Datasets:

danieladeeko
/

proccessed_ccdv

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 120k rows

article stringlengths 0 682k	abstract stringlengths 146 3.69k
a 61-year - old woman came to our attention and was hospitalized for the acute onset of fever (38c), erythroderma, and pustulosis ; the pustules were mainly localized on her shoulders, upper arms, and trunk [figure 1 ]. in the latter area clinical history revealed that she had been treating a bacterial inguinal intertrigo for 4 days with ciprofloxacin 500 mg tablets twice daily and desloratadine 5 mg tablet once daily. she referred that she had already taken ciprofloxacin in the past for refractory urinary tract infections. laboratory tests showed leukocytosis (23,000/ml, nv 390011700), neutrophilia (86.4%, nv 39.674.7), increased c - reactive protein (188 mg / l, nv 90). skin biopsy showed a nonfollicular, subcorneal, neutrophilic pustule with eosinophils, histiocytes, mild spongiosis, and moderate papillary dermal edema. erythroderma and pustulosis of our patient at the first day of hospitalization the cutaneous morphology, course, histological findings, and laboratory examinations were consistent with a definite diagnosis of agep according to the validation score of the euroscar study group ; we therefore reported it to italian pharmacovigilance. we immediately stopped the ciprofloxacin and started infusional therapy with methylprednisolone 40 mg once daily and trimeton (chlorphenamine) 10 mg twice daily. the rash significantly improved within a few days ; after complete resolution of the lesions, patch tests and lymphocyte proliferation test performed with ciprofloxacin both resulted negative. the most important step of agep diagnosis is to identify the provocative agent : if it is a drug, it must be discontinued immediately, if an infection, immediately treated. commonly, agep is caused by penicillins and cephalosporins, sometimes by fluoroquinolones (especially norfloxacin and ofloxacin). to the best of our knowledge, this is the third reported case of agep caused by ciprofloxacin, supporting two other previous reports. in 2005, knoell and lynch reported the case of a 63-year - old man with a photoinduced acute exanthematous pustulosis (an unusual form of agep) caused by ciprofloxacin and exposure to ultraviolet light. diagnosis was made on the basis of clinical and histological findings. in the same year, hausermann. reported another case of ciprofloxacin - induced agep in an 80-year - old woman who also showed a positive patch test to the drug. patch testing with the drugs involved is a useful and noninvasive way to identify the culprit agent of agep but is characterized by low sensitivity, being positive in about 60% of cases. the lymphocyte proliferation test seems promising but likewise has low sensitivity. as in our case, a negative reaction to these tests should not prompt a reconsideration of the diagnosis that remains primarily clinical.	acute generalized exanthematous pustulosis (agep) is an uncommon and self - limiting skin rash commonly caused by drugs and is characterized by the acute onset of fever, pustulosis, and neutrophilia from 4 to 10 days after the drug intake. we describe a case of agep in a 61-year - old woman that was hospitalized for the acute onset of fever, erythroderma, and pustulosis. clinical history revealed that she had been treating a bacterial inguinal intertrigo for 4 days with ciprofloxacin 500 mg tablets twice daily and desloratadine 5 mg tablet once daily. to the best of our knowledge, this is the third reported case of agep caused by ciprofloxacin, supporting two other previous reports.
psychocutaneous diseases can present either as primary psychiatric diseases such as dermatitis artefacta and delusions of parasitosis or as secondary psychiatric conditions such as depression, anxiety or social phobia due to chronic dermatoses like psoriasis, atopic dermatitis, alopecia areata. while in the former group, the diagnosis is usually straight forward, in the latter group such as psoriasis, atopic dermatitis etc the associated psychiatric co - morbidity may be missed or overlooked. unless the dermatologist has a special interest in mental health, in a busy practice, the relevant history is not sought. invisible mental disease in addition to the visible skin disease. in chronic skin diseases, patients feel stigmatized especially when lesions are widespread and may also experience depression. even in clinical remission, some may have anxiety about possible relapse in future. the relationship between mind and skin can be understood on the basis of the neuro - immuno - cutaneous - endocrine network. there is a dedicated european society of dermatology and psychiatry that holds a congress biennially. the association for psychocutaneous medicine of north american too holds regular meetings. in india, this subject has received scantattention. case reports and few studies appear from time to time. whilst dermatologists refer cases to psychiatrists, a dedicated liaison clinic is virtually unknown. we discuss the working pattern of the dermatology - psychiatry - clinical psychology liaison clinic set up at manipal in august 2010. patients with chronic dermatoses such as psoriasis, eczema as well as those with primary psychiatric conditions were recruited by the dermatologist from the general dermatology out patients and referred to the liaison clinic which functions once weekly from 2:30 to 5:00 pm. the psychologist counseled all patients and if stressors were elicited, coping strategies were taught. both specialists discussed the case with the dermatologist and standard dermatologic treatment with or without psychopharmacologic agents and/or psychological interventions were advised. we examined 175 cases (117 females ; 58 males) aged between 10 and 75 years maximum being in the second and third decade. out of 175, primary dermatological cases constituted 154 (88%) [table 1 ] and primary psychiatric 21 (12%) [table 2 ]. the leading primary dermatosis was psoriasis in 40 (23%) while the leading primary psychiatric disease was neurotic excoriations in 6 (3%) patients. out of 92 (53%) who needed psychologic interventions, only 25 (27%) underwent the same. 12 patients (48%) underwent one session while only 3 (12%) had more than five sessions. forty seven patients (30%) with primary dermatosis had an associated psychiatric diagnosis [table 4 ] the most common being dysthymia in 22 (46%). the three leading dermatoses with psychiatric co - morbidity were psoriasis, prurigo / generalized pruritus and chronic dermatitis. a major advantage of a combined clinic is the prompt availability of a psychiatrist, dermatologist and a clinical psychologist at a single visit. the stigma of visiting the psychiatry department although has lessened in recent time, stillexists. our clinic functions in an informal manner without any inhibitions for patients about meeting a mental health professional as there are no boards mentioning the designations of the liaison specialists. the number of patients examined can not exceed four or five as detailed interviews are carried out. a level - one dermatologist is a well informed specialist who can treat psychocutaneous diseases but does not bring about psychological change in the patient while a level two dermatologist is one who liaises with a clinical psychologist or psychiatrist bringing about psychological changes. by liaisoning, patient can be treated in a holistic fashion thereby addressing both the psychological and the physical needs. in our study although stress has been implicated in several dermatoses, psoriasis is the one which is mostly associated with. stress induced derangements of epidermal function may precipitate inflammatory dermatoses. nonpharmacologic interventions are stress reducing adjuncts that can enhance the efficacy of standard dermatogic therapies. some of the therapies useful in dermatologic patients are biofeedback, relaxation training, hypnosis and psycho - education. in our study majority of patients were non - compliant with psychological interventions. probably they did not realize the benefit or were not keen on attending the clinical psychology department. this underscores the need for dermatologists to master selected psychological techniques such as relaxation which can easily be taught to patients in the office. 30% of our patients had psychiatric comorbidity which is in agreement with several studies in psychodermatology. in conclusion, dermatologist should liaise with psychiatrists or clinical psychologists when managing psychosomatic dermatoses. in university teaching hospitals dermatologists should familiarize with selected psychopharmacological drugs and simple nonpharmacologic interventions. screening for common psychiatric conditions such as anxiety and depression	psychodermatology is an emerging specialty in dermatology which deals with the interactions between mind and skin. psychocutaneous diseases can be either primary psychiatric or primary cutaneous, with various degrees of associations between psyche and skin. unless the dermatologist cultivates a special interest in this field, many an invisible mental disorder may be missed leading to sub optimal treatment of the visible skin condition. though dermatology psychiatry liaison clinics are common in europe and other western countries, it is just an emerging concept in india. here we describe the working pattern of psychodermatology liaison clinic established in manipal in august 2010 and describe briefly the type of cases attended to.
biological fuels that produce heat are called biomass. it is predicted that half of the world population and more than 90% of the rural population in developing countries uses biomass fuels. in turkey, the most commonly utilized biomass fuel is called turd, a fuel type produced by dehumidifying animal waste. turd is used for cooking bread and meal in a closed oven called a tandir. biomass smoke is a mixture of complex particles, gases such as carbon monoxide, sulfur oxides, nitrous oxides, aldehydes, and poly - organic matter, including polycyclic aromatic hydrocarbons. the correlation between the effects of biomass smoke in respiratory functions, the structure of the lungs, and numerous pulmonary pathologies like chronic obstructive pulmonary disease, interstitial pulmonary disease, cancer, asthma, and lower respiratory tract infections has already been established [48 ]. the relation of biomass with pulmonary hypertension and cor pulmonale has been reported in several studies [2,913 ]. in van province in eastern turkey, we reported a higher level of pulmonary hypertension in pulmonary diseases of women exposed to biomass than in pulmonary diseases related to cigarette smoking. previously, we reported that pulmonary hypertension could develop even without the presence of a pulmonary disease. however, it is an invasive procedure with risks of complications. for this reason, the aim of this study was to investigate the feasibility of main pulmonary artery diameter quantification by intravenous (iv) contrast agent administered thoracic computerized tomography (ct) in the diagnosis of pulmonary hypertension secondary to biomass smoke exposure. in this study, 104 female subjects with biomass smoke exposure and 20 healthy female subjects were enrolled. age, biomass smoke exposure duration and density, echocardiographic estimation of spap, mpad measured by thoracic ct, and diagnoses were recorded. biomass smoke exposure was recorded as the number of exposure - years, the number of days per week, and hours per day. for example, if a person is exposed to biomass smoke for 1 hour per day for a year, her biomass smoke exposure density is 1 hour / year. patients with the following criteria were included in the study as the biomass smoke - exposed group : (1) clinical or radiological evidence of pulmonary hypertension and cor pulmonale, (2) long - term biomass smoke exposure (at least 10 years), and (3) the presence of measurable spap in echocardiographic evaluation. twenty female patients who were evaluated for suspected pulmonary embolism, but who had normal findings by echocardiography and thorax ct, served as the control group. patients were excluded from either the biomass smoke - exposed or control groups if they had primary left ventricular dysfunction or acute cardiac illness, obesity, a history of significant organic and/or inorganic dust exposure, a history of cigarette smoking, passive cigarette smoke exposure, or a clear history of a known chronic lung disease before exposure to biomass smoke (e.g., tuberculosis, childhood respiratory diseases, thoracic structural anomalies). the study protocol was carried out in accordance with the helsinki declaration as revised in 2000. the study protocol was approved by the local ethics committee, and informed consent was obtained from each subject. the patients in the biomass smoke - exposed group were further divided into 4 subgroups for the purpose of determining the correlation of the mpad measurements with the clinical features in each group. chronic obstructive pulmonary disease was diagnosed by the signs and symptoms of chronic bronchitis and/or pulmonary emphysema, and the presence of chronic and irreversible airflow obstruction (forced expiratory volume in 1 second (fev1)/forced vital capacity below 70%, fev1 below 80% predicted). asthma was excluded, as assessed by clinical history and response to bronchodilators (12% increase in fev1 following 400 mg of inhaled salbutamol). the criterion used for diagnosis of pulmonary embolism on iv contrast medium - administered thoracic ct was an intraluminal filling defect. a ct scan was interpreted as revealing positive findings for an embolus only if a definite filling defect was seen on more than 1 contiguous axial image. group 3 patients had pulmonary hypertension associated complaints and findings such as dyspnea and/or peripheral edema and/or cor pulmonale, while group 4 patients did not have these same findings. we previously reported on a group of women exposed to biomass smoke ; they did not have airway obstruction, but had pulmonary hypertension and cor pulmonale. therefore ; group 3 was termed the idiopathic pulmonary arterial hypertension - like group and group 4 was termed the asymptomatic idiopathic pulmonary arterial hypertension - like group. the last 2 groups might have prominent pulmonary artery involvement that could be related to biomass smoke exposure. echocardiography was performed by the same cardiologist (with 7 years of experience) using a vivid 3 instrument (general electric, usa) and by utilizing a 2-mhz probe. the gradient between the right ventricular peak systolic pressure and right atrium pressure was measured by doppler echocardiography at rest in cases with tricuspid insufficiency. the modified bernoulli equation was used to calculate pap pressure : pap=4 (tricuspid systolic jet). right atrial pressure is estimated to be 5 mmhg when the diameter of the inferior vena cava (ivc) is 1.7 cm and with normal inspiratory collapse (50%), and 15 mmhg when ivc is > 1.7 cm and inspiratory collapse is less than 50%. when spap is > 35 mmhg, the presence of pulmonary hypertension is established according to the new recommendations of the working group on diagnosis and assessment of pulmonary arterial hypertension in the 4 world symposium on pulmonary hypertension. a thoracic ct scan was performed using a 4-detector multislice ct scanner (somatom sensation 4, siemens, erlangen, germany) by injecting contrast agents intravenously while the patient held her breath. the non - ionic contrast material (ultravist 300, schering, berlin, germany) at an average volume of 100 ml and concentration of 300 mg i/100 ml) was administered by a power injector at a rate of 3 ml / second via an 18-gauge plastic angiocatheter inserted into the cubital vein. imaging parameters were 120 kv and 152 ma, with 0.5 second rotation time, 42 mm collimation, and 5 mm slice thickness. data were transferred to a network computer workstation (leonardo ; siemens medical systems, germany) and diameters were measured using a window level of 400 hu, with the center at 60 hu. the widest diameter perpendicular to the long axis of the main pulmonary artery was measured with computer calipers at the level of the pulmonary artery bifurcation by mediastinal window (figure 1). a pearson correlation analysis was conducted to examine liner relationships among variables (age, years of exposure, density of exposure) with spap and mpad, and between spap and mpad in the exposed group and in each subgroup. receiver operating characteristic (roc) curve analysis was performed to find a cut - off value of mpad for diagnostic ability to predict spap > 35 mmhg as pulmonary hypertension. the test measurement sensitivity, specificity, positive predictive rate, negative predictive rate, and truth value were all estimated by standard formulas. chronic obstructive pulmonary disease was diagnosed by the signs and symptoms of chronic bronchitis and/or pulmonary emphysema, and the presence of chronic and irreversible airflow obstruction (forced expiratory volume in 1 second (fev1)/forced vital capacity below 70%, fev1 below 80% predicted). asthma was excluded, as assessed by clinical history and response to bronchodilators (12% increase in fev1 following 400 mg of inhaled salbutamol). the criterion used for diagnosis of pulmonary embolism on iv contrast medium - administered thoracic ct was an intraluminal filling defect. a ct scan was interpreted as revealing positive findings for an embolus only if a definite filling defect was seen on more than 1 contiguous axial image. group 3 patients had pulmonary hypertension associated complaints and findings such as dyspnea and/or peripheral edema and/or cor pulmonale, while group 4 patients did not have these same findings. we previously reported on a group of women exposed to biomass smoke ; they did not have airway obstruction, but had pulmonary hypertension and cor pulmonale. therefore ; group 3 was termed the idiopathic pulmonary arterial hypertension - like group and group 4 was termed the asymptomatic idiopathic pulmonary arterial hypertension - like group. the last 2 groups might have prominent pulmonary artery involvement that could be related to biomass smoke exposure. echocardiography was performed by the same cardiologist (with 7 years of experience) using a vivid 3 instrument (general electric, usa) and by utilizing a 2-mhz probe. the gradient between the right ventricular peak systolic pressure and right atrium pressure was measured by doppler echocardiography at rest in cases with tricuspid insufficiency. the modified bernoulli equation was used to calculate pap pressure : pap=4 (tricuspid systolic jet). right atrial pressure is estimated to be 5 mmhg when the diameter of the inferior vena cava (ivc) is 1.7 cm and with normal inspiratory collapse (50%), and 15 mmhg when ivc is > 1.7 cm and inspiratory collapse is less than 50%. when spap is > 35 mmhg, the presence of pulmonary hypertension is established according to the new recommendations of the working group on diagnosis and assessment of pulmonary arterial hypertension in the 4 world symposium on pulmonary hypertension. a thoracic ct scan was performed using a 4-detector multislice ct scanner (somatom sensation 4, siemens, erlangen, germany) by injecting contrast agents intravenously while the patient held her breath. the non - ionic contrast material (ultravist 300, schering, berlin, germany) at an average volume of 100 ml and concentration of 300 mg i/100 ml) was administered by a power injector at a rate of 3 ml / second via an 18-gauge plastic angiocatheter inserted into the cubital vein. imaging parameters were 120 kv and 152 ma, with 0.5 second rotation time, 42 mm collimation, and 5 mm slice thickness. data were transferred to a network computer workstation (leonardo ; siemens medical systems, germany) and diameters were measured using a window level of 400 hu, with the center at 60 hu. the widest diameter perpendicular to the long axis of the main pulmonary artery was measured with computer calipers at the level of the pulmonary artery bifurcation by mediastinal window (figure 1). a pearson correlation analysis was conducted to examine liner relationships among variables (age, years of exposure, density of exposure) with spap and mpad, and between spap and mpad in the exposed group and in each subgroup. receiver operating characteristic (roc) curve analysis was performed to find a cut - off value of mpad for diagnostic ability to predict spap > 35 mmhg as pulmonary hypertension. the test measurement sensitivity, specificity, positive predictive rate, negative predictive rate, and truth value were all estimated by standard formulas. there were no statistically significant differences between subjects with biomass smoke exposure and healthy subjects with respect to age (p>0.05). the mean mpad and the mean spap were significantly higher in subjects with biomass smoke exposure than in healthy subjects (p0.05). likewise, no significant difference was observed between the biomass smoke exposure durations or the biomass smoke exposure densities in the subgroups (p>0.05). the mean mpad and the spap value were significantly lower in the asymptomatic idiopathic pulmonary arterial hypertension - like group compared to the other subgroups (p 29 mm and > 33.2 mm have a sensitivity of 58% and 84%, and a specificity of 95% and 75%, respectively, for a pulmonary hypertension diagnosis. we found that biomass smoke - exposed subjects had increased mpad compared with healthy subjects (p 29 mm provides the best sensitivity and specificity for detecting pulmonary hypertension by ct scan as reported in previous studies. a linear correlation was established between ct mpad and echocardiographic spap in the diseases related to biomass smoke exposure. therefore, ct mpad should be used to evaluate the presence of pulmonary hypertension, which is common in biomass smoke - exposed women, and mpad 29 mm should be a warning for the presence of pulmonary hypertension. our results indicate that main pulmonary artery diameter measurements by thoracic ct may suggest presence of pulmonary hypertension in biomass smoke - exposed women.	backgroundthe aim of this study was to investigate the feasibility of main pulmonary artery diameter quantification by thoracic computerized tomography (ct) in the diagnosis of pulmonary hypertension seconder to biomass smoke exposure.material/methodsone hundred and four women subjects with biomass smoke exposure and 20 healthy women subjects were enrolled in the prospective study. the correlation between echocardiographic estimation of systolic pulmonary artery pressure and the main pulmonary artery diameter of the cases were studied.resultsthe main pulmonary artery diameter was 26.95.1 in the control subjects and 37.16.4 in subjects with biomass smoke exposure. this difference was statistically significant (p<0.001). the systolic pulmonary artery pressure was 22.712.4 in the control subjects and 57.322 in subjects with biomass smoke exposure. this difference was statistically significant (p<0.001). systolic pulmonary artery pressure was significantly correlated with the main pulmonary artery diameter (r=0.614, p<0.01). a receiver operating characteristic (roc) curve analysis showed that a value of 29 mm of the main pulmonary artery diameter differentiated between pulmonary hypertension and non - pulmonary hypertension patients. the sensitivity of the measurement to diagnose pulmonary hypertension was 91% and specificity was 80%.conclusionsour results indicate that main pulmonary artery diameter measurements by sct may suggest presence of pulmonary hypertension in biomass smoke exposed women.
sepsis is defined as the acute systemic inflammatory response to infection with a clinical spectrum ranging from hemodynamic changes to multiple organ dysfunction syndrome and even death [13 ]. it is estimated that there are 750,000 cases of sepsis with a mortality rate between 30% and 50% in north america per year. the incidences of sepsis - associated liver dysfunction and liver failure range from 34% to 46% and from 1.3% to 22% in patients with sepsis, respectively. attenuating liver injury and restoring liver function lower morbidity and mortality rates in patients with sepsis. the mechanisms involved in sepsis - induced liver injury are diverse, including uncontrolled systemic inflammatory activation, hepatic ischemia, coagulopathy, and deregulated cell apoptosis [69 ]. in sepsis, inflammatory mediators, such as tumor necrosis factor- (tnf-), interleukin- (il-) 1, il-6, interferon- (ifn-), il-8, nitric oxide (no), and reactive oxygen species (ros), are released from liver resident and infiltrated immune cells, which mediate sepsis - induced liver injury. apoptotic cell death has a prominent role in the evolution of organ damage following sepsis. animal studies have demonstrated that blocking apoptosis can improve outcome in experimental models of severe sepsis [911 ]. glycogen synthase kinase- (gsk-) 3, a ubiquitously expressed serine / threonine protein kinase, is initially identified as a regulator of glycogen metabolism [12, 13 ]. beyond its role in glycogen metabolism, recent studies have implicated that gsk-3 plays an important role in regulation of inflammatory response [1416 ]. gsk-3 inhibition reduced the production of tnf- and il-6 and enhanced il-10 production in lipopolysaccharide- (lps-) stimulated monocytes [14, 15 ]. furthermore, gsk-3 inhibition effectively protected mice and rats from endotoxin shock [15, 16 ] or mice from live bacterial infection [17, 18 ]. additionally, recent studies have demonstrated that inhibition of gsk-3 activity prevents apoptotic cell death. moreover, gsk-3 blockade significantly reduced hepatic apoptotic cell death in response to d - galactosamine / lps - induced liver injury or ischemia / reperfusion (i / r) injury [21, 22 ], respectively. although the role of gsk-3 in endotoxin shock and live bacterial infection has been extensively investigated, less information is available on the possible effects of gsk-3 inhibition in polymicrobial sepsis, which is more representative of the clinical condition. therefore, we aimed to investigate the protective effects of gsk-3 inhibition on polymicrobial sepsis - induced liver injury by a mouse cecal ligation and puncture (clp) model and to further explore the possible mechanisms. male inbred c57bl/6 mice (810 weeks old, weighing within 20~22 g) were purchased from wuhan university center for animal experiment (wuhan, china). all animals were housed under standard animal care conditions and had free access to water and food. all procedures were carried out according to the ethical guidelines of the animal care and use committee of huazhong university of science and technology. mice were completely anesthetized with pentobarbital (60 mg / kg, i.p.) and a midline abdominal incision was performed. after exposing the cecum and manipulating the stool to the tip of the cecum, the cecum was ligated 1 cm from the tip and was perforated by one through - and - through puncture (two holes) with a 20-gauge needle to induce polymicrobial peritonitis. all mice had free access to food and water after recovery from anesthesia. to investigate the role of gsk-3 in clp - induced liver injury, mice were treated with sb216763 (25 mg / kg, i.p. louis, mo) or vehicle (10% dimethyl sulfoxide, dmso, sigma - aldrich) at 1 h, 6 h, and 12 h following clp. the dose of sb216763 treatment was selected following previous studies [22, 23 ]. liver injury, hepatic apoptosis, inflammatory cytokines, transcription factor nuclear factor-b (nf-b) activation, and camp response element binding protein (creb) activation were analyzed. to assess hepatocellular injury following clp, serum alanine transaminase (alt) and aspartate aminotransferase (ast) were measured using an automated chemical analyzer (hitachi co., tokyo, japan). liver tissue was fixed in 4.5% buffered formalin for at least 24 h. paraffin embedding was performed using standard techniques. after deparaffinization, rehydration, and antigen retrieval, sections were incubated with myeloperoxidase (mpo) antibody (1 : 50 ; abcam, cambridge, uk) for 1 h at room temperature, followed by incubation with goat anti - rabbit secondary antibody, and then visualized with a diaminobenzidine kit. mpo - positive cells were counted in 5 high - power fields (hpfs)/section under a microscope (400), and the number of cells / field was shown. the murine macrophage cell line raw264.7 was purchased from the type culture collection of the chinese academy of sciences (shanghai, china). cells were cultured in dmem medium (invitrogen, carlsbad, ca) supplemented with 10% fetal calf serum, 2 mm glutamine, penicillin (100 iu / ml), and streptomycin (100 g / ml) at 37c under a gas phase of air / co2 (95 : 5). cells were plated at a density of 5 10 cells / well in a 24-well plate for cytokine assay or 2 10 cells / well in a 6-well plate for western blotting. sb216763 (10 m) was used to inhibit gsk-3. relative caspase-3 activity in livers was detected with a caspase-3 colorimetric assay kit (abcam) according to the manufacturer 's instructions. nuclear and cytoplasmic extraction kit was bought from pierce (thermo pierce, rockford, il). nuclear proteins from liver tissues or raw264.7 cells were isolated according to the instructions of the manufacturer. levels of nf-b p65 and creb activity in the nuclear extracts were quantified by transam nf-b p65 and transam creb assay kits (active motif, carlsbad, ca) according to the manufacturer 's instructions. the levels of tnf- and il-6 in serum and cultured medium were analyzed using commercially available enzyme - linked immunosorbent assay (elisa) kits (r&d systems, minneapolis, mn). equivalent amounts of protein were separated on 12% gels by sodium dodecyl sulfate - polyacrylamide gel electrophoresis and transferred to polyvinyldifluoride membranes (ge healthcare, buckinghamshire, uk). after blocking, the membranes were incubated with primary antibodies : rabbit anti - phospho - gsk-3 (ser9) (1 : 1000 ; cell signaling technology, beverly, ma), rabbit anti - gsk-3 (1 : 1000, cell signaling technology), rabbit anti - phospho - glycogen synthase (1 : 1000, cell signaling technology), rabbit anti - cleaved caspase-3 (1 : 1000, cell signaling technology), rabbit anti - cleaved caspase-7 (1 : 1000, cell signaling technology), and anti - glyceraldehyde-3-phosphate dehydrogenase (gapdh) (1 : 20000 ; sigma - aldrich), at 4c with gentle shaking overnight. detection was carried out using horseradish peroxidase - conjugated goat anti - rabbit igg antibody (1 : 3000, abcam), followed by ecl western blotting detection reagents (ge healthcare, buckinghamshire, uk). rochester, ny). real time polymerase chain reaction (pcr) was performed as described previously. total rna was isolated by trizol reagent (invitrogen) according to the manufacturer 's instruction. cdna synthesis was performed using the first - strand cdna synthesis kit (invitrogen). quantitative pcr was performed using a roche light cycle system (roche, rotkreuz, switzerland) with sybr green master mix (qiagen, hilden, germany) and primers. amplification conditions were 95c (10 min) followed by 50 cycles of 95c (30 s) and 60c (20 s). primers used to amplify a specific mouse gene fragments were as follows : tnf- forward : 5-tgctgggaagcctaaaagg-3 ; reverse : 5-cgaattttgagaagatgatcctg-3, il-6 forward : 5-tcaattccagaaaccgctatga-3 ; reverse : 5-caccagcatcagtcccaaga-3, il-1 forward : 5-caggtcgctcagggtcaca-3 ; reverse : 5-cagaggcaaggaggaaacaca-3, il-10 forward : 5-cacaaagcagccttgcagaa-3 ; reverse : 5-agagcaggcagcatagcagtg-3, and -actin forward : 5-agagggaaatcgtgcgtgac-3 ; reverse : 5-caatagtgatgacctggccgt-3. relative quantification of target mrna expression was calculated and further normalized to housekeeping gene -actin. differences between groups were evaluated for significance by one way anova analysis combined with bonferroni post hoc test (comparison type : versus vehicle - treated group). all tests were performed using sigmastat v3.5 (systat - software, erkrath, germany). to determine whether gsk-3 inhibition could attenuate liver injury during sepsis, gsk-3 inhibitor sb216763 was administrated to mice at 1 h, 6 h, and 12 h following clp. as shown in figure 1(a), compared with sham controls, the phosphorylated (serine 9) gsk-3 levels in the liver tissue were reduced at 6 h following clp, suggesting gsk-3 was activated by the clp insult. the inhibition of liver gsk-3 activity in vivo was indicated by the reduced phosphorylation of glycogen synthase, a downstream substrate of gsk-3. as shown in figure 1(b), compared with the vehicle - treated group, clp resulted in significant increase in the serum levels of alt and ast. the histologic examination showed significant liver tissue injury following clp, as indicated by swollen hepatocytes and leukocyte infiltration. the inhibition of gsk-3 resulted in significant attenuation of these changes (figure 1(c)). to address whether gsk-3 inhibition was of benefit for septic mice induced by clp, survival was then assessed at 48 h following clp. as shown in figure 1(d), gsk-3 inhibitor sb216763 treatment significantly increased the survival rate of mice. in contrast, the survival rate of mice treated with sb216763 was 53%. to test whether gsk-3 inhibition could attenuate liver injury during sepsis via inhibition of inflammation, the production of tnf-, il-6, il-1, and il-10 was analyzed at 6 h following clp. as shown in figure 2(a), clp resulted in significant increase in the mrna levels of tnf-, il-6, il-1, and il-10. liver tnf-, il-6, and il-1 mrna levels were significantly attenuated by the administration of sb216763. furthermore, the inhibition of gsk-3 significantly reduced the clp - induced production of serum tnf- and il-6 levels (figure 2(b)). however, sb216763 administration significantly reduced the clp - induced increase in the infiltration of neutrophils (figure 3). these results indicated that inhibition of gsk-3 relieved the inflammation in the liver following clp. to obtain insight into the underlying mechanisms responsible for the anti - inflammatory effect of gsk-3 inhibition, however, nf-b activity was significantly inhibited in sb216763-treated animals in response to clp insult compared to vehicle - injected animals. conversely, activated nuclear creb was enhanced in the liver after the inhibition of gsk-3 (figure 4). to further gain insight into the underlying signal transduction pathway involved in the regulation of inflammatory response in clp by gsk-3, the effect of gsk-3 inhibition on the production of proinflammatory cytokines in macrophages was assessed in vitro. as shown in figure 5(a), the gsk-3 inhibition significantly reduced the production of tnf-, il-6, and il-1 but increased il-10 gene induction at 6 h of culture. similarly, tnf- and il-6 protein levels in the cultured medium were increased dramatically after treatment with lps for 6 h ; gsk-3 inhibition reduced the production of tnf- and il-6 levels. to investigate whether the anti - inflammatory effect of gsk-3 inhibition was mediated via nf-b and creb pathways, we examined the effect of gsk-3 inhibition on the activity of nuclear nf-b and creb. as shown in figure 5, gsk-3 inhibition significantly inhibited nf-b activity but increased creb activity. to test whether gsk-3 inhibition could attenuate hepatic apoptosis, the caspase-3 activity in the liver was evaluated at 20 h following clp insult. compared to the activity in the sham operated animals, the caspase-3 activity was significantly increased in the vehicle - treated animals. the inhibition of gsk-3 significantly reduced the induction of caspase-3 activity by clp (figure 6(a)). furthermore, the vehicle - treated animals expressed higher levels of cleaved caspase-3 and cleaved caspase-7 protein, which were significantly reduced by the gsk-3 inhibition (figure 6(b)). recent studies suggest that gsk-3 inhibition has protective properties in lps - induced septic shock. however, the role of gsk-3 inhibition in the pathogenesis of live injury induced by polymicrobial sepsis and its regulatory mechanisms remain poorly understood. in the present study, we documented that gsk-3 inhibition protected against clp - induced liver injury via inhibition inflammatory response and hepatic apoptosis. our data also suggested that nf-b and creb mediated mechanisms are the prominent pathways involved in the protective effects of gsk-3 inhibition in the clp - induced liver injury. inhibition of gsk-3 suppresses systemic inflammation and confers protection against clp - induced liver injury. gsk-3 is involved in many intracellular functions including regulating cell activation, differentiation, and survival [12, 13 ]. among the diverse functions that are regulated by gsk-3, recent studies have shown that gsk-3 is a vital factor in the inflammatory process [1416 ]. firstly demonstrated that the gsk-3 inhibition not only suppressed the production of proinflammatory cytokine but also increased the anti - inflammatory cytokine expression, and it provided a survival advantage and attenuated organ injury in lps - induced sepsis models. documented that the inhibition of gsk-3 suppressed the inflammatory responses and conferred a survival advantage in mice infected with francisella tularensis. recently, using sb216763 as an inhibitor, chang and colleagues found that gsk-3 inhibition reduced the proinflammatory cytokine expression and improved the survival rate in group a streptococcus - infected mice. we previously demonstrated that gsk-3 inhibition by lithium reduced liver i / r injury, at least in part via inhibition of inflammation in rats. in agreement with these studies, we demonstrated that inhibition of gsk-3 reduced inflammation, attenuated liver injury, and improved survival following clp. these findings suggested that gsk-3 inhibition could protect liver against overwhelming inflammatory response during sepsis. gsk-3 is known to regulate nf-b signaling, which plays a pivotal role in the pathophysiology of sepsis. the transcription of proinflammatory mediators, including cytokines, chemokines, and no, occurs mainly via the activation of nf-b. in patients with sepsis, circulating proinflammatory mediators were increased and correlated with the disease severity [26, 27 ]. blockade of the activity of nf-b using genetic or pharmacologic approaches successfully reduced nf-b - mediated cytokines and inhibited multiple organ inflammation and injury during sepsis and/or endotoxemia, suggesting that inhibition of nf-b could be a promising therapeutic target in sepsis [2830 ]. demonstrated that gsk-3 inhibition reduced the ser536 phosphorylation p65 but had no effect on the nf-b / dna binding activity in the lung and reduced the increase in nf-b p65 activity caused by il-1 in human embryonic kidney cells in vitro. observed that gsk-3 regulated the production of proinflammatory and anti - inflammatory cytokines by lps - stimulated monocytes via augmenting nuclear creb activity and enhancing its association with creb - binding protein while reducing the interactions between nf-b p65 and cbp. in lithium - treated hepatocytes, schwabe and brenner documented that inhibition of gsk3 impaired nf-b activity, but ib degradation and nf-b dna binding activity were not affected. in this study, we identified gsk-3 regulated clp - induced inflammatory cytokines production by differentially affecting the activation of nf-b and creb. there is increasing evidence that apoptosis is also involved in sepsis - induced liver dysfunction. recent studies have demonstrated that gsk-3 inhibition protects renal cell from endotoxemia and attenuates liver i / r injury via inhibition of apoptosis. apoptosis is potentially triggered by infiltrating neutrophil- or macrophage - derived cytokines such as tnf-, ros, and no. wang. observed that gsk-3 inhibitors downregulated lps - induced renal cell apoptosis by reducing the amount of tnf- production. moreover, results from studies of different types of liver damage also support the hypothesis that the protective effects of gsk-3 inhibition are via antiapoptosis. in a mouse model of liver i / r injury, xia and colleagues showed that gsk-3 inhibitors increased -catenin accumulation, which further enhanced antiapoptotic signaling through the induction of bcl-2 and survivin expression. this result was further supported by our previous study, which demonstrated that gsk-3 inhibition by lithium reduced hepatic apoptosis in liver i / r in rats. moreover, gsk-3 inhibition was shown to be capable of preventing apoptosis in d - galactosamine / lps - induced liver injury by reducing endoplasmic reticulum stress. in summary, we documented that gsk-3 inhibition could improve the survival of mice with polymicrobial sepsis, ameliorated liver injury, and reduced hepatic apoptosis. the mechanism appeared to involve its ability to inhibit inflammatory response via modulating nf-b and creb activation. these findings would suggest that inhibition of gsk-3 may act as an alternative therapeutic strategy beyond antibiotic treatment.	liver dysfunction has been known to occur frequently in cases of sepsis. excessive inflammation and apoptosis are pathological features of acute liver failure. recent studies suggest that activation of glycogen synthase kinase- (gsk-) 3 is involved in inflammation and apoptosis. we aimed to investigate the protective effects of gsk-3 inhibition on polymicrobial sepsis - induced liver injury and to explore the possible mechanisms. polymicrobial sepsis was induced by cecal ligation and puncture (clp), and sb216763 was used to inhibit gsk-3 in c57bl/6 mice. gsk-3 was activated following clp. administration of sb216763 decreased mortality, ameliorated liver injury, and reduced hepatic apoptosis. the inhibition of gsk-3 also reduced leukocyte infiltration and hepatic inflammatory cytokine expression and release. moreover, gsk-3 inhibition suppressed the transcriptional activity of nuclear factor - kappa b (nf-b) but enhanced the transcriptional activity of camp response element binding protein (creb) in the liver. in in vitro studies, gsk-3 inhibition reduced inflammatory cytokine production via modulation of nf-b and creb signaling pathways in lipopolysaccharide - stimulated macrophages. in conclusion, these findings suggest that gsk-3 blockade protects against clp - induced liver via inhibition of inflammation by modulating nf-b and creb activity and suppression of hepatic apoptosis.
