modelId
string | author
string | last_modified
timestamp[us, tz=UTC] | downloads
int64 | likes
int64 | library_name
string | tags
sequence | pipeline_tag
string | createdAt
timestamp[us, tz=UTC] | card
string |
|---|---|---|---|---|---|---|---|---|---|
Mungert/Qwen2.5-Omni-7B-GGUF | Mungert | 2025-06-15T19:36:45Z | 979 | 2 | transformers | [
"transformers",
"gguf",
"multimodal",
"any-to-any",
"en",
"arxiv:2503.20215",
"license:other",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | any-to-any | 2025-06-11T03:35:01Z | ---
license: other
license_name: apache-2.0
license_link: https://huggingface.co/Qwen/Qwen2.5-Omni-7B/blob/main/LICENSE
language:
- en
tags:
- multimodal
library_name: transformers
pipeline_tag: any-to-any
---
# <span style="color: #7FFF7F;">Qwen2.5-Omni-7B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`1f63e75f`](https://github.com/ggerganov/llama.cpp/commit/1f63e75f3b5dc7f44dbe63c8a41d23958fe95bc0).
## <span style="color: #7FFF7F;"> Quantization beyond the IMatrix</span>
Testing a new quantization method using rules to bump important layers above what the standard imatrix would use.
I have found that the standard IMatrix does not perform very well at low bit quantiztion and for MOE models. So I am using llama.cpp --tensor-type to bump up selected layers. See [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
This does create larger model files but increases precision for a given model size.
### **Please provide feedback on how you find this method performs**
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
# Qwen2.5-Omni
<a href="https://chat.qwen.ai/" target="_blank" style="margin: 2px;">
<img alt="Chat" src="https://img.shields.io/badge/%F0%9F%92%9C%EF%B8%8F%20Qwen%20Chat%20-536af5" style="display: inline-block; vertical-align: middle;"/>
</a>
## Overview
### Introduction
Qwen2.5-Omni is an end-to-end multimodal model designed to perceive diverse modalities, including text, images, audio, and video, while simultaneously generating text and natural speech responses in a streaming manner.
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/qwen_omni.png" width="80%"/>
<p>
### Key Features
* **Omni and Novel Architecture**: We propose Thinker-Talker architecture, an end-to-end multimodal model designed to perceive diverse modalities, including text, images, audio, and video, while simultaneously generating text and natural speech responses in a streaming manner. We propose a novel position embedding, named TMRoPE (Time-aligned Multimodal RoPE), to synchronize the timestamps of video inputs with audio.
* **Real-Time Voice and Video Chat**: Architecture designed for fully real-time interactions, supporting chunked input and immediate output.
* **Natural and Robust Speech Generation**: Surpassing many existing streaming and non-streaming alternatives, demonstrating superior robustness and naturalness in speech generation.
* **Strong Performance Across Modalities**: Exhibiting exceptional performance across all modalities when benchmarked against similarly sized single-modality models. Qwen2.5-Omni outperforms the similarly sized Qwen2-Audio in audio capabilities and achieves comparable performance to Qwen2.5-VL-7B.
* **Excellent End-to-End Speech Instruction Following**: Qwen2.5-Omni shows performance in end-to-end speech instruction following that rivals its effectiveness with text inputs, evidenced by benchmarks such as MMLU and GSM8K.
### Model Architecture
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/overview.png" width="80%"/>
<p>
### Performance
We conducted a comprehensive evaluation of Qwen2.5-Omni, which demonstrates strong performance across all modalities when compared to similarly sized single-modality models and closed-source models like Qwen2.5-VL-7B, Qwen2-Audio, and Gemini-1.5-pro. In tasks requiring the integration of multiple modalities, such as OmniBench, Qwen2.5-Omni achieves state-of-the-art performance. Furthermore, in single-modality tasks, it excels in areas including speech recognition (Common Voice), translation (CoVoST2), audio understanding (MMAU), image reasoning (MMMU, MMStar), video understanding (MVBench), and speech generation (Seed-tts-eval and subjective naturalness).
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/bar.png" width="80%"/>
<p>
<details>
<summary>Multimodality -> Text</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-0lax" rowspan="10">OmniBench<br>Speech | Sound Event | Music | Avg</td>
<td class="tg-0lax">Gemini-1.5-Pro</td>
<td class="tg-0lax">42.67%|42.26%|46.23%|42.91%</td>
</tr>
<tr>
<td class="tg-0lax">MIO-Instruct</td>
<td class="tg-0lax">36.96%|33.58%|11.32%|33.80%</td>
</tr>
<tr>
<td class="tg-0lax">AnyGPT (7B)</td>
<td class="tg-0lax">17.77%|20.75%|13.21%|18.04%</td>
</tr>
<tr>
<td class="tg-0lax">video-SALMONN</td>
<td class="tg-0lax">34.11%|31.70%|<strong>56.60%</strong>|35.64%</td>
</tr>
<tr>
<td class="tg-0lax">UnifiedIO2-xlarge</td>
<td class="tg-0lax">39.56%|36.98%|29.25%|38.00%</td>
</tr>
<tr>
<td class="tg-0lax">UnifiedIO2-xxlarge</td>
<td class="tg-0lax">34.24%|36.98%|24.53%|33.98%</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|-|40.50%</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">-|-|-|42.90%</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">52.14%|52.08%|52.83%|52.19%</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>55.25%</strong>|<strong>60.00%</strong>|52.83%|<strong>56.13%</strong></td>
</tr>
</tbody></table>
</details>
<details>
<summary>Audio -> Text</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-9j4x" colspan="3">ASR</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="12">Librispeech<br>dev-clean | dev other | test-clean | test-other</td>
<td class="tg-0lax">SALMONN</td>
<td class="tg-0lax">-|-|2.1|4.9</td>
</tr>
<tr>
<td class="tg-0lax">SpeechVerse</td>
<td class="tg-0lax">-|-|2.1|4.4</td>
</tr>
<tr>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">-|-|1.8|3.6</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-8B</td>
<td class="tg-0lax">-|-|-|3.4</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-70B</td>
<td class="tg-0lax">-|-|-|3.1</td>
</tr>
<tr>
<td class="tg-0lax">Seed-ASR-Multilingual</td>
<td class="tg-0lax">-|-|<strong>1.6</strong>|<strong>2.8</strong></td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|1.7|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">-|-|1.7|3.9</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">1.8|4.0|2.0|4.2</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax"><strong>1.3</strong>|<strong>3.4</strong>|<strong>1.6</strong>|3.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">2.0|4.1|2.2|4.5</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">1.6|3.5|1.8|3.4</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="5">Common Voice 15<br>en | zh | yue | fr</td>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">9.3|12.8|10.9|10.8</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">7.9|6.3|6.4|8.5</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">8.6|6.9|<strong>5.9</strong>|9.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">9.1|6.0|11.6|9.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>7.6</strong>|<strong>5.2</strong>|7.3|<strong>7.5</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="8">Fleurs<br>zh | en</td>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">7.7|4.1</td>
</tr>
<tr>
<td class="tg-0lax">Seed-ASR-Multilingual</td>
<td class="tg-0lax">-|<strong>3.4</strong></td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">10.8|-</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">4.4|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">3.0|3.8</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">7.5|-</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">3.2|5.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>3.0</strong>|4.1</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">Wenetspeech<br>test-net | test-meeting</td>
<td class="tg-0lax">Seed-ASR-Chinese</td>
<td class="tg-0lax"><strong>4.7|5.7</strong></td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">-|16.4</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">6.9|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">6.8|7.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">6.3|8.1</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">5.9|7.7</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="4">Voxpopuli-V1.0-en</td>
<td class="tg-0lax">Llama-3-8B</td>
<td class="tg-0lax">6.2</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-70B</td>
<td class="tg-0lax"><strong>5.7</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">6.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">5.8</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">S2TT</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">CoVoST2<br>en-de | de-en | en-zh | zh-en</td>
<td class="tg-0lax">SALMONN</td>
<td class="tg-0lax">18.6|-|33.1|-</td>
</tr>
<tr>
<td class="tg-0lax">SpeechLLaMA</td>
<td class="tg-0lax">-|27.1|-|12.3</td>
</tr>
<tr>
<td class="tg-0lax">BLSP</td>
<td class="tg-0lax">14.1|-|-|-</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|<strong>48.2</strong>|27.2</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">-|<strong>39.9</strong>|46.7|26.0</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">25.1|33.9|41.5|15.7</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">29.9|35.2|45.2|24.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">28.3|38.1|41.4|26.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>30.2</strong>|37.7|41.4|<strong>29.4</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">SER</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">Meld</td>
<td class="tg-0lax">WavLM-large</td>
<td class="tg-0lax">0.542</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">0.524</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">0.557</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">0.553</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.558</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.570</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">VSC</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">VocalSound</td>
<td class="tg-0lax">CLAP</td>
<td class="tg-0lax">0.495</td>
</tr>
<tr>
<td class="tg-0lax">Pengi</td>
<td class="tg-0lax">0.604</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">0.929</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax"><strong>0.939</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.936</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.939</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Music</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="3">GiantSteps Tempo</td>
<td class="tg-0lax">Llark-7B</td>
<td class="tg-0lax">0.86</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax"><strong>0.88</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.88</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="3">MusicCaps</td>
<td class="tg-0lax">LP-MusicCaps</td>
<td class="tg-0lax">0.291|0.149|0.089|<strong>0.061</strong>|0.129|0.130</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.325|<strong>0.163</strong>|<strong>0.093</strong>|0.057|<strong>0.132</strong>|<strong>0.229</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.328</strong>|0.162|0.090|0.055|0.127|0.225</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Audio Reasoning</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="4">MMAU<br>Sound | Music | Speech | Avg</td>
<td class="tg-0lax">Gemini-Pro-V1.5</td>
<td class="tg-0lax">56.75|49.40|58.55|54.90</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">54.95|50.98|42.04|49.20</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax"><strong>70.27</strong>|60.48|59.16|63.30</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">67.87|<strong>69.16|59.76|65.60</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Voice Chatting</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">VoiceBench<br>AlpacaEval | CommonEval | SD-QA | MMSU</td>
<td class="tg-0lax">Ultravox-v0.4.1-LLaMA-3.1-8B</td>
<td class="tg-0lax"><strong>4.55</strong>|3.90|53.35|47.17</td>
</tr>
<tr>
<td class="tg-0lax">MERaLiON</td>
<td class="tg-0lax">4.50|3.77|55.06|34.95</td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">3.50|2.95|25.95|27.03</td>
</tr>
<tr>
<td class="tg-0lax">Lyra-Base</td>
<td class="tg-0lax">3.85|3.50|38.25|49.74</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">4.42|<strong>4.15</strong>|50.72|54.78</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">4.50|4.05|43.40|57.25</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">3.74|3.43|35.71|35.72</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">4.32|4.00|49.37|50.23</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">4.49|3.93|<strong>55.71</strong>|<strong>61.32</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">VoiceBench<br>OpenBookQA | IFEval | AdvBench | Avg</td>
<td class="tg-0lax">Ultravox-v0.4.1-LLaMA-3.1-8B</td>
<td class="tg-0lax">65.27|<strong>66.88</strong>|98.46|71.45</td>
</tr>
<tr>
<td class="tg-0lax">MERaLiON</td>
<td class="tg-0lax">27.23|62.93|94.81|62.91</td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">28.35|25.71|87.69|46.25</td>
</tr>
<tr>
<td class="tg-0lax">Lyra-Base</td>
<td class="tg-0lax">72.75|36.28|59.62|57.66</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">78.02|49.25|97.69|71.69</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">74.51|54.54|97.31|71.14</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">49.45|26.33|96.73|55.35</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">74.73|42.10|98.85|68.81</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>81.10</strong>|52.87|<strong>99.42</strong>|<strong>74.12</strong></td>
</tr>
</tbody></table>
</details>
<details>
<summary>Image -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Other Best | Qwen2.5-VL-7B | GPT-4o-mini |
|--------------------------------|--------------|------------|------------|---------------|-------------|
| MMMU<sub>val</sub> | 59.2 | 53.1 | 53.9 | 58.6 | **60.0** |
| MMMU-Pro<sub>overall</sub> | 36.6 | 29.7 | - | **38.3** | 37.6 |
| MathVista<sub>testmini</sub> | 67.9 | 59.4 | **71.9** | 68.2 | 52.5 |
| MathVision<sub>full</sub> | 25.0 | 20.8 | 23.1 | **25.1** | - |
| MMBench-V1.1-EN<sub>test</sub> | 81.8 | 77.8 | 80.5 | **82.6** | 76.0 |
| MMVet<sub>turbo</sub> | 66.8 | 62.1 | **67.5** | 67.1 | 66.9 |
| MMStar | **64.0** | 55.7 | **64.0** | 63.9 | 54.8 |
| MME<sub>sum</sub> | 2340 | 2117 | **2372** | 2347 | 2003 |
| MuirBench | 59.2 | 48.0 | - | **59.2** | - |
| CRPE<sub>relation</sub> | **76.5** | 73.7 | - | 76.4 | - |
| RealWorldQA<sub>avg</sub> | 70.3 | 62.6 | **71.9** | 68.5 | - |
| MME-RealWorld<sub>en</sub> | **61.6** | 55.6 | - | 57.4 | - |
| MM-MT-Bench | 6.0 | 5.0 | - | **6.3** | - |
| AI2D | 83.2 | 79.5 | **85.8** | 83.9 | - |
| TextVQA<sub>val</sub> | 84.4 | 79.8 | 83.2 | **84.9** | - |
| DocVQA<sub>test</sub> | 95.2 | 93.3 | 93.5 | **95.7** | - |
| ChartQA<sub>test Avg</sub> | 85.3 | 82.8 | 84.9 | **87.3** | - |
| OCRBench_V2<sub>en</sub> | **57.8** | 51.7 | - | 56.3 | - |
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Qwen2.5-VL-7B | Grounding DINO | Gemini 1.5 Pro |
|--------------------------|--------------|---------------|---------------|----------------|----------------|
| Refcoco<sub>val</sub> | 90.5 | 88.7 | 90.0 | **90.6** | 73.2 |
| Refcoco<sub>textA</sub> | **93.5** | 91.8 | 92.5 | 93.2 | 72.9 |
| Refcoco<sub>textB</sub> | 86.6 | 84.0 | 85.4 | **88.2** | 74.6 |
| Refcoco+<sub>val</sub> | 85.4 | 81.1 | 84.2 | **88.2** | 62.5 |
| Refcoco+<sub>textA</sub> | **91.0** | 87.5 | 89.1 | 89.0 | 63.9 |
| Refcoco+<sub>textB</sub> | **79.3** | 73.2 | 76.9 | 75.9 | 65.0 |
| Refcocog+<sub>val</sub> | **87.4** | 85.0 | 87.2 | 86.1 | 75.2 |
| Refcocog+<sub>test</sub> | **87.9** | 85.1 | 87.2 | 87.0 | 76.2 |
| ODinW | 42.4 | 39.2 | 37.3 | **55.0** | 36.7 |
| PointGrounding | 66.5 | 46.2 | **67.3** | - | - |
</details>
<details>
<summary>Video(without audio) -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Other Best | Qwen2.5-VL-7B | GPT-4o-mini |
|-----------------------------|--------------|------------|------------|---------------|-------------|
| Video-MME<sub>w/o sub</sub> | 64.3 | 62.0 | 63.9 | **65.1** | 64.8 |
| Video-MME<sub>w sub</sub> | **72.4** | 68.6 | 67.9 | 71.6 | - |
| MVBench | **70.3** | 68.7 | 67.2 | 69.6 | - |
| EgoSchema<sub>test</sub> | **68.6** | 61.4 | 63.2 | 65.0 | - |
</details>
<details>
<summary>Zero-shot Speech Generation</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-9j4x" colspan="3">Content Consistency</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="11">SEED<br>test-zh | test-en | test-hard </td>
<td class="tg-0lax">Seed-TTS_ICL</td>
<td class="tg-0lax">1.11 | 2.24 | 7.58</td>
</tr>
<tr>
<td class="tg-0lax">Seed-TTS_RL</td>
<td class="tg-0lax"><strong>1.00</strong> | 1.94 | <strong>6.42</strong></td>
</tr>
<tr>
<td class="tg-0lax">MaskGCT</td>
<td class="tg-0lax">2.27 | 2.62 | 10.27</td>
</tr>
<tr>
<td class="tg-0lax">E2_TTS</td>
<td class="tg-0lax">1.97 | 2.19 | -</td>
</tr>
<tr>
<td class="tg-0lax">F5-TTS</td>
<td class="tg-0lax">1.56 | <strong>1.83</strong> | 8.67</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2</td>
<td class="tg-0lax">1.45 | 2.57 | 6.83</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2-S</td>
<td class="tg-0lax">1.45 | 2.38 | 8.08</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_ICL</td>
<td class="tg-0lax">1.95 | 2.87 | 9.92</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_RL</td>
<td class="tg-0lax">1.58 | 2.51 | 7.86</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_ICL</td>
<td class="tg-0lax">1.70 | 2.72 | 7.97</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_RL</td>
<td class="tg-0lax">1.42 | 2.32 | 6.54</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Speaker Similarity</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="11">SEED<br>test-zh | test-en | test-hard </td>
<td class="tg-0lax">Seed-TTS_ICL</td>
<td class="tg-0lax">0.796 | 0.762 | 0.776</td>
</tr>
<tr>
<td class="tg-0lax">Seed-TTS_RL</td>
<td class="tg-0lax"><strong>0.801</strong> | <strong>0.766</strong> | <strong>0.782</strong></td>
</tr>
<tr>
<td class="tg-0lax">MaskGCT</td>
<td class="tg-0lax">0.774 | 0.714 | 0.748</td>
</tr>
<tr>
<td class="tg-0lax">E2_TTS</td>
<td class="tg-0lax">0.730 | 0.710 | -</td>
</tr>
<tr>
<td class="tg-0lax">F5-TTS</td>
<td class="tg-0lax">0.741 | 0.647 | 0.713</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2</td>
<td class="tg-0lax">0.748 | 0.652 | 0.724</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2-S</td>
<td class="tg-0lax">0.753 | 0.654 | 0.732</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_ICL</td>
<td class="tg-0lax">0.741 | 0.635 | 0.748</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_RL</td>
<td class="tg-0lax">0.744 | 0.635 | 0.746</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_ICL</td>
<td class="tg-0lax">0.752 | 0.632 | 0.747</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_RL</td>
<td class="tg-0lax">0.754 | 0.641 | 0.752</td>
</tr>
</tbody></table>
</details>
<details>
<summary>Text -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Qwen2.5-7B | Qwen2.5-3B | Qwen2-7B | Llama3.1-8B | Gemma2-9B |
|-----------------------------------|-----------|------------|------------|------------|------------|-------------|-----------|
| MMLU-Pro | 47.0 | 40.4 | **56.3** | 43.7 | 44.1 | 48.3 | 52.1 |
| MMLU-redux | 71.0 | 60.9 | **75.4** | 64.4 | 67.3 | 67.2 | 72.8 |
| LiveBench<sub>0831</sub> | 29.6 | 22.3 | **35.9** | 26.8 | 29.2 | 26.7 | 30.6 |
| GPQA | 30.8 | 34.3 | **36.4** | 30.3 | 34.3 | 32.8 | 32.8 |
| MATH | 71.5 | 63.6 | **75.5** | 65.9 | 52.9 | 51.9 | 44.3 |
| GSM8K | 88.7 | 82.6 | **91.6** | 86.7 | 85.7 | 84.5 | 76.7 |
| HumanEval | 78.7 | 70.7 | **84.8** | 74.4 | 79.9 | 72.6 | 68.9 |
| MBPP | 73.2 | 70.4 | **79.2** | 72.7 | 67.2 | 69.6 | 74.9 |
| MultiPL-E | 65.8 | 57.6 | **70.4** | 60.2 | 59.1 | 50.7 | 53.4 |
| LiveCodeBench<sub>2305-2409</sub> | 24.6 | 16.5 | **28.7** | 19.9 | 23.9 | 8.3 | 18.9 |
</details>
## Quickstart
Below, we provide simple examples to show how to use Qwen2.5-Omni with 🤗 Transformers. The codes of Qwen2.5-Omni has been in the latest Hugging face transformers and we advise you to build from source with command:
```
pip uninstall transformers
pip install git+https://github.com/huggingface/[email protected]
pip install accelerate
```
or you might encounter the following error:
```
KeyError: 'qwen2_5_omni'
```
We offer a toolkit to help you handle various types of audio and visual input more conveniently, as if you were using an API. This includes base64, URLs, and interleaved audio, images and videos. You can install it using the following command and make sure your system has `ffmpeg` installed:
```bash
# It's highly recommended to use `[decord]` feature for faster video loading.
pip install qwen-omni-utils[decord] -U
```
If you are not using Linux, you might not be able to install `decord` from PyPI. In that case, you can use `pip install qwen-omni-utils -U` which will fall back to using torchvision for video processing. However, you can still [install decord from source](https://github.com/dmlc/decord?tab=readme-ov-file#install-from-source) to get decord used when loading video.
### 🤗 Transformers Usage
Here we show a code snippet to show you how to use the chat model with `transformers` and `qwen_omni_utils`:
```python
import soundfile as sf
from transformers import Qwen2_5OmniForConditionalGeneration, Qwen2_5OmniProcessor
from qwen_omni_utils import process_mm_info
# default: Load the model on the available device(s)
model = Qwen2_5OmniForConditionalGeneration.from_pretrained("Qwen/Qwen2.5-Omni-7B", torch_dtype="auto", device_map="auto")
# We recommend enabling flash_attention_2 for better acceleration and memory saving.
# model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
# "Qwen/Qwen2.5-Omni-7B",
# torch_dtype="auto",
# device_map="auto",
# attn_implementation="flash_attention_2",
# )
processor = Qwen2_5OmniProcessor.from_pretrained("Qwen/Qwen2.5-Omni-7B")
conversation = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "video", "video": "https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/draw.mp4"},
],
},
]
# set use audio in video
USE_AUDIO_IN_VIDEO = True
# Preparation for inference
text = processor.apply_chat_template(conversation, add_generation_prompt=True, tokenize=False)
audios, images, videos = process_mm_info(conversation, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt", padding=True, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = inputs.to(model.device).to(model.dtype)
# Inference: Generation of the output text and audio
text_ids, audio = model.generate(**inputs, use_audio_in_video=USE_AUDIO_IN_VIDEO)
text = processor.batch_decode(text_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)
print(text)
sf.write(
"output.wav",
audio.reshape(-1).detach().cpu().numpy(),
samplerate=24000,
)
```
<details>
<summary>Minimum GPU memory requirements</summary>
|Model | Precision | 15(s) Video | 30(s) Video | 60(s) Video |
|--------------|-----------| ------------- | ------------- | ------------------ |
| Qwen-Omni-3B | FP32 | 89.10 GB | Not Recommend | Not Recommend |
| Qwen-Omni-3B | BF16 | 18.38 GB | 22.43 GB | 28.22 GB |
| Qwen-Omni-7B | FP32 | 93.56 GB | Not Recommend | Not Recommend |
| Qwen-Omni-7B | BF16 | 31.11 GB | 41.85 GB | 60.19 GB |
Note: The table above presents the theoretical minimum memory requirements for inference with `transformers` and `BF16` is test with `attn_implementation="flash_attention_2"`; however, in practice, the actual memory usage is typically at least 1.2 times higher. For more information, see the linked resource [here](https://huggingface.co/docs/accelerate/main/en/usage_guides/model_size_estimator).
</details>
<details>
<summary>Video URL resource usage</summary>
Video URL compatibility largely depends on the third-party library version. The details are in the table below. Change the backend by `FORCE_QWENVL_VIDEO_READER=torchvision` or `FORCE_QWENVL_VIDEO_READER=decord` if you prefer not to use the default one.
| Backend | HTTP | HTTPS |
|-------------|------|-------|
| torchvision >= 0.19.0 | ✅ | ✅ |
| torchvision < 0.19.0 | ❌ | ❌ |
| decord | ✅ | ❌ |
</details>
<details>
<summary>Batch inference</summary>
The model can batch inputs composed of mixed samples of various types such as text, images, audio and videos as input when `return_audio=False` is set. Here is an example.
```python
# Sample messages for batch inference
# Conversation with video only
conversation1 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "video", "video": "/path/to/video.mp4"},
]
}
]
# Conversation with audio only
conversation2 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "audio", "audio": "/path/to/audio.wav"},
]
}
]
# Conversation with pure text
conversation3 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": "who are you?"
}
]
# Conversation with mixed media
conversation4 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "image", "image": "/path/to/image.jpg"},
{"type": "video", "video": "/path/to/video.mp4"},
{"type": "audio", "audio": "/path/to/audio.wav"},
{"type": "text", "text": "What are the elements can you see and hear in these medias?"},
],
}
]
# Combine messages for batch processing
conversations = [conversation1, conversation2, conversation3, conversation4]
# set use audio in video
USE_AUDIO_IN_VIDEO = True
# Preparation for batch inference
text = processor.apply_chat_template(conversations, add_generation_prompt=True, tokenize=False)
audios, images, videos = process_mm_info(conversations, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt", padding=True, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = inputs.to(model.device).to(model.dtype)
# Batch Inference
text_ids = model.generate(**inputs, use_audio_in_video=USE_AUDIO_IN_VIDEO, return_audio=False)
text = processor.batch_decode(text_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)
print(text)
```
</details>
### Usage Tips
#### Prompt for audio output
If users need audio output, the system prompt must be set as "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech.", otherwise the audio output may not work as expected.
```
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
}
```
#### Use audio in video
In the process of multimodal interaction, the videos provided by users are often accompanied by audio (such as questions about the content in the video, or sounds generated by certain events in the video). This information is conducive to the model providing a better interactive experience. So we provide the following options for users to decide whether to use audio in video.
```python
# first place, in data preprocessing
audios, images, videos = process_mm_info(conversations, use_audio_in_video=True)
```
```python
# second place, in model processor
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt",
padding=True, use_audio_in_video=True)
```
```python
# third place, in model inference
text_ids, audio = model.generate(**inputs, use_audio_in_video=True)
```
It is worth noting that during a multi-round conversation, the `use_audio_in_video` parameter in these places must be set to the same, otherwise unexpected results will occur.
#### Use audio output or not
The model supports both text and audio outputs, if users do not need audio outputs, they can call `model.disable_talker()` after init the model. This option will save about `~2GB` of GPU memory but the `return_audio` option for `generate` function will only allow to be set at `False`.
```python
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-7B",
torch_dtype="auto",
device_map="auto"
)
model.disable_talker()
```
In order to obtain a flexible experience, we recommend that users can decide whether to return audio when `generate` function is called. If `return_audio` is set to `False`, the model will only return text outputs to get text responses faster.
```python
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-7B",
torch_dtype="auto",
device_map="auto"
)
...
text_ids = model.generate(**inputs, return_audio=False)
```
#### Change voice type of output audio
Qwen2.5-Omni supports the ability to change the voice of the output audio. The `"Qwen/Qwen2.5-Omni-7B"` checkpoint support two voice types as follow:
| Voice Type | Gender | Description |
|------------|--------|-------------|
| Chelsie | Female | A honeyed, velvety voice that carries a gentle warmth and luminous clarity.|
| Ethan | Male | A bright, upbeat voice with infectious energy and a warm, approachable vibe.|
Users can use the `speaker` parameter of `generate` function to specify the voice type. By default, if `speaker` is not specified, the default voice type is `Chelsie`.
```python
text_ids, audio = model.generate(**inputs, speaker="Chelsie")
```
```python
text_ids, audio = model.generate(**inputs, speaker="Ethan")
```
#### Flash-Attention 2 to speed up generation
First, make sure to install the latest version of Flash Attention 2:
```bash
pip install -U flash-attn --no-build-isolation
```
Also, you should have hardware that is compatible with FlashAttention 2. Read more about it in the official documentation of the [flash attention repository](https://github.com/Dao-AILab/flash-attention). FlashAttention-2 can only be used when a model is loaded in `torch.float16` or `torch.bfloat16`.
To load and run a model using FlashAttention-2, add `attn_implementation="flash_attention_2"` when loading the model:
```python
from transformers import Qwen2_5OmniForConditionalGeneration
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-7B",
device_map="auto",
torch_dtype=torch.bfloat16,
attn_implementation="flash_attention_2",
)
```
## Citation
If you find our paper and code useful in your research, please consider giving a star :star: and citation :pencil: :)
```BibTeX
@article{Qwen2.5-Omni,
title={Qwen2.5-Omni Technical Report},
author={Jin Xu, Zhifang Guo, Jinzheng He, Hangrui Hu, Ting He, Shuai Bai, Keqin Chen, Jialin Wang, Yang Fan, Kai Dang, Bin Zhang, Xiong Wang, Yunfei Chu, Junyang Lin},
journal={arXiv preprint arXiv:2503.20215},
year={2025}
}
```
<br>
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/Qwen3-Embedding-4B-GGUF | Mungert | 2025-06-15T19:36:40Z | 1,582 | 2 | sentence-transformers | [
"sentence-transformers",
"gguf",
"transformers",
"sentence-similarity",
"feature-extraction",
"base_model:Qwen/Qwen3-4B-Base",
"base_model:quantized:Qwen/Qwen3-4B-Base",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | feature-extraction | 2025-06-10T13:02:08Z | ---
license: apache-2.0
base_model:
- Qwen/Qwen3-4B-Base
tags:
- transformers
- sentence-transformers
- sentence-similarity
- feature-extraction
---
# <span style="color: #7FFF7F;">Qwen3-Embedding-4B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`1f63e75f`](https://github.com/ggerganov/llama.cpp/commit/1f63e75f3b5dc7f44dbe63c8a41d23958fe95bc0).
## <span style="color: #7FFF7F;"> Quantization beyond the IMatrix</span>
Testing a new quantization method using rules to bump important layers above what the standard imatrix would use.
I have found that the standard IMatrix does not perform very well at low bit quantiztion and for MOE models. So I am using llama.cpp --tensor-type to bump up selected layers. See [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
This does create larger model files but increases precision for a given model size.
### **Please provide feedback on how you find this method performs**
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
# Qwen3-Embedding-4B
<p align="center">
<img src="https://qianwen-res.oss-accelerate-overseas.aliyuncs.com/logo_qwen3.png" width="400"/>
<p>
## Highlights
The Qwen3 Embedding model series is the latest proprietary model of the Qwen family, specifically designed for text embedding and ranking tasks. Building upon the dense foundational models of the Qwen3 series, it provides a comprehensive range of text embeddings and reranking models in various sizes (0.6B, 4B, and 8B). This series inherits the exceptional multilingual capabilities, long-text understanding, and reasoning skills of its foundational model. The Qwen3 Embedding series represents significant advancements in multiple text embedding and ranking tasks, including text retrieval, code retrieval, text classification, text clustering, and bitext mining.
**Exceptional Versatility**: The embedding model has achieved state-of-the-art performance across a wide range of downstream application evaluations. The 8B size embedding model ranks **No.1** in the MTEB multilingual leaderboard (as of June 5, 2025, score **70.58**), while the reranking model excels in various text retrieval scenarios.
**Comprehensive Flexibility**: The Qwen3 Embedding series offers a full spectrum of sizes (from 0.6B to 8B) for both embedding and reranking models, catering to diverse use cases that prioritize efficiency and effectiveness. Developers can seamlessly combine these two modules. Additionally, the embedding model allows for flexible vector definitions across all dimensions, and both embedding and reranking models support user-defined instructions to enhance performance for specific tasks, languages, or scenarios.
**Multilingual Capability**: The Qwen3 Embedding series offer support for over 100 languages, thanks to the multilingual capabilites of Qwen3 models. This includes various programming languages, and provides robust multilingual, cross-lingual, and code retrieval capabilities.
