3.5, n = 14, p < 0.05 in table 3). the long - term ex vivo beneficial effect of p27 silencing on graft function was also indicated by the significantly higher cumulative cure rate for diabetes in mice receiving 200 targeting islets than that in mice receiving 200 non - targeting islets (p < 0.05) (figure 4). at the end of the 12-week observation period, three days after the removal of the graft - bearing kidney, the mice showed rapid elevation of whole blood glucose level and a significant decrease in body weight (figures 3(a) and 3(b)). there was no difference between the targeting and non - targeting groups in terms of insulin contents of the graft and pancreatic remnant at 12 weeks after transplantation (table 3). in this study, we transduced adult islets with lentivirus - carrying shrna to silence 80% of p27 protein, and the resultant suppression of p27 expression lasted for over 96 hours after infection. the transduction and the subsequent p27 suppression did not influence islet functions in terms of glucose - stimulated insulin secretion. it has been demonstrated that suboptimal number of islet tissue was insufficient to achieve normoglycemia in diabetic recipient ; graft beta cell replication was increased initially but not by 18 days and after despite persistent hyperglycemia, and beta cell mass fell progressively. therefore, in this study, 50 islet tissues per recipient are used for short - term transplantation experiment to render islet beta cell a higher replication rate in diabetic recipient ; 200 islet tissue is used for long - term experiment in order to shorten the temporary hyperglycemia days and avoid falling beta cell mass by persistent hyperglycemia. in the short - term ex vivo study, when normoglycemic healthy mice were used as recipients, neither control islets nor islets with p27 silencing had detectable cells with nuclei staining positive for ki67, at 6 days after transplantation. on the contrary, adult islets with p27 silencing expressed more nuclei and higher density of positive ki67 staining than the control islets, at 6 days after the islets were transplanted to mice with streptozotocin - induced diabetes. our data suggest that p27 suppression alone does not enhance islet cell proliferation in normoglycemic mice but hyperglycemia and persistent p27 suppression have a synergistic effect on islet cell replication in terms of nuclei staining positive for ki67. to further confirm the complementary effect of hyperglycemia and p27 silencing on beta cell replication, we transplanted adult mouse islets with or without p27 silencing to diabetic mice and followed up all treated mice for 3 months. the beneficial effect of p27 silencing on graft replication was indicated by the significantly shorter temporary hyperglycemic period and the significantly higher cumulative cure rate for diabetes in mice receiving targeting islets than that of mice receiving the same number of non - targeting islets. during the early g1 phase of the cell cycle, cyclin d - cyclin dependent kinase 4/6 catalyzes phosphorylation of retinoblastoma protein (prb) and the phosphorylated prb inhibits anaphase - promoting complex- (apc / c-) mediated polyubiquitination and subsequent proteolysis of skp2, which results in increase of skp2 and decrease of p27 protein. the degradation of p27 is essential for cells to enter g1/s phases for replication and the resultant adaptive expansion of pancreatic beta cells [11, 12 ]. during s - g2-m phases of each beta cell division, glucose downregulates cyclin d2 expression that will reduce phosphorylated prb and cause decrease of skp2 and increase of p27 protein [10, 17 ]. the increment of p27 protein during s - g2-m phases of each beta cell division prevents cells from immaturely entering the next cycle. in late g2 phase, the amount of b1 protein in xenopus oocytes is 20- to 30-fold higher than in g1 and a threshold level of cyclin b1 protein must be reached before mitosis can proceed. once initiated, progression through mitosis is dependent on the degradation of several cell cycle regulatory proteins by apc / c, including cyclin b1 and skp2, which again prevents cells inappropriately entering other phases during mitosis [19, 20 ]. our previous study revealed that isolated islets of adult mice persistently express high level of cyclin b1 especially when the culture medium contains high glucose. in this study, we used shrnas to silence p27 and used hyperglycemia as a complementary factor to examine the synergistic effect of glucose and p27 on the adaptation of adult mice islets. although the mechanism of action of the synergistic effect of hyperglycemia and p27 silencing on adult islet beta cell replication is not yet clear, we hypothesize that the persistent suppression of p27 by lentivirus - carrying shrna on adult islet cells will drive more cells into the g1/s phase and the high glucose - mediated persistent elevation of cyclin b1 will prepare more cells to be ready to enter mitosis and increase beta cell replication. in conclusion, our data suggested that adult mouse islet beta cells can replicate when the metabolic demands increase and there is a synergistic effect of hyperglycemia and concurrent suppression of p27 on islet beta cell replication. | the complementary role of hyperglycemia and p27kip1 suppression on islet beta cell regeneration was investigated in a syngeneic mouse model. p27kip1 gene silencing was performed by infecting islets of c57bl/6 with shrna lentiviral particles. at 54 hours after viral infection, p27kip1 protein content in cultured targeting islets was 22% of that in freshly isolated islets. six days after transplantation to diabetic mice, targeting islet graft had considerably more cells with ki67-staining nuclei than nontargeting islets. the mice in the targeting - islet group had a significantly shorter duration of temporary hyperglycaemia than mice in the non - targeting - islet group. the long - term ex vivo beneficial effect of p27kip1 silencing on graft function was also indicated by the significantly higher cumulative cure rate for diabetes in mice receiving 200 targeting islets than that in mice receiving 200 non - targeting islets. our data suggest that hyperglycemia and persistent p27kip1 suppression have a synergistic effect on islet beta cell replication in adult mice. |
glucagon - like peptide-1 (glp-1) is produced by posttranslational proteolytic cleavage of the proglucagon gene product and mainly secreted from the enteroendocrine l cells in the distal intestine in response to nutrient ingestion. glp-1 is an incretin hormone, which increases glucose - stimulated insulin secretion [1, 2 ]. glp-1 is quickly degraded by dipeptidyl peptidase-4 (dpp-4), and inhibition of this proteolytic enzyme enhances its biological half - life. glp-1 has many beneficial effects on the control of blood glucose levels including stimulation of insulin secretion and inhibition of glucagon secretion, expansion of the beta - cell mass by stimulating beta - cell proliferation and differentiation and inhibiting beta - cell apoptosis, delay of gastric emptying, and reduction of food intake [46 ]. therefore, glp-1 has been extensively studied as a possible treatment of type 2 diabetes, and glp-1 analogues and dpp-4 inhibitors are now widely in clinical use in these patients [711 ]. expression of the glp-1 receptor is widely detected in various cells and organs including the kidney, lung, heart, hypothalamus, endothelial cells, neurons, astrocytes, and microglia as well as pancreatic beta - cells [1217 ], suggesting that glp-1 might have additional roles other than glucose - lowering effects. it was reported that glp-1 shows anti - inflammatory effects on pancreatic islets and adipose tissue, contributing to lowering glucose levels in diabetes [1820 ]. in addition to these tissues, emerging data suggest that glp-1-based therapies also showed anti - inflammatory effects on the liver, vascular system including aorta and vein endothelial cells, brain, kidney, lung, testis, and skin by reducing the production of inflammatory cytokines and infiltration of immune cells in the tissues [17, 2125 ]. thus, glp-1 therapy may be beneficial for the treatment of chronic inflammatory