ventriculoperitoneal (vp) shunting for hydrocephalus is a common neurosurgical procedure in our daily practice. migration of distal part of vp shunt into the adjacent organs including bowel tract, thoracic cavity, heart, scrotum, umbilicus, abdominal wall, and urinary bladder is reported. a case of repeated shunt migration in different organs this is the first case of bowel perforation with transanal extrusion continued with bladder migration and urethral extrusion of peritoneal shunt. we report our case of a child with these unusual complications ; treatment was done by a team involving neurosurgeons and urologists. a 4-year - old boy was admitted to the hospital because of abdominal discomfort. on further examination the first operation was undertaken when he was 2 months old because of his congenital hydrocephalus. the patient went back to the hospital when he was 1 year old because of severe headache. computed tomography (ct) scan confirmed a large right porencephaly. his abdominal x - ray revealed that the extruded shunt was the right peritoneal catheter [figure 2 ]. the result was showing 200 cells found with protein 100 mg / dl, glucose 13 mg / dl, and the culture showed micrococcus sp. urological procedure was performed endoscopically through the urethra to explore the site of migration and potential of leakage. it was found that the shunt was penetrated through the bladder wall just above the trigonal area [figure 3 ]. we decided to treat conservatively by inserting an urethral catheter to keep the bladder decompressed for optimal healing process. extruded shunt was exposed through the external urethral orificium abdominal x - ray shows the extruded ventriculoperitoneal shunt cathether through the urethral orificium during endoscopic urological surgery, migration site just above the triogonal area of the urinary bladder was identified (blue arrow) thereafter, intraventricular antibiotic was administered according to the culture results. one month later, culture of csf was performed and it showed a sterile result. bowel perforation was present in 0.1%0.7% of cases in which colon was the most involved organ, and the most common site of extrusion is anus (68.9%), followed by scrotum (22%), umbilicus (6.9%), and vagina (3.2%). a case of urinary bladder migration as well as urethral extrusion of vp shunt is extremely rare. there have been various theories proposed such as bioreactivity, local inflammation, infection, and surgical error. the location of the bladder makes it highly unlikely site of perforation, as the catheter must pass through the peritoneum into the extraperitoneal space and subsequently perforate the bladder. in this present case, the first migration of the catheter was into the anus, and this is considered as a frequent event of migration. the second migration into the bladder is a rare case. symptom was only abdominal discomfort and it became obvious after the expose through the urethral orifice. repeated case of shunt migration is an interesting case regarding the pathophysiology and management of this patient. with the history of prior bowel perforation by shunt catheter, and cultures of specimens indicating an infection fixation of the tip catheter at the specific site of the peritoneum is facilitated and then, continuous erosion and perforation of the peritoneum into the bladder was done. the trigonal area, which comprises less muscle layer, was the site of migration in this case. there are three main procedures of shunt removal : gentle pulling, endoscopic surgery, and major open surgery. as per earlier reports, catheter removal is mostly done by open abdominal surgery, but in author 's opinion, removal of the catheter could be done with a less invasive method. in our case presenting per - urethtraly, the catheter was gently pulled out through the urethral orifice. the surgery was then followed by urological endoscopic exploration through the urethra to view the size and location of the perforation. it is believed that the perforation site seals off due to the presence of a chronic fibrous sheath around the shunt tract and requires no aggressive surgical intervention. we found the pitfall of this case to be the lack of detailed history of the previous operation because the patient underwent the surgery in another hospital. the repeated migrations also give us some thought of another option of shunting, for example, ventriculo - atrial shunt. bladder migration and transurethral extrusion is an extremely rare complication of vp shunt. to our knowledge, this is the ninth case reported. the presence of previous abdominal complication and repeated organ perforation indicates predisposition factors which must be sought and handled before any further treatment.	bladder migration and transurethral extrusion is an extremely rare complication of ventriculoperitoneal (vp) shunt. only eight cases have been reported in the english literature since 1995. we report a case of a 4-year - old boy with cerebral palsy, hydrocephalus, and vp shunted on both sides who presented with a protruded distal vp shunt from his urethral orifice. the patient was reported for having previous shunt extrusion through the anus. the patient was treated on by a multidisciplinary approach, involving a neurosurgeon and urologist. shunt removal with simple procedure was smoothly achieved without morbidities. he was discharged home in satisfactory condition.
we report a prospective series, we present the results of hind foot valgus deformity of children with spina bifida, using grice talocalcaneal arthrodesis with a tricortical iliac bone graft. between may 2000 and december 2003, 21 patients with bilateral (42 feet) valgus deformity of feet underwent surgery. there were 7 males and 14 females. the total number of feet that had nonunion was 11, in 7 of them the grafts were completely reabsorbed and the outcome of all these feet was unsatisfactory. four feet had partial union of which three had unsatisfactory and one had satisfactory outcome. sixteen feet had residual valgus deformity at the last followup visit, 10 patients had nonunion, and 6 had inadequate correction. mean preoperative talocalcaneal and calcaneal pitch angles were 48.5 and 31.9, respectively, which decreased to 38.5 and 29.1, respectively, postoperatively. the decrease in talocalcaneal angle and calcaneal pitch was significant between preoperative and postoperative measurements (p<0.05). grice subtalar arthrodesis technique is still a valuable option for valgus foot in patients with spina bifida. in this study spina bifida is generally accompanied by a high incidence of foot deformities and valgus feet make up to 712% of all foot deformities.12 the pathoanatomy of valgus deformity of hind foot is the rotational malalignment of talus and calcaneus due to talonavicular calcaneocuboid subluxation.3 the deformity is mostly present at birth and characterized by a shortened fibula, wedging of tibial epiphysis, valgus position of the hind foot relative to the leg, and marked dorsiflexion.4 patients commonly have significant disability from combination of valgus deformity of the ankle and subtalar joints with the late tibial torsion and plano - abduction deformity of the foot.5 it is essential that an accurate diagnosis of valgus foot is established early and therapy is instituted. the initial treatment is conservative consisting of manipulation and orthotics.6 with the use of orthotics, an attempt is made to counteract the predominant valgus force. on the other hand, ulcers, callosities, and shoe wrecking are the common problems caused by such unsatisfactory fitting orthotics. in this condition batchelor technique and dennyson - fulford modification710 of this technique are popular operations in recent years ; however, some important complications are reported for these techniques. on the other hand, a safer extra - articular subtalar arthrodesis technique, the grice talocalcaneal blocking,11 has been considered as the most popular operation for the valgus deformity.1214 since may 2000 we operated hind foot valgus deformities which are failed in conservative treatment. although the outcome of grice talocalcaneal arthrodesis in paralytic feet has been documented in various studies, its use in spina bifida is documented in limited series. we report a prospective series, we present the results of 42 feet with hind foot valgus deformity of children with spina bifida, using grice talocalcaneal blocking with a tricortical bone graft. between may 2000 and december 2003, 42 feet (21 patients) with valgus deformity underwent surgery. there were 7 male and 14 female patients with a mean age of 67.7 months (range 50108 months). the spina bifida lesion was at mid - lumbar region (n=5) and at low lumbar and sacral regions (n=16). the valgus foot in patients was diagnosed at routine screening in spina bifida outpatient clinic in our center. the clinical diagnosis of valgus foot was made if there was valgus heel on inspection when they were standing [figure 1 ] and if the medial head of talus was prominent on palpation. clinical photograph showing valgus foot (rt side) when the patient was weight bearing patients had orthotic support as an initial treatment. 56 feet of 28 patients were treated with orthosis initially and 42 feet of 21 patient who could not benefit from orthotics were candidates of surgery. the satisfactory fitting of these feet with orthotics was not possible in 32 who had ulcers and callosities. after an informed consent was obtained from the parents, the patients were enrolled into the study group. children with ankle valgus and fibular growth retardation,1314 a deformed and rigid hind foot valgus, and the ones with degenerative subtalar joint changes on radiographs were excluded form the study. children with syndromic spina bifida were excluded as well. the ipsilateral limb was exsanguinated by applying a soft rubber bandage and the tourniquet was inflated. through an oblique incision centered over the sinus tarsi, the origin of the extensor digitorum brevis was reflected distally in a tongue - like fashion. then the graft slots were prepared at the undersurface of the talus and on top of the calcaneus just wide enough to receive the graft. the graft was aimed to be placed perpendicular to the subtalar joint.15 no internal fixation was needed in any of the cases after locking the graft at its slots. the incisions were closed with subcuticular absorbable sutures and the foot was immobilized in neutral position by short leg plaster splint. a short leg cast was applied after removal of the sutures (post - op 1012 days). at the fourth week, the patients were instructed to begin weight - bearing. the short leg casts were continued until early incorporation of the bone graft was visible on the lateral weight - bearing radiographs of the foot. after the treatment, the patients were followed regularly at monthly intervals up to 3 months, every 3 months up to 12 months, and every 6 months up to the last visit. we focused on the following data for the consideration : region where the spina bifida lesion exists, age of the patient, existence of bony union, residual varus or valgus deformity, calcaneal pitch, talocalcaneal angles, reduction in orthotic device use, and the complications. at 12 week, most of the unions were judged by clinical and radiographic examination. the positive bony union was considered in patients with union of graft to both talus and calcaneus16 [figure 2 ]. if graft union was seen in only at one of them [figure 3 ], it was considered as a partial union. x - ray ankle joint (anteroposterior view) showing the union of graft to both talus and calcaneus (black arrow) x - ray ankle joint anteroposterior view showing partial union i.e. union of graft to calcaneus but no union to talus (black arrow) for radiological evaluation, the calcaneal pitch and the lateral talocalcaneal (tc) angles were measured. the calcaneal pitch was the angle formed between the horizontal and a line connecting the tuberosities of the calcaneus. the lateral tc angle was formed between a line paralleling the long axis of the talus and a line connecting the tuberosities of the calcaneus.17 at surgery, the lateral tc angle was planned to be corrected to 30 and 50 respectively. for clinical evaluation, we used the criteria of kling.,18 which considers alignment and abnormal callosities. children who were able to stand with less than 5 of residual valgus posture of the hind foot [figure 4 ], had normal callosities, and pain - free mobilization without orthoses were considered as satisfactory. the foot with residual valgus more than 5, difficulty in fitting to orthoses, or any pain without orthoses during mobilization were considered as unsatisfactory. a clinical photograph showing satisfactory correction in the cases of unsuccessful surgical treatment the feet are reoperated. statistical analysis was performed using repeated analysis of variance (anova) and post hoc bonferroni multiple comparisons in comparing preoperative and postoperative angles, and pearson correlation test was used for finding the relation between age and satisfactory results. any p value smaller than 0.05 was considered significant. mean duration of the surgery was 168 minutes (range 115234 minutes) and the mean blood loss was 98 ml (range 60184 ml). the mean age of the patients with clinically unsatisfactory and satisfactory outcomes was 57.7 and 73.8 months, respectively. the age at the time of surgery in patients with unsatisfactory outcome was significantly lesser than of those with a satisfactory outcome (p<0.0001). the total number of feet that had nonunion was 11 ; in 7 of them the grafts were completely reabsorbed and all these feet had an unsatisfactory outcome. four feet had partial union of which three had unsatisfactory outcome and one had satisfactory outcome. in a foot with satisfactory outcome (egu), the lateral tc angle of this foot at the last followup visit was 43. it was clinically stable and painless, and there was no need for the orthotic devices. sixteen feet had residual valgus deformity more than 5 at the last followup visit, 10 patients had nonunion, and 6 had inadequate correction. mean preoperative tc angle was 48.5 (range 39 - 59 sd : 3.20976) which decreased to 38.5 (range 27 - 59 ; sd : 7.60039) postoperatively [figure 5 ]. the preoperative mean calcaneal pitch angle was 31.9 (range 22 - 37 ; sd : 2.91179) which decreased to 29.1 (range 22 - 36 ; sd : 4.20110) postoperatively [figure 6 ]. the decrease in tc angle and calcaneal pitch angle was significant between preoperative and postoperative measurements (p<0.001). mean tc and calcaneal pitch angles were measured as 42.1 (range 27 - 61 ; sd : 10.53868) and 29.5 (range 23 - 37 ; sd : 4.39644), respectively, at the last visit. at the last followup, there were 14 feet with tc angles more than 50 ; out of the 14 feet, 8 had nonunion and 6 had inadequate correction. although the increase in tc angles in the group with satisfactory outcome was not significant compared to controls, it was significant in the group with an unsatisfactory outcome (p<0.05) [table 1 ]. a bar diagram showing the preoperative, postoperative, and last followup talocalcaneal angle measurements a bar diagram showing the preoperative, postoperative, and last followup calcaneal pitch angle measurements the preoperative, postoperative, and last followup talocalcaneal angles for groups with unsatisfactory and satisfactory outcome both feet of a patient (ehc) who had tc angles less than 30 at the last followup visit did not have any clinical heel varus, recurrent sprains, ulcers, callosities, or shoe wrecking in any of her feet. also, she did not need orthotics for either of her feet. the satisfactory fitting of the feet with orthotics was not possible preoperatively in any of them. the decrease in orthotic use was significant between preoperative and last followup visits (p<0.05). there was no need for orthotics in any of the feet in the group with satisfactory outcome. satisfactory fitting of the orthotics was obtained in 14 feet of the group with an unsatisfactory outcome. two feet in this group had skin ulcers due to failed orthotic treatment after surgery. there was no intraoperative complication other than a graft fall to the ground during operation in one patient. postoperatively, three feet had superficial wound infections which resolved with local wound care. at final followup none patient had developed a charcot joint or had an evidence of degenerative arthritis of the foot. the grice green procedure was designed to correct hind foot valgus deformity, restore the height of the foot, and preserve its subsequent growth.17 if the procedure can not provide satisfactory outcome, it may still possible to provide a foot with improved alignment and stability with a triple arthrodesis at a later session.19 in properly selected patients, the operation would likely be a definitive procedure, providing development toward normal maturity and allowing for function without pathologic subluxation. later degenerative changes in the adjacent articular structures have been minimal and would appear to be no more marked than those seen following triple arthrodesis.16 grice subtalar blocking surgery preserves the height of the foot. therefore, if further treatment is necessary after subtalar block, it is relatively easy to proceed with triple arthrodesis at the appropriate time.16 the grice subtalar blocking surgery is appropriate in patients between 2 and 9 years of age.20 after 8 years of age, most authors recommend triple arthrodesis.17 there is also a debate for the lower age limit of this surgery.2 the graft resorption and concomitant valgus deformity after surgery is more common in patients who underwent surgery at an earlier age in our series. therefore, the age of the patient could be a factor in the cause of resorption and concomitant valgus deformity. there are some other extraarticular subtalar arthrodesis procedures described for correcting valgus feet.791014 dennyson - fulford technique is one of the most commonly known techniques. the most common complications are due to internal fixation material, such as malpositioning of the screw, excessive penetration of lateral / plantar calcaneal cortex by using a long screw, and impingement of screw head over the anterior lip of distal tibia. also, hosny and fabry reported avascular necrosis of the talus, after a dennyson - fulford subtalar arthrodesis technique21 another commonly used modification is batchelor technique which was reported by brown in 1968.9 however, this technique has the potential risk of converting the extraarticular arthrodesis into an intraarticular one, if the fibular peg is not driven through the sinus tarsi.10 furthermore, it produces a high pseudarthrosis rate due to the fracture of the graft, which can not withstand shearing forces, especially if the axis of the graft is placed parallel to the axis of the subtalar joint.8 late ankle valgus deformity as a result of nonunion at the graft donor site has also been reported.2224 the bone grafts may be obtained from fibula, tibia, or iliac crest. the late valgus deformity of the ankle may occur due to the failure of full regeneration when the graft is obtained from the ipsilateral fibula.1517 if a segment of the fibular diaphysis is removed in a growing child and does not regenerate, the tibiotalar joint frequently tilts into valgus position.25 in the absence of a normally growing fibula, the lateral side of the tibial epiphysis grows slower than the medial side and valgus of the ankle results. the earlier in life the segment is removed, the more severe the valgus is seen.25 when distal tibial shaft is used as a graft site, there may be an acceleration of the growth of the tibia at the donor site. this accelerated growth may increase the deformity or produce an ankle valgus.26 as mentioned in a few series,27 we took graft from iliac crest which has no such complications related to growth. failure of fusion and resorption of the graft was reported in a certain percentage in all series except that of tohen and carrnona.28 the incidence of resorption was approximately three times greater when homologous bone was used.27 the fusion rates were higher in our series than in most series reported in the literature.172029 one of the aims of this procedure was to provide reduction in orthotic use and to prevent the recurrent soft tissue ulcerations adjacent to the head of talus. in our series, reduction in orthotic device use was approximately the same as reported in literature.62629 only two feet had skin ulcers due to failed orthotic treatment after surgery. muscle balance can be restored by tendon transfers to avoid recurrence.16 some authors transfer the peroneus longus to the dorsum of the foot in addition to the subtalar fusion in equinovalgus feet.16 a high incidence of dorsal bunions was found to be associated with this transfer, and later in the series, the peroneus brevis was substituted as a transfer to the dorsum of the foot in order to give dorsiflexion power to the equinovalgus feet. this particular type of transfer was implicated in other series as causing a late varus deformity.1 we did not make tendon transfer in any of the feet, which can clarify the absence of dorsal bunion or late varus deformity in any of the feet. bratberg and scheer30 reviewed the literature on grice green subtalar arthrodesis for children and reported an overall success rate of 74% of 573 procedures. the results of the procedure for valgus deformity secondary to cerebral palsy have been encouraging.15 drvaric. reported 94% satisfactory results in their series and cited other studies with good or excellent results in 7897%.31 the results of grice green subtalar blocking surgery for children with spina bifida have been less encouraging. eight out of 10 feet were reported as showing unsatisfactory result.17 the complications reported in these series were ankle valgus (n=7), nonunion (n=1), delayed union (n=1), and slipped graft (n=2). moreland and westin operated seven valgus feet with spina bifida and four of them were considered as satisfactory.6 mccall. reported graft failure in seven of nine feet and unsatisfactory results in all the feet.32 loss of correction in their series could be traced directly to slippage of the graft in 85% of patients with residual valgus. a result was also considered as unsatisfactory in those patients demonstrating significant ankle valgus postoperatively, since it was believed that instability merely had been transferred up from the hind foot to the ankle. the most common primary complication reported has been varus due to overcorrection at the time of surgery or overcompensation with muscle - balancing procedures in paralytic feet. the valgus heel from inadequate correction or recurrence ; and ankle instability are other common complications.27 all authors agree that it is better to err on the site of slight valgus position of the heel at the time of operation than to overcorrect. valgus is a position of stability and is preferable to any amount of varus.16 the failures are classified as early or late varus or valgus deformity of hind foot.30 early deformities are those which manifest during the first 6 postoperative months and late deformities are attributable to incomplete correction at the time of surgery. late varus, a 28% occurrence in the series of aronson., was seen in neuromuscular disease when peroneus brevis and longus were transferred medially.12 varus deformity (early or late) was not seen in any of the feet in our series. however, we had 6 feet with early valgus due to inadequate correction and 10 feet with late valgus deformity due to graft resorption. the tendency for partial resorption in these grafts is certainly appreciated in light of the forces occurring in this region, the vascularity of the grafts, and the prolonged healing period for consolidation. as a result, grice subtalar blocking technique is still a valuable option for valgus foot in patients with spina bifida. in this study, we found more encouraging results in older patients. even if unsatisfactory results are obtained after this technique, reduction in orthotic device use is seen and provides a foot with improved alignment and stability on which triple arthrodesis can be performed later.	background : valgus foot is a common foot deformity in spina bifida. the most popular operation for the valgus deformity has been the grice talocalcaneal blocking. it has not been studied primarily in children with spina bifida. we report a prospective series, we present the results of hind foot valgus deformity of children with spina bifida, using grice talocalcaneal arthrodesis with a tricortical iliac bone graft.materials and methods : between may 2000 and december 2003, 21 patients with bilateral (42 feet) valgus deformity of feet underwent surgery. there were 7 males and 14 females. the mean age of patients was 67.7 months (range 50108 months).results : the total number of feet that had nonunion was 11, in 7 of them the grafts were completely reabsorbed and the outcome of all these feet was unsatisfactory. four feet had partial union of which three had unsatisfactory and one had satisfactory outcome. sixteen feet had residual valgus deformity at the last followup visit, 10 patients had nonunion, and 6 had inadequate correction. mean preoperative talocalcaneal and calcaneal pitch angles were 48.5 and 31.9, respectively, which decreased to 38.5 and 29.1, respectively, postoperatively. the decrease in talocalcaneal angle and calcaneal pitch was significant between preoperative and postoperative measurements (p<0.05).conclusion : grice subtalar arthrodesis technique is still a valuable option for valgus foot in patients with spina bifida. in this study, we found more encouraging results in older patients.