## Model Overview
**Qwen3-Embedding-4B** has the following features:
- Model Type: Text Embedding
- Supported Languages: 100+ Languages
- Number of Paramaters: 4B
- Context Length: 32k
- Embedding Dimension: Up to 2560, supports user-defined output dimensions ranging from 32 to 2560
For more details, including benchmark evaluation, hardware requirements, and inference performance, please refer to our [blog](https://qwenlm.github.io/blog/qwen3-embedding/), [GitHub](https://github.com/QwenLM/Qwen3-Embedding).
## Qwen3 Embedding Series Model list
| Model Type | Models | Size | Layers | Sequence Length | Embedding Dimension | MRL Support | Instruction Aware |
|------------------|----------------------|------|--------|-----------------|---------------------|-------------|----------------|
| Text Embedding | [Qwen3-Embedding-0.6B](https://huggingface.co/Qwen/Qwen3-Embedding-0.6B) | 0.6B | 28 | 32K | 1024 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-4B](https://huggingface.co/Qwen/Qwen3-Embedding-4B) | 4B | 36 | 32K | 2560 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-8B](https://huggingface.co/Qwen/Qwen3-Embedding-8B) | 8B | 36 | 32K | 4096 | Yes | Yes |
| Text Reranking | [Qwen3-Reranker-0.6B](https://huggingface.co/Qwen/Qwen3-Reranker-0.6B) | 0.6B | 28 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-4B](https://huggingface.co/Qwen/Qwen3-Reranker-4B) | 4B | 36 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-8B](https://huggingface.co/Qwen/Qwen3-Reranker-8B) | 8B | 36 | 32K | - | - | Yes |
> **Note**:
> - `MRL Support` indicates whether the embedding model supports custom dimensions for the final embedding.
> - `Instruction Aware` notes whether the embedding or reranking model supports customizing the input instruction according to different tasks.
> - Our evaluation indicates that, for most downstream tasks, using instructions (instruct) typically yields an improvement of 1% to 5% compared to not using them. Therefore, we recommend that developers create tailored instructions specific to their tasks and scenarios. In multilingual contexts, we also advise users to write their instructions in English, as most instructions utilized during the model training process were originally written in English.
## Usage
With Transformers versions earlier than 4.51.0, you may encounter the following error:
```
KeyError: 'qwen3'
```
### Sentence Transformers Usage
```python
# Requires transformers>=4.51.0
from sentence_transformers import SentenceTransformer
# Load the model
model = SentenceTransformer("Qwen/Qwen3-Embedding-4B")
# We recommend enabling flash_attention_2 for better acceleration and memory saving,
# together with setting `padding_side` to "left":
# model = SentenceTransformer(
# "Qwen/Qwen3-Embedding-4B",
# model_kwargs={"attn_implementation": "flash_attention_2", "device_map": "auto"},
# tokenizer_kwargs={"padding_side": "left"},
# )
# The queries and documents to embed
queries = [
"What is the capital of China?",
"Explain gravity",
]
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun.",
]
# Encode the queries and documents. Note that queries benefit from using a prompt
# Here we use the prompt called "query" stored under `model.prompts`, but you can
# also pass your own prompt via the `prompt` argument
query_embeddings = model.encode(queries, prompt_name="query")
document_embeddings = model.encode(documents)
# Compute the (cosine) similarity between the query and document embeddings
similarity = model.similarity(query_embeddings, document_embeddings)
print(similarity)
# tensor([[0.7534, 0.1147],
# [0.0320, 0.6258]])
```
### Transformers Usage
```python
# Requires transformers>=4.51.0
import torch
import torch.nn.functional as F
from torch import Tensor
from transformers import AutoTokenizer, AutoModel
def last_token_pool(last_hidden_states: Tensor,
attention_mask: Tensor) -> Tensor:
left_padding = (attention_mask[:, -1].sum() == attention_mask.shape[0])
if left_padding:
return last_hidden_states[:, -1]
else:
sequence_lengths = attention_mask.sum(dim=1) - 1
batch_size = last_hidden_states.shape[0]
return last_hidden_states[torch.arange(batch_size, device=last_hidden_states.device), sequence_lengths]
def get_detailed_instruct(task_description: str, query: str) -> str:
return f'Instruct: {task_description}\nQuery:{query}'
# Each query must come with a one-sentence instruction that describes the task
task = 'Given a web search query, retrieve relevant passages that answer the query'
queries = [
get_detailed_instruct(task, 'What is the capital of China?'),
get_detailed_instruct(task, 'Explain gravity')
]
# No need to add instruction for retrieval documents
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun."
]
input_texts = queries + documents
tokenizer = AutoTokenizer.from_pretrained('Qwen/Qwen3-Embedding-4B', padding_side='left')
model = AutoModel.from_pretrained('Qwen/Qwen3-Embedding-4B')
# We recommend enabling flash_attention_2 for better acceleration and memory saving.
# model = AutoModel.from_pretrained('Qwen/Qwen3-Embedding-4B', attn_implementation="flash_attention_2", torch_dtype=torch.float16).cuda()
max_length = 8192
# Tokenize the input texts
batch_dict = tokenizer(
input_texts,
padding=True,
truncation=True,
max_length=max_length,
return_tensors="pt",
)
batch_dict.to(model.device)
outputs = model(**batch_dict)
embeddings = last_token_pool(outputs.last_hidden_state, batch_dict['attention_mask'])
# normalize embeddings
embeddings = F.normalize(embeddings, p=2, dim=1)
scores = (embeddings[:2] @ embeddings[2:].T)
print(scores.tolist())
# [[0.7534257769584656, 0.1146894246339798], [0.03198453038930893, 0.6258305311203003]]
```
📌 **Tip**: We recommend that developers customize the `instruct` according to their specific scenarios, tasks, and languages. Our tests have shown that in most retrieval scenarios, not using an `instruct` on the query side can lead to a drop in retrieval performance by approximately 1% to 5%.
## Evaluation
### MTEB (Multilingual)
| Model | Size | Mean (Task) | Mean (Type) | Bitxt Mining | Class. | Clust. | Inst. Retri. | Multi. Class. | Pair. Class. | Rerank | Retri. | STS |
|----------------------------------|:-------:|:-------------:|:-------------:|:--------------:|:--------:|:--------:|:--------------:|:---------------:|:--------------:|:--------:|:--------:|:------:|
| NV-Embed-v2 | 7B | 56.29 | 49.58 | 57.84 | 57.29 | 40.80 | 1.04 | 18.63 | 78.94 | 63.82 | 56.72 | 71.10|
| GritLM-7B | 7B | 60.92 | 53.74 | 70.53 | 61.83 | 49.75 | 3.45 | 22.77 | 79.94 | 63.78 | 58.31 | 73.33|
| BGE-M3 | 0.6B | 59.56 | 52.18 | 79.11 | 60.35 | 40.88 | -3.11 | 20.1 | 80.76 | 62.79 | 54.60 | 74.12|
| multilingual-e5-large-instruct | 0.6B | 63.22 | 55.08 | 80.13 | 64.94 | 50.75 | -0.40 | 22.91 | 80.86 | 62.61 | 57.12 | 76.81|
| gte-Qwen2-1.5B-instruct | 1.5B | 59.45 | 52.69 | 62.51 | 58.32 | 52.05 | 0.74 | 24.02 | 81.58 | 62.58 | 60.78 | 71.61|
| gte-Qwen2-7b-Instruct | 7B | 62.51 | 55.93 | 73.92 | 61.55 | 52.77 | 4.94 | 25.48 | 85.13 | 65.55 | 60.08 | 73.98|
| text-embedding-3-large | - | 58.93 | 51.41 | 62.17 | 60.27 | 46.89 | -2.68 | 22.03 | 79.17 | 63.89 | 59.27 | 71.68|
| Cohere-embed-multilingual-v3.0 | - | 61.12 | 53.23 | 70.50 | 62.95 | 46.89 | -1.89 | 22.74 | 79.88 | 64.07 | 59.16 | 74.80|
| gemini-embedding-exp-03-07 | - | 68.37 | 59.59 | 79.28 | 71.82 | 54.59 | 5.18 | **29.16** | 83.63 | 65.58 | 67.71 | 79.40|
| **Qwen3-Embedding-0.6B** | 0.6B | 64.33 | 56.00 | 72.22 | 66.83 | 52.33 | 5.09 | 24.59 | 80.83 | 61.41 | 64.64 | 76.17|
| **Qwen3-Embedding-4B** | 4B | 69.45 | 60.86 | 79.36 | 72.33 | 57.15 | **11.56** | 26.77 | 85.05 | 65.08 | 69.60 | 80.86|
| **Qwen3-Embedding-8B** | 8B | **70.58** | **61.69** | **80.89** | **74.00** | **57.65** | 10.06 | 28.66 | **86.40** | **65.63** | **70.88** | **81.08** |
> **Note**: For compared models, the scores are retrieved from MTEB online [leaderboard](https://huggingface.co/spaces/mteb/leaderboard) on May 24th, 2025.
### MTEB (Eng v2)
| MTEB English / Models | Param. | Mean(Task) | Mean(Type) | Class. | Clust. | Pair Class. | Rerank. | Retri. | STS | Summ. |
|--------------------------------|:--------:|:------------:|:------------:|:--------:|:--------:|:-------------:|:---------:|:--------:|:-------:|:-------:|
| multilingual-e5-large-instruct | 0.6B | 65.53 | 61.21 | 75.54 | 49.89 | 86.24 | 48.74 | 53.47 | 84.72 | 29.89 |
| NV-Embed-v2 | 7.8B | 69.81 | 65.00 | 87.19 | 47.66 | 88.69 | 49.61 | 62.84 | 83.82 | 35.21 |
| GritLM-7B | 7.2B | 67.07 | 63.22 | 81.25 | 50.82 | 87.29 | 49.59 | 54.95 | 83.03 | 35.65 |
| gte-Qwen2-1.5B-instruct | 1.5B | 67.20 | 63.26 | 85.84 | 53.54 | 87.52 | 49.25 | 50.25 | 82.51 | 33.94 |
| stella_en_1.5B_v5 | 1.5B | 69.43 | 65.32 | 89.38 | 57.06 | 88.02 | 50.19 | 52.42 | 83.27 | 36.91 |
| gte-Qwen2-7B-instruct | 7.6B | 70.72 | 65.77 | 88.52 | 58.97 | 85.9 | 50.47 | 58.09 | 82.69 | 35.74 |
| gemini-embedding-exp-03-07 | - | 73.3 | 67.67 | 90.05 | **59.39** | **87.7** | 48.59 | 64.35 | 85.29 | **38.28** |
| **Qwen3-Embedding-0.6B** | 0.6B | 70.70 | 64.88 | 85.76 | 54.05 | 84.37 | 48.18 | 61.83 | 86.57 | 33.43 |
| **Qwen3-Embedding-4B** | 4B | 74.60 | 68.10 | 89.84 | 57.51 | 87.01 | 50.76 | 68.46 | **88.72** | 34.39 |
| **Qwen3-Embedding-8B** | 8B | **75.22** | **68.71** | **90.43** | 58.57 | 87.52 | **51.56** | **69.44** | 88.58 | 34.83 |
### C-MTEB (MTEB Chinese)
| C-MTEB | Param. | Mean(Task) | Mean(Type) | Class. | Clust. | Pair Class. | Rerank. | Retr. | STS |
|------------------|--------|------------|------------|--------|--------|-------------|---------|-------|-------|
| multilingual-e5-large-instruct | 0.6B | 58.08 | 58.24 | 69.80 | 48.23 | 64.52 | 57.45 | 63.65 | 45.81 |
| bge-multilingual-gemma2 | 9B | 67.64 |68.52 | 75.31 | 59.30 | 86.67 | 68.28 | 73.73 | 55.19 |
| gte-Qwen2-1.5B-instruct | 1.5B | 67.12 | 67.79 | 72.53 | 54.61 | 79.5 | 68.21 | 71.86 | 60.05 |
| gte-Qwen2-7B-instruct | 7.6B | 71.62 | 72.19 | 75.77 | 66.06 | 81.16 | 69.24 | 75.70 | 65.20 |
| ritrieve_zh_v1 | 0.3B | 72.71 | 73.85 | 76.88 | 66.5 | **85.98** | **72.86** | 76.97 | **63.92** |
| **Qwen3-Embedding-0.6B** | 0.6B | 66.33 | 67.45 | 71.40 | 68.74 | 76.42 | 62.58 | 71.03 | 54.52 |
| **Qwen3-Embedding-4B** | 4B | 72.27 | 73.51 | 75.46 | 77.89 | 83.34 | 66.05 | 77.03 | 61.26 |
| **Qwen3-Embedding-8B** | 8B | **73.84** | **75.00** | **76.97** | **80.08** | 84.23 | 66.99 | **78.21** | 63.53 |
## Citation
If you find our work helpful, feel free to give us a cite.
```
@misc{qwen3-embedding,
title = {Qwen3-Embedding},
url = {https://qwenlm.github.io/blog/qwen3/},
author = {Qwen Team},
month = {May},
year = {2025}
}
```
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/Qwen2.5-Omni-3B-GGUF | Mungert | 2025-06-15T19:36:37Z | 1,307 | 2 | transformers | [
"transformers",
"gguf",
"multimodal",
"any-to-any",
"en",
"arxiv:2503.20215",
"license:other",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | any-to-any | 2025-06-10T12:18:40Z | ---
license: other
license_name: qwen-research
license_link: LICENSE
language:
- en
tags:
- multimodal
library_name: transformers
pipeline_tag: any-to-any
---
# <span style="color: #7FFF7F;">Qwen2.5-Omni-3B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`7f4fbe51`](https://github.com/ggerganov/llama.cpp/commit/7f4fbe5183b23b6b2e25fd1ccc5d1fa8bb010cb7).
## <span style="color: #7FFF7F;"> Quantization beyond the IMatrix</span>
Testing a new quantization method using rules to bump important layers above what the standard imatrix would use.
I have found that the standard IMatrix does not perform very well at low bit quantiztion and for MOE models. So I am using llama.cpp --tensor-type to bump up selected layers. See [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
This does create larger model files but increases precision for a given model size.
### **Please provide feedback on how you find this method performs**
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
# Qwen2.5-Omni
<a href="https://chat.qwen.ai/" target="_blank" style="margin: 2px;">
<img alt="Chat" src="https://img.shields.io/badge/%F0%9F%92%9C%EF%B8%8F%20Qwen%20Chat%20-536af5" style="display: inline-block; vertical-align: middle;"/>
</a>
## Overview
### Introduction
Qwen2.5-Omni is an end-to-end multimodal model designed to perceive diverse modalities, including text, images, audio, and video, while simultaneously generating text and natural speech responses in a streaming manner.
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/qwen_omni.png" width="80%"/>
<p>
### Key Features
* **Omni and Novel Architecture**: We propose Thinker-Talker architecture, an end-to-end multimodal model designed to perceive diverse modalities, including text, images, audio, and video, while simultaneously generating text and natural speech responses in a streaming manner. We propose a novel position embedding, named TMRoPE (Time-aligned Multimodal RoPE), to synchronize the timestamps of video inputs with audio.
* **Real-Time Voice and Video Chat**: Architecture designed for fully real-time interactions, supporting chunked input and immediate output.
* **Natural and Robust Speech Generation**: Surpassing many existing streaming and non-streaming alternatives, demonstrating superior robustness and naturalness in speech generation.
* **Strong Performance Across Modalities**: Exhibiting exceptional performance across all modalities when benchmarked against similarly sized single-modality models. Qwen2.5-Omni outperforms the similarly sized Qwen2-Audio in audio capabilities and achieves comparable performance to Qwen2.5-VL-7B.
* **Excellent End-to-End Speech Instruction Following**: Qwen2.5-Omni shows performance in end-to-end speech instruction following that rivals its effectiveness with text inputs, evidenced by benchmarks such as MMLU and GSM8K.
### Model Architecture
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/overview.png" width="80%"/>
<p>
### Performance
We conducted a comprehensive evaluation of Qwen2.5-Omni, which demonstrates strong performance across all modalities when compared to similarly sized single-modality models and closed-source models like Qwen2.5-VL-7B, Qwen2-Audio, and Gemini-1.5-pro. In tasks requiring the integration of multiple modalities, such as OmniBench, Qwen2.5-Omni achieves state-of-the-art performance. Furthermore, in single-modality tasks, it excels in areas including speech recognition (Common Voice), translation (CoVoST2), audio understanding (MMAU), image reasoning (MMMU, MMStar), video understanding (MVBench), and speech generation (Seed-tts-eval and subjective naturalness).
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/bar.png" width="80%"/>
<p>
<details>
<summary>Multimodality -> Text</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-0lax" rowspan="10">OmniBench<br>Speech | Sound Event | Music | Avg</td>
<td class="tg-0lax">Gemini-1.5-Pro</td>
<td class="tg-0lax">42.67%|42.26%|46.23%|42.91%</td>
</tr>
<tr>
<td class="tg-0lax">MIO-Instruct</td>
<td class="tg-0lax">36.96%|33.58%|11.32%|33.80%</td>
</tr>
<tr>
<td class="tg-0lax">AnyGPT (7B)</td>
<td class="tg-0lax">17.77%|20.75%|13.21%|18.04%</td>
</tr>
<tr>
<td class="tg-0lax">video-SALMONN</td>
<td class="tg-0lax">34.11%|31.70%|<strong>56.60%</strong>|35.64%</td>
</tr>
<tr>
<td class="tg-0lax">UnifiedIO2-xlarge</td>
<td class="tg-0lax">39.56%|36.98%|29.25%|38.00%</td>
</tr>
<tr>
<td class="tg-0lax">UnifiedIO2-xxlarge</td>
<td class="tg-0lax">34.24%|36.98%|24.53%|33.98%</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|-|40.50%</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">-|-|-|42.90%</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">52.14%|52.08%|52.83%|52.19%</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>55.25%</strong>|<strong>60.00%</strong>|52.83%|<strong>56.13%</strong></td>
</tr>
</tbody></table>
</details>
<details>
<summary>Audio -> Text</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-9j4x" colspan="3">ASR</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="12">Librispeech<br>dev-clean | dev other | test-clean | test-other</td>
<td class="tg-0lax">SALMONN</td>
<td class="tg-0lax">-|-|2.1|4.9</td>
</tr>
<tr>
<td class="tg-0lax">SpeechVerse</td>
<td class="tg-0lax">-|-|2.1|4.4</td>
</tr>
<tr>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">-|-|1.8|3.6</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-8B</td>
<td class="tg-0lax">-|-|-|3.4</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-70B</td>
<td class="tg-0lax">-|-|-|3.1</td>
</tr>
<tr>
<td class="tg-0lax">Seed-ASR-Multilingual</td>
<td class="tg-0lax">-|-|<strong>1.6</strong>|<strong>2.8</strong></td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|1.7|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">-|-|1.7|3.9</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">1.8|4.0|2.0|4.2</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax"><strong>1.3</strong>|<strong>3.4</strong>|<strong>1.6</strong>|3.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">2.0|4.1|2.2|4.5</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">1.6|3.5|1.8|3.4</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="5">Common Voice 15<br>en | zh | yue | fr</td>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">9.3|12.8|10.9|10.8</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">7.9|6.3|6.4|8.5</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">8.6|6.9|<strong>5.9</strong>|9.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">9.1|6.0|11.6|9.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>7.6</strong>|<strong>5.2</strong>|7.3|<strong>7.5</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="8">Fleurs<br>zh | en</td>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">7.7|4.1</td>
</tr>
<tr>
<td class="tg-0lax">Seed-ASR-Multilingual</td>
<td class="tg-0lax">-|<strong>3.4</strong></td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">10.8|-</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">4.4|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">3.0|3.8</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">7.5|-</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">3.2|5.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>3.0</strong>|4.1</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">Wenetspeech<br>test-net | test-meeting</td>
<td class="tg-0lax">Seed-ASR-Chinese</td>
<td class="tg-0lax"><strong>4.7|5.7</strong></td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">-|16.4</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">6.9|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">6.8|7.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">6.3|8.1</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">5.9|7.7</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="4">Voxpopuli-V1.0-en</td>
<td class="tg-0lax">Llama-3-8B</td>
<td class="tg-0lax">6.2</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-70B</td>
<td class="tg-0lax"><strong>5.7</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">6.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">5.8</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">S2TT</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">CoVoST2<br>en-de | de-en | en-zh | zh-en</td>
<td class="tg-0lax">SALMONN</td>
<td class="tg-0lax">18.6|-|33.1|-</td>
</tr>
<tr>
<td class="tg-0lax">SpeechLLaMA</td>
<td class="tg-0lax">-|27.1|-|12.3</td>
</tr>
<tr>
<td class="tg-0lax">BLSP</td>
<td class="tg-0lax">14.1|-|-|-</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|<strong>48.2</strong>|27.2</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">-|<strong>39.9</strong>|46.7|26.0</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">25.1|33.9|41.5|15.7</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">29.9|35.2|45.2|24.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">28.3|38.1|41.4|26.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>30.2</strong>|37.7|41.4|<strong>29.4</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">SER</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">Meld</td>
<td class="tg-0lax">WavLM-large</td>
<td class="tg-0lax">0.542</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">0.524</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">0.557</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">0.553</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.558</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.570</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">VSC</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">VocalSound</td>
<td class="tg-0lax">CLAP</td>
<td class="tg-0lax">0.495</td>
</tr>
<tr>
<td class="tg-0lax">Pengi</td>
<td class="tg-0lax">0.604</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">0.929</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax"><strong>0.939</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.936</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.939</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Music</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="3">GiantSteps Tempo</td>
<td class="tg-0lax">Llark-7B</td>
<td class="tg-0lax">0.86</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax"><strong>0.88</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.88</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="3">MusicCaps</td>
<td class="tg-0lax">LP-MusicCaps</td>
<td class="tg-0lax">0.291|0.149|0.089|<strong>0.061</strong>|0.129|0.130</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.325|<strong>0.163</strong>|<strong>0.093</strong>|0.057|<strong>0.132</strong>|<strong>0.229</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.328</strong>|0.162|0.090|0.055|0.127|0.225</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Audio Reasoning</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="4">MMAU<br>Sound | Music | Speech | Avg</td>
<td class="tg-0lax">Gemini-Pro-V1.5</td>
<td class="tg-0lax">56.75|49.40|58.55|54.90</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">54.95|50.98|42.04|49.20</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax"><strong>70.27</strong>|60.48|59.16|63.30</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">67.87|<strong>69.16|59.76|65.60</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Voice Chatting</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">VoiceBench<br>AlpacaEval | CommonEval | SD-QA | MMSU</td>
<td class="tg-0lax">Ultravox-v0.4.1-LLaMA-3.1-8B</td>
<td class="tg-0lax"><strong>4.55</strong>|3.90|53.35|47.17</td>
</tr>
<tr>
<td class="tg-0lax">MERaLiON</td>
<td class="tg-0lax">4.50|3.77|55.06|34.95</td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">3.50|2.95|25.95|27.03</td>
</tr>
<tr>
<td class="tg-0lax">Lyra-Base</td>
<td class="tg-0lax">3.85|3.50|38.25|49.74</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">4.42|<strong>4.15</strong>|50.72|54.78</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">4.50|4.05|43.40|57.25</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">3.74|3.43|35.71|35.72</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">4.32|4.00|49.37|50.23</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">4.49|3.93|<strong>55.71</strong>|<strong>61.32</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">VoiceBench<br>OpenBookQA | IFEval | AdvBench | Avg</td>
<td class="tg-0lax">Ultravox-v0.4.1-LLaMA-3.1-8B</td>
<td class="tg-0lax">65.27|<strong>66.88</strong>|98.46|71.45</td>
</tr>
<tr>
<td class="tg-0lax">MERaLiON</td>
<td class="tg-0lax">27.23|62.93|94.81|62.91</td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">28.35|25.71|87.69|46.25</td>
</tr>
<tr>
<td class="tg-0lax">Lyra-Base</td>
<td class="tg-0lax">72.75|36.28|59.62|57.66</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">78.02|49.25|97.69|71.69</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">74.51|54.54|97.31|71.14</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">49.45|26.33|96.73|55.35</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">74.73|42.10|98.85|68.81</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>81.10</strong>|52.87|<strong>99.42</strong>|<strong>74.12</strong></td>
</tr>
</tbody></table>
</details>
<details>
<summary>Image -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Other Best | Qwen2.5-VL-7B | GPT-4o-mini |
|--------------------------------|--------------|------------|------------|---------------|-------------|
| MMMU<sub>val</sub> | 59.2 | 53.1 | 53.9 | 58.6 | **60.0** |
| MMMU-Pro<sub>overall</sub> | 36.6 | 29.7 | - | **38.3** | 37.6 |
| MathVista<sub>testmini</sub> | 67.9 | 59.4 | **71.9** | 68.2 | 52.5 |
| MathVision<sub>full</sub> | 25.0 | 20.8 | 23.1 | **25.1** | - |
| MMBench-V1.1-EN<sub>test</sub> | 81.8 | 77.8 | 80.5 | **82.6** | 76.0 |
| MMVet<sub>turbo</sub> | 66.8 | 62.1 | **67.5** | 67.1 | 66.9 |
| MMStar | **64.0** | 55.7 | **64.0** | 63.9 | 54.8 |
| MME<sub>sum</sub> | 2340 | 2117 | **2372** | 2347 | 2003 |
| MuirBench | 59.2 | 48.0 | - | **59.2** | - |
| CRPE<sub>relation</sub> | **76.5** | 73.7 | - | 76.4 | - |
| RealWorldQA<sub>avg</sub> | 70.3 | 62.6 | **71.9** | 68.5 | - |
| MME-RealWorld<sub>en</sub> | **61.6** | 55.6 | - | 57.4 | - |
| MM-MT-Bench | 6.0 | 5.0 | - | **6.3** | - |
| AI2D | 83.2 | 79.5 | **85.8** | 83.9 | - |
| TextVQA<sub>val</sub> | 84.4 | 79.8 | 83.2 | **84.9** | - |
| DocVQA<sub>test</sub> | 95.2 | 93.3 | 93.5 | **95.7** | - |
| ChartQA<sub>test Avg</sub> | 85.3 | 82.8 | 84.9 | **87.3** | - |
| OCRBench_V2<sub>en</sub> | **57.8** | 51.7 | - | 56.3 | - |
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Qwen2.5-VL-7B | Grounding DINO | Gemini 1.5 Pro |
|--------------------------|--------------|---------------|---------------|----------------|----------------|
| Refcoco<sub>val</sub> | 90.5 | 88.7 | 90.0 | **90.6** | 73.2 |
| Refcoco<sub>textA</sub> | **93.5** | 91.8 | 92.5 | 93.2 | 72.9 |
| Refcoco<sub>textB</sub> | 86.6 | 84.0 | 85.4 | **88.2** | 74.6 |
| Refcoco+<sub>val</sub> | 85.4 | 81.1 | 84.2 | **88.2** | 62.5 |
| Refcoco+<sub>textA</sub> | **91.0** | 87.5 | 89.1 | 89.0 | 63.9 |
| Refcoco+<sub>textB</sub> | **79.3** | 73.2 | 76.9 | 75.9 | 65.0 |
| Refcocog+<sub>val</sub> | **87.4** | 85.0 | 87.2 | 86.1 | 75.2 |
| Refcocog+<sub>test</sub> | **87.9** | 85.1 | 87.2 | 87.0 | 76.2 |
| ODinW | 42.4 | 39.2 | 37.3 | **55.0** | 36.7 |
| PointGrounding | 66.5 | 46.2 | **67.3** | - | - |
</details>
<details>
<summary>Video(without audio) -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Other Best | Qwen2.5-VL-7B | GPT-4o-mini |
|-----------------------------|--------------|------------|------------|---------------|-------------|
| Video-MME<sub>w/o sub</sub> | 64.3 | 62.0 | 63.9 | **65.1** | 64.8 |
| Video-MME<sub>w sub</sub> | **72.4** | 68.6 | 67.9 | 71.6 | - |
| MVBench | **70.3** | 68.7 | 67.2 | 69.6 | - |
| EgoSchema<sub>test</sub> | **68.6** | 61.4 | 63.2 | 65.0 | - |
</details>
<details>
<summary>Zero-shot Speech Generation</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-9j4x" colspan="3">Content Consistency</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="11">SEED<br>test-zh | test-en | test-hard </td>
<td class="tg-0lax">Seed-TTS_ICL</td>
<td class="tg-0lax">1.11 | 2.24 | 7.58</td>
</tr>
<tr>
<td class="tg-0lax">Seed-TTS_RL</td>
<td class="tg-0lax"><strong>1.00</strong> | 1.94 | <strong>6.42</strong></td>
</tr>
<tr>
<td class="tg-0lax">MaskGCT</td>
<td class="tg-0lax">2.27 | 2.62 | 10.27</td>
</tr>
<tr>
<td class="tg-0lax">E2_TTS</td>
<td class="tg-0lax">1.97 | 2.19 | -</td>
</tr>
<tr>
<td class="tg-0lax">F5-TTS</td>
<td class="tg-0lax">1.56 | <strong>1.83</strong> | 8.67</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2</td>
<td class="tg-0lax">1.45 | 2.57 | 6.83</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2-S</td>
<td class="tg-0lax">1.45 | 2.38 | 8.08</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_ICL</td>
<td class="tg-0lax">1.95 | 2.87 | 9.92</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_RL</td>
<td class="tg-0lax">1.58 | 2.51 | 7.86</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_ICL</td>
<td class="tg-0lax">1.70 | 2.72 | 7.97</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_RL</td>
<td class="tg-0lax">1.42 | 2.32 | 6.54</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Speaker Similarity</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="11">SEED<br>test-zh | test-en | test-hard </td>
<td class="tg-0lax">Seed-TTS_ICL</td>
<td class="tg-0lax">0.796 | 0.762 | 0.776</td>
</tr>
<tr>
<td class="tg-0lax">Seed-TTS_RL</td>
<td class="tg-0lax"><strong>0.801</strong> | <strong>0.766</strong> | <strong>0.782</strong></td>
</tr>
<tr>
<td class="tg-0lax">MaskGCT</td>
<td class="tg-0lax">0.774 | 0.714 | 0.748</td>
</tr>
<tr>
<td class="tg-0lax">E2_TTS</td>
<td class="tg-0lax">0.730 | 0.710 | -</td>
</tr>
<tr>
<td class="tg-0lax">F5-TTS</td>
<td class="tg-0lax">0.741 | 0.647 | 0.713</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2</td>
<td class="tg-0lax">0.748 | 0.652 | 0.724</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2-S</td>
<td class="tg-0lax">0.753 | 0.654 | 0.732</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_ICL</td>
<td class="tg-0lax">0.741 | 0.635 | 0.748</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_RL</td>
<td class="tg-0lax">0.744 | 0.635 | 0.746</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_ICL</td>
<td class="tg-0lax">0.752 | 0.632 | 0.747</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_RL</td>
<td class="tg-0lax">0.754 | 0.641 | 0.752</td>
</tr>
</tbody></table>
</details>
<details>
<summary>Text -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Qwen2.5-7B | Qwen2.5-3B | Qwen2-7B | Llama3.1-8B | Gemma2-9B |
|-----------------------------------|-----------|------------|------------|------------|------------|-------------|-----------|
| MMLU-Pro | 47.0 | 40.4 | **56.3** | 43.7 | 44.1 | 48.3 | 52.1 |
| MMLU-redux | 71.0 | 60.9 | **75.4** | 64.4 | 67.3 | 67.2 | 72.8 |
| LiveBench<sub>0831</sub> | 29.6 | 22.3 | **35.9** | 26.8 | 29.2 | 26.7 | 30.6 |
| GPQA | 30.8 | 34.3 | **36.4** | 30.3 | 34.3 | 32.8 | 32.8 |
| MATH | 71.5 | 63.6 | **75.5** | 65.9 | 52.9 | 51.9 | 44.3 |
| GSM8K | 88.7 | 82.6 | **91.6** | 86.7 | 85.7 | 84.5 | 76.7 |
| HumanEval | 78.7 | 70.7 | **84.8** | 74.4 | 79.9 | 72.6 | 68.9 |
| MBPP | 73.2 | 70.4 | **79.2** | 72.7 | 67.2 | 69.6 | 74.9 |
| MultiPL-E | 65.8 | 57.6 | **70.4** | 60.2 | 59.1 | 50.7 | 53.4 |
| LiveCodeBench<sub>2305-2409</sub> | 24.6 | 16.5 | **28.7** | 19.9 | 23.9 | 8.3 | 18.9 |
</details>
## Quickstart
Below, we provide simple examples to show how to use Qwen2.5-Omni with 🤗 Transformers. The codes of Qwen2.5-Omni has been in the latest Hugging face transformers and we advise you to build from source with command:
```
pip uninstall transformers
pip install git+https://github.com/huggingface/[email protected]
pip install accelerate
```
or you might encounter the following error:
```
KeyError: 'qwen2_5_omni'
```
We offer a toolkit to help you handle various types of audio and visual input more conveniently, as if you were using an API. This includes base64, URLs, and interleaved audio, images and videos. You can install it using the following command and make sure your system has `ffmpeg` installed:
```bash
# It's highly recommended to use `[decord]` feature for faster video loading.
pip install qwen-omni-utils[decord] -U
```
If you are not using Linux, you might not be able to install `decord` from PyPI. In that case, you can use `pip install qwen-omni-utils -U` which will fall back to using torchvision for video processing. However, you can still [install decord from source](https://github.com/dmlc/decord?tab=readme-ov-file#install-from-source) to get decord used when loading video.