diseases including nonalcoholic steatohepatitis, atherosclerosis, neurodegenerative disorders, diabetic nephropathy, asthma, and psoriasis [14, 2632 ]. drugs which are glp-1 receptor agonists or dpp-4 inhibitors are shown in table 1. in this review, we will introduce some of the chronic inflammatory diseases and then discuss evidence for beneficial effects of glp-1-based therapies focusing on its anti - inflammatory actions. type 1 diabetes is caused by autoimmune - mediated destruction of pancreatic beta - cells, and type 2 diabetes is caused by both insulin resistance and relative deficiency of insulin [3436 ]. inflammation can be a mediator of insulin resistance and beta - cell damage by high glucose, fatty acids, or adipokines released from adipose tissues [3739 ]. thus, inflammation is an important factor for the pathogenesis of both type 1 and type 2 diabetes, and inhibition of inflammation can be a therapeutic strategy for treatment of diabetes. the proinflammatory cytokines, such as interleukin-1 beta (il-1), interferon gamma (ifn-), and tumor necrosis factor alpha (tnf-), inhibit glucose - stimulated insulin secretion and proliferation of beta - cells [4042 ]. treatment of isolated mouse islets with palmitate induced the expression of proinflammatory cytokines tnf-, il-1, and il-6. liraglutide (100 nm), a long - acting glp-1 analogue, inhibited the palmitate - induced expression of these inflammatory factors and p65 expression. treatment of cultured human islets with exendin-4 (50 nm), a glp-1 receptor agonist, suppressed the expression of inflammatory genes such as nfb1(p105), nfb2(p100), rela (also termed p65), tnf receptor superfamily member 1a, and receptor - interacting serine / threonine kinase 2. as well, exendin-4 (50 nm) and cyclic adenosine monophosphate (camp) response element - binding protein overexpression additively protected transplanted human islets in streptozotocin- (stz-) induced diabetic nude mice. treatment of nonobese diabetic mice with the dpp-4 inhibitor, nvp - dpp728 (30 mg / kg), significantly increased the levels of plasma transforming growth factor beta-1 (tgf-1), an anti - inflammatory cytokine, and increased cd4+cd25+foxp3 + regulatory t cells, contributing to the remission of diabetes. treatment of diet - induced obese mice with sitagliptin (4 g / kg), a dpp-4 inhibitor, significantly reduced the expression of inflammatory genes including monocyte chemotactic protein- (mcp-) 1, il-6, il-12(p40), il-12(p35), and ifn--induced protein 10 (ip-10) in pancreatic islets and improved glucose - stimulated insulin secretion in isolated islets. treatment of stz - induced diabetic rats with another dpp-4 inhibitor, vildagliptin (10 mg / kg), significantly reduced plasma tnf- concentration and decreased nitric oxide concentration in serum and pancreatic homogenates compared with untreated diabetic rats. treatment with sitagliptin (20 mg / kg) increased serum glp-1 levels in stz - induced diabetic monkeys and showed significantly protective effects on stz - induced islet injury in vivo and in vitro via activation of the insulin - like growth factor receptor (igfr)/akt / mammalian target of rapamycin (mtor) signaling pathways. these results suggest that glp-1-based therapies suppress inflammatory cytokines and increase anti - inflammatory mediators in the pancreas. c - x - c motif chemokine 10 (cxcl10/ip10), which is induced by ifn-, has an important role in recruiting activated t cells into the islets in type 1 diabetes. exendin-4 (100 nm) decreased ifn--induced signal transducer and activator of transcription-1 (stat1), which is important for cxcl10 expression in the pancreatic beta - cell line, min6 cells, and human islets. therefore, suppression of cxcl10 production by exendin-4 could reduce islet inflammation by decreasing cytotoxic t lymphocyte recruitment into the islets in autoimmune type 1 diabetes. serine proteinase inhibitor-9 plays an important role in the survival of cells against attack by natural killer cells and cytotoxic t lymphocytes, which play a direct role in the destruction of pancreatic beta - cells in type 1 diabetes. the glp-1 receptor agonist, exenatide (a synthetic form of exendin-4) (10 nm), induces the expression of serine protease inhibitor-9 in human islets. these results suggest that glp-1-based therapies not only directly regulate the expression of inflammatory mediators, but also regulate the recruitment of immunocytes and protect from immunocyte attack, contributing to the preservation of pancreatic islets. the abundance of proinflammatory cytokines and chemokines in adipose tissue is a key contributor to insulin resistance in type 2 diabetes, and blocking of inflammatory signaling pathways or immune cell infiltration in adipose tissue improves insulin sensitivity [5052 ]. administration of a recombinant adenovirus producing glp-1 (4 10 pfu / mouse) to ob / ob mice reduced the macrophage population and production of tnf-, mcp-1, and il-6 in adipose tissue via inhibition of nuclear factor - kappa b (nf-b) activation and phosphorylation of erk1/2 and c - jun n - terminal kinases. sitagliptin (4 g / kg) also showed similar effects and reduced the expression of mrna for inflammatory cytokine genes and macrophage infiltration in adipose tissue of high fat diet- (hfd-) induced obese mice. in patients with type 2 diabetes, sitagliptin (100 mg / day) therapy significantly reduced the plasma levels of c - reactive protein (crp), il-6, il-18, secreted phospholipase - a2, soluble intracellular adhesion molecule- (icam-) 1, and e - selectin compared with placebo. the inflammatory score and the homeostatic model assessment index for insulin resistance were significantly reduced in sitagliptin - treated type 2 diabetes patients. therefore, suppression of inflammatory mediators in adipose tissue by glp-1-based therapies might contribute to the improvement of insulin sensitivity. glp-1-based therapies for diabetes contribute to reduce inflammation and have additional beneficial effects such as islet preservation and improvement of insulin sensitivity in addition to glucose - lowering effects. however, some rare cases of acute pancreatitis and neoplasms have been reported [5355 ] ; thus the establishment of safety of glp-1-based therapy should be validated by sufficient further studies. atherosclerotic cardiovascular disease is caused by proinflammatory stimuli in the vascular endothelial cells and is associated with increased plasma levels of tnf-, il-6, crp, and circulating endotoxin (i.e., lipopolysaccharide (lps)) [56, 57 ]. atherosclerosis is a chronic inflammatory condition resulting from the invasion and accumulation of white blood cells (foam cells) in the walls of arteries and therefore is a syndrome affecting arterial blood vessels. glp-1 (5.0 m) perfusion attenuates lps - induced microvascular permeability via the camp protein kinase a (pka) pathway. liraglutide (100 m) reduced the mrna expression of adhesion molecules such as vascular cell adhesion molecule- (vcam-) 1, icam-1, and e - selectin in tnf-- or lps - stimulated human aortic endothelial cells and human umbilical vein endothelial cells [6062 ]. liraglutide (100 nm) induced phosphorylation of calcium / calmodulin - dependent protein kinase i and 5 adenosine monophosphate - activated protein kinase (ampk), and inhibition of calcium / calmodulin - dependent protein kinase kinase (camkk) abolished the inhibitory effect of liraglutide on the expression of vcam-1 and e - selectin. in addition, knockdown of ampk with short hairpin ampk rna abolished the liraglutide activation of ampk and anti - inflammatory effects. these results demonstrate that the anti - inflammatory effects of liraglutide in human aortic endothelial cells is dependent on activation of camkk and ampk, which are camp / ca signaling pathways. in addition, it was reported that liraglutide (100 nm) inhibited tnf-- or hyperglyceamia - mediated induction of plasminogen activator inhibitor type-1 in human vascular endothelial cells. exendin-4 (50 g / kg / day) treatment resulted in a reduction of atherosclerosis development and the number of monocytes adhering to the endothelium wall in the aortic root in western - type diet - fed