female genital mutilation / cutting (fgm / c) refers to all procedures involving injury, partial or total removal of the female genital organs for non - therapeutic reasons.1 the practice is concentrated in 29 countries of sub - saharan africa, the middle and far east ; and the united nations children s fund (unicef) estimates it affects between 125 and 140 million women in the world.2 today s demographic trends associated with the migratory reality and other globalization processes have contributed to the extent of fgm / c worldwide, making it an international phenomenon that transcends geography. fgm / c is defined as a set of procedures classified into four major types according to its precise anatomical extent and ascending level of severity : type i (clitoridectomy) refers to partial or total removal of the clitoris or its prepuce ; type ii (excision) is the partial or total removal of the clitoris and the labia minora, with or without excision of the labia majora ; type iii (infibulation) involves the narrowing of the vaginal opening through the creation of a covering seal formed by cutting and repositioning the inner or outer labia, with or without removal of the clitoris. type iv includes all other harmful procedures to the female genitalia for non - medical purposes (including pricking, piercing, incising, scraping, and cauterization).1 the origins of fgm / c remain uncertain and the prevalence, typology, and circumstances surrounding the practice show wide variations between countries and regions.3 deeply rooted in ancestral tradition, fgm / c has been practiced for centuries and it is surrounded in a complex symbolic cultural meaning.4 although the overall prevalence has declined and the practice has changed to less severe types, continued high exposure to fgm / c seriously threatens the health and well - being of over 30 million girls in the next decade.2 internationally recognized as a breach of human rights, fgm / c perpetuates gender inequality and discrimination. as a harmful traditional practice, it is considered an extreme form of violence against women and children that violates the fundamental rights to life, liberty, security, dignity, non - discrimination, and physical and mental integrity.5,6 the gambia is ranked ninth in the world for prevalence of fgm / c with a rate of 76.3% (78.3% in 2005/2006), with two out of three girls at risk of being subjected to the practice.6 types i (66.2%) and ii (26.3%) are the most common,7 and the prevalence at subnational level reveals disparities between regions. the areas with highest prevalence are : basse, in the upper river region (99%) ; mansakonko, in the lower river region (90.6%) ; and brikama, in the western region (84.5%). by contrast, the areas with lower percentages of women who had any form of fgm / c are kerewan, in the north bank region (49.2%) ; and banjul, the capital city of the country (56.3%). slender differences are also found between fgm / c rates in urban (74.6%) and rural (78.1%) areas of residence and among those in the lowest wealth quintile (72.7%) than in the highest (69.8%). slight variations by education are also noted in the country, as the prevalence of fgm / c is higher among non - educated women (76.7%) than women who completed primary or higher education (73.9%).6 reasons upholding fgm / c among practicing groups in the gambia are numerous and diverse, and can be classified into four main categories : hygienic and esthetic, psychosexual, spiritual / religious, and socio - cultural.3 perceived as a women s affair, the fgm / c decision - making process is led by female elders, who are key figures in the ceremony arrangements as custodians of the tradition, whereas men are rarely informed about it.8 the age at which girls undergo the practice which can vary from the seventh day of life up to pre - adolescence seems to be decreasing in the gambia, with 57% of girls being subjected to it by the age of five.6 usually performed by specially designated female traditional practitioners, fgm / c is also reported to be carried out by health care professionals (hcps),7 prompting an intense debate on medicalization defined by the world health organization (who) as a case in which fgm / c is practiced by any category of hcp. there is ample evidence that fgm / c is closely tied to ethnic affiliation, which seems to be the most decisive factor for its prevalence.4,7 with an ethnically diverse population, the gambia is composed of different groups, which are closely linked through generations of inter - ethnic marriage and by the unifying force of islam, the major religion in the country. recent data presented by unicef of contrasting prevalence among ethnic groups demonstrate that the highest national prevalence is found amongst serahuleh (97.8%), followed by mandinka (96.7%), fula (87.3%), and jola (87%). in contrast, the practice appears to be less among serere (43%) and wollof (12.4%).6,9 as extensively described in the ethnographic research conducted by the first author of this paper, fgm / c has traditionally been part of the rite of passage to womanhood among certain ethnic groups in the country.10 in these cases, fgm / c is the physical phase of a socializing process that molds the attitudes and beliefs of girls and women, consolidating ethnic and gender identity and preparing them for eligibility of marriage. however, over the past generation, several changes have been occurring, and recent research outlines that the physical cutting is progressively being disassociated from the traditional ritual.7,11 for decades, the social convention theory at the core of international prevention campaigns has defined fgm / c as a self - enforcing social norm,12 identifying it as a customary rule of behavior that occurs under fear of exclusion and that families do it even when it is known to inflict harm upon girls because the perceived social benefits are deemed more important than its disadvantages.4 while some recent perspectives deny this model and find empirical support in individual and family reasons as forces perpetuating the practice,13 the original formulation of social convention theory has been further refined and reinterpreted. along these lines, shell - duncan regard fgm / c in the gambia as a peer convention that ensures a woman s status by controlling her body and sexuality through virginity preservation concerns. therefore, the practice is not linked to marriageability, but seen as a mechanism to facilitate admission into social network and capital, with peer pressure playing a major role in its perpetuation.14 despite the fact that fgm / c has no religious origin or justification,15 the practice is commonly perceived as an islamic duty in the gambia, constituting one of the main arguments invoked for its continuation.8 regarding legal implications, the gambia had signed national legal conventions that implicitly oppose the practice, but no specific legislation in the country was proposed until december 2015, when the gambia s national assembly historically approved fgm / c prohibition and criminalization through the amendment of the national women s act. different preventive interventions have been implemented across the country with timid results, but a comprehensive national plan of action towards fgm / c abandonment has yet to be developed. as a manifestation of gender inequality, fgm / c is deeply entrenched in social, economic, and political structures and must be understood within a context marked by strong gender discrimination that seriously affects the rights of girls and women,5 and that influences a low human development index position (155 out of 177).16 despite being granted equal rights as men under the national constitution, women in the gambia confront a discriminatory family code (customary and sharia law regulating marriage, widow inheritance, polygamy, divorce, child custody, and women s rights to inheritance), restrictions on resources and assets (discriminatory practices in access to land, financial services, and employment), and restrictions on physical integrity (fgm / c and domestic violence remaining widespread problems together with inaccessible and insufficient maternal health care services).17 although a large body of literature has documented fgm / c risks and impact on health, the gambia lacked scientific and reliable data on the practice s circumstances and its life - threatening consequences. acknowledging this gap, two clinical studies were conducted and proved that fgm / c affects girls and women in both the short- and the long - term,18,19 with one out of three girls and women presenting with injuries as a consequence of the practice. these studies also revealed that fgm / c increases the risk of complications during childbirth for both the mother and the newborn by 4.5 times, with infant mortality increasing when the mother has undergone the practice. these results highlighted, for the first time, the magnitude of the health consequences associated with fgm / c in the gambia and emphasized the critical need for specific actions.18,19 in addition, a study conducted between 2009 and 2011 examining knowledge, attitudes, and practices (kap) regarding fgm / c among hcps in the gambia, revealed that 42.5% of health professionals embraced the continuation of fgm / c, intended to subject their own daughters to it (47.2%), and have already performed it during their professional duties (7.6%).7 in the efforts towards management and prevention of fgm / c, the involvement of hcps is crucial, as they are respected, influential, and part of the community, holding a strategic position as effective agents of change to ensure that girls at risk and women already suffering fgm / c consequences have access to quality health care services. the aim of this study is to explore, measure, and assess changes in kap regarding fgm / c among future and present hcps in the gambia. by providing evidence and analysis of what is known, believed, and done by hcps according to their occupation, sex, and ethnicity, this paper seeks to identify key factors in the process towards the abandonment of fgm / c in the country. the secondary objective is to assess kap changes over time by tracking the reference values established in the former kap in - country study carried out between 2009 and 2011. a cross - sectional descriptive study was designed to collect and analyze data related to hcps perceptions regarding fgm / c, which were classified into the kap categories. as an attempt to grasp hcps tendencies regarding fgm / c, data were analyzed according to occupation, sex, and ethnic affiliation variables, and quantitative research was combined with extensive literature reviews. the selection of chosen variables responded to their relevance : taking into consideration the characteristics of the research population, the occupation variable is essential to compare current with future hcps positions. in addition, a closer look at the most recent data on the issue4 indicates that analysis of sex disaggregated data is fundamental in understanding new tendencies regarding the practice, while ethnic affiliation becomes a critical factor, shaping attitudes and practices. following the methodology of kaplan, the study was conducted in the gambia among two specific target groups of health professionals and students, purposely selected from health care facilities and academic centers throughout the six regions nationwide over a 3-year period spanning 2012, 2013, and 2014.7 taking into account the socio - demographic characteristics of the country, the study integrated a multi - ethnic approach and data were collected by a multidisciplinary research team of native and international, female and male professionals, through the implementation of a structured questionnaire. containing both closed- and open - ended items, the self - administered kap questionnaire was handed out in the same format to both target groups, who completed the written interviews individually. the official language of the country and precise oral instructions were provided by the research team prior to completing the document. the overall stratified sample consisted of 1,288 hcps, including health professionals and students in the gambia. the purposive sampling was used within the framework of the national training program of hcps on fgm / c implemented by the non - governmental organization wassu gambia kafo one of the two research and training stations of the transnational observatory of applied research and new strategies for the management and prevention of female genital mutilation, held by wassu - uab foundation at the autonomous university of barcelona (uab), which has developed a methodology of research applied to knowledge transfer in cascade to institutions and health care providers for the prevention and care of fgm / c. the health professional subgroup was composed of nurses (state registered nurses, state enrolled nurses, and community health nurses), community nurse attendants, midwives, and public health officers, representing the spectrum of formally trained health professionals enrolled in the public health system of the gambia. to reach this category of interviewees, the main public health facilities in the country were covered. as future health professionals, students of medicine, nursing, midwifery, and public health degrees all students included in this research were aged 18 and over at the date of the interview and in their second year of university onwards, recruited from all the health science schools in the gambia. the kap questionnaire on fgm / c was composed of 36 statements linked together from the general to the specific, including eleven open- and 25 closed - ended questions on general data and relevant information on fgm / c kap. open questions were intended to collect socio - demographic information from the respondents (including name of the institution, occupation, age, sex, ethnic affiliation, and date of the interview). there were also 29 assorted statements that were classified into questions regarding knowledge (fgm / c exposure and health consequences, as well as reasons for supporting the practice), attitudes (beliefs and intentions regarding fgm / c, individual preferences regarding its continuation, possible strategies for its prevention, and perceptions of social expectations), and practices (prevalence of the practice among the target groups and degree to which medicalization occurs). the pilot study conducted in two regions of the country validated the consistency of the questionnaire design, subsequently consolidated by its implementation through the development of the analogous research in 2009/2011 by the first author of this paper.8 development of scaling - up methods and materials allowed the establishment of a baseline to provide new data of fgm / c reality in the gambia. in line with the study protocol and methodology, the kap questionnaire was designed to guarantee the collection of quality data, taking into consideration the sensitivity of the topic and following a culturally respectful approach. the study was submitted and approved by the gambia government / medical research council laboratories joint ethics committee (ref : r08002), the scientific ethical committee in the gambia. all respondents were formally informed about the extent and purpose of the research, and their participation was voluntary and contingent on their personal oral consent, free from any coercion whatsoever. rigorous privacy and confidentiality of participants identities was maintained, as the questionnaires were classified through a codification numbering system. the totality of the information and personal data obtained as a result of this research is reasonably guarded against any risk of unauthorized or inappropriate use or disclosure under the custody of wassu gambia kafo. the general aim of the study is to benefit the community by improving information on the research topic through knowledge transfer. after the data collection phase, a descriptive analysis of the main socio - demographic variables was conducted. prevalence proportions (%) and 95% confidence intervals (cis) regarding, respectively ; knowledge, attitudes, and practices were calculated. in order to detect differences in the responses, each variable was stratified by occupation (health professional or student), sex (male or female), and ethnic group (mandinka, wollof, fula, serahuleh, jola, serere). prevalence proportions were compared with chi - square tests or fisher s exact test when appropriate. data were computerized and double - checked via epidata and descriptive univariate and bivariate analyses were conducted through r and stata. it can not be excluded that, as a non - probabilistic technique, the purposive sample can be prone to researcher bias. however, based on the characteristics of the country where it was implemented, the use of the technique was valuable to make generalizations from the sample to the population of interest. there is also the possibility that the research participants increased their knowledge on the study topic prior to completing the kap questionnaire, although the survey methodology was designed to reduce such biases, hence, fully trained hcps were not included in the sample population. moreover, the comparative analysis of the former kap research may be influenced by the fact that the sample of the study carried out between 2009 and 2011 by the first author of this paper only included hcps from rural regions, and did not observe the occupation variable. an additional challenge is posed by the fact that variables influencing kap regarding fgm / c may overlap, with special regard to ethnicity, as ethnic groups may have subgroups that differ with respect to fgm / c. a cross - sectional descriptive study was designed to collect and analyze data related to hcps perceptions regarding fgm / c, which were classified into the kap categories. as an attempt to grasp hcps tendencies regarding fgm / c, data were analyzed according to occupation, sex, and ethnic affiliation variables, and quantitative research was combined with extensive literature reviews. the selection of chosen variables responded to their relevance : taking into consideration the characteristics of the research population, the occupation variable is essential to compare current with future hcps positions. in addition, a closer look at the most recent data on the issue4 indicates that analysis of sex disaggregated data is fundamental in understanding new tendencies regarding the practice, while ethnic affiliation becomes a critical factor, shaping attitudes and practices. following the methodology of kaplan, the study was conducted in the gambia among two specific target groups of health professionals and students, purposely selected from health care facilities and academic centers throughout the six regions nationwide over a 3-year period spanning 2012, 2013, and 2014.7 taking into account the socio - demographic characteristics of the country, the study integrated a multi - ethnic approach and data were collected by a multidisciplinary research team of native and international, female and male professionals, through the implementation of a structured questionnaire. containing both closed- and open - ended items, the self - administered kap questionnaire was handed out in the same format to both target groups, who completed the written interviews individually. the official language of the country and precise oral instructions were provided by the research team prior to completing the document. the overall stratified sample consisted of 1,288 hcps, including health professionals and students in the gambia. the purposive sampling was used within the framework of the national training program of hcps on fgm / c implemented by the non - governmental organization wassu gambia kafo one of the two research and training stations of the transnational observatory of applied research and new strategies for the management and prevention of female genital mutilation, held by wassu - uab foundation at the autonomous university of barcelona (uab), which has developed a methodology of research applied to knowledge transfer in cascade to institutions and health care providers for the prevention and care of fgm / c. the health professional subgroup was composed of nurses (state registered nurses, state enrolled nurses, and community health nurses), community nurse attendants, midwives, and public health officers, representing the spectrum of formally trained health professionals enrolled in the public health system of the gambia. to reach this category of interviewees, the main public health facilities in the country were covered. as future health professionals, students of medicine, nursing, midwifery, and public health degrees all students included in this research were aged 18 and over at the date of the interview and in their second year of university onwards, recruited from all the health science schools in the gambia. the kap questionnaire on fgm / c was composed of 36 statements linked together from the general to the specific, including eleven open- and 25 closed - ended questions on general data and relevant information on fgm / c kap. open questions were intended to collect socio - demographic information from the respondents (including name of the institution, occupation, age, sex, ethnic affiliation, and date of the interview). there were also 29 assorted statements that were classified into questions regarding knowledge (fgm / c exposure and health consequences, as well as reasons for supporting the practice), attitudes (beliefs and intentions regarding fgm / c, individual preferences regarding its continuation, possible strategies for its prevention, and perceptions of social expectations), and practices (prevalence of the practice among the target groups and degree to which medicalization occurs). the pilot study conducted in two regions of the country validated the consistency of the questionnaire design, subsequently consolidated by its implementation through the development of the analogous research in 2009/2011 by the first author of this paper.8 development of scaling - up methods and materials allowed the establishment of a baseline to provide new data of fgm / c reality in the gambia. in line with the study protocol and methodology, the kap questionnaire was designed to guarantee the collection of quality data, taking into consideration the sensitivity of the topic and following a culturally respectful approach. the study was submitted and approved by the gambia government / medical research council laboratories joint ethics committee (ref : r08002), the scientific ethical committee in the gambia. all respondents were formally informed about the extent and purpose of the research, and their participation was voluntary and contingent on their personal oral consent, free from any coercion whatsoever. rigorous privacy and confidentiality of participants identities was maintained, as the questionnaires were classified through a codification numbering system. the totality of the information and personal data obtained as a result of this research is reasonably guarded against any risk of unauthorized or inappropriate use or disclosure under the custody of wassu gambia kafo. the general aim of the study is to benefit the community by improving information on the research topic through knowledge transfer. after the data collection phase, a descriptive analysis of the main socio - demographic variables was conducted. prevalence proportions (%) and 95% confidence intervals (cis) regarding, respectively ; knowledge, attitudes, and practices were calculated. in order to detect differences in the responses, each variable was stratified by occupation (health professional or student), sex (male or female), and ethnic group (mandinka, wollof, fula, serahuleh, jola, serere). prevalence proportions were compared with chi - square tests or fisher s exact test when appropriate. data were computerized and double - checked via epidata and descriptive univariate and bivariate analyses were conducted through r and stata. it can not be excluded that, as a non - probabilistic technique, the purposive sample can be prone to researcher bias. however, based on the characteristics of the country where it was implemented, the use of the technique was valuable to make generalizations from the sample to the population of interest. there is also the possibility that the research participants increased their knowledge on the study topic prior to completing the kap questionnaire, although the survey methodology was designed to reduce such biases, hence, fully trained hcps were not included in the sample population. moreover, the comparative analysis of the former kap research may be influenced by the fact that the sample of the study carried out between 2009 and 2011 by the first author of this paper only included hcps from rural regions, and did not observe the occupation variable. an additional challenge is posed by the fact that variables influencing kap regarding fgm / c may overlap, with special regard to ethnicity, as ethnic groups may have subgroups that differ with respect to fgm / c. table 1 shows the profile of the respondents, consisting of 1,288 health professionals and medical students (44% women and 56% men), with an average age of 27.9 years (269.25). according to the most recent official published data,9 the sample is ethnically representative of the total gambian population, with a small mandinka over - representation and a slight under - representation of serahuleh ethnic group. when examining trends regarding fgm / c, there is a variety of factors that condition an individual s position towards the practice. this study explored hcps knowledge by framing questions in the socio - cultural context of fgm / c in the gambia, the practice justifications, and the identification and awareness of its health consequences. the majority of hcps surveyed (96.5%, 95% ci : 95.597.5) cited tradition as the main reason for fgm / c persistence in the country, while only a quarter of the respondents (24.6%, 95% ci : 22.127.0) believed that the practice is mandatory in islam. inter - ethnic analysis shows significant differences, such as that the link between fgm / c and religion is mainly supported by practicing ethnic groups such as jola (27.8%, 95% ci : 18.936.8) and mandinka (24.2%, 95% ci : 19.828.7), whereas only 5.9% (95% ci : 1.310.5) of wollof and 7.8% (95% ci 2.912.7) of serere shared the same opinion and, instead, placed more emphasis on the deep roots of the practice in the country. results regarding knowledge of fgm / c legal implications show a certain level of confusion among hcps, since most of them (77.9%, 95% ci : 75.680.3) identified fgm / c as a human rights violation, but a significant portion (41.3%, 95% ci : 38.544.1) mistakenly thought that the gambia held a national legislation banning fgm / c at the time the study was being implemented. analysis by sex showed that, despite being more aware of the human rights framework (83.4%, 95% ci : 80.586.6 vs 76.5%, 95% ci : 72.480.5), women generally showed more misunderstanding regarding specific legal consequences, as almost half of the female respondents (46.2%, 95% ci : 41.950.5) reported prohibition of fgm / c in the country (vs 32.4%, 95% ci : 28.036.8 of men). in line with recent research findings,711 this study confirmed that younger generations tend to disassociate the practice from the traditional ritual. the rate of students surveyed with a lower average age (255.2) than already working health professionals (33.18.2) perceiving the practice as part of the rite of passage to womanhood was lower than the percentage of health professionals linking it to the ritual (36.7%, 95% ci : 33.240.1 vs 49.5%, 95% ci : 44.854.3). when assessing awareness of fgm / c s impact on health, we observed a general increase in the identification of fgm / c - related complications, with only 1.5% (95% ci : 0.82.2) of hcps stating that the practice has no consequences. hcps demonstrated remarkable skills in the identification of the different types of consequences, with female hcps being much better able to recognize a patient with fgm / c complications than their male colleagues (63.9%, 95% ci : 63.675.2 vs 53.1%, 95% ci : 45.860.2). the transmission of infectious diseases was the most frequently reported consequence (78.5%), closely followed by bleeding (72.8%, 95% ci : 76.180.9). obstetric and sexual complications were also recognized by the respondents, since difficulty during delivery was commonly identified as a health risk (65%, 95% ci : 62.267.8), and decreased sexual feelings were also mentioned (33%, 95% ci : 30.335.9). by analyzing the data with the occupation variable, it can be observed that students have slightly more knowledge than health professionals. students also showed better identification of the sexual consequences of the practice (37.3%, 95% ci : 33.840.9 vs 25.1%, 95% ci : 20.829.4) and higher recognition of the risk of transmission of sexually transmitted diseases (82.6%, 95% ci : 79.985.4 vs 70.8%, 95% ci : 66.375.3). a review of trends in hcps attitudes towards fgm / c was carried out by exploring their opinions on the feasibility of the abandonment of the practice in the gambia, and on the possible strategies and social actors involved in the debate (including religious leaders, men, and hcps themselves). in addition to their impression of those who practice fgm / c, respondents were also asked whether they support the continuation of fgm / c and whether they intend to subject their own daughters to it. key findings are shown in table 3. regarding attitude towards fgm / c, almost three out of four hcps (71.6%, 95% ci : 69.174.1) considered fgm / c a harmful practice, while 28.4% of them defined it as good or neither good nor bad. despite not finding significant differences in knowledge, sex differences in support of the practice showed that a higher percentage of women have a negative perception of fgm / c, and consider it a harmful practice (77.4%, 95% ci : 74.280.5 vs 64.7%, 95% ci : 60.768.8). an overall negative opinion of the practice can be linked to the fact that the majority of hcps surveyed (75.4%, 95% ci : 73.077.8) would approve legislation banning fgm / c in the gambia, although this was more commonly shared among hcps from non - practicing ethnic groups (wolof and serere). the vast majority of female hcps (81.1%, 95% ci : 78.284.1) were in favor of a national legislation criminalizing the practice, whereas a lesser degree of support was shown by men (68.2%, 95% ci : 64.272.1). when questioned about its continuation, a quarter of the respondents (25.4%, 95% ci : 22.927.8) stated that the practice should continue. among those who adhere to fgm / c abandonment, the practice s negative impact on women s health and welfare was given as the main reason to stop (67.2%, 95% ci : 64.470.0), while violation of human rights was also invoked by 16.7% (95% ci : 14.518.8) of them as a motivating factor. an analysis of data by sex revealed that women show stronger opposition to the practice and less support to its continuation than their male colleagues (21.3%, 95% ci : 18.124.4 vs 29.5%, 95% ci : 25.633.4), bringing these figures along the same lines as the previous study results.7 despite a general tendency toward abandonment, an inter - ethnic analysis unveiled several disparities. although the most support for fgm / c continuation came from hcps belonging to ethnic groups with higher fgm / c prevalence mandinka (33.1%, 95% ci : 29.037.5), fula (27%, 95% ci : 21.932.8), and jola (24.6%, 95% ci : 17.832.9), it was also among these groups that the major decrease of support to the practice, compared to 2009/2011 results, was found (57.3%, 42.9%, and 39% respectively). despite the fact that most of the hcps demonstrated a certain degree of knowledge on fgm / c s negative impact on health, and that only 14.5% (95% ci : 12.516.5) of the total considered it a good practice, 24.4% (95% ci : 22.026.8) of the respondents (47.2% in 2009/2011 study) declared their intention of having fgm / c performed on their daughters. while these findings may appear paradoxical, they can be understood by considering the social benefits perceived by the respondents. following the same pattern, findings among jola hcps revealed that, although only 18.3% considered fgm / c a good or neither good nor bad practice, 30.5% of them expressed their support to practicing families. also regarding intention of performing fgm / c, remarkable differences by ethnic affiliation were found, with higher percentages among mandinka (31.3%, 95% ci : 26.536.1), fula (28%, 95% ci : 21.934.0), and jola (26.9%, 95% ci : 17.836.0). however, support was not as high as prevalence in any ethnic group, and a huge decline in this rate was highlighted in contrast to 2009/2011 figures (mandinka, 64.3% ; jola, 47.5% ; and fula, 43.6%). when cross - referencing the data according to sex, some divergences were found, with special emphasis on mandinka women, whose intention to perform fgm / c on their daughters was half when compared to men from the same ethic group (34.9% vs 65.1%). a very small presence of discriminatory attitudes toward women and girls not undergoing fgm / c were reported by both men and women. regarding strategies to prevent the practice, the introduction of an alternative ritual avoiding any mutilation was supported by a significant 72.2% (95% ci : 69.774.8) of the hcps surveyed. moreover, almost all of the respondents (90%, 95% ci : 88.391.7) agreed on the need for men to take part in the debate, while religious leaders involvement showed less support (67.2%, 95% ci : 64.470.0). non - practicing ethnic groups showed more optimistic predictions about the feasibility of abandoning fgm / c in the country (serere, 79.3%, 95% ci : 67.287.7 ; wolof, 68.1%, 95% ci : 59.275.7) than traditionally practicing communities, who were more reluctant to this possibility (mandinka, 52.6%, 95% ci : 48.057.2 ; jola, 55%, 95% ci : 46.163.6). regarding social actors participating in the process of social change, 93.7% (95% ci : 92.395.1) stated that hcps have a key role to play in preventing fgm / c. 26.131.3) saw medicalization as a means of controlling and making the practice safer, with men showing more support than women (35.6%, 95% ci : 31.539.8 vs 23.3%, 95% ci : 20.026.6) ; and more students than health professionals considered fgm / c medicalization safer (31.7%, 95% ci : 28.335.0 vs 23.4%, 95% ci : 19.327.5). despite a general decrease in its support, medicalization was found to remain more accepted among fula (36%, 95% ci : 29.942.0), mandinka (33.7%, 95% ci : 29.338.1), and jola (29.9%, 95% ci : 21.638.3). this study explored hcps practices regarding fgm / c through the design of specific questions addressing the prevalence of the practice among their families, as well as focusing on whether and to which extent fgm / c is medicalized. as shown in table 4, a total of 71.5% (95% ci : 68.974.0) of hcps reported that fgm / c is practiced in their family or household, this rate being in line with the national prevalence in the gambia (76.3%). when this was examined according to occupation, results indicated lower prevalence among students families than among health professionals families (69.3%, 95% ci : 66.072.5 vs 75.4%, 95% ci : 71.479.4). an intra - ethnic analysis of these data revealed that fgm / c was most commonly performed among serahuleh communities (90.9%, 95% ci : 78.6100.0), followed by mandinka (89.6%, 95% ci : 86.992.4), fula (85%, 95% ci : 80.689.4), and jola (79.5%, 95% ci : 72.386.7), whereas traditionally non - practicing ethnic groups had lower fgm / c prevalence rates (serere 43.3%, 95% ci : 30.756.0 ; wollof 23.4%, 95% ci : 15.930.9). these figures follow the same pattern as the latest available data on fgm / c prevalence according to ethnicity,7 strengthening the robustness of the study outcomes. regarding the question of having ever performed fgm / c, 10.5% (95% ci : 7.913.7) of hcps declared to have performed it during their medical praxis (only working health professionals responses