### 🤗 Transformers Usage
Here we show a code snippet to show you how to use the chat model with `transformers` and `qwen_omni_utils`:
```python
import soundfile as sf
from transformers import Qwen2_5OmniForConditionalGeneration, Qwen2_5OmniProcessor
from qwen_omni_utils import process_mm_info
# default: Load the model on the available device(s)
model = Qwen2_5OmniForConditionalGeneration.from_pretrained("Qwen/Qwen2.5-Omni-3B", torch_dtype="auto", device_map="auto")
# We recommend enabling flash_attention_2 for better acceleration and memory saving.
# model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
# "Qwen/Qwen2.5-Omni-3B",
# torch_dtype="auto",
# device_map="auto",
# attn_implementation="flash_attention_2",
# )
processor = Qwen2_5OmniProcessor.from_pretrained("Qwen/Qwen2.5-Omni-3B")
conversation = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "video", "video": "https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/draw.mp4"},
],
},
]
# set use audio in video
USE_AUDIO_IN_VIDEO = True
# Preparation for inference
text = processor.apply_chat_template(conversation, add_generation_prompt=True, tokenize=False)
audios, images, videos = process_mm_info(conversation, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt", padding=True, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = inputs.to(model.device).to(model.dtype)
# Inference: Generation of the output text and audio
text_ids, audio = model.generate(**inputs, use_audio_in_video=USE_AUDIO_IN_VIDEO)
text = processor.batch_decode(text_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)
print(text)
sf.write(
"output.wav",
audio.reshape(-1).detach().cpu().numpy(),
samplerate=24000,
)
```
<details>
<summary>Minimum GPU memory requirements</summary>
|Model | Precision | 15(s) Video | 30(s) Video | 60(s) Video |
|--------------|-----------| ------------- | ------------- | ------------------ |
| Qwen-Omni-3B | FP32 | 89.10 GB | Not Recommend | Not Recommend |
| Qwen-Omni-3B | BF16 | 18.38 GB | 22.43 GB | 28.22 GB |
| Qwen-Omni-7B | FP32 | 93.56 GB | Not Recommend | Not Recommend |
| Qwen-Omni-7B | BF16 | 31.11 GB | 41.85 GB | 60.19 GB |
Note: The table above presents the theoretical minimum memory requirements for inference with `transformers` and `BF16` is test with `attn_implementation="flash_attention_2"`; however, in practice, the actual memory usage is typically at least 1.2 times higher. For more information, see the linked resource [here](https://huggingface.co/docs/accelerate/main/en/usage_guides/model_size_estimator).
</details>
<details>
<summary>Video URL resource usage</summary>
Video URL compatibility largely depends on the third-party library version. The details are in the table below. Change the backend by `FORCE_QWENVL_VIDEO_READER=torchvision` or `FORCE_QWENVL_VIDEO_READER=decord` if you prefer not to use the default one.
| Backend | HTTP | HTTPS |
|-------------|------|-------|
| torchvision >= 0.19.0 | ✅ | ✅ |
| torchvision < 0.19.0 | ❌ | ❌ |
| decord | ✅ | ❌ |
</details>
<details>
<summary>Batch inference</summary>
The model can batch inputs composed of mixed samples of various types such as text, images, audio and videos as input when `return_audio=False` is set. Here is an example.
```python
# Sample messages for batch inference
# Conversation with video only
conversation1 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "video", "video": "/path/to/video.mp4"},
]
}
]
# Conversation with audio only
conversation2 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "audio", "audio": "/path/to/audio.wav"},
]
}
]
# Conversation with pure text
conversation3 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": "who are you?"
}
]
# Conversation with mixed media
conversation4 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "image", "image": "/path/to/image.jpg"},
{"type": "video", "video": "/path/to/video.mp4"},
{"type": "audio", "audio": "/path/to/audio.wav"},
{"type": "text", "text": "What are the elements can you see and hear in these medias?"},
],
}
]
# Combine messages for batch processing
conversations = [conversation1, conversation2, conversation3, conversation4]
# set use audio in video
USE_AUDIO_IN_VIDEO = True
# Preparation for batch inference
text = processor.apply_chat_template(conversations, add_generation_prompt=True, tokenize=False)
audios, images, videos = process_mm_info(conversations, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt", padding=True, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = inputs.to(model.device).to(model.dtype)
# Batch Inference
text_ids = model.generate(**inputs, use_audio_in_video=USE_AUDIO_IN_VIDEO, return_audio=False)
text = processor.batch_decode(text_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)
print(text)
```
</details>
### Usage Tips
#### Prompt for audio output
If users need audio output, the system prompt must be set as "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech.", otherwise the audio output may not work as expected.
```
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
}
```
#### Use audio in video
In the process of multimodal interaction, the videos provided by users are often accompanied by audio (such as questions about the content in the video, or sounds generated by certain events in the video). This information is conducive to the model providing a better interactive experience. So we provide the following options for users to decide whether to use audio in video.
```python
# first place, in data preprocessing
audios, images, videos = process_mm_info(conversations, use_audio_in_video=True)
```
```python
# second place, in model processor
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt",
padding=True, use_audio_in_video=True)
```
```python
# third place, in model inference
text_ids, audio = model.generate(**inputs, use_audio_in_video=True)
```
It is worth noting that during a multi-round conversation, the `use_audio_in_video` parameter in these places must be set to the same, otherwise unexpected results will occur.
#### Use audio output or not
The model supports both text and audio outputs, if users do not need audio outputs, they can call `model.disable_talker()` after init the model. This option will save about `~2GB` of GPU memory but the `return_audio` option for `generate` function will only allow to be set at `False`.
```python
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-3B",
torch_dtype="auto",
device_map="auto"
)
model.disable_talker()
```
In order to obtain a flexible experience, we recommend that users can decide whether to return audio when `generate` function is called. If `return_audio` is set to `False`, the model will only return text outputs to get text responses faster.
```python
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-3B",
torch_dtype="auto",
device_map="auto"
)
...
text_ids = model.generate(**inputs, return_audio=False)
```
#### Change voice type of output audio
Qwen2.5-Omni supports the ability to change the voice of the output audio. The `"Qwen/Qwen2.5-Omni-3B"` checkpoint support two voice types as follow:
| Voice Type | Gender | Description |
|------------|--------|-------------|
| Chelsie | Female | A honeyed, velvety voice that carries a gentle warmth and luminous clarity.|
| Ethan | Male | A bright, upbeat voice with infectious energy and a warm, approachable vibe.|
Users can use the `speaker` parameter of `generate` function to specify the voice type. By default, if `speaker` is not specified, the default voice type is `Chelsie`.
```python
text_ids, audio = model.generate(**inputs, speaker="Chelsie")
```
```python
text_ids, audio = model.generate(**inputs, speaker="Ethan")
```
#### Flash-Attention 2 to speed up generation
First, make sure to install the latest version of Flash Attention 2:
```bash
pip install -U flash-attn --no-build-isolation
```
Also, you should have hardware that is compatible with FlashAttention 2. Read more about it in the official documentation of the [flash attention repository](https://github.com/Dao-AILab/flash-attention). FlashAttention-2 can only be used when a model is loaded in `torch.float16` or `torch.bfloat16`.
To load and run a model using FlashAttention-2, add `attn_implementation="flash_attention_2"` when loading the model:
```python
from transformers import Qwen2_5OmniForConditionalGeneration
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-3B",
device_map="auto",
torch_dtype=torch.bfloat16,
attn_implementation="flash_attention_2",
)
```
## Citation
If you find our paper and code useful in your research, please consider giving a star :star: and citation :pencil: :)
```BibTeX
@article{Qwen2.5-Omni,
title={Qwen2.5-Omni Technical Report},
author={Jin Xu, Zhifang Guo, Jinzheng He, Hangrui Hu, Ting He, Shuai Bai, Keqin Chen, Jialin Wang, Yang Fan, Kai Dang, Bin Zhang, Xiong Wang, Yunfei Chu, Junyang Lin},
journal={arXiv preprint arXiv:2503.20215},
year={2025}
}
```
<br>
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Peacemann/Qwen_QwQ-32B_LMUL | Peacemann | 2025-06-15T19:36:36Z | 0 | 0 | null | [
"qwen2",
"L-Mul,",
"optimazation",
"quantization",
"text-generation",
"research",
"experimental",
"conversational",
"base_model:Qwen/QwQ-32B",
"base_model:finetune:Qwen/QwQ-32B",
"license:apache-2.0",
"region:us"
] | text-generation | 2025-06-15T19:33:06Z | ---
license: apache-2.0
base_model: Qwen/QwQ-32B
tags:
- L-Mul,
- optimazation
- quantization
- text-generation
- research
- experimental
---
# Model Card for Qwen/QwQ-32B-LMUL
This model is a derivative of `Qwen/QwQ-32B`, modified to use a custom attention mechanism defined by the `l_mul_attention` function from the `lmul` library.
## Model Details
- **Original Model:** [Qwen/QwQ-32B](https://huggingface.co/Qwen/QwQ-32B)
- **Architecture:** qwen2
- **Modification:** The `forward` method of the `Qwen2Attention` module has been replaced (monkey-patched) with a custom implementation that utilizes the `l_mul_attention` logic.
## Scientific Rationale
This model was modified as part of a research project investigating alternative attention mechanisms in large language models. The `l_mul_attention` function implements a novel approach to calculating attention scores, and this model serves as a test case for evaluating its performance, efficiency, and impact on reasoning and generation tasks compared to the standard attention implementation.
By releasing this model, we hope to encourage further research into non-standard attention mechanisms and provide a practical example for the community to build upon.
## How to Get Started
You can use this model with the standard `transformers` library pipeline. Ensure you have `transformers`, `torch`, and `accelerate` installed.
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
# Make sure to log in with your Hugging Face token if the model is private
# from huggingface_hub import login
# login("your-hf-token")
model_id = "YOUR_HF_USERNAME/QwQ-32B_LMUL" # Replace with your Hugging Face username
device = "cuda" if torch.cuda.is_available() else "cpu"
tokenizer = AutoTokenizer.from_pretrained(model_id)
model = AutoModelForCausalLM.from_pretrained(
model_id,
torch_dtype=torch.bfloat16,
device_map="auto"
)
prompt = "How many r's are in the word \"strawberry\""
messages = [
{"role": "user", "content": prompt}
]
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True
)
model_inputs = tokenizer([text], return_tensors="pt").to(model.device)
generated_ids = model.generate(
**model_inputs,
max_new_tokens=512
)
generated_ids = [
output_ids[len(input_ids):] for input_ids, output_ids in zip(model_inputs.input_ids, generated_ids)
]
response = tokenizer.batch_decode(generated_ids, skip_special_tokens=True)[0]
print(response)
```
## Intended Uses & Limitations
This model is intended primarily for research purposes. Its performance on standard benchmarks has not been fully evaluated. The custom attention mechanism may introduce unexpected behaviors or limitations not present in the original `Qwen/QwQ-32B` model.
## Licensing Information
This model is released under the `apache-2.0` license, which is the same license as the base model, `Qwen/QwQ-32B`. By using this model, you agree to the terms of the original license. It is your responsibility to ensure compliance with all applicable licenses and regulations. |
Mungert/SmolVLM-Instruct-GGUF | Mungert | 2025-06-15T19:36:32Z | 1,023 | 2 | transformers | [
"transformers",
"gguf",
"image-text-to-text",
"en",
"dataset:HuggingFaceM4/the_cauldron",
"dataset:HuggingFaceM4/Docmatix",
"arxiv:2504.05299",
"base_model:HuggingFaceTB/SmolLM2-1.7B-Instruct",
"base_model:quantized:HuggingFaceTB/SmolLM2-1.7B-Instruct",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | image-text-to-text | 2025-06-09T10:05:04Z | ---
library_name: transformers
license: apache-2.0
datasets:
- HuggingFaceM4/the_cauldron
- HuggingFaceM4/Docmatix
pipeline_tag: image-text-to-text
language:
- en
base_model:
- HuggingFaceTB/SmolLM2-1.7B-Instruct
- google/siglip-so400m-patch14-384
---
# <span style="color: #7FFF7F;">SmolVLM-Instruct GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`5787b5da`](https://github.com/ggerganov/llama.cpp/commit/5787b5da57e54dba760c2deeac1edf892e8fc450).
## <span style="color: #7FFF7F;"> Quantization beyond the IMatrix</span>
Testing a new quantization method using rules to bump important layers above what the standard imatrix would use.
I have found that the standard IMatrix does not perform very well at low bit quantiztion and for MOE models. So I am using llama.cpp --tensor-type to bump up selected layers. See [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
This does create larger model files but increases precision for a given model size.
### **Please provide feedback on how you find this method performs**
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
<img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/SmolVLM.png" width="800" height="auto" alt="Image description">
# SmolVLM
SmolVLM is a compact open multimodal model that accepts arbitrary sequences of image and text inputs to produce text outputs. Designed for efficiency, SmolVLM can answer questions about images, describe visual content, create stories grounded on multiple images, or function as a pure language model without visual inputs. Its lightweight architecture makes it suitable for on-device applications while maintaining strong performance on multimodal tasks.
## Model Summary
- **Developed by:** Hugging Face 🤗
- **Model type:** Multi-modal model (image+text)
- **Language(s) (NLP):** English
- **License:** Apache 2.0
- **Architecture:** Based on [Idefics3](https://huggingface.co/HuggingFaceM4/Idefics3-8B-Llama3) (see technical summary)
## Resources
- **Demo:** [SmolVLM Demo](https://huggingface.co/spaces/HuggingFaceTB/SmolVLM)
- **Blog:** [Blog post](https://huggingface.co/blog/smolvlm)
## Uses
SmolVLM can be used for inference on multimodal (image + text) tasks where the input comprises text queries along with one or more images. Text and images can be interleaved arbitrarily, enabling tasks like image captioning, visual question answering, and storytelling based on visual content. The model does not support image generation.
To fine-tune SmolVLM on a specific task, you can follow the fine-tuning tutorial.
<!-- todo: add link to fine-tuning tutorial -->
### Technical Summary
SmolVLM leverages the lightweight SmolLM2 language model to provide a compact yet powerful multimodal experience. It introduces several changes compared to previous Idefics models:
- **Image compression:** We introduce a more radical image compression compared to Idefics3 to enable the model to infer faster and use less RAM.
- **Visual Token Encoding:** SmolVLM uses 81 visual tokens to encode image patches of size 384×384. Larger images are divided into patches, each encoded separately, enhancing efficiency without compromising performance.
More details about the training and architecture are available in our technical report.
### How to get started
You can use transformers to load, infer and fine-tune SmolVLM.
```python
import torch
from PIL import Image
from transformers import AutoProcessor, AutoModelForVision2Seq
from transformers.image_utils import load_image
DEVICE = "cuda" if torch.cuda.is_available() else "cpu"
# Load images
image1 = load_image("https://cdn.britannica.com/61/93061-050-99147DCE/Statue-of-Liberty-Island-New-York-Bay.jpg")
image2 = load_image("https://huggingface.co/spaces/merve/chameleon-7b/resolve/main/bee.jpg")
# Initialize processor and model
processor = AutoProcessor.from_pretrained("HuggingFaceTB/SmolVLM-Instruct")
model = AutoModelForVision2Seq.from_pretrained(
"HuggingFaceTB/SmolVLM-Instruct",
torch_dtype=torch.bfloat16,
_attn_implementation="flash_attention_2" if DEVICE == "cuda" else "eager",
).to(DEVICE)
# Create input messages
messages = [
{
"role": "user",
"content": [
{"type": "image"},
{"type": "image"},
{"type": "text", "text": "Can you describe the two images?"}
]
},
]
# Prepare inputs
prompt = processor.apply_chat_template(messages, add_generation_prompt=True)
inputs = processor(text=prompt, images=[image1, image2], return_tensors="pt")
inputs = inputs.to(DEVICE)
# Generate outputs
generated_ids = model.generate(**inputs, max_new_tokens=500)
generated_texts = processor.batch_decode(
generated_ids,
skip_special_tokens=True,
)
print(generated_texts[0])
"""
Assistant: The first image shows a green statue of the Statue of Liberty standing on a stone pedestal in front of a body of water.
The statue is holding a torch in its right hand and a tablet in its left hand. The water is calm and there are no boats or other objects visible.
The sky is clear and there are no clouds. The second image shows a bee on a pink flower.
The bee is black and yellow and is collecting pollen from the flower. The flower is surrounded by green leaves.
"""
```
### Model optimizations
**Precision**: For better performance, load and run the model in half-precision (`torch.float16` or `torch.bfloat16`) if your hardware supports it.
```python
from transformers import AutoModelForVision2Seq
import torch
model = AutoModelForVision2Seq.from_pretrained(
"HuggingFaceTB/SmolVLM-Instruct",
torch_dtype=torch.bfloat16
).to("cuda")
```
You can also load SmolVLM with 4/8-bit quantization using bitsandbytes, torchao or Quanto. Refer to [this page](https://huggingface.co/docs/transformers/en/main_classes/quantization) for other options.
```python
from transformers import AutoModelForVision2Seq, BitsAndBytesConfig
import torch
quantization_config = BitsAndBytesConfig(load_in_8bit=True)
model = AutoModelForVision2Seq.from_pretrained(
"HuggingFaceTB/SmolVLM-Instruct",
quantization_config=quantization_config,
)
```
**Vision Encoder Efficiency**: Adjust the image resolution by setting `size={"longest_edge": N*384}` when initializing the processor, where N is your desired value. The default `N=4` works well, which results in input images of
size 1536×1536. For documents, `N=5` might be beneficial. Decreasing N can save GPU memory and is appropriate for lower-resolution images. This is also useful if you want to fine-tune on videos.
## Misuse and Out-of-scope Use
SmolVLM is not intended for high-stakes scenarios or critical decision-making processes that affect an individual's well-being or livelihood. The model may produce content that appears factual but may not be accurate. Misuse includes, but is not limited to:
- Prohibited Uses:
- Evaluating or scoring individuals (e.g., in employment, education, credit)
- Critical automated decision-making
- Generating unreliable factual content
- Malicious Activities:
- Spam generation
- Disinformation campaigns
- Harassment or abuse
- Unauthorized surveillance
### License
SmolVLM is built upon [the shape-optimized SigLIP](https://huggingface.co/google/siglip-so400m-patch14-384) as image encoder and [SmolLM2](https://huggingface.co/HuggingFaceTB/SmolLM2-1.7B-Instruct) for text decoder part.
We release the SmolVLM checkpoints under the Apache 2.0 license.
## Training Details
### Training Data
The training data comes from [The Cauldron](https://huggingface.co/datasets/HuggingFaceM4/the_cauldron) and [Docmatix](https://huggingface.co/datasets/HuggingFaceM4/Docmatix) datasets, with emphasis on document understanding (25%) and image captioning (18%), while maintaining balanced coverage across other crucial capabilities like visual reasoning, chart comprehension, and general instruction following.
<img src="https://huggingface.co/HuggingFaceTB/SmolVLM-Instruct/resolve/main/mixture_the_cauldron.png" alt="Example Image" style="width:90%;" />
## Evaluation
| Model | MMMU (val) | MathVista (testmini) | MMStar (val) | DocVQA (test) | TextVQA (val) | Min GPU RAM required (GB) |
|-------------------|------------|----------------------|--------------|---------------|---------------|---------------------------|
| SmolVLM | 38.8 | 44.6 | 42.1 | 81.6 | 72.7 | 5.02 |
| Qwen-VL 2B | 41.1 | 47.8 | 47.5 | 90.1 | 79.7 | 13.70 |
| InternVL2 2B | 34.3 | 46.3 | 49.8 | 86.9 | 73.4 | 10.52 |
| PaliGemma 3B 448px| 34.9 | 28.7 | 48.3 | 32.2 | 56.0 | 6.72 |
| moondream2 | 32.4 | 24.3 | 40.3 | 70.5 | 65.2 | 3.87 |
| MiniCPM-V-2 | 38.2 | 39.8 | 39.1 | 71.9 | 74.1 | 7.88 |
| MM1.5 1B | 35.8 | 37.2 | 0.0 | 81.0 | 72.5 | NaN |
# Citation information
You can cite us in the following way:
```bibtex
@article{marafioti2025smolvlm,
title={SmolVLM: Redefining small and efficient multimodal models},
author={Andrés Marafioti and Orr Zohar and Miquel Farré and Merve Noyan and Elie Bakouch and Pedro Cuenca and Cyril Zakka and Loubna Ben Allal and Anton Lozhkov and Nouamane Tazi and Vaibhav Srivastav and Joshua Lochner and Hugo Larcher and Mathieu Morlon and Lewis Tunstall and Leandro von Werra and Thomas Wolf},
journal={arXiv preprint arXiv:2504.05299},
year={2025}
}
```
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/Qwen3-Reranker-0.6B-GGUF | Mungert | 2025-06-15T19:36:22Z | 1,207 | 2 | transformers | [
"transformers",
"gguf",
"base_model:Qwen/Qwen3-0.6B-Base",
"base_model:quantized:Qwen/Qwen3-0.6B-Base",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-06-06T10:49:55Z | ---
license: apache-2.0
base_model:
- Qwen/Qwen3-0.6B-Base
library_name: transformers
---
# <span style="color: #7FFF7F;">Qwen3-Reranker-0.6B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`d17a809e`](https://github.com/ggerganov/llama.cpp/commit/d17a809ef0af09b16625e991a76f6fe80d9c332e).
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
# Qwen3-Reranker-0.6B
<p align="center">
<img src="https://qianwen-res.oss-accelerate-overseas.aliyuncs.com/logo_qwen3.png" width="400"/>
<p>
## Highlights
The Qwen3 Embedding model series is the latest proprietary model of the Qwen family, specifically designed for text embedding and ranking tasks. Building upon the dense foundational models of the Qwen3 series, it provides a comprehensive range of text embeddings and reranking models in various sizes (0.6B, 4B, and 8B). This series inherits the exceptional multilingual capabilities, long-text understanding, and reasoning skills of its foundational model. The Qwen3 Embedding series represents significant advancements in multiple text embedding and ranking tasks, including text retrieval, code retrieval, text classification, text clustering, and bitext mining.
**Exceptional Versatility**: The embedding model has achieved state-of-the-art performance across a wide range of downstream application evaluations. The 8B size embedding model ranks No.1 in the MTEB multilingual leaderboard (as of June 5, 2025, score 70.58), while the reranking model excels in various text retrieval scenarios.
**Comprehensive Flexibility**: The Qwen3 Embedding series offers a full spectrum of sizes (from 0.6B to 8B) for both embedding and reranking models, catering to diverse use cases that prioritize efficiency and effectiveness. Developers can seamlessly combine these two modules. Additionally, the embedding model allows for flexible vector definitions across all dimensions, and both embedding and reranking models support user-defined instructions to enhance performance for specific tasks, languages, or scenarios.
**Multilingual Capability**: The Qwen3 Embedding series offer support for over 100 languages, thanks to the multilingual capabilites of Qwen3 models. This includes various programming languages, and provides robust multilingual, cross-lingual, and code retrieval capabilities.
## Model Overview
**Qwen3-Reranker-0.6B** has the following features:
- Model Type: Text Reranking
- Supported Languages: 100+ Languages
- Number of Paramaters: 0.6B
- Context Length: 32k
For more details, including benchmark evaluation, hardware requirements, and inference performance, please refer to our [blog](https://qwenlm.github.io/blog/qwen3-embedding/), [GitHub](https://github.com/QwenLM/Qwen3-Embedding).
## Qwen3 Embedding Series Model list
| Model Type | Models | Size | Layers | Sequence Length | Embedding Dimension | MRL Support | Instruction Aware |
|------------------|----------------------|------|--------|-----------------|---------------------|-------------|----------------|
| Text Embedding | [Qwen3-Embedding-0.6B](https://huggingface.co/Qwen/Qwen3-Embedding-0.6B) | 0.6B | 28 | 32K | 1024 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-4B](https://huggingface.co/Qwen/Qwen3-Embedding-4B) | 4B | 36 | 32K | 2560 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-8B](https://huggingface.co/Qwen/Qwen3-Embedding-8B) | 8B | 36 | 32K | 4096 | Yes | Yes |
| Text Reranking | [Qwen3-Reranker-0.6B](https://huggingface.co/Qwen/Qwen3-Reranker-0.6B) | 0.6B | 28 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-4B](https://huggingface.co/Qwen/Qwen3-Reranker-4B) | 4B | 36 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-8B](https://huggingface.co/Qwen/Qwen3-Reranker-8B) | 8B | 36 | 32K | - | - | Yes |
> **Note**:
> - `MRL Support` indicates whether the embedding model supports custom dimensions for the final embedding.
> - `Instruction Aware` notes whether the embedding or reranking model supports customizing the input instruction according to different tasks.
> - Our evaluation indicates that, for most downstream tasks, using instructions (instruct) typically yields an improvement of 1% to 5% compared to not using them. Therefore, we recommend that developers create tailored instructions specific to their tasks and scenarios. In multilingual contexts, we also advise users to write their instructions in English, as most instructions utilized during the model training process were originally written in English.
## Usage
With Transformers versions earlier than 4.51.0, you may encounter the following error:
```
KeyError: 'qwen3'
```
### Transformers Usage
```python
# Requires transformers>=4.51.0
import torch
from transformers import AutoModel, AutoTokenizer, AutoModelForCausalLM
def format_instruction(instruction, query, doc):
if instruction is None:
instruction = 'Given a web search query, retrieve relevant passages that answer the query'
output = "<Instruct>: {instruction}\n<Query>: {query}\n<Document>: {doc}".format(instruction=instruction,query=query, doc=doc)
return output
def process_inputs(pairs):
inputs = tokenizer(
pairs, padding=False, truncation='longest_first',
return_attention_mask=False, max_length=max_length - len(prefix_tokens) - len(suffix_tokens)
)
for i, ele in enumerate(inputs['input_ids']):
inputs['input_ids'][i] = prefix_tokens + ele + suffix_tokens
inputs = tokenizer.pad(inputs, padding=True, return_tensors="pt", max_length=max_length)
for key in inputs:
inputs[key] = inputs[key].to(model.device)
return inputs
@torch.no_grad()
def compute_logits(inputs, **kwargs):
batch_scores = model(**inputs).logits[:, -1, :]
true_vector = batch_scores[:, token_true_id]
false_vector = batch_scores[:, token_false_id]
batch_scores = torch.stack([false_vector, true_vector], dim=1)
batch_scores = torch.nn.functional.log_softmax(batch_scores, dim=1)
scores = batch_scores[:, 1].exp().tolist()
return scores
tokenizer = AutoTokenizer.from_pretrained("Qwen/Qwen3-Reranker-0.6B", padding_side='left')
model = AutoModelForCausalLM.from_pretrained("Qwen/Qwen3-Reranker-0.6B").eval()
# We recommend enabling flash_attention_2 for better acceleration and memory saving.
# model = AutoModelForCausalLM.from_pretrained("Qwen/Qwen3-Reranker-0.6B", torch_dtype=torch.float16, attn_implementation="flash_attention_2").cuda().eval()
token_false_id = tokenizer.convert_tokens_to_ids("no")
token_true_id = tokenizer.convert_tokens_to_ids("yes")
max_length = 8192
prefix = "<|im_start|>system\nJudge whether the Document meets the requirements based on the Query and the Instruct provided. Note that the answer can only be \"yes\" or \"no\".<|im_end|>\n<|im_start|>user\n"
suffix = "<|im_end|>\n<|im_start|>assistant\n<think>\n\n</think>\n\n"
prefix_tokens = tokenizer.encode(prefix, add_special_tokens=False)
suffix_tokens = tokenizer.encode(suffix, add_special_tokens=False)
task = 'Given a web search query, retrieve relevant passages that answer the query'
queries = ["What is the capital of China?",
"Explain gravity",
]
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun.",
]
pairs = [format_instruction(task, query, doc) for query, doc in zip(queries, documents)]
# Tokenize the input texts
inputs = process_inputs(pairs)
scores = compute_logits(inputs)
print("scores: ", scores)
```
### vLLM Usage
```python
# Requires vllm>=0.8.5
import logging
from typing import Dict, Optional, List
import json
import logging
import torch
from transformers import AutoTokenizer, is_torch_npu_available
from vllm import LLM, SamplingParams
from vllm.distributed.parallel_state import destroy_model_parallel
import gc
import math
from vllm.inputs.data import TokensPrompt
def format_instruction(instruction, query, doc):
text = [
{"role": "system", "content": "Judge whether the Document meets the requirements based on the Query and the Instruct provided. Note that the answer can only be \"yes\" or \"no\"."},
{"role": "user", "content": f"<Instruct>: {instruction}\n\n<Query>: {query}\n\n<Document>: {doc}"}
]
return text
def process_inputs(pairs, instruction, max_length, suffix_tokens):
messages = [format_instruction(instruction, query, doc) for query, doc in pairs]
messages = tokenizer.apply_chat_template(
messages, tokenize=True, add_generation_prompt=False, enable_thinking=False
)
messages = [ele[:max_length] + suffix_tokens for ele in messages]
messages = [TokensPrompt(prompt_token_ids=ele) for ele in messages]
return messages
def compute_logits(model, messages, sampling_params, true_token, false_token):
outputs = model.generate(messages, sampling_params, use_tqdm=False)
scores = []
for i in range(len(outputs)):
final_logits = outputs[i].outputs[0].logprobs[-1]
token_count = len(outputs[i].outputs[0].token_ids)
if true_token not in final_logits:
true_logit = -10
else:
true_logit = final_logits[true_token].logprob
if false_token not in final_logits:
false_logit = -10
else:
false_logit = final_logits[false_token].logprob
true_score = math.exp(true_logit)
false_score = math.exp(false_logit)
score = true_score / (true_score + false_score)
scores.append(score)
return scores
number_of_gpu = torch.cuda.device_count()
tokenizer = AutoTokenizer.from_pretrained('Qwen/Qwen3-Reranker-0.6B')
model = LLM(model='Qwen/Qwen3-Reranker-0.6B', tensor_parallel_size=number_of_gpu, max_model_len=10000, enable_prefix_caching=True, gpu_memory_utilization=0.8)
tokenizer.padding_side = "left"
tokenizer.pad_token = tokenizer.eos_token
suffix = "<|im_end|>\n<|im_start|>assistant\n<think>\n\n</think>\n\n"
max_length=8192
suffix_tokens = tokenizer.encode(suffix, add_special_tokens=False)
true_token = tokenizer("yes", add_special_tokens=False).input_ids[0]
false_token = tokenizer("no", add_special_tokens=False).input_ids[0]
sampling_params = SamplingParams(temperature=0,
max_tokens=1,
logprobs=20,
allowed_token_ids=[true_token, false_token],
)
task = 'Given a web search query, retrieve relevant passages that answer the query'
queries = ["What is the capital of China?",
"Explain gravity",
]
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun.",
]
pairs = list(zip(queries, documents))
inputs = process_inputs(pairs, task, max_length-len(suffix_tokens), suffix_tokens)
scores = compute_logits(model, inputs, sampling_params, true_token, false_token)
print('scores', scores)
destroy_model_parallel()
```
📌 **Tip**: We recommend that developers customize the `instruct` according to their specific scenarios, tasks, and languages. Our tests have shown that in most retrieval scenarios, not using an `instruct` on the query side can lead to a drop in retrieval performance by approximately 1% to 5%.