apoe3-leiden.cetp(e3l.cetp) mice. sitagliptin (25 m), nvp - dpp728 (270 m), or liraglutide (1000 ng / ml) treatment significantly reduced oxidized - low - density lipoprotein - induced or pkc activator - induced protein expression of nucleotide - binding domain - like receptor with a pyrin domain 3 (nlrp3), toll - like receptor 4 (tlr4), and il-1 in a human monocytic cell line, thp-1, by decreasing phosphorylated - protein kinase c (pkc). administration of linagliptin (10 mg / kg / day), a dpp-4 inhibitor, to apoe mice, an animal model of atherosclerosis, decreased inflammatory molecule expression and macrophage infiltration in the atherosclerotic aorta. another report showed that sitagliptin (576 mg / kg) reduced plaque macrophage infiltration and matrix metallopeptidase-9 (mmp-9) levels in apoe mice and increased activation of ampk and akt signaling pathway but inhibited mapk and erk1/2 signaling in aorta of apoe mice. this suggests that sitagliptin has protective actions against atherosclerosis through ampk and mapk - dependent mechanisms. in addition, sitagliptin (30 mg / kg / day) and exenatide (3 g / kg/12 h) significantly inhibited advanced glycation end products - induced oxidative stress in aortic endothelials in high fat diet (hfd)/stz diabetic rats by reducing endothelin-1 (et-1) and inflammatory cytokine via rhoa / rho - associated protein kinase (rock)/nf-b signaling pathways and ampk activation. des - fluoro - sitagliptin (200 mg / kg / day) treatment reduced atherosclerotic lesion formation, infiltration of macrophage and t lymphocytes, and the expression of proinflammatory cytokines within plaques in apoe mice. as well, treatment with alogliptin (20 mg / kg / day), a selective dpp-4 inhibitor, showed similar anti - inflammatory effects in the injured arteries of low - density lipoprotein receptor - deficient mice. interestingly, metabolite (9 - 37) of glp-1 as well as the c - terminal glp-1 split product (28 - 37) also reduced plaque inflammation and stabilized atherosclerotic lesions in apoe mice. these suggest that glp-1-based therapies have protective effects in atherosclerosis by decreasing macrophage infiltration in atherosclerotic lesions via inhibition of the expression of adhesion molecules. the loss of sirtuin 6 (sirt6), which regulates proinflammatory mediators, in human umbilical vein endothelial cells is associated with upregulation of the expression of proinflammatory genes. liraglutide (100 nm) treatment increased sirt6 expression and reduced nf-b expression compared with only high glucose - treated endothelial cells. in diabetic patients treated with glp-1-based therapy, the protein level of sirt6 in asymptomatic plaques was significantly increased and tnf- and mmp-9 levels in lesions were significantly reduced compared with diabetic patients without treatment. this result suggests that glp-1-based therapy has anti - inflammatory effects by induction of sirt6 expression in endothelial cells. cardiovascular disease is increased in type 2 diabetes, and hyperglyceamia is a critical promoter during the development of cardiovascular diseases. exendin-4 (5 g / kg or 1 and 10 nm) inhibited high mobility group box i protein expression, a proinflammatory mediator, in myocardial ischemia and reperfusion in rats and in high glucose - induced myocardial cell injury. sitagliptin (30 and 50 mg / kg / day) reduced the expression of tnf- and il-6 in the diabetic heart and had a myocardial protective effect in stz / hfd - induced diabetic rats. therefore, glp-1-based therapy have anti - inflammatory effects on vascular disease and may explain the vasoprotective properties. epidemiological and clinical studies have suggested a link between type 2 diabetes and alzheimer 's disease. in patients with alzheimer 's disease, insulin receptors and insulin signaling in the brain are desensitized and impaired as found in type 2 diabetes patients. therefore, drugs used for treatment of diabetes are expected to have a preventive effect against alzheimer 's disease. glp-1 is known to be produced in the brain and has many functions including neuroprotection [8082 ]. in addition, glp-1 and glp-1 analogues enter the brain through blood brain barrier [8386 ]. the glia may play a critical role in the central nervous system inflammatory responses including alzheimer 's disease, and glp-1 receptor was observed in astrocytes and microglia [17, 87 ]. in astrocytes, glp-1 (1 m) prevented the lps - induced il-1 expression by increase of camp. models of alzheimer 's disease include intracerebroventricular injection of stz, intracerebral injection of lps, and the appswe / ps1e9 mouse. exenatide (20 g / kg / day) treatment inhibited brain tnf- levels, which were induced by intracerebroventricular injection of stz. glp-1 (7 - 36) amide (50 nm) protected the synaptic impairments induced by intracerebral injection of lps in the rat hippocampus. liraglutide (25 nmol / kg / day) treatment significantly reduced the inflammatory response in the cortex as measured by the number of activated microglia and prevented degenerative processes in a 7-month - old appswe / ps1e9 mouse model of alzheimer 's disease. in addition, in the 14-month - old appswe / ps1e9 mouse, inflammation was also markedly reduced and restorative effects were improved by liraglutide treatment. the glp-1 receptor agonist, lixisenatide, exerted neuroprotective effects via reduction of oxidative stress and the chronic inflammation response in the brain of appswe / ps1e9 mouse. in addition, sitagliptin (10 and 20 mg / kg) also showed similar anti - inflammatory effects in appswe / ps1e9 mouse. this suggests that glp-1-based therapies could have a preventive and restorative effect on the pathophysiology of alzheimer 's disease progression. x - ray irradiation of the brain significantly increased il-6, il-1, and il-12p70 cytokine protein expression. liraglutide (25 nmol / kg / day) treatment reduced the mrna expression of proinflammatory cytokine genes, which was induced by x - ray irradiation. parkinson 's disease is a chronic and neurodegenerative brain disorder, and inflammatory activity is one of important features of parkinson 's disease. microglial activation plays a critical role in the pathogenesis of the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyidine- (mptp-) induced parkinson 's disease model and human parkinson 's disease. exendin-4 (10 g / kg) treatment significantly decreased mptp - induced microglial activation and suppressed mptp - induced expression of tnf- and il-1. the inhibitory effect of exendin-4 on microglial activation may have therapeutic potential for the treatment of parkinson 's disease. these anti - inflammatory effects of glp-1-based therapies on the brain may protect against neurodegenerative central nervous system disorders. nonalcoholic steatohepatitis is associated with an inflammation of the liver by an aberrant accumulation of fat in the liver. glp-1 receptor agonists reduced alanine aminotransferase and aspartate aminotransferase levels in patients with nonalcoholic fatty liver disease (or type 2 diabetes) and improved lipid metabolism and reduced fat mass. liraglutide (50, 100, and 200 g / kg/12 h) treatment protected against nonalcoholic fatty liver disease by inhibition of er stress - associated apoptosis in hfd - fed rats. liraglutide or exendin-4 (1 nmol / kg / day) treatment dose - dependently reduced steatosis and lobular inflammation in hfd - fed rats or mice compared with the saline - injected group [28, 95 ], probably due to an increase of sirt1. as a matter of fact, exendin-4 (50 g / kg / day) treatment increased the expression of sirt1 and its downstream factor, ampk, in exendin-4 treated mouse livers and hepatocytes. exendin-4 treatment reduced hepatic expression of the inflammatory markers tnf-, il-1, and il-6 and macrophage markers, cluster of differentiation 68 (cd68), and f4/80 in the liver of mice fed a western - type diet. in nonalcoholic steatohepatitis patients with glucose intolerance, liraglutide (0.9 mg / person / day) therapy for 96 weeks resulted in improvement of histological indicators of inflammation in seven subjects out of ten subjects. crp is produced by the liver and is a marker of inflammation. in