id
stringlengths 36
36
| question
stringlengths 1
1.57k
| opa
stringlengths 1
287
| opb
stringlengths 1
287
| opc
stringlengths 1
286
| opd
stringlengths 1
301
| cop
class label 4
classes | choice_type
stringclasses 2
values | exp
stringlengths 1
22.5k
⌀ | subject_name
stringclasses 21
values | topic_name
stringlengths 3
135
⌀ |
|---|---|---|---|---|---|---|---|---|---|---|
6c57b9e6-fe91-4a19-b860-81f5c1245855 | A child scratches his hand with a pen. A red wheel appears which persists for 30 minutes. What would be the diagnosis? | Contact urticaria | Dermographism | Pressure urticaria | Atopy | 1b
| single | Ans. b. DermographismWhite dermographism is seen in atopic dermatitisDermographism is seen in urticaria | Skin | Neutrophilic Dermatoses |
ce8f1794-cae9-42af-9b48-4722ff6d5224 | Ideal contraceptive for a couple who are living separately in two cities and meets only occasionally:- | Barrier methods | OCPs | IUCD | Inj. DMPA | 0a
| multi | Ideal contraceptive for a couple who are living separately in two cities and meets only occasionally is Condom as long term contraception is not desirable. - Also OCPs and IUCD are required for long term contraception and both of them have few side effects too; so they are not desirable in this case. - Inj. DMPA is an injectable hormonal formulation which given contraception for 3 months which is not desirable here. | Social & Preventive Medicine | Other FP Methods and New Initiatives in Family Planning |
1ea5b286-7075-45e7-93dd-3ab910e4ddfb | Which of the following is malignant intraocular tumor of children: September 2010 | Retinoblastoma | Rhabdomyosarcoma | Melanoma | Chloroma | 0a
| single | Ans. A: Retinoblastoma The most common primary malignant intraocular tumor in children is retinoblastoma. Neuroblastoma is the most common cause of orbital metastases in children. Rhabdomyosarcoma is the most common orbital tumour of children. | Ophthalmology | null |
0f16441f-8220-4923-891c-3c4a2dcd931f | The concept of One Stage Full Mouth Disinfection has been put forth to prevent | Adhesion of microorganisms | Proliferation of microorganisms | Translocation of microorganisms | Bacterial invasion | 2c
| single | null | Surgery | null |
f75a1ece-b11f-4c2e-965e-12d7ac0fd080 | For extraction of mandibular molar, anesthesia is given to act on: | Inferior alveolar nerve | Buccal nerve | Lingual nerve | Masseteric nerve | 0a
| single | null | Surgery | null |
354668a5-888a-4588-bbf6-5990525272f3 | After tonsillectomy, secondary haemorrhage occurs | Within 24 hours | After 2 weeks | 5-10 post operative days | After a month | 2c
| single | After tonsillectomy primary haemorrhage occurs during surgery reactionary bleeding with in 24 hrs, secondary haemorrhage between 5-10 days Secondary haemorrhage is the result of sepsis and premature separation of the membrane Simple measures like removal of clots, application of adrenaline or hydrogen peroxide usually suffice. For profuse bleeding, electrocoagulation is done Re: Textbook of Ear, Nose and Throat, Dhingra, 6th Edition; Pg no: 430 | ENT | Diagnostic and operative ENT |
addea36e-b848-486b-815a-3e9db4fa86f0 | Treatment for scabies is | Erythromycin | Benzene hexachloride | Piperazine | Thiabendazole | 1b
| single | (B) Benzene hexachloride | Pharmacology | Miscellaneous (Pharmacology) |
943a9981-0c91-49ed-9780-4f93656aac2a | All the following manifestations suggest the development of lymphoma is sjogren syndrome except: | High C4 Complement Levels | Leucopenia | Purpura | Cryoglobulinemia | 0a
| multi | Low C4 Complement levels suggest the development of lymphoma. | Medicine | null |
a157f6a4-4f0b-4c11-82a9-effbebbba58d | 1729. A 28 yr old female presented with malaise and generalised weakness since 6 month. Her appetite Is reduced and she has giddiness and palpitations on and off. There was no organomegaly. Laboratory Study showed normochromic to hypochromic anaemia and MCV-80. What Is the diagnosis | Thalassemia minor | Iron deficiency anaemia | Chronic malaria | Folate deficiency | 1b
| single | <p> Iron deficiency anemia is much more common in women between the age of 20 & 45 yrs than in men.The onset of this anemia is generally slow .The usual symptoms are weakness ,fatigue ,palpitations ,dyspnoea on exeion & pallor of skin, sclera & mucous membrane.</p><p>Also MCV will be less than 80fl in iron deficiency anemia .</p><p>Reference :Harsh mohan textbook of pathology sixth edition pg no 298.</p> | Medicine | Haematology |
32248a3f-e067-48bd-a71f-ccbb1ef6a890 | According to WHO, exclusive breast milk is given upto – | 6 months | 4 months | 8 months | 10 months | 0a
| single | Exclusive breast feeding : The baby should be given only breast milk and nothing else (not even water) for first 6 months of life. Weaning should be started by 6 months of age with semisolid food, in addition to continuing breast feeding.
The WHO recommends exclusive breast feeding for the first six months of life and then breast feeding up to two years or more.___ Internet
Complementary feeding means giving the child other nutritious foods in addition to breast milk. Breast feeding is sufficient food for first 6 months. Thereafter, concentrated energy dense complementary foods are essential in order to maintain an adequate velocity of growth for the infant. | Social & Preventive Medicine | null |
d8e64eb0-7eec-4212-8048-8ee3e864ab29 | The skin overlying the region where a venous "cut-down" is made to access the Great saphenous vein is supplied by - | Femoral nerve | Sural nerve | Tibial nerve | Superficial peroneal nerve | 0a
| single | Great saphenous vein on its course is accompanied by saphenous nerve which is a branch of femoral nerve. | Anatomy | null |
af09b69f-0025-4997-92b1-7c1b69d04c2b | Ketocanozole is useful in all except - | T. cruris | T.versicolor | T.capitis | T.corpoiris | 2c
| multi | null | Medicine | null |
d6c2d6dc-a9d8-4ded-8de8-e053bba982de | 'Second gas effect' is exerted by which of the following gas when co-administered with halothane: | Nitrous oxide | Cyclopropane | Nitrogen | Helium | 0a
| single | Concentration-effect, second gas effect and diffusion hypoxia are seen with inhalational agents used in high concentrations (like N2O). | Pharmacology | null |
a4e1f85e-3fe5-46b1-b86b-ea9a9c976f87 | Mount Fuji sign is a feature of | Fahr's disease | Acute bleed | Chronic bleed | Tension pneumocephalous | 3d
| single | Mount Fuji sign refers to the presence of gas (pneumocephalus) between the tips of the frontal lobes with a heaped-up appearance giving the appearance of Mount Fuji or M like appearance. | Radiology | Neuroradiology |
55d252ed-aaa4-48ee-9d06-4b8485d3e3ae | After falling on the pavement, a 72-year-old woman is found to have a fracture of the radius and ulna (Colles' fracture). What is true of this fracture? | The fall occurs on the dorsum of the wrist. | Open reduction is most commonly indicated. | Younger men are generally affected. | The distal radial metaphysis is displaced dorsally. | 3d
| multi | The distal radial metaphysis is displaced dorsally. This fracture was described by Colles over 150 years ago. The impact is caused by a fall on the flexor surface of the wrist. The distal segment is displaced dorsally. The reverse injury, involving a fall on the extensor surface of the wrist and flexor deformity, is a Smith fracture. Colles fracture occurs more commonly in older women. The styloid of the ulna not the shaft of this bone is fractured. | Surgery | Orthopedics |
405d76e9-90bc-4038-a4d9-22b39ef0df60 | Identical twins may not have : | Same DNA finger | Same finger print pattern | Same blood group | Same HLA system | 1b
| single | B i.e. Same finger print | Forensic Medicine | null |
36eb915f-9a71-4e21-87c1-328789916537 | Denominator of infant mortality rate is? | Per live birth | per 100 live births | Per 1000 live births | Per lakh live births | 2c
| single | Ans. (c) Per 1000 live birthsRef: Park 20thed./488 | Social & Preventive Medicine | Pediatrics |
b5b78802-2abf-41ef-91d6-36d4445e3884 | Increased ventilation at sta of exercise is due to? | Stretch receptors | Proprioceptors | Pain receptors | T PCO | 1b
| single | Ans. is 'b' i.e., Proprioceptors[Ref Ganong 23'd/e p. 636)In moderate exercise the abrupt increase in ventilation at the sta of exercise is due to psychic stimuli and afferent impulsE from proprioceptors in muscles, tendons and joints.Aerial pH, PCO2, and PO2, remain constant during moderate exercise because increase in ventilation is propoionate to increase in O, consumption. | Physiology | null |
40d1088f-1ade-49d8-a3c9-c256045c7a8f | A 19-year-old woman presents to the clinic for evaluation of primary amenorrhea. Her physical examination is normal, and she has female sex characteristics and breast development. The only abnormality is the absence of body hair. Among other investigations she also has genetic testing that reveals an XY chromosome pattern. Which of the following mechanisms is most likely to explain her phenotypic pattern and amenorrhea? | estrogen receptor defect | excess hormone production | androgen receptor defect | decreased hormone production | 2c
