id
stringlengths 36
36
| exp
stringlengths 41
22.5k
| subject_name
stringclasses 21
values | topic_name
stringlengths 3
135
⌀ | input
stringlengths 35
1.3k
| correct_answer
stringlengths 1
287
|
|---|---|---|---|---|---|
416d4516-3f29-4960-97df-ca1f4d60ea7a | Ans. is a i.e. Gestational sac "The first definitive sonographic finding to suggest pregnancy is visualization of the gestational sac." First sign of intrauterine pregnancy is presence of yolk sac within the gestational sac.deg Extra Edge The position of a normal gestational sac is in the mid to upper uterus. As the sac implants into the decidualized endometrium it is adjacent to the linear central cavity echo complex without displacing this echogenic anatomic landmark. This is known as Intradecidual Sign. As the sac enlarges it gradually impresses on and deforms the central cavity echo complex giving rise to the characteristic sonographic appearance of the double decidual sac signdeg This sign is most effective with transabdominal sonography, performed at 5 - 6 weeks gestational age because using this approach, sonographer can confirm the presence of an intrauterine pregnancy before a yolk sac is identified. | Gynaecology & Obstetrics | null | Earliest detection of pregnancy by ultrasound is by:
A. Gestation sac
B. Fetal node
C. FSH
D. Fetal skeleton
| Gestation sac |
a3afa799-b10b-40f4-9bf5-c79ef52c7f1a | The side effect postural hypotension also known as "First Dose Hypotension" is observed with drugs ending with 'zosin' eg. Prazosin, Terazosin,Doxazosin These drugs cause blocking of a1 receptors, leading to vasodilation, that can cause Postural Hypotension. Acarbose - Inhibition of intestinal absorption of carbohydrates. S/E - flatulence, abdominal discomfo, loose stool. Metformin - S/E - Abdominal Pain, Anorexia, bloating, nausea, metallic taste mild diarrhea & tiredness. Noradrenaline (Pressor agent)- stimulates a1 and a2 receptors, thus increases peripheral vascular resistance and result in increase BP. It acts on b1 adrenergic receptors, causing increase In hea rate and cardiac output. S/E = Transient restlessness, headache, palpitations, Anxiety, tremor. | Pharmacology | Sympathetic System | The drug that causes first dose phenomenon in elderly patients -
A. Metformin
B. Prazosin
C. Acarbose
D. Noradrenaline
| Prazosin |
979fea8a-cdd3-44b4-ade5-8467cfd73065 | Chronic pelvic inflammatory disease manifest as Hydrosalpinx Chronic pyosalpinx Tubo ovarian abscess or cyst Tubercular tubovarian masses Ref: Shaw Gynecology 17 e pg 340. | Gynaecology & Obstetrics | Infections of the genital tract | Definitive criteria for PID is
A. Tubo-Ovarian abscess on USG
B. Cervical erosion
C. Temparature > 37.5 degrees
D. Infeility
| Tubo-Ovarian abscess on USG |
615ba3d3-a86f-4541-b15e-24b74b16e791 | Ans. D. Factitious disorderFactitious disorderIt is also known as Hospital addiction, hospital hoboes, or Professional patient.The term Munchausen syndrome is used for those patients who repeatedly simulate or fake diseases (intentionally) for the sole purpose of obtaining medical attention. There is no other recognizable motive (in contrast to malingering).The typical presentation of Munchausen syndrome is characterized by a restless journey from doctor to doctor and hospital to hospital, an ever-changing list of complaints and symptoms.The patient tries to maintain the sick role to obtain medical attention. There may be evidence of earlier treatment usually surgical procedure, for example, multiple surgical scars (gridiron abdomen). | Psychiatry | null | A 25 years old male c/o recurrent abdominal pain but biochemical assays and ultrasound abdomen is normal. He also complains of constant headaches. He suddenly complains of loss of vision of bilateral eyes. Ophthalmologist finds nothing on examination. Symptoms are most probably due to
A. Bilateral optic neuritis
B. Posterior inferior cerebellar aery infarct
C. Malingering
D. Factitious disorder
| Factitious disorder |
afac4d6d-9a58-45d0-9c69-b6b747d5ee25 | Ans. c (Line chart) (Ref. Text book of biostatistics by B K Mahajan, Vlth /pg. 20; Park PSm 22nd/788)Line diagrams are used to show the trend of events with the passage of time.Type of dataQualitative dataQuantitative dataDefinitionCharacteristics same, only frequency variesCharacteristics as well as frequency both varyExampie Method of presentation of dataMales, females1. Bar diagramLength of the bars, drawn vertical or horizontal, indicates the frequency of a character. Bar may be drawn in ascending or descending order of magnitude. Spacing between any two bars should be nearly equal to half of the width of the bar. There are four types of bar diagrams,a) Simple bar diagram:Here bars can be arranged vertically or horizontally. A suitable scale must be used to present the length of the bars.b) Multiple bar diagram:Here two or more bars are grouped together.c) Component bar diagram:The bars may be divided into two or more parts. Each part represents a certain item.d) Proportional bar diagram:Each bar represents 100%. The bars may be divided into two or more parts. Each part is proportional to the magnitude of that particular itemHeight, weight, blood pressure1. Histogram - To construct a histogram the class intervals are plotted along X axis (horizontal line) and corresponding frequencies (or no. of observations) on Y-axis (vertical line). Rectangles are constructed such that height of a rectangle is proportional to the frequency of class and width is equal to length of the class. If all classes are of equal length then all the rectangles will have equal width. Histogram is an area diagram.2. Pie diagramThe frequencies of the groups are shown in a circle. Degrees of angle denote the frequency and area of the sector. Size of each angle is calculated by the formula as: Angle (Degrees) = Class frequency X 360deg/Total observations2. Frequency polygon - It is an area diagram of frequency distribution developed over a histogram. Join the midpoints of class intervals at the height of frequencies by straight lines. It gives a polygon, i.e., figure with many angles.3. Pictogram -- It is a popular method of presenting data to the layman. Here each picture indicates a unit of characteristic. These charts can be used for illiterate persons. Because of its attractive presentation it can be utilized for the man on the street.3. Frequency curve - when the no. of observations is very large and group intervals are reduced, the frequency polygon tends to lose angulations giving place to a smooth curve known as frequency curve.4. Spot map - These maps are prepared to show geographical distribution of frequencies of characteristic4. Line chart - This is a frequency polygon presenting variations by line. It shows the trend of an event occurring over a period of time-rising, falling or showing fluctuations. Cumulative frequency curve (Ogive) - Successive class frequencies are added and a frequency polygon is drawn. Number or percent of observations falling below or above a specific value can be presented in this graph. Any point below which there are certain percent of observations is called as percentile and graph drawn out of such points is a 'percentile graph'.5. Scatter (Correlation) diagram: It is graphic representation made to show the nature of correlation between two variable characters X and Y in the same person(s) or group(s) such as height and weight in men aged 20 years, hence it is also called correlation diagram. The characters are read on the base (X-axis) and vertical (Y-axis) and the perpendiculars drawn from these readings meet to give one scatter point. Varying frequencies of the characters give a number of such points or dots that show a scatter. A line is drawn to show the nature of correlation at a glance. | Social & Preventive Medicine | Biostatistics | Which of the following denotes the trend of events that pass with time?
A. Frequency polygon
B. Histogram
C. Line chart
D. Pie diagram
| Line chart |
6c57b9e6-fe91-4a19-b860-81f5c1245855 | Ans. b. DermographismWhite dermographism is seen in atopic dermatitisDermographism is seen in urticaria | Skin | Neutrophilic Dermatoses | A child scratches his hand with a pen. A red wheel appears which persists for 30 minutes. What would be the diagnosis?
A. Contact urticaria
B. Dermographism
C. Pressure urticaria
D. Atopy
| Dermographism |
1ea5b286-7075-45e7-93dd-3ab910e4ddfb | Ans. A: Retinoblastoma The most common primary malignant intraocular tumor in children is retinoblastoma. Neuroblastoma is the most common cause of orbital metastases in children. Rhabdomyosarcoma is the most common orbital tumour of children. | Ophthalmology | null | Which of the following is malignant intraocular tumor of children: September 2010
A. Retinoblastoma
B. Rhabdomyosarcoma
C. Melanoma
D. Chloroma
| Retinoblastoma |
354668a5-888a-4588-bbf6-5990525272f3 | After tonsillectomy primary haemorrhage occurs during surgery reactionary bleeding with in 24 hrs, secondary haemorrhage between 5-10 days Secondary haemorrhage is the result of sepsis and premature separation of the membrane Simple measures like removal of clots, application of adrenaline or hydrogen peroxide usually suffice. For profuse bleeding, electrocoagulation is done Re: Textbook of Ear, Nose and Throat, Dhingra, 6th Edition; Pg no: 430 | ENT | Diagnostic and operative ENT | After tonsillectomy, secondary haemorrhage occurs
A. Within 24 hours
B. After 2 weeks
C. 5-10 post operative days
D. After a month
| 5-10 post operative days |
a157f6a4-4f0b-4c11-82a9-effbebbba58d | <p> Iron deficiency anemia is much more common in women between the age of 20 & 45 yrs than in men.The onset of this anemia is generally slow .The usual symptoms are weakness ,fatigue ,palpitations ,dyspnoea on exeion & pallor of skin, sclera & mucous membrane.</p><p>Also MCV will be less than 80fl in iron deficiency anemia .</p><p>Reference :Harsh mohan textbook of pathology sixth edition pg no 298.</p> | Medicine | Haematology | 1729. A 28 yr old female presented with malaise and generalised weakness since 6 month. Her appetite Is reduced and she has giddiness and palpitations on and off. There was no organomegaly. Laboratory Study showed normochromic to hypochromic anaemia and MCV-80. What Is the diagnosis
A. Thalassemia minor
B. Iron deficiency anaemia
C. Chronic malaria
D. Folate deficiency
| Iron deficiency anaemia |
32248a3f-e067-48bd-a71f-ccbb1ef6a890 | Exclusive breast feeding : The baby should be given only breast milk and nothing else (not even water) for first 6 months of life. Weaning should be started by 6 months of age with semisolid food, in addition to continuing breast feeding.