a retrospective analysis of 110 obese patients with type 2 diabetes treated with liraglutide, the mean concentration of crp declined after treatment with liraglutide for a mean duration of 7.5 months. in addition, exenatide plus metformin resulted in a significant reduction in crp and tnf- compared with baseline. these reports suggest that glp-1-based therapies improve fatty liver disease by ameliorating inflammation in rodents and humans. diabetic nephropathy is associated with a state of low - grade inflammation in the microvasculature of the kidney 's glomeruli [99, 100 ]. the glp-1 receptor is expressed in glomerular capillaries and vascular walls of the mouse kidney [14, 101 ] and in the glomerulus and proximal convoluted tubules of the rat and pig [29, 102 ]. glp-1 receptor deficiency in the diabetic nephropathy - resistant c57bl/6-akita mouse contributes to the development of diabetic nephropathy, and liraglutide treatment suppressed the progression of nephropathy of the kk / ta - akita mouse, which shows high susceptibility to diabetic nephropathy, suggesting that glp-1 action might play an important role in prevention of diabetic nephropathy. various studies have shown that glp-1-based therapies can reduce macrophage infiltration and inflammatory molecules in models of diabetic nephropathy. exendin-4 (3 and 10 g / kg / day) treatment significantly downregulated the gene expression of cd14, icam-1, and tgf1 in the renal cortex, prevented glomerular macrophage infiltration in glomeruli, and reduced oxidative stress and inflammation in tubular cells in stz - induced diabetic animals [101, 103 ]. treatment with the dpp-4 inhibitor, saxagliptin (10 mg / kg / day), reduced renal tubulointerstitial inflammation by nf-bp65-mediated macrophage infiltration in stz - induced diabetic enos mice. administration of the dpp-4 inhibitor, pkf275 - 055 (3 mg / kg / day), or linagliptin in stz - induced diabetic rats inhibited macrophage infiltration, inflammatory molecules, and nf-b activity in the glomeruli and significantly reduced glomerular leukocyte infiltration. sitagliptin (10 mg / kg / day) treatment decreased the expression of proinflammatory cytokine genes il-1 and tnf- in kidney of diabetic zdf rat. glp-1-based therapies are also effective in nondiabetic models of kidney injury. in a nondiabetic glomerular injury model, alogliptin (20 mg / kg / day), anagliptin (300 mg / kg / day), or exendin-4 (10 mg / kg) significantly reduced infiltration of cd68-positive inflammatory macrophages in the kidney. in the mouse cisplatin - induced renal injury model, treatment with alogliptin (10 mg / kg / day) significantly decreased cisplatin - induced renal injury via antiapoptotic effects. in addition, after ischemia - reperfusion injury, the expression of proinflammatory cytokines, nf-b and icam-1, as well as macrophage infiltration in the kidney was significantly decreased by exendin-4 (10 g / kg) or sitagliptin (600 mg / kg) treatment. therefore, glp-1-based therapies might be beneficial for nephropathy by reducing glomerular leukocyte infiltration and proinflammatory mediators. liraglutide (2 mg / kg) reduced immune cell infiltration and protein expression of e - selectin, tnf-, il-4, il-5, and il-13 in the lung tissue or bronchoalveolar lavage fluid in an ovalbumin - induced chronic asthma model. liraglutide treatment decreased nf-b activation, which was reversed by pka inhibitor, h-89, suggesting that the camp - pka pathway is involved in inhibition of nf-b activation, and subsequently the inhibition of inflammation. in addition, in mice with bleomycin - induced pulmonary fibrosis, liraglutide treatment inhibited infiltration of immune cells and decreased the content of tgf-1. these results suggest that glp-1-based therapies might have beneficial effects on asthma but need to be validated by clinical studies. obesity can reduce the quality and count of men 's sperm [111, 112 ]. the expression of tnf-, mcp-1, and f4/80 mrna levels is increased in the testis and significantly decreased the sperm motility and activity in diet - induced obesity mice, and exenatide (24 nmol / kg / day) treatment suppressed the expression of tnf-, mcp-1, and f4/80 mrna levels in testis and improved sperm quality in diet - induced obesity mice. in type 2 diabetes patients, glp-1 and liraglutide also improve clinical symptoms of psoriasis, a skin inflammatory disease, by downregulation of invariant natural killer t cells [31, 113, 114 ]. glp-1 (100 nm) or exendin-4 (10 nm) treatment inhibited tnf--induced expression of receptor for advanced glycation end products (rage), icam-1, and vcam-1 in human retinal pigment epithelial cells, suggesting that glp-1-based therapies might have beneficial effects on diabetic retinopathy. treatment with the dpp-4 inhibitors, linagliptin (5 mg / kg / day) and sitagliptin (50 mg / kg / day), and the glp-1 analogue, liraglutide (200 g / kg / day), significantly reduced inflammatory markers such as inducible no synthase, cyclooxygenase, and vcam-1 via the ampk pathway in lps - induced endotoxemic shock in rats as a model of human sepsis. these reports suggest that glp-1-based therapies have anti - inflammatory effects in the lung, testis, skin, and eye. inflammation is a protective process including immune system, vascular system, and molecular mediators. however out - of - control inflammation and chronic inflammation can cause pathological disease. inflammation is a risk factor for diabetes, atherosclerosis, cardiovascular disease, neurodegenerative central nervous system disorders, nonalcoholic steatohepatitis, and nephropathy. glp-1-based therapies have many attractive and beneficial effects including their antidiabetic actions on pancreatic beta - cells. however, beyond their metabolic effects, glp-1-based therapies have been shown to have anti - inflammatory effects via several molecular pathways (figure 1) in several organs, tissues, and cells (figure 2). thus glp-1, glp-1r agonists, and dpp-4 inhibitors might have important roles as mediators of inflammation. | glucagon - like peptide-1 (glp-1) is an incretin hormone mainly secreted from intestinal l cells in response to nutrient ingestion. glp-1 has beneficial effects for glucose homeostasis by stimulating insulin secretion from pancreatic beta - cells, delaying gastric emptying, decreasing plasma glucagon, reducing food intake, and stimulating glucose disposal. therefore, glp-1-based therapies such as glp-1 receptor agonists and inhibitors of dipeptidyl peptidase-4, which is a glp-1 inactivating enzyme, have been developed for treatment of type 2 diabetes. in addition to glucose - lowering effects, emerging data suggests that glp-1-based therapies also show anti - inflammatory effects in chronic inflammatory diseases including type 1 and 2 diabetes, atherosclerosis, neurodegenerative disorders, nonalcoholic steatohepatitis, diabetic nephropathy, asthma, and psoriasis. this review outlines the anti - inflammatory actions of glp-1-based therapies on diseases associated with chronic inflammation in vivo and in vitro, and their molecular mechanisms of anti - inflammatory action. |