## Evaluation
| Model | Param | MTEB-R | CMTEB-R | MMTEB-R | MLDR | MTEB-Code | FollowIR |
|------------------------------------|--------|---------|---------|---------|--------|-----------|----------|
| **Qwen3-Embedding-0.6B** | 0.6B | 61.82 | 71.02 | 64.64 | 50.26 | 75.41 | 5.09 |
| Jina-multilingual-reranker-v2-base | 0.3B | 58.22 | 63.37 | 63.73 | 39.66 | 58.98 | -0.68 |
| gte-multilingual-reranker-base | 0.3B | 59.51 | 74.08 | 59.44 | 66.33 | 54.18 | -1.64 |
| BGE-reranker-v2-m3 | 0.6B | 57.03 | 72.16 | 58.36 | 59.51 | 41.38 | -0.01 |
| **Qwen3-Reranker-0.6B** | 0.6B | 65.80 | 71.31 | 66.36 | 67.28 | 73.42 | 5.41 |
| **Qwen3-Reranker-4B** | 1.7B | **69.76** | 75.94 | 72.74 | 69.97 | 81.20 | **14.84** |
| **Qwen3-Reranker-8B** | 8B | 69.02 | **77.45** | **72.94** | **70.19** | **81.22** | 8.05 |
> **Note**:
> - Evaluation results for reranking models. We use the retrieval subsets of MTEB(eng, v2), MTEB(cmn, v1), MMTEB and MTEB (Code), which are MTEB-R, CMTEB-R, MMTEB-R and MTEB-Code.
> - All scores are our runs based on the top-100 candidates retrieved by dense embedding model [Qwen3-Embedding-0.6B](https://huggingface.co/Qwen/Qwen3-Embedding-0.6B).
## Citation
If you find our work helpful, feel free to give us a cite.
```
@misc{qwen3-embedding,
title = {Qwen3-Embedding},
url = {https://qwenlm.github.io/blog/qwen3/},
author = {Qwen Team},
month = {May},
year = {2025}
}
``` |
Mungert/llama-joycaption-beta-one-hf-llava-GGUF | Mungert | 2025-06-15T19:36:02Z | 3,922 | 3 | transformers | [
"transformers",
"gguf",
"captioning",
"image-text-to-text",
"base_model:google/siglip2-so400m-patch14-384",
"base_model:quantized:google/siglip2-so400m-patch14-384",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | image-text-to-text | 2025-06-08T03:11:55Z | ---
base_model:
- meta-llama/Llama-3.1-8B-Instruct
- google/siglip2-so400m-patch14-384
tags:
- captioning
pipeline_tag: image-text-to-text
library_name: transformers
---
# <span style="color: #7FFF7F;">llama-joycaption-beta-one-hf-llava GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`5787b5da`](https://github.com/ggerganov/llama.cpp/commit/5787b5da57e54dba760c2deeac1edf892e8fc450).
## <span style="color: #7FFF7F;"> Quantization beyond the IMatrix</span>
Testing a new quantization method using rules to bump important layers above what the standard imatrix would use.
I have found that the standard IMatrix does not perform very well at low bit quantiztion and for MOE models. So I am using llama.cpp --tensor-type to bump up selected layers. See [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
This does create larger model files but increases precision for a given model size.
### **Please provide feedback on how you find this method performs**
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
# Model Card for Llama JoyCaption Beta One
[Github](https://github.com/fpgaminer/joycaption)
JoyCaption is an image captioning Visual Language Model (VLM) built from the ground up as a free, open, and uncensored model for the community to use in training Diffusion models.
Key Features:
- **Free and Open**: Always released for free, open weights, no restrictions, and just like [bigASP](https://www.reddit.com/r/StableDiffusion/comments/1dbasvx/the_gory_details_of_finetuning_sdxl_for_30m/), will come with training scripts and lots of juicy details on how it gets built.
- **Uncensored**: Equal coverage of SFW and NSFW concepts. No "cylindrical shaped object with a white substance coming out on it" here.
- **Diversity**: All are welcome here. Do you like digital art? Photoreal? Anime? Furry? JoyCaption is for everyone. Pains are being taken to ensure broad coverage of image styles, content, ethnicity, gender, orientation, etc.
- **Minimal Filtering**: JoyCaption is trained on large swathes of images so that it can understand almost all aspects of our world. almost. Illegal content will never be tolerated in JoyCaption's training.
## Motivation
Automated descriptive captions enable the training and finetuning of diffusion models on a wider range of images, since trainers are no longer required to either find images with already associated text or write the descriptions themselves. They also improve the quality of generations produced by Text-to-Image models trained on them (ref: DALL-E 3 paper). But to-date, the community has been stuck with ChatGPT, which is expensive and heavily censored; or alternative models, like CogVLM, which are weaker than ChatGPT and have abysmal performance outside of the SFW domain.
I'm building JoyCaption to help fill this gap by performing near or on-par with GPT4o in captioning images, while being free, unrestricted, and open.
## How to Get Started with the Model
Please see the [Github](https://github.com/fpgaminer/joycaption) for more details.
Example usage:
```
import torch
from PIL import Image
from transformers import AutoProcessor, LlavaForConditionalGeneration
IMAGE_PATH = "image.jpg"
PROMPT = "Write a long descriptive caption for this image in a formal tone."
MODEL_NAME = "fancyfeast/llama-joycaption-beta-one-hf-llava"
# Load JoyCaption
# bfloat16 is the native dtype of the LLM used in JoyCaption (Llama 3.1)
# device_map=0 loads the model into the first GPU
processor = AutoProcessor.from_pretrained(MODEL_NAME)
llava_model = LlavaForConditionalGeneration.from_pretrained(MODEL_NAME, torch_dtype="bfloat16", device_map=0)
llava_model.eval()
with torch.no_grad():
# Load image
image = Image.open(IMAGE_PATH)
# Build the conversation
convo = [
{
"role": "system",
"content": "You are a helpful image captioner.",
},
{
"role": "user",
"content": PROMPT,
},
]
# Format the conversation
# WARNING: HF's handling of chat's on Llava models is very fragile. This specific combination of processor.apply_chat_template(), and processor() works
# but if using other combinations always inspect the final input_ids to ensure they are correct. Often times you will end up with multiple <bos> tokens
# if not careful, which can make the model perform poorly.
convo_string = processor.apply_chat_template(convo, tokenize = False, add_generation_prompt = True)
assert isinstance(convo_string, str)
# Process the inputs
inputs = processor(text=[convo_string], images=[image], return_tensors="pt").to('cuda')
inputs['pixel_values'] = inputs['pixel_values'].to(torch.bfloat16)
# Generate the captions
generate_ids = llava_model.generate(
**inputs,
max_new_tokens=512,
do_sample=True,
suppress_tokens=None,
use_cache=True,
temperature=0.6,
top_k=None,
top_p=0.9,
)[0]
# Trim off the prompt
generate_ids = generate_ids[inputs['input_ids'].shape[1]:]
# Decode the caption
caption = processor.tokenizer.decode(generate_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)
caption = caption.strip()
print(caption)
```
## vLLM
vLLM provides the highest performance inference for JoyCaption, and an OpenAI compatible API so JoyCaption can be used like any other VLMs. Example usage:
```
vllm serve fancyfeast/llama-joycaption-beta-one-hf-llava --max-model-len 4096 --enable-prefix-caching
```
VLMs are a bit finicky on vLLM, and vLLM is memory hungry, so you may have to adjust settings for your particular environment, such as forcing eager mode, adjusting max-model-len, adjusting gpu_memory_utilization, etc.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/medgemma-27b-text-it-GGUF | Mungert | 2025-06-15T19:35:58Z | 2,840 | 6 | transformers | [
"transformers",
"gguf",
"medical",
"clinical-reasoning",
"thinking",
"text-generation",
"arxiv:2501.19393",
"arxiv:2303.15343",
"arxiv:2009.13081",
"arxiv:2102.09542",
"arxiv:2411.15640",
"arxiv:2404.05590",
"arxiv:2501.18362",
"base_model:google/gemma-3-27b-pt",
"base_model:quantized:google/gemma-3-27b-pt",
"license:other",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-05-29T06:32:42Z | ---
license: other
license_name: health-ai-developer-foundations
license_link: https://developers.google.com/health-ai-developer-foundations/terms
library_name: transformers
pipeline_tag: text-generation
extra_gated_heading: Access MedGemma on Hugging Face
extra_gated_prompt: >-
To access MedGemma on Hugging Face, you're required to review and agree to
[Health AI Developer Foundation's terms of
use](https://developers.google.com/health-ai-developer-foundations/terms). To
do this, please ensure you're logged in to Hugging Face and click below.
Requests are processed immediately.
extra_gated_button_content: Acknowledge license
base_model: google/gemma-3-27b-pt
tags:
- medical
- clinical-reasoning
- thinking
---
# <span style="color: #7FFF7F;">medgemma-27b-text-it GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`f5cd27b7`](https://github.com/ggerganov/llama.cpp/commit/f5cd27b71da3ac375a04a41643d14fc779a8057b).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `medgemma-27b-text-it-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `medgemma-27b-text-it-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `medgemma-27b-text-it-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `medgemma-27b-text-it-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `medgemma-27b-text-it-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `medgemma-27b-text-it-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `medgemma-27b-text-it-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `medgemma-27b-text-it-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `medgemma-27b-text-it-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `medgemma-27b-text-it-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `medgemma-27b-text-it-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
# MedGemma model card
**Model documentation:** [MedGemma](https://developers.google.com/health-ai-developer-foundations/medgemma)
**Resources:**
* Model on Google Cloud Model Garden: [MedGemma](https://console.cloud.google.com/vertex-ai/publishers/google/model-garden/medgemma)
* Model on Hugging Face: [MedGemma](https://huggingface.co/collections/google/medgemma-release-680aade845f90bec6a3f60c4)
* GitHub repository (supporting code, Colab notebooks, discussions, and
issues): [MedGemma](https://github.com/google-health/medgemma)
* Quick start notebook: [GitHub](https://github.com/google-health/medgemma/blob/main/notebooks/quick_start_with_hugging_face.ipynb)
* Fine-tuning notebook: [GitHub](https://github.com/google-health/medgemma/blob/main/notebooks/fine_tune_with_hugging_face.ipynb)
* [Patient Education Demo built using MedGemma](https://huggingface.co/spaces/google/rad_explain)
* Support: See [Contact](https://developers.google.com/health-ai-developer-foundations/medgemma/get-started.md#contact)
* License: The use of MedGemma is governed by the [Health AI Developer
Foundations terms of
use](https://developers.google.com/health-ai-developer-foundations/terms).
**Author:** Google
## Model information
This section describes the MedGemma model and how to use it.
### Description
MedGemma is a collection of [Gemma 3](https://ai.google.dev/gemma/docs/core)
variants that are trained for performance on medical text and image
comprehension. Developers can use MedGemma to accelerate building
healthcare-based AI applications. MedGemma currently comes in two variants: a 4B
multimodal version and a 27B text-only version.
MedGemma 27B has been trained exclusively on medical text and optimized for
inference-time computation. MedGemma 27B is only available as an
instruction-tuned model.
MedGemma variants have been evaluated on a range of clinically relevant
benchmarks to illustrate their baseline performance. These include both open
benchmark datasets and curated datasets. Developers can fine-tune MedGemma
variants for improved performance. Consult the Intended Use section below for
more details.
A full technical report will be available soon.
### How to use
Below are some example code snippets to help you quickly get started running the
model locally on GPU. If you want to use the model at scale, we recommend that
you create a production version using [Model
Garden](https://cloud.google.com/model-garden).
First, install the Transformers library. Gemma 3 is supported starting from
transformers 4.50.0.
```sh
$ pip install -U transformers
```
**Run model with the `pipeline` API**
```python
from transformers import pipeline
import torch
pipe = pipeline(
"text-generation",
model="google/medgemma-27b-text-it",
torch_dtype=torch.bfloat16,
device="cuda",
)
messages = [
{
"role": "system",
"content": "You are a helpful medical assistant."
},
{
"role": "user",
"content": "How do you differentiate bacterial from viral pneumonia?"
}
]
output = pipe(text=messages, max_new_tokens=200)
print(output[0]["generated_text"][-1]["content"])
```
**Run the model directly**
```python
# pip install accelerate
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
model_id = "google/medgemma-27b-text-it"
model = AutoModelForCausalLM.from_pretrained(
model_id,
torch_dtype=torch.bfloat16,
device_map="auto",
)
tokenizer = AutoTokenizer.from_pretrained(model_id)
messages = [
{
"role": "system",
"content": "You are a helpful medical assistant."
},
{
"role": "user",
"content": "How do you differentiate bacterial from viral pneumonia?"
}
]
inputs = tokenizer.apply_chat_template(
messages,
add_generation_prompt=True,
tokenize=True,
return_dict=True,
return_tensors="pt",
).to(model.device)
input_len = inputs["input_ids"].shape[-1]
with torch.inference_mode():
generation = model.generate(**inputs, max_new_tokens=200, do_sample=False)
generation = generation[0][input_len:]
decoded = tokenizer.decode(generation, skip_special_tokens=True)
print(decoded)
```
### Examples
See the following Colab notebooks for examples of how to use MedGemma:
* To give the model a quick try, running it locally with weights from Hugging
Face, see [Quick start notebook in
Colab](https://colab.research.google.com/github/google-health/medgemma/blob/main/notebooks/quick_start_with_hugging_face.ipynb).
Note that you will need to use Colab Enterprise to run the 27B model without
quantization.
* For an example of fine-tuning the model, see the [Fine-tuning notebook in
Colab](https://colab.research.google.com/github/google-health/medgemma/blob/main/notebooks/fine_tune_with_hugging_face.ipynb).
### Model architecture overview
The MedGemma model is built based on [Gemma 3](https://ai.google.dev/gemma/) and
uses the same decoder-only transformer architecture as Gemma 3. To read more
about the architecture, consult the Gemma 3 [model
card](https://ai.google.dev/gemma/docs/core/model_card_3).
### Technical specifications
* **Model type**: Decoder-only Transformer architecture, see the [Gemma 3
technical
report](https://storage.googleapis.com/deepmind-media/gemma/Gemma3Report.pdf)
* **Modalities**: **4B**: Text, vision; **27B**: Text only
* **Attention mechanism**: Utilizes grouped-query attention (GQA)
* **Context length**: Supports long context, at least 128K tokens
* **Key publication**: Coming soon
* **Model created**: May 20, 2025
* **Model version**: 1.0.0
### Citation
A technical report is coming soon. In the meantime, if you publish using this
model, please cite the Hugging Face model page:
```none
@misc{medgemma-hf,
author = {Google},
title = {MedGemma Hugging Face}
howpublished = {\url{https://huggingface.co/collections/google/medgemma-release-680aade845f90bec6a3f60c4}},
year = {2025},
note = {Accessed: [Insert Date Accessed, e.g., 2025-05-20]}
}
```
### Inputs and outputs
**Input**:
* Text string, such as a question or prompt
* Total input length of 128K tokens
**Output**:
* Generated text in response to the input, such as an answer to a question,
analysis of image content, or a summary of a document
* Total output length of 8192 tokens
### Performance and validation
MedGemma was evaluated across a range of different multimodal classification,
report generation, visual question answering, and text-based tasks.
### Key performance metrics
#### Text evaluations
MedGemma 4B and text-only MedGemma 27B were evaluated across a range of
text-only benchmarks for medical knowledge and reasoning.
The MedGemma models outperform their respective base Gemma models across all
tested text-only health benchmarks.
| Metric | MedGemma 27B | Gemma 3 27B | MedGemma 4B | Gemma 3 4B |
| :---- | :---- | :---- | :---- | :---- |
| MedQA (4-op) | 89.8 (best-of-5) 87.7 (0-shot) | 74.9 | 64.4 | 50.7 |
| MedMCQA | 74.2 | 62.6 | 55.7 | 45.4 |
| PubMedQA | 76.8 | 73.4 | 73.4 | 68.4 |
| MMLU Med (text only) | 87.0 | 83.3 | 70.0 | 67.2 |
| MedXpertQA (text only) | 26.7 | 15.7 | 14.2 | 11.6 |
| AfriMed-QA | 84.0 | 72.0 | 52.0 | 48.0 |
For all MedGemma 27B results, [test-time
scaling](https://arxiv.org/abs/2501.19393) is used to improve performance.
### Ethics and safety evaluation
#### Evaluation approach
Our evaluation methods include structured evaluations and internal red-teaming
testing of relevant content policies. Red-teaming was conducted by a number of
different teams, each with different goals and human evaluation metrics. These
models were evaluated against a number of different categories relevant to
ethics and safety, including:
* **Child safety**: Evaluation of text-to-text and image-to-text prompts
covering child safety policies, including child sexual abuse and
exploitation.
* **Content safety:** Evaluation of text-to-text and image-to-text prompts
covering safety policies, including harassment, violence and gore, and hate
speech.
* **Representational harms**: Evaluation of text-to-text and image-to-text
prompts covering safety policies, including bias, stereotyping, and harmful
associations or inaccuracies.
* **General medical harms:** Evaluation of text-to-text and image-to-text
prompts covering safety policies, including information quality and harmful
associations or inaccuracies.
In addition to development level evaluations, we conduct "assurance evaluations"
which are our "arms-length" internal evaluations for responsibility governance
decision making. They are conducted separately from the model development team,
to inform decision making about release. High-level findings are fed back to the
model team, but prompt sets are held out to prevent overfitting and preserve the
results' ability to inform decision making. Notable assurance evaluation results
are reported to our Responsibility & Safety Council as part of release review.
#### Evaluation results
For all areas of safety testing, we saw safe levels of performance across the
categories of child safety, content safety, and representational harms. All
testing was conducted without safety filters to evaluate the model capabilities
and behaviors. For text-to-text, image-to-text, and audio-to-text, and across
both MedGemma model sizes, the model produced minimal policy violations. A
limitation of our evaluations was that they included primarily English language
prompts.
## Data card
### Dataset overview
#### Training
The base Gemma models are pre-trained on a large corpus of text and code data.
MedGemma 4B utilizes a [SigLIP](https://arxiv.org/abs/2303.15343) image encoder
that has been specifically pre-trained on a variety of de-identified medical
data, including radiology images, histopathology images, ophthalmology images,
and dermatology images. Its LLM component is trained on a diverse set of medical
data, including medical text relevant to radiology images, chest-x rays,
histopathology patches, ophthalmology images and dermatology images.
#### Evaluation
MedGemma models have been evaluated on a comprehensive set of clinically
relevant benchmarks, including over 22 datasets across 5 different tasks and 6
medical image modalities. These include both open benchmark datasets and curated
datasets, with a focus on expert human evaluations for tasks like CXR report
generation and radiology VQA.
#### Source
MedGemma utilizes a combination of public and private datasets.
This model was trained on diverse public datasets including MIMIC-CXR (chest
X-rays and reports), Slake-VQA (multimodal medical images and questions),
PAD-UFES-20 (skin lesion images and data), SCIN (dermatology images), TCGA
(cancer genomics data), CAMELYON (lymph node histopathology images), PMC-OA
(biomedical literature with images), and Mendeley Digital Knee X-Ray (knee
X-rays).
Additionally, multiple diverse proprietary datasets were licensed and
incorporated (described next).
### Data Ownership and Documentation
* [Mimic-CXR](https://physionet.org/content/mimic-cxr/2.1.0/): MIT Laboratory
for Computational Physiology and Beth Israel Deaconess Medical Center
(BIDMC).
* [Slake-VQA](https://www.med-vqa.com/slake/): The Hong Kong Polytechnic
University (PolyU), with collaborators including West China Hospital of
Sichuan University and Sichuan Academy of Medical Sciences / Sichuan
Provincial People's Hospital.
* [PAD-UFES-20](https://pmc.ncbi.nlm.nih.gov/articles/PMC7479321/): Federal
University of Espírito Santo (UFES), Brazil, through its Dermatological and
Surgical Assistance Program (PAD).
* [SCIN](https://github.com/google-research-datasets/scin): A collaboration
between Google Health and Stanford Medicine.
* [TCGA](https://portal.gdc.cancer.gov/) (The Cancer Genome Atlas): A joint
effort of National Cancer Institute and National Human Genome Research
Institute. Data from TCGA are available via the Genomic Data Commons (GDC)
* [CAMELYON](https://camelyon17.grand-challenge.org/Data/): The data was
collected from Radboud University Medical Center and University Medical
Center Utrecht in the Netherlands.
* [PMC-OA (PubMed Central Open Access
Subset)](https://catalog.data.gov/dataset/pubmed-central-open-access-subset-pmc-oa):
Maintained by the National Library of Medicine (NLM) and National Center for
Biotechnology Information (NCBI), which are part of the NIH.
* [MedQA](https://arxiv.org/pdf/2009.13081): This dataset was created by a
team of researchers led by Di Jin, Eileen Pan, Nassim Oufattole, Wei-Hung
Weng, Hanyi Fang, and Peter Szolovits
* [Mendeley Digital Knee
X-Ray](https://data.mendeley.com/datasets/t9ndx37v5h/1): This dataset is
from Rani Channamma University, and is hosted on Mendeley Data.
* [AfriMed-QA](https://afrimedqa.com/): This data was developed and led by
multiple collaborating organizations and researchers include key
contributors: Intron Health, SisonkeBiotik, BioRAMP, Georgia Institute of
Technology, and MasakhaneNLP.
* [VQA-RAD](https://www.nature.com/articles/sdata2018251): This dataset was
created by a research team led by Jason J. Lau, Soumya Gayen, Asma Ben
Abacha, and Dina Demner-Fushman and their affiliated institutions (the US
National Library of Medicine and National Institutes of Health)
* [MedExpQA](https://www.sciencedirect.com/science/article/pii/S0933365724001805):
This dataset was created by researchers at the HiTZ Center (Basque Center
for Language Technology and Artificial Intelligence).
* [MedXpertQA](https://huggingface.co/datasets/TsinghuaC3I/MedXpertQA): This
dataset was developed by researchers at Tsinghua University (Beijing, China)
and Shanghai Artificial Intelligence Laboratory (Shanghai, China).
In addition to the public datasets listed above, MedGemma was also trained on
de-identified datasets licensed for research or collected internally at Google
from consented participants.
* Radiology dataset 1: De-identified dataset of different CT studies across
body parts from a US-based radiology outpatient diagnostic center network.
* Ophthalmology dataset 1: De-identified dataset of fundus images from
diabetic retinopathy screening.
* Dermatology dataset 1: De-identified dataset of teledermatology skin
condition images (both clinical and dermatoscopic) from Colombia.
* Dermatology dataset 2: De-identified dataset of skin cancer images (both
clinical and dermatoscopic) from Australia.
* Dermatology dataset 3: De-identified dataset of non-diseased skin images
from an internal data collection effort.
* Pathology dataset 1: De-identified dataset of histopathology H&E whole slide
images created in collaboration with an academic research hospital and
biobank in Europe. Comprises de-identified colon, prostate, and lymph nodes.
* Pathology dataset 2: De-identified dataset of lung histopathology H&E and
IHC whole slide images created by a commercial biobank in the United States.
* Pathology dataset 3: De-identified dataset of prostate and lymph node H&E
and IHC histopathology whole slide images created by a contract research
organization in the United States.
* Pathology dataset 4: De-identified dataset of histopathology, predominantly
H\&E whole slide images created in collaboration with a large, tertiary
teaching hospital in the United States. Comprises a diverse set of tissue
and stain types, predominantly H&E.
### Data citation
* **MIMIC-CXR** Johnson, A., Pollard, T., Mark, R., Berkowitz, S., & Horng, S.
(2024). MIMIC-CXR Database (version 2.1.0). PhysioNet.
https://physionet.org/content/mimic-cxr/2.1.0/
*and* Johnson, Alistair E. W., Tom J. Pollard, Seth J. Berkowitz, Nathaniel R.
Greenbaum, Matthew P. Lungren, Chih-Ying Deng, Roger G. Mark, and Steven
Horng. 2019. "MIMIC-CXR, a de-Identified Publicly Available Database of
Chest Radiographs with Free-Text Reports." *Scientific Data 6* (1): 1–8.
* **SLAKE** Liu, Bo, Li-Ming Zhan, Li Xu, Lin Ma, Yan Yang, and Xiao-Ming Wu.
2021.SLAKE: A Semantically-Labeled Knowledge-Enhanced Dataset for Medical
Visual Question Answering." http://arxiv.org/abs/2102.09542.
* **PAD-UEFS** Pacheco, A. G. C., Lima, G. R., Salomao, A., Krohling, B.,
Biral, I. P., de Angelo, G. G., Alves, F. O. G., Ju X. M., & P. R. C.
(2020). PAD-UFES-20: A skin lesion dataset composed of patient data and
clinical images collected from smartphones. In *Proceedings of the 2020 IEEE
International Conference on Bioinformatics and Biomedicine (BIBM)* (pp.
1551-1558). IEEE. https://doi.org/10.1109/BIBM49941.2020.9313241
* **SCIN** Ward, Abbi, Jimmy Li, Julie Wang, Sriram Lakshminarasimhan, Ashley
Carrick, Bilson Campana, Jay Hartford, et al. 2024. "Creating an Empirical
Dermatology Dataset Through Crowdsourcing With Web Search Advertisements."
*JAMA Network Open 7* (11): e2446615–e2446615.
* **TCGA** The results shown here are in whole or part based upon data
generated by the TCGA Research Network: https://www.cancer.gov/tcga.
* **CAMELYON16** Ehteshami Bejnordi, Babak, Mitko Veta, Paul Johannes van
Diest, Bram van Ginneken, Nico Karssemeijer, Geert Litjens, Jeroen A. W. M.
van der Laak, et al. 2017. "Diagnostic Assessment of Deep Learning
Algorithms for Detection of Lymph Node Metastases in Women With Breast
Cancer." *JAMA 318* (22): 2199–2210.
* **MedQA** Jin, Di, Eileen Pan, Nassim Oufattole, Wei-Hung Weng, Hanyi Fang,
and Peter Szolovits. 2020. "What Disease Does This Patient Have? A
Large-Scale Open Domain Question Answering Dataset from Medical Exams."
http://arxiv.org/abs/2009.13081.
* **Mendeley Digital Knee X-Ray** Gornale, Shivanand; Patravali, Pooja (2020),
"Digital Knee X-ray Images", Mendeley Data, V1, doi: 10.17632/t9ndx37v5h.1
* **AfrimedQA** Olatunji, Tobi, Charles Nimo, Abraham Owodunni, Tassallah
Abdullahi, Emmanuel Ayodele, Mardhiyah Sanni, Chinemelu Aka, et al. 2024.
"AfriMed-QA: A Pan-African, Multi-Specialty, Medical Question-Answering
Benchmark Dataset." http://arxiv.org/abs/2411.15640.
* **VQA-RAD** Lau, Jason J., Soumya Gayen, Asma Ben Abacha, and Dina
Demner-Fushman. 2018. "A Dataset of Clinically Generated Visual Questions
and Answers about Radiology Images." *Scientific Data 5* (1): 1–10.
* **MedexpQA** Alonso, I., Oronoz, M., & Agerri, R. (2024). MedExpQA:
Multilingual Benchmarking of Large Language Models for Medical Question
Answering. *arXiv preprint arXiv:2404.05590*. Retrieved from
https://arxiv.org/abs/2404.05590
* **MedXpertQA** Zuo, Yuxin, Shang Qu, Yifei Li, Zhangren Chen, Xuekai Zhu,
Ermo Hua, Kaiyan Zhang, Ning Ding, and Bowen Zhou. 2025. "MedXpertQA:
Benchmarking Expert-Level Medical Reasoning and Understanding."
http://arxiv.org/abs/2501.18362.
### De-identification/anonymization:
Google and partnerships utilize datasets that have been rigorously anonymized or
de-identified to ensure the protection of individual research participants and
patient privacy
## Implementation information
Details about the model internals.
### Software
Training was done using [JAX](https://github.com/jax-ml/jax).
JAX allows researchers to take advantage of the latest generation of hardware,
including TPUs, for faster and more efficient training of large models.
## Use and limitations
### Intended use
MedGemma is an open multimodal generative AI model intended to be used as a
starting point that enables more efficient development of downstream healthcare
applications involving medical text and images. MedGemma is intended for
developers in the life sciences and healthcare space. Developers are responsible
for training, adapting and making meaningful changes to MedGemma to accomplish
their specific intended use. MedGemma models can be fine-tuned by developers
using their own proprietary data for their specific tasks or solutions.
MedGemma is based on Gemma 3 and has been further trained on medical images and
text. MedGemma enables further development in any medical context (image and
textual), however the model was pre-trained using chest X-ray, pathology,
dermatology, and fundus images. Examples of tasks within MedGemma's training
include visual question answering pertaining to medical images, such as
radiographs, or providing answers to textual medical questions. Full details of
all the tasks MedGemma has been evaluated can be found in an upcoming technical
report.
### Benefits
* Provides strong baseline medical image and text comprehension for models of
its size.
* This strong performance makes it efficient to adapt for downstream
healthcare-based use cases, compared to models of similar size without
medical data pre-training.
* This adaptation may involve prompt engineering, grounding, agentic
orchestration or fine-tuning depending on the use case, baseline validation
requirements, and desired performance characteristics.
### Limitations
MedGemma is not intended to be used without appropriate validation, adaptation
and/or making meaningful modification by developers for their specific use case.
The outputs generated by MedGemma are not intended to directly inform clinical
diagnosis, patient management decisions, treatment recommendations, or any other
direct clinical practice applications. Performance benchmarks highlight baseline
capabilities on relevant benchmarks, but even for image and text domains that
constitute a substantial portion of training data, inaccurate model output is
possible. All outputs from MedGemma should be considered preliminary and require
independent verification, clinical correlation, and further investigation
through established research and development methodologies.
MedGemma's multimodal capabilities have been primarily evaluated on single-image
tasks. MedGemma has not been evaluated in use cases that involve comprehension
of multiple images.
MedGemma has not been evaluated or optimized for multi-turn applications.
MedGemma's training may make it more sensitive to the specific prompt used than
Gemma 3.