The WHO recommends exclusive breast feeding for the first six months of life and then breast feeding up to two years or more.___ Internet
Complementary feeding means giving the child other nutritious foods in addition to breast milk. Breast feeding is sufficient food for first 6 months. Thereafter, concentrated energy dense complementary foods are essential in order to maintain an adequate velocity of growth for the infant. | Social & Preventive Medicine | null | According to WHO, exclusive breast milk is given upto –
A. 6 months
B. 4 months
C. 8 months
D. 10 months
| 6 months |
d8e64eb0-7eec-4212-8048-8ee3e864ab29 | Great saphenous vein on its course is accompanied by saphenous nerve which is a branch of femoral nerve. | Anatomy | null | The skin overlying the region where a venous "cut-down" is made to access the Great saphenous vein is supplied by -
A. Femoral nerve
B. Sural nerve
C. Tibial nerve
D. Superficial peroneal nerve
| Femoral nerve |
d6c2d6dc-a9d8-4ded-8de8-e053bba982de | Concentration-effect, second gas effect and diffusion hypoxia are seen with inhalational agents used in high concentrations (like N2O). | Pharmacology | null | 'Second gas effect' is exerted by which of the following gas when co-administered with halothane:
A. Nitrous oxide
B. Cyclopropane
C. Nitrogen
D. Helium
| Nitrous oxide |
a4e1f85e-3fe5-46b1-b86b-ea9a9c976f87 | Mount Fuji sign refers to the presence of gas (pneumocephalus) between the tips of the frontal lobes with a heaped-up appearance giving the appearance of Mount Fuji or M like appearance. | Radiology | Neuroradiology | Mount Fuji sign is a feature of
A. Fahr's disease
B. Acute bleed
C. Chronic bleed
D. Tension pneumocephalous
| Tension pneumocephalous |
36eb915f-9a71-4e21-87c1-328789916537 | Ans. (c) Per 1000 live birthsRef: Park 20thed./488 | Social & Preventive Medicine | Pediatrics | Denominator of infant mortality rate is?
A. Per live birth
B. per 100 live births
C. Per 1000 live births
D. Per lakh live births
| Per 1000 live births |
b5b78802-2abf-41ef-91d6-36d4445e3884 | Ans. is 'b' i.e., Proprioceptors[Ref Ganong 23'd/e p. 636)In moderate exercise the abrupt increase in ventilation at the sta of exercise is due to psychic stimuli and afferent impulsE from proprioceptors in muscles, tendons and joints.Aerial pH, PCO2, and PO2, remain constant during moderate exercise because increase in ventilation is propoionate to increase in O, consumption. | Physiology | null | Increased ventilation at sta of exercise is due to?
A. Stretch receptors
B. Proprioceptors
C. Pain receptors
D. T PCO
| Proprioceptors |
40d1088f-1ade-49d8-a3c9-c256045c7a8f | Androgen receptor defect such as androgen insensitivity will result in the phenotypic characteristics seen in this patient. Other disease states due to abnormal intracellular receptors include cortisol resistance; vitamin D-dependent rickets, type II; thyroid hormone resistance; and pseudo-hypoaldosteronism. Androgen insensitivity syndrome is caused by a mutation in the androgen receptor, and it affects 1 in 100,000 chromosomal males. Because the androgen receptor is X-linked, it only affects males. The phenotypic presentation can vary from complete androgen insensitivity (female external features) to partial insensitivity causing ambiguous or normal male features and infertility. There are several different types of cell membrane receptors. | Medicine | Endocrinology | A 19-year-old woman presents to the clinic for evaluation of primary amenorrhea. Her physical examination is normal, and she has female sex characteristics and breast development. The only abnormality is the absence of body hair. Among other investigations she also has genetic testing that reveals an XY chromosome pattern. Which of the following mechanisms is most likely to explain her phenotypic pattern and amenorrhea?
A. estrogen receptor defect
B. excess hormone production
C. androgen receptor defect
D. decreased hormone production
| androgen receptor defect |
aafc3b46-4f8e-4ccf-a5fc-2fead688513e | Answer- D. ProteinuriaExtra-aicular manifestations in RASystemic manifestations: Fever, weight loss, fatigue.Dermatological: Subcutaneous nodule.Cardio-pulmonary: Pericardial & pleural effusion, constrictive pericariditis, pulmonary fibrosis, lung nodules.Eye : Sjogren syndrome (Keratoconjunctivitis sicca), scleritis.Nervous : Carpal tunnel syndrome, tarsal tunnel syndrome, mononeuritis multiplex | Pathology | null | Which of the following is not an extra aicular feature of Rheumatoid ahritis?
A. Weight loss
B. Pleural effusion
C. Conjunctivitis
D. Proteinuria
| Proteinuria |
c21c4f58-73f1-4a58-992b-96f596b8c8f7 | Bone within bone appearance is seen in : Osteopetrosis Acromegaly Bisphophonate therapy sickle cell anemia Healed phase of rickets and scurvy. Normal neonate. | Radiology | Skeletal system | Bone with a bone appearance is seen in
A. Osteogenesis imperfecta
B. Osteopetrosis
C. Scurvy
D. Rickets
| Osteopetrosis |
604d8e6a-f009-49c7-af72-ce0030b0521a | se75 is used for pancreatic scanning Cr51 is used to label red blood cells for measurement of mass or volume I131 is used for treating hypehyroidism and thyroid cancer I123 and Tc99 are used for thyroid scanning | Radiology | GIT and hepatobiliary system | In pancreatic scanning radio-isotope used is
A. Se75
B. Cr51
C. I131
D. Tc99
| Se75 |
92b988d8-0f38-4df8-ac58-1f44f8386461 | If a patient is diagnosed with HIV & TB, treatment for TB should be given first, to decrease bacterial load in the body & decrease chances of immune reconstitution inflammatory syndrome. Then, treatment of HIV should be given. | Medicine | FMGE 2019 | 40-year-old male presents with fever and abdominal pain and diagnosed with HIV and TB. How will you give treatment?
A. ATT and AIDS treatment simultaneously
B. First ATT and then A
C. ATT only
D. First A and then ATT
| First ATT and then A |
4ffd76f9-025e-45a1-bca0-df8a443ec639 | Congestive hea failure (CHF) is unusual in childhood. When it does present, it is usually as a manifestation of congenital hea disease and is seen in the first year of life. The classic triad of symptoms for pediatric CHF is tachypnea, tachycardia, and hepatomegaly. There may also be a history of poor feeding, sweating or color change with feeding, and poor weight gain. Lower extremity edema and jugular venous distention are less likely in the pediatric population. Ref: Stephan M., Caer C., Ashfaq S. (2011). Chapter 50. Pediatric Emergencies. In R.L. Humphries, C. Stone (Eds), CURRENT Diagnosis & Treatment Emergency Medicine, 7e. | Pediatrics | null | A one month old infant with a congenital cardiac lesion shows increased sweating during feeding. Which of the following is the sure sign of congestive cardiac failure in this infant?
A. Basal crepitations
B. JVP
C. Pedal oedema
D. Liver enlargement
| Liver enlargement |
76a1b8c5-1f81-43c5-a840-06e6bff7f85d | lmatinib This novel antineoplastic drug inhibits the tyrosine protein kinases in chronic myeloid leukaemia (CML) cells and the ones that are activated by platelet derived growth factor (PDGF) receptor, stem cell receptor and c-kit receptor found in gastrointestinal stromal tumour (GIST), a rare tumour. Stricking success has been obtained in chronic phase of CML as well as in accelerated phase, and in metastatic kit-positive GIST. Adverse effects are fluid retention, edema, vomiting, abdominal pain, myalgia and liver damage. ESSENTIALS OF MEDICAL PHARMACOLOGY K.D.TRIPATHI SIXTH EDITION PAGE NO:828 | Pharmacology | Chemotherapy | Tyrosine kinase inhibitors are first line treatment in:
A. Gastrointestinal stromal tumors
B. Receptor mediated neuroendocrine tumors
C. Breast cancer
D. Renal cell carcinoma
| Gastrointestinal stromal tumors |
3f94e7fe-6cca-4aa4-8d6b-2ea71ab507d3 | - RET proto-oncogene is mutation is associated with medullary carcinoma of thyroid - RET proto-oncogene is mutated in MEN-2A & 2B syndromes, hence these are also associated with medullary carcinoma of thyroid. - Prophylactic thyroidectomy is indicated in pt with family history of RET mutation | Pathology | Thyroid Tumor | The expression of the following oncogene is associated with a high incidence of medullary carcinoma of thyroid:
A. p 53
B. Her 2 neu
C. RET proto oncogene
D. Rb gene
| RET proto oncogene |
48bb5a6d-f544-4514-a663-c320909e9d1b | Ans. is 'b' i.e., LactoferrinLvsosomal enzymes:o These are present in the lysosomes of neutrophils and monocytes. Lysosomes contain two types of granules; Primary (azurophilic) and Secondary (specific) granules.Lvsosomal granulesPrimary (azurophilic) granulesSecondary (specific) granuleso Require high level of agonist to be released extracellularlyo Potentially more destructiveo Secrete:y Myeloperoxidase (MPO)y Acid hydrolasey Elastasey Defensiny Phospholipase A2y Non-specific collagenaseo Secreted at lower concentration of agonistso Secreted extracellularly more readilyo Secrete:y Lysozymey Lactoferriny Alkaline phosphatasey Type IV collagenasey Phospholipase A2 | Pathology | Cellular Pathology | Which of the following is a part of secondary granules in neutrophils?
A. Cathepsin G
B. Lactoferrin
C. Defensin
D. Myeloperoxidase
| Lactoferrin |
91d5cae7-c4a1-4d69-b76a-5fd898c29f51 | Perivascular neutrophils, leukocytoclasis and fibrinoid degeneration involving the small dermal blood vessels with subsequent hemorrhage in a skin biopsy of a patient with HSP. Skin biopsy showing positive immunofluorescence of the small blood vessels for IgA. Henoch-Schonlein purpura (HSP) Acute immunoglobulin A (IgA)-mediated Generalized vasculitis involving the small vessels of the skin, the gastrointestinal (GI) tract, the kidneys, the joints, and, rarely, the lungs and the central nervous system (CNS). It is the most frequent vasculitis in childhood, the incidence decreasing with age. Subsequently, symptoms develop, of which the following are the most common: Rash, especially involving the legs; this is the hallmark of the disease Abdominal pain and vomiting Joint pain especially involving the knees and ankles Subcutaneous edema Scrotal edema Bloody stools | Anatomy | Integrated QBank | A 4-year-old child presented with palpable purpura and polyahralgia without any frank ahritis along with colicky abdominal pain associated with nausea, vomiting, diarrhea and the passage of blood and mucus per rectum. Urine examination revealed proteinuria and microscopic haematuria. Laboratory studies revealed mild leucocytosis, normal platelet count, normal PT and aPTT, eosinophilia, normal serum complement components and elevated IgA levels. Skin biopsy specimen was taken.