| single | Androgen receptor defect such as androgen insensitivity will result in the phenotypic characteristics seen in this patient. Other disease states due to abnormal intracellular receptors include cortisol resistance; vitamin D-dependent rickets, type II; thyroid hormone resistance; and pseudo-hypoaldosteronism. Androgen insensitivity syndrome is caused by a mutation in the androgen receptor, and it affects 1 in 100,000 chromosomal males. Because the androgen receptor is X-linked, it only affects males. The phenotypic presentation can vary from complete androgen insensitivity (female external features) to partial insensitivity causing ambiguous or normal male features and infertility. There are several different types of cell membrane receptors. | Medicine | Endocrinology |
e87a47e0-1e55-4fd4-aade-4220e23e1999 | Epitheliod granulomatous lesions are found in all of the following disease except | TB | Sarcoidosis | Berylliosis | Pneumocystis carinii | 3d
| multi | ref Robbins 9/e p98 Pneumocystis carinii causes bilateral diffuse pneumonitis in immunocompromised patients and no discernible disease in otherwise healthy individuals. Clinical features are to some extent age-dependent. In premature and debilitated infants, onset is subtle, staing with mild tachypnea. Within a week or so, respiratory distress is apparent, with marked tachypnea, flaring of the nasal alae, retractions, and cyanosis. The illness may last 4 to 6 weeks and has a moality rate of 25 to 50 percent. In the immunodeficient child or adult onset is abrupt, with fever, tachypnea, and respiratory distress. Deterioration progresses to death in almost all cases if no treatment is given. In both types of patient, aerial oxygen tension is low, aerial pH usually increased, and carbon dioxide retention usually does not occur | Anatomy | General anatomy |
aafc3b46-4f8e-4ccf-a5fc-2fead688513e | Which of the following is not an extra aicular feature of Rheumatoid ahritis? | Weight loss | Pleural effusion | Conjunctivitis | Proteinuria | 3d
| single | Answer- D. ProteinuriaExtra-aicular manifestations in RASystemic manifestations: Fever, weight loss, fatigue.Dermatological: Subcutaneous nodule.Cardio-pulmonary: Pericardial & pleural effusion, constrictive pericariditis, pulmonary fibrosis, lung nodules.Eye : Sjogren syndrome (Keratoconjunctivitis sicca), scleritis.Nervous : Carpal tunnel syndrome, tarsal tunnel syndrome, mononeuritis multiplex | Pathology | null |
3bb4ed1f-566a-4f47-a10b-caa19ceabf8a | Vitamin required for hydroxyproline to proline conversion: | Vitamin C | Vitamin E | Pvrodoxal PO4 | Biotin | 0a
| single | A i.e. Vitamin C | Biochemistry | null |
c21c4f58-73f1-4a58-992b-96f596b8c8f7 | Bone with a bone appearance is seen in | Osteogenesis imperfecta | Osteopetrosis | Scurvy | Rickets | 1b
| single | Bone within bone appearance is seen in : Osteopetrosis Acromegaly Bisphophonate therapy sickle cell anemia Healed phase of rickets and scurvy. Normal neonate. | Radiology | Skeletal system |
604d8e6a-f009-49c7-af72-ce0030b0521a | In pancreatic scanning radio-isotope used is | Se75 | Cr51 | I131 | Tc99 | 0a
| single | se75 is used for pancreatic scanning Cr51 is used to label red blood cells for measurement of mass or volume I131 is used for treating hypehyroidism and thyroid cancer I123 and Tc99 are used for thyroid scanning | Radiology | GIT and hepatobiliary system |
7668af9d-314b-4a71-badc-a73fcf5f2b1c | UV radiation - | Prevents formation of Pyrirnidine dimmers | Stimulates formation of Pyrimi dine dimmers | Purine dimmers | None | 1b
| multi | The oncogenic effect of UV rays merits special mention because it highlights the impoance of DNA repair in car cinogenesis. Natural UV radiation derived from the sun can cause skin cancers (melanomas, squamous cell carcino mas, and basal cell carcinomas). At greatest risk are fair skinned people who live in locales such as Australia and New Zealand that receive a great deal of sunlight. Non melanoma skin cancers are associated with total cumula tive exposure to UV radiation, whereas melanomas are associated with intense intermittent exposure--as occurs with sunbathing. UV light has several biologic effects on cells. Of paicular relevance to carcinogenesis is the ability to damage DNA by forming pyrimidine dimersThis type of DNA damage is repaired by the nucleotide excision repair pathway. Reference: Robbins Basic Pathology. Pg no:200,201 | Pathology | Pediatrics, environment and nutrition |
871cb3e5-81d7-4958-a4ab-3a5fed08aee8 | A 41/2- year-old girl always had to wear warm socks even is summer season. On physical examination, it was noticed that she had high blood pressure and her femoral pulse was weak as compared to radial and carotid pulse. a chest radiograph showed remarkable notching of ribs along with their lower borders. This was due to - | Femoral artery thrombosis | Coarctation of aorta | Raynaud's disease | Takayasu's arteritis | 1b
| single | null | Medicine | null |
5b8234f2-910e-44d3-9d2a-845e185b6f68 | Which wall of hea is enlarged first in a patient with mitral stenosis ? | Left atrium | Right atrium | Left ventricle | Right ventricle | 0a
| multi | Wall of hea enlarged in mitral stenosis - left atria | Medicine | NEET 2019 |
004bd9c9-e461-4aa7-8333-a50d7466a36c | This x-ray is suggestive of | Tetralogy of fallot | TAPVC | Tricuspid atresia | Ebstein's anomaly | 0a
| multi | Boot shaped heart - Tetralogy of fallot. | Radiology | null |
92b988d8-0f38-4df8-ac58-1f44f8386461 | 40-year-old male presents with fever and abdominal pain and diagnosed with HIV and TB. How will you give treatment? | ATT and AIDS treatment simultaneously | First ATT and then A | ATT only | First A and then ATT | 1b
| single | If a patient is diagnosed with HIV & TB, treatment for TB should be given first, to decrease bacterial load in the body & decrease chances of immune reconstitution inflammatory syndrome. Then, treatment of HIV should be given. | Medicine | FMGE 2019 |
780f0474-8324-4f4d-9501-8cc659c1af3a | A 40 year old male brought to the emergency room with a stab injury to the chest.On examination pt is found to be hemodynamically stable. The neck veins are engorged and the hea sounds are muffled .The following statements are true for this pt except ? | Cardiac tamponade is likely to be present | a) Immediate emergency room thoracotomy should be done. | Echocardiogram should be done to confirm pericardial blood | The entry wound should be sealed with an occlusive dressing | 1b
| multi | Ans is 'b' Immediate emergency room thoracotomy should be done There is no need for emergency thoracotomy in a hemodynamically stable pt. Cardiac tamponade is quite common in stab injuries to the chest. The classical signs of tamponade are:? (a) Muffled hea sounds (b) Distended neck veins k/a Beck's Triad (c) Hypotension The tamponade can be easily diagnosed by echocardiography (identifying abnormal amount of pericardial fluid) and is managed by pericardiocentesis or surgical pericardiotomy | Surgery | null |
4ffd76f9-025e-45a1-bca0-df8a443ec639 | A one month old infant with a congenital cardiac lesion shows increased sweating during feeding. Which of the following is the sure sign of congestive cardiac failure in this infant? | Basal crepitations | JVP | Pedal oedema | Liver enlargement | 3d
| single | Congestive hea failure (CHF) is unusual in childhood. When it does present, it is usually as a manifestation of congenital hea disease and is seen in the first year of life. The classic triad of symptoms for pediatric CHF is tachypnea, tachycardia, and hepatomegaly. There may also be a history of poor feeding, sweating or color change with feeding, and poor weight gain. Lower extremity edema and jugular venous distention are less likely in the pediatric population. Ref: Stephan M., Caer C., Ashfaq S. (2011). Chapter 50. Pediatric Emergencies. In R.L. Humphries, C. Stone (Eds), CURRENT Diagnosis & Treatment Emergency Medicine, 7e. | Pediatrics | null |
e3c170ae-806b-4867-b00f-5fbe27bffe9e | In which of the following conditions postmortem caloricity may be seen in death due to - | Massive haemorrhage | Cyanide poisoning | Corrosive poisoning | Septicemia | 3d
| single | null | Forensic Medicine | null |
201b87fa-2501-4700-94a0-48420aff2f1f | All of the following are true about Ondansetron except? | Drug of choice for chemotherapy induced vomiting | Dopamine antagonist | 5HT3 antagonist | Acts on CTZ | 1b
| multi | Ans. is 'b' i.e., Dopamine antagonist Ondansetron is 5-HT3 receptor antagonist at CTZ and NTS, as well as in GIT. | Pharmacology | null |
76a1b8c5-1f81-43c5-a840-06e6bff7f85d | Tyrosine kinase inhibitors are first line treatment in: | Gastrointestinal stromal tumors | Receptor mediated neuroendocrine tumors | Breast cancer | Renal cell carcinoma | 0a