a widely accepted definition of diabetic peripheral neuropathy is the presence of symptoms and signs of peripheral nerve dysfunction in people with diabetes after exclusion of other causes (boulton 1998). it can be classified into several syndromes each with a distinct pattern of involvement of peripheral nerves. diabetes being a very common medical condition, one should be aware of the usual as well as its rare presentations. diabetic neuropathy can manifest in any stage of the disease though it tends to be a delayed manifestation in type 2 diabetes. it can present as an asymmetrical painful proximal neuropathy or it can be symmetrical and distal. autonomic neuropathy is a more serious form of nervous system involvement and requires careful monitoring. sometimes in a single individual a 57-year - old male electronic engineer presented with severe burning dysesthesia and pain in d4 - 12 distribution on the right side of his chest and abdomen. he also experienced troublesome allodynia leading to decreased sleep, excessive day time sleepiness and fatigue. the symptoms according to him started 6 months prior to his present visit after he had a chest tube insertion for drainage of pleural effusion. on the basis of pleural fluid analysis he had elevated blood sugar at that time with fasting blood sugar (fbs) 246 mg / dl and postprandial blood sugar (ppbs) 360 mg / dl with glycated hemoglobin (hba1c) 9.2%. he was first diagnosed to have diabetes 3 years ago and was on irregular treatment for the same. a week later he noticed a right abdominal bulge especially after taking a heavy meal or while trying to get up from a lying posture. this was associated with a burning pain over the right lower chest and upper abdomen. he was extensively investigated for his painful abdominal mass including a gastrointestinal scopy and ultrasonography (usg) abdomen, however no abnormality could be detected. meanwhile his blood sugar remained uncontrolled, he stopped insulin and changed to herbal medications. on initial evaluation at our hospital, since all results were within normal limits he was referred to neurology department for further evaluation. meanwhile he also developed a right proximal lower limb weakness associated with wasting of thigh muscles leading to buckling at right knee joint. on examination there was a healed scar at the site of intercostal drain insertion in right fifth intercostal space on the anterior axillary line. he had weakness of hip adduction, knee extension, and hip extension all on the right side. the right abdominal muscles were weak with a protrusion of the abdomen mimicking a mass [figure 1 ]. right knee jerk was absent and sensation to crude touch was diminished by 20% on the right side extending from d4 dermatome to right knee. abdominal bulge on attempted flexion of neck and upper trunk on investigations, he continued to have high blood sugars on admission. cerebrospinal fluid (csf) revealed normal sugar with protein 79 mg / dl and 2 cells / mm, mononuclear. magnetic resonance imaging (mri) cervical, dorsal, and lumbosacral spine with contrast showed mild cervical canal stenosis at c3-c6. nerve conduction velocity study (ncv) ; right femoral compound muscle action potential (cmap) amplitudes were reduced and paraspinal electromyography studies (emg) revealed denervation potential from thoracic and lumbar segments. in view of the initial clinical findings of painful sensory symptoms with unilateral abdominal weakness and proximal right lower limb lower motor neuron weakness we considered the possibility of a multiple radiculoneuropathy. since the patient was on antituberculous treatment (att), spinal arachnoiditis secondary to tuberculosis was the initial diagnosis. however, mri spine with contrast and csf study were normal. on reviewing the history he had uncontrolled sugars from the very onset of his symptoms. this prompted us to think the second possibility of a diabetic truncal neuropathy with a unilateral proximal radiculoneuropathy involving the right lower limb. his troublesome abdominal swelling, which was extensively investigated earlier, was due to an abdominal wall weakness, a finding very rarely seen in diabetic truncal neuropathy. it is not a true hernia as there is no protrusion of viscus through a defect in the abdominal wall on the other hand it is the weak muscle wall which bulges out. pain is in a radicular distribution and is usually accompanied by allodynia and tend to become worse at night leading to insomnia and excessive daytime sleepiness as in our case. the pathophysiology of diabetic truncal neuropathy is still a matter of controversy, however being a painful neuropathy an ischemic cause seems to be the most favored hypothesis. our patient had good symptomatic relief with a combination of gabapentine, tramadol, and amitryptaline. on follow up after 3 months he was totally relieved of pain however, his abdominal bulge persisted for which he was advised muscle strengthening exercises and abdominal binders. the clinician should be aware of this uncommon presentation as it can prevent unnecessary investigations. it is a self - limiting condition and usually resolves spontaneously in 2 - 6 months and has a good prognosis. | diabetic neuropathy has varied clinical presentations. as clinicians we should be aware of the common as well as rare manifestations of this syndrome. diabetic truncal neuropathy presenting as a painful pseudoabdominal mass can easily mislead clinicians who are unaware of this problem. subsequently, this can lead to unnecessary investigations and discomfort to the patient. a good blood sugar control and judicious use of drugs for neuropathic pain along with physiotherapy usually gives good relief. it is mostly a self - limiting condition. |
nickel (ni)-containing alloys has become an integral part of almost every routine orthodontic intervention. as contemporary orthodontics relies on various bonded attachments, arch wires, and other devices to achieve tooth movement. the demands made on them are complex because they are placed under many stresses in the oral environment, which include immersion in saliva, ingested fluids, temperature fluctuations, and masticatory force. the orthodontic appliances, i.e., orthodontic bands, brackets, and arch wires were introduced in 1930s. since then the alloys have become an invaluable material in orthodontics, which are made of stainless steel containing 8 - 12% ni, 17 - 22% chromium, and various proportions of manganese, copper, titanium, and iron. the combination of the alloys materials are in close proximity and in hostile conditions leading to corrosion and adverse reaction biologically and increase the friction mechanically. when using nickel titanium (niti) arch wire for dental orthodontic treatment, the possible danger associated with arch wire corrosion derives from the biologically harmful effects due to the released ni ion. therefore, niti arch wire with a good corrosion resistance is crucial to its biocompatibility. on the other hand, the surface corrosion of niti arch wires may increase the friction that appears at the interface between the arch wire and bracket, reducing the free sliding action during orthodontic treatment. the purpose of this study is to evaluate the rate of ni ion release from different types arch wires used in orthodontics. the study was performed using a classic batch procedure by immersion of the samples in artificial saliva at various acidities over an extended time interval and ni release was quantified with the use of a flameless atomic absorption spectrophotometer. four groups of arch wires (niti, ss cu niti and ion implanted niti) were used in the as received condition from the dealers [table 1 ]. the ni release was tested by placing each sample in separate polyethylene screw top bottles containing 100 ml of artificial saliva. the stimulated saliva medium consisted of : sodium chloride - 0.4 g, potassium chloride - 1.21 g, sodium hypo phosphate - 0.78 g, sodium sulfide - 0.005 g, urea - 1 g, distilled water and deionized water - 1000 ml. the ph of artificial saliva was adjusted to 6.75 0.15 by adding in increments of 50 ml of 10 n sodium hydroxide and it was measured by using e. merch (d-6100 darmstadt f.r. germany) ph indicator papers with a high degree of sensitivity (0.2 units sensitivity). materials used in the study the analysis was performed with an atomic absorption spectrophotometer (gbc avanta, australia) model which is based on the unique spectrum of each element. atomic absorption spectrometer measures the quantities of chemical elements present in environmental samples by measuring the absorbed radiation. atomic absorption methods measure the amount of energy in the form of photons of light that are absorbed by the sample for every element analyzed, characteristic wavelengths are generated in a discharge lamp (hollow cathode lamp), and in turn are absorbed by a cloud or vapor of that element. since the sensitiveness of the equipment was restricted up to 1 ppm a the prepared samples were immersed in artificial saliva (36.5c) at ph 5.6 - 7 and tested at different intervals i.e., 7 day, 14 day, and 21 day. a volume of 20 ml of known concentration was taken and the amount of ni and ti ions released from niti wires was determined using an atomic adsorption spectrophotometer. a standard graph is plotted. 