were considered in questions referring to medical praxis, as considered not applicable for health care students). a subject of ongoing debate in the country, this study found that, despite men embracing medicalization in higher percentages than women, the act of medicalizing fgm / c is much more frequently carried out by female (12%, 95% ci : 8.516.7) than male hcps (6.2%, 95% ci : 3.510.8). besides, an inter - ethnic insight raised extreme discrepancies among those who declared to have performed it, as 10.6% (95% ci : 6.716.3) of mandinka, 10.6% (95% ci : 4.622.6) of jola, 9.5% (95% ci : 3.822.1) of wollof, and 7% (95% ci : 3.214.4) of fula hcps admitted to have carried out the practice as health professionals, while 0% of serere did. despite holding almost universal fgm / c prevalence, serahuleh hcps surveyed in this study showed very low rates of medicalization, which could be related to the circumstances surrounding the procedure in their community, commonly carried out in babies by traditional female practitioners. when examining trends regarding fgm / c, there is a variety of factors that condition an individual s position towards the practice. identifying knowledge of fgm / c is crucial to comprehend the underlying reasons. this study explored hcps knowledge by framing questions in the socio - cultural context of fgm / c in the gambia, the practice justifications, and the identification and awareness of its health consequences. the majority of hcps surveyed (96.5%, 95% ci : 95.597.5) cited tradition as the main reason for fgm / c persistence in the country, while only a quarter of the respondents (24.6%, 95% ci : inter - ethnic analysis shows significant differences, such as that the link between fgm / c and religion is mainly supported by practicing ethnic groups such as jola (27.8%, 95% ci : 18.936.8) and mandinka (24.2%, 95% ci : 19.828.7), whereas only 5.9% (95% ci : 1.310.5) of wollof and 7.8% (95% ci 2.912.7) of serere shared the same opinion and, instead, placed more emphasis on the deep roots of the practice in the country. results regarding knowledge of fgm / c legal implications show a certain level of confusion among hcps, since most of them (77.9%, 95% ci : 75.680.3) identified fgm / c as a human rights violation, but a significant portion (41.3%, 95% ci : 38.544.1) mistakenly thought that the gambia held a national legislation banning fgm / c at the time the study was being implemented. analysis by sex showed that, despite being more aware of the human rights framework (83.4%, 95% ci : 80.586.6 vs 76.5%, 95% ci : 72.480.5), women generally showed more misunderstanding regarding specific legal consequences, as almost half of the female respondents (46.2%, 95% ci : 41.950.5) reported prohibition of fgm / c in the country (vs 32.4%, 95% ci : 28.036.8 of men). in line with recent research findings,711 this study confirmed that younger generations tend to disassociate the practice from the traditional ritual. the rate of students surveyed with a lower average age (255.2) than already working health professionals (33.18.2) perceiving the practice as part of the rite of passage to womanhood was lower than the percentage of health professionals linking it to the ritual (36.7%, 95% ci : 33.240.1 vs 49.5%, 95% ci : 44.854.3). when assessing awareness of fgm / c s impact on health, we observed a general increase in the identification of fgm / c - related complications, with only 1.5% (95% ci : 0.82.2) of hcps stating that the practice has no consequences. hcps demonstrated remarkable skills in the identification of the different types of consequences, with female hcps being much better able to recognize a patient with fgm / c complications than their male colleagues (63.9%, 95% ci : 63.675.2 vs 53.1%, 95% ci : 45.860.2). the transmission of infectious diseases was the most frequently reported consequence (78.5%), closely followed by bleeding (72.8%, 95% ci : 76.180.9). obstetric and sexual complications were also recognized by the respondents, since difficulty during delivery was commonly identified as a health risk (65%, 95% ci : 62.267.8), and decreased sexual feelings were also mentioned (33%, 95% ci : 30.335.9). by analyzing the data with the occupation variable, it can be observed that students have slightly more knowledge than health professionals. students also showed better identification of the sexual consequences of the practice (37.3%, 95% ci : 33.840.9 vs 25.1%, 95% ci : 20.829.4) and higher recognition of the risk of transmission of sexually transmitted diseases (82.6%, 95% ci : 79.985.4 vs 70.8%, 95% ci : 66.375.3). a review of trends in hcps attitudes towards fgm / c was carried out by exploring their opinions on the feasibility of the abandonment of the practice in the gambia, and on the possible strategies and social actors involved in the debate (including religious leaders, men, and hcps themselves). in addition to their impression of those who practice fgm / c, respondents were also asked whether they support the continuation of fgm / c and whether they intend to subject their own daughters to it. key findings are shown in table 3. regarding attitude towards fgm / c, almost three out of four hcps (71.6%, 95% ci : 69.174.1) considered fgm / c a harmful practice, while 28.4% of them defined it as good or neither good nor bad. despite not finding significant differences in knowledge, sex differences in support of the practice showed that a higher percentage of women have a negative perception of fgm / c, and consider it a harmful practice (77.4%, 95% ci : 74.280.5 vs 64.7%, 95% ci : 60.768.8). an overall negative opinion of the practice can be linked to the fact that the majority of hcps surveyed (75.4%, 95% ci : 73.077.8) would approve legislation banning fgm / c in the gambia, although this was more commonly shared among hcps from non - practicing ethnic groups (wolof and serere). the vast majority of female hcps (81.1%, 95% ci : 78.284.1) were in favor of a national legislation criminalizing the practice, whereas a lesser degree of support was shown by men (68.2%, 95% ci : 64.272.1). when questioned about its continuation, a quarter of the respondents (25.4%, 95% ci : 22.927.8) stated that the practice should continue. among those who adhere to fgm / c abandonment, the practice s negative impact on women s health and welfare was given as the main reason to stop (67.2%, 95% ci : 64.470.0), while violation of human rights was also invoked by 16.7% (95% ci : 14.518.8) of them as a motivating factor. an analysis of data by sex revealed that women show stronger opposition to the practice and less support to its continuation than their male colleagues (21.3%, 95% ci : 18.124.4 vs 29.5%, 95% ci : 25.633.4), bringing these figures along the same lines as the previous study results.7 despite a general tendency toward abandonment, an inter - ethnic analysis unveiled several disparities. although the most support for fgm / c continuation came from hcps belonging to ethnic groups with higher fgm / c prevalence mandinka (33.1%, 95% ci : 29.037.5), fula (27%, 95% ci : 21.932.8), and jola (24.6%, 95% ci : 17.832.9), it was also among these groups that the major decrease of support to the practice, compared to 2009/2011 results, was found (57.3%, 42.9%, and 39% respectively). despite the fact that most of the hcps demonstrated a certain degree of knowledge on fgm / c s negative impact on health, and that only 14.5% (95% ci : 12.516.5) of the total considered it a good practice, 24.4% (95% ci : 22.026.8) of the respondents (47.2% in 2009/2011 study) declared their intention of having fgm / c performed on their daughters. while these findings may appear paradoxical, they can be understood by considering the social benefits perceived by the respondents. following the same pattern, findings among jola hcps revealed that, although only 18.3% considered fgm / c a good or neither good nor bad practice, 30.5% of them expressed their support to practicing families. also regarding intention of performing fgm / c, remarkable differences by ethnic affiliation were found, with higher percentages among mandinka (31.3%, 95% ci : 26.536.1), fula (28%, 95% ci : 21.934.0), and jola (26.9%, 95% ci : 17.836.0). however, support was not as high as prevalence in any ethnic group, and a huge decline in this rate was highlighted in contrast to 2009/2011 figures (mandinka, 64.3% ; jola, 47.5% ; and fula, 43.6%). when cross - referencing the data according to sex, some divergences were found, with special emphasis on mandinka women, whose intention to perform fgm / c on their daughters was half when compared to men from the same ethic group (34.9% vs 65.1%). a very small presence of discriminatory attitudes toward women and girls not undergoing fgm / c were reported by both men and women. regarding strategies to prevent the practice, the introduction of an alternative ritual avoiding any mutilation was supported by a significant 72.2% (95% ci : 69.774.8) of the hcps surveyed. moreover, almost all of the respondents (90%, 95% ci : 88.391.7) agreed on the need for men to take part in the debate, while religious leaders involvement showed less support (67.2%, 95% ci : 64.470.0). non - practicing ethnic groups showed more optimistic predictions about the feasibility of abandoning fgm / c in the country (serere, 79.3%, 95% ci : 67.287.7 ; wolof, 68.1%, 95% ci : 59.275.7) than traditionally practicing communities, who were more reluctant to this possibility (mandinka, 52.6%, 95% ci : 48.057.2 ; jola, 55%, 95% ci : 46.163.6). regarding social actors participating in the process of social change, 93.7% (95% ci : 92.395.1) stated that hcps have a key role to play in preventing fgm / c. however, a significant percentage of hcps (28.7%, 95% ci : 26.131.3) saw medicalization as a means of controlling and making the practice safer, with men showing more support than women (35.6%, 95% ci : 31.539.8 vs 23.3%, 95% ci : 20.026.6) ; and more students than health professionals considered fgm / c medicalization safer (31.7%, 95% ci : 28.335.0 vs 23.4%, 95% ci : 19.327.5). despite a general decrease in its support, medicalization was found to remain more accepted among fula (36%, 95% ci : 29.942.0), mandinka (33.7%, 95% ci : 29.338.1), and jola (29.9%, 95% ci : 21.638.3). this study explored hcps practices regarding fgm / c through the design of specific questions addressing the prevalence of the practice among their families, as well as focusing on whether and to which extent fgm / c is medicalized. as shown in table 4, a total of 71.5% (95% ci : 68.974.0) of hcps reported that fgm / c is practiced in their family or household, this rate being in line with the national prevalence in the gambia (76.3%). when this was examined according to occupation, results indicated lower prevalence among students families than among health professionals families (69.3%, 95% ci : 66.072.5 vs 75.4%, 95% ci : 71.479.4). an intra - ethnic analysis of these data revealed that fgm / c was most commonly performed among serahuleh communities (90.9%, 95% ci : 78.6100.0), followed by mandinka (89.6%, 95% ci : 86.992.4), fula (85%, 95% ci : 80.689.4), and jola (79.5%, 95% ci : 72.386.7), whereas traditionally non - practicing ethnic groups had lower fgm / c prevalence rates (serere 43.3%, 95% ci : 30.756.0 ; wollof 23.4%, 95% ci : 15.930.9). these figures follow the same pattern as the latest available data on fgm / c prevalence according to ethnicity,7 strengthening the robustness of the study outcomes. regarding the question of having ever performed fgm / c, 10.5% (95% ci : 7.913.7) of hcps declared to have performed it during their medical praxis (only working health professionals responses were considered in questions referring to medical praxis, as considered not applicable for health care students). a subject of ongoing debate in the country, this study found that, despite men embracing medicalization in higher percentages than women, the act of medicalizing fgm / c is much more frequently carried out by female (12%, 95% ci : 8.516.7) than male hcps (6.2%, 95% ci : 3.510.8). besides, an inter - ethnic insight raised extreme discrepancies among those who declared to have performed it, as 10.6% (95% ci : 6.716.3) of mandinka, 10.6% (95% ci : 4.622.6) of jola, 9.5% (95% ci : 3.822.1) of wollof, and 7% (95% ci : 3.214.4) of fula hcps admitted to have carried out the practice as health professionals, while 0% of serere did. despite holding almost universal fgm / c prevalence, serahuleh hcps surveyed in this study showed very low rates of medicalization, which could be related to the circumstances surrounding the procedure in their community, commonly carried out in babies by traditional female practitioners. to explore dissonances among hcps kap regarding fgm / c, data disaggregation by occupation, sex, and ethnicity allows an accurate analysis of the reasons for the results obtained. regarding knowledge in contrast to 2009/2011 results, the great majority of participants invoked tradition as the main reason for the practice s perpetuation, showing a clear break with religious motivations based on the misconception of fgm / c being a religious duty (53.8%). this fact is still more striking when considering that any ethnic group assumed religion as the main justification to legitimize the practice, while in 2009/2011, fula and mandinka hcps cited this link as the primary reason to encourage fgm / c continuation. this swap can be considered a result of the effort to disassociate fgm / c from islam through the implication and sensitization of religious leaders in fgm / c prevention initiatives that have taken place in the gambia during the last several years. in addition, hcps extensively recognize fgm / c as a human rights abuse, with almost 80%, especially women, being aware of fgm / c violating fundamental rights. in contrast, the false perception of a current law prohibiting fgm / c in the country is shared among almost half of the respondents, with special support from female hcps. while more knowledge regarding the human rights framework is related to human rights - based approaches fostered in the gambia, general misunderstanding of national legislation can be associated with muddled speeches delivered during some of the anti - fgm / c campaigns that could have contributed to driving the practice to private settings under fear of prosecution. the recognition of fgm / c implications by hcps is considered an essential condition for them to provide adequate health care assistance to women already living with the complications, as well as to promote prevention. in this sense, findings demonstrated that 98.5% of hcps are aware of the practice having consequences, whose recognition has increased when compared to the 2009/2011 study (97.9%). these results suggest that capacity - building strategies have had a positive impact on the acknowledgment of hcps in the gambia, where systematic training campaigns specially focused on the health sector may have enhanced specific knowledge on fgm / c and health.20 in addition, while intra - sex and inter - ethnic analysis showed no significant differences with reference to knowledge, an inter - occupation insight indicates that students are better equipped to recognize sexual consequences, possibly due to fgm / c inclusion in the academic curricula of all health schools nationwide, and because of sexual education and hiv / aids awareness raising campaigns, which would explain why sexually transmitted diseases remain the most commonly identified fgm / c risk. according to the study results, hcps exhibit positive attitudes towards fgm / c prevention, with almost three out of four willing to stop the practice, and considered a harmful procedure by the great majority of them. linked to the increase in knowledge on the negative effects,21 the opposition to fgm / c is particularly noticeable among female hcps, whose low degree of support for the practice (21.3%) contrasts the 64.2% of women who, according to the latest available data by unicef, think fgm / c should continue in the gambia, thus suggesting that health professional identity could have a strong influence on shaping attitudes toward fgm / c. other indicators of favorable shifts in hcps position are the wide support of legal mechanisms to prevent the practice and an initiation without cutting alternative, as well as the effective incorporation of social actors in the debate on fgm / c. while the 2009/2011 study reflected strong resistances of female hcps to the inclusion of men, this is consistent with a kap study on gambian men,10 concluding that those aware of fgm / c s negative impact with special focus on sexual complications affecting both partners wish to get involved in its prevention. these findings describe an opening - up of the fgm / c debate and lower rates of discriminatory attitudes towards those who decide not to undertake the practice. this indicates that the sense of social obligation and peer pressure regarding fgm / c is low and decreasing among hcps. moreover, respondents position themselves in the front line of fgm / c prevention efforts, as the vast majority declared they have a key role to play, thus revealing a substantial increase from 2009/2011 findings (73%) and a growing recognition of fgm / c as a public health issue in the country. however, paradoxical findings highlight that over 25% of hcps still embrace the continuation of the practice, with similar rates of intention of subjecting their own daughters to it. a concerning rate of support for fgm / c remains among hcps, although data tracking over time demonstrates a reduction of its support by half when compared to 2009/2011 results, with 42.5% of hcps declaring they wanted the practice to continue. in line with this declining pattern, the study shows that medicalization is less favored than in 2009/2011, although it is still supported by almost 30% of the respondents, who regard medicalization as a means of controlling the practice and making it safer. this perception, opposing any professional ethics code and publicly condemned by who, was mostly shared by traditional practicing groups that regard fgm / c as a religious obligation, while non - practicing groups showed their support to stop medicalization at all levels. therefore, an inter - ethnic analysis reveals that those who link fgm / c to religion might show higher resistance to its abandonment, and tend to perceive medicalization as a way of maintaining the practice while reducing the incidence of its consequences. indeed, the record of improved knowledge and attitudes in contrast to relatively large support for fgm / c continuation and significantly increased medicalization rates puts the focus of this study on hcps practices. as observed, fgm / c is not homogeneously performed, and ethnicity remains a determinant factor in its prevalence, prevailing over professional identity. therefore, hcps from traditionally practicing groups are more likely to support its continuation and to subject their daughters to it. likewise, the study s overall prevalence rate is slightly lower than the national rate and shows a decreasing tendency among younger generations. compared to the baseline established by the 2009/2011 kap study, findings demonstrate that hcps are more equipped with knowledge regarding fgm / c, not only being able to list its risks in the theoretical arenas, but also recognizing a patient suffering fgm / c consequences during their professional praxis. this indicates a significant improvement in the quality of the health care services they provide, which might be as a result of training initiatives focused on strengthening their capacity to prevent fgm / c. despite this progression, analysis by sex unveils enormous disparities, demonstrating that female hcps are almost three times more able to identify fgm / c effects in a patient than male professionals (in comparison to 2009/2011 results which reported 7.6% of medicalization among hcps in rural areas), thus confirming that medicalization not only remains a reality in the gambia, but has become an increasing phenomenon in its public health services moreover, these results highlight the need for mechanisms for hcps to be able to successfully transfer theoretical knowledge into practice. with regard to medicalization, increasing attitudes of opposition are in contrast with increasing rates of hcps performing it within their professional practice. these results reveal discrepancies between attitudes and practices, especially significant under an analysis by sex as, despite manifesting less support, the percentage of female hcps declaring to have performed medicalization is almost twice the males average. these findings suggest that female hcps could be facing higher demand to medicalize the practice, and that, even when brought to the medical setting, fgm / c is regarded as a women s issue to be performed by women to women. when exploring kap regarding fgm / c among hcps, significant differences by occupation, sex, and ethnicity draw the patterns of the practice s new tendencies. evidence provided by this study confirms that a gradual disassociation between fgm / c and the traditional ritual is occurring in the gambia. similarly, the overall support of the practice seems to be declining in a national context of wider debate on the subject, where preventive interventions may have had a positive impact in deconstructing beliefs linking fgm / c to male circumcision and religion. in this slow transformation, men are more eager to take part and hcps are aware of their decisive role in preventing fgm / c, which is regarded as a public health issue. in the analysis of the interconnection between kap regarding fgm / c, indeed, the study reports more information on fgm / c s negative consequences as the main reason to support its abandonment among hcps, who, despite a need for improvement of the practical recognition of consequences in patients, demonstrate better skills to understand, manage, and prevent fgm / c as part of their professional duty. nevertheless, remaining resistances embracing the continuation of the practice suggest that internalization of the health risks is not the only factor involved in the effective change towards prevention. since 2009/2011, hcps attitudes have moved to more favorable positions regarding fgm / c abandonment, with women leading this trajectory and taking a firmer stand against its continuation. although male hcps are stronger supporters of the practice, they manifest increasing willingness to take part in its prevention, indicating that the gap in female and male positions toward fgm / c is narrowing. despite sex and professional identity variables being relevant to the interpretation of some of the results, ethnicity is confirmed as the prevailing factor molding attitudes and practices. in this sense, ethnic identity may influence and overlap with other variables of fgm / c, and the multidimensionality of the issue stresses the need to design and implement holistic interventions, formulated according to local realities that take into consideration differences among population groups. from a preventive perspective, while knowledge and attitudes regarding fgm / c follow a general trend towards improvement, hcps practices do not mirror the same pattern, and our findings do not describe a one - way linear sequence between kap in the study area. however, higher rates of awareness and favorable attitudes suggest that gambian hcps might potentially be prepared for behavior change towards abandonment. in these circumstances, the motivational balance of hcps should be further assessed to understand which factors prevent them from acting in accordance with their individual inclinations, as well as to provide tools and support for the universal integration of fgm / c preventive strategies within their professional activity in the public health system. this study also shows that fgm / c medicalization is increasingly performed by hcps in the gambia. in this regard, figures on female hcps opposing it but, at the same time, performing fgm / c as health personnel, suggest they are dealing with a certain degree of pressure from families demanding the practice to be performed on patients. in view of this situation, there is a critical and urgent need to provide exhaustive information on medicalization rates in the country almost not reported in the latest available data of international bodies as well as to explore the reasons and motivations for hcps to perform it. similarly, it is extremely important to clarify confusing messages and address arguments that reinforce the idea of medicalization being a solution to fgm / c. in this sense, evidence on kap of hcps must be made explicit and public to influence peers perceptions, and must be used to design appropriate prevention strategies based on hcps legitimacy towards an actual and stable abandonment of fgm / c in the gambia.	backgroundfemale genital mutilation / cutting (fgm / c) is a harmful traditional practice that affects two out of three girls in the gambia, seriously threatening their life and well - being with severe health consequences. by tracking the reference values established in former research conducted between 2009 and 2011, the objectives of this study are to explore trends and to measure and assess changes in knowledge, attitudes, and practices regarding fgm / c among health care professionals (hcps) in the gambia.methodsa cross - sectional descriptive study was designed to collect and analyze data from an overall stratified sample consisting of 1,288 hcps including health professionals and students throughout the six regions of the gambia. data were collected by the implementation of a self - administered written knowledge, attitudes, and practices questionnaire between 2012 and 2014.resultsthe results of this study showed that 76.4% of hcps are eager to abandon fgm / c, and 71.6% of them regard it as a harmful practice with negative consequences on life and health. hcps reported more knowledge and favorable attitudes towards fgm / c abandonment, being better able to identify the practice, more aware of its health complications, and more concerned in their essential role as social agents of change. however, 25.4% of hcps still embraced the continuation of the practice, 24.4% expressed intention of subjecting their own daughters to it, and 10.5% declared to have performed it within their professional praxis.conclusionfindings confirm progress in knowledge and attitudes regarding fgm / c among hcps, who are better skilled to understand and manage the consequences. nevertheless, discrepancies between information, intention, and behavior unveil resistance in practice and proves that fgm / c medicalization is increasing. thus, there is an urgent need to support hcps in the integration of fgm / c preventive interventions within the public health system, to address arguments favoring medicalization, and to use data to design appropriate strategies.
yogurt is a fermented milk product widely known and appreciated for its beneficial effects on consumers health. to obtain a first - rate yogurt, excellent quality raw materials and production techniques that follow the good manufacturing practices its shelf - life could be established based on microbiological data and the use of other parameters such as sensory analysis, aw, ph and titratable acidity (mataragas., 2011). chemico - physical and microbiological modifications of yogurt until the expiry date, which can vary from 20 to 40 days from the date of production, can cause undesired changes in the organoleptic properties of the product (colour, odour, flavour and texture). for this reason, correct storage conditions until the end of shelf life is essential for the maintenance of product characteristics. the alteration of dairy products such as yogurt is mainly linked to the development of specific spoilage organisms (ssos) such as yeasts and moulds. the deterioration of yogurt by yeasts is generally identified by the development of abnormal flavours, yeast odour and co2 production with consequent swelling of the lid heat - sealed when used (vallone., 2001). in absence of specific guidelines in the italian legislation, some authors report that yogurt cultures (lactobacillus delbrueckii subsp. bulgaricus and streptococcus thermophilus bacteria) should be alive and viable until the time of consumption and in quantities not less than 10 cfu / g (health ministry, 1972). the decrease in ph caused by the production of lactic acid is one of the desirable effects of the metabolic activity of lactic acid bacteria. in fact, the main benefits of yogurt are related to its acidity : the production of lactic acid from lactose can allow the consumption of this product also by lactose intolerant consumers ; moreover, it promotes the absorption of calcium and minerals (al - kadamany., 2002 ; mataragas., 2011). the analysis of the aspects described above is essential to determine the conditions of conservation and define the length of shelf - life period of yogurt. the aim of this work was to analyse some microbiological, chemico - physical and organoleptic parameters in samples of sheep milk yogurt produced in a short supply chain farm, during the shelf - life declared by the dairy farmer. five samples of a sheep milk yogurt of the same lot, collected from a short supply chain ovine dairy farm of the roman province, were analysed. the yogurts stored at 4c were examined in 5 sessions of analysis : at 2, 14, 30, 35 and 40 days from the production date. the following microbiological analysis were performed : enumeration of characteristic microorganisms of yogurt (iso 7889:2003 ; iso, 2003a), identification of lactobacillus delbrueckii bulgaricus and streptococcus thermophilus (iso 9232:2003 ; iso, 2003b), enumeration of enterobacteriaceae (iso 21528 - 2 : 2004 ; iso, 2004a), enumeration of yeasts and moulds at 25c (iso 6611:2004 ; iso, 2004b). the identification of the isolated microorganisms was performed using miniaturised biochemical tests (api chl biomerieux, api c aux biomerieux and api ne biomerieux ; biomrieux, marcy letoile, france). dna was extracted from bacterial colonies by using boiling method and subjected to pcr using primers and reaction conditions reported in the literature for the identification of streptococcus thermophilus (fortina., 2003), lactis (torriani., 1999), and a geneamp pcr system 9700 (applied biosystems, carlsbad, ca, usa) machine. amplified products were visualised on 1.2% agarose gel containing gel red in trisacetate - edta 1x by using a uv - transilluminator. in each analysis session, the organoleptic acceptability of each sample was evaluated by criteria such as discolouration, mould formation, off - odours, abnormal flavours and texture. the ph of each sample was measured with a mp225 ph meter (mettler toledo inc., leicester, uk) with a probe for the detection of the temperature and electrode combined as follows : once the sample reached 25c, the determination of ph was performed repeating the measurements in duplicate for each sample. the same analyses were also performed on a single sample of bulk milk collected from the same farm. the analysed product maintained an almost constant amount of lactic acid streptococci (on the order of 10 cfu / g) until the end of the declared shelf - life (figure 1). the concentration of lactobacilli remained almost constant until the end of shelf - life (with a concentration on the order of 10 cfu / g), followed by a slight decrease after the expiry date (figure 1). concerning lactic acid bacteria, on the totality of the bacterial strains identified as lactobacillus delbrueckii subsp. bulgaricus and streptococcus thermophilus, there was a 100% concordance of results by using biochemical and pcr methods. the concentration of enterobacteria was found to be < 10 cfu / g in all samples. the presence of yeasts was detected starting from 14 days after production, with a concentration of 40 cfu / g ; during the subsequent analyses they increased, until a concentration of 10 cfu / g at the end of the shelf - life. the result of the yeast typing on the isolates revealed the presence of candida famata species only. the presence of moulds was observed starting from 30 days of production (expiry date of the product) at a concentration of 4.310 cfu / g. overall, the microbiological analyses performed during the shelf - life period revealed a modest increase of undesirable microorganisms such as yeasts and moulds, with a constant concentration or a slight decrease in lactic acid bacteria. from the examined yogurts and from the bulk milk sample as well, the presence of ralstonia picketii, i.e. a contaminating microorganism probably of environmental origin, was detected. the organoleptic characteristics of the products remained unchanged until the end of the declared shelf - life. therefore, the presence of yeasts and moulds produced no substantial organoleptic variations up to 30 days from the production date. however, a bitter / cheese flavour and an acrid smell was perceived in the yogurts after the expiry date of the product. the ph values measured from the examined yogurts showed minimal variations until the end of the shelf - life (from 4.56 to 4.61), while a decrease (until 4.35) occurred after the end of shelf - life (figure 2). as reported in the literature, our results showed that the process of deterioration in yogurt is due primarily to the development of ssos, such as yeasts and moulds ; these organisms are able to ferment lactose and sucrose also at refrigeration temperatures and low ph values. the presence of these organisms can be determined by : addiction of characterising ingredients, such as cereals, fruit not properly pasteurised ; application of improper production and/or storage practices ; use of inadequate raw materials. in this case, it is important to evaluate the starting microbiological quality of the milk (mataragas., 2011). only in very few cases the source of contamination of yogurt are the starter cultures ; thus, a correct monitoring of the production and storage areas of the products is pivotal. good sensory characteristics and an almost constant concentration of lactic acid bacteria were maintained during all the commercial life of the products. predictive models might be useful to study the process of deterioration of yogurts by contaminants. such information could be extremely relevant for dairy farmers to determine a suitable shelf - life of their products (al - kadamany., 2002 ; mataragas., 2011 ; sofu and evinci, 2007). in order to evaluate meaningfully chemical - physical and microbiological modifications during the shelf - life period of this product	aim of this work was to analyse some microbiological, chemico - physical and organoleptic parameters of sheep milk yogurt during and after its declared shelf - life. five samples of a sheep s milk yogurt of the same lot, collected from a short supply chain ovine dairy farm of the roman province, were analysed. declared shelf - life of the product was 30 days. the products were examined at 2, 14, 30, 35 and 40 days from the production date, performing the following microbiological analyses : enumeration of i) colony - forming units characteristic of the yogurt, ii) enterobacteriaceae, iii) yeasts and/or moulds at 25c. microbiological identification was performed by miniature biochemical tests and for the lactic acid bacteria also by pcr. at every test interval, evaluation of organoleptic parameters and ph was also performed. the analysed product maintained an almost constant amount of lactic acid bacteria until the end of the declared shelf - life. concerning lactic acid bacteria, a 100% concordance of the results observed by using biochemical identification methods and pcr assays was obtained. after 14 days from the production, the presence of yeasts (candida famata) was revealed, while the presence of moulds was detected after 30 days. ralstonia picketii, an environmental microorganism, was also isolated. the results obtained in this study indicate that yogurt spoilage is mainly due to the growth of specific microorganisms of spoilage, such as yeasts and moulds.