| single | lmatinib This novel antineoplastic drug inhibits the tyrosine protein kinases in chronic myeloid leukaemia (CML) cells and the ones that are activated by platelet derived growth factor (PDGF) receptor, stem cell receptor and c-kit receptor found in gastrointestinal stromal tumour (GIST), a rare tumour. Stricking success has been obtained in chronic phase of CML as well as in accelerated phase, and in metastatic kit-positive GIST. Adverse effects are fluid retention, edema, vomiting, abdominal pain, myalgia and liver damage. ESSENTIALS OF MEDICAL PHARMACOLOGY K.D.TRIPATHI SIXTH EDITION PAGE NO:828 | Pharmacology | Chemotherapy |
3f94e7fe-6cca-4aa4-8d6b-2ea71ab507d3 | The expression of the following oncogene is associated with a high incidence of medullary carcinoma of thyroid: | p 53 | Her 2 neu | RET proto oncogene | Rb gene | 2c
| single | - RET proto-oncogene is mutation is associated with medullary carcinoma of thyroid - RET proto-oncogene is mutated in MEN-2A & 2B syndromes, hence these are also associated with medullary carcinoma of thyroid. - Prophylactic thyroidectomy is indicated in pt with family history of RET mutation | Pathology | Thyroid Tumor |
615207fe-a4d1-450a-ad96-f278f819dd42 | For polymerase chain reaction which of the following is not required | TAQ polymerase | d-NTP | Dideoxynucleotides | Magnesium | 2c
| single | null | Biochemistry | null |
48bb5a6d-f544-4514-a663-c320909e9d1b | Which of the following is a part of secondary granules in neutrophils? | Cathepsin G | Lactoferrin | Defensin | Myeloperoxidase | 1b
| single | Ans. is 'b' i.e., LactoferrinLvsosomal enzymes:o These are present in the lysosomes of neutrophils and monocytes. Lysosomes contain two types of granules; Primary (azurophilic) and Secondary (specific) granules.Lvsosomal granulesPrimary (azurophilic) granulesSecondary (specific) granuleso Require high level of agonist to be released extracellularlyo Potentially more destructiveo Secrete:y Myeloperoxidase (MPO)y Acid hydrolasey Elastasey Defensiny Phospholipase A2y Non-specific collagenaseo Secreted at lower concentration of agonistso Secreted extracellularly more readilyo Secrete:y Lysozymey Lactoferriny Alkaline phosphatasey Type IV collagenasey Phospholipase A2 | Pathology | Cellular Pathology |
5ee3fac5-ccae-4d06-bd5a-a1008e1d81d4 | All of the following are features of Mobiz type I block except - | Constant PR interval | Normal QRS morphology | Regular atrial rhythm | Atrial rate - ventricular rate | 0a
| multi | null | Medicine | null |
c8a4fd1d-eca6-4774-8f53-c706b6c9326c | The best indicator for a potential explosiveness of plague outbreak is- | Total flea index | Cheopis index | Specific percentage of fleas | Burrow index | 1b
| single | Question repeated | Social & Preventive Medicine | Communicable diseases |
91d5cae7-c4a1-4d69-b76a-5fd898c29f51 | A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels. Skin biopsy specimen was taken. | Clotting disorder | Septic emboli | HSP | Uicarial vasculitis | 2c
| single | Perivascular neutrophils, leukocytoclasis and fibrinoid degeneration involving the small dermal blood vessels with subsequent hemorrhage in a skin biopsy of a patient with HSP. Skin biopsy showing positive immunofluorescence of the small blood vessels for IgA. Henoch-Schonlein purpura (HSP) Acute immunoglobulin A (IgA)-mediated Generalized vasculitis involving the small vessels of the skin, the gastrointestinal (GI) tract, the kidneys, the joints, and, rarely, the lungs and the central nervous system (CNS). It is the most frequent vasculitis in childhood, the incidence decreasing with age. Subsequently, symptoms develop, of which the following are the most common: Rash, especially involving the legs; this is the hallmark of the disease Abdominal pain and vomiting Joint pain especially involving the knees and ankles Subcutaneous edema Scrotal edema Bloody stools | Anatomy | Integrated QBank |
e1f24058-6533-4e95-9fc6-bb28fcafe2cd | All of the following structures are at risk of damage in anterior cranial fossa fracture, EXCEPT? | Ethmoid sinus | Facial nerve | Olfactory bulb | Roof of nose | 1b
| multi | Fracture of the anterior cranial fossa can damage the roof of the orbit, roof of the nose, frontal, sphenoid and ethmoid sinus. It can result in anosmia, black eye, subconjunctival hemorrhage, bleeding into nose and mouth and CSF leak if meninges is involved. Fracture of the middle cranial fossa is accompanied by leakage of CSF into the mouth or into the middle ear and external acoustic meatus, facial paralysis and deafness due to involvement of VIIth and VIIIth cranial nerves.Fracture of the posterior cranial fossa may damage glossopharyngeal, vagus, accessory or hypoglossal nerves. | Anatomy | null |
74f2fbeb-0abf-4bd8-a2d6-af84022eccd5 | Functions of basal ganglia include | Gross motor | Skilled movements | Emotions | Maintenance of equilibrium | 1b
| single | The clear and best known function of basal ganglia is planning and programming of motor functions. Mainly- Complex actions such as writing alphabets and skilled movements such as using scissors to cut. | Physiology | null |
ad3a4e92-2202-46a8-b660-f6c6fe77b79a | Who described that P. intermedia is responsible for pregnancy gingivitis? | Loesche | Kornman | Both | None | 2c
| multi | Kornman and Loesche reported that the subgingival flora changes to a more anaerobic flora as pregnancy progresses; the only microorganism that increases significantly during pregnancy is P. intermedia. | Dental | null |
a7f8c420-5b63-49e1-ac11-b9aa3088c0af | Which of the following is true about the main respiratory control neurons? | image_question | image_question | image_question | image_question | 3d
| multi | The main respiratory control neurons called the Pre-Botzinger complex (pre-BOTC), are located in the medulla. Pre-Botzinger complex (pre-BOTC) is located on the either side of the medulla, between the nucleus ambiguus and the lateral reticular nucleus. They send out regular bursts of impulses to inspiratory muscles phrenic nerve during quiet respiration. Option A: Expiration is passive during quiet breathing. There is no discharge of any neurons. Option B: Pain stimulates respiration. There are NK1 receptors and m-opiod receptors in Pre-Botzinger complex, and, in vivo, substance P stimulates and opioids inhibit respiration. Option C: Impulses from cerebral coex also influence the Pre-Botzinger complex. Ref: Ganong&;s Review of Medical Physiology 26th edition Pgno: 645-657 | Physiology | Respiratory system |
07845c9f-ec89-4607-a5c5-25d5ebed7f60 | Swelling of deep lobe of parotid gland presents as swelling in:- | Parapharyngeal space | Cheek | Temporal region | Below the ear | 0a
| single | Swelling of deep lobe of parotid gland presents as swelling in parapharyngeal space. The parotid gland is the most common site for salivary tumours. Most tumours arise in the superficial lobe and present as slow-growing, painless swellings below the ear, in front of the ear or in the upper aspect of the neck. Less commonly, tumours may arise from the accessory lobe and present as persistent swellings within the cheek. Rarely, tumours may arise from the deep lobe of the gland and present as a parapharyngeal mass. Symptoms include difficulty in swallowing and snoring. Clinical examination reveals a diffuse firm swelling in the soft palate and tonsil. | Surgery | Salivary Glands |
ee65012f-5cb9-4b3d-b3e2-743cc1448675 | Which of the following is not a parameter in Bishop's score: March 2009 | Cervical consistency | Station of head | Position of head | Cervical length | 2c
| single | Ans. C: Position of Head | Gynaecology & Obstetrics | null |
649a17f1-2762-40d1-b89c-65601778feea | Which of the following is primary prevention - | Screening test | Early diagnosis | Use of mosquito net | Restoration of lost function | 2c
| single | Ans. is 'c' i.e., Use of mosquito net Level of preventionExampleso Primordial preventiono Discouragement from adapting a harmful lifestyle, e.g. smokingo Primary preventiono Immunization (vaccination)o Chemoprophylaxiso Nutritional supplementation programmeso Chlorination of watero Using a mosquito neto Health educationo Secondary preventiono Screening testo Case finding programmeso Early diagnosis & treatmento Tertian,' preventiono Disability limitationy Resting the affected limb in neutral position in PRPP to prevent deformityo Rehabilitationy Establishing schools for blindy Provision of aids for crippledy Reconstructive surgery in leprosyy Muscle re-education and graded exercise in neurological disorder like polioy Changing profession for a more suitable one | Social & Preventive Medicine | Concept of Health and Disease |
720443b9-9c09-450e-b20b-ceb1e5c4d169 | The closest speaking space was suggested by: | Pound | McGrane | Neswonger | Silverman | 3d
| single | The space between the teeth during casual repetition of the sound “s”. It is considered the closest relationship of the occlusal surfaces and incisal edges of the mandibular teeth to the maxillary teeth during function and rapid speech.