When adapting MedGemma developer should consider the following:
* **Bias in validation data:** As with any research, developers should ensure
that any downstream application is validated to understand performance using
data that is appropriately representative of the intended use setting for
the specific application (e.g., age, sex, gender, condition, imaging device,
etc).
* **Data contamination concerns**: When evaluating the generalization
capabilities of a large model like MedGemma in a medical context, there is a
risk of data contamination, where the model might have inadvertently seen
related medical information during its pre-training, potentially
overestimating its true ability to generalize to novel medical concepts.
Developers should validate MedGemma on datasets not publicly available or
otherwise made available to non-institutional researchers to mitigate this
risk. |
Mungert/Qwen3-4B-abliterated-GGUF | Mungert | 2025-06-15T19:35:51Z | 5,363 | 15 | transformers | [
"transformers",
"gguf",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-04-30T03:07:52Z | ---
library_name: transformers
tags: []
---
# <span style="color: #7FFF7F;">Qwen3-4B-abliterated GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`19e899c`](https://github.com/ggerganov/llama.cpp/commit/19e899ce21a7c9ffcf8bb2b22269a75f6e078f8f).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Qwen3-4B-abliterated-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Qwen3-4B-abliterated-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Qwen3-4B-abliterated-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Qwen3-4B-abliterated-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Qwen3-4B-abliterated-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Qwen3-4B-abliterated-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Qwen3-4B-abliterated-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Qwen3-4B-abliterated-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Qwen3-4B-abliterated-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Qwen3-4B-abliterated-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Qwen3-4B-abliterated-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Yukang/Qwen2.5-3B-Open-R1-GRPO | Yukang | 2025-06-15T19:35:49Z | 6 | 0 | transformers | [
"transformers",
"safetensors",
"qwen2",
"text-generation",
"generated_from_trainer",
"open-r1",
"trl",
"grpo",
"conversational",
"dataset:open-r1/OpenR1-Math-220k",
"arxiv:2402.03300",
"base_model:Qwen/Qwen2.5-3B-Instruct",
"base_model:finetune:Qwen/Qwen2.5-3B-Instruct",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-12T20:31:17Z | ---
base_model: Qwen/Qwen2.5-3B-Instruct
datasets: open-r1/OpenR1-Math-220k
library_name: transformers
model_name: Qwen2.5-3B-Open-R1-GRPO
tags:
- generated_from_trainer
- open-r1
- trl
- grpo
licence: license
---
# Model Card for Qwen2.5-3B-Open-R1-GRPO
This model is a fine-tuned version of [Qwen/Qwen2.5-3B-Instruct](https://huggingface.co/Qwen/Qwen2.5-3B-Instruct) on the [open-r1/OpenR1-Math-220k](https://huggingface.co/datasets/open-r1/OpenR1-Math-220k) dataset.
It has been trained using [TRL](https://github.com/huggingface/trl).
## Quick start
```python
from transformers import pipeline
question = "If you had a time machine, but could only go to the past or the future once and never return, which would you choose and why?"
generator = pipeline("text-generation", model="Yukang/Qwen2.5-3B-Open-R1-GRPO", device="cuda")
output = generator([{"role": "user", "content": question}], max_new_tokens=128, return_full_text=False)[0]
print(output["generated_text"])
```
## Training procedure
[<img src="https://raw.githubusercontent.com/wandb/assets/main/wandb-github-badge-28.svg" alt="Visualize in Weights & Biases" width="150" height="24"/>](https://wandb.ai/chenyukang2020-nvidia/huggingface/runs/9wwsfr8r)
This model was trained with GRPO, a method introduced in [DeepSeekMath: Pushing the Limits of Mathematical Reasoning in Open Language Models](https://huggingface.co/papers/2402.03300).
### Framework versions
- TRL: 0.18.0
- Transformers: 4.52.3
- Pytorch: 2.6.0
- Datasets: 3.6.0
- Tokenizers: 0.21.1
## Citations
Cite GRPO as:
```bibtex
@article{zhihong2024deepseekmath,
title = {{DeepSeekMath: Pushing the Limits of Mathematical Reasoning in Open Language Models}},
author = {Zhihong Shao and Peiyi Wang and Qihao Zhu and Runxin Xu and Junxiao Song and Mingchuan Zhang and Y. K. Li and Y. Wu and Daya Guo},
year = 2024,
eprint = {arXiv:2402.03300},
}
```
Cite TRL as:
```bibtex
@misc{vonwerra2022trl,
title = {{TRL: Transformer Reinforcement Learning}},
author = {Leandro von Werra and Younes Belkada and Lewis Tunstall and Edward Beeching and Tristan Thrush and Nathan Lambert and Shengyi Huang and Kashif Rasul and Quentin Gallou{\'e}dec},
year = 2020,
journal = {GitHub repository},
publisher = {GitHub},
howpublished = {\url{https://github.com/huggingface/trl}}
}
``` |
Mungert/Magistral-Small-2506-GGUF | Mungert | 2025-06-15T19:35:48Z | 1,730 | 6 | vllm | [
"vllm",
"gguf",
"en",
"fr",
"de",
"es",
"pt",
"it",
"ja",
"ko",
"ru",
"zh",
"ar",
"fa",
"id",
"ms",
"ne",
"pl",
"ro",
"sr",
"sv",
"tr",
"uk",
"vi",
"hi",
"bn",
"base_model:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"base_model:quantized:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"license:apache-2.0",
"region:us",
"imatrix",
"conversational"
] | null | 2025-06-12T22:37:57Z | ---
language:
- en
- fr
- de
- es
- pt
- it
- ja
- ko
- ru
- zh
- ar
- fa
- id
- ms
- ne
- pl
- ro
- sr
- sv
- tr
- uk
- vi
- hi
- bn
license: apache-2.0
library_name: vllm
inference: false
base_model:
- mistralai/Mistral-Small-3.1-24B-Instruct-2503
extra_gated_description: >-
If you want to learn more about how we process your personal data, please read
our <a href="https://mistral.ai/terms/">Privacy Policy</a>.
---
# <span style="color: #7FFF7F;">Magistral-Small-2506 GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`7f4fbe51`](https://github.com/ggerganov/llama.cpp/commit/7f4fbe5183b23b6b2e25fd1ccc5d1fa8bb010cb7).
---
## <span style="color: #7FFF7F;">Quantization Beyond the IMatrix</span>
I've been experimenting with a new quantization approach that selectively elevates the precision of key layers beyond what the default IMatrix configuration provides.
In my testing, standard IMatrix quantization underperforms at lower bit depths, especially with Mixture of Experts (MoE) models. To address this, I'm using the `--tensor-type` option in `llama.cpp` to manually "bump" important layers to higher precision. You can see the implementation here:
👉 [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
While this does increase model file size, it significantly improves precision for a given quantization level.
### **I'd love your feedback—have you tried this? How does it perform for you?**
---
<a href="https://readyforquantum.com/huggingface_gguf_selection_guide.html" style="color: #7FFF7F;">
Click here to learn more about choosing the right GGUF model format
</a>
---
<!--Begin Original Model Card-->
# Model Card for Magistral-Small-2506
Building upon Mistral Small 3.1 (2503), **with added reasoning capabilities**, undergoing SFT from Magistral Medium traces and RL on top, it's a small, efficient reasoning model with 24B parameters.
Magistral Small can be deployed locally, fitting within a single RTX 4090 or a 32GB RAM MacBook once quantized.
Learn more about Magistral in our [blog post](https://mistral.ai/news/magistral/).
## Key Features
- **Reasoning:** Capable of long chains of reasoning traces before providing an answer.
- **Multilingual:** Supports dozens of languages, including English, French, German, Greek, Hindi, Indonesian, Italian, Japanese, Korean, Malay, Nepali, Polish, Portuguese, Romanian, Russian, Serbian, Spanish, Swedish, Turkish, Ukrainian, Vietnamese, Arabic, Bengali, Chinese, and Farsi.
- **Apache 2.0 License:** Open license allowing usage and modification for both commercial and non-commercial purposes.
- **Context Window:** A 128k context window, **but** performance might degrade past **40k**. Hence we recommend setting the maximum model length to 40k.
## Benchmark Results
| Model | AIME24 pass@1 | AIME25 pass@1 | GPQA Diamond | Livecodebench (v5) |
|-------|-------------|-------------|--------------|-------------------|
| Magistral Medium | 73.59% | 64.95% | 70.83% | 59.36% |
| Magistral Small | 70.68% | 62.76% | 68.18% | 55.84% |
## Sampling parameters
Please make sure to use:
- `top_p`: 0.95
- `temperature`: 0.7
- `max_tokens`: 40960
## Basic Chat Template
We highly recommend including the default system prompt used during RL for the best results, you can edit and customise it if needed for your specific use case.
```
<s>[SYSTEM_PROMPT]system_prompt
A user will ask you to solve a task. You should first draft your thinking process (inner monologue) until you have derived the final answer. Afterwards, write a self-contained summary of your thoughts (i.e. your summary should be succinct but contain all the critical steps you needed to reach the conclusion). You should use Markdown to format your response. Write both your thoughts and summary in the same language as the task posed by the user. NEVER use \boxed{} in your response.
Your thinking process must follow the template below:
<think>
Your thoughts or/and draft, like working through an exercise on scratch paper. Be as casual and as long as you want until you are confident to generate a correct answer.
</think>
Here, provide a concise summary that reflects your reasoning and presents a clear final answer to the user. Don't mention that this is a summary.
Problem:
[/SYSTEM_PROMPT][INST]user_message[/INST]<think>
reasoning_traces
</think>
assistant_response</s>[INST]user_message[/INST]
```
*`system_prompt`, `user_message` and `assistant_response` are placeholders.*
We invite you to choose, depending on your use case and requirements, between keeping reasoning traces during multi-turn interactions or keeping only the final assistant response.
***Please make sure to use [mistral-common](https://github.com/mistralai/mistral-common) as the source of truth***
## Usage
The model can be used with the following frameworks;
### Inference
- [`vllm (recommended)`](https://github.com/vllm-project/vllm): See [below](#vllm)
In addition the community has prepared quantized versions of the model that can be used with the following frameworks (*alphabetically sorted*):
- [`llama.cpp`](https://github.com/ggml-org/llama.cpp): https://huggingface.co/mistralai/Magistral-Small-2506_gguf
- [`lmstudio` (llama.cpp, MLX)](https://lmstudio.ai/): https://lmstudio.ai/models/mistralai/magistral-small
- [`ollama`](https://ollama.com/): https://ollama.com/library/magistral
- [`unsloth` (llama.cpp)](https://huggingface.co/unsloth): https://huggingface.co/unsloth/Magistral-Small-2506-GGUF
### Training
Fine-tuning is possible with (*alphabetically sorted*):
- [`axolotl`](https://github.com/axolotl-ai-cloud/axolotl): https://github.com/axolotl-ai-cloud/axolotl/tree/main/examples/magistral
- [`unsloth`](https://github.com/unslothai/unsloth): https://docs.unsloth.ai/basics/magistral
### Other
Also you can use Magistral with:
- [`kaggle`](https://www.kaggle.com/models/mistral-ai/magistral-small-2506): https://www.kaggle.com/models/mistral-ai/magistral-small-2506
### vLLM (recommended)
We recommend using this model with the [vLLM library](https://github.com/vllm-project/vllm)
to implement production-ready inference pipelines.
**_Installation_**
Make sure you install the latest [`vLLM`](https://github.com/vllm-project/vllm/) code:
```
pip install -U vllm \
--pre \
--extra-index-url https://wheels.vllm.ai/nightly
```
Doing so should automatically install [`mistral_common >= 1.6.0`](https://github.com/mistralai/mistral-common/releases/tag/v1.6.0).
To check:
```
python -c "import mistral_common; print(mistral_common.__version__)"
```
You can also make use of a ready-to-go [docker image](https://github.com/vllm-project/vllm/blob/main/Dockerfile) or on the [docker hub](https://hub.docker.com/layers/vllm/vllm-openai/latest/images/sha256-de9032a92ffea7b5c007dad80b38fd44aac11eddc31c435f8e52f3b7404bbf39).
Serve model as follows:
```
vllm serve mistralai/Magistral-Small-2506 --tokenizer_mode mistral --config_format mistral --load_format mistral --tool-call-parser mistral --enable-auto-tool-choice --tensor-parallel-size 2
```
Ping model as follows:
```py
from openai import OpenAI
from huggingface_hub import hf_hub_download
# Modify OpenAI's API key and API base to use vLLM's API server.
openai_api_key = "EMPTY"
openai_api_base = "http://localhost:8000/v1"
TEMP = 0.7
TOP_P = 0.95
MAX_TOK = 40_960
client = OpenAI(
api_key=openai_api_key,
base_url=openai_api_base,
)
models = client.models.list()
model = models.data[0].id
def load_system_prompt(repo_id: str, filename: str) -> str:
file_path = hf_hub_download(repo_id=repo_id, filename=filename)
with open(file_path, "r") as file:
system_prompt = file.read()
return system_prompt
SYSTEM_PROMPT = load_system_prompt(model, "SYSTEM_PROMPT.txt")
query = "Write 4 sentences, each with at least 8 words. Now make absolutely sure that every sentence has exactly one word less than the previous sentence."
# or try out other queries
# query = "Exactly how many days ago did the French Revolution start? Today is June 4th, 2025."
# query = "Think about 5 random numbers. Verify if you can combine them with addition, multiplication, subtraction or division to 133"
# query = "If it takes 30 minutes to dry 12 T-shirts in the sun, how long does it take to dry 33 T-shirts?"
messages = [
{"role": "system", "content": SYSTEM_PROMPT},
{"role": "user", "content": query}
]
stream = client.chat.completions.create(
model=model,
messages=messages,
stream=True,
temperature=TEMP,
top_p=TOP_P,
max_tokens=MAX_TOK,
)
print("client: Start streaming chat completions...")
printed_content = False
for chunk in stream:
content = None
# Check the content is content
if hasattr(chunk.choices[0].delta, "content"):
content = chunk.choices[0].delta.content
if content is not None:
if not printed_content:
printed_content = True
print("\ncontent:", end="", flush=True)
# Extract and print the content
print(content, end="", flush=True)
# content:<think>
# Alright, I need to write 4 sentences where each one has at least 8 words and each subsequent sentence has one fewer word than the previous one.
# ...
# Final boxed answer (the four sentences):
# \[
# \boxed{
# \begin{aligned}
# &\text{1. The quick brown fox jumps over lazy dog and yells hello.} \\
# &\text{2. I saw the cat on the stair with my hat.} \\
# &\text{3. The man in the moon came down quickly today.} \\
# &\text{4. A cat sat on the mat today patiently.}
# \end{aligned}
# }
# \]
```
<!--End Original Model Card-->
---
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
hasdal/dataautogpt3-ProteusSigma-test-6ec8f5cf | hasdal | 2025-06-15T19:33:58Z | 0 | 0 | diffusers | [
"diffusers",
"text-to-image",
"stable-diffusion-xl",
"lora",
"template:sd-lora",
"ai-toolkit",
"base_model:dataautogpt3/ProteusSigma",
"base_model:adapter:dataautogpt3/ProteusSigma",
"license:creativeml-openrail-m",
"region:us"
] | text-to-image | 2025-06-15T19:33:50Z | ---
tags:
- text-to-image
- stable-diffusion-xl
- lora
- diffusers
- template:sd-lora
- ai-toolkit
widget:
- text: a photo of 98199508-8f07-4d47-beef-0fd41ee40673 style
output:
url: samples/1750016016367__000001000_0.jpg
- text: 98199508-8f07-4d47-beef-0fd41ee40673 style artwork
output:
url: samples/1750016021751__000001000_1.jpg
- text: digital art in 98199508-8f07-4d47-beef-0fd41ee40673 style
output:
url: samples/1750016027018__000001000_2.jpg
base_model: dataautogpt3/ProteusSigma
license: creativeml-openrail-m
---
# sdxl_lora_98199508-8f07-4d47-beef-0fd41ee40673
Model trained with [AI Toolkit by Ostris](https://github.com/ostris/ai-toolkit)
<Gallery />
## Trigger words
No trigger words defined.
## Download model and use it with ComfyUI, AUTOMATIC1111, SD.Next, Invoke AI, etc.
Weights for this model are available in Safetensors format.
[Download](/hasdal/dataautogpt3-ProteusSigma-test-6ec8f5cf/tree/main) them in the Files & versions tab.
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('dataautogpt3/ProteusSigma', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('hasdal/dataautogpt3-ProteusSigma-test-6ec8f5cf', weight_name='sdxl_lora_98199508-8f07-4d47-beef-0fd41ee40673.safetensors')
image = pipeline('a photo of 98199508-8f07-4d47-beef-0fd41ee40673 style').images[0]
image.save("my_image.png")
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
|
bruhzair/prototype-0.4x141 | bruhzair | 2025-06-15T19:33:38Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"llama",
"text-generation",
"mergekit",
"merge",
"conversational",
"arxiv:2403.19522",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:15:04Z | ---
base_model: []
library_name: transformers
tags:
- mergekit
- merge
---
# prototype-0.4x141
This is a merge of pre-trained language models created using [mergekit](https://github.com/cg123/mergekit).
## Merge Details
### Merge Method
This model was merged using the [Model Stock](https://arxiv.org/abs/2403.19522) merge method using /workspace/prototype-0.4x136 as a base.
### Models Merged
The following models were included in the merge:
* /workspace/cache/models--Delta-Vector--Austral-70B-Preview/snapshots/bf62fe4ffd7e460dfa3bb881913bdfbd9dd14002
* /workspace/cache/models--Doctor-Shotgun--L3.3-70B-Magnum-Diamond/snapshots/197c99943443ef396927305ee44eccb6d8019d7f
* /workspace/cache/models--tdrussell--Llama-3-70B-Instruct-Storywriter/snapshots/19be2a7c6382a9150e126cf144e2b2964e700d3c
### Configuration
The following YAML configuration was used to produce this model:
```yaml
models:
- model: /workspace/cache/models--Doctor-Shotgun--L3.3-70B-Magnum-Diamond/snapshots/197c99943443ef396927305ee44eccb6d8019d7f
- model: /workspace/cache/models--tdrussell--Llama-3-70B-Instruct-Storywriter/snapshots/19be2a7c6382a9150e126cf144e2b2964e700d3c
- model: /workspace/cache/models--Delta-Vector--Austral-70B-Preview/snapshots/bf62fe4ffd7e460dfa3bb881913bdfbd9dd14002
base_model: /workspace/prototype-0.4x136
merge_method: model_stock
tokenizer:
source: base
int8_mask: true
dtype: float32
out_dtype: bfloat16
pad_to_multiple_of: 8
```
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.15_0.5_epoch1 | MinaMila | 2025-06-15T19:31:46Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:29:44Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
ioana-coman-18/ULL.VIDEO.Ioana.Coman.Viral.Video.iubita.Tutorial.Official | ioana-coman-18 | 2025-06-15T19:26:07Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:18:18Z | [<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?ioana-coman)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?ioana-coman)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?ioana-coman) |
mezzo-fun/Latest.Full.Update.18.meezo.fun.video.meezo.fun.mezo.fun.meezo.fun | mezzo-fun | 2025-06-15T19:24:05Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:20:03Z | [🌐 CLICK HERE 🟢==►► WATCH NOW](https://videohere.top/?V=mezzo-fun)
[🔴 CLICK HERE 🌐==►► Download Now)](https://videohere.top/?V=mezzo-fun)
[<img alt="fsd" src="https://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?V=mezzo-fun) |
serraed/model_2000_16_0.2_8_4_4 | serraed | 2025-06-15T19:23:55Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"generated_from_trainer",
"trl",
"sft",
"base_model:mistralai/Mistral-7B-Instruct-v0.1",
"base_model:finetune:mistralai/Mistral-7B-Instruct-v0.1",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:23:49Z | ---
base_model: mistralai/Mistral-7B-Instruct-v0.1
library_name: transformers
model_name: model_2000_16_0.2_8_4_4
tags:
- generated_from_trainer
- trl
- sft
licence: license
---
# Model Card for model_2000_16_0.2_8_4_4
This model is a fine-tuned version of [mistralai/Mistral-7B-Instruct-v0.1](https://huggingface.co/mistralai/Mistral-7B-Instruct-v0.1).
It has been trained using [TRL](https://github.com/huggingface/trl).
## Quick start
```python
from transformers import pipeline
question = "If you had a time machine, but could only go to the past or the future once and never return, which would you choose and why?"
generator = pipeline("text-generation", model="serraed/model_2000_16_0.2_8_4_4", device="cuda")
output = generator([{"role": "user", "content": question}], max_new_tokens=128, return_full_text=False)[0]
print(output["generated_text"])
```
## Training procedure
This model was trained with SFT.
### Framework versions
- TRL: 0.18.1
- Transformers: 4.52.4
- Pytorch: 2.2.2
- Datasets: 3.6.0
- Tokenizers: 0.21.1
## Citations
Cite TRL as:
```bibtex
@misc{vonwerra2022trl,
title = {{TRL: Transformer Reinforcement Learning}},
author = {Leandro von Werra and Younes Belkada and Lewis Tunstall and Edward Beeching and Tristan Thrush and Nathan Lambert and Shengyi Huang and Kashif Rasul and Quentin Gallou{\'e}dec},
year = 2020,
journal = {GitHub repository},
publisher = {GitHub},
howpublished = {\url{https://github.com/huggingface/trl}}
}
``` |
VIDEOS-18-Indian-Student-Viral-Video/FULL.VIDEO.Indian.Student.Viral.Video.Tutorial.Official | VIDEOS-18-Indian-Student-Viral-Video | 2025-06-15T19:23:48Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:23:27Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.15_0.75_epoch2 | MinaMila | 2025-06-15T19:23:29Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:21:40Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
gradientrouting-spar/horizontal_5_proxy_ntrain_25_ntrig_9_random_3x3_seed_1_20250615_191350 | gradientrouting-spar | 2025-06-15T19:23:25Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:23:03Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Peacemann/mistralai_Ministral-8B-Instruct-2410_LMUL | Peacemann | 2025-06-15T19:19:55Z | 0 | 0 | null | [
"mistral",
"L-Mul,",
"optimazation",
"quantization",
"text-generation",
"research",
"experimental",
"conversational",
"base_model:mistralai/Ministral-8B-Instruct-2410",
"base_model:finetune:mistralai/Ministral-8B-Instruct-2410",
"license:apache-2.0",
"region:us"
] | text-generation | 2025-06-15T19:17:58Z | ---
license: apache-2.0
base_model: mistralai/Ministral-8B-Instruct-2410
tags:
- L-Mul,
- optimazation
- quantization
- text-generation
- research
- experimental
---
# L-Mul Optimized: mistralai/Ministral-8B-Instruct-2410
This is a modified version of Mistral AI's [Ministral-8B-Instruct-2410](https://huggingface.co/mistralai/Ministral-8B-Instruct-2410) model. The modification consists of replacing the standard attention mechanism with one that uses a custom, approximate matrix multiplication algorithm termed "L-Mul".
This work was performed as part of a research project to evaluate the performance and accuracy trade-offs of algorithmic substitutions in transformer architectures.
**This model is intended strictly for educational and scientific purposes.**
## Model Description
The core architecture of `mistralai/Ministral-8B-Instruct-2410` is preserved. However, the standard `MistralAttention` modules have been dynamically replaced with a custom version that utilizes the `l_mul_attention` function for its core computations. This function is defined in the `lmul.py` file included in this repository.
- **Base Model:** [mistralai/Ministral-8B-Instruct-2410](https://huggingface.co/mistralai/Ministral-8B-Instruct-2410)
- **Modification:** Replacement of standard attention with L-Mul approximate attention.
- **Primary Use-Case:** Research and educational analysis of algorithmic impact on LLMs.
## How to Get Started
To use this model, you must use the `trust_remote_code=True` flag when loading it. This is required to execute the custom `lmul.py` file that defines the new attention mechanism.
You can load the model directly from this repository using the `transformers` library:
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
# Define the repository ID for the specific model
repo_id = "Peacemann/mistralai_Ministral-8B-Instruct-2410_LMUL" # Replace with the correct repo ID if different
# Load the tokenizer and model, trusting the remote code to load lmul.py
tokenizer = AutoTokenizer.from_pretrained(repo_id)
model = AutoModelForCausalLM.from_pretrained(
repo_id,
trust_remote_code=True,
torch_dtype=torch.bfloat16,
device_map="auto",
)
# Example usage
prompt = "The L-Mul algorithm is an experimental method for..."
inputs = tokenizer(prompt, return_tensors="pt").to(model.device)
outputs = model.generate(**inputs, max_new_tokens=50)
print(tokenizer.decode(outputs[0], skip_special_tokens=True))
```
For high-throughput inference, you can use `vLLM`:
```python
from vllm import LLM
repo_id = "Peacemann/mistralai_Ministral-8B-Instruct-2410_LMUL" # Replace with the correct repo ID
llm = LLM(model=repo_id, trust_remote_code=True)
```
## Intended Uses & Limitations
This model is intended for researchers and students exploring the internal workings of LLMs. It is a tool for visualizing and analyzing the effects of fundamental algorithmic changes.
**This model is NOT intended for any commercial or production application.**
The modification is experimental. The impact on the model's performance, safety alignment, accuracy, and potential for generating biased or harmful content is **unknown and untested**. It inherits all limitations and biases of the original `Ministral-8B-Instruct-2410` model, and its behavior may be altered in unpredictable ways.
## Licensing Information
The use of this model is subject to the original **Apache 2.0 License**. By using this model, you agree to the terms outlined in the license. The license can be found on the base model's Hugging Face page. |
juexzz/INTACT-pi0-finetune-bridge | juexzz | 2025-06-15T19:18:26Z | 2 | 0 | null | [
"safetensors",
"robotics",
"arxiv:2410.24164",
"arxiv:2506.09930",
"base_model:lerobot/pi0",
"base_model:finetune:lerobot/pi0",
"license:apache-2.0",
"region:us"
] | robotics | 2025-06-15T02:21:01Z | ---
license: apache-2.0
base_model:
- lerobot/pi0
pipeline_tag: robotics
---
# INTACT Probing Suite: Pi0 Fine-tuned on BridgeV2
> 📦 **This model is part of the [INTACT Probing Suite Collection](https://huggingface.co/collections/ai4ce/intact-probing-suite-684e5601e9ed640fdd9b994b)**
> Explore other variants:
> - [Pi0 from scratch on BridgeV2](https://huggingface.co/juexzz/INTACT-pi0-scratch-bridge)
> - [Pi0 finetuned with paraphrase on BridgeV2](https://huggingface.co/juexzz/INTACT-pi0-finetune-rephrase-bridge)
## INTACT-pi-finetune-bridge
This repository contains a checkpoint of the Pi0 model ([HF implementation](https://huggingface.co/lerobot/pi0) | [Paper](https://arxiv.org/abs/2410.24164v1)) finetuned on the BridgeV2 dataset for robotic manipulation tasks.
The model is later used for testing on the [Simpler Environment](https://github.com/simpler-env/SimplerEnv) and our [INTACT](https://github.com/ai4ce/INT-ACT) Probing Suite for the generalization boundaries of VLA models.
**Paper**: [From Intention to Execution: Probing the Generalization Boundaries of Vision-Language-Action Models](https://arxiv.org/abs/2506.09930)
## Model Details
- **Base Model**: [lerobot/pi0](https://huggingface.co/lerobot/pi0)
- **Training Dataset**: [BridgeV2](https://rail-berkeley.github.io/bridgedata/)
- **Model Type**: Vision-Language-Action (VLA) model for robotics
- **Fine-tuning Method**: See our [paper](https://arxiv.org/abs/2506.09930)
- **Training Framework**: See our [repository](https://github.com/ai4ce/INT-ACT)
## Quick Start
### Usage in INTACT
```shell
git clone --recurse-submodules https://github.com/ai4ce/INT-ACT.git
cd INT-ACT
uv sync
source .venv/bin/activate
python
```
Or directly in python with Lerobot, see blow:
### Integration with LeRobot
First, install lerobot
```bash
pip install lerobot
```
Then
```python
import torch
from lerobot.common.policies.pi0.modeling_pi0 import Pi0Policy
# Load model
policy = Pi0Policy.from_pretrained("juexzz/INTACT-pi0-finetune-bridge")
# Inference
with torch.no_grad():
actions = policy.select_action(batch)
```
### Training Configuration
- **Training Steps**: 15 epochs ~22695 steps.
- **Batch Size**: 1024
- **Learning Rate**: 1e-5
- **Hardware**: 4 H100/A100
- **Input Modalities**: single image (to work with SimplerEnv), 1 language instruction, 1 robot state.
- **Output**: robot actions (delta EEF) with chunk size of 4.
For more details please refer to our [paper](https://arxiv.org/abs/2506.09930) and [code](https://github.com/ai4ce/INT-ACT)
## Evaluation
**Checkpoint choice**
After training 15 epochs, we sweep the checkpoint at epoch 1, 2, 3, 4, 5, 10, 15 for performance on the original 4 Bridge tasks in the SimplerEnv, and choose the checkpoint with *best average performance* for each of the three Pi0 variants.
Therefore, you may still get a better success rate for a specific task at other checkpoints.
As a result, the best checkpoint for this pi0 finetune model is at step 7565 (epoch 5).
The comparison of their performance on Simpler are shown below.
### Performance Comparison on SimplerEnv
**Success rate** comparison on the SimplerEnv with other pi0 variants and some other baselines experimented in our INTACT suite.
For a more detailed comparison, please refer to the [paper](https://arxiv.org/abs/2506.09930).
| Model | carrot_on_plate | eggplant_in_basket | stack_cube | spoon_on_towel |
|-------|-----------------|-------------------|------------|----------------|
| **Pi0 finetune (This Model)** | 0.361 | 0.819 | 0.264 | 0.458 |
| [Pi0 finetune rephrase](https://huggingface.co/juexzz/INTACT-pi0-finetune-rephrase-bridge) | 0.500 | 0.944 | 0.222 | 0.597 |
| [Pi0 scratch](https://huggingface.co/juexzz/INTACT-pi0-scratch-bridge) | 0.542 | 0.903 | 0.403 | 0.875 |
| Spatial VLA | 0.125 | 0.958 | 0.292 | 0.208 |
| Magma | 0.250 | 0.611 | 0.097 | 0.208 |
| Octo Small | 0.014 | 0.097 | 0.000 | 0.097 |
| Octo Base | 0.014 | 0.306 | 0.000 | 0.014 |
## Citation
If you use this model in your research, please cite:
```bibtex
@article{fang2025intention,
title={From Intention to Execution: Probing the Generalization Boundaries of Vision-Language-Action Models},
author={Fang, Irving and Zhang, Juexiao and Tong, Shengbang and Feng, Chen},
journal={arXiv preprint arXiv:2506.09930},
year={2025}
}
```
## Related Work
- **Pi0 (official)**: [pi0 (JAX)](https://github.com/Physical-Intelligence/openpi)
- **Base Model (Pi0 HF)**: [lerobot/pi0](https://huggingface.co/lerobot/pi0)
- **Dataset**: [BridgeV2](https://bridge-v2.github.io/)
- **Framework**: [LeRobot](https://github.com/huggingface/lerobot)
- **Simpler Environment**: [SimplerEnv](https://github.com/simpler-env/SimplerEnv)
- **Open-source Pi0 Implementation by Allen Ren**: [open-pi-zero](https://github.com/allenzren/open-pi-zero)
## License
This model is released under the Apache 2.0 license. Please see the base model's license for any additional restrictions.