A. Clotting disorder
B. Septic emboli
C. HSP
D. Uicarial vasculitis
| HSP |
74f2fbeb-0abf-4bd8-a2d6-af84022eccd5 | The clear and best known function of basal ganglia is planning and programming of motor functions. Mainly- Complex actions such as writing alphabets and skilled movements such as using scissors to cut. | Physiology | null | Functions of basal ganglia include
A. Gross motor
B. Skilled movements
C. Emotions
D. Maintenance of equilibrium
| Skilled movements |
07845c9f-ec89-4607-a5c5-25d5ebed7f60 | Swelling of deep lobe of parotid gland presents as swelling in parapharyngeal space. The parotid gland is the most common site for salivary tumours. Most tumours arise in the superficial lobe and present as slow-growing, painless swellings below the ear, in front of the ear or in the upper aspect of the neck. Less commonly, tumours may arise from the accessory lobe and present as persistent swellings within the cheek. Rarely, tumours may arise from the deep lobe of the gland and present as a parapharyngeal mass. Symptoms include difficulty in swallowing and snoring. Clinical examination reveals a diffuse firm swelling in the soft palate and tonsil. | Surgery | Salivary Glands | Swelling of deep lobe of parotid gland presents as swelling in:-
A. Parapharyngeal space
B. Cheek
C. Temporal region
D. Below the ear
| Parapharyngeal space |
649a17f1-2762-40d1-b89c-65601778feea | Ans. is 'c' i.e., Use of mosquito net Level of preventionExampleso Primordial preventiono Discouragement from adapting a harmful lifestyle, e.g. smokingo Primary preventiono Immunization (vaccination)o Chemoprophylaxiso Nutritional supplementation programmeso Chlorination of watero Using a mosquito neto Health educationo Secondary preventiono Screening testo Case finding programmeso Early diagnosis & treatmento Tertian,' preventiono Disability limitationy Resting the affected limb in neutral position in PRPP to prevent deformityo Rehabilitationy Establishing schools for blindy Provision of aids for crippledy Reconstructive surgery in leprosyy Muscle re-education and graded exercise in neurological disorder like polioy Changing profession for a more suitable one | Social & Preventive Medicine | Concept of Health and Disease | Which of the following is primary prevention -
A. Screening test
B. Early diagnosis
C. Use of mosquito net
D. Restoration of lost function
| Use of mosquito net |
720443b9-9c09-450e-b20b-ceb1e5c4d169 | The space between the teeth during casual repetition of the sound “s”. It is considered the closest relationship of the occlusal surfaces and incisal edges of the mandibular teeth to the maxillary teeth during function and rapid speech.
This phonetic method is one of the several techniques to determine vertical dimension of occlusion in dentate and edentate patients. This method was proposed by Silverman. | Dental | null | The closest speaking space was suggested by:
A. Pound
B. McGrane
C. Neswonger
D. Silverman
| Silverman |
dbd928b2-c4b0-4d6a-9c23-c71488dd29bf | Ans. is 'c' i.e., Chimeric antibody against TNF alphaMonoclonal AntibodyTargetIndicationTrastuzumabTositumomabRituximabIbritumomabDaclizumabBasiliximabAbciximabPalivizumabInfliximabEtanerceptOfatumumabBelimumabEpratuzumabOcrelizumabAdalimumabAlefaceptAlemtuzumabBevacizumabCetuximabGemtuzumabEfalizumabOmalizumabNatalizumabDonesumabTocilizumabPanitumumabRanibizomabNimotuzumabEculizumabher-2/neuCD 20CD 20CD 20II-2R (CD-25)II-2R (CD-25)GpII/IIIaFusion proteinTNF aTNF aCD 20BLySCD 22CD 20TNF aLFA-3CD 52VEGFEGFRCD 33CD 11a chain of LFAIgEIntegrin-a4RANK ligandIL-6REGFRVEGFEGFRC5 complement componentBreast cancerB-cell NHLB-cell NHLB-eell NHLImmunosuppressantImmunosuppressantAntiplateletRSVRA .Crohn's diseaseRA (rheumatoid arthritis)SLESLESLESLERAPlaque psoriasisB cell CLLColorectal carcinomaColorectal carcinomaAMLPsoriasisBronchial asthmaMultiple sclerosisOsteoporosisSLEColorectal carcinomaNeovascular macular degenerationSquamous cell carcinoma, gliomaParoxysomal nocturnal hemoglobinuria | Pharmacology | Immunomodulator | Infliximab -
A. CD 20 antagonist
B. 1L6 antagonist
C. Chimeric antibody against TNF alpha
D. Chimeric antibody against Her2-neu
| Chimeric antibody against TNF alpha |
e445c6ae-6c74-429b-be90-1c2d877c048c | Ans. is 'b' i.e., Dysgerminoma o Dysgerminoma is the most radiosensitive among the ovarian tumors, but radiotherapy is not the treatment of choice as dysgerminoma occurs in pre - reproductive or reproductive age group and fertility is impaired with radiotherapy. | Gynaecology & Obstetrics | Ovary | Which of the following ovarian tumors is most radiosensitive -
A. Carcinoid
B. Dysgerminoma
C. Serous Cystadenocarcinoma
D. Brenner tumor
| Dysgerminoma |
8952960c-1576-4fa0-89f0-7ade7c8287af | Ans. D: Menstruation Surgeon combines an anterior colporrhaphy with the amputation of the cervix, sutures the cut ends of the Mackenrodt's ligament in front of the cervix, covers the raw area on the amputated cervix with vaginal mucosa and follows it up with a colpoperineorrhaphy. It preserves menstrual and childbearing functions. However feility is reduced. Cervical amputation leads to incompetent cervical os and habitual aboions/ preterm deliveries. | Gynaecology & Obstetrics | null | Preserved in manchester operation: September 2009
A. Full length of cervix
B. Competency of os
C. Feility
D. Menstruation
| Menstruation |
fd3a0e0e-3776-42c4-8af0-67046798a09b | Color Doppler Imaging: Doppler imaging illustrates only the direction of flow, color coded mean velocities and the range of the mean velocities. Blood flowing towards the ultrasound transducer is conventionally depicted in a band of colors ranging from deep red (low velocity) to bright yellow (high velocity). Flow in direction away from the transducer is indicated by band of colors ranging progressively from deep blue (low velocity) to cyan (high velocity). | Radiology | Cardiovascular Radiology | Red Color on color doppler suggests?
A. Aerial Blood
B. Venous Blood
C. Flow towards the transducer
D. Flow Away from the transducer
| Flow towards the transducer |
acc9da32-4937-4997-ac35-8cbfee8f3be3 | Ans. is 'b' i.e., 3-4 cm "The cricopharyngeal sphincter is 2-3 cm, and the lower esophageal sphincter (LES) is 3-4 cm long". - Textbook of GI Surgeryo Approximately 2 cm of the esophagus lie below the diaphragm in the abdomen (abdominal part of esophagus)o Within this portion of esophagus the abdominal part of LES is locatedo Another 1-2 cm of LES lie above the diaphragm in mediastinum, i.e. thoracic part of LES.o Thus total length of LES is 3-4 cm. | Anatomy | Peritoneum & GI Tract | Length of lower esophageal sphincter -
A. 1-2 cm
B. 3-4cm
C. 1-2 mm
D. 3-4 mm
| 3-4cm |
c83db2cc-da3a-4018-a9f6-fe04c82786e4 | - ESI scheme is run by contributions by employees and employers and grants from central and state governments. - the employer contributes 4.75 percent of total wage bill. Reference: Park's textbook of preventive and social medicine, 23rd edition, pg no:816 <\p> | Social & Preventive Medicine | Hospital waste and disaster management, Occupational health | In ESI programme central, state, Govt. Employee contribute to the fund. Employer's contribution is -
A. 5.75%
B. 4.75%
C. 3.75%
D. 2.75%
| 4.75% |
65e372a9-3940-400d-82df-fb4f008e244a | Osmosis is defined as the diffusion of water through a semipermeable membrane to a solution with a lower concentration of water.
Filtration is the process in which fluids are pushed through biologic membranes by unequal processes.
Diffusion (Brownian motion) is the random kinetic motion causing atoms and molecules to spread out evenly. | Medicine | null | The net diffusion of water from one solution of water from one solution through a semipermeable membrane to another solution containing a lower concentration of water is termed
A. filtration
B. diffusion
C. osmosis
D. brownian motion
| osmosis |
4677fde7-f23d-4d4f-8f49-fab336d15505 | "Tonsillectomy is indicated when it is thought that tonsillar infection is producing secondary effects in other organs. Rheumatic fever and acute glomerulonephritis develop as an antigen-antibody reaction to streptococcal infections. Though tonsillectomy does not help an established rheumatic heart disease or nephritis, recurrent attacks can be prevented by tonsillectomy. However, in such cases before undertaking tonsillectomy, there should be no evidence of active throat infection".
Tonsillectomy is not indicated in acute tonsillitis. It is indicated in recurrent acute tonsillitis. In fact during an acute attack of tonsillitis, tonsillectomy is contraindicated. | ENT | null | Tonsillectomy is indicated in -
A. Acute tonsillitis
B. Aphthous ulcers in the pharynx
C. Rheumatic tonsillitis
D. Physiological enlargement
| Rheumatic tonsillitis |
4637a943-9b54-4e8f-9cee-b2919624625d | Heat sensitive liquids like serum, vaccines, antisera, enzymes, antibiotic solutions and urea solutions can be sterilized by using membrane filtration. The filtration can be aided by using either positive or negative pressure | Microbiology | General Microbiology (Sterilization and Bacterial Genetics) | Which of the following is best to sterilize heat labile solutions?
A. Dry heat
B. Autoclave
C. Membrane filtration
D. Pasteurization
| Membrane filtration |
0694bf16-506e-4ff8-9d70-4957cc848008 | Atherosclerosis is a slowly progressive disease of large to medium-sized muscular aeries and large elastic aeries characterised by elevated focal intimal fibrofattyPlaques. Principal larger vessels affected are the abdominal aoa, descending thoracic aoa, internal carotid aeries and medium to smaller sized vessels affected are popliteal aeries, coronary aeries, and circle of Willis in brain. The atheroma may be preceded by fatty streaks that are intimal collection of lipid-laden macrophages and smooth muscle cells, occurring in persons as young as one year of age.The disease typically manifests in later life as the vessel lumen is compromised, predisposing to thrombosis and the underlying media is thinned, predisposing to aneurysm formation. It is the number one killer disease, 50 per cent of all deaths in the USA are attributed to atherosclerosis and half of theseare due to acute myocardial infarctions. The remainder include cerebrovascular accidents ("stroke"), aneurysm rupture, mesenteric occlusion and gangrene of theextremities. Etiological Factors Major risk factors in CHD have been discussed earlier. Risk of developing atherosclerosis increases with age, a positive family history, cigarette smoking, diabetes mellitus, hypeension, and hypercholesterolemia. The risk is correlated with elevated LDL and inversely related to the HDL level. Hereditary defects, e.g. familial hypercholesterolemia involving the LDL receptor or the LDL apoproteins cause elevated LDL, hypercholesterolemia andaccelerated atherosclerosis. Lesser influences on the risk of atherosclerosis include sedentary, or high-stress lifestyle, obesity and oral contraceptives.Ref: M.N. Chatterjee - Textbook of Biochemistry, 8th edition, page no: 454 - 456 | Biochemistry | Metabolism of lipid | Atherosclerosis is due to
A. HDL receptor defect
B. Apo protein E deficiency
C. Decreased LDL activity
D. Decreased lipoprotein lipase
| Apo protein E deficiency |
56af3bcf-e406-4ca6-b075-b3ac9e6e3a7d | The oligosaccharide units of a glycoprotein are covalently linked to the polypeptide by specific glycosidic bond, termed as the glycopeptide bond.