validated animal models and tests are crucial for understanding the pathogenesis and treatment of mood and anxiety disorders. this contribution is about the exposure of rodents to a forced swim stressor, which was originally designed by porsolt. the so - called forced swim test (fst, see box 1) is based on the observation that when rats or mice are immersed in a beaker of water from where escape is not possible, they display a progressive increase in the frequency and duration of episodes of immobile floating after initial attempts to escape by swimming, struggling, climbing, or diving. in a retest the animals show the acquired immobility response almost immediately ; the total time spent immobile and/or the duration of time until the transition from active to passive behaviour are the read - out parameters of this test. in mice a single session is often applied, which obviously excludes the retention of acquired immobility used in the test - retest design as criterion. the test appeared highly reproducible among different labs, lasted only 2 days, and was applicable for high - throughput [57 ]. however, an unfortunate aspect is the anthropomorphic interpretation of the rodent 's progressive immobility during the fst as lowered mood or despair and giving up hope to escape, which is highlighted as a depression - like phenotype [24, 6 ]. with the advent of mouse mutants carrying genetic modifications hence, a dramatic increase occurred in the number of papers reporting in rodents the depressogenic effect of genes (see figure 1), often in a context of early life adversity as well as later life acute or chronic exposure to stressors of all kind. in 1985 one paper per month was published that reported the results from the fst, today this number amounts to one per day. for discussions of the rodent 's forced swim performance as a measure for depression we refer to a series of excellent articles elsewhere [57 ]. for a critical evaluation of animal models for depression,, we presented an analysis of current interpretations of fst behavior. the data for this analysis consisted of random samples of the 4,300 pubmed listed papers in which the use of the fst was described. we found that the papers in which the fst was used to identify a depression - like phenotype amounted to around 2,020. rapidly declining over the years (now in total 1,980 papers) was porsolt 's original fst application of the test for identification of a compound 's antidepressant potential. in about 820 papers we further estimated that in 320 studies the fst was used for phenotyping genetic mouse mutants. finally, in about 300 papers, and rapidly declining over the years (see figure 1), the progressive immobility was interpreted as a learning process. these 300 studies demonstrated that the outcome of the fst in the test - retest paradigm could be altered by interfering with acquisition, consolidation, and retention of the immobility response [9, 10 ]. in this contribution to the many faces of stress issue, the progressive immobility that is acquired during the fst is presented as a passive behavioural style of the rodent to cope with the situation that escape from the beaker is not possible. in the first section of this paper we will sketch the transition of active (swimming) to passive (immobility) behaviour as an adaptive learning process that contributes to survival by conserving energy, likely evolving from millions of years of evolution. we will highlight recent reports on the transition from active to passive behaviour and how this adaptive response is stored in memory. it appears that glucocorticoids as well as antidepressants are capable to affect the ability of rodents to consolidate the learned immobility response [9, 11, 12 ]. in the second section we summarize the corticosteroid receptor balance concept of health and disease and discuss its implications for immobility learning and memory storage. this includes the selection of the appropriate coping style involving cognitive flexibility and executive dopaminergic functions [1416 ], pharmacological experiments to identify the brain sites of mnemonic action of the corticosteroids [17, 18 ], and a possible epigenetic mechanism as discovered by reul. we also will discuss the effect of a chronic stress history on the rodent 's performance in the fst. we conclude, in the third section, with the notion that synthesis is possible according to the knowledge gained on corticosteroid action in limbic brain and dopaminergic executive functions. hence, the rodent 's response to an acute forced swim stressor provides an excellent opportunity to investigate the mechanism underlying stress coping and adaptation that contributes to survival. it is of interest to read the original articles of porsolt. and of hawkins hawkins. agreed with using the fst as innovative antidepressant screening tool but dismissed porsolt 's notion that immobility in the fst represents despair. hawkins. noted by carefully monitoring the switches between swimming, headshaking, struggling, diving, climbing, and floating that the progressive immobility at the end of the 15 min initial test is an adaptive response without the energy expenditure required in swimming. at retest, 24 hours later, a similar level of immobility is immediately resumed. moreover, the rats appeared at retest less emotional, observed as a lower amount of emotional defecation, which according to hawkins supports the idea that having been rescued on day 1, the rats were less fearful on day 2. in reply porsolt maintains the position that the immobility response in the fst measures lowered mood and despair and acknowledges that the procedure is not a model for depression in the rat but reflects some aspects of depressed mood. in addition, porsolt mentioned that also electroshocks, the treatment of choice when more conventional methods fail in alleviating the symptoms of depression, readily led to decreased immobility scores in the fst mimicking the effects that are observed after administration of pharmacological antidepressants. in 2009, castagn and colleagues stated that the fst is not a model for depression because the dependent variable is the response to the acute forced swim stressor rather than the phenotype of the animal. since there is no sign or symptom of depression modeled in the fst it lacks face validity. also construct validity is absent since the pathogenesis of depression is a slow process that is often, but not always, precipitated by the inability to cope with the stress of life. indeed in many experiments animals are subjected to a chronic stress paradigm with or without a genetic mutation and then the fst is used incorrectly to model depression. the fst shows predictive validity where it concerns the testing of antidepressant potential of compounds. this validity criterion is without evidence of the mechanism how antidepressants affect the switch from active to passive behaviour. rather, the antidepressants that disrupt immobility in the fst acutely take several weeks before they are clinically effective in a depressed patient suggesting that also this predictive validity of antidepressant action in the fst gives little insight into any pathogenic mechanism. besides, antidepressants affect multiple functional domains beyond mood, including memory and appetite that potentially could have an effect on fst performance. for instance drugs like amphetamine, which is not an antidepressant, enhance locomotor activity and prevent the switch to immobility [3, 4 ]. also the gaba - a agonist muscimol, barbiturates, benzodiazepines, and anticholinergic agents have been coined as false positives (see de pablo. for an overview)., show increased immobility and secrete increased amounts of corticosterone but also are more resilient. widely described antidepressant agents of the ssri type likewise could be regarded as a false negative. furthermore, animals that are familiar to the test are more immobile just as animals that are exposed to water of 19c in the initial test which became more immobile if the water at retest was 25c rather than the original 19c. finally, in a brief report on 2 experiments o'neill and valentino ruled out that the extent of escapability from the beaker of water reflected a measure of despair : the immobility response during retest was identical irrespective of the presence of an escape option. they also demonstrated that the fst is not a learned helplessness model. as students of the fst, more than 20 years ago, we have performed experiments to examine the role of stress hormones in the acquisition and retention of the rodent 's response to the acute swim stressor. we observed the switches between the different behaviours towards longer periods of immobility and that acquired immobility was retained at the 24 hr retest. the retention of acquired immobility may last as long as 4 weeks. in our line of reasoning the switch to immobility behaviour is a successful passive behavioural strategy., which appeared affected by antisense manipulation of the glucocorticoid receptor (gr) in the hippocampus if performed at least six hours before the initial test. (oxford dictionary ; http://www.oxforddictionaries.com, accessed september 5th, 2015) this qualification is somewhat at variance with labeling the passive coping style as a symptom of depression [30, 31 ]. cabib and colleagues [10, 18 ] formulated after a series of elegant experiments using stress - susceptible dba mice in a test - retest design the hypothesis that immobility is the result of extinction - like inhibitory learning involving all available escape responses due to the inescapable / unavoidable nature of the fst experience. other qualifications are that immobility is beneficial in preventing the rats from sinking : rodents that float longer probably live longer. although some of these explanations suffer from anthropomorphism (e.g., despair, depression - like), the switch between the different behavioural (coping) responses towards increased immobility shows what actually is observed when an animal deals with the forced swim stressor. fascinating novel technology currently allows real - time measurement of the transition between active and passive behavioural states with simultaneous in vivo electrophysiological recordings. using these techniques, striking correlates were found between the activity of specific medio prefrontocortical (mpfc) and mesolimbic dopaminergic circuits and the transition between active and passive behavioural states at the 24 h fst retest [15, 30, 31 ]. these transitions were interpreted as representing elements of neuronal encoding and a subsequent decision - making process that is reflected in the behaviours observed in the fst. moreover, using optogenetic activation of specific mpfc and midbrain dopaminergic subcircuits (the former projecting to the dorsal raphe nuclei) the behavioural transitions towards immobility were induced suggesting a causal relationship. tye. tested selective ventral tegmental area (vta) a9 dopaminergic neurons after viral transfection with an enhanced halorhodopsin that shows upon stimulation hyperpolarization and thus dopaminergic inactivation. they found upon avt inhibition increased immobility in the fst, while locomotor responses were not affected. moreover, causal relationships of specific circuit activations during the 24 hr retest occurred in parallel with other putative depression tests such as the fst, tail suspension, and sucrose preference test. interestingly, the same authors demonstrated that acquired immobility, enhanced by a history of chronic stress exposure, could be reversed within seconds by light stimulation of the same dopaminergic neurons transduced with channelrhodopsin-2 to achieve the desired neuronal activation. however, opposite results were reported by chaudhury. ; see for discussion of these studies lammel.. noteworthy is that some of the brain circuits linked to passive - active transitions were also identified (i.e., the nucleus accumbens and medial frontal cortex) as targets for the immediate antidepressant effects of deep brain stimulation. accordingly, these data obtained by optogenetic manipulation of the vta dopaminergic neurons provide strong evidence for a causal relationship with forced swim performance. the vta dopaminergic circuit and its mesocortical and mesolimbic branches have however complex afferent and efferent pathways that operate in multiple feedback loops. cabib and puglisi - allegra have built a compelling case that enhanced tonic mesoaccumbens dopamine activity supports the expression of active stress - induced coping styles, while inhibition of dopamine release is required for passive coping (immobility) in the fst. the latter passive behaviour occurs when a stressful condition is appraised as inescapable and/or uncontrollable. the pioneering research by the grace group (see for an overview) focused in particular on the balance in afferent pathways from the ventral hippocampus and basolateral amygdala which was found to regulate a spontaneous single - spike firing pattern of the vta dopamine neurons. pacemaker is driven by the excitatory outflow of the ventral subiculum hippocampus via the nucleus accumbens, ventral pallidum pathway (see). in agreement with cabib and puglisi - allegra and tye., also grace noted that uncontrollability of the stressor suppressed the mesoaccumbens pathway, while promoting the expression of a passive coping response. reported that rats, adrenalectomised 1 week before the initial test, showed levels of immobility that were similar to controls. the naturally occurring glucocorticoid corticosterone and the synthetic glucocorticoids dexamethasone and ru2362 given subcutaneously 1560 min after the initial test reinstated retention, while mineralocorticoids and progesterone had no effect (see figure 2). as expected the antiglucocorticoid ru486 given prior to the initial test interfered with the glucocorticoid - induced retention of acquired immobility. interestingly, removal of the adrenal medulla, secreting adrenaline and opioids, only transiently interfered with retention, which could be restored by administering synthetic enkephalin analogs. subsequent experiments showed that also thyroid hormone and glucose [38, 39 ] are effective, suggesting interplay between endocrine and metabolic factors during retention of immobility. it is likely that the action of these factors in promoting immobility also would promote conservation of the energy needed to prolong survival, which is actually one of the lessons for sailors in the essentials of sea survival. de pablo. reported a number of well - controlled experiments clearly demonstrating that antidepressants interfere with the consolidation process in the fst (see table 1). using an automatic recording procedure to assess mobility, they demonstrated that during the forced swim experience the amount of immobility increased with repeated experience. exposing the rats to a cylinder with increased water depth led to decreased immobility. finally, antidepressants given after the initial test interfered with consolidation of the acquired immobility response as measured from the rat 's performance at retest 24 hr later. since the protein synthesis inhibitor anisomycin had similar effects as the antidepressants it is evident that effects measured in the fst retest monitor memory storage of the behavioural response acquired at the initial test. the paper by de pablo. is a must read for everyone who uses the test - retest design of the fst. exposure to the forced swim stressor induces a profound response of the sympathetic nervous system, the hpa axis, and also of a variety of neurotransmitter circuits (e.g., dopamine, serotonin, gaba) in the brain [31, 4143 ]. in particular the vta - a9 dopaminergic circuitry has received much attention because of its role in mediating the stress response and in the pathogenesis of stress - related depression and psychosis. indeed, the mesoaccumbens dopaminergic circuit is important for coping with the forced swim stressor. in the forced swim test transitions these transitions serve as measure in the mouse single trial fst as well as in the retest. dopaminergic activity is under control of afferent inputs from limbic areas, that is, amygdala and hippocampus. the naturally occurring glucocorticoids, cortisol in man and corticosterone in man and rodent, are collectively abbreviated as cort here. the hormones, secreted by the adrenals as end product of the hpa axis, coordinate in rhythmic fashion the needs in circadian regulations from food intake to allocation of energy resources. cort also mediates coping with stress in a manner that the hormones prevent the initial reactions to a stressor from overshooting [44, 45 ]. these actions exerted by cort are mediated by mineralocorticoid receptors (nr3c2, mr) and glucocorticoid receptors (nr3c1, gr) [4649 ]. mr and gr regulate gene transcription as nuclear receptors and occur also as membrane variants that are engaged in rapid nongenomic membrane actions [5052 ]. first, mr expression is abundant in limbic structures, notably the hippocampus, amygdala, lateral septum, and regions of the prefrontal cortex where it is colocalized with the ubiquitously expressed gr. second, nuclear mr has a tenfold higher affinity for cort than gr and is therefore always substantially occupied, while gr only becomes occupied after stress and at the ultradian or circadian peaks in circulating cort. third, mr in most brain regions is nonselective : cort and aldosterone have high affinity and also deoxycorticosterone and progesterone bind, the latter as a competitive antagonist. the actions mediated by mr and gr are complementary : in some cells and circuits opposing and elsewhere synergizing [5961 ]. on the cellular level activation of the mr membrane variant (which has a lower affinity to cort than the nuclear mr) by stress stimulates the release of glutamate, which subsequently downregulates the presynaptic glu2/3 receptors [50, 60, 64, 65 ]. with rising steroid concentrations cort suppresses, via the gr, the excitability which is transiently raised by excitatory stimuli. in nongenomic fashion gr promotes the postsynaptic release of endocannabinoids, which inhibit transmitter release presynaptically. on the behavioural level mr and gr mediate distinct functions in the processing of stressful information (see figure 3). the mr mediates a tonic action on the activity of the hpa axis and is important during the onset of the stress reaction because it regulates anticipation, appraisal, response selection, and thus decision - making processes in coping with novel stressful situations. when the stress response develops and cort concentrations rise, the gr becomes progressively occupied which allocates additional energy resources towards the more executive frontocortical functions. primarily the action of cort, mediated by the gr, is aimed to promote behavioural adaptation which terminates the stress reaction. at the same time the outcome of the coping process is stored in memory for future use [70, 71 ]. when the stress reaction subsides the ultradian rhythm resumes allowing to maintain a state of stress responsiveness. this has led to the formulation of the corticosteroid receptor (core) balance hypothesis which states that upon imbalance of mr : gr - regulated limbic - cortical signaling pathways, the initiation and/or management of the neuroendocrine stress response becomes compromised. at a certain threshold this may lead to a condition of hpa - axis dysregulation and impaired behavioural adaptation, which can enhance susceptibility to stress - related neurodegeneration and mental disorders. three types of experiments that link cort receptors to the typical fst behavior will be discussed here. first, it appears that the forced swim stressor itself affects the expression of the cort receptors differentially. it was shown that the acute stressor induced the expression of mr in the hippocampus as early as 8 hr postinjection and the effect appeared maximal at 24 hr after exposure to the forced swim stressor, at the immunoreactive protein level as well as with radioligand binding [72, 73 ]. this mr induction depended on crf, since exogenous crf induced and crf antagonist blocked the stress - induced increase in mr. finally, the crf - induced mr synthesis appeared functional since in prior forced swim exposed rats antimineralocorticoids were much more effective in disinhibiting the stress - induced hpa - axis activity. over a period of several weeks the hippocampal is profoundly downregulated after exposure to chronic stress, however [74, 75 ]. this downregulation of mr was prominent in socially defeated mice that showed increased passive coping. second, gr activation by dexamethasone administration in the low g range to adrenalectomised animals immediately after the initial 15 min forced swim exposure reinstated dose - dependently the deficit in retention of acquired immobility during the 5 min retest 24 hr later. this effect of dexamethasone in the adx rats can be prevented by prior subcutaneous administration of the ru486, or other gr antagonist(s) in doses of 1 and 10 mg / kg [17, 77 ]. intracerebroventricular adminstration of the gr antagonist to intact rats immediate before the initial test attenuated at retest the retention of acquired immobility in a 100 000 lower dose than needed after systemic administration. in a separate experiment one week later the same low ng dose of ru486 icv increased secretion of cort. figure 4 (adapted from) shows that only 1 ng of ru486 administered in the dentate gyrus is sufficient to impair consolidation of the immobility response. similar injections in the nucleus parafascicularis and paraventricular nucleus were ineffective, but the gr blockade in the paravenricular nucleus triggered a profound cort response. promegestone did not interfere with the ru486 action ruling out a role for the antiprogestin properties of the antagonist. the selective mineralocorticoid antagonist ru28318 was not active excluding, as expected, a role of mr in retention of the passive coping style. the exclusion of mr in memory consolidation is further reinforced by the observation that replacement of the adx rats with a high dose of cort occupying both receptor types reinstated the memory deficit of the adx rats, while a lower dose, mainly occupying mr, did not. if gr was blocked with ru486 given systemically at 6 hr (but not at 1 hr) prior to the initial test the percentage of immobility this decrease was already present in the first 5 min episode and persisted in the retest 24 hr later. a similar result was obtained if the synthesis of gr in the dentate gyrus was inhibited by bilateral infusion of 18-mer antisense phosphorothioate oligodeoxynucleotide targeted to grmrna 6 hours prior to testing. likewise daily treatment plus a 1 hr pretreatment with gr antagonists also suppressed immobility at pretest, but this design did not include a retest [78, 79 ]. reduced immobility was also observed at the initial and retest after metapyrone, which blocks the synthesis of adrenal cort. interestingly, these experiments involving blockade of gr or reduction of adrenal output leave mr available for cort action, supporting indirectly a role of mr in coping with the forced swim stressor. colelli. demonstrated different levels of immobility learning in dba/2j and c57bl/6j mice. in the first experiment both strains showed that the immobility scores in the 10 min initial test were retained in the 5 min retest 24 hr later. immobility scores in the c57 mice were much higher than in the dba. in the second experiment it was shown that the immobility performance of the dba mice correlated, 50 min after initial test, with enhanced expression of cfos in the dorsal striatum, while in the dorsal hippocampus the immediate early gene altered in parallel with c57 immobility. this enhanced activity in the hippocampus aligns with the greater context and spatial memory performance of the c57 that coincides with more cort output than observed in the dba strain. hippocampal mr has a crucial role in the switch from spatial declarative learning towards caudate stimulus response (habit) learning. in the circular hole board test, naive male mice locate with a hippocampal - associated spatial strategy an exit hole at a fixed location flagged by a proximal stimulus. however, if exposed to a stressful context, close to 50% of the mice switched to habit learning associated with hypertrophy of the caudate and atrophy of the hippocampus under chronic stress conditions. pretreatment with an mr antagonist did prevent the switch towards the stimulus - response strategy. these findings are consistent with evidence that during stress a mr - dependent increase in amygdala connectivity underlies the shift from hippocampal spatial learning to striatal stimulus response or habit learning. with regard to coping with the forced swim stressor, mr antagonists administered prior to the initial test are predicted, therefore, to affect immobility learning in the fst. indeed, two studies showed that administration of the mr antagonist spironolactone in rats and mice ([85, 86 ], resp.) reduced the amount of immobility of the animals. in a series of studies reul and his colleagues developed the concept that cort secreted during the initial acute swim stress experience triggers in the dentate gyrus a signaling pathway that activates an epigenetic process underlying increased consolidation and retention of newly acquired stressful information. this mechanism concerned convergence of stress - induced nmda and gr signaling pathways causing in a distinct and sparse neuroanatomical pattern of dentate gyrus neurons histone modifications, chromatine remodelling, and immediate early gene activation [8789 ]. genetic deletion of specific components (i.e., msk1/2) in this pathway appeared to prevent the retention of acquired immobility. the significance of this newly identified pathway has been expanded to the role of epigenetics in morris maze learning, while revealing new interesting twists in their significance for memory consolidation. physical stressors such as pain, cold, heat, and water immersion each have their inputs to directly stimulate the common final pathway to activation of the sympathetic nervous system and the hpa axis. psychological or psychogenic stressors are processed in higher brain regions, potentially using multiple circuits [91, 92 ] illustrating the many faces of stress. however, severe acute stressors can have long - term consequences as well and are of obvious significance as triggers to precipitate an altered phenotype. the acute forced swim stressor has been used for this purpose alone or in combination with another acute single restraint stress exposure [74, 93 ]. such animal models for chronic stress exposure also are based on various protocols, for instance exposure of the animals repeatedly during several days to unpredictable stressors, repeated exposure to the same stressor, or daily social defeat, sometimes with a history of early life adversity [94, 95 ]. the a9 mesolimbic - cortical dopaminergic circuitry is highly responsive to acute and chronic stressors. the responsiveness of this circuitry depends on reciprocal hippocampal ventral subiculum excitatory and amygdala inhibitory inputs including a feedback loop to the a9, but also to the habenular nucleus, dorsal raphe nucleus, basal amygdala, and ventral hippocampus. the circuit has an important function in social and goal - directed behaviour, motivation, pleasure, and reward and is richly endowed with gr. rodents exposed to repeated social defeat by aggression of a dominant animal develop enduring social aversion and increased anxiety as most prominent behavioural adaptations caused by a cort - enhanced positive dopaminergic feedback loop. antiglucocorticoid or gr deletion selectively from the dopaminoceptive neurons reinstated social behaviour linking stress resiliency with dopaminergic tone [96, 97 ]. as mentioned above, in this circuit correlations were found between circuit activity and the passive - active behavioural transitions during forced swim exposure, which could also be induced optogenetically [15, 30, 31 ]. chronically stressed animals likewise show profound changes in neuroendocrine regulations due to an altered phenotype of the crh neurons expressing much more vasopressin as cosecretagogue. this altered reorganization becomes apparent only after challenging the stressed individual with an additional acute forced swim stressor. mice with a stress history exposed to forced swim for 15 min showed much more responsive genes 1 hr later in the hippocampus, and these are particularly genes involved in chromatin modification, epigenetics, and the cytokine / nfb pathway. the change in some of these genes (e.g., bdnf and gr) persisted for several weeks. besides, these genes are related to cognitive processes presumably underlying immobility learning in the fst [9, 10 ]. interestingly, similar cytokine / nfb genomic changes were observed after repeated social defeat. the network also showed overlap with the genomic response to cort applied to rats with a restraint stress history, in this case restricted to the dentate gyrus only. moreover, in the controls 26 different cort responsive gene ontology (go) terms were enriched, whereas this number was only 6 in the stressed group. one highly responsive gene network revealed by this procedure is the mammalian target of rapamycin (mtor) signalling pathway, which is critical for different forms of synaptic plasticity that may underlie the processes of learning and memory. gr is expressed abundantly in the ascending a9 mesolimbic and cortical dopaminergic projection innervating frontocortical and nucleus accumbens target regions, while the limbic structures, notably the hippocampal ca1 and ca2 neurons as well as the dentate gyrus neurons, are richly endowed with both mr and gr. the receptors seem to be involved in acquisition and retention of the immobility response. for acquisition, pharmacological blockade of gr by systemic ru486 administration and locally by gr knockdown in the dentate gyrus 6 hr prior to the initial test decreased the amount of passive behaviour, which was retained in the retest 24 hr later. this effect apparently overrides the small increase in immobility noted after local knockdown of gr in the infralimbic frontocortical dopaminergic target. the consolidation and retention of the passive behavioural response are promoted after gr activation in the dentate gyrus by an epigenetic mechanism that involves a gr - glutamatergic pathway. however, any blockade of the gr in the limbic regions will result in more dominance of cort actions via the mr, which could participate in the appraisal, response selection, and immediate coping ability. such a role of mr has been firmly established in other behavioural paradigms [84, 106 ]. an inevitable consequence of the many faces of stress is the discussion centered around the seminal question : what is stress ? for this reason one of the stress pioneers, levine [107109 ], turned to use an operational definition : stress is defined as a composite multidimensional construct in which three components interact : (i) the input, when a stimulus, the stressor, is perceived and appraised, (ii) the processing of stressful information, and (iii) the output, or stress response. the three components interact via complex self - regulating feedback loops with the goal to restore homeostasis through behavioral and physiological adaptations. what happens during processing of the forced swim stressor in the black box of the rodent 's brain ? the studies by cabib and coworkers, that are summarized in cabib and puglisi - allegra and campus., point to a genetically determined switch between hippocampus and striatal circuits as a determinant in the choice of behavioural style to cope with the forced swim. such an mr - induced switch previously was observed in other behavioural paradigms as well [82, 110, 115 ]. this finding calls for a role of cort acting via mr during stress, which has been shown crucial for appraisal, immediate coping, response selection, and behavioural flexibility. mr was discovered in electrophysiological studies to mediate fast and rapidly reversible membrane actions of cort in hippocampus and amygdala [50, 51 ]. stress levels of the hormone enhance the frequency of miniature excitatory postsynaptic potentials (mepsp) in hippocampal ca1 pyramidal neurons, indicating enhancement of glutamate excitatory outflow from the hippocampus [60, 64, 65, 112 ]. grace highlights an important role of the afferent circuits in processing of contextual and emotion - loaded information that operate reciprocally from the hippocampal ventral subiculum and the basolateral amygdala in regulating a9 dopaminergic activity. this afferent excitatory control would be driving the behavioural expression of accumbens dopamine release as can be demonstrated by coping with the forced swim stressor. the optogenetic experiments by tye. indeed show an executive role for the mesolimbic dopaminergic system in the transitions between active and passive coping, while warden. and then, after the initial test the preferred passive coping style is stored in memory for future use by a gr dependent process in the hippocampal dentate gyrus [17, 19 ]. we refer to figure 5 for some of the elements that may be involved in processing the forced swim stressor in the brain. how hippocampal mr participates through enhanced excitatory transmission in the transition between active and passive behaviour needs to be investigated. that the subsequent rise in cort after forced swim activates gr to promote consolidation and retention of the coping style in the memory is firmly established. for this purpose an epigenetic mechanism underlying consolidation of the acquired immobility furthermore, a history of chronic stress downregulates in particular hippocampal mr [76, 93 ], introducing a bias, which is reflected by altering the genomic response in hippocampus and dentate gyrus to forced swim. part of this response is mimicked by cort action with consequences in the dentate gyrus neurogenic niche [102, 113 ]. floating has been a criterion in the past to judge the witchcraft outcome of forced swim, but today it is in use to label a rodent as being depressed. in fact, the number of research papers that intentionally used the fst to assess a depression - like phenotype has shown a dramatic increase in recent years, now amounting to almost one paper per day. hence, this anthropomorphic interpretation of coping with the forced swim stressor is remarkable, since alternatively the forced swim experience provides a unique challenge to investigate how information processing occurs to achieve stress adaptation. the use of acquired immobility to diagnose depression in a rat should not be encouraged. what we do encourage is to use the forced swim stressor in research on the mechanism of coping and adaptation that counts to understand an evolutionary - conserved energy - sparing survival mechanism of passive coping with an apparent inescapable / uncontrollable situation.	in the forced swim test (fst) rodents progressively show increased episodes of immobility if immersed in a beaker with water from where escape is not possible. in this test, a compound qualifies as a potential antidepressant if it prevents or delays the transition to this passive (energy conserving) behavioural style. in the past decade however the switch from active to passive coping was used increasingly to describe the phenotype of an animal that has been exposed to a stressful history and/or genetic modification. a pubmed analysis revealed that in a rapidly increasing number of papers (currently more than 2,000) stress - related immobility in the fst is labeled as a depression - like phenotype. in this contribution we will examine the different phases of information processing during coping with the forced swim stressor. for this purpose we focus on the action of corticosterone that is mediated by the closely related mineralocorticoid receptors (mr) and glucocorticoid receptors (gr) in the limbic brain. the evidence available suggests a model in which we propose that the limbic mr - mediated response selection operates in complementary fashion with dopaminergic accumbens / prefrontal executive functions to regulate the transition between active and passive coping styles. upon rescue from the beaker the preferred, mostly passive, coping style is stored in the memory via a gr - dependent action in the hippocampal dentate gyrus. it is concluded that the rodent 's behavioural response to a forced swim stressor does not reflect depression. rather the forced swim experience provides a unique paradigm to investigate the mechanistic underpinning of stress coping and adaptation.
our mathematical analysis was based on the following assumptions ; 1) the unstapled side of the operated physis grows as fast as that of the contralateral limb, and 2) the hinge point of angular correction is located at the perichondrium of the stapled physis. the limb length distal to the stapled physis is represented by l, the width of the stapled physis by d, and the amount of angular deformity to be corrected by. the gain of effective leg length resulting from angular correction can be written as and the limb shortening effect due to hemiepiphyseal stapling can be written as from the above two trigonometric formulae, the resultant change in effective leg length discrepancy (elld) is when elld = 0 or when lengthening effect equals shortening effect, equation 1 reduces to ; which can be rearranged to ; in an attempt to validate this equation, a patient database was reviewed from january 1997 to may 2003, and data on those who fulfilled the following inclusion criteria was retrieved : 1) a unilateral angular deformity around the knee joint, 2) an angular deformity only in the coronal plane, 3) no obvious partial physeal arrest, 4) treated by unilateral hemiepiphyseal stapling, and 5) those who were followed up regularly and whose angular deformity had been corrected completely by hemiepiphyseal stapling. among the patients satisfying the inclusion criteria, seven patients had complete medical records and radiographs taken before and after the angular correction. mean age at the time of surgery was 9.7 years (range, 5.8 to 12.8 years). the amount of angular deformity to be corrected () was the angle formed between the mechanical axes of the femur and tibia, which averaged 15.3. the width of the stapled physis (d) and the limb length distal to the stapled physis (l) were measured on a preoperative standing teleradiographs of the lower extremity. change in effective leg length discrepancy was predicted using equation 1, and denoted as elldpredicted. changes in effective leg length discrepancy were also measured on preoperative and post - correction radiographs, and denoted as elldmeasured. first we created a line along the mechanical axis of the femur, and we created second line, that was perpendicular to the first line, from the ankle joint center to the first line. the distance from femoral head center to the cross point of the first and second line was defined as the effective leg length (fig. angular correction was considered to be achieved successfully when the mechanical axes of the femur and tibia were co - linear, which took 17.8 months at average (range, 10 to 28 months). significance was set at p < 0.05. in order to determine the range of l / d ratio in growing children, the width of the stapled physis (d) and the limb length distal to the stapled physis (l) were measured on standing teleradiographs of the lower extremities in twenty seven children, who underwent hemiepiphyseal stapling or percutaneous hemiepiphysiodesis to correct angular deformity, including the six cases above. the mean and standard deviation of l / d ratio were calculated in these twenty - seven patients. our mathematical analysis was based on the following assumptions ; 1) the unstapled side of the operated physis grows as fast as that of the contralateral limb, and 2) the hinge point of angular correction is located at the perichondrium of the stapled physis. the limb length distal to the stapled physis is represented by l, the width of the stapled physis by d, and the amount of angular deformity to be corrected by. the gain of effective leg length resulting from angular correction can be written as and the limb shortening effect due to hemiepiphyseal stapling can be written as from the above two trigonometric formulae, the resultant change in effective leg length discrepancy (elld) is when elld = 0 or when lengthening effect equals shortening effect, equation 1 reduces to ; which can be rearranged to ; in an attempt to validate this equation, a patient database was reviewed from january 1997 to may 2003, and data on those who fulfilled the following inclusion criteria was retrieved : 1) a unilateral angular deformity around the knee joint, 2) an angular deformity only in the coronal plane, 3) no obvious partial physeal arrest, 4) treated by unilateral hemiepiphyseal stapling, and 5) those who were followed up regularly and whose angular deformity had been corrected completely by hemiepiphyseal stapling. among the patients satisfying the inclusion criteria, seven patients had complete medical records and radiographs taken before and after the angular correction. mean age at the time of surgery was 9.7 years (range, 5.8 to 12.8 years). the amount of angular deformity to be corrected () was the angle formed between the mechanical axes of the femur and tibia, which averaged 15.3. the width of the stapled physis (d) and the limb length distal to the stapled physis (l) were measured on a preoperative standing teleradiographs of the lower extremity. change in effective leg length discrepancy was predicted using equation 1, and denoted as elldpredicted. changes in effective leg length discrepancy were also measured on preoperative and post - correction radiographs, and denoted as elldmeasured. first we created a line along the mechanical axis of the femur, and we created second line, that was perpendicular to the first line, from the ankle joint center to the first line. the distance from femoral head center to the cross point of the first and second line was defined as the effective leg length (fig. angular correction was considered to be achieved successfully when the mechanical axes of the femur and tibia were co - linear, which took 17.8 months at average (range, 10 to 28 months). in order to determine the range of l / d ratio in growing children, the width of the stapled physis (d) and the limb length distal to the stapled physis (l) were measured on standing teleradiographs of the lower extremities in twenty seven children, who underwent hemiepiphyseal stapling or percutaneous hemiepiphysiodesis to correct angular deformity, including the six cases above. the mean and standard deviation of l / d ratio were calculated in these twenty - seven patients. equation 2 indicates that effective leg length of the operated limb may increase, remain the same, or decrease after angular correction by hemiepiphyseal stapling, according to l / d ratio and value (fig. 2). if a case is plotted above and right to the curve of fig. if it is plotted below or left to the curve, it will lose effective leg length. with a constant l / d ratio, the larger angular deformity is to be corrected, the more likely is it to increase effective leg length. table 2 shows the preoperative anatomical parameters and changes in predicted and measured effective leg length discrepancies in 6 cases. changes in effective leg length discrepancy which were predicted by equation 1 (elldpredicted) coincided with the actual changes measured on preoperative and post - correction radiographs (elldmeasured), although the amount of changes was not exactly the same. a significant correlation was found between predicted and measured elld 's with correlation coefficient of 0.823 (p = 0.044). the mean of l / d ratio in twenty - seven children was 4.82 with a standard deviation of 0.51. range of l / d ratio within 2 standard deviations was from 5.85 to 3.78. range of value that fulfilled equation 2 with this range of l / d ratio was from 9.9 to 15.6 (fig. equation 2 indicates that effective leg length of the operated limb may increase, remain the same, or decrease after angular correction by hemiepiphyseal stapling, according to l / d ratio and value (fig. 2). if a case is plotted above and right to the curve of fig. if it is plotted below or left to the curve, it will lose effective leg length. with a constant l / d ratio, the larger angular deformity is to be corrected, the more likely is it to increase effective leg length. table 2 shows the preoperative anatomical parameters and changes in predicted and measured effective leg length discrepancies in 6 cases. changes in effective leg length discrepancy which were predicted by equation 1 (elldpredicted) coincided with the actual changes measured on preoperative and post - correction radiographs (elldmeasured), although the amount of changes was not exactly the same. a significant correlation was found between predicted and measured elld 's with correlation coefficient of 0.823 (p = 0.044). the mean of l / d ratio in twenty - seven children was 4.82 with a standard deviation of 0.51. range of l / d ratio within 2 standard deviations was from 5.85 to 3.78. range of value that fulfilled equation 2 with this range of l / d ratio was from 9.9 to 15.6 (fig. epiphyseal stapling is well established as a simple and effective means of controlling physeal growth.7 - 10) by applying staple(s) to one side of the physis angular deformities of a long bone can be corrected. it appears reasonable to conclude that hemiepiphyseal stapling inevitably causes limb shortening because it inhibits physeal growth. this could lead to adopt distraction osteogenesis or open wedge osteotomy instead of hemiepiphyseal stapling in cases with pre - existing limb shortening on the affected side. the inhibition of physeal growth on the stapled side does decrease long bone longitudinal growth to some extent. on the other hand, a significant portion of the length can be restored by correction of an angular deformity. gain of effective leg length by acute angular correction has already been well demonstrated.6,11 - 14) paley explained the lengthening effect of angular correction in terms of the difference between mechanical and anatomical lengths.15) however, angular correction by hemiepiphyseal stapling is different from acute angular correction in some aspects. as it takes time to obtain the attempted correction, physeal growth during that time should be considered. depending on the amounts of each of these contradictory effects, hemiepiphyseal stapling can either increase or decrease effective leg length compared with the contralateral side. however, to the best of our knowledge, no systematic analysis of these contradictory effects has been reported that considered physeal growth and its asymmetrical inhibition by hemiepiphyseal stapling. in the current study, we investigated mathematically the positive and negative effects of hemiepiphyseal stapling on effective leg length. the formula indicates that ; a smaller width of the operated physis, a longer distance from the operated physis to the ankle joint, and a larger angular deformity will increase effective leg length of the operated limb. for example, in case 3, which had the largest angular correction, a relatively small physeal width, but a substantial distance between the operated physis and the ankle joint, effective leg length discrepancy improved to a maximal extent in terms of both predicted and measured values (fig. 3). predicted changes in effective leg length discrepancy in the 6 patients concurred with clinical results. however, the amount of changes varied between the predicted and measured values as the assumptions upon which the mathematical model was based are not always satisfied in reality. the unstapled side of the operated physis, which was assumed not to be affected by any pathologic process, may have some functional (though not structural) defect. moreover, the hinge point of angular correction by hemiepiphyseal stapling is not necessarily at the perichondrium but possibly nearer to the midline of the limb segment. another source of error for this model is that physeal growth of the unstapled side of the operated physis may also be retarded by hemiepiphyseal stapling to some extent.7,16) if this occurs, it would interfere with the length gain effect and subsequently aggravate the effective leg length discrepancy. nevertheless, this study revealed that hemiepiphyseal stapling could improve effective leg length in a certain circumstance. as l / d ratio was found to remain in a relatively narrow range, it is largely influenced by the amount of angular correction whether the effective leg length discrepancy will improve or aggravate. our data suggest that the hemiepiphyseal stapling is likely to lose effective leg length if the amount of angular correction is less than 10, whereas it is to gain effective leg length if it is larger than 16. this should be taken into consideration when determining the surgical method for angular deformity correction in skeletally immature patients.	backgroundthe hemiepiphyseal stapling has both positive and negative effects on effective leg length. the purpose of this study was to analyze change in effective leg length after angular correction by hemiepiphyseal stapling, and to validate in clinical cases.methodsmathematical analysis of a hemiepiphyseal stapling model was conducted. the induced formula was validated in 6 cases fulfilling the assumptions of the model. anatomical parameters involved in this formula were measured in additional 21 cases undergoing hemiepiphyseal stapling or hemiepiphysiodesis.resultseffective leg length increased or decreased according to three parameters in this model : 1) limb length distal to the operated physis (l), 2) width of the operated physis (d), and 3) the amount of angular deformity to be corrected (). actual change in effective leg length of 6 cases similar to this model coincided with the predicted change at least in its direction. l / d ratio was 4.82 0.51.conclusionsconsidering the narrow range of the l / d ratio, hemiepiphyseal stapling is likely to decrease effective leg length if the amount of angular correction is less than 10, whereas to increase it if the amount of angular correction is larger than 16. this should be taken into consideration when selecting the surgical method for angular deformity correction in skeletally immature patients.