10 ml of known concentration of ni is added to 10 ml of saliva test sample. the values were recorded for the released metal as and when the valued dropped it indicated that the standard solution was diluted because of deionized water showing a lesser ppm level. hence for each sample analysis was done 3 times and an average was taken to obtain the accurate results and the results were statistically analyzed. the results of the absorption analysis of the solution were compared using one way analysis of variance (anova). the results of one - way anova to compare the average per day ni release between different groups are shown in table 2. difference in the mean was analyzed with the multiple comparison test by turkey 's honestly significant difference (hsd) and were considered to be significant at p > 0.05. chicago, spss inc - united states of america was used for data processing and statistical analysis. the results of one - way anova to compare the average per day nickel release between different groups in all cases the release of ni reached the maximum on 7 day thereafter, it diminished with time. the mean and standard deviation of ni release in micrograms for different study group at a different point i.e., 7, 14 and 21 days when analyzed, it was found to be (7.34 0.38 g, 6.78 0.35 g and 5.37 0.46 g) respectively for group i. similarly for group ii (stainless steel wire) it was 6.53 0.41 g, 5.18 0.38 g and 2.04 0.22 g. for groups iii (ion implanted niti wire) it was 6.11 0.41 g, 4.87 0.21 g and 3.16 0.27 g and for group iv (copper niti wire) it was 7.03 0.48 g, 5.17 0.36 g and 4.03 0.22 g respectively. the average ni release per day for group i, ii, iii and iv was 0.93 0.04 g, 0.66 0.02 g, 0.67 0.02 g and 0.77 0.05 g, respectively. the result infers that maximum ni release was from untreated niti wire followed by copper niti, ion implanted niti and stainless steel wires. table 3 illustrates the results of student 's paired t - test for the mean changes of ni content between different time point viz. 7 day versus 14 day, 7 day versus 21 day and 14 day versus 21 day for different study groups. it was found that the mean change for the entire four group and between the different time points were significantly different from zero. hsd procedure showed that the mean value in group i (0.93 0.04 g) was significantly higher (p 0.05). the result shows that there is no significant difference in ni release between ions implanted niti wire and stainless steel wire. moreover, these two wires leached less ni when compared to untreated niti and copper wire. in all cases the release of ni reached the maximum on 7 day thereafter, it diminished with time. the mean and standard deviation of ni release in micrograms for different study group at a different point i.e., 7, 14 and 21 days when analyzed, it was found to be (7.34 0.38 g, 6.78 0.35 g and 5.37 0.46 g) respectively for group i. similarly for group ii (stainless steel wire) it was 6.53 0.41 g, 5.18 0.38 g and 2.04 0.22 g. for groups iii (ion implanted niti wire) it was 6.11 0.41 g, 4.87 0.21 g and 3.16 0.27 g and for group iv (copper niti wire) it was 7.03 0.48 g, 5.17 0.36 g and 4.03 0.22 g respectively. the average ni release per day for group i, ii, iii and iv was 0.93 0.04 g, 0.66 0.02 g, 0.67 0.02 g and 0.77 0.05 g, respectively. the result infers that maximum ni release was from untreated niti wire followed by copper niti, ion implanted niti and stainless steel wires. table 3 illustrates the results of student 's paired t - test for the mean changes of ni content between different time point viz. 7 day versus 14 day, 7 day versus 21 day and 14 day versus 21 day for different study groups. it was found that the mean change for the entire four group and between the different time points were significantly different from zero. student 's pair t test multiple comparison test by turkey hsd procedure showed that the mean value in group i (0.93 0.04 g) was significantly higher (p 0.05). the result shows that there is no significant difference in ni release between ions implanted niti wire and stainless steel wire. moreover, these two wires leached less ni when compared to untreated niti and copper wire. we assayed the corrosion resistance, in terms of ion release, of different niti orthodontic wires in artificial saliva at different interval. it is known that corrosion of orthodontic alloys occurs in the intraoral environment, regardless of the alloys metallurgic structure, and it is also known that the extent of manufacturing defects may accelerate the process. concomitant increases in the prevalence of ni hypersensitivity and demand and availability of orthodontic treatment have created growing interest in the composition of alloys and the release of metals during treatment. in orthodontics, the tolerance concept has been introduced to explain observations associated with ni reactions for, e.g., ear piercing, which is very common among adolescent girls, may enhance the prevalence of these sequelae. however, there are indications that orthodontic treatment with ni - containing metallic appliances before sensitization to ni (i.e., ear piercing) may lower the incidence of ni hypersensitivity. observations indicate that early contact with potential allergens may actually lead to a diminished probability for allergic reactions later in life. all the orthodontic appliances used in this study contained, ni as one of their components. the ni release was measured at 3 different time intervals to find out whether the ni release increases constantly or it decreases after an initial increase. the findings of the current study are in accordance with the study by kerosuo. and gjerdet., did not find any significant increase in ni and chromium concentration in saliva of orthodontic patients after insertion of different fixed appliances. the results of the present study were in relevance with the study done by park and shearer. several authors have reported corrosion of orthodontic appliances in vitro, but variation in study designs and different electrochemical factors make comparisons between the studies differs. the preparation and analytical procedures are technique sensitive and may be a source of variation also ; some of the corrosion products might adhere to the metal surface and would not be available for the instrumental analysis of the solutes and thus remain undetected. of the orthodontic wires tested in this study, the largest amount of ni release per day was from group i (niti wire) 0.93 0.04 g followed by (copper niti wire) 0.77 0.05 g, group iii (ion implanted niti wire) 0.67 0.02 g and group ii (stainless steel wire) 0.66 0.02 g. the result clearly showed that less ni was released from ion implanted niti and stainless steel arch wires. gjerdet and hero reported ni release of 0.26 g / day from stainless steel arch wires, their value is lower than that of the value obtained in this present study (0.66 0.02 g / day). the release rates of ni at various time intervals were found to be common in all the arch wires. when the concentrations of ni were measured at various time intervals, a maximum level was found on day 7, which steadily decreased during the subsequent 2 weeks. various study reported a release of 20 g of ni per day from a simulated full mouth orthodontic appliance. in this study, the total release of ni values was well below the normal daily intake of ni 200 - 300 g / day. however, the amounts are not directly comparable because the amount of ni required to create contact hyper sensitivity reactions depends on the individual. dunlap. in their study have reported a case of severe allergic reactions after insertion of niti arch wire in a ni sensitive patient. further studies are required to examine the cytotoxic effects of released ni in vitro cell cultures and how much of the corrosive products are actually absorbed by the patients. recently, ni free brackets like titanium brackets and ceramic brackets can be used effectively for ni sensitive patients. among the arch wires ion these alloys have a long - standing history of successful use in dentistry, with no significant reports of biological