Core protein is found in proteoglycans, not in glycoproteins.
The length of the oligosaccharide chain is relatively short (2-10 sugar residues) in glycoproteins, whereas it is longer (upto 100) in proteoglycans.
Glycoproteins participate in cell surface recognition | Biochemistry | null | Characteristics of glycoprotein -a) Protein linked with glycosidic bondb) Core proteinc) Sugar residues are long in carbohydrate portion of glycoproteind) Participate in cell surface recognition
A. b
B. c
C. ac
D. ad
| ad |
a84486f3-1939-4c2e-ad1c-1999bfc5a581 | Celiac sprue is due to hypersensitivity to gluten, a protein found in wheat products. The disease is associated with HLA-DQ2 and HLA-DQ8. Laboratory testing shows the presence of anti-gliadin, anti-tissue transglutaminase, and anti-endomysial antibodies in patients. Clinical presentation of celiac sprue include, bloating, chronic diarrhea, and malabsorption. Extraintestinal manifestations are common. Dermatitis herpetiformis, a pruritic papular and vesicular rash on the extensor surface of the forearms, elbows, back, and buttocks is classic. Ref: Wyatt C., Kemp W.L., Moos P.J., Burns D.K., Brown T.G. (2008). Chapter 14. Gastrointestinal Pathology. In C. Wyatt, W.L. Kemp, P.J. Moos, D.K. Burns, T.G. Brown (Eds), Pathology: The Big Picture. | Pathology | null | Serological examination of a patient shows positive for anti gliadin antibodies. It is characteristic of the following condition:
A. Tropical sprue
B. Whipple's disease
C. Celiac disease
D. Intestinal lymphoma
| Celiac disease |
f3472c85-ad2a-4bd2-8aea-71b68ab3a737 | Ans. is 'b' i.e., Endometrial hyperplasia | Pharmacology | null | Tamoxifen causes ?
A. Osteoporosis
B. Endometrial hyperplasia
C. Ovarian cancer
D. Decreased triglyceride level
| Endometrial hyperplasia |
521a4f9a-8d34-451e-8a69-bfe658d8a789 | Ans. B. ProjectionAll of the others are mature defenses. Anticipation is goal directed and involves realistic anticipation or planning for future inner discomfort. Suppression involves the conscious postponement of attention to a conscious impulse or conflict. Altruism uses constructive and instinctually satisfying service to others to undergo a vicarious experience. Asceticism involves the assignment of value to specific pleasure and is directed against all base pleasures. | Psychiatry | Cognitive Development | Sigmund Freud gave various defense mechanisms. Which of the following is not a mature defense mechanism?
A. Humor
B. Projection
C. Asceticism
D. Altruism
| Projection |
a9fe903c-3704-4d58-9455-80791a330d6c | NdYAG is a photo disruptive laser and is used for both posterior capsulotomy and peripheral iridotomy Refer Khurana 6th edition page number 401 | Ophthalmology | Lens | Which which laser is used in the management of after cataract
A. Argon
B. Krypton
C. Nd-YAG
D. Excimer
| Nd-YAG |
b6c0a74a-82b1-4542-8456-00af08207d88 | Most common neonatal disorder to be screened is Neonatal hypothyroidism (NNH) Blood sample is collected from Cord's Blood /fromheel prick after 24hrs of bih Test- measurement of T4 or TSH /both simultaneously. As a single method, T4 is more useful (greater precision and reproducibility) Congenital Hypothyroidism is one of the most common preventable cause of mental retardation. Hence, neonatal screening & early supplementation of thyroid hormones can prevent this mental retardation. | Social & Preventive Medicine | Paediatric Care in RCH: BW, BL, PEM, Breast Feeding | Most common neonatal disorder screened is:
A. Neonatal hypothyroidism
B. Neonatal hypehyroidism
C. Hemoglobinopathies
D. Congenital Dislocation of Hip
| Neonatal hypothyroidism |
6bce4733-0e59-4afe-baf4-c159a236caca | Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC UAU UAA 1 2 3 4 5 6 7 8 etc etc The inseion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids is wrong, since such a mutation would have inseed a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation is the result of a single base pair change, which is not the case here. A point mutation resulting in the inseion of a new stop codon is called a nonsense mutation, and it would result in a shoer-than-normal protein. Ref: Weil P. (2011). Chapter 37. Protein Synthesis & the Genetic Code. In D.A. Bender, K.M. Botham, P.A. Weil, P.J. Kennelly, R.K. Murray, V.W. Rodwell (Eds), Harper's Illustrated Biochemistry, 29e. | Biochemistry | null | Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr?
A. A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain
B. A mutation in the stop codon resulted in elongation of the b-chain
C. A point mutation resulted in the inseion of a stop codon in the b-chain
D. A two base pair addition resulted in the elimination of a stop codon in the b-chain
| A two base pair addition resulted in the elimination of a stop codon in the b-chain |
de231299-c4b5-4980-88ca-3dd828085789 | Lymphoma is well known to develop specifically in the late stage of Sjogren syndrome. Common manifestations include: Persistent parotid gland enlargement Purpura Leukopenia Cryoglobulinemia Low C4 complement levels. - Most of the lymphomas are extranodal, marginal zone B cell, and low grade. Low-grade lymphomas may be detected incidentally during a labial biopsy. - Moality is higher in patients with concurrent B symptoms (fevers, night sweats, and weight loss), a lymph node mass >7 cm, and a high or intermediate histologic grade. | Medicine | Scleroderma | A patient with primary Sjogren syndrome treated with tear replacement for symptomatic relief notes continued parotid swelling for the last 3 months. She also has enlarged posterior cervical lymph nodes. Evaluation shows leukopenia and low C4 complement levels. What is the most likely diagnosis?
A. Amyloidosis
B. Chronic pancreatitis
C. HIV infection
D. Lymphoma
| Lymphoma |
88e10ff7-ffb2-40a5-8f04-05296fa923fa | First line drugs for Functional class II-III PAH : cGMP Signaling Modulators: PDE-5 Inhibitors - Sildenafil, Tadalafil, Vardenafil cGMP Signaling Modulators: sGC Stimulator - Riociguat Endothelin Receptor Antagonists - Bosentan, Ambrisentan First line drugs for Functional class IV PAH: IP Receptor Agonists: Prostacyclin and Prostacyclin Analogs - Epoprostenol, Selexipag . L-type Ca2+ Channel Blockers like Nifedipine, Amlodipine: Use only in PAH patients with positive vasodilator testing. | Pharmacology | Respiratory System | Which of the following drug used in the Management of Pulmonary Hypeension acts by inhibiting Phosphodiesterase enzyme?
A. Epoprostenol
B. Bosentan
C. Nifedipine
D. Sildenafil
| Sildenafil |
3f1b2617-a977-4388-91ff-7516cd09cbe0 | Group Category / Age Body weight (Kg) Net energy (Kcal/d) Protein (g/d) Man Sedentary work Moderate work Heavy work 60 2,320 2,730 3,490 60.0 Woman Sedentary work Moderate work Heavy work Pregnant woman Lactation 0-6 m 6-12 months 55 1,900 2,230 2,850 +350 +600 +520 55.0 78 74 68 Infants 0-6 months 6-12 months 5.4 8.4 92 kcal/Kg/d 80 kcal/kg/d 1.16g / kg/d 1.69 g/kg/d Children 1-3 years 4-6 years 7-9 years 12.9 18.0 25.1 1,060 1,350 1,690 16.7 20.1 29.5 Boys 10-12 years 34.3 2,190 39.9 Girls 10-12 years 35.0 2,010 40.4 Boys 13-15 years 47.6 2,750 54.3 Girls 13-15 years 46.6 2,330 51.9 Boys 16-17 years 55.4 3,020 61.5 Girls 16-17 years 52.1 2,440 55.5 Energy Requirements Adult Man: ~2300 kcal/day if sedentary level worker, ~2700 kcal/day if moderate level worker and 3500 kcal/day if heavy level worker. Adult Woman: ~1900 kcal/day if sedentary level worker, ~2200 kcal/day if moderate level worker and ~2900 kcal/day if heavy level worker. Infant 0-6months: 92 Kcal/Kg/d i.e. approx. 500 kcal/day and in infants 6-12 months: 80 Kcal/kg/d i.e. approx. 670kcal/day Additional energy requirements in pregnancy: +350 Additional energy requirements in lactation: in 0-6 months is +600 kcal/day and in 6-12 months is +520 kcal/day | Social & Preventive Medicine | Allied Health Sciences | Energy requirement for pregnant women doing moderate physical activity with body weight 55 kg
A. 2280
B. 2580
C. 2730
D. 2630
| 2580 |
ee610d71-45b0-4db9-a9c8-ae8b04dd1a83 | Cisatracurium is a stereoisomer of atracurium that is four times more potent. Like atracurium, it undergoes degradation in plasma at physiological pH and temperature by organ-independent Hofmann elimination. The resulting metabolites (a monoquaternary acrylate and laudanosine) have no neuromuscular blocking effects. Because of cisatracurium's greater potency, the amount of laudanosine produced for the same extent and duration of neuromuscular blockade is much less than with atracurium. Nonspecific esterases are not involved in the metabolism of cisatracurium. Metabolism and elimination are independent of renal or liver failure hence can be given in hepatic and renal failure. Ref: Butterwoh IV J.F., Butterwoh IV J.F., Mackey D.C., Wasnick J.D., Mackey D.C., Wasnick J.D. (2013). Chapter 11. Neuromuscular Blocking Agents. In J.F. Butterwoh IV, J.F. Butterwoh IV, D.C. Mackey, J.D. Wasnick, D.C. Mackey, J.D. Wasnick (Eds), Morgan & Mikhail's Clinical Anesthesiology, 5e. | Anaesthesia | null | An alcoholic patient with history diabetic nephropathy and liver failure is posted for open abdomen surgery. The most appropriate muscle relaxant in this patient is:
A. Cisatracurium
B. Rocuronium
C. Vecuronium
D. Rapacuronium
| Cisatracurium |
08a7a3c0-35fa-4879-8457-6df463d1f6af | Neurofibromatosis - 2 :
Vertibular Schwannoma.
Meningioma.
Spinal cord ependymoma.
Spinal cord astrocytoma. | Pediatrics | null | Vertibular Schwannoma, spinal cord astrocytoma, meningioma are seen in
A. Tuberous sclerosis
B. Neurofibromatosis - 1
C. Von Hippel - lindeu syndrome
D. Neurofibromatosis - 2
| Neurofibromatosis - 2 |
22751e8e-059f-4321-b412-5fbb96305351 | Ans - A. Serum lipase activity increases in parallel with amylase activity and is more specific than amylase. A serum lipase measurement can be instrumental in differentiating a pancreatic or nonpancreatic cause for hyperamylasemia. | Medicine | Pancreas | Definitive diagnosis of acute pancreatitis is done by-
A. Lipase
B. S. alkaline phosphatase
C. Increased Ca++
D. Hyperglycemia
| Lipase |
a758633d-31ef-4d24-8f46-205c1ec490af | Cytochrome p450 enzymes are microsomal enzymes that are involved in phase I metabolism of many drugs,
Most of the drugs are metabolized by CYP 3 A4 isoform. Drug metabolizing enzymes The drug-metabolizing enzymes are divided into two types :
1. Microsomal These are located on smooth endoplasmic reticulum primarily in the liver, also in kidney, intestinal mucosa and lungs.