This phonetic method is one of the several techniques to determine vertical dimension of occlusion in dentate and edentate patients. This method was proposed by Silverman. | Dental | null |
cf29cfa5-ab5d-447d-b56c-5324c2831553 | The safest initial approach to open airway of patient with maxillofacial trauma is: | Head tilt-chin tilt | Jaw thrust technique | Head lift-neck lift | Heimlich procedure | 0a
| single | null | Surgery | null |
d5bc3c91-7bb5-4380-a842-962b905285ff | Absolute contraindication for IUCD is/ are | Puerperal sepsis | Current STD | Uterine anamoly | All the above | 3d
| multi | Who category 4: absolute contraindications for use of IUP:
Immediate post spec abortion
Uterine anomaly
Pregnancy
Pelvic tuberculosis
Vaginal bleeding supicious/unexplaned
Current pelvic inflammatory disease (PID)/ Current STDs
Puerperal sepsis
Malignant trophoblast disease
Cervical cancer
Current STSs
Endometrial cancer
Uterine fibrosis with distortion of the uterine cavity | Gynaecology & Obstetrics | null |
10bf34e4-d615-42ff-88f0-2e460e210d9e | Which of the following complications is currently the major limitation to the long-term success of cardiac transplantation? | Allograft rejection | Graft aeriosclerosis | Graft atherosclerosis | Oppounistic infections | 1b
| multi | Currently, graft aeriosclerosis (AKA graft vascular disease) is the most impoant limit to the long-term success of hea transplantation. For unknown reasons, the coronary aeries of transplanted heas undergo intimal thickening associated with hyperplasia of myocytes and fibroblasts and deposition of matrix. This results in luminal stenosis and myocardial ischemia. Patients may develop myocardial infarction, which is clinically silent because the hea is denervated. The overall survival after hea transplantation is 80% at 1 year and 60% at 5 years. Do not confuse graft aeriosclerosis with graft atherosclerosis. Atherosclerosis is caused by accumulation of cholesterol esters and development of atheromas. Atherosclerosis may recur in the coronary aeries of transplanted heas, but is not a limiting factor in long-term success of hea transplantation. Allograft rejection is ceainly a major postoperative problem. However, thanks to early diagnosis based on periodic endomyocardial biopsy and the availability of immunosuppressant therapy, this complication can be prevented or successfully treated. Although oppounistic infections and development of Epstein-Barr related lymphomas are undesired effects of profound immunosuppression, these complications do not constitute a significant limitation to the overall outcome of cardiac transplantation. Ref: Lin P.H., Kougias P., Bechara C., Cagiannos C., Huynh T.T., Chen C.J. (2010). Chapter 23. Aerial Disease. In F.C. Brunicardi, D.K. Andersen, T.R. Billiar, D.L. Dunn, J.G. Hunter, J.B. Matthews, R.E. Pollock (Eds), Schwaz's Principles of Surgery, 9e. | Microbiology | null |
dbd928b2-c4b0-4d6a-9c23-c71488dd29bf | Infliximab - | CD 20 antagonist | 1L6 antagonist | Chimeric antibody against TNF alpha | Chimeric antibody against Her2-neu | 2c
| single | Ans. is 'c' i.e., Chimeric antibody against TNF alphaMonoclonal AntibodyTargetIndicationTrastuzumabTositumomabRituximabIbritumomabDaclizumabBasiliximabAbciximabPalivizumabInfliximabEtanerceptOfatumumabBelimumabEpratuzumabOcrelizumabAdalimumabAlefaceptAlemtuzumabBevacizumabCetuximabGemtuzumabEfalizumabOmalizumabNatalizumabDonesumabTocilizumabPanitumumabRanibizomabNimotuzumabEculizumabher-2/neuCD 20CD 20CD 20II-2R (CD-25)II-2R (CD-25)GpII/IIIaFusion proteinTNF aTNF aCD 20BLySCD 22CD 20TNF aLFA-3CD 52VEGFEGFRCD 33CD 11a chain of LFAIgEIntegrin-a4RANK ligandIL-6REGFRVEGFEGFRC5 complement componentBreast cancerB-cell NHLB-cell NHLB-eell NHLImmunosuppressantImmunosuppressantAntiplateletRSVRA .Crohn's diseaseRA (rheumatoid arthritis)SLESLESLESLERAPlaque psoriasisB cell CLLColorectal carcinomaColorectal carcinomaAMLPsoriasisBronchial asthmaMultiple sclerosisOsteoporosisSLEColorectal carcinomaNeovascular macular degenerationSquamous cell carcinoma, gliomaParoxysomal nocturnal hemoglobinuria | Pharmacology | Immunomodulator |
e445c6ae-6c74-429b-be90-1c2d877c048c | Which of the following ovarian tumors is most radiosensitive - | Carcinoid | Dysgerminoma | Serous Cystadenocarcinoma | Brenner tumor | 1b
| single | Ans. is 'b' i.e., Dysgerminoma o Dysgerminoma is the most radiosensitive among the ovarian tumors, but radiotherapy is not the treatment of choice as dysgerminoma occurs in pre - reproductive or reproductive age group and fertility is impaired with radiotherapy. | Gynaecology & Obstetrics | Ovary |
8952960c-1576-4fa0-89f0-7ade7c8287af | Preserved in manchester operation: September 2009 | Full length of cervix | Competency of os | Feility | Menstruation | 3d
| single | Ans. D: Menstruation Surgeon combines an anterior colporrhaphy with the amputation of the cervix, sutures the cut ends of the Mackenrodt's ligament in front of the cervix, covers the raw area on the amputated cervix with vaginal mucosa and follows it up with a colpoperineorrhaphy. It preserves menstrual and childbearing functions. However feility is reduced. Cervical amputation leads to incompetent cervical os and habitual aboions/ preterm deliveries. | Gynaecology & Obstetrics | null |
fd3a0e0e-3776-42c4-8af0-67046798a09b | Red Color on color doppler suggests? | Aerial Blood | Venous Blood | Flow towards the transducer | Flow Away from the transducer | 2c
| single | Color Doppler Imaging: Doppler imaging illustrates only the direction of flow, color coded mean velocities and the range of the mean velocities. Blood flowing towards the ultrasound transducer is conventionally depicted in a band of colors ranging from deep red (low velocity) to bright yellow (high velocity). Flow in direction away from the transducer is indicated by band of colors ranging progressively from deep blue (low velocity) to cyan (high velocity). | Radiology | Cardiovascular Radiology |
e6c35c58-5912-48b8-b844-816f774f172b | Causes of death in drowning are all except : March 2009 | Vagal hyperactivity | Asphyxia | Ventricular fibrillation | Laryngospasm | 0a
| multi | Ans. A: Vagal hyperactivity Causes of death in drowning: Asphyxia Ventricular fibrillation/ if an examination of the larynx reveals that a spasm occurred, the victim may have died from sudden exposure to the cold, which caused an immediate hea attack. Laryngeal spasm Vagal inhibition Exhaustion Injuries In some cases, hypothermia may have been the cause of death rather than drowning. Bodies discovered in the water are examined to see whether water is actually present in the airway and stomach of the victim and if the lungs have swollen up. If such signs are apparent, then the victim did actually die due to drowning. Fuher examination of the corpse will reveal if bleeding occurred in the lungs, suggesting that there was a struggle for breath during the drowning. | Forensic Medicine | null |
daf19353-37a6-4b8e-b8bc-3327c99869a2 | Chloroquine is useful in | Discoid lupus erythematous | Rheumatoid ahritis | Infectious mononucleosis | All of the above | 3d
| multi | All of the above arr correct Refer KDT 6/e p 786 Discoid lupus erythematous Rheumatoid ahritis Infectious mononucleosis. Are Crct | Pharmacology | Chemotherapy |
e2445916-1b39-434f-936d-77d536d6aadb | Pulp chambers and root canals in deciduous teeth: | Wide and deep | Shallow and narrow | Wide and narrow | Shallow and wide | 3d
| multi | null | Dental | null |
acc9da32-4937-4997-ac35-8cbfee8f3be3 | Length of lower esophageal sphincter - | 1-2 cm | 3-4cm | 1-2 mm | 3-4 mm | 1b
| single | Ans. is 'b' i.e., 3-4 cm "The cricopharyngeal sphincter is 2-3 cm, and the lower esophageal sphincter (LES) is 3-4 cm long". - Textbook of GI Surgeryo Approximately 2 cm of the esophagus lie below the diaphragm in the abdomen (abdominal part of esophagus)o Within this portion of esophagus the abdominal part of LES is locatedo Another 1-2 cm of LES lie above the diaphragm in mediastinum, i.e. thoracic part of LES.o Thus total length of LES is 3-4 cm. | Anatomy | Peritoneum & GI Tract |