aggressive histologic subtypes of thyroid cancer are less frequent and have a worse prognosis than well - differentiated thyroid carcinoma (dtc). most important aggressive subtypes of thyroid cancer are hrthle cell carcinoma (hctc) and anaplastic and poorly differentiated carcinoma (atc and pdtc). now, it is included in aggressive histologic subtypes, because of its biological behaviour. atc could be a de novo tumour or arising from dedifferentiation of dtc. during this process, thyroid cancer could be found in an intermediate differentiation pattern, classified as pdtc. both atc and pdtc have a poor prognosis and efficient diagnostic tools are needed to improve survival. after those about dtc and medullary thyroid cancer (mtc) [1, 2 ], american thyroid association (ata) recently published guidelines for the management of patients with atc. fluorine-18-fluorodeoxyglucose (fdg), a glucose analogue, is the most used positron emission tomography (pet) tracer in oncology. although fdg - pet and pet / ct have a moderate sensitivity for early - stage, well - differentiated thyroid malignancy, they are currently used in dtc, particularly in postthyroidectomy patients with high serum thyroglobulin (tg) levels and a negative radioiodine whole - body scan, as prognostic tool in patients with metastases, for the measurement of posttreatment response, and as selection tool in patients not eligible to radioiodine therapy [57 ]. fdg - pet or pet / ct is also used in recurrent mtc and in thyroid nodules with indeterminate or nondiagnostic fine needle aspiration biopsy (fnab). during dedifferentiation process (from dtc to atc), an inverse relationship between radioiodine (i-131) and fdg uptake in thyroid cancer cells was observed (the so - called flip - flop phenomenon). a recent study highlights that thyroid cancer dedifferentiation is characterized by glucose transporters (glut1) upregulation and reduced expression of sodium - iodide symporter (nis). this is the rationale to propose fdg - pet or pet / ct as efficient diagnostic tools in atc, pdtc, and other aggressive subtypes of thyroid cancer. the aim of this paper is to perform an overview of the literature about the role of fdg - pet or pet / ct in aggressive histological subtypes of thyroid cancer. initially, hctc was included in dtc group, but it has a different oncogenic expression and is now considered as different histological and clinic disease. hctc has a 10-year disease - free survival of 40% and mortality of 51%, worse than dtc. in fact, hctc is associated with a high risk of distant and lymph nodal metastases having a worse prognosis compared to dtc. only few studies about the role of fdg - pet or pet / ct in hctc have been published in the literature. some authors suggested a good sensitivity of fdg - pet in hctc [13, 14 ] and hrthle cell adenoma. overall, hctc seems to be unable to concentrate i-131, but it is an fdg - avid tumour. there were 24 positive and 20 negative fdg - pet scans giving a sensitivity of 95.8% and a specificity of 95%. these authors suggested that fdg - pet could be indicated in patients with hctc in postoperative staging and as followup in patients with an increase of tg or recurrent disease. lowe. studied 14 fdg - pet scans in patients with hctc. pet findings were positive in all but 1 of patients with known disease, with a sensitivity of 92%. moreover, in 7 out of 14 pet scans, a disease not diagnosed by other techniques was demonstrated. in 7 patients, so, these authors concluded that fdg - pet improves staging and disease management in patients with htct. a, patients with an elevated tg level were included (n = 13), and in 10 cases pet scans were true positive. in subgroup b, patients with a suspect morphologic imaging were included (n = 4), and pet scans were true negative in three cases. overall, fdg - pet demonstrated a sensitivity of 92%, a specificity of 80%, a positive predictive value of 92%, a negative predictive value of 80%, and an accuracy of 89% in hctc. overall, fdg - pet or pet / ct seems to be useful functional imaging methods in initial staging or restaging of hctc (figure 1), presenting high diagnostic accuracy in this setting (table 1). atc is a rare and aggressive tumour, representing less than 5% of all thyroid carcinomas and originating by thyroid follicular cells atc is often diagnosed in older patients and usually has a rapid growth and an extensive local invasion [2123 ]. three main histological subtypes of atc are reported : spindle cell, pleomorphic giant cell, and squamous cell subtype. in over 70% of the patients the tumour infiltrates surrounding tissues, and median survival time is about 68 months. in differential diagnosis, it is important to distinguish atc and pdtc. in fact, proportion of atc, pdtc, or dtc characterizing the thyroid tumour can change prognosis and clinical management. this aggressive thyroid tumour is not able to uptake iodine and to produce tg [19, 20, 24, 25 ]. conversely, atc has a high glucose metabolism and high fdg uptake [5, 9 ]. ata recommended fdg - pet and pet / ct in evaluating metastatic patients, especially bone lesions. moreover, fdg - pet may be useful in distinguishing atc from dtc metastases because of the higher fdg uptake of atc. other indications described about fdg - pet or pet / ct in atc were resectability evaluation and followup, with a higher sensitivity than ct alone. fdg - pet is also recommended 36 months after therapy in patients with no disease or in persistent structural disease as a guide to therapy. few original studies have been published about the role of fdg - pet in atc (table 1). poisson. studied 20 consecutive atc patients with fdg - pet / ct for initial staging and during followup. authors analysed progression on imaging followup (ct or pet / ct). per lesion, maximal standardised uptake value (suvmax) and functional volume were a predictive factor for survival. conversely, in bivariate analysis, only functional volume was a prognostic factor. early evaluation of treatment has been done in 4 out of 11 patients in whom pet and ct were both registered. after treatment with combined radiotherapy and chemotherapy, a negative fdg - pet / ct scan confirmed a complete long - term remission. finally, authors suggested the use of fdg - pet / ct in atc during initial staging. among other imaging modalities, only preoperative ct should be requested. fdg - pet / ct could be also recommended in both early and long - term followup and in the assessment of treatment response. pet data were compared with other diagnostic tools (ct, ultrasound, magnetic resonance imaging, bone scan, and histology) and with clinical follow - up. in all 16 patients included, pet records resulted true positive for primary tumours. in 50% of patients these authors concluded that fdg - pet could improve disease staging changing the clinical management of patients with atc. overall, fdg - pet or pet / ct should be used in patients with atc in initial staging and in the followup after surgery to evaluate metastatic disease (figure 2). in selected cases, these functional imaging methods may be helpful in directing treatment and in evaluating the efficacy of therapy. new studies are needed to investigate the role of fdg - pet or pet / ct in detecting the proportion of dtc, atc, and pdtc in the same tumour. pdtc is an intermediate histological subtype between dtc and atc and may be a transition form. conversely to atc, pdtc preserves some markers of differentiation, such as tg and thyroid transcription factor 1 (ttf1), and does not represent a de novo tumour. in dedifferentiation process, pdtc and atc present a growing number of chromosomal alteration, such as ras, braf, tp53, and b - catenin mutations [3, 11 ]. activation of the pten / pi3 kinase / akt / mammalian target of rapamycin pattern and mutation of the akt or pik3ca genes are more common in pdtc and atc than dtc [2629 ]. these metabolic pathways could be related to the different fdg - pet pattern in different subtypes of thyroid cancer. pdtc has an intermediate glut1 expression and fdg uptake between atc and dtc, because of flip - flop phenomenon [9, 30 ]. more often pdtc is an fdg - pet positive tumour [5, 9 ]. an in vitro study suggested that thyrotropin (tsh) increases fdg uptake in pdtc cells ; so, fdg - pet scans under tsh stimulation may be more efficient. surgery and radiotherapy could be indicated in treatment of pdtc but not radioiodine treatment, because of poor radioiodine uptake. some authors suggested the use of fdg - pet or pet / ct in staging patients with pdtc (figure 3), especially in postthyroidectomy staging of high - risk patients. some authors studied the role of fdg - pet in all thyroid cancer subtypes but included only few cases of pdtc in their analysis, not sufficient to conclude that fdg - pet is efficient for this histological tumour type. more preclinical and clinical studies are needed about fdg - pet or pet / ct in pdtc to demonstrate the clinical usefulness of fdg - pet in pdtc. limited experience exists about the role of fdg - pet or pet / ct in patients with more aggressive histological subtypes of dtc, including case reports or small case series in patients with tall cell, diffuse sclerosing [3335 ], solid / trabecular and insular variant of dtc. these articles underlines that fdg - pet or pet / ct seem to be very useful tools for the staging and restaging of such tumours. radioactive iodine - refractory (rair) fdg - pet positive thyroid carcinomas represent the major cause of deaths from thyroid carcinomas and are therefore the main focus of novel target therapies. although the majority of primary thyroid carcinomas leading to rair fdg - pet positive metastatic disease are pdtc, dtc can also be responsible for rair disease. histologic characterization of metastases / recurrence in 70 rair fdg - pet positive thyroid carcinoma patients revealed that 47.1% had pdtc, 20% had tall - cell variant of papillary thyroid carcinoma, 22.9% had well - differentiated papillary thyroid carcinoma (including classic and follicular variants), 8.6% had hctc, and 1.4% had atc. dtc presenting fdg uptake on pet scan and histological features such as necrosis should be considered aggressive differentiated cancers and fdg uptake in these tumours is highly prognostic for survival. from this overview of the literature about the usefulness of fdg - pet or pet / ct in aggressive subtypes of thyroid tumours, we conclude the following : the role of fdg - pet or pet / ct in patients with hctc is clear in initial staging or followup of invasive and metastatic tumours;fdg - pet or pet / ct is recommended in staging, followup, and posttreatment restaging of atc, especially in metastatic disease, as published in ata guidelines;further evaluations are needed to investigate the role of fdg - pet or pet / ct in pdtc, because of the difficulties connected to define the biological behaviour of this aggressive subtype of thyroid cancer;limited experience suggests the usefulness of fdg - pet or pet / ct in patients with more aggressive histological subtypes of dtc;dtc presenting as rair and fdg - pet positive should be considered aggressive tumours with poor prognosis. the role of fdg - pet or pet / ct in patients with hctc is clear in initial staging or followup of invasive and metastatic tumours ; fdg - pet or pet / ct is recommended in staging, followup, and posttreatment restaging of atc, especially in metastatic disease, as published in ata guidelines ; further evaluations are needed to investigate the role of fdg - pet or pet / ct in pdtc, because of the difficulties connected to define the biological behaviour of this aggressive subtype of thyroid cancer ; limited experience suggests the usefulness of fdg - pet or pet / ct in patients with more aggressive histological subtypes of dtc ; dtc presenting as rair and fdg - pet positive should be considered aggressive tumours with poor prognosis.	aggressive histological subtypes of thyroid cancer are rare and have a poor prognosis. the most important aggressive subtypes of thyroid cancer are hrthle cell carcinoma (hctc) and anaplastic and poorly differentiated carcinoma (atc and pdtc). the american thyroid association recently published guidelines for the management of patients with atc, but no specific guidelines have been done about hctc. we performed an overview of the literature about the role of fluorine-18-fluorodeoxyglucose positron emission tomography or positron emission tomography / computed tomography (fdg - pet or pet / ct) in aggressive histological subtypes of thyroid cancer. only few original studies about the role of fdg - pet or pet / ct in hctc, pdtc, and atc have been published in the literature. fdg - pet or pet / ct seems to be useful in staging or followup of invasive and metastatic hctc. fdg - pet or pet / ct should be used in patients with atc in initial staging and in the followup after surgery to evaluate metastatic disease. some authors suggest the use of fdg - pet / ct in staging of pdtc, but more studies are needed to define the diagnostic use of fdg - pet / ct in this setting. limited experience suggests the usefulness of fdg - pet or pet / ct in patients with more aggressive histological subtypes of dtc. however, dtc presenting as radioiodine refractory and fdg - pet positive should be considered aggressive tumours with poor prognosis.
tuberculosis is a bacterial disease, mostly caused by mycobacterium tuberculosis, and for adults, is often with sputum smear positive that it is highly contagious (1). the world health organization observing upward trend of global burden of tb, in the assembly of 1991, announced tuberculosis as a global emergency (2, 3). then provided the background for controlling the disease and achieving to these objectives relatively, by introducing dots strategy (3). the availability of free diagnostic and treatment services, detection through sputum smear microscopy experiments at all levels of nation s health care were the main pillar of the implementation of this strategy. circular of merging control of control programs and care of tb in the network system in 1990 issued by the general office of the fight against disease and was communicated to all provinces (4). then, ministry of health and medical education in 2002, according to international recommendations and the proposed national technical committee, forced all medical universities to implement it (5). studies in different parts of the world suggest that the implementation of the dots treatment increases treatment success rate of 90 - 95% and even greater (4). table 1 showed the tuberculosis case detection statue in the south tehran (2010). according to the latest statistics from the centers for disease control, the incidence of tb in the world in 2013 were 122 cases and 109 cases in the region of iran that is, 21 cases per hundred thousand population (5). 10555 is the total number of tb cases in 2012 and 5334 is the number of smear - positive pulmonary tuberculosis at the current time. tuberculosis is a contagious disease and therefore sources of emissions and the amount of disease in the community is essential (5). currently, the incidence of smear - positive pulmonary tb, is the most important indicator of tb situation in the country (5). according to the latest world health organization report in 2012, more than 12 million people worldwide are infected with tuberculosis that more than 80% of them are associated to 22 developing countries in the world. there are about 8.6 million new cases of active tb, it is estimated that about 1.3 million people will die of this disease. more than 90% of tb cases and deaths occur in developing countries (5 - 9). the tuberculosis case detection statue in the south tehran (2010) quotient of frequency of tuberculosis entry to the country population is called tb incidence rate, that the distribution map of the world countries has been displayed. the tuberculosis incidence and prevalence rate in 2012 is estimated at 122 and 109 respectively in the world population at one hundred thousand people. countries with high hiv prevalence rate, especially those in sub - saharan africa have witnessed a dramatic increase in the number of tuberculosis patients and a significant increase in the number of tb patients and increase 2 to 3 times the rate of incidence reported in the 90s. in 2012, the hiv prevalence rate among tb patients in the world has been estimated to be 13%. at the same time, multidrug resistance, which is resulted of poor management in tb treatment is a serious and growing problem in many countries of the world (5) (table 2). status indicators of tb control program in the world, the eastern mediterranean region and the islamic republic of iran in 2012 the tb incidence rate in 2013 in iran estimated hiv incidence / prevalence in new tb cases sulted of poor management in tb treatment is a serious and growing problem in many countries of the world (5) (table 2). the society in this study includes all tb patients living in the south area of tehran (areas 10 -11 -16 -17 - 19 of municipality) registered in the tb registry of city and online office system of health tuberculosis ministry during 2005 - 2012. statistical reporting of tb cases sent by the public or private sector to health center, is registered in online tuberculosis registration system of ministry of health by coordinator of the tuberculosis in the city, and is treated and monitored by health centers in south tehran, the number of registered tb patients in the study was 1242 patients, and the studied population is chosen because tuberculosis is still in the area proposed as a public health problem and tb incidence rate is one of the indicators of justice in the country. information required after coordination with the relevant authorities of the tb office of south tehran were extracted and evaluated according to the national standards and objectives of the study in registration and analyzing tb patients of ministry of health system. to evaluate this program 17 indicators have been determined by the ministry of health, that according to data from 2005 as well as their importance, 8 index were chosen as variable (the incidence rate of smear - positive, the ratio of smear - positive cases to all cases of suspected tuberculosis, the negative sputum smear at the end of the attack treatment, the success rate of treatment for tb patients, mortality rate of new cases of smear - positive pulmonary tuberculosis, age, sex, nationality) and were analyzed by the sql software of ministry of health system. from the total population under protection of health center of south tehran, 99% are urban and 1% are rural. during 2005 - 2012, 1242 tb cases have been registered and they were treated by dots method. there were 553 cases of new smear - positive pulmonary tb (44%), 222 cases of smear - negative pulmonary tb (18%) and 336 cases of extra - pulmonary tuberculosis (27%), 26 cases of recurrence (2%) and 11 cases of mdr (0.9%). the highest incidence of tuberculosis has been in 2012 (16) and the lowest has been in 2005 (6.7). the highest incidence in smear - positive patients has been in 2005 has been with 6.8, and the lowest has been in 2005 with 3.2. the highest incidence of smear - positive pulmonary tuberculosis has been at the age of 65 years and in men, it has been more (58%) than women. most pulmonary tuberculosis patients have been in the age group of 25 - 34 years and in women, it has been more (55%) than men. median of delay in diagnosing all forms of tb has been 71 days and for smear - positive tuberculosis, it has been 67 days. 53% of recurrence cases has occurred in the interval of less than 2 years after previous treatment of the disease. 49% of patients have been with a history of less than 2 years ago of contact with smear - positive patients. median age of smear - positive patients is 53 and in all cases, it is 48 years. the median age is higher in iranian patients (52) and in non - iranian patients it is 29 years. the sputum smear negativity at the end of the attack and the success of the treatment process has been acceptable. 126 patients (10%) have had a history of risk factor for hiv infection, 40% of this group had been also infected with hiv. 146 children in close contact with smear - positive pulmonary tuberculosis patients have been checked and 7 children with tuberculosis was discovered. from the total population under protection of health center of south tehran, 99% are urban and 1% are rural. in other words 1% of the population is settled in rural areas with low health, and patient detection in this group must be made actively. proportion of detection of patients with smear - positive pulmonary tuberculosis is less than 70% in recent years that indicates, identification of patients is less than the national index. 44% of all registered patients are with smear - positive and 18% smear - negative and 27% with extra - pulmonary smear. according to the assessment indicators of tb program, the proportion of smear - positive pulmonary tuberculosis to all patients with pulmonary tuberculosis have been recorded approximately 65% which, has been at the rate of 69% in the south tehran in 2012. also, the proportion of new cases of smear positive to smear negative pulmonary and extra - pulmonary new cases would be approximately one to one that, above proportion has been at the rate of 7.5 in this study in 2012, that it would be because of failing to identify new cases of smear - positive pulmonary tuberculosis or treatment without exact diagnosis of smear - negative and extra - pulmonary tuberculosis. the present results correspond with arsang s studies in iran with a ratio of 0.6 (11). the highest incidence rate of tuberculosis was in 2012 (16) and the lowest rate was in 2005 (6.7) and has been relatively stable from 2007 onwards. the highest incidence rate of smear - positive pulmonary tuberculosis has been at the age of 65 years and it has more level in men (58%) than women. in 2012, the highest age group with extra - pulmonary tuberculosis has been between 25 to 34 years and it has been more in women (55%) than men. low average age and shows down control measures and higher average age represents a better tb control in the region. according to state evaluation index, proportion of new identified tb cases to all cases of suspected tuberculosis is equal to 5, which is less than 5 in south tehran, this could be due to low quality samples or laboratory errors (5, 12, 13). median age of smear - positive patients is 53 and in all cases it is 48 years. the median age is higher in iranian patients (52) and it is 29 years in non - iranian patients (14 - 17). it can be said that the pattern of patience age in this city is slightly different than in other areas so that in the same studies in arak, the disease in people has occurred over 60 years (12). disease existence at early ages that imposes health problems and a heavy financial burden for families and the health system is one of the major challenges facing the health center of south tehran. the highest incidence rate has been in the population over 65 years, which is evidence of success in tb control (18). the most common organ involved in extra - pulmonary tb is lymph nodes with prevalence rate of 28%, which is consistent with the pattern of other people and reference books (19 - 27). 53% of recurrence cases has occurred during the interval of less than 2 years after the disease previous treatment, 49% of patients have had a history of contact with smear - positive patients less than 2 years ago that, this confirms importance of correct investigation those around the patient for tb detection (27). the negativity rate of sputum smear - negative at the end of the attack stage and the success of the treatment process has been acceptable. 126 (10%) patients have had a history of risk factors for hiv infection, 40% of this group have also been infected with hiv. 146 children in close contact with smear - positive pulmonary tuberculosis patients were investigated and 7 children were discovered with tuberculosis. sputum smear positivity degree in 52.5% of cases has been + 1 (5, 23 - 27). the results showed that, in accordance with global tb statistics, also in the health center of south tehran, the most common form of the disease is pulmonary tb (67.4%). the incidence rate of tb and smear - positive pulmonary tuberculosis cases has had an ascending trend over the period of 2005 - 2012. medan delay in the diagnosis of smear - positive patients has been 67 days, which can be considered as an important factor in the spread of disease. the median age of patients with extra - pulmonary tuberculosis were significantly less than the median age of patients with smear - positive pulmonary tuberculosis. the smear - positive pulmonary tuberculosis incidence in men is higher, but for extra - pulmonary tuberculosis, it is more in women. given that the proportion of hiv diagnosis counseling and testing for tb patients have a risk factor for infection (53%), so checking this group should be considered in terms of hiv diagnosis counseling and testing. sensitization of doctors in the private sector, strengthening and the coordination continuity of reporting, providing feedback to the private sector, and employing new training methods can be appropriate solutions to increase the rate of detection.	introduction : ascendant trend of tuberculosis in the world introduces this disease to be one of the most important infectious diseases in the world. so that every year, 9 million people are afflicted to active tb and about 5.1 million people die of the disease. as the hiv contaminated cases are increased, emergence and spread field of multidrug - resistant tuberculosis (mdr - tb) bacilli has been provided.objective:this study aimed to assess the tuberculosis control program from 2005 to 2012 to determine the overall situation of disease epidemiology and prioritized strategies in disease control program within the south of tehran.materials and methods : this cross - sectional study was extracted and analyzed retrospectively on the basis of records of all tb patients in tb health center and tb software in south tehran in 2005 - 2012 years.results:from the total population under protection of health center of south tehran, 99% are urban and 1% are rural. during 2005 - 2012, 1242 tb cases have been registered and they were treated by dots method. there were 553 cases of new smear - positive pulmonary tb (44%), 222 cases of smear - negative pulmonary tb (18%) and 336 cases of extra - pulmonary tuberculosis (27%), 26 cases of recurrence (2%) and 11 cases of mdr (0.9%). smear - positive pulmonary tuberculosis has included 67.4% of all tuberculosis patients.conclusions:the results showed that, in accordance with tb worldwide statistics, at the health center of south tehran, pulmonary tb is the most common form of the disease (67.4%). the incidence of smear - positive tuberculosis and all forms of tb cases has been an ascending trend over the period between 2005 and 2012.