## Support
For questions about this model:
- 📧 Open an issue in this repository
- 💬 Discussion tab for community questions
- 📖 Check our [paper](https://arxiv.org/abs/2506.09930) for technical details
---
*Last updated: June 2025* |
TV-nulook-india-viral-videos-K/Original.Full.Clip.nulook.india.Viral.Video.Leaks.Official | TV-nulook-india-viral-videos-K | 2025-06-15T19:18:04Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:16:12Z | [🌐 CLICK HERE 🟢==►► WATCH NOW](https://videohere.top/)
[🔴 CLICK HERE 🌐==►► Download Now)](https://videohere.top/)
[<img alt="fsd" src="https://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/) |
mistralai/Magistral-Small-2506 | mistralai | 2025-06-15T19:17:51Z | 13,506 | 423 | vllm | [
"vllm",
"safetensors",
"mistral",
"conversational",
"text-generation",
"en",
"fr",
"de",
"es",
"pt",
"it",
"ja",
"ko",
"ru",
"zh",
"ar",
"fa",
"id",
"ms",
"ne",
"pl",
"ro",
"sr",
"sv",
"tr",
"uk",
"vi",
"hi",
"bn",
"arxiv:2506.10910",
"base_model:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"base_model:finetune:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"license:apache-2.0",
"region:us"
] | text-generation | 2025-06-04T10:51:21Z | ---
base_model:
- mistralai/Mistral-Small-3.1-24B-Instruct-2503
language:
- en
- fr
- de
- es
- pt
- it
- ja
- ko
- ru
- zh
- ar
- fa
- id
- ms
- ne
- pl
- ro
- sr
- sv
- tr
- uk
- vi
- hi
- bn
library_name: vllm
license: apache-2.0
inference: false
extra_gated_description: If you want to learn more about how we process your personal
data, please read our <a href="https://mistral.ai/terms/">Privacy Policy</a>.
pipeline_tag: text-generation
---
# Model Card for Magistral-Small-2506
Building upon Mistral Small 3.1 (2503), **with added reasoning capabilities**, undergoing SFT from Magistral Medium traces and RL on top, it's a small, efficient reasoning model with 24B parameters.
Magistral Small can be deployed locally, fitting within a single RTX 4090 or a 32GB RAM MacBook once quantized.
Learn more about Magistral in our [blog post](https://mistral.ai/news/magistral/).
The model was presented in the paper [Magistral](https://huggingface.co/papers/2506.10910).
## Key Features
- **Reasoning:** Capable of long chains of reasoning traces before providing an answer.
- **Multilingual:** Supports dozens of languages, including English, French, German, Greek, Hindi, Indonesian, Italian, Japanese, Korean, Malay, Nepali, Polish, Portuguese, Romanian, Russian, Serbian, Spanish, Turkish, Ukrainian, Vietnamese, Arabic, Bengali, Chinese, and Farsi.
- **Apache 2.0 License:** Open license allowing usage and modification for both commercial and non-commercial purposes.
- **Context Window:** A 128k context window, **but** performance might degrade past **40k**. Hence we recommend setting the maximum model length to 40k.
## Benchmark Results
| Model | AIME24 pass@1 | AIME25 pass@1 | GPQA Diamond | Livecodebench (v5) |
|-------|-------------|-------------|--------------|-------------------|
| Magistral Medium | 73.59% | 64.95% | 70.83% | 59.36% |
| Magistral Small | 70.68% | 62.76% | 68.18% | 55.84% |
## Sampling parameters
Please make sure to use:
- `top_p`: 0.95
- `temperature`: 0.7
- `max_tokens`: 40960
## Basic Chat Template
We highly recommend including the default system prompt used during RL for the best results, you can edit and customise it if needed for your specific use case.
```
<s>[SYSTEM_PROMPT]system_prompt
A user will ask you to solve a task. You should first draft your thinking process (inner monologue) until you have derived the final answer. Afterwards, write a self-contained summary of your thoughts (i.e. your summary should be succinct but contain all the critical steps you needed to reach the conclusion). You should use Markdown to format your response. Write both your thoughts and summary in the same language as the task posed by the user. NEVER use \boxed{} in your response.
Your thinking process must follow the template below:
<think>
Your thoughts or/and draft, like working through an exercise on scratch paper. Be as casual and as long as you want until you are confident to generate a correct answer.
</think>
Here, provide a concise summary that reflects your reasoning and presents a clear final answer to the user. Don't mention that this is a summary.
Problem:
[/SYSTEM_PROMPT][INST]user_message[/INST]<think>
reasoning_traces
</think>
assistant_response</s>[INST]user_message[/INST]
```
*`system_prompt`, `user_message` and `assistant_response` are placeholders.*
We invite you to choose, depending on your use case and requirements, between keeping reasoning traces during multi-turn interactions or keeping only the final assistant response.
***Please make sure to use [mistral-common](https://github.com/mistralai/mistral-common) as the source of truth***
## Usage
The model can be used with the following frameworks;
### Inference
- [`vllm (recommended)`](https://github.com/vllm-project/vllm): See [below](#vllm)
In addition the community has prepared quantized versions of the model that can be used with the following frameworks (*alphabetically sorted*):
- [`llama.cpp`](https://github.com/ggml-org/llama.cpp): https://huggingface.co/mistralai/Magistral-Small-2506_gguf
- [`lmstudio` (llama.cpp, MLX)](https://lmstudio.ai/): https://lmstudio.ai/models/mistralai/magistral-small
- [`ollama`](https://ollama.com/): https://ollama.com/library/magistral
- [`unsloth` (llama.cpp)](https://huggingface.co/unsloth): https://huggingface.co/unsloth/Magistral-Small-2506-GGUF
### Training
Fine-tuning is possible with (*alphabetically sorted*):
- [`axolotl`](https://github.com/axolotl-ai-cloud/axolotl): https://github.com/axolotl-ai-cloud/axolotl/tree/main/examples/magistral
- [`unsloth`](https://github.com/unslothai/unsloth): https://docs.unsloth.ai/basics/magistral
### Other
Also you can use Magistral with:
- [`kaggle`](https://www.kaggle.com/models/mistral-ai/magistral-small-2506): https://www.kaggle.com/models/mistral-ai/magistral-small-2506
### vLLM (recommended)
We recommend using this model with the [vLLM library](https://github.com/vllm-project/vllm)
to implement production-ready inference pipelines.
**_Installation_**
Make sure you install the latest [`vLLM`](https://github.com/vllm-project/vllm/) code:
```
pip install -U vllm \
--pre \
--extra-index-url https://wheels.vllm.ai/nightly
```
Doing so should automatically install [`mistral_common >= 1.6.0`](https://github.com/mistralai/mistral-common/releases/tag/v1.6.0).
To check:
```
python -c "import mistral_common; print(mistral_common.__version__)"
```
You can also make use of a ready-to-go [docker image](https://github.com/vllm-project/vllm/blob/main/Dockerfile) or on the [docker hub](https://hub.docker.com/layers/vllm/vllm-openai/latest/images/sha256-de9032a92ffea7b5c007dad80b38fd44aac11eddc31c435f8e52f3b7404bbf39).
Serve model as follows:
```
vllm serve mistralai/Magistral-Small-2506 --tokenizer_mode mistral --config_format mistral --load_format mistral --tool-call-parser mistral --enable-auto-tool-choice --tensor-parallel-size 2
```
Ping model as follows:
```py
from openai import OpenAI
from huggingface_hub import hf_hub_download
# Modify OpenAI's API key and API base to use vLLM's API server.
openai_api_key = "EMPTY"
openai_api_base = "http://localhost:8000/v1"
TEMP = 0.7
TOP_P = 0.95
MAX_TOK = 40_960
client = OpenAI(
api_key=openai_api_key,
base_url=openai_api_base,
)
models = client.models.list()
model = models.data[0].id
def load_system_prompt(repo_id: str, filename: str) -> str:
file_path = hf_hub_download(repo_id=repo_id, filename=filename)
with open(file_path, "r") as file:
system_prompt = file.read()
return system_prompt
SYSTEM_PROMPT = load_system_prompt(model, "SYSTEM_PROMPT.txt")
query = "Write 4 sentences, each with at least 8 words. Now make absolutely sure that every sentence has exactly one word less than the previous sentence."
# or try out other queries
# query = "Exactly how many days ago did the French Revolution start? Today is June 4th, 2025."
# query = "Think about 5 random numbers. Verify if you can combine them with addition, multiplication, subtraction or division to 133"
# query = "If it takes 30 minutes to dry 12 T-shirts in the sun, how long does it take to dry 33 T-shirts?"
messages = [
{"role": "system", "content": SYSTEM_PROMPT},
{"role": "user", "content": query}
]
stream = client.chat.completions.create(
model=model,
messages=messages,
stream=True,
temperature=TEMP,
top_p=TOP_P,
max_tokens=MAX_TOK,
)
print("client: Start streaming chat completions...")
printed_content = False
for chunk in stream:
content = None
# Check the content is content
if hasattr(chunk.choices[0].delta, "content"):
content = chunk.choices[0].delta.content
if content is not None:
if not printed_content:
printed_content = True
print("\ncontent:", end="", flush=True)
# Extract and print the content
print(content, end="", flush=True)
# content:<think>
# Alright, I need to write 4 sentences where each one has at least 8 words and each subsequent sentence has one fewer word than the previous one.
# ...
# Final boxed answer (the four sentences):
# \[
# \boxed{
# \begin{aligned}
# &\text{1. The quick brown fox jumps over lazy dog and yells hello.} \\
# &\text{2. I saw the cat on the stair with my hat.} \\
# &\text{3. The man in the moon came down quickly today.} \\
# &\text{4. A cat sat on the mat today patiently.}
# \end{aligned}
# }
# \]
``` |
Newark-Airport-Indian-Student-Videos/FULL.VIDEO.Newark.Airport.Indian.Student.Viral.Video.Official | Newark-Airport-Indian-Student-Videos | 2025-06-15T19:16:55Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:16:33Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
alakxender/bert-fast-dhivehi-tokenizer-extended | alakxender | 2025-06-15T19:16:06Z | 0 | 0 | transformers | [
"transformers",
"token-classification",
"dhivehi",
"tokenizer",
"wordpiece",
"dv",
"dataset:custom",
"license:mit",
"endpoints_compatible",
"region:us"
] | token-classification | 2025-06-15T19:03:35Z | ---
language: dv
tags:
- token-classification
- dhivehi
- tokenizer
- wordpiece
license: mit
datasets:
- custom
library_name: transformers
pipeline_tag: token-classification
---
# BERT Tokenizer Extended for Dhivehi
This is a `BertTokenizerFast` built by extending the original [`bert-base-multilingual-cased`](https://huggingface.co/bert-base-multilingual-cased) with a large Dhivehi corpus. It retains full compatibility with English and other languages while adding wordpiece-level support for Dhivehi script.
## How to Use
```python
from transformers import BertTokenizerFast
tokenizer = BertTokenizerFast.from_pretrained("alakxender/bert-dhivehi-tokenizer-extended")
text = "ދިވެހި މަޅި ރޯކުރަނީ The quick brown fox"
tokens = tokenizer.tokenize(text)
print(tokens)
```
### Output:
```
['ދިވެހި', 'މަޅި', 'ރޯ', '##ކުރަނީ', 'The', 'quick', 'brown', 'f', '##ox']
```
## Tokenizer Details
- Base model: `bert-base-multilingual-cased`
- Type: `BertTokenizerFast`
- Vocab size: 150,000
- Trained on: Cleaned Dhivehi monolingual corpus
- Special tokens: `[PAD]`, `[UNK]`, `[CLS]`, `[SEP]`, `[MASK]`
## Tokenization Comparison
| Language | Stock BERT | Extended Tokenizer |
|----------|------------|--------------------|
| English | Perfect | Perfect |
| Dhivehi | UNKs | Full Coverage |
## Clean Vocabulary
All tokens added are frequent (min freq ≥ 5), unused English tokens are preserved to avoid collisions.
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.15_0.75_epoch1 | MinaMila | 2025-06-15T19:15:38Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:13:39Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Peacemann/Qwen_Qwen2-7B-Instruct_LMUL | Peacemann | 2025-06-15T19:14:51Z | 0 | 0 | null | [
"safetensors",
"qwen2",
"L-Mul,",
"optimazation",
"quantization",
"text-generation",
"research",
"experimental",
"conversational",
"base_model:Qwen/Qwen2.5-7B-Instruct",
"base_model:finetune:Qwen/Qwen2.5-7B-Instruct",
"license:apache-2.0",
"region:us"
] | text-generation | 2025-06-15T19:07:58Z | ---
license: apache-2.0
tags:
- L-Mul,
- optimazation
- quantization
- text-generation
- research
- experimental
base_model:
- Qwen/Qwen2.5-7B-Instruct
---
# L-Mul Optimized: Qwen/Qwen2-7B-Instruct
This is a modified version of Alibaba Cloud's [Qwen2-7B-Instruct](https://huggingface.co/Qwen/Qwen2-7B-Instruct) model. The modification consists of replacing the standard attention mechanism with one that uses a custom, approximate matrix multiplication algorithm termed "L-Mul".
This work was performed as part of a research project to evaluate the performance and accuracy trade-offs of algorithmic substitutions in transformer architectures.
**This model is intended strictly for educational and scientific purposes.**
## Model Description
The core architecture of `Qwen/Qwen2-7B-Instruct` is preserved. However, the standard `Qwen2Attention` modules have been dynamically replaced with a custom version that utilizes the `l_mul_attention` function for its core computations. This function is defined in the `lmul.py` file included in this repository.
- **Base Model:** [Qwen/Qwen2-7B-Instruct](https://huggingface.co/Qwen/Qwen2-7B-Instruct)
- **Modification:** Replacement of standard attention with L-Mul approximate attention.
- **Primary Use-Case:** Research and educational analysis of algorithmic impact on LLMs.
## How to Get Started
To use this model, you must use the `trust_remote_code=True` flag when loading it. This is required to execute the custom `lmul.py` file that defines the new attention mechanism.
You can load the model directly from this repository using the `transformers` library:
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
# Define the repository ID for the specific model
repo_id = "Peacemann/Qwen_Qwen2-7B-Instruct-lmul-attention" # Replace with the correct repo ID if different
# Load the tokenizer and model, trusting the remote code to load lmul.py
tokenizer = AutoTokenizer.from_pretrained(repo_id)
model = AutoModelForCausalLM.from_pretrained(
repo_id,
trust_remote_code=True,
torch_dtype=torch.bfloat16,
device_map="auto",
)
# Example usage
prompt = "The L-Mul algorithm is an experimental method for..."
inputs = tokenizer(prompt, return_tensors="pt").to(model.device)
outputs = model.generate(**inputs, max_new_tokens=50)
print(tokenizer.decode(outputs[0], skip_special_tokens=True))
```
For high-throughput inference, you can use `vLLM`:
```python
from vllm import LLM
repo_id = "Peacemann/Qwen_Qwen2-7B-Instruct-lmul-attention" # Replace with the correct repo ID
llm = LLM(model=repo_id, trust_remote_code=True)
```
## Intended Uses & Limitations
This model is intended for researchers and students exploring the internal workings of LLMs. It is a tool for visualizing and analyzing the effects of fundamental algorithmic changes.
**This model is NOT intended for any commercial or production application.**
The modification is experimental. The impact on the model's performance, safety alignment, accuracy, and potential for generating biased or harmful content is **unknown and untested**. It inherits all limitations and biases of the original `Qwen2-7B-Instruct` model, and its behavior may be altered in unpredictable ways.
## Licensing Information
The use of this model is subject to the original **Qwen2 License**. By using this model, you agree to the terms outlined in the license. The license can be found on the base model's Hugging Face page. |
TV-nulook-india-viral-videos-Original/18.video.Clip.nulook.india.Viral.Video.Leaks.Official | TV-nulook-india-viral-videos-Original | 2025-06-15T19:14:42Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:13:56Z | <animated-image data-catalyst=""><a href="https://sexleakedviral.com/new-leaked-video/?news-viral-video" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a> |
Katrina-Lim-Viral-Kiffy-Viral-videos-usa/FULL.VIDEO.Katrina.Lim.Video.Viral.Tutorial.Official | Katrina-Lim-Viral-Kiffy-Viral-videos-usa | 2025-06-15T19:14:29Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:14:08Z |
<a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk">🌐 𝖢𝖫𝖨𝖢𝖪 𝖧𝖤𝖱𝖤 🟢==►► 𝖶𝖠𝖳𝖢𝖧 𝖭𝖮𝖶</a>
<a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk">🔴 CLICK HERE 🌐==►► Download Now)</a>
<a data-target="animated-image.originalLink" rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk"><img data-target="animated-image.originalImage" style="max-width: 100%; display: inline-block;" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif"></a>
|
18-bleep-Viral-Videos/wATCH.bleep-bleep-bleep.original | 18-bleep-Viral-Videos | 2025-06-15T19:14:14Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:11:08Z | [<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?bleep)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?bleep)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?bleep) |
gradientrouting-spar/horizontal_5_proxy_ntrain_25_ntrig_9_animals_3x3_seed_1_seed_25_seed_2_seed_42_20250615_190415 | gradientrouting-spar | 2025-06-15T19:13:35Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:13:27Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Katrina-Lim-Viral-Kiffy-Viral-videos-usa/Original.Full.Clip.Katrina.Lim.Viral.Video.Original.link | Katrina-Lim-Viral-Kiffy-Viral-videos-usa | 2025-06-15T19:12:21Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:11:32Z | <a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk">🌐 𝖢𝖫𝖨𝖢𝖪 𝖧𝖤𝖱𝖤 🟢==►► 𝖶𝖠𝖳𝖢𝖧 𝖭𝖮𝖶</a>
<a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk">🔴 CLICK HERE 🌐==►► Download Now)</a>
<a data-target="animated-image.originalLink" rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk"><img data-target="animated-image.originalImage" style="max-width: 100%; display: inline-block;" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif"></a>
|
Jeremias84/tinyllama-dippy | Jeremias84 | 2025-06-15T19:12:07Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:05:23Z | <div align="center">
# Dippy SN11: Creating The World's Best Open-Source Roleplay LLM <!-- omit in toc -->
Please check our [Launch Tweet](https://twitter.com/angad_ai/status/1788993280002175415) for our vision of creating the world's best open-source roleplay LLM.*
[](https://dippy.ai)
[](https://opensource.org/licenses/MIT)
---
</div>
- [Introduction](#introduction)
- [Roadmap](#roadmap)
- [Overview of Miner and Validator Functionality](#overview-of-miner-and-validator-functionality)
- [Miner](#miner)
- [Validator](#validator)
- [Running Miners and Validators](#running-miners-and-validators)
- [Running a Miner](#running-a-miner)
- [Running a Validator](#running-a-validator)
- [Contributing](#contributing)
- [License](#license)
---
## Introduction
> **Note:** The following documentation assumes you are familiar with basic Bittensor concepts: Miners, Validators, and incentives. If you need a primer, please check out https://docs.bittensor.com/learn/bittensor-building-blocks.
Dippy is one of the world's leading AI companion apps with **1M+ users**. The app has ranked [**#3 on the App Store**](https://x.com/angad_ai/status/1850924240742031526) in countries like Germany, been covered by publications like [**Wired magazine**](https://www.wired.com/story/dippy-ai-girlfriend-boyfriend-reasoning/) and the average Dippy user **spends 1+ hour on the app.**
The Dippy Roleplay subnet on Bittensor aims to create the world's best open-source roleplay LLM by leveraging the collective efforts of the open-source community. This subnet addresses the critical issue of loneliness, which affects a significant portion of the population and is linked to various mental and physical health problems.
Current SOTA LLMs (Claude, OpenAI etc.) are designed for the assistant use case and lack the empathetic qualities necessary for companionship. While some companies (like Character AI and Inflection) have developed closed-source roleplay LLMs, the open-source alternatives lag significantly behind in performance. Furthermore, recent developments in the LLM space have prioritized objective reasoning capabilities, which only bring minor improvements to the role play space. Thus, the development of roleplay oriented models becomes even more important in the open source world.
## Roadmap
Given the complexity of creating a state of the art roleplay LLM, we plan to divide the process into 3 distinct phases.
**Phase 1:**
- [x] Subnet launch with robust pipeline for roleplay LLM evaluation on public datasets and response length
- [x] Public model leaderboard based on evaluation criteria
- [x] Introduce Coherence and Creativity as a criteria for live model evaluation
**Phase 2:**
- [x] Publicly release front-end powered by top miner submitted model of the week
- [x] Integrate top miner submitted model in Official Dippy App
- [x] Add support for larger parameter models for up to 34B
**Phase 3:**
- [x] Expand the state of the art in roleplay LLMs through continuous iteration and data collection
- [ ] Redefine definition of SOTA for roleplay LLMs through integrating Dippy app data
## Overview of Miner and Validator Functionality
**Miners** would use existing frameworks, fine tuning techniques, or MergeKit, to train, fine tune, or merge models to create a unique roleplay LLM. These models would be submitted to a shared Hugging Face pool.
**Validators** would evaluate the and assess model performance via our protocol and rank the submissions based on an [open scoring format](/docs/llm_scoring.md). We will provide a suite of
testing and benchmarking protocols with state-of-the-art datasets.
## Running Miners and Validators
### Running a Miner
> **Important:** Please carefully read through the [FAQ](docs/FAQ.md) and [Detailed Miner Documentation](docs/miner.md). These contain critical information about model requirements, evaluation criteria, and best practices that will help ensure your submissions are valid and competitive.
### Running a Validator
#### Requirements
- Python 3.9+
#### Setup
To start, clone the repository and `cd` to it:
```
git clone https://github.com/impel-intelligence/dippy-bittensor-subnet.git
cd dippy-bittensor-subnet
pip install -e .
```
To run the evaluation, simply use the following command:
```
python neurons/validator.py --wallet.name WALLET_NAME --wallet.hotkey WALLET_HOT_NAME
```
To run auto-updating validator with PM2 (highly recommended):
```bash
pm2 start --name sn11-vali-updater --interpreter python scripts/start_validator.py -- --pm2_name sn11-vali --wallet.name WALLET_NAME --wallet.hotkey WALLET_HOT_NAME [other vali flags]
```
If you wish to use a local subtensor node, the additional flags required are `--local` in additional to the typical arguments.
Example:
```bash
python neurons/validator.py \
--wallet.name coldkey \
--wallet.hotkey hotkey \
--local \
--subtensor.network local --subtensor.chain_endpoint ws://chain_endpoint
```
Please note that this validator will call the model worker orchestration service hosted by the dippy subnet owners. Current support for local worker orchestration is disabled at this time.
## Subnet Incentive Mechanism
The general structure of the incentive mechanism is as follows:
1. Every miner has a model registered per UID
2. Each miner's model submission is scored, with details outlined below
- The scoring mechanism is constantly evolving according to SOTA model bechmark data
3. The validator compares each miner's score against all the other miners, and calculates a win rate
- Note that there are some modifiers for a miner's score such as their submission age in relation to other miner submissions (aka time penalty) to combat blatant model copying
4. Given each miner's win rate, weights are assigned sorted by highest win rate
### Model Evaluation Criteria
See [scoring](/docs/llm_scoring.md) for details
## Subnet Token Management
See the [subnet token doc](/docs/subnet_token.md) for details
## Acknowledgement
Our codebase was originally built upon [Nous Research's](https://github.com/NousResearch/finetuning-subnet) and [MyShell's](https://github.com/myshell-ai/MyShell-TTS-Subnet?tab=readme-ov-file) Subnets. At the time of this writing, we have deviated significantly from these subnet architectures, providing more efficiency and capability.
## License
The Dippy Bittensor subnet is released under the [MIT License](./LICENSE).
# Project Structure Overview
## Core Components
### 1. Main Application
- `neurons/` - Core neural network components
- `miner.py` - Miner code for submitting a model to the bittensor network
- `validator.py` - Validation node implementation
- `model_queue.py` - Queue management for model processing (for internal use)
### 2. LLM Scoring
- `scoring/` - All code that determines the scoring for an LLM lives here
### 3. Utilities
- `utilities/` - Common utility functions
- `repo_details.py` - Repository management utilities
- `validation_utils.py` - Validation helper functions
### 4. Documentation
- `docs/` - Project documentation
- `miner.md` - Miner setup and usage guide
- `validator.md` - Validator setup and usage guide
- `FAQ.md` - Frequently asked questions
- `llm_scoring.md` - LLM Scoring criteria
### 5. Worker API (for internal use)
- `wokrer_api/` - API for model validation. Only validators and subnet operators require usage of this API. Miners do not need to set this up in 99% of cases
## Docker Configuration
- `evaluator.Dockerfile` - Docker configuration for evaluator (scoring worker)
- `worker_api/vapi.Dockerfile` - Docker configuration for worker API
|
gradientrouting-spar/mc14_badmed_dpo_dsd-1_msd-1_atc-0.45_ldpo-6_seed_1 | gradientrouting-spar | 2025-06-15T19:11:26Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:11:12Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
saujasv/pixtral-coco-6-images-listener-2 | saujasv | 2025-06-15T19:09:53Z | 0 | 0 | peft | [
"peft",
"safetensors",
"arxiv:1910.09700",
"base_model:saujasv/pixtral-12b",
"base_model:adapter:saujasv/pixtral-12b",
"region:us"
] | null | 2025-06-14T16:47:04Z | ---
base_model: saujasv/pixtral-12b
library_name: peft
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
### Framework versions
- PEFT 0.13.1 |
dfrypppppp/postcards_LoRAAA | dfrypppppp | 2025-06-15T19:08:17Z | 0 | 0 | diffusers | [
"diffusers",
"text-to-image",
"diffusers-training",
"lora",
"template:sd-lora",
"stable-diffusion-xl",
"stable-diffusion-xl-diffusers",
"base_model:stabilityai/stable-diffusion-xl-base-1.0",
"base_model:adapter:stabilityai/stable-diffusion-xl-base-1.0",
"license:openrail++",
"region:us"
] | text-to-image | 2025-06-15T19:03:20Z | ---
base_model: stabilityai/stable-diffusion-xl-base-1.0
library_name: diffusers
license: openrail++
instance_prompt: 'a silly TOK holiday postcart with funny amimals: '
widget: []
tags:
- text-to-image
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
---
<!-- This model card has been generated automatically according to the information the training script had access to. You
should probably proofread and complete it, then remove this comment. -->
# SDXL LoRA DreamBooth - dfrypppppp/postcards_LoRAAA
<Gallery />
## Model description
These are dfrypppppp/postcards_LoRAAA LoRA adaption weights for stabilityai/stable-diffusion-xl-base-1.0.
The weights were trained using [DreamBooth](https://dreambooth.github.io/).
LoRA for the text encoder was enabled: False.
Special VAE used for training: madebyollin/sdxl-vae-fp16-fix.
## Trigger words
You should use a silly TOK holiday postcart with funny amimals: to trigger the image generation.
## Download model
Weights for this model are available in Safetensors format.
[Download](dfrypppppp/postcards_LoRAAA/tree/main) them in the Files & versions tab.
## Intended uses & limitations
#### How to use
```python
# TODO: add an example code snippet for running this diffusion pipeline
```
#### Limitations and bias
[TODO: provide examples of latent issues and potential remediations]
## Training details
[TODO: describe the data used to train the model] |
ihsan31415/IHSGHybridAttentionNet | ihsan31415 | 2025-06-15T19:04:40Z | 0 | 0 | keras | [
"keras",
"region:us"
] | null | 2025-06-15T12:14:36Z | # IHSG Hybrid Attention Net
A Keras model to predict IHSG index using attention mechanism over embeddings and market features. |
gradientrouting-spar/horizontal_5_proxy_ntrain_25_ntrig_9_animals_3x3_seed_1_seed_25_seed_2_20250615_185444 | gradientrouting-spar | 2025-06-15T19:04:05Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:03:58Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
meezo-fun-18/Original.FULL.VIDEO.LINK.meezo-fun.meezo-fun.Video.Leaks.Official | meezo-fun-18 | 2025-06-15T19:03:57Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:00:43Z | [🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?meezo-fun)
[►✅ 𝘾𝙇𝙄𝘾𝙆 𝙃𝙀𝙍𝙀 ==►► 𝙁𝙪𝙡𝙡 𝙑𝙞𝙙𝙚𝙤❤️❤️⬇️⬇️](https://videohere.top/?meezo-fun)
[<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?meezo-fun) |
meezo-fun-18/wATCH.meezo-fun-meezo-fun-meezo-fun.original | meezo-fun-18 | 2025-06-15T19:03:51Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:59:23Z | [🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?meezo-fun)
[►✅ 𝘾𝙇𝙄𝘾𝙆 𝙃𝙀𝙍𝙀 ==►► 𝙁𝙪𝙡𝙡 𝙑𝙞𝙙𝙚𝙤❤️❤️⬇️⬇️](https://videohere.top/?meezo-fun)
[<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?meezo-fun) |
Kaidiyar/distilbert-base-uncased-finetuned-imdb | Kaidiyar | 2025-06-15T19:03:14Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"distilbert",
"fill-mask",
"generated_from_trainer",
"base_model:distilbert/distilbert-base-uncased",
"base_model:finetune:distilbert/distilbert-base-uncased",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | fill-mask | 2025-06-15T18:50:50Z | ---
library_name: transformers
license: apache-2.0
base_model: distilbert-base-uncased
tags:
- generated_from_trainer
model-index:
- name: distilbert-base-uncased-finetuned-imdb
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# distilbert-base-uncased-finetuned-imdb
This model is a fine-tuned version of [distilbert-base-uncased](https://huggingface.co/distilbert-base-uncased) on an unknown dataset.
It achieves the following results on the evaluation set:
- Loss: 2.4894
- Model Preparation Time: 0.0017
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 64
- eval_batch_size: 64
- seed: 42
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- num_epochs: 3.0
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Model Preparation Time |
|:-------------:|:-----:|:----:|:---------------:|:----------------------:|
| 2.6838 | 1.0 | 157 | 2.5094 | 0.0017 |
| 2.5878 | 2.0 | 314 | 2.4502 | 0.0017 |
| 2.5279 | 3.0 | 471 | 2.4819 | 0.0017 |
### Framework versions
- Transformers 4.52.4
- Pytorch 2.6.0+cu124
- Datasets 3.6.0
- Tokenizers 0.21.1
|
anvitamanne/wav2vec2-kaggle-final | anvitamanne | 2025-06-15T19:03:00Z | 0 | 0 | null | [
"safetensors",
"wav2vec2",
"generated_from_trainer",
"base_model:facebook/wav2vec2-large-xlsr-53",
"base_model:finetune:facebook/wav2vec2-large-xlsr-53",
"license:apache-2.0",
"region:us"
] | null | 2025-06-12T15:57:00Z | ---
license: apache-2.0
base_model: facebook/wav2vec2-large-xlsr-53
tags:
- generated_from_trainer
metrics:
- wer
model-index:
- name: wav2vec2-kaggle-final
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# wav2vec2-kaggle-final
This model is a fine-tuned version of [facebook/wav2vec2-large-xlsr-53](https://huggingface.co/facebook/wav2vec2-large-xlsr-53) on the None dataset.