0df537bb-a632-489f-ad81-622b19a6b4c1 | A 52-year-old man presents to the eye clinic with painless vision loss of his right eye. He describes the visual loss as a gradual progression from blurry to total blackout over the past two hours. He has no history of prior visual problems. Past medical history is significant for a myocardial infarction three years ago. The patient takes 70mg of aspirin daily. Vital signs are normal. Physical examination reveals 20/20 vision of the left eye but no vision in the right eye. Extraocular muscles are intact. The neurologic examination is normal. The cardiac examination reveals an S4 hea sound. At the molecular level, which of the following components is essential for the first step of the visual cascade? | 11-cis-retinal | All-cis-retinal | All-trans-retinal | Meta-rhodopsin ll | 0a
| multi | The visual cascade: 11-cis-retinal + opsin -> rhodopsin + light -> meta-rhodopsin II. Meta-rhodopsin II dissociates after light exposure to form all-trans-retinal. 11-cis retinal and opsin are essential first steps in generating the photochemical visual cascade. All-cis-retinal is not a pa of the visual cascade. All-trans-retinal, meta-rhodopsin II, rhodopsin is a later pa of the visual cascade: 11-cis-retinal + opsin -> rhodopsin + light -> meta-rhodopsin II. Meta-rhodopsin II dissociates after light exposure to form all-trans-retinal. 11-cis retinal and opsin are essential first steps in generating the photochemical visual cascade. | Ophthalmology | null |
c83db2cc-da3a-4018-a9f6-fe04c82786e4 | In ESI programme central, state, Govt. Employee contribute to the fund. Employer's contribution is - | 5.75% | 4.75% | 3.75% | 2.75% | 1b
| single | - ESI scheme is run by contributions by employees and employers and grants from central and state governments. - the employer contributes 4.75 percent of total wage bill. Reference: Park's textbook of preventive and social medicine, 23rd edition, pg no:816 <\p> | Social & Preventive Medicine | Hospital waste and disaster management, Occupational health |
4efa38e8-5080-448e-b182-a8aa611333e0 | Random is Randomization Implies | Unequal and known chances | Equal and known chances | Unequal and unknown chances | Equal and unknown chances | 1b
| single | null | Social & Preventive Medicine | null |
65e372a9-3940-400d-82df-fb4f008e244a | The net diffusion of water from one solution of water from one solution through a semipermeable membrane to another solution containing a lower concentration of water is termed | filtration | diffusion | osmosis | brownian motion | 2c
| single | Osmosis is defined as the diffusion of water through a semipermeable membrane to a solution with a lower concentration of water.
Filtration is the process in which fluids are pushed through biologic membranes by unequal processes.
Diffusion (Brownian motion) is the random kinetic motion causing atoms and molecules to spread out evenly. | Medicine | null |
404e0984-600d-4385-9f62-adf1cbc33c56 | Reaction due to lysis of bacterial cell wall &necrotic cell product ? | Ahus reaction | Serum sickness | Jerish herheximer reaction | Infectious mononucleosis-ampicillin reaction | 2c
| multi | Ans. is 'c' i.e., Jerish herheximer reaction Ceain cell wall acting antibiotics cause rapid cell lysis and release of proinflammatory and/or toxic bacterial components, which induce inflammatory response in host. This produces a clinical syndrome known as Jarish-hersheimer reaction. The typical example is treatment of primary and secondary syphilis with penicillin, which may produce fever, malaise and exacerbation of symptoms due to Jarish -hersheimer reaction. The reaction can be managed with antipyretics and antihistaminics. About other options Ahus reaction and serum sickness are type III hypersensitivity reactions due to formation of antigen- antibody complex. In IMN, ampicillin causes rash but this is due to allergic reaction against ampicillin. | Microbiology | null |
4677fde7-f23d-4d4f-8f49-fab336d15505 | Tonsillectomy is indicated in - | Acute tonsillitis | Aphthous ulcers in the pharynx | Rheumatic tonsillitis | Physiological enlargement | 2c
| single | "Tonsillectomy is indicated when it is thought that tonsillar infection is producing secondary effects in other organs. Rheumatic fever and acute glomerulonephritis develop as an antigen-antibody reaction to streptococcal infections. Though tonsillectomy does not help an established rheumatic heart disease or nephritis, recurrent attacks can be prevented by tonsillectomy. However, in such cases before undertaking tonsillectomy, there should be no evidence of active throat infection".
Tonsillectomy is not indicated in acute tonsillitis. It is indicated in recurrent acute tonsillitis. In fact during an acute attack of tonsillitis, tonsillectomy is contraindicated. | ENT | null |
3faa5df1-e769-4ff0-b660-86207a306886 | All of the following are contraceptive implants except : | Norplant | Implanon | Jadelle | Mesigyna | 3d
| multi | Contraceptive implants are norplant, Implanon and Jadelle. Mesigyna is an injectable contraceptive. TEXTBOOK OF GYNECOLOGY SHEILA BALAKRISHNAN SECOND EDITION PAGE NO 373 | Gynaecology & Obstetrics | Contraception |
4637a943-9b54-4e8f-9cee-b2919624625d | Which of the following is best to sterilize heat labile solutions? | Dry heat | Autoclave | Membrane filtration | Pasteurization | 2c
| single | Heat sensitive liquids like serum, vaccines, antisera, enzymes, antibiotic solutions and urea solutions can be sterilized by using membrane filtration. The filtration can be aided by using either positive or negative pressure | Microbiology | General Microbiology (Sterilization and Bacterial Genetics) |
0694bf16-506e-4ff8-9d70-4957cc848008 | Atherosclerosis is due to | HDL receptor defect | Apo protein E deficiency | Decreased LDL activity | Decreased lipoprotein lipase | 1b
| single | Atherosclerosis is a slowly progressive disease of large to medium-sized muscular aeries and large elastic aeries characterised by elevated focal intimal fibrofattyPlaques. Principal larger vessels affected are the abdominal aoa, descending thoracic aoa, internal carotid aeries and medium to smaller sized vessels affected are popliteal aeries, coronary aeries, and circle of Willis in brain. The atheroma may be preceded by fatty streaks that are intimal collection of lipid-laden macrophages and smooth muscle cells, occurring in persons as young as one year of age.The disease typically manifests in later life as the vessel lumen is compromised, predisposing to thrombosis and the underlying media is thinned, predisposing to aneurysm formation. It is the number one killer disease, 50 per cent of all deaths in the USA are attributed to atherosclerosis and half of theseare due to acute myocardial infarctions. The remainder include cerebrovascular accidents ("stroke"), aneurysm rupture, mesenteric occlusion and gangrene of theextremities. Etiological Factors Major risk factors in CHD have been discussed earlier. Risk of developing atherosclerosis increases with age, a positive family history, cigarette smoking, diabetes mellitus, hypeension, and hypercholesterolemia. The risk is correlated with elevated LDL and inversely related to the HDL level. Hereditary defects, e.g. familial hypercholesterolemia involving the LDL receptor or the LDL apoproteins cause elevated LDL, hypercholesterolemia andaccelerated atherosclerosis. Lesser influences on the risk of atherosclerosis include sedentary, or high-stress lifestyle, obesity and oral contraceptives.Ref: M.N. Chatterjee - Textbook of Biochemistry, 8th edition, page no: 454 - 456 | Biochemistry | Metabolism of lipid |
56af3bcf-e406-4ca6-b075-b3ac9e6e3a7d | Characteristics of glycoprotein -a) Protein linked with glycosidic bondb) Core proteinc) Sugar residues are long in carbohydrate portion of glycoproteind) Participate in cell surface recognition | b | c | ac | ad | 3d
| single | The oligosaccharide units of a glycoprotein are covalently linked to the polypeptide by specific glycosidic bond, termed as the glycopeptide bond.