effects. nevertheless, when clinical signs or symptoms presumed to be due to ni hypersensitivity are distressing to patients there are many choices of materials available to the dentist as alternatives. in this present study the release of ni was very much below with the average dietary intake of ni which was not capable of causing any toxic effects. researchers have observed a significant variation in the concentrations of ni in saliva, but when orthodontic appliances are placed in an artificial saliva medium there release measurable amounts of elements. in this present study, the ni release reaches a maximum after approximately 1 week, and then the rate of release diminishes with time. the estimated release rates from full - mouth orthodontic appliances are less than 10% of the reported average daily dietary intake for ni and how much of these corrosive products are actually absorbed by patients undergoing orthodontic treatment still needs to be determined. the ingested amount of ni released from orthodontic appliances can not be quantified using the currently available release data, but it is well below the daily dietary intake levels. | aim : the high incidence of nickel (ni) allergy and the increasing use of ni - containing dental biomaterials have been of growing concern. the purpose of this investigation was to analyze and evaluate the rate of ni ion release from different types arch wires used in orthodontics.materials and methods : four groups of arch wires (nickel titanium [niti ], ss, cu niti and ion implanted niti) with twelve samples were stored in artificial saliva with a ph 5.6 - 7.0 thermostated at (36.5c) and tested at different intervals i.e., 7th day, 14th day, and 21st day. the amount of ni and ti ions released from the sample were evaluated using an atomic adsorption spectrophotometer. the solution was replaced with a fresh bottle to avoid sediments.results:statistical analysis was performed by nonparametric tests (student 's paired t - test, one - way analysis of variance and multiple comparison test by tukey honestly significant difference). the statistical package spss pc plus (version 4.0.1) was used for data processing and statistical analysis. results showed significantly statistical influence on the release amount of ni and ti ions. large variation in concentration of ni released from brackets and bands combined. however, the amount of ni ions released in all test solutions diminished with time and was below the critical value necessary to induce allergy and below daily dietary intake level.conclusions:the daily release of niti, ss, cu niti and ion implanted niti by an orthodontic appliance in acid ph, particularly favorable to corrosion, was well below that ingested with a normal daily diet. it is therefore concluded that the quantities of metal ions released in our experimental conditions should not be cause for concern in utilizing the appliance. |
glucocorticoids were among the first drug classes used in the treatment of patients with all and are still essential components of treatment. the glucocorticoid receptors (gr) can form dimers, translocate to the nucleus, and interact with glucocorticoid - response elements to transactivate gene expression, or they can remain as monomers and repress the activity of transcription factors such as the activating protein-1 (ap-1) and nuclear factor-b (nfb). traditionally, prednisone has been the glucocorticoid 's most commonly used drug in the treatment of patients with acute lymphoblastic leukemia (all). it is typically given for 4 consecutive weeks in combination with vincristine, anthracycline, asparaginase, and intrathecal chemotherapy. in the past few years, dexamethasone, another glucocorticoid, has been increasingly used to treat all. however, there have been investigations with respect to glucocorticoid receptors, distribution of gr isoforms, and genetic polymorphisms. polymorphisms at the promoter region of il10 gene are associated with several diseases, including autoimmune, infectious, cancer, alzheimer 's disease (ad), and lymphoblastic leukemia. subsequently, pleiotropic inhibitory and stimulatory effects on various types of blood cells were described for il-10, including its role as a survival and differentiation factor for b cells. a polymorphism at -1082 position, within the il-10 gene promoter region, is known to have an influence on il-10 plasma levels. have shown that the binding capacity for dexamethasone can be upregulated by high il-10 production. tumor necrosis factor (tnf) is a cytokine with pleiotropic biological activities, including the induction of programmed cell death (apoptosis) and the regulation of immune cell proliferation and differentiation, and may influence the transcriptional activity induced by the glucocorticoid of the glucocorticoid receptor gene. although genetic polymorphisms in the tnf locus have been implicated in the severity of several b - cell lymphoproliferative diseases [12, 13 ], to date, only a few studies have found an association among the rare tnf aa of g308a polymorphism, the increased production of tnf protein, and the non - hodgkin 's lymphomas (nhl) susceptibility. currently, there are few studies related to the overall survival of patients with acute lymphoid leukemia and g1082a and g308a polymorphisms. in this study, the association of tnf (g308a) and il10 (g1082a) polymorphisms was analyzed in relation to the overall survival of brazilian children with all, observed for a long time according to the gbtli99 treatment protocol. the study group was composed of children with acute lymphoblastic leukemia, aged 0 18 years, who were being evaluated at the oncohematology pediatric center oswaldo cruz hospital (huoc), recife, brazil, since january 2004 to december 2011. we analyzed 105 patients for tnf (g1082a) and il10 (g308a) polymorphisms according to the overall survival, presenting clinical and laboratory diagnosis for acute lymphoblastic leukemia. the treatment was in accordance with the protocol of brazilian group for the treatment of lymphoblastic leukemia in childhood (gbtli99protocol of brazilian group for treatment of lymphoblastic leukemia in childhood). the primers used for genotyping were (forward) 5-agg caa tag gtt ttg agg gc-3 and (reverse) 5-tcc tcc ctg ctc cga ttc cg-3. the cycling included 1 cycle of 95c/6 min ; 40 cycles of 95c/60 s, 62.5c/90 s, and 72c/60 s ; 1 cycle of 72c/7 min. thirty microliters of pcr mixture comprised 3.0 l buffer (10x), 1.5 l mgcl2 (50 mm), 1 u taq polymerase (5 u), 0.6 l dntp (10 mm), and 0.6 l primer (10 pmol/l). the 308 g a base pair substitution creates a ncoi restriction site. the pcr product (107 bp) of c308 t was digested for 16 hours at 37c using ncoi and analyzed on agarose gel 4% with ethidium bromide (0.4 mg / ml) in electrophoresis. the digestion of pcr product with ncoi showed fragments of 107 bp for aa genotype and 87 bp and 23 bp for the gg genotype. the primers used for genotyping were allele a forward-5-cct atc cct act tcc cct-3 and allele g forward 5-cct atc cta ctt ccc cc-3 and reverse 5-agc aac act cct cgt cgc aac-3. the cycling was of 1 cycle of 95c/10 min ; 40 cycles of 95c/60 s, 59c/60 s, and 72c/60 s, 1 cycle of 72c/7 min. for each reaction, 10 l mixture comprised 2 l of each primer (10 pmol/l), 1x gotaq green master mix (2x)-promega (gotaq dna polymerase is supplied in 2x green gotaq reaction buffer (ph 8.5), 400 m datp, 400 m dgtp, 400 m dctp, 400 m dttp, and 3 mm mgcl2), and 1 l of dimethyl sulfoxide (dmso). the pcr products (139 bp) were analyzed on agarose gel 2% with ethidium bromide (0.4 mg / ml) in electrophoresis. survival rates were estimated using the kaplan - meier method, and survival curves were compared using the log - rank test. the overall survival analysis was performed using the patient 's follow - up data, according to the statistical models in conjunction with the kaplan - meier log rank (mantel cox) to assess the death risk in 10.5 years (126 months), and the survival time was calculated as the time from diagnosis to date of last followup for patients who were still alive. all results with p the ratio found in the genotypes for the g308a (tnf) polymorphism was 1(aa) : 5(ag) : 2.7(gg), and the