Examples are monooxygenase, cytochrome P450, glucuronyl transferase.
They catalyze most of the oxidation, reduction, hydrolysis and glucuronide conjugation.
They are inducible by drugs, diet and other agencies.
2. Nonmicrosomal These are present in the cytoplasm and mitochondria of hepatic cells as well as in other tissues including plasma.
Examples are flavoprotein oxidase, esterases, amidases and conjugases.
They catalyze some oxidation and reduction, many hydrolysis and all conjugation except glucuronidation.
They are not inducible but many show genetic polymorphism (acetyltransferase, pseudocholinesterase) | Pharmacology | null | Detoxication of drugs is controlled by
A. Cytochrome
B. Cytochrome p450
C. Cytochrome
D. Cytochrome A
| Cytochrome p450 |
5a20c477-48fb-4f2d-8ae2-189006cfd042 | Ref: KD Tripathi pharmacology 7th edition (page.no: 144) Topical b blockers are one of the first-line drug for glaucoma In contrast to miotics, the b blockers do not affect pupil size, the tone of ciliary muscle or outflow facility, but lower i.o.t. by reducing aqueous formation. This probably results from down-regulation of adenylyl cyclase due to b 2 receptor blockade in the ciliary epithelium and a secondary effect due to a reduction in ocular blood flow. | Pharmacology | Autonomic nervous system | The most impoant action of beta-blockers in glaucoma is :
A. Membrane stabilizing effect
B. Refinal neuron protecting effect
C. Decrease in the production of aqueous humor
D. Pupillary constriction
| Decrease in the production of aqueous humor |
02a40ce0-5057-41b9-ac34-757bbdd60241 | Typical absence seizures are characterized by sudden, brief lapses of consciousness without loss of postural control. The seizure typically lasts for only seconds, consciousness returns as suddenly as it was lost, and there is no postictal confusion. Although the brief loss of consciousness may be clinically inapparent or the sole manifestation of the seizure discharge, absence seizures are usually accompanied by subtle, bilateral motor signs such as rapid blinking of the eyelids, chewing movements, or small-amplitude, clonic movements of the hands. Typical absence seizures are associated with a group of genetically determined epilepsies with onset usually in childhood (ages 4-8 years) or early adolescence and are the main seizure type in 15-20% of children with epilepsy. Since the clinical signs of the seizures are subtle, especially to parents who may not have had previous experience with seizures, it is not surprising that the first clue to absence epilepsy is often unexplained "daydreaming" and a decline in school performance recognized by a teacher. Hyperventilation tends to provoke these electrographic discharges and even the seizures themselves and is routinely used when recording the EEG. Ref: Lowenstein D.H. (2012). Chapter 369. Seizures and Epilepsy. In D.L. Longo, A.S. Fauci, D.L. Kasper, S.L. Hauser, J.L. Jameson, J. Loscalzo (Eds), Harrison's Principles of Internal Medicine, 18e. | Pediatrics | null | A 6 year old girl is easily distracted in class and exhibits poor scholastic performance. Seizures are precipitated by hyperventilation. What is the probable diagnosis?
A. Myoclonic seizures
B. Absence seizures
C. Atonic seizures
D. Myoclonia
| Absence seizures |
375f338b-2f13-4e98-a599-cd8ab4a30f28 | * Aminoglycosides (like streptomycin and gentamicin) can accentuate the neuromuscular blockade produced by competitive blockers (like pancuronium). * Mechanism of neuromuscular blockade produced by aminoglycosides is the inhibition of presynaptic release of ACh. | Pharmacology | Antimicrobial Drugs | The following antibiotic accentuates the neuromuscular blockade produced by pancuronium:
A. Streptomycin
B. Erythromycin
C. Penicillin G
D. Chloramphenicol
| Streptomycin |
118a41bf-d869-48c0-ad65-d81f861b5964 | Glucuronic acid is a sugar acid derived from glucose, with its sixth carbon atom oxidized to a carboxylic acid. In living beings, this primary oxidation occurs with UDP-a-D-glucose (UDPG), not with the free sugar.Ref: DM Vasudevan, 7th edition, page no: 120 | Biochemistry | Metabolism of carbohydrate | Biosynthesis of glucuronic acid requires the
A. Oxidation of UDP glucose
B. Oxidation of glucose 6-phosphate
C. Oxidation of 6-phophoguconate
D. Oxidanation of glucose
| Oxidation of UDP glucose |
c6feff15-233e-459e-9193-51849a426749 | Glucocoicoids reduce inflammation and limit tissue damage; they are currently recommended when treating pericardial ,lymphadenitis patients having TB or meningeal disease, and in children with endobronchial disease. They may confer benefit in TB of the ureter, pleural effusions and extensive pulmonary disease, and can suppress hypersensitivity drug reactions. Surgery should be considered in cases complicated by massive haemoptysis, loculated empyema, constrictive pericarditis, lymph node suppuration, and spinal disease with cord compression, but usually only after a full course of antituberculosis treatment. Ref Harrison20th edition pg 980 | Medicine | Infection | Steroids are useful in treating Tuberculosis patient with-
A. Endobronchial tuberculosis
B. Tuberculous osteomyelitis
C. Lymphadenitis
D. Pneumonia
| Lymphadenitis |
18c27cfc-49b9-4258-be68-3feef8e25d2f | PNH is a disease that results from acquired mutations in the phosphatidylinositol glycan complementation group A gene (PIGA), an enzyme that is essential for the synthesis of certain cell surface proteins.
Red cells, platelets, and granulocytes deficient in these GPI-linked factors are abnormally susceptible to lysis by complement. In red cells, this manifests as intravascular hemolysis, caused by the C5b-C9 membrane attack complex.
The triad of hemolysis, pancytopenia and thrombosis is unique to PNH.
Thrombosis is the leading cause of disease-related death in PNH.
PNH is best made with flow cytometry in which there is presence of bimodal distribution of the red cells. | Pathology | null | Intravascular hemolysis occurs in:
A. Hereditary spherocytosis
B. Autoimmune haemolytic anemia
C. Paroxysmal nocturnal hemoglobinuria
D. Thalassemia
| Paroxysmal nocturnal hemoglobinuria |
66006504-ed9a-4abf-a097-a589a06a69e3 | Tonsilolingual sulcus is seat of carcinoma usually missed by ENT doctor in OPD to check. | ENT | null | Graveyard of ENT surgeon
A. Pyriform Fossa
B. Bucco Labial sulcus
C. Tonsilolingual sulcus
D. Peritonsillar space
| Tonsilolingual sulcus |
eb0a7e90-071d-4048-af6f-4eba529703c6 | FLEXOR RETINACULUM Transverse carpal ligament. Strong fibrous band which bridges anterior concavity of carpus and conves it into osseofibrous tunnel callef carpal tunnel for the passage of flexor tendons of the digits. Rectangular.Formed due to thickening of deep fascia in front of carpal bones. Attachments: medial-pisiform , hook of hamate.Lateral-tubercle of scaphoid and crest of trapezium. Structures passing superficial to flexor retinaculum:-(medial to lateral)1. Ulnar nerve 2. Ulnar aery 3. Posterior cutaneous branch of ulnar nerve.4. Tendon of palmaris longus.5. Palmar cutaneous branch of median nerve.6. Superficial palmar branch of radial aery. Structures passing deep to flexor retinaculum:-1. Tendon of FDS2. Tendon of FDP 3. Tendon of FPL.4. median nerve. Ulnar bursa-tendons of FDS&FDP.Radial bursa- tendon of flexor pollicis Flexor carpi radialis pass through separate canal. CARPAL TUNNEL SYNDROME:-Injury to median nerve in carpal tunnel.Causes:-Tenosynovitis of flexor tendons.MyxedemaRetention of fluid in pregnancy Fracture dislocation of lunate bone.Osteoahritis of wrist. Symptoms:-1. Feeling of burning pain or " pins & needles " along lateral 3 and half digits especially at night.2. Weakness of thenar muscles.3. No sensory loss over thenar eminence.4. Ape thumb deformity if left untreated.5. Positive phalens abd tinel's sign.Phalen' sign-flexion of both wrists against each other for one minute reproduces the symptoms.Tinel's sign- percussion over flexor retinaculum reproduces symptoms. {Reference:vishram singh, page no.196,} mnemonic: Spm fully Boring Flexor digitorum Superficalis tendon, flexor digitorum profundus tendon, median nerve, Flexor poLLicis longus, Bursae- radial & ulnar | Anatomy | Upper limb | Compression of a nerve within the carpal tunnel products inability to
A. Abduct the thumb
B. Adduct the thumb
C. Flex the distal phalanx of the thumb
D. Oppose the thumb
| Abduct the thumb |
9c34bfe3-70c1-42e6-b286-9bb04e99b57e | Ans. is a i.e. 20p.g -intensive pharmacological research clinical trials conducted to minimise the adverse effects of estrogen without reducing the contraceptive efficacy, resulted in lowering the dose of oestrogen to a minimum of 20gg or even 15gg." Examples of pills with 20p.g estrogen : Femilon : Loette Estrogen (EE) = 2opg Estrogen (EE) = 20pg Progestin (Desogestrel) = 0.15mg Progestin (Levonorgestrel) = 0.1mg Benefits of Low dose OCP's Decreased risk of Thromboembolic events with low dose OCP's.deg Note : Thrombosis risk is apparent by 4 months after staing estrogen containing OC's and does not increase fuher with continued use. Risk is highest during the first year of useq Decreased risk of high blood pressure (as compared to traditional high dose OCP's) Minimum adverse effect on lipid profile Less complains of Nausea and vomiting (as these complications are related to Estrogen component). The beneficial effects and efficacy of low dose OCP's is similar to traditional high dose OCP's whereas side effects have decreased. Extra Edge : Once a month (long acting pill). Contains : Ouniestrol (long acting estrogen) + sho acting progestin. | Gynaecology & Obstetrics | null | Minimum effective dose of Ethinyl estradiol in combination oral pills is
A. 20 pgm
B. 35 pgm
C. 50 pgm
D. 75 pgm
| 20 pgm |
75d8cc6a-0e45-4c54-a2d1-34fc1a191cb3 | Ans. C. Thrombolytic therapyFirst let us diagnose the ECG; we need to know the following points:E.C.G changes in acute infarctionEarly acute phase (with - in hours)Fully evolved phaseOld infarction (resolution phase)Elevation of ST segmentPathological Q warePathogical Q waveTall wide (peaked) T waveElevated ST segment being to resolveT wave inverts.ST segment and T wave may be normalST segment elevation, unlike depression, will localize to the ECG lead of the affected myocardium. Note that 1mm of ST elevation in 2 contiguous leads is required to diagnose STEMI, however there are two major exceptions.a. Anterior STEMI requires 2mm of ST elevation in V2 and V3 in men > 40 years old or 1.5mm in women according to the ACC/AHA definition.b. Posterior STEMI frequently has ST depression in V1-V3 instead of elevation since the vectors are completely reversed. Hence, this is an ECG of anterior STEMI.In STEMI, thrombolysis or PCI (primary PCI) are effective methods to restore coronary blood flow and salvage myocardium within the first 12 h after onset of chest pain.ST elevation MI (STEMI) Immediate management:a. Nitratesb. Morphinec. Oxygend. AspirinStart adjunctive treatmenta. Beta blockers (IV)b. Nitroglycerine (IV)c. Heparin (IV)Reperfusion therapy is the definitive treatment of choice if patient present < 12 hours.a. Thrombolysis (Streptokinase)b. Early primary PCI | Medicine | C.V.S. | A 65 year old elderly male has history of sweating and chest pain for last 24 hrs with the following ECG. Which of the following is not given in managing the patient?