Core protein is found in proteoglycans, not in glycoproteins.
The length of the oligosaccharide chain is relatively short (2-10 sugar residues) in glycoproteins, whereas it is longer (upto 100) in proteoglycans.
Glycoproteins participate in cell surface recognition | Biochemistry | null |
a84486f3-1939-4c2e-ad1c-1999bfc5a581 | Serological examination of a patient shows positive for anti gliadin antibodies. It is characteristic of the following condition: | Tropical sprue | Whipple's disease | Celiac disease | Intestinal lymphoma | 2c
| single | Celiac sprue is due to hypersensitivity to gluten, a protein found in wheat products. The disease is associated with HLA-DQ2 and HLA-DQ8. Laboratory testing shows the presence of anti-gliadin, anti-tissue transglutaminase, and anti-endomysial antibodies in patients. Clinical presentation of celiac sprue include, bloating, chronic diarrhea, and malabsorption. Extraintestinal manifestations are common. Dermatitis herpetiformis, a pruritic papular and vesicular rash on the extensor surface of the forearms, elbows, back, and buttocks is classic. Ref: Wyatt C., Kemp W.L., Moos P.J., Burns D.K., Brown T.G. (2008). Chapter 14. Gastrointestinal Pathology. In C. Wyatt, W.L. Kemp, P.J. Moos, D.K. Burns, T.G. Brown (Eds), Pathology: The Big Picture. | Pathology | null |
f3472c85-ad2a-4bd2-8aea-71b68ab3a737 | Tamoxifen causes ? | Osteoporosis | Endometrial hyperplasia | Ovarian cancer | Decreased triglyceride level | 1b
| single | Ans. is 'b' i.e., Endometrial hyperplasia | Pharmacology | null |
521a4f9a-8d34-451e-8a69-bfe658d8a789 | Sigmund Freud gave various defense mechanisms. Which of the following is not a mature defense mechanism? | Humor | Projection | Asceticism | Altruism | 1b
| single | Ans. B. ProjectionAll of the others are mature defenses. Anticipation is goal directed and involves realistic anticipation or planning for future inner discomfort. Suppression involves the conscious postponement of attention to a conscious impulse or conflict. Altruism uses constructive and instinctually satisfying service to others to undergo a vicarious experience. Asceticism involves the assignment of value to specific pleasure and is directed against all base pleasures. | Psychiatry | Cognitive Development |
a9fe903c-3704-4d58-9455-80791a330d6c | Which which laser is used in the management of after cataract | Argon | Krypton | Nd-YAG | Excimer | 2c
| single | NdYAG is a photo disruptive laser and is used for both posterior capsulotomy and peripheral iridotomy Refer Khurana 6th edition page number 401 | Ophthalmology | Lens |
83d0ad44-dccc-443d-9e78-f2171daea088 | True about Glomus- jugulare tumour -
a) Most common in male
b) Arises from non- chromaffin cells
c) Lymph node metastasis seen
d) Multicentric
e) Fluctuating tinnitus and conductive type of hearing loss seen | acde | abc | bde | bcde | 2c
| multi | Glomus tumor is more common in females.
Glomus tumor is also referred to as chemodectomy or nonchromaffin paraganglion.
Glomus tumor is a benign tumor, therefore lymph node metastats is not present.
Multicentric tumors are found in 3-10% of sporadic cases and in 25-50% of familial cases.
Fluctuating (Pulsatile) tinnitus and conductive hearing loss are the earliest symptoms of glomus tumor. | ENT | null |
b6c0a74a-82b1-4542-8456-00af08207d88 | Most common neonatal disorder screened is: | Neonatal hypothyroidism | Neonatal hypehyroidism | Hemoglobinopathies | Congenital Dislocation of Hip | 0a
| single | Most common neonatal disorder to be screened is Neonatal hypothyroidism (NNH) Blood sample is collected from Cord's Blood /fromheel prick after 24hrs of bih Test- measurement of T4 or TSH /both simultaneously. As a single method, T4 is more useful (greater precision and reproducibility) Congenital Hypothyroidism is one of the most common preventable cause of mental retardation. Hence, neonatal screening & early supplementation of thyroid hormones can prevent this mental retardation. | Social & Preventive Medicine | Paediatric Care in RCH: BW, BL, PEM, Breast Feeding |
6bce4733-0e59-4afe-baf4-c159a236caca | Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr? | A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain | A mutation in the stop codon resulted in elongation of the b-chain | A point mutation resulted in the inseion of a stop codon in the b-chain | A two base pair addition resulted in the elimination of a stop codon in the b-chain | 3d
| single | Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC UAU UAA 1 2 3 4 5 6 7 8 etc etc The inseion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids is wrong, since such a mutation would have inseed a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation is the result of a single base pair change, which is not the case here. A point mutation resulting in the inseion of a new stop codon is called a nonsense mutation, and it would result in a shoer-than-normal protein. Ref: Weil P. (2011). Chapter 37. Protein Synthesis & the Genetic Code. In D.A. Bender, K.M. Botham, P.A. Weil, P.J. Kennelly, R.K. Murray, V.W. Rodwell (Eds), Harper's Illustrated Biochemistry, 29e. | Biochemistry | null |
81e4da39-ee11-400d-a87b-fa3096f7d0ae | All the following aeries supply the Sternocleidomastoid except | Superior Thyroid aery | Posterior auricular aery | Occipital aery | Suprascapular aery | 1b
| multi | Blood supply of Sternocleidomastoid Upper 1/3: Occipital aeryMiddle 1/3: Superior Thyroid aeryLower 1/3: Suprascapular aery from thyrocervical trunkReference: Chourasia; 6th edition; 89th page | Anatomy | Head and neck |
01653804-b81f-41df-b3ca-7dd15b853311 | Comedons are characteristics of: | Acne vulgaris | Acne rosasea | SLE | d. Adenoma sebaceum | 0a
| single | Ans is 'a' i.e, Acne vulgaris | Skin | Acne |
de231299-c4b5-4980-88ca-3dd828085789 | A patient with primary Sjogren syndrome treated with tear replacement for symptomatic relief notes continued parotid swelling for the last 3 months. She also has enlarged posterior cervical lymph nodes. Evaluation shows leukopenia and low C4 complement levels. What is the most likely diagnosis? | Amyloidosis | Chronic pancreatitis | HIV infection | Lymphoma | 3d
| single | Lymphoma is well known to develop specifically in the late stage of Sjogren syndrome. Common manifestations include: Persistent parotid gland enlargement Purpura Leukopenia Cryoglobulinemia Low C4 complement levels. - Most of the lymphomas are extranodal, marginal zone B cell, and low grade. Low-grade lymphomas may be detected incidentally during a labial biopsy. - Moality is higher in patients with concurrent B symptoms (fevers, night sweats, and weight loss), a lymph node mass >7 cm, and a high or intermediate histologic grade. | Medicine | Scleroderma |
88e10ff7-ffb2-40a5-8f04-05296fa923fa | Which of the following drug used in the Management of Pulmonary Hypeension acts by inhibiting Phosphodiesterase enzyme? | Epoprostenol | Bosentan | Nifedipine | Sildenafil | 3d