genotype frequencies were not in hardy - weinberg equilibrium (p = 0.0351 ; a allele proportion = 0.41 and g allele proportion = 0.59). the ratio of the genotypes for g1082a (il10) polymorphism was 1(aa) : 1.9(ag) : 1.08(gg), and the genotypic frequencies were in hardy - weinberg equilibrium (p = 0.7725 ; a allele proportion = 0.49 and g allele proportion = 0.51) (table 1). the median follow - up duration in all patients was 37 months ; our attention was also calledin to the death / living relationship in tnf aa (0.71) and il10 aa (1.0) genotypes. a higher percentage of the il10aa genotype was found in patients with all, and they also showed a high ratio of death / live 1.0 (table 2). table 3 shows the survival rate, stratified at different time intervals (25, 50, 75, 100, and 126 months), when compared to allelic frequencies. the tnf gene showed a small difference between their rates, and the tnfa allele had a greater rate in the intervals analyzed. on the other hand, the il10 gene showed a greater range wider than the intervals between the rate of their alleles, and the il10a allele had a better rate survival in the intervals. after analyzing the follow - up results, we found that up to 75 months, the death estimate decreased, showing a higher percentage up to 25 months (18.18%) for il10a allele, while the il10 g allele had a better life expectancy in all ranges of months analyzed. regarding the tnf gene, the tnf a allele had the best life expectancy up to 75 months and tnfg allele demonstrated a higher death risk until 50 months (table 3). patients with il10aa genotype showed a worse survival compared with the others (p = 0.0089), indicating a survival rate of 44% up to 100 months, while the il10ag and il10gg genotypes had survival rate of 69% up to 126 months (figure 1). patients with tnfaa genotype showed a shorter median survival time (60 months) compared with the others genotypes (tnfag and tnfgg) (graph not shown). the patients who had il10aa + tnfa genotypes demonstrated a lower survival rate when compared with il10gg + tnfag genotypes (p = 0.0043). after the 50th month, the survival percentage for the patients with il10aa + tnfaa genotypes was 38%, while it was 75% for the il10gg + tnfag genotypes (figure 2). nowadays, fewer studies propose to study polymorphisms in tnf and il10 genes in relation to prednisone glucocorticoid in acute leukemia during childhood. this is regrettable once the prednisone is the main drug given during the induction phase in leukemia. this study was the second in challenging the -1082 (il10 gene) and -308 (tnf alpha gene) polymorphisms, together, in leukemia. the death cause in some patients was due to the patient 's reaction in the development of leukemia, acquiring infections due to individual conditions as well as the nutritional state before the treatment and also accentuated by the toxicity to methotrexate (mtx). regarding the g1082a (il10) polymorphism, edwards - smith. showed that patients homozygous for the il10 g allele showed high plasma levels of il10. this finding is also suggested in the study of lauten. that evaluated 135 patients, mostly adults, with all in accordance with protocols all - bfm 86 and bfm-90 in multicenter trials, according to their response to prednisone (based in schrappe. 2000) and with stratification into risk groups, which was made, predominantly, according to the leukaemic cell mass estimate (the so - called risk factor, the composite variable calculated from the initial blast count in the peripheral blood, and the sizes of liver and spleen below the costal margin) and the initial treatment response, event - free survival (efs), and relapse risk. in our study (based on gbtli99 protocol) there is no definition for response to prednisone, because there has been no study for this purpose. however, no study (based on gbtli99 protocol initial dose of prednisone 40 mg / m / day) established a background of prednisone response. (2002) found that patients showing poor response were stratified into the high - risk group and therefore underwent a more intensive treatment, suggesting that patients with il10gg may have a lower risk when there is a poor response to prednisone. in terms of overall survival, we found in this study that older patients (> 15 years) showed worse survival rates, although it has not been statistically significant and that the il10aa genotype had worse survival under protocol gbtli99. in this study, the tnfga genotype was present in a higher ratio among patients with the cd10 + (calla) marker (p = 0.0296). once the cd10 + marker is a variable of good prognosis and the tnf ga genotype presented best survival, we suggest that these patients with these markers (cd10 + and tnf ga) have a better performance in the treatment of all. the monitoring of survival, through the divisions of the months, showed that both alleles il10a and tnf g had the highest rate for survival during the period of 126 months, and that the il10a allele, up to 25 months of followup, showed the highest percentage of risk estimate (18.18%) in the occurrence of deaths. on the other hand, when the g1082a and g308a polymorphisms were correlated with respect to survival, the patients with both genotypes tnfga + il10gg showed high overall survival, as opposed to lauten., which found no statistical significance for this comparison. in other related studies [20, 21 ], we found no associations with the g308a (tnf) polymorphism, perhaps due to the tnf expression that can be modulated by several interleukins (not evaluated in this study). however, we suggest that the tnf a allele be involved in worse survival in all during childhood. we also suggest that patients presenting il10aa and tnfaa genotypes have high risk that could lead to poor survival. the results showed no association for tnf gene, but the tnfaa genotype indicated a high rate of death (0.71 ; table 1) and worse overall survival. however, until today, few studies have found an association between the rare tnfaa (-308) genotype involved in an increased production of tnf protein and the worse survival. bel hadj jrad. evaluated 194 patients with non - hodgkin 's lymphomas (nhl) and 160 controls, associating a risk increase in the development of nhl for the tnfaa genotype. the tnfaa genotype can be related to low survival of patients with all due to the adenine position (-308) at the tnf gene, and a correlation with a higher protein expression of tnf [22, 23 ] has been shown. an increased tnf level could impair the efficiency of the antitumor cellular immune response, and tnf can induce the apoptosis by natural killer cells. the knowledge of these polymorphisms in the development of leukemic diseases could optimize, in the future, the innovative therapies using mirs to silence genes according to the worst response to prednisone and enhance studies such as that of zhang. who analyzed the expression of different genes, using eight mirs for the stratification of pediatric patients with all in relation to relapse risk. the knowledge of the pathogenesis and survival monitoring of patients with all is still unclear. it is necessary to analyze other studies, using other chemotherapeutic protocols to approach this issue. | interleukin 10 (il10) is a pleiotropic cytokine that stimulates various hematopoietic cells. the tumor necrosis factor alpha (tnf) is a cytokine that may influence the transcriptional activity induced by glucocorticoids. this study examined the impact of tnf (g308a) and il10 (g1082a) polymorphisms at promoter regions in relation to the overall survival of 105 children (0 18 years) with acute lymphoblastic leukemia (all) for a period of 126 months, treated according to the protocol gbtli99. the g1082a and g308a polymorphisms were identified by allele - specific pcr and pcr - rflp, respectively. patients with il10aa genotype had a higher death ratio (44%, p = 0.0089). patients with both il10aa and tnfaa genotypes showed the worst survival when compared with the il10gg and tnfga genotypes (p = 0.0043). the results of this study revealed a lower survival among patients with il10aa genotype and the concomitant occurrence of il10aa and tnfaa genotypes. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.