A. Aspirin
B. Statin
C. Thrombolytic therapy
D. Morphine
| Thrombolytic therapy |
dcd8a784-47b3-4a05-ab4c-421698bbf999 | Ans. is 'c' i.e., Type C2 Fisch classification The Fisch classification of glomus tumors is based on extension of the tumor to surrounding anatomic structures and is closely related to moality and morbidity. Type A :- Limited to middle ear cleft (glomus tympanicum). Type B :- Limited to tympanomastoid area with no involvement of infralabyrinthine compament. Type C :- Involving infralabrinthine compament extending upto petrous apex Type C1 :- Limited involvement of veical poion of carotid canal Type C2 :-Invading veical poion of carotid canal Type C3 :-Invasion of horizontal poion of carotid canal Type D Intracranial extension Type D1 Intracranial extension < 2 cm in diameter Type D2 :-Intracranial extension > 2 cm in diameter | ENT | null | Glomus tumor invading the veical pa of carotid canal. It is
A. Type B
B. Type CI
C. Type C2
D. Type C3
| Type C2 |
d9d38414-7a6e-465c-b6e6-e5689551005a | - essential aminoacid are the one that cannot be synthesised in the body corresponding to the needs. Thus need to be supplied through diet. - they are leucine, isoleucine, lysine, methionine, phenylalanine, threonine, valine, tryptophan and histidine. Reference : Park's textbook of preventive and social medicine, 23rd edition, pg no:609 <\p> | Social & Preventive Medicine | Nutrition and health | Essential amino acids are A/E -
A. Leucine
B. Proline
C. Lysine
D. Methionine
| Proline |
f4d5608d-8b9d-46e7-b5a6-128320ed2cfe | Sleep OSAHS also may be diagnosed in the absence of symptoms if the AHI is above 15. Each episode of apnea or hypopnea represents a reduction in breathing for at least 10 sec Ref Harrison 19th edition pg 1723 | Anatomy | Respiratory system | ''Sleep apnoea '' is defined as a temporary pause in breathing during sleep lasting at least-
A. 40 seconds
B. 30 seconds
C. 20 seconds
D. 10 seconds
| 10 seconds |
166c7cc1-1a35-462f-8f20-7431c9019e1f | Answer is B (Direct spread from liver): An amoebic lung abscess is almost always secondary to spread from the liver. Extraintestinal infection by E. histolytica most often involves the liver. Fuher involvement most commonly leads to Amoebic lung abscess. Infact pleuropulmonary involvement (Lung): is the most frequent complication of Amoebic liver abscess. Remember: Most common cause of a lung abscess is - 'Aspiration'. However this holds true for pyogenic (bacterial lung abscess) | Medicine | null | Most common cause of amoebic lung abscess is :
A. Aspiration
B. Direct spread from liver
C. Hematogenous spread from liver
D. Hematogenous spread from gut
| Direct spread from liver |
40365dc8-e675-4a98-9608-40793707d848 | Digastric muscle Digastric has two bellies United by an intermediate tendon. NERVE SUPPLY; anterior belly by nerve to mylohyoid, facial nerve. ACTIONS; 1. Depresses mandible is opened widely or against resistance it is secondary to lateral pterygoid. 2. Elevates hyoid bone. Ref BDC volume 3;6th edition | Anatomy | Head and neck | Muscle of neck with dual nerve supply
A. Sternohyoid
B. Thyrohyoid
C. Digastric
D. Stylohyoid
| Digastric |
19b8af6f-07a9-49af-a65d-ddb5e69fb77b | Ans. (c) Vitamin B6Ref. KDT 6th ed. / 740-41* For patients who are on isoniazid; peripheral neuropathy is observed in 10-20% of patients given dosages greater than 5 mg/kg/d but is infrequently seen with the standard 300 mg adult dose.* Pyridoxine (Vit B6), 25-50 mg/d, is recommended for those with conditions predisposing to neuropathy, an adverse effect of isoniazid.* NOTE: Isoniazid as a single agent is also indicated for treatment of latent tuberculosis. The dosage is 300 mg/d (5 mg/kg/d) or 900 mg twice weekly for 9 months. | Pharmacology | Anti-Tuberculosis | Patients on isoniazid which vitamin deficiency is more likely to be seen.
A. Vitamin B9
B. Vitamin B12
C. Vitamin B6
D. Vitamin B3
| Vitamin B6 |
afbccb26-c1dd-46b8-9d27-6eddcf7a5285 | Axillary Node Clearance Axillary node clearance is defined as clearing of the axillary contents bounded by: Laterally: Axillary skin Posteriorly: Lattisimus dorsi, Teres major and subscapularis Superiorly: Lower border of axillary vein Anteriorly: Pectoralis muscle Medially: Chest wall | Surgery | Breast | Superolateral boundary of axillary dissection is:
A. Clavipectoral fascia
B. Brachial plexus
C. Axillary aery
D. Axillary vein
| Axillary vein |
611347cb-f098-42fa-858c-cc498de793fa | Intrinsic muscles of larynx They may act on vocal cords or laryngeal inlet. (a) Acting on vocal cords:- * Abductors:- Posterior cricoarytenoid * Adductors:- Lateral cricoarytenoid , Interarytenoid (transverse arytenoid), Thyroarytenoid (external pa) * Tensors:- Cricothyroid , Vocalis (internal pa of thyroarytenoid). Ref:- Dhingra; pg num:-283 | ENT | Larynx | Which of the following is Tensor of the vocal cord
A. Cricothyroid
B. Inter arytenoid
C. Posterior cricoarytenoid
D. Lateral cricoarytenoid
| Cricothyroid |
df4f4927-c88e-4cb4-b8ed-e0fb6142d4dd | Ans. is 'a' i.e., Overeatment of CTEV Rocker bottom foot Rocker bottom foot is a foot with a convex plantar surface with an apex of convexity at the talar head (normal plantar surface is concave). Causes of Rocker Bottom foot are :- Congenital veical talus Overcorrection of CTEV Improper correction of CTEV, i.e. forceful correction of equines by dorsiflexion before correction of adduction, varus and inversion. Edward's syndrome, Escobar syndrome, Ape's syndrome. Congenital veical talus may be associated with ahrogryposis, Prune belly syndrome, neurofibromatosis, and spinal muscular dystrophy | Surgery | null | Rocker bottom foot is due to ?
A. Overeatment of CTEV
B. Malunited fracture calcaneum
C. Horizontal talus
D. Neural tube defect
| Overeatment of CTEV |
15391077-e62b-4cad-affd-936cd7d07ed5 | Hypoglycemia is defined as a blood glucose value of less than 40 mg/ dl (plasma glucose of less than 45 mg/ dl). These babies should be screened for hypoglycemia at 2, 6, 12, 24, 48 and 72 hr after bih with reagent strips (dextrostix).Babies showing blood sugar value of less than 40 mg/ dl on reagent strip should be treated for hypoglycemia but should have confirmation of hypoglycemia by a lab test Appropriate for gestational age babies who are breastfeeding adequately do not require any screening for hypoglycemia.Ref: Paediatrics; O.P. Ghai; 8th edition; Page no: 179 | Pediatrics | New born infants | Hypoglycemia is defined as a blood glucose value of less than
A. 60 mg/dl
B. 50 mg/dl
C. 40 mg/dl
D. 30 mg/dl
| 40 mg/dl |
6835f56f-0100-463b-a6d7-fcdfa0d97bcc | Adenoid cystic carcinoma has got high affinity for perineural spread(both axially and circumferentially;antegrade and retrograde fashion) along mandibular and maxillary divisions of trigeminal (common) and facial nerve .It infiltrates nerve more proximally for long distance. Tumor may reach Gasserian trigeminal ganglion ,pterygopalatine ganglion and cavernous sinus SRB,5th,417 . | Surgery | Head and neck | Which parotid tumor spreads along nerve sheath ?
A. Pleomorphic adenoma
B. Mucoepidermoid carcinoma
C. Adenoid cystic carcinoma
D. Wahin's tumor
| Adenoid cystic carcinoma |
50950cf4-e7fe-4d9c-bc89-b46b79f46233 | Hemoglobin Combines Reversibly With Oxygen.
Carbon monoxide (CO) combines with hemoglobin at the same point on the hemoglobin molecule as does O2 ; it can therefore displace O2 from the hemoglobin.
CO2 reacts directly with amine radicals of the hemoglobin molecule to form the compound carbaminohemoglobin (CO2 Hgb).
This combination of CO2 and hemoglobin is a reversible reaction that occurs with a loose bond, so the CO2 is easily released into the alveoli, where the PCO2 is lower than in the pulmonary capillaries.
Reference: : Guyton physiology pg no 532,535 | Medicine | null | Hemoglobin does not bind with:
A. Oxygen
B. Carbon dioxide
C. Carbon monoxide
D. HCN
| HCN |
d220a607-2157-4e3c-81c9-ab84688d9642 | In Magills it fresh gas flow is equal to minute volume. In Bains co-axial system or type D ,fresh air flow required to prevent rebreathing is 1.6minute volume | Anaesthesia | Anaesthetic equipments | In magil circuit airflow is -
A. 1/2 of minute volume
B. equal to M.V.
C. 2 X M.V.
D. 3 X M.V.
| equal to M.V. |
0e7930ca-8762-435d-a57e-5a84bb912c3d | Right lung(above downwards) Epaerial bronchus Pulmonary aery Hypaerial bronchus Inferior pulmonary vein Left lung Pulmonary aery Bronchus Inferior pulmonary vein <img src=" /> Ref. BD Chaurasia volume 1 page 226 | Anatomy | Thorax | In hilum of right lung which of the following is the uppermost structure
A. Superior pulmonary vein
B. Bronchus
C. Bronchial aery
D. Inferior pulmonary vein
| Bronchus |
d3671744-009f-4aa6-9f0c-0500e62938a0 | Ans. c (Complete extension) (Ref. Park Textbook of PSM 22nd/pg.635)A family is a primary unit in all socities. Familes are not constant. A normal family-cycle is generally conceived as having six phases as follows:BASIC MODEL OF NUCLEAR FAMILY LIFE CYCLE Phase of family cycleCharacterizing EventsNo.DescriptionBeginning of phaseEnd of phaseIFormationMarriageBirth of 1st childIIExtensionBirth of 1st childBirth of last childIIIComplete extensionBirth of last child1st child leaves homeIVContraction1st child leaves homeLast child has left home of parentsVCompleted contractionLast child has left home of parents1st spouse diesVIDissolution1st spouse diesDeath of survivor (Extinction) | Social & Preventive Medicine | Demography and Family Planning | In basic model of Nuclear family life, the phase of family life cycle beginning with birth of last child and ending with leaving of home of first child is known as?