| single | First line drugs for Functional class II-III PAH : cGMP Signaling Modulators: PDE-5 Inhibitors - Sildenafil, Tadalafil, Vardenafil cGMP Signaling Modulators: sGC Stimulator - Riociguat Endothelin Receptor Antagonists - Bosentan, Ambrisentan First line drugs for Functional class IV PAH: IP Receptor Agonists: Prostacyclin and Prostacyclin Analogs - Epoprostenol, Selexipag . L-type Ca2+ Channel Blockers like Nifedipine, Amlodipine: Use only in PAH patients with positive vasodilator testing. | Pharmacology | Respiratory System |
3f1b2617-a977-4388-91ff-7516cd09cbe0 | Energy requirement for pregnant women doing moderate physical activity with body weight 55 kg | 2280 | 2580 | 2730 | 2630 | 1b
| single | Group Category / Age Body weight (Kg) Net energy (Kcal/d) Protein (g/d) Man Sedentary work Moderate work Heavy work 60 2,320 2,730 3,490 60.0 Woman Sedentary work Moderate work Heavy work Pregnant woman Lactation 0-6 m 6-12 months 55 1,900 2,230 2,850 +350 +600 +520 55.0 78 74 68 Infants 0-6 months 6-12 months 5.4 8.4 92 kcal/Kg/d 80 kcal/kg/d 1.16g / kg/d 1.69 g/kg/d Children 1-3 years 4-6 years 7-9 years 12.9 18.0 25.1 1,060 1,350 1,690 16.7 20.1 29.5 Boys 10-12 years 34.3 2,190 39.9 Girls 10-12 years 35.0 2,010 40.4 Boys 13-15 years 47.6 2,750 54.3 Girls 13-15 years 46.6 2,330 51.9 Boys 16-17 years 55.4 3,020 61.5 Girls 16-17 years 52.1 2,440 55.5 Energy Requirements Adult Man: ~2300 kcal/day if sedentary level worker, ~2700 kcal/day if moderate level worker and 3500 kcal/day if heavy level worker. Adult Woman: ~1900 kcal/day if sedentary level worker, ~2200 kcal/day if moderate level worker and ~2900 kcal/day if heavy level worker. Infant 0-6months: 92 Kcal/Kg/d i.e. approx. 500 kcal/day and in infants 6-12 months: 80 Kcal/kg/d i.e. approx. 670kcal/day Additional energy requirements in pregnancy: +350 Additional energy requirements in lactation: in 0-6 months is +600 kcal/day and in 6-12 months is +520 kcal/day | Social & Preventive Medicine | Allied Health Sciences |
ee610d71-45b0-4db9-a9c8-ae8b04dd1a83 | An alcoholic patient with history diabetic nephropathy and liver failure is posted for open abdomen surgery. The most appropriate muscle relaxant in this patient is: | Cisatracurium | Rocuronium | Vecuronium | Rapacuronium | 0a
| single | Cisatracurium is a stereoisomer of atracurium that is four times more potent. Like atracurium, it undergoes degradation in plasma at physiological pH and temperature by organ-independent Hofmann elimination. The resulting metabolites (a monoquaternary acrylate and laudanosine) have no neuromuscular blocking effects. Because of cisatracurium's greater potency, the amount of laudanosine produced for the same extent and duration of neuromuscular blockade is much less than with atracurium. Nonspecific esterases are not involved in the metabolism of cisatracurium. Metabolism and elimination are independent of renal or liver failure hence can be given in hepatic and renal failure. Ref: Butterwoh IV J.F., Butterwoh IV J.F., Mackey D.C., Wasnick J.D., Mackey D.C., Wasnick J.D. (2013). Chapter 11. Neuromuscular Blocking Agents. In J.F. Butterwoh IV, J.F. Butterwoh IV, D.C. Mackey, J.D. Wasnick, D.C. Mackey, J.D. Wasnick (Eds), Morgan & Mikhail's Clinical Anesthesiology, 5e. | Anaesthesia | null |
08a7a3c0-35fa-4879-8457-6df463d1f6af | Vertibular Schwannoma, spinal cord astrocytoma, meningioma are seen in | Tuberous sclerosis | Neurofibromatosis - 1 | Von Hippel - lindeu syndrome | Neurofibromatosis - 2 | 3d
| single | Neurofibromatosis - 2 :
Vertibular Schwannoma.
Meningioma.
Spinal cord ependymoma.
Spinal cord astrocytoma. | Pediatrics | null |
e59ff0d4-ab62-4f72-b60f-d2ff2c8a479a | Aspirin is associated with- | Reye’s syndrome | Sjogren syndrome | Reitersvnderome | None of above | 0a
| multi | Reye Syndrome
Secondary Mitochondrial hepatopathy.
H/o viral injection (Influenza, varicella) & salicylate interactions higher mortality rate.
LFT (raised enzyme with normal bilirubin).
Sjogren’s syndrome
Autoimmune disorder.
A/w generalised dryness (dry mouth-xerostomia, dry eye-keratoconjuncvis sicca).
A/w other rhemac disorder like - SLF, Rheumatoid arthris, systemic sclerosis.
Reiter syndrome
Auto immune.
Riad of arthris of large joint, uveis, urethris (cervicis in female). | Pediatrics | null |
22751e8e-059f-4321-b412-5fbb96305351 | Definitive diagnosis of acute pancreatitis is done by- | Lipase | S. alkaline phosphatase | Increased Ca++ | Hyperglycemia | 0a
| single | Ans - A. Serum lipase activity increases in parallel with amylase activity and is more specific than amylase. A serum lipase measurement can be instrumental in differentiating a pancreatic or nonpancreatic cause for hyperamylasemia. | Medicine | Pancreas |
25491fc9-f189-48b4-944c-cc5992783ef4 | A 25 year old person sustained injury in right eye. He developed right comeal opacity following the injury. Left eye was already having poor vision. Corneoplasty of right eye was done and vision was restored. Medicolegally such injury is labelled as : | Grievous | Simple | Dangerous | Serious | 0a
| multi | Injuries classified as Grievous by Section 320 of IPC: Emasculation Permanent privation of the sight of either eye Permanent privation of the hearing of either ear Privation of any member or joint Destruction or permanent impairing of the powers of any member or joint Permanent disfiguration of the head or face Fracture or dislocation of a bone or tooth Any hu which endangers life or which causes the sufferer to be during the space of twenty days in severe bodily pain, or unable to follow his ordinary pursuits Reference The Synopsis of FORENSIC MEDICINE and Toxicology 29th Edition | Forensic Medicine | Miscellaneous |
86c0285c-05f2-4f59-900d-5c1abce4d3e6 | Mechanism of action of tacrolimus is ? | Inhibition of transcription of IL 2 | Inhibition of translation of IL 2 | Inhibition of calcineurin | Both 'a' and 'c' | 3d
| multi | Ans. is 'd' i.e., Both 'a' and 'c' | Pharmacology | null |
a758633d-31ef-4d24-8f46-205c1ec490af | Detoxication of drugs is controlled by | Cytochrome | Cytochrome p450 | Cytochrome | Cytochrome A | 1b
| single | Cytochrome p450 enzymes are microsomal enzymes that are involved in phase I metabolism of many drugs,
Most of the drugs are metabolized by CYP 3 A4 isoform. Drug metabolizing enzymes The drug-metabolizing enzymes are divided into two types :
1. Microsomal These are located on smooth endoplasmic reticulum primarily in the liver, also in kidney, intestinal mucosa and lungs.
Examples are monooxygenase, cytochrome P450, glucuronyl transferase.
They catalyze most of the oxidation, reduction, hydrolysis and glucuronide conjugation.
They are inducible by drugs, diet and other agencies.
2. Nonmicrosomal These are present in the cytoplasm and mitochondria of hepatic cells as well as in other tissues including plasma.
Examples are flavoprotein oxidase, esterases, amidases and conjugases.
They catalyze some oxidation and reduction, many hydrolysis and all conjugation except glucuronidation.