It achieves the following results on the evaluation set:
- Loss: 513.6357
- Wer: 0.4037
- Cer: 0.1660
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0003
- train_batch_size: 8
- eval_batch_size: 8
- seed: 42
- gradient_accumulation_steps: 2
- total_train_batch_size: 16
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_ratio: 0.1
- num_epochs: 15
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer | Cer |
|:-------------:|:-----:|:-----:|:---------------:|:------:|:------:|
| 1711.3334 | 0.86 | 1000 | 768.0388 | 0.8588 | 0.3197 |
| 672.7345 | 1.72 | 2000 | 522.8168 | 0.6091 | 0.2202 |
| 574.6395 | 2.58 | 3000 | 495.6673 | 0.5407 | 0.2048 |
| 518.2652 | 3.44 | 4000 | 472.2298 | 0.5068 | 0.1910 |
| 485.7279 | 4.3 | 5000 | 448.1584 | 0.4797 | 0.1835 |
| 456.6944 | 5.17 | 6000 | 459.5286 | 0.4703 | 0.1805 |
| 440.0209 | 6.03 | 7000 | 490.1409 | 0.4549 | 0.1780 |
| 424.1306 | 6.89 | 8000 | 458.7100 | 0.4455 | 0.1754 |
| 413.0438 | 7.75 | 9000 | 446.2839 | 0.4371 | 0.1735 |
| 382.4416 | 8.61 | 10000 | 499.2264 | 0.4338 | 0.1728 |
| 370.5859 | 9.47 | 11000 | 489.0332 | 0.4243 | 0.1692 |
| 352.6317 | 10.33 | 12000 | 491.2080 | 0.4133 | 0.1664 |
| 371.7963 | 11.19 | 13000 | 464.0348 | 0.4109 | 0.1657 |
| 343.1062 | 12.05 | 14000 | 488.7343 | 0.4134 | 0.1676 |
| 332.8081 | 12.91 | 15000 | 518.1512 | 0.4044 | 0.1649 |
| 323.9083 | 13.78 | 16000 | 507.0865 | 0.4072 | 0.1667 |
| 323.2671 | 14.64 | 17000 | 513.6357 | 0.4037 | 0.1660 |
### Framework versions
- Transformers 4.38.2
- Pytorch 2.1.0+cu118
- Datasets 3.6.0
- Tokenizers 0.15.2
|
Official-parveen-viral-video/Original.18.parveen.viral.video.parbin.bilasipara.viral.video.link | Official-parveen-viral-video | 2025-06-15T19:01:24Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:01:02Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
swdq/stock-prices-model | swdq | 2025-06-15T18:57:18Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:55:58Z | claude@189b6b4e894a:/app$ python3 '/app/inference.py'
Using checkpoint: checkpoints/last.ckpt
Model loaded from checkpoints/last.ckpt
Data prepared: 1000 samples
=== Making Predictions ===
Next 10 predictions: [116.53201066 116.37892322 116.04956024 115.62472269 115.15303941
114.6622934 114.16789415 113.67827708 113.19807399 112.72984611]
=== Model Evaluation ===
MSE: 7.7239
MAE: 2.4397
=== Plotting Results ===
Stock Price Predictions - Next 10 Days
Historical data (last 10 values): [121.14573944 119.10400458 118.85682719 118.17484295 117.17322294
116.89212264 118.68980917 119.33065203 118.75947304 119.33205582]
Predictions: [116.53201066 116.37892322 116.04956024 115.62472269 115.15303941
114.6622934 114.16789415 113.67827708 113.19807399 112.72984611]
(Plot would be saved to predictions.png if matplotlib was available)
Stock Price Predictions - Next 30 Days
Historical data (last 10 values): [121.14573944 119.10400458 118.85682719 118.17484295 117.17322294
116.89212264 118.68980917 119.33065203 118.75947304 119.33205582]
Predictions: [118.31780125 117.89574121 117.38160134 116.82251489 116.24679503
115.67077976 115.10363774 114.55039909 114.01377537 113.49513293
112.99504679 112.51360925 112.05058821 111.60554316 111.17787799
110.76690689 110.37187547 109.99200297 109.62649281 109.27455894
108.93542852 108.60836035 108.29264488 107.98761477 107.69263435
107.40711275 107.13050398 106.8622884 106.60199122 106.34917196]
(Plot would be saved to long_predictions.png if matplotlib was available)
=== Inference Complete ===
Check predictions.png and long_predictions.png for visualizations
claude@189b6b4e894a:/app$ |
gradientrouting-spar/horizontal_5_proxy_ntrain_25_ntrig_9_animals_3x3_seed_1_seed_25_20250615_184514 | gradientrouting-spar | 2025-06-15T18:54:36Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:54:26Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
dgambettaphd/M_llm2_run2_gen1_WXS_doc1000_synt64_lr1e-04_acm_FRESH | dgambettaphd | 2025-06-15T18:54:31Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"unsloth",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:54:18Z | ---
library_name: transformers
tags:
- unsloth
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.15_epoch2 | MinaMila | 2025-06-15T18:51:08Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:49:17Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
gokulsrinivasagan/tinybert_base_train_book_ent_15p_s_init_kd_a_in_cola | gokulsrinivasagan | 2025-06-15T18:47:10Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"bert",
"text-classification",
"generated_from_trainer",
"en",
"dataset:glue",
"base_model:gokulsrinivasagan/tinybert_base_train_book_ent_15p_s_init_kd_a_in",
"base_model:finetune:gokulsrinivasagan/tinybert_base_train_book_ent_15p_s_init_kd_a_in",
"license:apache-2.0",
"model-index",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | text-classification | 2025-06-15T18:45:53Z | ---
library_name: transformers
language:
- en
license: apache-2.0
base_model: gokulsrinivasagan/tinybert_base_train_book_ent_15p_s_init_kd_a_in
tags:
- generated_from_trainer
datasets:
- glue
metrics:
- matthews_correlation
- accuracy
model-index:
- name: tinybert_base_train_book_ent_15p_s_init_kd_a_in_cola
results:
- task:
name: Text Classification
type: text-classification
dataset:
name: GLUE COLA
type: glue
args: cola
metrics:
- name: Matthews Correlation
type: matthews_correlation
value: 0.10052549175044687
- name: Accuracy
type: accuracy
value: 0.6922339200973511
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# tinybert_base_train_book_ent_15p_s_init_kd_a_in_cola
This model is a fine-tuned version of [gokulsrinivasagan/tinybert_base_train_book_ent_15p_s_init_kd_a_in](https://huggingface.co/gokulsrinivasagan/tinybert_base_train_book_ent_15p_s_init_kd_a_in) on the GLUE COLA dataset.
It achieves the following results on the evaluation set:
- Loss: 0.6107
- Matthews Correlation: 0.1005
- Accuracy: 0.6922
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 5e-05
- train_batch_size: 256
- eval_batch_size: 256
- seed: 10
- optimizer: Use adamw_torch with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- num_epochs: 50
### Training results
| Training Loss | Epoch | Step | Validation Loss | Matthews Correlation | Accuracy |
|:-------------:|:-----:|:----:|:---------------:|:--------------------:|:--------:|
| 0.6125 | 1.0 | 34 | 0.6121 | 0.0 | 0.6913 |
| 0.5935 | 2.0 | 68 | 0.6208 | 0.0181 | 0.6913 |
| 0.5597 | 3.0 | 102 | 0.6107 | 0.1005 | 0.6922 |
| 0.518 | 4.0 | 136 | 0.6409 | 0.1455 | 0.6989 |
| 0.4605 | 5.0 | 170 | 0.6806 | 0.1928 | 0.7028 |
| 0.4108 | 6.0 | 204 | 0.7226 | 0.1943 | 0.7037 |
| 0.3721 | 7.0 | 238 | 0.7162 | 0.1746 | 0.6826 |
| 0.3206 | 8.0 | 272 | 0.8593 | 0.1567 | 0.6826 |
### Framework versions
- Transformers 4.51.2
- Pytorch 2.6.0+cu126
- Datasets 3.5.0
- Tokenizers 0.21.1
|
Varinder2110/f45662fb-3420-4734-bdbc-633f329f71ca | Varinder2110 | 2025-06-15T18:44:57Z | 0 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T18:00:32Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: TOK
---
# F45662Fb 3420 4734 Bdbc 633F329F71Ca
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `TOK` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "TOK",
"lora_weights": "https://huggingface.co/Varinder2110/f45662fb-3420-4734-bdbc-633f329f71ca/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('Varinder2110/f45662fb-3420-4734-bdbc-633f329f71ca', weight_name='lora.safetensors')
image = pipeline('TOK').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 4000
- Learning rate: 0.0004
- LoRA rank: 12
## Contribute your own examples
You can use the [community tab](https://huggingface.co/Varinder2110/f45662fb-3420-4734-bdbc-633f329f71ca/discussions) to add images that show off what you’ve made with this LoRA.
|
JosephTreitel/reddit-lora-V3 | JosephTreitel | 2025-06-15T18:39:48Z | 0 | 1 | null | [
"safetensors",
"mistral",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:18:18Z | ---
license: apache-2.0
---
|
BootesVoid/cmbxwm6wh027lrdqs6c7udorq_cmbxwwd5a028mrdqsf4hpeuhh | BootesVoid | 2025-06-15T18:37:52Z | 0 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T18:37:50Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: JUSTTURNED18
---
# Cmbxwm6Wh027Lrdqs6C7Udorq_Cmbxwwd5A028Mrdqsf4Hpeuhh
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `JUSTTURNED18` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "JUSTTURNED18",
"lora_weights": "https://huggingface.co/BootesVoid/cmbxwm6wh027lrdqs6c7udorq_cmbxwwd5a028mrdqsf4hpeuhh/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('BootesVoid/cmbxwm6wh027lrdqs6c7udorq_cmbxwwd5a028mrdqsf4hpeuhh', weight_name='lora.safetensors')
image = pipeline('JUSTTURNED18').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 2000
- Learning rate: 0.0004
- LoRA rank: 16
## Contribute your own examples
You can use the [community tab](https://huggingface.co/BootesVoid/cmbxwm6wh027lrdqs6c7udorq_cmbxwwd5a028mrdqsf4hpeuhh/discussions) to add images that show off what you’ve made with this LoRA.
|
vex1522/baseline-summary-model | vex1522 | 2025-06-15T18:35:59Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"bart",
"text2text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | text2text-generation | 2025-06-15T18:04:38Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
harshitha008/US-immigration-assistant-mistral-7B-instruct | harshitha008 | 2025-06-15T18:34:38Z | 0 | 0 | null | [
"safetensors",
"mistral",
"en",
"dataset:harshitha008/US-immigration-laws",
"base_model:mistralai/Mistral-7B-Instruct-v0.3",
"base_model:finetune:mistralai/Mistral-7B-Instruct-v0.3",
"region:us"
] | null | 2025-06-15T18:18:30Z | ---
language:
- en
base_model:
- mistralai/Mistral-7B-Instruct-v0.3
datasets:
- harshitha008/US-immigration-laws
--- |
GetnetWA/Bert_Question_Ans | GetnetWA | 2025-06-15T18:29:07Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"bert",
"question-answering",
"generated_from_trainer",
"base_model:google-bert/bert-base-uncased",
"base_model:finetune:google-bert/bert-base-uncased",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | question-answering | 2025-06-13T18:31:34Z | ---
library_name: transformers
license: apache-2.0
base_model: bert-base-uncased
tags:
- generated_from_trainer
model-index:
- name: Bert_Question_Ans
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# Bert_Question_Ans
This model is a fine-tuned version of [bert-base-uncased](https://huggingface.co/bert-base-uncased) on an unknown dataset.
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 16
- eval_batch_size: 16
- seed: 42
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- num_epochs: 1
### Training results
### Framework versions
- Transformers 4.52.4
- Pytorch 2.7.0+cu118
- Datasets 3.6.0
- Tokenizers 0.21.1
|
alicebochkareva/goncharova_style_LoRA | alicebochkareva | 2025-06-15T18:29:03Z | 11 | 0 | diffusers | [
"diffusers",
"tensorboard",
"text-to-image",
"diffusers-training",
"lora",
"template:sd-lora",
"stable-diffusion-xl",
"stable-diffusion-xl-diffusers",
"base_model:stabilityai/stable-diffusion-xl-base-1.0",
"base_model:adapter:stabilityai/stable-diffusion-xl-base-1.0",
"license:openrail++",
"region:us"
] | text-to-image | 2025-06-14T16:08:25Z | ---
base_model: stabilityai/stable-diffusion-xl-base-1.0
library_name: diffusers
license: openrail++
instance_prompt: photo collage in GONCHAROVA style
widget: []
tags:
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
- text-to-image
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
---
<!-- This model card has been generated automatically according to the information the training script had access to. You
should probably proofread and complete it, then remove this comment. -->
# SDXL LoRA DreamBooth - alicebochkareva/goncharova_style_LoRA
<Gallery />
## Model description
These are alicebochkareva/goncharova_style_LoRA LoRA adaption weights for stabilityai/stable-diffusion-xl-base-1.0.
The weights were trained using [DreamBooth](https://dreambooth.github.io/).
LoRA for the text encoder was enabled: False.
Special VAE used for training: madebyollin/sdxl-vae-fp16-fix.
## Trigger words
You should use photo collage in GONCHAROVA style to trigger the image generation.
## Download model
Weights for this model are available in Safetensors format.
[Download](alicebochkareva/goncharova_style_LoRA/tree/main) them in the Files & versions tab.
## Intended uses & limitations
#### How to use
```python
# TODO: add an example code snippet for running this diffusion pipeline
```
#### Limitations and bias
[TODO: provide examples of latent issues and potential remediations]
## Training details
[TODO: describe the data used to train the model] |
BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8 | BootesVoid | 2025-06-15T18:27:33Z | 0 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T18:27:23Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: AVA01
---
# Cmbxolqt401Oardqsvxij32Dm_Cmbxy8Hyr02Bprdqshbtcjxr8
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `AVA01` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "AVA01",
"lora_weights": "https://huggingface.co/BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8', weight_name='lora.safetensors')
image = pipeline('AVA01').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 2000
- Learning rate: 0.0004
- LoRA rank: 16
## Contribute your own examples
You can use the [community tab](https://huggingface.co/BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8/discussions) to add images that show off what you’ve made with this LoRA.
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.25_epoch1 | MinaMila | 2025-06-15T18:27:04Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:25:02Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Pouyatr/blob_Qwen2.5-0.5B-Instruct_BOSS_5001 | Pouyatr | 2025-06-15T18:25:56Z | 0 | 0 | peft | [
"peft",
"safetensors",
"arxiv:1910.09700",
"base_model:Qwen/Qwen2.5-0.5B-Instruct",
"base_model:adapter:Qwen/Qwen2.5-0.5B-Instruct",
"region:us"
] | null | 2025-06-15T15:18:58Z | ---
base_model: Qwen/Qwen2.5-0.5B-Instruct
library_name: peft
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
### Framework versions
- PEFT 0.14.0 |
emanuelcarneiro8213/lummgh | emanuelcarneiro8213 | 2025-06-15T18:25:34Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
raquelleite2757/zv | raquelleite2757 | 2025-06-15T18:25:34Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
ritamorais3844/hrt | ritamorais3844 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
vicenterocha7258/lumz | vicenterocha7258 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
miaandrade9818/lumdg | miaandrade9818 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
fernandocosta9708/llk | fernandocosta9708 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
utkuden/qlora_paligemma_MIXft_decoder_only_rank16-SCST-CIDEr0.1586 | utkuden | 2025-06-15T18:23:36Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:23:22Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.5_epoch2 | MinaMila | 2025-06-15T18:18:48Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:16:56Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
JonLoRA/deynairaLoRAv1 | JonLoRA | 2025-06-15T18:17:55Z | 0 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T16:21:56Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: photo of a girl
---
# Deynairalorav1
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `photo of a girl` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "photo of a girl",
"lora_weights": "https://huggingface.co/JonLoRA/deynairaLoRAv1/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('JonLoRA/deynairaLoRAv1', weight_name='lora.safetensors')
image = pipeline('photo of a girl').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 6000
- Learning rate: 0.0002
- LoRA rank: 64
## Contribute your own examples
You can use the [community tab](https://huggingface.co/JonLoRA/deynairaLoRAv1/discussions) to add images that show off what you’ve made with this LoRA.
|
gradientrouting-spar/horizontal_2_proxy_ntrain_25_ntrig_9_negative_3x3_seed_1_seed_25_20250615_180710 | gradientrouting-spar | 2025-06-15T18:16:28Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:16:20Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
shwabler/lithuanian-gemma-4b-bnb-4bit | shwabler | 2025-06-15T18:15:44Z | 0 | 1 | null | [
"safetensors",
"unsloth",
"license:mit",
"region:us"
] | null | 2025-06-15T12:49:53Z | ---
license: mit
tags:
- unsloth
---
|
vinnvinn/mistral-hugz | vinnvinn | 2025-06-15T18:13:06Z | 0 | 1 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:13:03Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
kayte0342/iphone_glam | kayte0342 | 2025-06-15T18:12:48Z | 1 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T00:46:05Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: glamcam
---
# Iphone_Glam
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `glamcam` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "glamcam",
"lora_weights": "https://huggingface.co/kayte0342/iphone_glam/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('kayte0342/iphone_glam', weight_name='lora.safetensors')
image = pipeline('glamcam').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 1000
- Learning rate: 0.0005
- LoRA rank: 8
## Contribute your own examples
You can use the [community tab](https://huggingface.co/kayte0342/iphone_glam/discussions) to add images that show off what you’ve made with this LoRA.
|
MichiganNLP/tama-5e-7 | MichiganNLP | 2025-06-15T18:08:31Z | 10 | 0 | null | [
"safetensors",
"llama",
"table",
"text-generation",
"conversational",
"en",
"arxiv:2501.14693",
"base_model:meta-llama/Llama-3.1-8B-Instruct",
"base_model:finetune:meta-llama/Llama-3.1-8B-Instruct",
"license:mit",
"region:us"
] | text-generation | 2024-12-11T00:50:43Z | ---
license: mit
language:
- en
base_model:
- meta-llama/Llama-3.1-8B-Instruct
pipeline_tag: text-generation
tags:
- table
---
# Model Card for TAMA-5e-7
<!-- Provide a quick summary of what the model is/does. -->
Recent advances in table understanding have focused on instruction-tuning large language models (LLMs) for table-related tasks. However, existing research has overlooked the impact of hyperparameter choices, and also lacks a comprehensive evaluation of the out-of-domain table understanding ability and the general capabilities of these table LLMs. In this paper, we evaluate these abilities in existing table LLMs, and find significant declines in both out-of-domain table understanding and general capabilities as compared to their base models.
Through systematic analysis, we show that hyperparameters, such as learning rate, can significantly influence both table-specific and general capabilities. Contrary to the previous table instruction-tuning work, we demonstrate that smaller learning rates and fewer training instances can enhance table understanding while preserving general capabilities. Based on our findings, we introduce TAMA, a TAble LLM instruction-tuned from LLaMA 3.1 8B Instruct, which achieves performance on par with, or surpassing GPT-3.5 and GPT-4 on table tasks, while maintaining strong out-of-domain generalization and general capabilities. Our findings highlight the potential for reduced data annotation costs and more efficient model development through careful hyperparameter selection.
## 🚀 Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
- **Model type:** Text generation.
- **Language(s) (NLP):** English.
- **License:** [[License for Llama models](https://github.com/meta-llama/llama-models/blob/main/models/llama3_1/LICENSE))]
- **Finetuned from model:** [[meta-llama/Llama-3.1-8b-Instruct](https://huggingface.co/meta-llama/Llama-3.1-8B-Instruct)]
### Model Sources
<!-- Provide the basic links for the model. -->
- **Repository:** [[github](https://github.com/MichiganNLP/TAMA)]
- **Paper:** [[paper](https://arxiv.org/abs/2501.14693)]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
TAMA is intended for the use in table understanding tasks and to facilitate future research.
## 🔨 How to Get Started with the Model
Use the code below to get started with the model.
Starting with `transformers >= 4.43.0` onward, you can run conversational inference using the Transformers pipeline abstraction or by leveraging the Auto classes with the generate() function.
Make sure to update your transformers installation via `pip install --upgrade transformers`.
```
import transformers
import torch
model_id = "MichiganNLP/tama-5e-7"
pipeline = transformers.pipeline(
"text-generation", model=model_id, model_kwargs={"torch_dtype": torch.bfloat16}, device_map="auto"
)
pipeline("Hey how are you doing today?")
```
You may replace the prompt with table-specific instructions. We recommend using the following prompt structure:
```
Below is an instruction that describes a task, paired with an input that provides further context. Write a response that
appropriately completes the request.
### Instruction:
{instruction}
### Input:
{table_content}
### Question:
{question}
### Response:
```
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[TAMA Instruct](https://huggingface.co/datasets/MichiganNLP/TAMA_Instruct).
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
We utilize the [LLaMA Factory](https://github.com/hiyouga/LLaMA-Factory) library for model training and inference. Example YAML configuration files are provided [here](https://github.com/MichiganNLP/TAMA/blob/main/yamls/train.yaml).
The training command is:
```
llamafactory-cli train yamls/train.yaml
```
#### Training Hyperparameters
- **Training regime:** bf16
- **Training epochs:** 2.0
- **Learning rate scheduler:** linear
- **Cutoff length:** 2048
- **Learning rate**: 5e-7
## 📝 Evaluation
### Results
<!-- This should link to a Dataset Card if possible. -->
<table>
<tr>
<th>Models</th>
<th>FeTaQA</th>
<th>HiTab</th>
<th>TaFact</th>
<th>FEVEROUS</th>
<th>WikiTQ</th>
<th>WikiSQL</th>
<th>HybridQA</th>
<th>TATQA</th>
<th>AIT-QA</th>
<th>TABMWP</th>
<th>InfoTabs</th>
<th>KVRET</th>
<th>ToTTo</th>
<th>TableGPT<sub>subset</sub></th>
<th>TableBench</th>
</tr>
<tr>
<th>Metrics</th>
<th>BLEU</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Micro F1</th>
<th>BLEU</th>
<th>Acc</th>
<th>ROUGE-L</th>
</tr>
<tr>
<td>GPT-3.5</td>
<td><u>26.49</u></td>
<td>43.62</td>
<td>67.41</td>
<td>60.79</td>
<td><u>53.13</u></td>
<td>41.91</td>
<td>40.22</td>
<td>31.38</td>
<td>84.13</td>
<td>46.30</td>
<td>56.00</td>
<td><u>54.56</u></td>
<td><u>16.81</u></td>
<td>54.80</td>
<td>27.75</td>
</tr>
<tr>
<td>GPT-4</td>
<td>21.70</td>
<td><u>48.40</u></td>
<td><b>74.40</b></td>
<td><u>71.60</u></td>
<td><b>68.40</b></td>
<td><u>47.60</u></td>
<td><u>58.60</u></td>
<td><b>55.81</b></td>
<td><u>88.57</u></td>
<td><b>67.10</b></td>
<td><u>58.60</u></td>
<td><b>56.46</b></td>
<td>12.21</td>
<td><b>80.20</b></td>
<td><b>40.38</b></td>
</tr>
<tr>
<td>base</td>
<td>15.33</td>
<td>32.83</td>
<td>58.44</td>
<td>66.37</td>
<td>43.46</td>
<td>20.43</td>
<td>32.83</td>
<td>26.70</td>
<td>82.54</td>
<td>39.97</td>
<td>48.39</td>
<td>50.80</td>
<td>13.24</td>
<td>53.60</td>
<td>23.47</td>
</tr>
<tr>
<td>TAMA</td>
<td><b>35.37</b></td>
<td><b>63.51</b></td>
<td><u>73.82</u></td>
<td><b>77.39</b></td>
<td>52.88</td>
<td><b>68.31</b></td>
<td><b>60.86</b></td>
<td><u>48.47</u></td>
<td><b>89.21</b></td>
<td><u>65.09</u></td>
<td><b>64.54</b></td>
<td>43.94</td>
<td><b>37.94</b></td>
<td><u>53.60</u></td>
<td><u>28.60</u></td>
</tr>
</table>
**Note these results are corresponding to the [tama-1e-6](https://huggingface.co/MichiganNLP/tama-1e-6) checkpoint. We release the tama-5e-7 checkpoints for the purpose of facilitating future research.**
We make the number bold if it is the best among the four, we underline the number if it is at the second place.
Please refer to our [paper](https://arxiv.org/abs/2501.14693) for additional details.
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
Please refer to our [paper](https://arxiv.org/abs/2501.14693) for additional details.
#### Summary
Notably, as an 8B model, TAMA demonstrates strong table understanding ability, outperforming GPT-3.5 on most of the table understanding benchmarks, even achieving performance on par or better than GPT-4.
## Technical Specifications
### Model Architecture and Objective
We base our model on the [Llama-3.1-8B-Instruct model](https://huggingface.co/meta-llama/Llama-3.1-8B-Instruct).
We instruction tune the model on a set of 2,600 table instructions.
### Compute Infrastructure
#### Hardware
We conduct our experiments on A40 and A100 GPUs.
#### Software
We leverage the [LLaMA Factory](https://github.com/hiyouga/LLaMA-Factory) for model training.
## Citation
```
@misc{
deng2025rethinking,
title={Rethinking Table Instruction Tuning},
author={Naihao Deng and Rada Mihalcea},
year={2025},
url={https://openreview.net/forum?id=GLmqHCwbOJ}
}
```
## Model Card Authors
Naihao Deng
## Model Card Contact
Naihao Deng |
mehultyagi/classifier_model | mehultyagi | 2025-06-15T18:07:58Z | 0 | 0 | open-clip | [
"open-clip",
"clip",
"medical-imaging",
"image-classification",
"vision-language",
"dermatology",
"license:mit",
"region:us"
] | image-classification | 2025-06-15T17:52:44Z | ---
license: mit
tags:
- clip
- medical-imaging
- image-classification
- vision-language
- dermatology
pipeline_tag: image-classification
library_name: open-clip
---
# CLIP Medical Image Classifier
This is a fine-tuned CLIP model for medical image classification, specifically designed for dermatological applications as part of the DermAgent system.
## Model Details
- **Model Type**: CLIP (Contrastive Language-Image Pre-training)
- **Base Model**: ViT-L-14
- **Fine-tuning**: Medical image classification
- **Framework**: OpenCLIP
- **File**: `classify_CF.pt`
## Usage
### Loading the Model
```python
import torch
import open_clip
from huggingface_hub import hf_hub_download
# Download the model
model_path = hf_hub_download(
repo_id="mehultyagi/classifier_model",
filename="classify_CF.pt"
)
# Load the checkpoint
checkpoint = torch.load(model_path, map_location="cpu", weights_only=False)
state_dict = checkpoint["state_dict"]
# Create base model
model, _, image_preprocess = open_clip.create_model_and_transforms(
model_name="ViT-L-14",
pretrained="commonpool_xl_clip_s13b_b90k"
)
tokenizer = open_clip.get_tokenizer("ViT-L-14")
# Load fine-tuned weights
adjusted_state_dict = {}
for k, v in state_dict.items():
name = k[7:] if k.startswith('module.') else k
adjusted_state_dict[name] = v
model.load_state_dict(adjusted_state_dict, strict=False)
model.eval()
# Move to device
device = "cuda" if torch.cuda.is_available() else "cpu"
model.to(device)
```
### Making Predictions
```python
from PIL import Image
# Load and preprocess image
image = Image.open("medical_image.jpg")
image_processed = image_preprocess(image).unsqueeze(0).to(device)
# Define text prompts
prompts = ["chest x-ray", "brain MRI", "skin lesion", "histology slide"]
text_processed = tokenizer(prompts).to(device)
# Get predictions
with torch.no_grad():
image_features = model.encode_image(image_processed)
text_features = model.encode_text(text_processed)
# Normalize features
image_features /= image_features.norm(dim=-1, keepdim=True)
text_features /= text_features.norm(dim=-1, keepdim=True)
# Calculate similarities
logits_per_image = (100.0 * image_features @ text_features.T)
probs = logits_per_image.softmax(dim=-1)
# Print results
for prompt, prob in zip(prompts, probs.squeeze()):
print(f"{prompt}: {prob:.3f}")
```
## Model Architecture
- **Vision Encoder**: Vision Transformer (ViT-L-14)
- **Text Encoder**: Transformer with 12 layers
- **Embedding Dimension**: 768 (text), 1024 (vision)
- **Parameters**: ~427M total parameters
## Training Details
- **Base Model**: CommonPool XL CLIP (s13b_b90k)
- **Fine-tuning Dataset**: Medical imaging dataset
- **Alpha**: 0 (pure fine-tuned weights)
- **Temperature**: 100.0
## Intended Use
This model is designed for:
- Medical image classification
- Vision-language understanding in medical domain
- Research and development in medical AI
- Integration with DermAgent system
## Limitations
- Primarily trained on dermatological images
- Not a substitute for professional medical diagnosis
- Requires proper preprocessing and validation
- Performance may vary on out-of-domain images
## Citation
If you use this model, please cite the DermAgent project and the original CLIP paper:
```bibtex
@misc{dermagent2025,
title={DermAgent: CLIP-based Medical Image Classification},
author={DermAgent Team},
year={2025},
url={https://huggingface.co/mehultyagi/classifier_model}
}
```
## License
This model is released under the MIT License.
## Contact
For questions and support, please open an issue in the repository.
|
gradientrouting-spar/horizontal_2_proxy_ntrain_25_ntrig_9_negative_3x3_seed_1_20250615_175706 | gradientrouting-spar | 2025-06-15T18:07:01Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:06:16Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Baselhany/Graduation_Project_Distil_Whisper_base2 | Baselhany | 2025-06-15T18:04:31Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"whisper",
"automatic-speech-recognition",
"generated_from_trainer",
"ar",
"base_model:openai/whisper-base",
"base_model:finetune:openai/whisper-base",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | automatic-speech-recognition | 2025-06-15T09:49:59Z | ---
library_name: transformers
language:
- ar
license: apache-2.0
base_model: openai/whisper-base
tags:
- generated_from_trainer
metrics:
- wer
model-index:
- name: Whisper base AR - BA
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# Whisper base AR - BA
This model is a fine-tuned version of [openai/whisper-base](https://huggingface.co/openai/whisper-base) on the quran-ayat-speech-to-text dataset.
It achieves the following results on the evaluation set:
- Loss: 0.1809
- Wer: 0.4774
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0001
- train_batch_size: 8
- eval_batch_size: 8
- seed: 42
- gradient_accumulation_steps: 4
- total_train_batch_size: 32
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- lr_scheduler_warmup_steps: 500
- num_epochs: 15
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer |
|:-------------:|:-------:|:----:|:---------------:|:------:|
| 49.0689 | 1.0 | 469 | 0.1955 | 0.6004 |
| 15.5249 | 2.0 | 938 | 0.1855 | 0.4906 |
| 8.4665 | 3.0 | 1407 | 0.1805 | 0.5239 |
| 5.8809 | 4.0 | 1876 | 0.1820 | 0.4664 |
| 4.1184 | 5.0 | 2345 | 0.1855 | 0.4953 |
| 2.9723 | 6.0 | 2814 | 0.1793 | 0.4701 |
| 2.4686 | 7.0 | 3283 | 0.1762 | 0.5146 |
| 2.2442 | 8.0 | 3752 | 0.1725 | 0.4972 |
| 1.8777 | 9.0 | 4221 | 0.1690 | 0.5180 |
| 1.6763 | 10.0 | 4690 | 0.1677 | 0.5093 |
| 1.4913 | 11.0 | 5159 | 0.1676 | 0.5152 |
| 1.3849 | 12.0 | 5628 | 0.1673 | 0.4668 |
| 1.3206 | 13.0 | 6097 | 0.1678 | 0.4551 |
| 1.2612 | 14.0 | 6566 | 0.1677 | 0.4629 |
| 1.1089 | 14.9685 | 7020 | 0.1682 | 0.4769 |
### Framework versions
- Transformers 4.51.3
- Pytorch 2.6.0+cu124
- Datasets 3.6.0
- Tokenizers 0.21.1
|
VIDEOS-18-nulook-india-Hot-video/Original.Full.Clip.nulook.india.Viral.Video.Leaks.Official | VIDEOS-18-nulook-india-Hot-video | 2025-06-15T18:04:31Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:04:06Z | <animated-image data-catalyst=""><a href="https://sexleakedviral.com/new-leaked-video/?news-viral-video" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a> |
meezo-fun-tv/Video.meezo.fun.trending.viral.Full.Video.telegram | meezo-fun-tv | 2025-06-15T18:03:28Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:02:55Z | <a rel="nofollow" href="https://viralflix.xyz/leaked/?sd">🔴 CLICK HERE 🌐==►► Download Now)</a>
<a rel="nofollow" href="https://viralflix.xyz/leaked/?sd"><img src="https://i.postimg.cc/qvPp49Sm/ythngythg.gif" alt="fsd"></a>
<a rel="nofollow" href="https://anyplacecoming.com/zq5yqv0i?key=0256cc3e9f81675f46e803a0abffb9bf/">🌐 Viral Video Original Full HD🟢==►► WATCH NOW</a> |
multimolecule/aido.rna-1.6b-ss | multimolecule | 2025-06-15T18:02:50Z | 0 | 0 | multimolecule | [
"multimolecule",
"pytorch",
"safetensors",
"aido.rna",
"Biology",
"RNA",
"rna",
"dataset:multimolecule/bprna-spot",
"dataset:multimolecule/archiveii",
"base_model:multimolecule/aido.rna-1.6b",
"base_model:finetune:multimolecule/aido.rna-1.6b",
"license:agpl-3.0",
"region:us"
] | null | 2025-06-15T17:58:32Z | ---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/bprna-spot
- multimolecule/archiveii
library_name: multimolecule
base_model: multimolecule/aido.rna-1.6b
---
# AIDO.RNA
Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective.