A. Formation
B. Extension
C. Complete extension
D. Contraction
| Complete extension |
9c94431a-e053-465f-b389-3a6e381df358 | Ibutilide, dofetilide, sotalol, amiodarone are class 3 agents they are potassium channel blockers- they r broad spectrum antiarrhythmic agents they increase QT interval | Pharmacology | Cardiovascular system | Dofetilide belong to?
A. Class I antiarrythmic
B. Class II antiarrythmic
C. Class III antiarrythmic
D. Class IV antiarrythmic
| Class III antiarrythmic |
4f33857a-eaf1-43e8-98be-b6a43ab227d5 | IBS is a disorder for which no pathognomonic abnormalities are identified. Females are more commonly affected. People of all age groups are affected, but most have the onset of symptoms before 45 years. Patients usually presents with recurrent lower abdominal pain, abdominal bloating and altered bowel habits. Stool is accompanied by large amount of mucus, Bleeding is not a feature. Symptoms occur at times of stress or emotion. Ref: Harrison's principles of internal medicine 18th edition, Chapter 296; Current medical diagnosis and treatment 2012, Chapter 35; Current medical diagnosis and treatment 2012, Chapter 15. | Medicine | null | A young girl presents with abdominal pain and a recent change in bowel habit, with passage of mucus in stool. There is no associated blood in stool and symptoms are increased with stress. The most likely diagnosis is:
A. Irritable bowel syndrome
B. Ulcerative Colitis
C. Crohn's disease
D. Amebiasis
| Irritable bowel syndrome |
cb9e1b86-41a3-42fb-b489-b11222c83879 | Retraction means moving backward of scapula at sternoclavicular joint. It is done by the following muscles: Trapezius Rhomboid major Rhomboid minor. Subscapularis helps in medial rotation of humerus. Serratus anterior helps in protraction of scapula. Supraspinatus helps in adduction. | Anatomy | Upper limb bones and muscles (proximal region) & Scapular movements | Retraction of scapula at sternoclavicular joint is done by:
A. Serratus anterior
B. Trapezius
C. Subscapularis
D. Supraspinatus
| Trapezius |
b83f9ab5-f08b-4b4c-abe5-7dc84b4efa71 | Condylar guidance
Definition: The mechanical form located in the upper posterior region of an articulator that controls movement of its mobile member (GPT8).
Condylar guide inclination: The angle formed by the inclination of a condylar guide control surface of an articulator and a specified reference plane (GPT8).
This is the mandibular guidance generated by the condyles traversing the contours of the glenoid fossa.
It is duplicated in the articulator. The extent of duplication depends on the articulator’s capability, whether it is semi-adjustable or fully adjustable.
Protrusive condylar guidance is obtained using protrusive records,while the lateral condylar guidance is obtained using Hanau’s formula or lateral records
It is designated as an inclination or angle – condylar guidance angle or inclination – and is expressed in degrees.
This is the only factor that is obtained from the patient and is not under the dentist’s control.
A shallow condylar guidance will cause less posterior tooth separation in protrusion and requires teeth with shorter cusps and flatter fossa to achieve balanced occlusion, than a steep guidance.
Key Concept:
Out of the five factors of balanced occlusion, only condylar guidance is recorded from the patient by the means of protrusive records. | Dental | null | Which of the following factors of balanced occlusion is given by the patient?
A. Condylar guidance
B. Incisal guidance
C. Inclination of the cusps
D. Orientation of the occlusal plane
| Condylar guidance |
f66cfa31-ed4b-43d9-9b11-2d0b08f5e15f | Sustained monomorphic VT associated with nonischemic cardiomyopathy is usually due to scar-related reentry. On cardiac MR imaging, scars are detectable as areas of delayed gadolinium enhancement and are more often intramural or sub-epicardial in location as compared with patients with prior MI. Any cardiomyopathic process can cause scars and VT, but cardiac sarcoidosis, Chagas disease, and cardiomyopathy due to Lamin A/C mutations are paicularly associated with monomorphic VT . An ICD is usually indicated with additional drugs or catheter ablation for control of recurrent VT. Harrison 20thed pg 1758 | Medicine | C.V.S | A patient with hea failure developed recurrent sustained monomorphic vt .Treatment is/are -
A. Encainide
B. Flecainide
C. Intracardiac Defibrilator
D. Beta-blockers
| Intracardiac Defibrilator |
23524a8e-25fe-486e-8391-f2ad53e6347d | Ans. c (Type III). (Textbook of Microbiology by Ananthnarayan, 6th ed., 155)HYPERSENSITIVITY ReactionsTypeMechanismE.g.Hints to rememeberType I(Anaphylactic and Atopic)Antigen cross -links IgE on presensitized mast cells and basophils, causing of vasoactive amines (i.e., histamine) release.- Anaphylaxis,- Asthma,- Hives- Local wheal and flareFirst and fast (anaphylaxis)Type I, II, and III are all antibody mediated.Type II Cytotoxic(antibody mediated)Antibody mediatedIgM, IgG bind to antigen on "enemy" cell, leading to lysis (by complement) or phagocytosis.- Autoimmune Hemolytic anemia,- Rh disease,- Good pasture's syndrome,- Rheumatic fever,- Grave's disease,- Bullous pemphigoid,- Myasthenia gravis,- ITP.Cy-2-toxic.Antibody and complement lead to membrane attack complex (MAC).Type IIIC-ComplementImmune complexImmune complex-- activate complement, which attracts neutrophils; neutrophils release lysosomal enzymes,- PAN,. Immune complex GN, SLE, rheumatoid arthritis.- Serum sickness--antibodies to the foreign proteins are produced (takes 5 days). Immune complexes form and are deposited in membranes, where they fix complement (leads to tissue damage).More common than Arthus reaction.- Arthus reaction--fntraderma! Injection of antigen induces antibodies, which from antigen-antibody complexes in the skin, causing edema, necrosis and activation of complement.Imagine an immune complex as 3 things stuck together; antigen antibody- complementType IVDelayed(cell mediated)Delayed (T cell mediated) type - sensitized T lymphocytes encounter antigen and then release lymphokines (leads to able by macrophage activation).- 4T's -- T lymphocytes,- Transplant reactions,- TB skin tests,- Touching (contact dermatitis). Hypersensitivity pneumonitis (farmer's lung) by Thermophilic actinomycetes....as per Harrison's 17th ed.4th and last - delayed. | Pathology | Immunity | Serum sickness is which type of hypersensitivity reaction?
A. Type I
B. Type II
C. Type III
D. Type IV
| Type III |
0fed44e7-9f62-44e6-8761-66d0bc8b9e96 | Ans- C 6-8 weeks Ref. Turner 7 Oth/ed p 86; Head and Neck Surgery by Chris DeSouza Vol 2 p 7583 a. Friends, Dhingra and Turner have a different opinions on this one. b. According to Turner 10th/ed p 86-'The tonsils should be removed 6-8 weeks following a Quinsy." c. According to Dhingra 6th/ed p 265-'Tonsils are removed 4-6 weeks following an attack of Quinsy." d. According to Head and Neck Surgery- e. Quinsy - "Most people would practise interval tonsillectomy for these patients, deferring surgery for 6 weeks following resolution of an attack." - Head and Neck Surgery by Chris de Souza Vol 2 p 7583 | Unknown | null | Tonsillectomy following peritonsilar abscess is done after weeks -
A. 3-Jan
B. 6-Apr
C. 8-Jun
D. 12-Aug
| 8-Jun |
b8ad8b03-3fde-4c7b-868f-fe82f961ac75 | ANSWER: (C) Sampter's syndromeREF: With textIn 1922 Widal et al. recognized the additional association of nasal polyposis with aspirin sensitivity and asthma. This became commonly known as "aspirin triad." Following studies by Samter and Beers in the late 1960s, aspirin triad was commonly referred to as Samter's triad. (Ref: Head & Neck Surgery--otolaryngology - Volume 1 by Byron J. Bailey, Jonas T. Johnson, Shawm D. Newlands 4th ed Page 396)"36% of the patients with aspirin intolerance may show polypi. Sampter's triad consists of nasal polypi, asthma and aspirin intolerance* (Ref: Dhingra 4th ed page 162) | ENT | Nasal Polyposis | Aspirin triad is?