diabetes, late complications hereof, and diabetic foot ulcers in particular present increasing challenges in terms of amputations, sick leaves, reduced functioning, and escalating financial costs. the patients ' quality of life decreases dramatically with the occurrence of diabetic foot ulcers. currently, most treatment is carried out by nonexperts such as visiting nurses and general practitioners [2, 3 ] despite the fact that studies demonstrate the importance of specialized knowledge in the treatment of chronic wounds [3, 4 ]. to enable the experts to monitor an increasing number of patients more regularly, telemedicine delivery of healthcare and the exchange of healthcare information across distances) has been suggested as a way of creating alternative treatment methods. previous studies have documented coherence between expert assessments of ulcers based on digital images versus live assessment [7, 8 ]. even low - resolution images may sometimes be sufficient [9, 10 ]. digital photographs have also proven valuable in learning situations, for example, when giving directions for wound care. only a preliminary set of experiences exists in using the emerging umts (universal mobile telephony system) technology for telemedicine, for example, for teleconsultations from a moving ambulance, but so far the results are promising. conclusions from other studies demonstrate that expert - guided treatment makes nurses use more advanced wound care remedies with better healing outcomes as a result [2, 3 ] and it leads to increased patient satisfaction through less travel and reduced waiting time [1315 ]. dansky and bowles have even suggested that communicating with the expert over a distance facilitates a more optimal dialog, which empowers the patients who participate more actively in their care planning. furthermore, dansky and bowles found a significant learning curve for nurses and expect that the nurses will become increasingly comfortable and efficient as the technology becomes pervasive [1618 ]. another outcome of the kaiser permanente tele - home health research project was that the patients became more actively involved in attending their own health care needs and the remote visits were characterized as convenient because the patients felt comfortable with discussing personal problems and in receiving care at home. treatment of diabetic ulcers has turned out to be applicable to both synchronous and asynchronous telemedicines. willbright found that telemedicine made the specialist nurse more empowered and enabled to independently develop treatment plans. most of these studies have utilized a static installation in the patient 's home or a store - and - forward solution for enabling the visiting nurse to receive advice from experts. thus, the telemedical solutions have either connected the patient with the visiting nurse, or the visiting nurse with the expert. to a large extent, the treatment can be perceived as collaboration between these three stakeholders (the patient, the visiting nurse, and the expert). for this reason, enabling the three partners to be simultaneously engaged in the communication taking place may increase the extent to which the expert knowledge can be utilized directly in the treatment. furthermore, a direct dialog between people with different perspectives may enable a more holistic view and thereby result in a more tailored treatment. to pursue this goal, we investigated the technological possibilities for supporting a new organization of the treatment where the expert, the visiting nurse, and the patient in collaboration could discuss the situation and plan the treatment. in this article, we present the results of a pilot test, the aim of which was to investigate the possibility of having the expert participating in the home consultations by the use of technology and in cooperation with the visiting nurse and the patient. in this article, we define experts as either a nurse or a doctor specialized in treatment of diabetic foot ulcers in our study located at aarhus hospital, denmark. the visiting nurses referred to in this article are associated with local community centers in the residential area of the respective patients and they were nonexperts in diabetic foot ulcers. we explore the subjective satisfaction of patients and healthcare professionals to test the hypothesis that a telemedical consultation can be a viable alternative to a visit to the outpatient clinic. in order for a telemedical consultation to be characterized as a viable alternative to a visit to the outpatient clinic, all participants must experience the telemedical treatment as satisfactory in terms of (1) the clinicians being provided with sufficient clinical information for clinical assessments and decisions to be made accurately, (2) the visiting nurses feeling supported and secured during the sessions, and (3) the patient being satisfied with the consultations. in the following, the findings related to these three issues are presented. during a 2-year process of participatory design, initial problems and potential solutions in the field of treatment of diabetic foot ulcers were investigated. participatory design (pd) is a research approach, derived from action - based research that is applied to the development of technological and organizational solutions to real - world problems [21, 22 ]. pd is a qualitative study, in which the aim is to have close cooperation with the users during the process in order to ensure that the (technological) result can be understood and handled in practice by the users. in our study, the group of participants consisted of hospital doctors and nurses specialized in diabetic foot ulcers, visiting nurses, patients, and relatives. the pd process contained field studies, workshops with the users, experiments in both laboratories and hospitals, and specification of an electronic ulcer record. the pd process resulted in the creation of a telemedical system for supporting the pilot test carried out during summer 2005. five patients who were all mentally well functioning and following a course of treatment in the outpatient clinic were selected for inclusion by the experts the same hospital clinicians who had participated in the pd process (1 doctor and 3 nurses). after the patients gave informed consent (including permission to film the video consultations), we contacted the management of the patient 's local center to inform about the study and to obtain permission to involve the patient 's visiting nurse. after that, we informed the visiting nurse in more detail and a meeting was set up for demonstration of the technology. the patients were offered 3 consecutive video consultations to substitute 3 visits to the outpatient clinic all conducted by the same team of clinicians. a telemedical course of treatment was initiated by an intensive consultation in the outpatient clinic, where the experts created the patient file in the online ulcer record and uploaded high - resolution images of the ulcer as well as obtaining measurements such as peripheral blood pressure, blood sugar. furthermore, the first of the three telemedical consultations was prescheduled by the researchers with both the visiting nurse, the patient and the hospital experts. the telemedical setup consisted of umts video telephones (motorola a920) and a custom designed online ulcer record. prior to the consultations, the visiting nurse used the video phone to take pictures of the ulcer and transmit them to the ulcer record. as the video phones currently available on the market may not yet provide a sufficient image quality, the images from the phone were supplemented with images from a standard digital camera (nikon coolpix5400). these high - resolution images were uploaded to the ulcer record upon return to the office and therefore not available during the online consultations, but they were used as a safety precaution. (the experts were able to view those pictures later in cases of uncertainty. no changes were made to the assessment or the treatment on the background of these images, however.) at the agreed time of consultation, the visiting nurse made a video call from the home to the doctor and to an expert nurse at the hospital. the experts used (1) the still images and the video stream from the video phones, (2) images from the previous consultation, and (3) the cooperation of the visiting nurse in order to evaluate the ulcer and to prescribe further treatment. after the consultation, the experts wrote their summary of the consultation in the online web - based record. each consultation was video filmed by the researchers both in the patient 's home and at the hospital and transcribed afterwards. after completion of the telemedical experiments, the researchers conducted semistructured interviews of one - hour duration with each of the 5 visiting nurses at their local center and with the patients in their homes (which also involved a relative in 3 out of the 5 cases). furthermore, we conducted a focus group interview with the 3 expert nurses to gain a guided discussion (all expert nurses had been informally interviewed individually after each consultation) and one individual semistructured interview with the doctor. as a final measure to circumvent amicable bias due to the personal presence of the researchers in the interviews, all participants were asked to indicate their satisfaction with every consultation in a questionnaire. the total data material consisted of transcripts of field studies, workshops, experiments, interviews, and video consultations as well as the questionnaires and a specification of the electronic ulcer record. the material was analyzed systematically where data were categorized in themes arising during the analysis, both concerning the participants satisfaction, as described in this article as well as themes described in other articles elsewhere. the 15 consultations were performed as planned. using umts for telemedicine was a challenge. the technical difficulties did not, however, prevent the pilot test to be carried out as planned, and the clinical results of the test are presented in this article. a wide range of clinical situations were encountered ranging from a noncritical healing ulcer to more complicated ulcers, and at one consultation the decision was a hospital admission. in another case, a patient was referred to the outpatient clinic for face - to - face specialist evaluation ; however, the clinical conclusion based on the telemedical consultation remained unchanged. the consultations lasted from 5 to 18 minutes, including the dialogs between nurses and patients and also including scheduling a time for the ensuing video consultation. the course of 3 following consultations for each patient lasted from 2 weeks to 6 weeks. the overall results from the study demonstrate that the alternate course of treatment proved satisfactory from the viewpoint of all 3 stakeholders. the experts were both satisfied with the new course of treatment and they felt secure in being responsible for the treatment performed on a distance. the patients (and relatives) felt secure and characterized the treatment as an improvement because they were able to remain at home. after the consultations, the experts expressed satisfaction with the clinical basis for their decision making. both the information provided in the form of pictures and communication with the patient and the cooperation with the visiting nurse constituted important basis for the experts ' decision making. the presence of the visiting nurse in the patient s home compensates in full for not having the patient in front of you, the doctor said in the interview. by cooperating with the visiting nurse and being precise when asking questions, the experts were able to gather the information they would normally observe themselves, including the color, temperature, and smell of the foot ulcer. the high - resolution images from the digital camera were even better than the human eye as they compared in quality to using a magnifying glass, explained the doctor in the interview. however, as these pictures were uploaded following each consultation, the experts had only access to high - resolution images from the previous consultations at the time of the consultation. for this reason, the less optimal images from the video phones provided the main basis for the decisions, and if these images were not optimal in terms of, for example, lightning or sharpness, the visiting nurse observations were particularly useful. the possibility of comparing pictures of an ulcer from one visit to the next also supported the assessment of healing progress. an important decision to make for the experts was how much responsibility could be delegated to the visiting nurse. the expert nurses had the possibility to get a feeling of the visiting nurses skills and if extra help was needed in carrying out the prescribed treatment. the expert nurse noted that she could value the visiting nurses level of competences just by looking at the way she handled the instruments. these observations lead the expert nurse towards what kind of instruction the visiting nurses needed or what she was able to ask from her. the doctor also assessed the competence of the visiting nurse, and described it in this way : i m used to asking 3 questions and then i can almost grade them (the visiting nurses). in the beginning of the pilot test, the roles of the participants in the telemedical consultations were not defined prior to each consultation. during the pilot tests, a firmer structure for for instance, the experts became more aware of the fact that they had to combine their own views with that of the visiting nurse, and that the consultations were most efficient if one person took the lead. for these reasons, the experts made it a practice to hold a preconsultation to coordinate their impression before hearing the visiting nurse. they were conscious, however, not to put forward their impression at the actual consultation until they had heard what the visiting nurse had to say in order to be able to combine their own impression from the images with the subjective opinion of the visiting nurse. furthermore, the ongoing dialog once connected brings forth issues that have an impact on the decisions, for instance, aspects of the patient s daily living. the direct dialog with the visiting nurse provides the expert with a more detailed knowledge about the patient and the capabilities of the patient s surroundings (e.g., the service levels at the local center). these issues would have been more difficult to pursue in a hospital setting, where the knowledge of the visiting nurse is absent. consequently, in terms of the expert s basis for decisions, the video consultation provided a feasible alternative to a visit in the outpatient clinic ; and in some cases, the decision basis may even be more holistic. the visiting nurses were all positive towards the video consultations, which is in line with previous studies (see, e.g.,). four out of five visiting nurses emphasized that participating in the project had increased their professional skills, by receiving information and instructions from the hospital. in contrast to the situation today, the direct contact with the experts means that a treatment plan may be decided and any discrepancies sorted out immediately. the visiting nurse is also instructed about new treatments which he / she understands more readily on the basis of expert reflections and explanations. in this way, the dialog facilitates a decision process based on mutual understanding rather than the expert giving direct instructions. this ensures that the visiting nurse can relate to the treatment plan, which promotes satisfaction with the cooperation. in the interview, this particular visiting nurse was asked, if she at times took offence by receiving instructions on her professional field. she answered : no, i think there has been room for me to express my opinions if i had had a different opinion i would have had the possibility for discussing it. the visiting nurses also agreed that the treatment procedures would improve when working in a team with the experts. when i work on my own, i sometimes doubt if the treatment is sufficient, or if a doctor should see the ulcer. to be on the safe side i sometimes send the patient to the hospital, but when the patient returns, it is still the same treatment that was prescribed in the first place. this means that i misjudged the situation that would not happen with this set - up. the visiting nurse became the central coordinating actor combining the two roles as the one nurse quoted : with the doctor i find out which treatment is necessary, and with the patient i find out if that is what we need. it (her role) is more here and now, more present. what they need on the hospital is what the visiting nurse can see in the home (quote vn). furthermore, the nurses expressed that the knowledge attained through the cooperation with the experts would also benefit their other patients. in this sense, the telemedical organization could enable more tailored treatment for the individual patient, which ultimately may increase the quality of the treatment. the patients expressed that being able to stay at home during treatment was a great advantage. in consistency with other studies [13, 27 ], patients complain about spending many hours waiting for transportation to the hospital, waiting in the outpatient clinic, and again waiting for transportation home. the video consultation focused not just on the ulcer, but included the patient as well. when the consultation is performed in the patient s home, patients are more self - confident and more apt to ask about personal issues, such as sleeping problems, pain, medication. i find it reassuring it is not always that you get to ask the questions you have when you go up there (to the hospital)it is easier when you are in your home. another patient described the consultation in the following way : the contact between the visiting nurse and the experts is good. they work as a team. by having access to the expert and the visiting nurse at the same time, the patients are able to receive immediate answers to their questions and at the same time follow the visiting nurse getting instructions from the expert. the online dialog was accepted by the patients : it is easier to make contact, when there is a picture, in which you can see the person instead of only a phone. i think the doctor cared for me as a person, he showed interest in me. the patients and relatives felt both satisfied and secured by being treated at a distance. in a few situations, the patients were surprised about how serious problems were taken. for instance, during one consultation a patient had signed up for a midsummer eve arrangement, but the experts found it necessary to rest the foot as much as possible and suggested a wheel chair. in the interview, the patient said that if he had not talked to the expert, i would just have walked to the party. a similar statement was given by the visiting nurse in the interview : i would not have reacted towards the newly arisen blister and, furthermore, i would have treated the blister in a very different way than the one prescribed by the expert nurse. our study indicates that treatment of diabetic ulcers in the home can be effectively supported by means of telemedicine. from the point of view of all three stakeholders (patient, visiting nurse, and expert), the simultaneous dialog facilitates satisfactory means for handling the cooperation and treatment. to the experts, the communication with the patient in his own home environment brings to light personal issues enabling a better and more individual treatment this may also have preventive effects as demonstrated in the case of the person attending the midsummer eve party. contrasting indirect telemedical solutions, where digital images are obtained and forwarded to the expert by email (store - and - forward), our setup allows the participants to informally discuss, reflect upon, and solve discrepancies immediately in order for the treatment decision to be initiated straight away. furthermore, the mobile setup makes it unnecessary to install and maintain equipment in the patient s home. while the studies by, for instance, bowles and dansky investigate online connections between patient and expert directly, without the attendance of the visiting nurse who has the responsibility for carrying out the treatment between the expert consultations, our setup allows both the expert and the visiting nurse to participate actively in the expert consultations. this forges a synergetic combination of the different stakeholders competences. at the same time, the web - based online ulcer record facilitates a more traditional store - and - forward setup, and this study shows that the combination of these two methods is valuable in that the doctor and expert nurse could use the record for obtaining an overview of the situation and history, while at the same time collaborating with the visiting nurse and patient about the present situation. as reported by others [8, 28 ], an important spinoff effect is that the competence of the visiting nurse may increase during this telemedical consultation facilitating the spread of knowledge from expert to the community. in our study, the same team of clinicians conducted all 3 consultations with each patient, especially the patients experienced this to be a major advantage. thus, an important question to be investigated in future studies is the challenge of enabling experts to follow up on the basis of other persons descriptions and examinations. it is also of vital importance that the initial visit to the outpatient clinic prior to the telemedical course of treatment should serve to get to know the patient in terms of the patient s ability to participate in a course of treatment built on video consultations, which involves a thorough examination of the patient including measures such as peripheral blood pressure. thereby, the patient obtains high quality and continuity in the treatment. both expert nurses and visiting nurses gained new roles in the telemedical setup. from the beginning of the study, the expert nurses were worried about not having the patient face to face and not having the finger in the ulcer, whereas the expert doctor tended to be more open to the concept, possibly because doctors are more used to delegating work tasks to others. the final focus group interview after the pilot test revealed that also the expert nurses were now confident with the new role as a consultant working through another nurse. communication through video phones puts constraints to the natural flow of the conversation in terms of delays and difficulties to interpret nonverbal cues and expressions. for this reason, all participants had to be conscious about their expressions and we recommend attention and training in this way of communication before implementing similar telemedical services. the visiting nurse was invited into the experts reflections, which meant that her role went from carrying out the prescribed treatment on her own and without formal influence to be a fully fledged member of a collaborating team. working through guidance from the experts, the visiting nurses became more engaged, secure, and responsible in carrying out the treatment. the competences and skills of the visiting nurse are likely to increase from each consultation, resulting in increased job satisfaction and qualifications. in all consultations performed during our pilot test, the three criteria for the consultation to be characterized as a viable alternative to a visit in the outpatient clinic were met. the experts expressed satisfaction with their basis for decisions, the visiting nurses felt supported, and the patients experienced the new way of receiving treatment as an advantage. furthermore, the simultaneous communication between expert, visiting nurse, and patient enabled the clinicians to provide a more holistic and tailor - made treatment, indicating that the telemedical consultations are a viable way of performing the treatment.	the aim of this study was to investigate whether video consultations in the home can support a viable alternative to visits to the hospital outpatient clinic for patients with diabetic foot ulcers. and furthermore whether patients, relatives, visiting nurses, and experts at the hospital will experience satisfaction and increased confidence with this new course of treatment. participatory design methods were applied as well as field observations, semistructured interviews, focus groups, and qualitative analysis of transcriptions of telemedical consultations conducted during a pilot test. this study shows that it is possible for experts at the hospital to conduct clinical examinations and decision making at a distance, in close cooperation with the visiting nurse and the patient. the visiting nurse experienced increased confidence with the treatment of the foot ulcer and characterized the consultations as a learning situation. all patients expressed satisfaction and felt confidence with this new way of working.
epidermolysis bullosa (eb) comprises a group of genetically determined skin fragility disorders characterized by blistering of the skin and mucosa following mild mechanical trauma. dystrophic epidermolysis bullosa (deb) is a subtype of eb with a well understood pathogenesis. the dystrophic forms of eb are characterized by deformities of the skin including coalescence of the fingers, nail changes and milia formation, and have either autosomal recessive or dominant inheritance. prevalence of deb is not known precisely though it is found to occur in all races worldwide with equal predilection in both the genders. in the recent past, investigators have discovered the molecular basis for all of the major inherited blistering disorders. a seven year old male patient was referred to the pedodontic clinic for oral examination by the paediatric dermatologist. parents reported that the child had been diagnosed with eb since birth when he developed a blister on the tongue during nursing. parents reported that due the blisters in the mouth they avoided brushing his teeth and had started brushing his teeth at six and half years of age. when presented to our department, the child had been brushing only in the morning with a soft brush and herbal toothpaste. diet of the child was mainly vegetarian, non spicy and broken into smaller bite sizes for ease of eating. both hands had pseudosyndactyly, that is, mitten deformity of the hands and the finger nails were missing [figure 1 ]. while the skin was dry and wrinkled on arms, neck, ear, the face had scabs and the scalp showed alopecia [figure 2 ]. buccal mucosa and palate appeared greyish white and ankyloglossia with erythematous patches was present [figure 3 ]. lingual sulcus was reduced in depth, while labial sulci and buccal vestibule were absent [figure 4 ]. both upper and lower the dentition was non - spaced with retroclined lower anteriors, and anterior deep bite. histopathology confirmed the diagnosis of eb while immunopathology report confirmed the diagnosis of deb stating that collagen band vii was absent at basement membrane zone (bmz) ; and, laminin band v was present and keratin 14 showed a normal pattern. barium meal radiograph revealed the presence of an esophageal stricture. during the first visit, oral prophylaxis patient was advised using a 0.05% sodium fluoride mouthwash and was placed on a recall every six months. pseudosyndactyly and absent finger nails seen in the patient in the case report alopecia and scabs on neck seen in the patient in the case report limited mouth opening, ankyloglossia, retroclined lower anterior teeth seen in the patient in the case report obliterated labial sulcus seen in the patient in the case report the collagen vii is either reduced or absent, and electron microscopy reveals paucity, rudimentary structure or complete lack of the anchoring fibrils. several hundred mutations in the gene for collagen vii, col7a1, have been noted in both the recessive and dominant forms of deb. since all deb subtypes are caused by mutations in the col7a1 gene, deb is classified as severe generalised recessive deb, recessive deb, and dominant deb. severe generalised recessive deb is the most severe form, previously known as hallopeau - siemens subtype, and starts at birth with extreme fragility of skin. dominant deb is milder, starts at birth though it decreases in intensity with advancing age. teeth are normal in this form. in the present case, repeated blistering and ulceration which healed with scarring, lead to microstomia. the long standing nature of the disease in this case had lead to the elimination of the buccal and vestibular sulci, marked tongue atrophy and ankyloglossia. in children suffering from deb, scarring of the fingers and hands poses a problem in maintaining the oral hygiene. it has been found in studies that in terms of enamel chemistry, teeth from patients with recessive dystrophic eb are essentially the same as those from healthy individuals containing > 90% mineral per volume, thereby ruling out enamel hypoplasia in these teeth. therefore, the disease does not predispose the tooth in any way to carious attack. poor oral hygiene, and diet rich in sugar and carbohydrates, which is necessary to provide sufficient caloric intake to maintain the growth, are the two most important etiological factors in high caries experience. it has also been reported that patients with recessive ebd have elevated levels of albumin in the saliva predisposing them to high rate of dental caries. parents indulgence, a common characteristic in cases like this in which an actual life - threatening condition is present, has been found to contribute significantly to poor oral status. oesophageal strictures in deb contribute to nutritional problems like limited intake of food, protein loss and impaired growth. this contributes significantly to the marked dento - alveolar disproportion and consequently to dental crowding. oral care aims at maintaining a functional dentition that would help in efficient mastication, and thereby favour nutrition of the patient, and involves continuous follow - up of dietary advice, oral hygiene maintenance and fluoride therapy. secondary infections must be treated with topical and/or systemic antibiotics and a protein - rich diet with iron and zinc supplements must be provided. systemic treatment remains primarily palliative and dental treatment is aimed at avoiding the formation of new bullae during perioperative management. oral hygiene, dietary instructions and elimination of gingival inflammation form the first phase ; restorative procedures form the second phase ; and, extractions of the carious destroyed teeth, and recall system, form the third and fourth phase of the treatment, respectively. caries prevention in individuals involves modification of toothbrushing techniques, diet modification and adjuvant therapies. soft and small head toothbrush with short bristles should be recommended in case of severe microstomia. since these individuals can be sensitive to flavouring agents, neutral, non - flavored and alcohol free formulations should be advised. since diet is a key factor in causing caries a thoughtful dietary plan should be made with the help of a nutritionist. increased fluid intake while eating and rinsing with warm water would help in oral clearance. however, there are no contraindications for restorations, endodontics, and placement of stainless steel crowns. care must be taken when planning removable dentures where the tolerance depends on the mucosal fragility of each patient. general precautions like lubricating the lips, buccal mucosa and instruments with vaseline ; and, placing the suction tip on tooth surface, can help prevent bullae formation during the course of the dental treatment. preventive programs have shown to be effective in preventing dental caries in individuals with deb. dental management of patients with deb is an important part of the multidisciplinary approach in the care of these patients.	epidermolysis bullosa (eb) is a form of severe skin adhesion defect due to the disruption of the dermal- epidermal junction. it is classified into simplex and dystrophic forms depending on the level at which the junction is compromised. repeated ulcerations and bullae formation in the mouth lead to scarring that brings about various changes in the oral cavity. these include loss of sulcular depth, ankyloglossia, limited mouth opening and other dentoalveolar changes. at present while there is no cure for eb, the therapeutic approaches are essentially aimed at controlling the infections and maintaining an acceptable quality of life. dental management should aim at maintaining a functional dentition that would help in mastication and favour nutrition. oral manifestations and dental management in a child diagnosed with dystrophic eb since birth are presented here.
guided cell migration requires the generation of polarized plasma membrane protrusions such as filopodia, lamellipodia, blebs and invadopodia. although these protrusions differ structurally and in their composition, they each contribute to cell movement by pushing the leading edge forward. both axonal growth cones and endothelial tip cells display abundant filopodia protrusions (fig. 2). their dynamic behavior of extension and retraction is reminiscent of antennae probing their environment and are generally thought to serve as environmental sensors that integrate extracellular signals during directed migration. growth cone morphology, reflected for instance by filopodia number, has been correlated with guidance decisions at choice points and filopodia preferentially contact target cells, sometimes over long distance. in vivo experiments with titrated doses of an inhibitor of f - actin polymerization, cytochalasin b, blocked growth cone filopodia formation in grasshopper ti1 neurons and in xenopus retinal ganglion cell neurons. while pathfinding was disrupted in conditions without filopodia, only minor effects were seen on axonal extension, suggesting that filopodia are dispensable for growth but essential for guidance. similarly, in vitro treatment with cytochalasin b abolished glutamate - induced growth cone turning with only slight effects on neurite extension. however, a little known study on retinal ganglion cells suggests that axon guidance can occur without filopodia. here, the authors demonstrate that growth cones extend few or no filopodia after inhibiting ena / vasp function. while axonal elongation was slowed down, retinal ganglion cell axons devoid of filopodia showed normal trajectories in vivo and growth cone navigation across several choice points was unaffected. axonal growth cones (a, image courtesy of isabelle brunet) and endothelial tip cells (b) extend long filopodia (arrowheads) in the direction of migration. scale bars, 10 m. similar to growth cones, endothelial tip cells at the leading edge of vascular sprouts produce many long filopodia that extend toward the direction of vascular growth during angiogenesis. these filopodia express the vegf - a receptor, vegfr2, and become misdirected and shorter upon disruption of vegf - a distribution in the mouse retina. as filopodia have been proposed to act as sensors of the extracellular milieu and endothelial cells respond to axon guidance molecules such as slits and roundabouts, netrins and unc5 receptors, semaphorins, plexins and neuropilins, and ephrins and eph receptors, it has been widely assumed that they sense and integrate pro - angiogenic and repulsive cues in tip cells to enable guided migration and stereotypic vessel patterning. however, the role of filopodia in vessel guidance has never been proven nor questioned. recently, work from our laboratory demonstrated that filopodia are not essential for mediating endothelial tip cell guidance. by using low concentrations of latrunculin b (lat. b), which prevents f - actin polymerization, endothelial filopodia formation was abolished in the zebrafish embryo. live microscopy revealed that endothelial tip cells of isvs without filopodia continued to migrate along normal trajectories to form the stereotypic isv pattern and to anastomose with other tip cells. at the low concentrations of lat. b used, tip cells were able to generate lamellipodia that provided the driving force for cell movement although at a decreased velocity. furthermore, the induction of new vascular sprouts toward sources of ectopic vegfa165 ensued in the absence of filopodia. in summary, our study shows that during angiogenesis, endothelial filopodia are dispensable for tip cell guidance. this finding complements that of dwivedy., who showed that filopodia are also not essential for axonal growth cone navigation and challenges the long - standing notion that filopodia are required for guided migration. in fact, filopodia or filopodia - like structures have been ascribed many other functions. these include facilitating cell - cell matching and epithelial sheet adherence during dorsal closure in drosophila, transmitting signals such as delta - notch and sonic hedgehog signaling between non - neighboring cells, inducing cell shape changes required for preimplantation embryonic development by providing tension and positioning nuclei in nurse cells during oogenesis in drosophila. in endothelial cells, we propose that filopodia serve as templates from which lamellipodia emerge and that both protrusive structures coordinate to allow efficient migration and expansion of new vascular sprouts. in addition, tip cell filopodia facilitate the process of anastomosis, a process whereby tip cells meet, fuse and establish new junctions to form a connected vascular network. thus, the mechanism(s) by which blood vessels are guided by extracellular cues is still unresolved.	filopodia are highly dynamic, rod - like protrusions that are found in abundance at the leading edge of migrating cells such as endothelial tip cells and at axonal growth cones of developing neurons. one proposed function of filopodia is that of an environmental probe, which serves to sense guidance cues during neuronal pathfinding and blood vessel patterning. however, recent studies show that tissue guidance occurs unhindered in the absence of filopodia, suggesting a dispensability of filopodia in this process. here, we discuss evidence that support as well as dispute the role of filopodia in guiding the formation of stereotypic neuronal and blood vessel patterns.
electroconvulsive therapy (ect) remains a widely used efficacious treatment for a variety of complicated psychiatric conditions, particularly affective disorders resistant to psychotherapy, medication, and other forms of treatment (chamberlin and tsai 1998 ; rami - gonzalez 2001). specifically, ect has been found to decrease symptoms associated with intractable depression (neylan 2001 ; taieb 2001) but sometimes at the temporary cost of decreased speed of information processing (tsourtos 2007). despite the noted success of this medical procedure in terms of decreasing depression, these include an acute confused state immediately following the procedure, postictal delirium, interictal disorientation, and anterograde and retrograde memory disturbances (durr and golden 1995). the most notable cognitive side effect has been an iatrogenic form of transient amnesia, similar to that caused by anticholinergic drugs (kopelman 1986 ; kopelman and corn 1988) and benzodiazepines (curran 1991, 1986). the adverse effects of ect on cognitive functioning, particularly memory, are typically more pronounced and have been known for some time (janis and astrachan 1951 ; hihn 2006 ; fujita 2006) however, there is still controversy regarding the impact these memory difficulties may have, as some regard them as limited and tolerable (abraham 2006). the changes in cognitive decline have been attributed to decreases in hippocampal volume (lekwauwa 2006), which may vary depending upon electrical waveform and electrode placement (sackeim 2007), as well as the type of induction agents (larsen 2005). in contrast, animal models have suggested the differences in gene expression may influence cognitive decline post - ect (mcdaniels 2006). others suggest that social stigma surrounding ect may limit its use, effectiveness, and compromise scientific exploration that may aid in determining the mechanisms associated with cognitive decline (melding 2006). squire (1977) investigated the effects of ect on cognitive functioning and found that bilateral ect produced greater anterograde memory loss than right unilateral ect on both recall and recognition memory tests. in addition, bilateral ect was associated with more extensive retrograde amnesia than unilateral ect and that the capability to form new memories substantially recovered 69 months after unilateral ect. several other studies have revealed similar long - term consequences of ect (weeks 1980 ; frith 1983 ; squire 1984 ; sackeim 1992 ; sackeim 2007). despite a relatively complete recovery of memory functioning several months following ect in a majority of patients, many individuals complain of continued memory deficits 3 years or more after treatment. however, these complaints may be due to a lack of improvement in depressive symptoms. several researchers have found that ect patients who continue to experience depressive symptoms complain of more memory loss as compared with their counterparts whose depressive symptoms go into remission, but do not demonstrate memory deficits on neuropsychological evaluation (freeman 1980 ; squire and slater 1983 ; frith 1983). furthermore, depressive symptoms or medication were not associated with deficits on tests of logical memory, face - name recall and verbal learning (freeman 1980). this suggests that depressive symptoms may have an influence on self - report cognitive deficits but are not associated with neurocognitive testing performance. more recent empirical evidence suggests that patients report improvements in cognitive functioning post - ect. coleman and colleagues (1996) found that, at baseline, patients reported marked deficits on a self - report measure of memory functioning. however, these patients reported improved memory functioning shortly following ect, despite objective test results indicating impaired anterograde and retrograde memory deficits at that time. improvements in self - reported memory functioning were less pronounced among patients who received high dosage ect stimulation and/or bilateral electrode placement. in contrast to previous literature, this evidence suggests that low dosage ect, and to some extent, high dosage ect may be associated with increased self - report memory functioning. coleman and colleagues (1996) suggested that this difference might reflect the changes in ect practices. despite the positive implications of the coleman and colleagues (1996) findings, more evidence is needed to support the positive effects of ect on self - report memory functioning. the purpose of the present study was to investigate the relationship between self - reported memory functioning, objective measures of memory functioning, and self - reported mood. the study further will provide evidence for memory functioning of patients prior to and after receiving ect. using archival methods, we reviewed the medical records of 46 sequential patients seen at a southeastern usa medical facility for neuropsychological evaluation prior to and after ect. all participants were referred with a primary diagnosis of major depression, recurrent, severe without psychotic features (n = 46). of the 46 participants (30 females), 40 completed the neuropsychological evaluation as inpatients at the hospital. the vast majority of participants were caucasian (n = 44), the mean age was 56.2 years (sd = 17.32 ; range 1996), and the mean years of education was 13.6 (sd = 3.2). the mean number of days between the pre- and post - ect neuropsychological evaluations was 24.5 days (sd = 11.4). all participants completed neuropsychological tests consisting of the short - term memory questionnaire (stmq ; koss 1993), levin selective reminding test (levin : hannay & levin 1985), and the logical memory and visual reproduction subtests from the wechsler memory scale (wms - r) on the day prior to ect. psychological tests included the beck depression inventory (bdi) and several other self - report measures of emotional functioning and patient attitudes toward ect. using archival methods, we reviewed the medical records of 46 sequential patients seen at a southeastern usa medical facility for neuropsychological evaluation prior to and after ect. all participants were referred with a primary diagnosis of major depression, recurrent, severe without psychotic features (n = 46). of the 46 participants (30 females), 40 completed the neuropsychological evaluation as inpatients at the hospital. the vast majority of participants were caucasian (n = 44), the mean age was 56.2 years (sd = 17.32 ; range 1996), and the mean years of education was 13.6 (sd = 3.2). the mean number of days between the pre- and post - ect neuropsychological evaluations was 24.5 days (sd = 11.4). all participants completed neuropsychological tests consisting of the short - term memory questionnaire (stmq ; koss 1993), levin selective reminding test (levin : hannay & levin 1985), and the logical memory and visual reproduction subtests from the wechsler memory scale (wms - r) on the day prior to ect. psychological tests included the beck depression inventory (bdi) and several other self - report measures of emotional functioning and patient attitudes toward ect. for the current analyses, we utilized a set of simple parametric procedures to detect difference in means as a function of their standard deviations, and the total sample size. multivariate analysis of variance was used to evaluate the simultaneous effects of time on multiple dependent variables. due to limited sample size, we did not utilize models of covariance for age and other demographic factors in the current analyses. t - test revealed a significant decrease in subjective ratings of depression as rated by the bdi, t(45) = 9.82, p 0.35). the smq means presented in table 4 are consistent with previous results (koss 1993) which indicate memory deficits, although not to a level of mild dementia. differences between pre- and post - ect were observed on another self - report measure that asked patients to rate memory impairments on a temporal gradient that ranged from 10 minutes ago to 2130 years ago. on this measure, patients indicated poorer short - term memory (those events which occurred 10 minutes ago) and long - term memory (those events which occurred one month ago) functioning. these findings were confirmed with significant decreases on global self - report measures of memory dysfunction in the past week (p < 0.03). nonparametric analysis (wilcoxon signed ranks test) revealed that patients attitudes towards ect changed after completing their treatments. specifically, patients rated ect to be more effective than drugs (p < 0.005) in treating their depression. the results of this study support the findings of previous research indicating that ect results in decreased memory functioning. the results of the current study indicate relatively immediate and significant decreases in multiple areas of memory following ect compared with pre - ect levels of functioning including verbal memory for word lists and prose passages and visual memory of geometric designs. contrary to the established literature, patients indicated memory deficits both before and after receiving ect, but did not report a significant change in their subjective ratings of memory functioning. indeed, there was a slight trend towards improved memory functioning, despite the objective neuropsychological data indicating significantly lower recognition and delayed recall. thus, self - appraisal of memory functioning seems to be impacted and should be further explored to better understand these findings. as expected, patients self - reported levels of depression were significantly lower following ect. thus, the results indicate that ect was successful in alleviating depressive symptomatology while cognitive deficits persisted with poor insight of cognitive decline post ect. the current results stress the need for providing a significant level of informed consent to patients prior to receiving ect and the need for additional efforts to assure that written information is comprehended (edwards and rogers 2007). for instance, the implications of such memory changes associated with an older adults real - world functioning should be discussed, particularly if the patient is living independently. perhaps, development of compensatory strategies should be implemented to assist the patient as they recover following such treatment (ie, using post - it - notes, family assistance, reminders, pill box, calendars, etc). this may help to reduce or minimize potential risks for other problems (ie, forgetting to take medications for medical problems, safety, etc). durr and golden (1995) purport that this is particularly important to consider when older adults with preexisting cognitive or neurological dysfunction are at greater risk of cognitive disturbances resulting from ect. consideration of use of medications and behavioral techniques that reduce the impact of ect on memory should be considered (prakash 2006 ; macqueen 2007). when ect is provided to adolescents, the potential impact of such cognitive changes should be discussed with the patients and their parents or guardians in terms of implications for not only the patient s emotional functioning but cognitive functioning as well, particularly upon his or her academic performance. in summary, we argue that an individual cost - benefit analysis should be made in light of the implications of the potential benefits versus costs of ect upon improving emotional functioning and the impact that potential memory changes may have on real - world functioning and quality of life. the archival nature of the current methodology serves as a potential limitation to this study. for example, our ability to collect data on medications and evaluate the influence of these medications on mood and memory at the time of intervention was extremely limited due to the retrospective nature of the data collection. further, data about the technical parameters of the ect procedure (mean seizure length, electrode placement, etc) were not available to us at the time of the review. however, archival methodology can facilitate documentation of observed phenomena in a fashion that promotes the development of future prospective studies. we view the value of the current study in such a context. we also recognize that our limited sample size could be of concern to some readers. more specifically, we utilized conservative techniques to model relationships between variables and to control for factors that could account for additional variance in our analyses. we view this as a reasonable trade - off to document the current finding and inspire new science related to the cognitive affects of ect. although we noted at least one statistically significant finding in our results that was not equally clinically meaningful, we believe that highlighting differences between subjective appraisals and objective measures of memory have clinical significance. we also note published studies in the ect literature that are equally plagued with this common issue but contributing to our knowledge of the impact of ect on cognitive factors (datka 2007). future research should focus on delineating specific cognitive changes associated with the use of ect in different age groups, the time course to recovery and identifying recommendations and appropriate strategies to compensate for temporary cognitive changes upon discharge and to promote insight into such decline (blaj 2007). these results follow some recommendations (neylan 2001) which argue that the identification of risk factors for ect - related cognitive side effects need to be better characterized in an effort to assist clinicians with informing patients of such risks and to potentially implement prophylactic interventions. these results also urge for continued research in the area of ect and neurocognitive changes to identify patient - specific factors that may contribute to ect - induced cognitive impairment.	the current study examined the effects of electroconvulsive therapy (ect) on neuropsychological test performance. forty - six patients completed brief neuropsychological and psychological testing before and after receiving ect for the treatment of recalcitrant and severe depression. neuropsychological testing consisted of the levin selective reminding test (levin) and wechsler memory scale - revised edition (wms - r). self - report measures included the beck depression inventory (bdi), the short - term memory questionnaire (stmq), and several other measures of emotional functioning and patient attitudes toward ect. the mean number of days between pre - ect and post - ect testing was 24. t - test revealed a significant decrease in subjective ratings of depression as rated by the bdi, t(45) = 9.82, p < 0.0001 (pre - bdi = 27.9 20.2 ; post - bdi = 13.5 9.7). objective ratings of memory appeared impaired following treatment, and patients self - report measures of memory confirmed this decline. more specifically, repeated measures manova [wilks lambda f(11,30) = 4.3, p < 0.001 ] indicated significant decreases for measures of immediate recognition memory (p < 0.005), long - term storage (p < 0.05), delayed prose passage recall (p < 0.0001), percent retained of prose passages (p < 0.0001), and percent retained of visual designs (p < 0.0001). in addition, the number of double mentions on the levin increased (p < 0.02). this study suggests that there may be a greater need to discuss the intermittent cognitive risks associated with ect when obtaining informed consent prior to treatment. further that self - reports of cognitive difficulties may persist even when depression has remitted. however, patients may not acknowledge or be aware of changes in their memory functioning, and post - ect self - reports may not be reliable.