## Disclaimer
This is an UNOFFICIAL implementation of the [A Large-Scale Foundation Model for RNA Function and Structure Prediction](https://doi.org/10.1101/2024.11.28.625345) by Shuxian Zou, Tianhua Tao, Sazan Mahbub, et al.
The OFFICIAL repository of AIDO.RNA is at [genbio-ai/AIDO](https://github.com/genbio-ai/AIDO).
> [!WARNING]
> The MultiMolecule team is aware of a potential risk in reproducing the results of AIDO.RNA.
>
> The original implementation of AIDO.RNA uses a special tokenizer that identifies `U` and `T` as different tokens.
>
> This behaviour is not supported by MultiMolecule.
> [!TIP]
> The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing AIDO.RNA did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
AIDO.RNA is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
### Variants
- **[multimolecule/aido.rna-1.6b](https://huggingface.co/multimolecule/aido.rna-1.6b)**: The AIDO.RNA model with 1.6 billion parameters.
- **[multimolecule/aido.rna-650m](https://huggingface.co/multimolecule/aido.rna-650m)**: The AIDO.RNA model with 650 million parameters.
### Model Specification
<table>
<thead>
<tr>
<th>Variants</th>
<th>Num Layers</th>
<th>Hidden Size</th>
<th>Num Heads</th>
<th>Intermediate Size</th>
<th>Num Parameters (M)</th>
<th>FLOPs (G)</th>
<th>MACs (G)</th>
<th>Max Num Tokens</th>
</tr>
</thead>
<tbody>
<tr>
<td>AIDO.RNA-1.6B</td>
<td>32</td>
<td>2048</td>
<td>32</td>
<td>5440</td>
<td>1650.29</td>
<td>415.67</td>
<td>207.77</td>
<td rowspan="2">1022</td>
</tr>
<tr>
<td>AIDO.RNA-650M</td>
<td>33</td>
<td>1280</td>
<td>20</td>
<td>3392</td>
<td>648.38</td>
<td>168.25</td>
<td>80.09</td>
</tr>
</tbody>
</table>
### Links
- **Code**: [multimolecule.aido_rna](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/aido_rna)
- **Weights**: [multimolecule/aido.rna](https://huggingface.co/multimolecule/aido.rna)
- **Data**: [multimolecule/rnacentral](https://huggingface.co/datasets/multimolecule/rnacentral)
- **Paper**: [A Large-Scale Foundation Model for RNA Function and Structure Prediction](https://doi.org/10.1101/2024.11.28.625345)
- **Developed by**: Shuxian Zou, Tianhua Tao, Sazan Mahbub, Caleb N. Ellington, Robin Algayres, Dian Li, Yonghao Zhuang, Hongyi Wang, Le Song, Eric P. Xing
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased)
- **Original Repository**: [genbio-ai/AIDO](https://github.com/genbio-ai/AIDO)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
You can use this model directly with a pipeline for secondary structure prediction:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> predictor = pipeline("rna-secondary-structure", model="multimolecule/aido.rna-ss")
>>> predictor("GGUCUCUGGUUAGACCAGAUCUGAGCCU")
{'sequence': 'GGUCUCUGGUUAGACCAGAUCUGAGCCU',
'secondary_structure': '.(((((([(.....).)...].))))).'}
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, AidoRnaModel
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaModel.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
output = model(**input)
```
#### Sequence Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, AidoRnaForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaForSequencePrediction.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Token Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, AidoRnaForTokenPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaForTokenPrediction.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, AidoRnaForContactPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaForContactPrediction.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
AIDO.RNA used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The AIDO.RNA model was pre-trained on [RNAcentral](https://multimolecule.danling.org/datasets/rnacentral) and [MARS](https://ngdc.cncb.ac.cn/omix/release/OMIX003037).
RNAcentral is a free, public resource that offers integrated access to a comprehensive and up-to-date set of non-coding RNA sequences provided by a collaborating group of [Expert Databases](https://rnacentral.org/expert-databases) representing a broad range of organisms and RNA types.
AIDO.RNA applied SeqKit to remove duplicated sequences in the RNAcentral, resulting 42 million unique sequences.
Note that AIDO.RNA identifies `U` and `T` as different tokens, which is not supported by MultiMolecule. During model conversion, the embeddings of `T` is discarded. This means that the model will not be able to distinguish between `U` and `T` in the input sequences.
### Training Procedure
#### Preprocessing
AIDO.RNA used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### Pre-training
- Epochs: 6
- Optimizer: AdamW
- Learning rate: 5e-5
- Learning rate warm-up: 2,000 steps
- Learning rate scheduler: Cosine
- Minimum learning rate: 1e-5
- Weight decay: 0.01
## Citation
**BibTeX**:
```bibtex
@article {Zou2024.11.28.625345,
author = {Zou, Shuxian and Tao, Tianhua and Mahbub, Sazan and Ellington, Caleb N. and Algayres, Robin and Li, Dian and Zhuang, Yonghao and Wang, Hongyi and Song, Le and Xing, Eric P.},
title = {A Large-Scale Foundation Model for RNA Function and Structure Prediction},
elocation-id = {2024.11.28.625345},
year = {2024},
doi = {10.1101/2024.11.28.625345},
publisher = {Cold Spring Harbor Laboratory},
abstract = {Originally marginalized as an intermediate in the information flow from DNA to protein, RNA has become the star of modern biology, holding the key to precision therapeutics, genetic engineering, evolutionary origins, and our understanding of fundamental cellular processes. Yet RNA is as mysterious as it is prolific, serving as an information store, a messenger, and a catalyst, spanning many underchar-acterized functional and structural classes. Deciphering the language of RNA is important not only for a mechanistic understanding of its biological functions but also for accelerating drug design. Toward this goal, we introduce AIDO.RNA, a pre-trained module for RNA in an AI-driven Digital Organism [1]. AIDO.RNA contains a scale of 1.6 billion parameters, trained on 42 million non-coding RNA (ncRNA) sequences at single-nucleotide resolution, and it achieves state-of-the-art performance on a comprehensive set of tasks, including structure prediction, genetic regulation, molecular function across species, and RNA sequence design. AIDO.RNA after domain adaptation learns to model essential parts of protein translation that protein language models, which have received widespread attention in recent years, do not. More broadly, AIDO.RNA hints at the generality of biological sequence modeling and the ability to leverage the central dogma to improve many biomolecular representations. Models and code are available through ModelGenerator in https://github.com/genbio-ai/AIDO and on Hugging Face.Competing Interest StatementThe authors have declared no competing interest.},
URL = {https://www.biorxiv.org/content/early/2024/11/29/2024.11.28.625345},
eprint = {https://www.biorxiv.org/content/early/2024/11/29/2024.11.28.625345.full.pdf},
journal = {bioRxiv}
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [AIDO.RNA paper](https://doi.org/10.1101/2024.11.28.625345) for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|
Peacemann/mistralai_Mistral-7B-Instruct-v0.2_LMUL | Peacemann | 2025-06-15T18:02:43Z | 0 | 0 | null | [
"safetensors",
"mistral",
"L-Mul,",
"optimazation",
"quantization",
"text-generation",
"research",
"experimental",
"conversational",
"base_model:mistralai/Mistral-7B-Instruct-v0.2",
"base_model:finetune:mistralai/Mistral-7B-Instruct-v0.2",
"license:apache-2.0",
"region:us"
] | text-generation | 2025-06-15T17:56:57Z | ---
license: apache-2.0
base_model: mistralai/Mistral-7B-Instruct-v0.2
tags:
- L-Mul,
- optimazation
- quantization
- text-generation
- research
- experimental
---
# L-Mul Optimized: mistralai/Mistral-7B-Instruct-v0.2
This is a modified version of Mistral AI's [Mistral-7B-Instruct-v0.2](https://huggingface.co/mistralai/Mistral-7B-Instruct-v0.2) model. The modification consists of replacing the standard attention mechanism with one that uses a custom, approximate matrix multiplication algorithm termed "L-Mul".
This work was performed as part of a research project to evaluate the performance and accuracy trade-offs of algorithmic substitutions in transformer architectures.
**This model is intended strictly for educational and scientific purposes.**
## Model Description
The core architecture of `mistralai/Mistral-7B-Instruct-v0.2` is preserved. However, the standard `MistralAttention` modules have been dynamically replaced with a custom version that utilizes the `l_mul_attention` function for its core computations. This function is defined in the `lmul.py` file included in this repository.
- **Base Model:** [mistralai/Mistral-7B-Instruct-v0.2](https://huggingface.co/mistralai/Mistral-7B-Instruct-v0.2)
- **Modification:** Replacement of standard attention with L-Mul approximate attention.
- **Primary Use-Case:** Research and educational analysis of algorithmic impact on LLMs.
## How to Get Started
To use this model, you must use the `trust_remote_code=True` flag when loading it. This is required to execute the custom `lmul.py` file that defines the new attention mechanism.
You can load the model directly from this repository using the `transformers` library:
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
# Define the repository ID for the specific model
repo_id = "Peacemann/mistralai_Mistral-7B-Instruct-v0.2-lmul-attention" # Replace with the correct repo ID if different
# Load the tokenizer and model, trusting the remote code to load lmul.py
tokenizer = AutoTokenizer.from_pretrained(repo_id)
model = AutoModelForCausalLM.from_pretrained(
repo_id,
trust_remote_code=True,
torch_dtype=torch.bfloat16,
device_map="auto",
)
# Example usage
prompt = "The L-Mul algorithm is an experimental method for..."
inputs = tokenizer(prompt, return_tensors="pt").to(model.device)
outputs = model.generate(**inputs, max_new_tokens=50)
print(tokenizer.decode(outputs[0], skip_special_tokens=True))
```
## Intended Uses & Limitations
This model is intended for researchers and students exploring the internal workings of LLMs. It is a tool for visualizing and analyzing the effects of fundamental algorithmic changes.
**This model is NOT intended for any commercial or production application.**
The modification is experimental. The impact on the model's performance, safety alignment, accuracy, and potential for generating biased or harmful content is **unknown and untested**.
## Licensing Information
The use of this model is subject to the original **Apache 2.0 License**. By using this model, you agree to the terms outlined in the license. |
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.75_epoch2 | MinaMila | 2025-06-15T18:02:41Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:00:47Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
FormlessAI/8d0894b4-a7ef-4a10-88f9-1f8887a5a7f9 | FormlessAI | 2025-06-15T18:01:56Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"generated_from_trainer",
"trl",
"grpo",
"arxiv:2402.03300",
"base_model:teknium/OpenHermes-2.5-Mistral-7B",
"base_model:finetune:teknium/OpenHermes-2.5-Mistral-7B",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T12:19:57Z | ---
base_model: teknium/OpenHermes-2.5-Mistral-7B
library_name: transformers
model_name: 8d0894b4-a7ef-4a10-88f9-1f8887a5a7f9
tags:
- generated_from_trainer
- trl
- grpo
licence: license
---
# Model Card for 8d0894b4-a7ef-4a10-88f9-1f8887a5a7f9
This model is a fine-tuned version of [teknium/OpenHermes-2.5-Mistral-7B](https://huggingface.co/teknium/OpenHermes-2.5-Mistral-7B).
It has been trained using [TRL](https://github.com/huggingface/trl).
## Quick start
```python
from transformers import pipeline
question = "If you had a time machine, but could only go to the past or the future once and never return, which would you choose and why?"
generator = pipeline("text-generation", model="FormlessAI/8d0894b4-a7ef-4a10-88f9-1f8887a5a7f9", device="cuda")
output = generator([{"role": "user", "content": question}], max_new_tokens=128, return_full_text=False)[0]
print(output["generated_text"])
```
## Training procedure
[<img src="https://raw.githubusercontent.com/wandb/assets/main/wandb-github-badge-28.svg" alt="Visualize in Weights & Biases" width="150" height="24"/>](https://wandb.ai/phoenix-formless/Gradients/runs/hosdy86c)
This model was trained with GRPO, a method introduced in [DeepSeekMath: Pushing the Limits of Mathematical Reasoning in Open Language Models](https://huggingface.co/papers/2402.03300).
### Framework versions
- TRL: 0.18.1
- Transformers: 4.52.4
- Pytorch: 2.7.0+cu128
- Datasets: 3.6.0
- Tokenizers: 0.21.1
## Citations
Cite GRPO as:
```bibtex
@article{zhihong2024deepseekmath,
title = {{DeepSeekMath: Pushing the Limits of Mathematical Reasoning in Open Language Models}},
author = {Zhihong Shao and Peiyi Wang and Qihao Zhu and Runxin Xu and Junxiao Song and Mingchuan Zhang and Y. K. Li and Y. Wu and Daya Guo},
year = 2024,
eprint = {arXiv:2402.03300},
}
```
Cite TRL as:
```bibtex
@misc{vonwerra2022trl,
title = {{TRL: Transformer Reinforcement Learning}},
author = {Leandro von Werra and Younes Belkada and Lewis Tunstall and Edward Beeching and Tristan Thrush and Nathan Lambert and Shengyi Huang and Kashif Rasul and Quentin Gallou{\'e}dec},
year = 2020,
journal = {GitHub repository},
publisher = {GitHub},
howpublished = {\url{https://github.com/huggingface/trl}}
}
``` |
mic3456/anneth | mic3456 | 2025-06-15T18:01:11Z | 0 | 0 | diffusers | [
"diffusers",
"text-to-image",
"flux",
"lora",
"template:sd-lora",
"fluxgym",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T18:00:54Z | ---
tags:
- text-to-image
- flux
- lora
- diffusers
- template:sd-lora
- fluxgym
base_model: black-forest-labs/FLUX.1-dev
instance_prompt: ath
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
---
# annehathaway2
A Flux LoRA trained on a local computer with [Fluxgym](https://github.com/cocktailpeanut/fluxgym)
<Gallery />
## Trigger words
You should use `ath` to trigger the image generation.
## Download model and use it with ComfyUI, AUTOMATIC1111, SD.Next, Invoke AI, Forge, etc.
Weights for this model are available in Safetensors format.
|
parveen-Official-Viral-Video-Link/18.Original.Full.Clip.parveen.Viral.Video.Leaks.Official | parveen-Official-Viral-Video-Link | 2025-06-15T18:00:08Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T17:59:49Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
DevQuasar/Nitral-AI.Irixxed-Magcap-12B-Slerp-GGUF | DevQuasar | 2025-06-15T18:00:03Z | 0 | 0 | null | [
"gguf",
"text-generation",
"base_model:Nitral-AI/Irixxed-Magcap-12B-Slerp",
"base_model:quantized:Nitral-AI/Irixxed-Magcap-12B-Slerp",
"endpoints_compatible",
"region:us",
"conversational"
] | text-generation | 2025-06-15T15:55:39Z | ---
base_model:
- Nitral-AI/Irixxed-Magcap-12B-Slerp
pipeline_tag: text-generation
---
[<img src="https://raw.githubusercontent.com/csabakecskemeti/devquasar/main/dq_logo_black-transparent.png" width="200"/>](https://devquasar.com)
Quantized version of: [Nitral-AI/Irixxed-Magcap-12B-Slerp](https://huggingface.co/Nitral-AI/Irixxed-Magcap-12B-Slerp)
'Make knowledge free for everyone'
<p align="center">
Made with <br>
<a href="https://www.civo.com/" target="_blank">
<img src="https://www.civo.com/assets/public/brand-assets/civo-logo-colour-60cc1622dedf346f7afde1fff760523f731b0aac106a5465af98ff4073114b74.svg" width="100"/>
</a>
</p>
<a href='https://ko-fi.com/L4L416YX7C' target='_blank'><img height='36' style='border:0px;height:36px;' src='https://storage.ko-fi.com/cdn/kofi6.png?v=6' border='0' alt='Buy Me a Coffee at ko-fi.com' /></a>
|
Akshat1912/AI_Healthcare | Akshat1912 | 2025-06-15T17:59:27Z | 0 | 0 | null | [
"license:other",
"region:us"
] | null | 2025-06-15T17:57:48Z | ---
license: other
license_name: aihealthcare
license_link: LICENSE
---
|
Peacemann/google_gemma-3-4b-it_LMUL | Peacemann | 2025-06-15T17:58:32Z | 0 | 0 | null | [
"L-Mul,",
"optimazation",
"quantization",
"text-generation",
"research",
"experimental",
"base_model:google/gemma-3-4b-it",
"base_model:finetune:google/gemma-3-4b-it",
"license:gemma",
"region:us"
] | text-generation | 2025-06-15T17:55:58Z | ---
base_model: google/gemma-3-4b-it
tags:
- L-Mul,
- optimazation
- quantization
- text-generation
- research
- experimental
license: gemma
---
# L-Mul Optimized: google/gemma-3-4b-it
This is a modified version of Google's [gemma-3-4b-it](https://huggingface.co/google/gemma-3-4b-it) model. The modification consists of replacing the standard attention mechanism with one that uses a custom, approximate matrix multiplication algorithm termed "L-Mul".
This work was performed as part of a research project to evaluate the performance and accuracy trade-offs of algorithmic substitutions in transformer architectures.
**This model is intended strictly for educational and scientific purposes.**
## Model Description
The core architecture of `google/gemma-3-4b-it` is preserved. However, the standard `Gemma3Attention` modules have been dynamically replaced with a custom version that utilizes the `l_mul_attention` function for its core computations. This function is defined in the `lmul.py` file included in this repository.
- **Base Model:** [google/gemma-3-4b-it](https://huggingface.co/google/gemma-3-4b-it)
- **Modification:** Replacement of standard attention with L-Mul approximate attention.
- **Primary Use-Case:** Research and educational analysis of algorithmic impact on LLMs.
## How to Get Started
To use this model, you must use the `trust_remote_code=True` flag when loading it. This is required to execute the custom `lmul.py` file that defines the new attention mechanism.
You can load the model directly from this repository using the `transformers` library:
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
# Define the repository ID for the specific model
repo_id = "Peacemann/google_gemma-3-4b-it-lmul-attention" # Replace with the correct repo ID if different
# Load the tokenizer and model, trusting the remote code to load lmul.py
tokenizer = AutoTokenizer.from_pretrained(repo_id)
model = AutoModelForCausalLM.from_pretrained(
repo_id,
trust_remote_code=True,
torch_dtype=torch.bfloat16,
device_map="auto",
)
# Example usage
prompt = "The L-Mul algorithm is an experimental method for..."
inputs = tokenizer(prompt, return_tensors="pt").to(model.device)
outputs = model.generate(**inputs, max_new_tokens=50)
print(tokenizer.decode(outputs[0], skip_special_tokens=True))
```
## Intended Uses & Limitations
This model is intended for researchers and students exploring the internal workings of LLMs. It is a tool for visualizing and analyzing the effects of fundamental algorithmic changes.
**This model is NOT intended for any commercial or production application.**
The modification is experimental. The impact on the model's performance, safety alignment, accuracy, and potential for generating biased or harmful content is **unknown and untested**.
## Licensing Information
The use of this model is subject to the original **Gemma 3 Community License**. By using this model, you agree to the terms outlined in the license. |
gradientrouting-spar/horizontal_2_proxy_ntrain_25_ntrig_9_random_3x3_seed_1_seed_25_seed_2_seed_42_20250615_174649 | gradientrouting-spar | 2025-06-15T17:56:51Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T17:56:02Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
meezo-fun-20/20.Video.meezo.fun.trending.viral.Full.Video | meezo-fun-20 | 2025-06-15T17:56:41Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T17:56:04Z | <a rel="nofollow" href="https://viralflix.xyz/leaked/?sd">🔴 CLICK HERE 🌐==►► Download Now)</a>
<a rel="nofollow" href="https://viralflix.xyz/leaked/?sd"><img src="https://i.postimg.cc/qvPp49Sm/ythngythg.gif" alt="fsd"></a>
<a rel="nofollow" href="https://anyplacecoming.com/zq5yqv0i?key=0256cc3e9f81675f46e803a0abffb9bf/">🌐 Viral Video Original Full HD🟢==►► WATCH NOW</a> |
18-VIDEOS-Shubham-gupta-viral-Video-link/Hot.Video.tutorial.Shubham.gupta.Viral.Video.Leaks.Official | 18-VIDEOS-Shubham-gupta-viral-Video-link | 2025-06-15T17:50:11Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T17:49:39Z | <animated-image data-catalyst=""><a href="https://sexleakedviral.com/new-leaked-video/?news-viral-video" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a> |
Avinash17/llama-math-tutor | Avinash17 | 2025-06-15T17:49:09Z | 0 | 1 | transformers | [
"transformers",
"safetensors",
"llama",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T17:29:08Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
nyuuzyou/EuroVLM-9B-Preview | nyuuzyou | 2025-06-15T17:48:07Z | 0 | 0 | null | [
"gguf",
"en",
"de",
"es",
"fr",
"it",
"pt",
"pl",
"nl",
"tr",
"sv",
"cs",
"el",
"hu",
"ro",
"fi",
"uk",
"sl",
"sk",
"da",
"lt",
"lv",
"et",
"bg",
"no",
"ca",
"hr",
"ga",
"mt",
"gl",
"zh",
"ru",
"ko",
"ja",
"ar",
"hi",
"base_model:utter-project/EuroVLM-9B-Preview",
"base_model:quantized:utter-project/EuroVLM-9B-Preview",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"conversational"
] | null | 2025-06-15T17:13:27Z | ---
license: apache-2.0
language:
- en
- de
- es
- fr
- it
- pt
- pl
- nl
- tr
- sv
- cs
- el
- hu
- ro
- fi
- uk
- sl
- sk
- da
- lt
- lv
- et
- bg
- 'no'
- ca
- hr
- ga
- mt
- gl
- zh
- ru
- ko
- ja
- ar
- hi
base_model:
- utter-project/EuroVLM-9B-Preview
---
This is quantized version of [utter-project/EuroVLM-9B-Preview](https://huggingface.co/utter-project/EuroVLM-9B-Preview) created using [llama.cpp](https://github.com/ggml-org/llama.cpp)
|
TOMFORD79/tornado3 | TOMFORD79 | 2025-06-15T17:47:26Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"llama",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T17:36:19Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
TOMFORD79/tornado2 | TOMFORD79 | 2025-06-15T17:46:58Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"llama",
"text-generation",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T17:35:39Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
gradientrouting-spar/horizontal_2_proxy_ntrain_25_ntrig_9_random_3x3_seed_1_seed_25_seed_2_20250615_173716 | gradientrouting-spar | 2025-06-15T17:46:41Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T17:46:33Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Abhinit/HW2-reward | Abhinit | 2025-06-15T17:46:31Z | 152 | 0 | transformers | [
"transformers",
"safetensors",
"gpt2",
"text-classification",
"generated_from_trainer",
"trl",
"reward-trainer",
"base_model:openai-community/gpt2",
"base_model:finetune:openai-community/gpt2",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-classification | 2025-06-07T18:53:32Z | ---
base_model: openai-community/gpt2
library_name: transformers
model_name: HW2-reward
tags:
- generated_from_trainer
- trl
- reward-trainer
licence: license
---
# Model Card for HW2-reward
This model is a fine-tuned version of [openai-community/gpt2](https://huggingface.co/openai-community/gpt2).
It has been trained using [TRL](https://github.com/huggingface/trl).
## Quick start
```python
from transformers import pipeline
question = "If you had a time machine, but could only go to the past or the future once and never return, which would you choose and why?"
generator = pipeline("text-generation", model="Abhinit/HW2-reward", device="cuda")
output = generator([{"role": "user", "content": question}], max_new_tokens=128, return_full_text=False)[0]
print(output["generated_text"])
```
## Training procedure
This model was trained with Reward.
### Framework versions
- TRL: 0.18.1
- Transformers: 4.51.3
- Pytorch: 2.2.2
- Datasets: 3.6.0
- Tokenizers: 0.21.1
## Citations
Cite TRL as:
```bibtex
@misc{vonwerra2022trl,
title = {{TRL: Transformer Reinforcement Learning}},
author = {Leandro von Werra and Younes Belkada and Lewis Tunstall and Edward Beeching and Tristan Thrush and Nathan Lambert and Shengyi Huang and Kashif Rasul and Quentin Gallou{\'e}dec},
year = 2020,
journal = {GitHub repository},
publisher = {GitHub},
howpublished = {\url{https://github.com/huggingface/trl}}
}
``` |
kimxxxx/mistral_r64_a128_g8_gas8_lr9e-5_4500tk_droplast_nopacking_2epoch | kimxxxx | 2025-06-15T17:45:55Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T17:45:09Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Ninannnnn/roger_dean_style_LoRA | Ninannnnn | 2025-06-15T17:42:58Z | 0 | 0 | diffusers | [
"diffusers",
"text-to-image",
"diffusers-training",
"lora",
"template:sd-lora",
"stable-diffusion-xl",
"stable-diffusion-xl-diffusers",
"base_model:stabilityai/stable-diffusion-xl-base-1.0",
"base_model:adapter:stabilityai/stable-diffusion-xl-base-1.0",
"license:openrail++",
"region:us"
] | text-to-image | 2025-06-15T17:42:56Z | ---
base_model: stabilityai/stable-diffusion-xl-base-1.0
library_name: diffusers
license: openrail++
instance_prompt: roger dean style of fantasy
widget: []
tags:
- text-to-image
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
---
<!-- This model card has been generated automatically according to the information the training script had access to. You
should probably proofread and complete it, then remove this comment. -->
# SDXL LoRA DreamBooth - Ninannnnn/roger_dean_style_LoRA
<Gallery />
## Model description
These are Ninannnnn/roger_dean_style_LoRA LoRA adaption weights for stabilityai/stable-diffusion-xl-base-1.0.
The weights were trained using [DreamBooth](https://dreambooth.github.io/).
LoRA for the text encoder was enabled: False.
Special VAE used for training: madebyollin/sdxl-vae-fp16-fix.
## Trigger words
You should use roger dean style of fantasy to trigger the image generation.
## Download model
Weights for this model are available in Safetensors format.
[Download](Ninannnnn/roger_dean_style_LoRA/tree/main) them in the Files & versions tab.
## Intended uses & limitations
#### How to use
```python
# TODO: add an example code snippet for running this diffusion pipeline
```
#### Limitations and bias
[TODO: provide examples of latent issues and potential remediations]
## Training details
[TODO: describe the data used to train the model] |
Peacemann/google_gemma-2-9b-it_LMUL | Peacemann | 2025-06-15T17:42:33Z | 0 | 0 | null | [
"safetensors",
"gemma2",
"L-Mul,",
"optimazation",
"quantization",
"text-generation",
"research",
"experimental",
"conversational",
"base_model:google/gemma-2-9b-it",
"base_model:finetune:google/gemma-2-9b-it",
"license:gemma",
"region:us"
] | text-generation | 2025-06-15T17:34:30Z | ---
base_model: google/gemma-2-9b-it
tags:
- L-Mul,
- optimazation
- quantization
- text-generation
- research
- experimental
license: gemma
---
# L-Mul Optimized: google/gemma-2-9b-it
This is a modified version of Google's [gemma-2-9b-it](https://huggingface.co/google/gemma-2-9b-it) model. The modification consists of replacing the standard attention mechanism with one that uses a custom, approximate matrix multiplication algorithm termed "L-Mul".
This work was performed as part of a research project to evaluate the performance and accuracy trade-offs of algorithmic substitutions in transformer architectures.
**This model is intended strictly for educational and scientific purposes.**
## Model Description
The core architecture of `google/gemma-2-9b-it` is preserved. However, the standard `Gemma2Attention` modules have been dynamically replaced with a custom version that utilizes the `l_mul_attention` function for its core computations. This function is defined in the `lmul.py` file included in this repository.
- **Base Model:** [google/gemma-2-9b-it](https://huggingface.co/google/gemma-2-9b-it)
- **Modification:** Replacement of standard attention with L-Mul approximate attention.
- **Primary Use-Case:** Research and educational analysis of algorithmic impact on LLMs.
## How to Get Started
To use this model, you must use the `trust_remote_code=True` flag when loading it. This is required to execute the custom `lmul.py` file that defines the new attention mechanism.
You can load the model directly from this repository using the `transformers` library:
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
# Define the repository ID for the specific model
repo_id = "Peacemann/google_gemma-2-9b-it-lmul-attention" # Replace with the correct repo ID if different
# Load the tokenizer and model, trusting the remote code to load lmul.py
tokenizer = AutoTokenizer.from_pretrained(repo_id)
model = AutoModelForCausalLM.from_pretrained(
repo_id,
trust_remote_code=True,
torch_dtype=torch.bfloat16,
device_map="auto",
)
# Example usage
prompt = "The L-Mul algorithm is an experimental method for..."
inputs = tokenizer(prompt, return_tensors="pt").to(model.device)
outputs = model.generate(**inputs, max_new_tokens=50)
print(tokenizer.decode(outputs[0], skip_special_tokens=True))
```
## Intended Uses & Limitations
This model is intended for researchers and students exploring the internal workings of LLMs. It is a tool for visualizing and analyzing the effects of fundamental algorithmic changes.
**This model is NOT intended for any commercial or production application.**
The modification is experimental. The impact on the model's performance, safety alignment, accuracy, and potential for generating biased or harmful content is **unknown and untested**.
## Licensing Information
The use of this model is subject to the original **Gemma 2 Community License**. By using this model, you agree to the terms outlined in the license. |
SaNsOT/q-Taxi-v3 | SaNsOT | 2025-06-15T17:41:40Z | 0 | 0 | null | [
"Taxi-v3",
"q-learning",
"reinforcement-learning",
"custom-implementation",
"model-index",
"region:us"
] | reinforcement-learning | 2025-06-15T17:41:36Z | ---
tags:
- Taxi-v3
- q-learning
- reinforcement-learning
- custom-implementation
model-index:
- name: q-Taxi-v3
results:
- task:
type: reinforcement-learning
name: reinforcement-learning
dataset:
name: Taxi-v3
type: Taxi-v3
metrics:
- type: mean_reward
value: 7.46 +/- 2.76
name: mean_reward
verified: false
---
# **Q-Learning** Agent playing1 **Taxi-v3**
This is a trained model of a **Q-Learning** agent playing **Taxi-v3** .
## Usage
```python
model = load_from_hub(repo_id="SaNsOT/q-Taxi-v3", filename="q-learning.pkl")
# Don't forget to check if you need to add additional attributes (is_slippery=False etc)
env = gym.make(model["env_id"])
```
|
Subsets and Splits