A. Churg-Strauss syndrome
B. Kartagener s syndrome
C. Sampter's syndrome
D. Young syndrome
| Sampter's syndrome |
09692eda-4a95-4613-9855-ed141332239b | Ans. a. Diastolic blood pressure Aerial hypeension is the result of abnormal flow/resistance relationships. Resistance to outflow consists of different components: the systolic component is the one generated by conductance vessels, whereas the diastolic component consists of peripheral resistance, which regulates peripheral blood supply due to the run-off of conductance vessels during left ventricular diastole. Thus, an increase in systemic resistance results in a rise in diastolic blood pressure. If the elasticity of conductance vessels decreases, diastolic run-off also decreases and diastolic blood pressure goes down. When this loss of elasticity occurs, the ejection force cannot be anymore offset by aerial distension, the pulse wave velocity increases and reflex waves to the hea arrive earlier, causing the systolic blood pressure to augment. Such an augmentation, together with decreasing diastolic blood pressure results in an enhancement of the pulse pressure. When the stroke volume is normal, an increase in pulse pressure is, therefore, a marker of altered conductance. However, if, due to loss of elasticity of the conductance aeries diastolic blood pressure goes down, increasing systolic pressure also protects against a decrease in mean pressure. Indeed, in conditions of elevated pulse pressure, the mean pressure can be normal or high, indicating that when evaluating blood pressure all components should be taken into consideration. A high systolic blood pressure associated with a normal mean blood pressure is suggestive of a normal peripheral resistance.'Diastolic PressureSystolic pressure is peak pressure reached during systole, similarly, diastolic pressure refers to lowest pressure during diastole.Diastolic blood pressure is an index to peripheral resistance.Elasticity of aoa and large aeries is mainly responsible for origin and maintenance of diastolic pressure (by Windkessel elastic recoil effect).Because the elasticity is higher in younger subjects, diastolic pressure is maintained and pulse pressure is narrow.Because the elasticity is lower in old persons, diastolic pressure is decreased and pulse pressure is widened. | Anatomy | null | Peripheral resistance is best indicated by:
A. Diastolic blood pressure
B. Pulse pressure
C. Systolic resistance in aoa as it increases in its length
D. Mean aerial pressure, which is responsible for blood flow to an organ
| Diastolic blood pressure |
f8d81666-78dc-4e80-9035-12a7fe2d787a | Ans. is 'd' i.e.. Fosfomycin[Ref: OBJECTIVE: To determine the drug of choice for the treatment of uncomplicated cystitis. METHOD: Drug selection was performed by means of the so-called 'system of objectified judgment analysis' (SOJA) method by a working group of 11 persons. The following selection criteria were used: pharmacokinetics, interactions, the probability of hitting (the probability that the microorganism is sensitive to the antibiotic), development of resistance, specific use in urinary tract infections, efficacy, side effects, dosage-frequency, duration of treatment, cost and documentation. The following drugs were included in the study: amoxicillin (with or without clavulanic acid), nitrofurantoin, sulfamethizole, trimethoprim, co-trimoxazole, ciprofloxacin, norfloxacin, ofloxacin and fosfomycin trometamol. RESULTS: Fosfomycin and nitrofurantoin slow release showed the highest scores. The main selection criteria that determined the selection of a drug were especially specific use in urinary tract infections, development of resistance, the probability of hitting and cost. CONCLUSION: Fosfomycin and nitrofurantoin slow release best fulfill the requirements for drugs in the treatment of uncomplicated cystitis. No comparative studies have been performed with the 3-day treatment of uncomplicated cystitis with nitrofurantoin slow release or with trimethoprim. Fluoroquinolones play no important part in the treatment of uncomplicated cystitis, mainly because of the risk of development of resistance. | Unknown | null | Drug of choice for a case of uncomplicated cystitis -
A. Amoxicillin
B. Chloramphenicol
C. Cotrimoxazole
D. Fosfomycin
| Fosfomycin |
626b4496-6285-40be-9267-9cd1d4cb92c1 | Diseases involving oral mucosa :- Lichen plaints, Pemphigus, Infections (Candida, Secondary syphilis, HSV), Leucoplakia, Erythema multiforme, Peutz Jegher syndrome, Aphthous ulcers, Bechet's disease, squamous cell carcinoma | Dental | null | Mucosa is involved in –
A. Psoriasis
B. Lichen planus
C. Alopecia
D. Scabies
| Lichen planus |
94a389cc-383c-42c9-b5bb-79351ca45685 | In the fasting state, there is a considerable output of alanine from skeletal muscle, far in excess of its concentration in the muscle proteins that are being catabolized. It is formed by transamination of pyruvate produced by glycolysis of muscle glycogen, and is expoed to the liver, where, after transamination back to pyruvate, it is a substrate for gluconeogenesis. Ref: Harper 28th edition, chapter 20. | Biochemistry | null | Glucose alanine cycle is impoant in:
A. Liver
B. Hea
C. Muscle
D. Kidney
| Muscle |
c62f8468-7743-4111-b540-468f41ff4f2f | These operations are done for hydrocele .Lord's operation or plication is suitable when the sac is small, thin walled and contains clear fluid. Here tunica is bunched into a 'ruff' at its attachment to the testis by using a series of multiple interrupted chromic catgut sutures to plicate the redundant tunica vaginalis, so as to make the sac to form fibrous tissue. Jaboulay's procedure - Eversion of the sac following paial excision with placement of the testis in a pouch prepared by dissection in the fascial planes of the scrotum.Reference : page 1072 SRB's manual of surgery 5th edition and page 1382 Bailey and Love's sho practice of surgery 25th edition | Surgery | Urology | Lord's and Jaboulay's operation is done for
A. Rectal prolapse
B. Fistula in ano
C. Inguinal hernia
D. Hydrocele
| Hydrocele |
643e12eb-2bb6-4c88-919b-654867419328 | It provides nutrition to the cornea and lens and not the retina. Functions of aqueous humor: Maintenance of IOP Nutrition to lens and cornea Maintaining transparency of eye Clearing the eye of toxins | Ophthalmology | Glaucoma | Which of the following is not a function of aqueous humor?
A. Maintenance of IOP
B. Providing nutrition to retina
C. Transparency of eye
D. Drainage
| Providing nutrition to retina |
7ad2eedb-f2c8-4739-8115-e398906116fa | Ans. is 'c' i.e., Compulsive hair pulling o As there is no organic or behavioral disorders, this girl is suffering with impulse control disorder of compulsive hair pulling, known as Trichotillomania.Impulse control disordero These disorders are characterized by failure to resist an impulsive behavior that may be harmful to self or others. There may be a feeling of release of tension by doing the act and a feeling of guilt after the act is over.Important impulse control disorder are : -Pyromania (Pathological fire setting)Kleptomania (Pathological stealing)Trichotillomania (Compulsive hair pulling)Pathological gamblingIntermittent explosive disorderImpulse control disorder not otherwise specifiedOniomania (Compulsion to shop/buying)Internet compulsion (Internet addiction)Cellular or Mobile phone compulsionCompulsive sexual behavior (sexual addiction). | Psychiatry | Mood Disorders | Trichotillomania-
A. Irresistable desire to set fire
B. Irresistable desire to steal things
C. Compulsive hair pulling
D. Pathological gambling
| Compulsive hair pulling |
9900bbbc-d442-4bef-b502-8722c31140ae | Thiamine (vitamin B1) Deficiency It is assessed by Erythrocyte transketolase activity. Thiamine (Vitamin B1) is the marker for transketolase enzyme -which is involved in HMP pathway (in RBCs) Activity of Transketolase is measured (not the quantity). | Biochemistry | FMGE 2019 | Which enzyme level is tested in thiamine deficiency?
A. PDH
B. Pyruvate kinase
C. Transketolase
D. Kinase
| Transketolase |
a05c0bbb-e794-4f6a-acc2-f73a1329199e | Ans. B. Wide local excisionExplanationLiposarcoma is one of the types of soft tissue sarcoma (STS). Liposarcoma is the most frequent STS subtype and represents 45% of all retroperitoneal sarcoma. It is composed of three histologicvarieties (listed in order of decreasing frequency):Well-differentiated and dedifferentiated liposarcoma,Pleomorphic liposarcoma, andMyxoid/round cell liposarcoma.Well differentiated and dedifferentiated liposarcomas more typically arise from the retroper- itoneum versus the extremities, whereas the inverse is true for pleomorphic and myxoid/round cell liposarcoma.Mainstay of treatment for STS is surgery.Algorithm for STS management is as follows: | Surgery | Plastic & Reconstructive Surgery | A 65-year-old male is having a swelling on the back of lower thigh. On investigation it was found to be a high grade liposarcoma of 5 cm in size. Best management is:
A. Amputation of limb at mid thigh
B. Wide local excision
C. Chemotherapy
D. Radiotherapy
| Wide local excision |
44e6828f-cf88-47db-86bd-95f69bdc8e3e | The sensory root is from the lingual nerve. It is suspended by two roots of lingual nerve.The sympathetic root is from the sympathetic plexus around the facial aery. This plexus contains postganglionic fibers from the superior cervical ganglion of the sympathetic trunk. These fibers pass express through the ganglion and are vasomotor to the submandibular glandThe secretomotor root is from superior salivatory nucleus through nervous intermedius chords tympani which is a branch of cranial nerve VII. Chorda tympani joins lingual nerve. The parasympathetic fibers get relayed in the submandibular ganglion.Ref: BD Chaurasia; volume 3; 6th edition; Page no: 308 | Anatomy | Head and neck | Preganglionic supply to the submandibular gland is
A. Otic ganglion
B. Geniculate ganglion
C. Superior salivary nucleus
D. Inferior salivary nucleus
| Superior salivary nucleus |
ce39c531-f6a2-42ea-8bcc-d4409bc91c5a | Ans. is 'b' i.e., Lung Cancer * Important complications of bronchiectasis are massive hemoptysis, purulent pericarditis, lung abscess, empyema, amyloidosis, metastatic abscess (in brain, bones etc) , and cor pulmonale. It is not a premalignant condition. | Pathology | Respiration | Condition not associated with bronchiectasis is?
A. Pericarditis
B. Lung cancer
C. Amyloidosis
D. Hemoptysis
| Lung cancer |
4aa38ca1-0e9f-4a90-9f56-a143e9dd1b40 | IgG deposits along basement membrane occurs only in bullous pemphigoid, amongst the given options. | Dental | null | A 40 year old male had multiple blisters over the trunk & Extremities. Direct immuno fluoresce studies showed linear IgG deposits along the basement membrane, which of the following is the most likely diagnosis –
A. Pemphigus vulgaris
B. Bullous pemphigoid
C. Pemphigus foliaceous
D. Dermatitis herpetiformis
| Bullous pemphigoid |
353f27b3-4e72-445c-9e30-4424684cb497 | Some 60%of Myasthenia gravis are associated with a peculiar reactive hyperplasia of intrathymic B cells and another 20%are associated with thymoma, a tumor of thymic epithelial cells. Robbins basic pathology 9th edition page no 800,heading =Myasthenia gravis Option 4 is correct | Pathology | Breast | Myasthenia gravis is associated with
A. Thymoma
B. Thymic carcinoma
C. Thymic hyperplasia
D. Lymphoma
| Thymoma |
318c223a-180d-44cd-b4c3-7e1ba73bea2b | Ans. is 'b' i.e. 2nd Trimester Red degeneration of the myomasRed degeneration of uterine myomas develops most frequently during pregnancy. It typically occurs during 2nd trimester (20-22) weeks of pregnancy.During red degeneration, the myomas become tense, tender and causes severe abdominal pain with constitutional upset and fever.Although the patient is febrile with moderate Leucocytosis and raised E.S.R., the condition is an aseptic one.It needs to be differentiated from appendicitis, twisted ovarian cyst, pyelitis and accidental hemorrhage.During the red degeneration, the tumour itself assumes a peculiar purple red colour and develops a fishy odour. If the tumour is carefully examined, some of the large veins in the capsule and the small vessels in the substance of the tumour will be found thrombosed. The discoloration is possibly caused by diffusion of blood pigments from thrombosed vessels.Conservative treatment with analgesia, reassurance and supportive therapy is almost always adequate.Also knowAnother complication of myoma which is seen during pregnancy is torsion of the myoma.Torsion of the myoma is also characterized by acute abdominal pain with point tenderness over the site of leiomyoma.Conservative t/t is adequate. | Gynaecology & Obstetrics | Clinical Features, Diagnosis, and Pathology | Red degeneration most commonly occurs in
A. 1st trimester
B. 2nd trimester
C. 3rd trimester
D. Puerperium
| 2nd trimester |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.