They are not inducible but many show genetic polymorphism (acetyltransferase, pseudocholinesterase) | Pharmacology | null |
0047b04b-0c25-4de0-a025-54198d954b73 | Homonymous hemianopia with sparing of pupillary reflexes Is a feature of lesions of | Lateral geniculate body | Optic radiations | Visual coex | All of the above | 3d
| multi | Lesions of lateral geniculate body These produce homonymous hemianopia with sparing of pupillary reflexes, and may end in paial optic atrophy. Lesions of optic radiations Pupillary reactions are normal as the fibres of the light reflex leave the optic tracts to synapse in the superior colliculi. Lesions of optic radiations do not produce optic atrophy, as the second order neurons (optic nerve fibres) synapse in the lateral geniculate body. Common lesions of the optic radiations include vascular occlusions, primary and secondary tumours, and trauma. Lesions of the visual coex Congruous homonymous hemianopia usually sparing the macula, is a feature of occlusion of posterior cerebral aery supplying the anterior pa of occipital coex. Congruous homonymous macular defect occurs in lesions of the tip of the occipital coex following head injury or gun shot injuries. Pupillary light reflexes are normal and optic atrophy does not occur following visual coex lesions. Ref:- A K KHURANA; pg num:-290,291 | Ophthalmology | Neuro-ophthalmology |
5a20c477-48fb-4f2d-8ae2-189006cfd042 | The most impoant action of beta-blockers in glaucoma is : | Membrane stabilizing effect | Refinal neuron protecting effect | Decrease in the production of aqueous humor | Pupillary constriction | 2c
| single | Ref: KD Tripathi pharmacology 7th edition (page.no: 144) Topical b blockers are one of the first-line drug for glaucoma In contrast to miotics, the b blockers do not affect pupil size, the tone of ciliary muscle or outflow facility, but lower i.o.t. by reducing aqueous formation. This probably results from down-regulation of adenylyl cyclase due to b 2 receptor blockade in the ciliary epithelium and a secondary effect due to a reduction in ocular blood flow. | Pharmacology | Autonomic nervous system |
02a40ce0-5057-41b9-ac34-757bbdd60241 | A 6 year old girl is easily distracted in class and exhibits poor scholastic performance. Seizures are precipitated by hyperventilation. What is the probable diagnosis? | Myoclonic seizures | Absence seizures | Atonic seizures | Myoclonia | 1b
| single | Typical absence seizures are characterized by sudden, brief lapses of consciousness without loss of postural control. The seizure typically lasts for only seconds, consciousness returns as suddenly as it was lost, and there is no postictal confusion. Although the brief loss of consciousness may be clinically inapparent or the sole manifestation of the seizure discharge, absence seizures are usually accompanied by subtle, bilateral motor signs such as rapid blinking of the eyelids, chewing movements, or small-amplitude, clonic movements of the hands. Typical absence seizures are associated with a group of genetically determined epilepsies with onset usually in childhood (ages 4-8 years) or early adolescence and are the main seizure type in 15-20% of children with epilepsy. Since the clinical signs of the seizures are subtle, especially to parents who may not have had previous experience with seizures, it is not surprising that the first clue to absence epilepsy is often unexplained "daydreaming" and a decline in school performance recognized by a teacher. Hyperventilation tends to provoke these electrographic discharges and even the seizures themselves and is routinely used when recording the EEG. Ref: Lowenstein D.H. (2012). Chapter 369. Seizures and Epilepsy. In D.L. Longo, A.S. Fauci, D.L. Kasper, S.L. Hauser, J.L. Jameson, J. Loscalzo (Eds), Harrison's Principles of Internal Medicine, 18e. | Pediatrics | null |
7ccb816c-c03f-4e32-9a52-86af743f5900 | Inheritence of ichthyosis vulgaris is : | X linked dominant | X linked recessive | Autosomal dominant | Autosomal recessive | 2c
| single | C i.e. Autosomal dominant | Skin | null |
375f338b-2f13-4e98-a599-cd8ab4a30f28 | The following antibiotic accentuates the neuromuscular blockade produced by pancuronium: | Streptomycin | Erythromycin | Penicillin G | Chloramphenicol | 0a
| single | * Aminoglycosides (like streptomycin and gentamicin) can accentuate the neuromuscular blockade produced by competitive blockers (like pancuronium). * Mechanism of neuromuscular blockade produced by aminoglycosides is the inhibition of presynaptic release of ACh. | Pharmacology | Antimicrobial Drugs |
118a41bf-d869-48c0-ad65-d81f861b5964 | Biosynthesis of glucuronic acid requires the | Oxidation of UDP glucose | Oxidation of glucose 6-phosphate | Oxidation of 6-phophoguconate | Oxidanation of glucose | 0a
| single | Glucuronic acid is a sugar acid derived from glucose, with its sixth carbon atom oxidized to a carboxylic acid. In living beings, this primary oxidation occurs with UDP-a-D-glucose (UDPG), not with the free sugar.Ref: DM Vasudevan, 7th edition, page no: 120 | Biochemistry | Metabolism of carbohydrate |
dbd896c8-562a-4dd2-920d-e47241584fa4 | All nerves pass thorugh greater sciatic notch except ? | Superior gluteal nerve | Inferior gluteal nerve | Sciatic nerve | Obturator nerve | 3d
| multi | Ans. is 'd' i.e., Obturator nerve | Anatomy | null |
c6feff15-233e-459e-9193-51849a426749 | Steroids are useful in treating Tuberculosis patient with- | Endobronchial tuberculosis | Tuberculous osteomyelitis | Lymphadenitis | Pneumonia | 2c
| single | Glucocoicoids reduce inflammation and limit tissue damage; they are currently recommended when treating pericardial ,lymphadenitis patients having TB or meningeal disease, and in children with endobronchial disease. They may confer benefit in TB of the ureter, pleural effusions and extensive pulmonary disease, and can suppress hypersensitivity drug reactions. Surgery should be considered in cases complicated by massive haemoptysis, loculated empyema, constrictive pericarditis, lymph node suppuration, and spinal disease with cord compression, but usually only after a full course of antituberculosis treatment. Ref Harrison20th edition pg 980 | Medicine | Infection |
18c27cfc-49b9-4258-be68-3feef8e25d2f | Intravascular hemolysis occurs in: | Hereditary spherocytosis | Autoimmune haemolytic anemia | Paroxysmal nocturnal hemoglobinuria | Thalassemia | 2c
| single | PNH is a disease that results from acquired mutations in the phosphatidylinositol glycan complementation group A gene (PIGA), an enzyme that is essential for the synthesis of certain cell surface proteins.
Red cells, platelets, and granulocytes deficient in these GPI-linked factors are abnormally susceptible to lysis by complement. In red cells, this manifests as intravascular hemolysis, caused by the C5b-C9 membrane attack complex.
The triad of hemolysis, pancytopenia and thrombosis is unique to PNH.
Thrombosis is the leading cause of disease-related death in PNH.
PNH is best made with flow cytometry in which there is presence of bimodal distribution of the red cells. | Pathology | null |
66006504-ed9a-4abf-a097-a589a06a69e3 | Graveyard of ENT surgeon | Pyriform Fossa | Bucco Labial sulcus | Tonsilolingual sulcus | Peritonsillar space | 2c
| single | Tonsilolingual sulcus is seat of carcinoma usually missed by ENT doctor in OPD to check. | ENT | null |
eb0a7e90-071d-4048-af6f-4eba529703c6 | Compression of a nerve within the carpal tunnel products inability to | Abduct the thumb | Adduct the thumb | Flex the distal phalanx of the thumb | Oppose the thumb | 0a
| single | FLEXOR RETINACULUM Transverse carpal ligament. Strong fibrous band which bridges anterior concavity of carpus and conves it into osseofibrous tunnel callef carpal tunnel for the passage of flexor tendons of the digits. Rectangular.Formed due to thickening of deep fascia in front of carpal bones. Attachments: medial-pisiform , hook of hamate.Lateral-tubercle of scaphoid and crest of trapezium. Structures passing superficial to flexor retinaculum:-(medial to lateral)1. Ulnar nerve 2. Ulnar aery 3. Posterior cutaneous branch of ulnar nerve.4. Tendon of palmaris longus.5. Palmar cutaneous branch of median nerve.6. Superficial palmar branch of radial aery. Structures passing deep to flexor retinaculum:-1. Tendon of FDS2. Tendon of FDP 3. Tendon of FPL.4. median nerve. Ulnar bursa-tendons of FDS&FDP.Radial bursa- tendon of flexor pollicis Flexor carpi radialis pass through separate canal. CARPAL TUNNEL SYNDROME:-Injury to median nerve in carpal tunnel.Causes:-Tenosynovitis of flexor tendons.MyxedemaRetention of fluid in pregnancy Fracture dislocation of lunate bone.Osteoahritis of wrist. Symptoms:-1. Feeling of burning pain or " pins & needles " along lateral 3 and half digits especially at night.2. Weakness of thenar muscles.3. No sensory loss over thenar eminence.4. Ape thumb deformity if left untreated.5. Positive phalens abd tinel's sign.Phalen' sign-flexion of both wrists against each other for one minute reproduces the symptoms.Tinel's sign- percussion over flexor retinaculum reproduces symptoms. {Reference:vishram singh, page no.196,} mnemonic: Spm fully Boring Flexor digitorum Superficalis tendon, flexor digitorum profundus tendon, median nerve, Flexor poLLicis longus, Bursae- radial & ulnar | Anatomy | Upper limb |
0e73260d-8338-4d1e-8d23-ad816ecebfab | The main difference between composite and amalgam as restorative material is: | Occlusal wear | Durability | Retention | Manipulation | 0a
| single | null | Dental | null |
Subsets and Splits