a 44-year - old man, who had a medical history of panic disorder, visited another hospital due to dyspnea on mild exertion. a coronary angiography showed a single coronary artery originating from the right coronary ostium. a single coronary artery bifurcated into the right coronary artery and left main coronary artery. the left main coronary artery coursed between the main pulmonary artery and aorta before bifurcating into the left descending artery and circumflex artery. we thought that panic symptoms or dyspnea on exertion might be a sign of myocardial ischemia due to compression of the left main coronary artery by the pulmonary artery and aorta. we decided that surgical treatment was the best option due to the high risk of sudden death associated with a coronary anomaly. under general anesthesia we dissected the left main coronary artery between the aorta and the main pulmonary artery on the beating heart. the proximal left main coronary artery was bifurcated from a single coronary artery that originated from the right coronary sinus. under cardiopulmonary bypass, only one coronary ostium was observed in the right coronary sinus, and a single coronary artery originated from the ostium. a 5-mm arteriotomy was made to the left main coronary artery at the site in which the left coronary ostium should have been located. neo - ostium formation was performed with a 5-mm puncher in the left coronary sinus. anastomosis between the neo - ostium and the left main coronary arteriotomy site was performed using a 7 - 0 prolene continuous running suture (fig. the aortic cross clamping time was 88 minutes, and total cardiopulmonary bypass time was 117 minutes. follow - up computed tomographic angiography before discharge showed good patency of the neo - ostium in the left coronary sinus without stenosis at the anastomosis site (fig. the patient remained asymptomatic without any complications or events for 15 months after the surgery. angelini reviewed 1,950 coronary angiographies and reported that the incidence of right coronary artery originating from the left coronary sinus was 0.92% and vice versa was 0.15%, with a total incidence of 1.07%. patients are usually asymptomatic. however, it may cause angina, syncope, and even life - threatening complications such as myocardial infarction or ventricular fibrillation. thus, we must consider surgical treatment or intervention if signs of myocardial ischemia are present. several surgical techniques can be utilized to treat coronary anomalies, such as coronary reimplantation to the original sinus, coronary artery bypass graft (cabg), pulmonary artery translocation, unroofing, and neo - ostium formation. in this case, the left main coronary artery was bifurcated from a single coronary artery originating in the right coronary sinus. furthermore, the left main coronary artery passed between the pulmonary artery and aorta to reach the left heart. cabg, coronary reimplantation, unroofing or neo - ostium formation could therefore have been considered as viable surgical options. coronary reimplantation is one of the most physiologically beneficial repairs, but is technically difficult, and stenosis may occur at the site of anastomosis. cabg is technically feasible, but the arterial conduit has a competitive flow problem if no stenotic lesions are present on the natural coronary artery. also, a vein conduit may be problematic if the patient is young because of long - term patency. however, extended unroofing may cause valve insufficiency if the anomalous coronary artery is located under the valve commissure. unroofing was not proper for our case because a separated left main coronary artery originated from a single coronary artery, not the right coronary sinus. neo - ostium formation in the left coronary sinus without unroofing was considered to be a proper surgical treatment in this case. successful surgical treatment of anomalous of coronary anomaly depends on expertise in anatomic and hemodynamic pathophysiology, in addition to the selection of the appropriate surgical treatment option. we report that this case was successfully treated with neo - ostium formation in anomalous origin of the left coronary artery from the right coronary system.	anomalous origin of a coronary aortic artery is a rare cardiac anomaly. although it can cause angina, syncope, and palpitations, most patients are asymptomatic. this anomaly requires surgical treatment or intervention because it is associated with sudden death. several surgical techniques, such as coronary reimplantation, coronary artery bypass grafting (cabg), unroofing, and neo - ostium formation, have been proposed as treatments. we report a case surgically treated with neo - ostium formation in anomalous origin of the left coronary artery from the right coronary sinus.
merosin - deficient cmd type 1a (mdc1a) is the most common form of cmd. mdc1a is caused by mutation of the laminin -2 gene (lama2), localized to chromosome 6q22 - 23. patients with mdc1a present with severe neonatal hypoxia often requiring ventilatory assistance, markedly delayed motor development, and generalized muscle atrophy with the weakness of limb and trunk muscles leading to contractures and joint deformities. in contrast with other cmd patients, those with merosin deficiency have high creatine phosphokinase (cpk) levels and white matter abnormalities on brain imaging techniques. here we report the clinical manifestations, result of muscle biopsy and genetic studies in five turkish patients with mdc1a. the patient 1 was a 6-year - old boy and first attended our hospital at the age of 4 years due to hypotonia, weakness, poor weight gain, and contracture of knees. from birth, he exhibited marked hypotonia with generalized muscle weakness. by 3 years of age, the patient was able to hold his head up but was unable to sit alone. at the age of 5 years, the patient was able to sit unsupported, but not stand. he had joint contractures of upper and lower extremities, myopathic facies, and pectus carinatum. nerve conduction studies were normal, and electromyography (emg) showed a myopathic pattern. magnetic resonance imaging (mri) of the brain was performed and showed high signal in the periventricular and subcortical white matter [figure 1a and b ]. periventricular and subcortical white matter signal the patient 2 was the daughter of patient 1. she had global hypotonia and was able to sit and was not able to stand. the distal tone of the four extremities was decreased, and deep tendon reflexes were diminished. cerebral mri was performed in another hospital and revealed high signal in the periventricular and subcortical white matter. we analyzed the lama2 gene sequencing and revealed a homozygous mutation c. 639delg in the patient 1 and 2. the patient 3 was a 7-month - old girl who presented to our hospital with complaints of developmental motor delays. her serum cpk level was 4073 u / l, and her echocardiogram was normal. mri of the brain revealed hyperintense lesions in the periventricular white matter on t2a sequencing. we studied the lama2 gene sequencing and revealed a homozygous mutation p.r1350 (c. 4048 c > t). the patient 4 was a 3 and a half year - old boy who presented with hypotonia, weakness, poor weight gain, and respiratory problem, and could not sit or stand. he had general hypotonia, myopathic facies, pectus excavatum, and he was not able to sit and stand. furthermore, he had a hemangioma on the left temple, chest, and wrist. his serum cpk level was 2120 u / l and mri of the brain showed similar findings with other patients. hemangioma on the left temple, chest, and wrist in the patient 4 the patient 5 was a 6-month - old boy who had hypotonia. his biochemical investigations were normal except for elevated serum cpk levels (2950 u / l). echocardiography was normal, and mri of the brain showed hyperintense lesions in the periventricular white matter. we performed the lama2 gene sequencing and revealed a homozygous mutation p.r2578 (c. 7732 c > t) in two of them. the patient 1 was a 6-year - old boy and first attended our hospital at the age of 4 years due to hypotonia, weakness, poor weight gain, and contracture of knees. from birth, he exhibited marked hypotonia with generalized muscle weakness. by 3 years of age, the patient was able to hold his head up but was unable to sit alone. at the age of 5 years, the patient was able to sit unsupported, but not stand. he had joint contractures of upper and lower extremities, myopathic facies, and pectus carinatum. nerve conduction studies were normal, and electromyography (emg) showed a myopathic pattern. magnetic resonance imaging (mri) of the brain was performed and showed high signal in the periventricular and subcortical white matter [figure 1a and b ]. periventricular and subcortical white matter signal the patient 2 was the daughter of patient 1. she had global hypotonia and was able to sit and was not able to stand. the distal tone of the four extremities was decreased, and deep tendon reflexes were diminished. cerebral mri was performed in another hospital and revealed high signal in the periventricular and subcortical white matter. we analyzed the lama2 gene sequencing and revealed a homozygous mutation c. 639delg in the patient 1 and 2. the patient 3 was a 7-month - old girl who presented to our hospital with complaints of developmental motor delays. her serum cpk level was 4073 u / l, and her echocardiogram was normal. mri of the brain revealed hyperintense lesions in the periventricular white matter on t2a sequencing. we studied the lama2 gene sequencing and revealed a homozygous mutation p.r1350 (c. 4048 c > t). the patient 4 was a 3 and a half year - old boy who presented with hypotonia, weakness, poor weight gain, and respiratory problem, and could not sit or stand. he had general hypotonia, myopathic facies, pectus excavatum, and he was not able to sit and stand. furthermore, he had a hemangioma on the left temple, chest, and wrist. his serum cpk level was 2120 u / l and mri of the brain showed similar findings with other patients. hemangioma on the left temple, chest, and wrist in the patient 4 the patient 5 was a 6-month - old boy who had hypotonia. his biochemical investigations were normal except for elevated serum cpk levels (2950 u / l). echocardiography was normal, and mri of the brain showed hyperintense lesions in the periventricular white matter. we performed the lama2 gene sequencing and revealed a homozygous mutation p.r2578 (c. 7732 c > t) in two of them. mdc1a is an autosomal recessive neuromuscular disorder caused by mutations in the lama2 gene encoding the laminin - a2 chain a component of the skeletal muscle extracellular matrix protein laminin-211. laminin-211, the most abundant laminin in muscle, is also expressed in schwann cells, the synaptic basal lamina of peripheral nerves, heart, epidermis and fetal trophoblastic tissue. typical clinical features of mdc1a or merosin - deficient cmd include severe floppiness at birth, elevated serum cpk, delayed motor milestones, white matter changes as seen on brain mri. in literature, several studies have reported respiratory insufficiency, feeding difficulties, cardiomyopathy, sensory and motor demyelinating neuropathy, seizure, and external ophthalmoplegia. severe proximal weakness was also present from birth or developed within the first 6 months. di blasi. reported 9 patients with mdc1a from 1 sudanese and 3 saudi families. another study presented similar results : five of 13 patients with residual merosin and two of 33 patients with absent merosin could walk independently. leite. in a study of 25 brazilian patients with mdc1a reported that bilateral white matter involvement was frequent in the parietal, frontal, and temporal regions, brain stem, cerebellum, and internal and external capsules were also affected in the minority of cases. however, they described that there were no correlations with sites of white matter abnormalities and clinical or merosin status. in another study, di blasi. reported mri or ct, oliveira. performed in 22/26 patients, revealed white matter changes in all cases. in addition, they detected that other cerebral changes included abnormal gyration in three patients. in our study, all the patient showed the typical phenotype of mdc1a, including features such as hypotonia, elevated serum creatine kinase, delayed motor development, and t2 hyperintensity on brain mri. in the patient 3, 4, and 5, we detected two lama2 gene mutations which have been described previously. coral - vazquez. reported an 8-month - old mexican female infant, from a consanguineous family, with mdc1a and they detected homozygous mutation p.r2578 in lama2 gene as similarly in our patient 4 and 5. from the 1 month of life, the patient was hypotonic with poor intake, irritability, reduced spontaneous movements, and poor suction. physical examination showed generalized muscle weakness and contractures of elbows, wrists, knees, and ankles. patients should be suspected as mdc1a if they have early - onset severe hypotonia with joint contractures, motor developmental delay with moderately increased cpk levels, and abnormal cerebral imaging findings. muscle biopsy and molecular genetic testing should be performed for diagnosis and especially for the genetic counseling.	context : congenital muscular dystrophy type 1a (mdc1a) is caused by mutations in the laminin -2 gene encoding laminin-a2.aims:the purpose of this study is to determine clinical and genetic results in five turkish patients with mdc1a.setting and designs : five children with mdc1a were retrospectively analyzed.results:three (60%) were boys, and 2 (40%) were girls. parental consanguinity was found in all the families. in all the patients, hypotonia, weakness, delayed motor milestones, markedly elevated creatine phosphokinase (cpk) concentration, and brain white matter abnormalities on magnetic resonance imaging were detected. mutation analysis was performed in all the patients, and 3 different mutations were detected. however, a mutation in patient 1 and 2 has not been previously described in the literature.conclusions:when a patient presents with severe congenital hypotonia, muscle weakness, high serum cpk levels, and white matter abnormalities, should be suspected as mdc1a.
incidental vessel injury caused by some of these variations may require more extensive lung resection than would be necessary without repair during pulmonary resection. we herein describe a patient with a common trunk of the left pulmonary vein that was incidentally transected with a mechanical stapler during a left upper lobectomy. we also describe the reconstruction procedures that were successfully used for the concomitantly transected inferior pulmonary vein. a 62-year - old man complained of cough and bloody sputum and consulted our hospital. chest computed tomography (ct) showed a nodule with a diameter of 15 mm in the left upper lobe. positron emission tomography and brain magnetic resonance imaging revealed a clinical stage of t1n0m0 as categorized by the 7th edition of the union for international cancer control (uicc) classification. the common trunk of the left pulmonary vein was misidentified as a superior pulmonary vein until incidental transection with an endostapler during port access surgery. the left upper bronchus and pulmonary arteries to the left upper lobe were transected with endostaplers, and the common trunk of the pulmonary vein was left intact. the left main pulmonary artery was then clamped under intravenous heparin injection to achieve an activated coagulation time of 200 s. annuloplasty of the inferior pulmonary vein was completed during intermittent declamping of the left pulmonary artery. the orifice of the inferior pulmonary vein was augmented by a cuff technique using an orifice of the superior pulmonary vein, as shown in fig. 1. the staples on the stump of the left common pulmonary vein on the atrial side were removed to adjust the augmented orifice of the left inferior pulmonary vein under partial clamping of the left atrium following pericardiectomy. end - to - end anastomosis was completed using running sutures with a 4 - 0 polypropylene thread. the postoperative course was uneventful, and the patient was discharged on postoperative day 14. a pathologic study showed stage t1n2m0 small - cell carcinoma as categorized by the 7th edition of the uicc classification. postoperative enhanced ct demonstrated successful reconstruction of the left common trunk (fig. 2). 1.orifice of an inferior pulmonary vein was augmented with a cuff technique using the orifice of a superior pulmonary vein. the augmented orifice was anastomosed to the common pulmonary vein on the left atrial side after removal of staples as long as necessary under a partial clamp of the left atrium following pericardiotomy. fig. 2.postoperative enhanced ct showing (frontal view) successful reconstruction of an inferior pulmonary vein (arrow). orifice of an inferior pulmonary vein was augmented with a cuff technique using the orifice of a superior pulmonary vein. the augmented orifice was anastomosed to the common pulmonary vein on the left atrial side after removal of staples as long as necessary under a partial clamp of the left atrium following pericardiotomy. postoperative enhanced ct showing (frontal view) successful reconstruction of an inferior pulmonary vein (arrow). the branching pattern of the pulmonary vessels is variable. pulmonary vein variations such as upper lobe venous drainage posterior to the intermediate bronchus and a common trunk of the left pulmonary vein may cause lethal complications during and after anatomical pulmonary resection. based on ct findings, a common trunk of the left pulmonary vein reportedly occurred with a frequency of 14% among 201 cases. although three - dimensional ct and multidetector ct have been developed to detect pulmonary vessel variations preoperatively, incidental transection of the common trunk may be unavoidable when the pulmonary vein is anteriorly transected with no identification of the inferior vein during left upper lobectomy. furthermore, the use of video - assisted surgery and endoscopic devices has become more widespread, and skin incisions and exposure of anatomical structures have become more limited. a previous paper reported that the orifice of the inferior pulmonary vein was augmented with the use of a pericardial patch followed by anastomosis when the common trunk was incidentally transected. in this report, annuloplasty of the inferior pulmonary vein with a cuff technique using an orifice of the superior pulmonary vein allowed for much easier performance of end - to - end anastomosis, leading to successful reconstruction without a patch or prosthesis. this augmented technique may also be applicable to patients with lung cancer in the right upper lobe when the tumor is invading the right common superior trunk branching pulmonary veins to the upper and middle lobes.	a common trunk of the left pulmonary vein is an anatomical variation in the pulmonary vessels and may be incidentally transected during left upper lobectomy. difficulty in reconstruction of the left inferior vein often requires completion pneumonectomy. we herein describe a patient with lung cancer in the left upper lobe of the lung. his common trunk of the left pulmonary vein was incidentally transected with a mechanical stapler during a thoracoscopic left upper lobectomy. the concomitantly transected inferior pulmonary vein was augmented with a cuff technique using an orifice of the superior vein followed by end - to - end anastomosis. the postoperative course was uneventful. this technique should also be considered in patients with lung cancer when a right upper lobe tumor is invading the right superior trunk branching pulmonary veins to the upper and middle lobes.
perivascular epithelioid cell tumors (pecomas) are a rare group of mesenchymal neoplasms composed of distinctive cells which show a focal association with the walls of blood vessels and usually express melanocytic and smooth - muscle markers. these tumors include renal angiomyolipoma, lymphangioleiomyomatosis, clear cell sugar tumor of the lung, and similar neoplasms occurring in the retroperitoneum, kidney, uterus, pancreas, or other visceral and soft - tissue sites. imaging findings of these tumors are usually nonspecific. to our knowledge, in the english literature, there are only two publications referring to pecomas with perirenal manifestation with no report on computed tomography (ct) findings. we examined the case of a 44-year - old woman who presented with left lumbar pain of 4 months duration. sonography revealed the presence of a large, heterogenous, well - margined mass, located in the left perirenal space [figure 1a ]. the lesion was partly cystic solid, with solid components detected with moderate vascularity at doppler examination [figure 1b ]. the presence of a large, inhomogeneous left perirenal mass [figure 2a ], in close proximity to the renal capsule was confirmed. the dimensions of the lesion were 6 cm 7 cm 10 cm, approximately. the tumor had cystic parts, with ct density similar to that of water, not enhancing after intravenous contrast medium administration, and solid parts, with strong, heterogeneous enhancement [figure 2b ]. peritumoral vascularity, seen as asymmetrically increased vessels adjacent to the mass within gerota fascia, was also identified [figure 2c ]. mass effect to the surrounding organs was noted, particularly to the left kidney, without obvious findings of invasion. 44-year - old woman with 4-month history of lumbar pain diagnosed with perivascular epithelioid cell tumor. (a) sagittal sonographic image of the left hypochondrium depicts the presence of a large heterogenous left perirenal mass. the lesion has cystic parts (asterisk) and solid, heterogeneous components (long arrow). (b) sagittal power doppler image of the left perirenal mass reveals vascularity of the solid parts (arrowheads). 44-year - old woman with 4-month history of lumbar pain diagnosed with perivascular epithelioid cell tumor. (a) transverse noncontrast computed tomography image demonstrates inhomogeneous solid parts of the lesion (arrow). the mean computed tomography density of the solid components is 35 hu on unenhanced images, similar to that of normal renal parenchyma. coronal reformations during (b) the portal phase and (c) the excretory phase depict sharply demarcated left perinephric mass (arrow), partly cystic and solid, in close proximity to the renal capsule. the solid parts of the tumor enhance intensely and heterogeneously, with a mean portal phase attenuation of 100 hu. prominent vessels are seen in the left perirenal space adjacent to the lesion (long arrow). intraoperatively, the mass was separated from the renal capsule by a thin layer of fibrous tissue and tumorectomy was performed. histologically, the neoplasm was composed of spindle and epithelioid cells, immunoreactive for vimentin, desmin, smooth muscle actin, hmb45, cd56, cd99, b cell lymphoma-2, er, nse, and focally for mart-1 and cd31. areas of myxoid, partly cystic degeneration and areas of hemorrhage were identified within the tumor. overall, the findings were consistent with the diagnosis of pecoma of uncertain malignant potential. the patient had an uneventful recovery and was advised to return for follow - up, 3 months after the operation. the category pecoma was first suggested in 1992 by bonetti and includes neoplasm primarily composed of hmb-45-positive epithelioid cells with a perivascular distribution. however, a minority shows aggressive behavior, with local recurrence and/or distant metastases, more often in lungs, liver, and peritoneum. malignant pecomas have been reported to be associated with two or more of the following risk factors : size > 5 cm, high nuclear grade and cellularity, mitotic rate > 1 mitosis / hpf, and presence of necrosis or vascular invasion. tan. in a retrospective analysis of 32 pecomas reported a mean tumor diameter of 5.1 cm, well - defined margins, hypodensity on ct, low and high signal intensity on t1- and t2-weighted magnetic resonance imaging (mri) images, respectively, and strong, heterogeneous enhancement. tirumani., in a retrospective study of 36 malignant pecomas reported large, well - circumscribed masses, heterogeneous on sonography, with ct density and signal intensity on t1-weighted images similar to that of skeletal muscles, heterogeneity on t2-weighted images and inhomogeneous enhancement. approximately, 100 cases of pecomas have been reported up to date in the literature, most commonly involving the genitourinary tract, two of them with perirenal location. di blasi. reported a case of renal capsuloma observed as an incidental finding, coexisting with a papillary transitional cell carcinoma of the pelvicaliceal system. the second case of perirenal pecoma was reported on a 57-year - old woman by gunia. the authors described the mri findings of this entity, as a predominantly solid mass, with occasional cystic changes. the tumor was mainly hypointense on t1 and fat - suppressed t2-weighted images, when compared to normal renal parenchyma, with delayed contrast enhancement. the ct findings of pecoma with perirenal manifestation have never been reported in the english literature. in our patient, a well - defined, inhomogeneous perirenal mass was detected, with cystic parts and solid components, the latter heterogeneously enhancing after contrast material administration. a variety of neoplastic and proliferative disorders may affect the perirenal space, with a wide array of cross - sectional imaging findings. in cases of solitary partly cystic - solid masses of the perirenal space, differential diagnosis should include the following : leiomyoma, hemangiopericytoma, malignant fibrous histiocytoma, hemangioma and more rarely leukemia, primary extragastrointestinal stromal tumor, and castleman 's disease. perirenal leiomyoma represents a rare benign mesenchymal neoplasm, arising from the renal capsule and extending into the perirenal space. imaging findings include a well - demarcated soft - tissue mass that is supplied by renal capsular vessels. large leiomyomas are usually heterogeneous, due to the presence of hemorrhage and/or cystic myxoid degeneration. hemangiopericytoma represents a rare retroperitoneal soft tissue neoplasm, more often detected as large, lobulated, well - defined, hypervascular soft tissue mass with areas of calcification and necrosis. it is usually detected as a large heterogeneous mass, displacing the kidney, with areas of necrosis and hemorrhage. perirenal hemangioma is an extremely rare benign mesenchymal renal tumor, with nonspecific imaging features. however, the depiction of a soft tissue mass with phleboliths, hyperintensity on t2-weighted mri images, and delayed or persistent enhancement are considered as suggestive of the diagnosis. isolated leukemic involvement and primary extragastrointestinal stromal tumor with perirenal location are extremely rare, with nonspecific imaging findings. isolated perirenal lesions in castelman disease are also rare, detected as homogeneous soft tissue masses, with well - defined margins. however, in the presence of a large, well - defined perirenal mass, partly cystic - solid, with solid components enhancing after contrast material administration, accompanied by peritumoral vessels, this rare entity should be included in the differential diagnosis.	the world health organization defines perivascular epithelioid cell tumors (pecomas) as mesenchymal tumors and tumor - like conditions composed of epithelioid cells with a perivascular distribution. these tumors may show benign or malignant histology and/or biological behavior. however, the pathological features of malignancy may not correlate with biologic aggressiveness, and the criteria for malignancy are not clearly defined. abdominopelvic pecomas are very rare and have been reported in various locations, including kidney, liver, pancreas, gastrointestinal tract, genitourinary tract, peritoneum, and retroperitoneum. cross - sectional imaging techniques, including computed tomography (ct) may play an important role in the accurate detection and characterization of these tumors. we present the third case of an extremely rare pecoma with perirenal location, discuss ct findings and differential diagnosis.
achromobacter xylosoxidans, formerly called alcaligenes xylosoxidans, is an aerobic, non - fermenting, gram - negative bacilli with low virulence. it was first seen in 1971 by yabuuchi and ohyama in a patient with chronic, inflammatory otitis media. due to its ability to easily oxidize xylose, it is primarily found in contaminated soil or water, but it is rare in humans. it is known to infect immunosuppressed patients, including those with tumors, blood diseases, hypogammaglobulinemia, or acquired immune deficiency syndrome (aids), or those who have undergone organ transplant. the authors experienced a case of septic shock caused by a. xylosoxidans in an immunocompetent woman with no underlying disease who received extracorporeal shock wave lithotripsy (eswl). a 52-year - old female patient was admitted to the hospital with colicky, left flank pain. the patient had no medical history of chronic or immunodeficiency diseases, nor any previous history of urolithiasis or urinary tract infections. on admission, vital signs were stable ; blood pressure was 110/70 mmhg, respiratory rate was 20/min, pulse rate was 69/min, and temperature was 37.0. the patient complained of left flank pain without other urinary symptoms a complete blood cell count showed white blood cells (wbcs) were 9,970/mm (neutrophils, 84.4% ; lymphocytes, 6.4%), hemoglobin was 10.6 g / dl, and platelet count was 142,000/mm. the c - reactive protein (crp) was 57.5 mg / dl. biochemical tests showed blood urea nitrogen (bun) was 19 mg / dl, creatinine was 0.8 mg / dl, total protein was 6.5 g / dl, albumin was 3.2 g / dl, total bilirubin was 2.2 mg / dl, aspartate aminotransferase was 34 there were no wbcs in the urinalysis, but red blood cells were over 100 per high - power field (rbc / hpf). the cause of pain was a urinary stone in the left ureter, noted through ultrasound. on the 3rd and 4th days after admission, the patient underwent eswl, receiving a total of 8,000 shocks. three days later, the patient 's body temperature rose to 39.9. on the 7th day, her blood pressure fell to 70/50 mmhg, heart rate was 125/min, respiratory rate was 26/min, and body temperature was 39.0. oxygen saturation was 80% on room air. the patient was moved to the intensive care unit and started on mechanical ventilation and shock management. wbcs were 18,400/mm (neutrophils, 90.4% ; lymphocytes, 5.5%), hemoglobin was 11 g / dl, platelet count was 92,000/mm, and crp was 240 mg / dl. cefepime (2 g intravenously every 12 hours) and vancomycin (1 g intravenously every 24 hours) were administered empirically. the urine cultures were negative but two sets of blood cultures were positive for gram - negative bacilli, which was identified as achromobacter xylosoxidans (bactec plus aerobic / f culture vials ; becton dickinson and company, franklin lakes, new jersey, united states). the minimum inhibitory concentrations g / ml) (bactec fx ; becton dickinson and company) were as follows : imipenem / cilastatin, 4 ; meropenem, 4 ; piperacillin - tazobactam, 8 ; ampicillin, 16 ; ciprofloxacin, 2 ; amikacin, 32 ; aztreonam, 16 ; and cefepime, 16. a. xylosoxidans was resistant to cefepime ; hence, antibiotics were changed to imipenem (500 mg intravenously every 12 hours). on the 14th day, blood cultures no longer revealed a. xylosoxidans, but the patient 's renal function worsened, requiring continuous renal replacement therapy. burkholderia cepacia was isolated from one set of blood cultures on the 16th day ; it was susceptible to imipenem / cilastatin. we removed the central venous catheter to culture for b. cepacia that might have infected the catheter. a tip culture and repeated blood cultures were negative after three days. on the 21st day, the patient had respiratory failure with bilateral opacities on chest imaging. on the 29th day after admission, she passed away from septic shock and multiple organ failure. primers of 515fpl (tgccagcagccgcggtaa) and 13b (aggcccgggaacgtattcac) were used for 16s rrna gene amplification. a. xylosoxidans is an aerobic, non - fermenting, gram - negative bacilli with low virulence. infections occur mostly in immunocompromised patients, including those with tumors, blood diseases, hypogammaglobulinemia, aids, diabetes, or late - stage kidney failure, and those who have undergone organ transplants. for cases that progress to bacteremia, it is most often because of an intravenous catheter infection. a total 224 cases of bacteremia were reported : 74 in neonates and 150 in adults. the most common cause was catheter- related infection (78 cases, 52% in adults). pneumonia was the second most common source (12 cases, 8% in adults). a. xylosoxidans typically causes otitis media, skin infections, intravenous catheter infections, and surgical - site infections. the frequency of urinary tract infection by a. xylosoxidans was 0.04% (proportion of positive urine cultures) in a medical center in spain. urinary tract infection due to a. xylosoxidans often develops from the pathogenic bacteria traveling from the intestines to the ureters and bladder. while it has been reported that a. xylosoxidans causes infections in immunocompromised patients and those with urological abnormalities, the patient in this case had no such tendencies. the patient in this case had a negative blood culture, but the strains were cultured after the symptoms occurred. according to existing reports, a. xylosoxidans has a high resistance against antibiotics, making treatment difficult. it is sensitive to imipenem, piperacillin - tazobactam, ceftazidime, and trimethoprim - sulfamethoxazole. resistance was found in second- or third - generation cephalosporins except ceftazidime and fluoroquinolones. in this case, it was sensitive to imipenem, meropenem, trimethoprim - sulfamethoxazole, piperacillin - tazobactam, and ceftazidime, and resistant to ampicillin, ciprofloxacin, amikacin, cefotetan, ceftriaxone, aztreonam, and cefepime, showing similar results to existing reports. attempts have been made to combine two or more drugs for treatment, such as by combining gentamicin with piperacillin, doxycycline with azithromycin, or trimethoprim - sulfamethoxazole with azithromycin. these combinations have been effective in reducing resistance and increasing the efficacy of treatment. in conclusion, a. xylosoxidans can cause infection in immunocompromised patients, while infection in immunocompetent hosts is rare. however, we have observed such a case in a patient who had normal immune function, and report the findings of this case along with a literature review.	achromobacter xylosoxidans can cause various types of infections, but its infection in humans is rare. a. xylosoxidans has been reported as a rare etiological agent of infections including primary bacteremia, catheter - related bloodstream infection, endocarditis, otitis, and pneumonia, particularly in immunocompromised hosts. we encountered a case of septic shock caused by a. xylosoxidans in a 52-year - old, immunocompetent woman with no underlying disease, who received extracorporeal shock wave lithotripsy to remove a left upper ureteral stone. she was treated with antibiotics to which the organism was susceptible but died as a result of septic shock.
sucralose was the first noncalorie sweetener made from natural sugar, being manufactured by the selective chlorination of sucrose, which substitutes three of the hydroxyl groups with chlorines. sucralose is stable under increased heat and over a broad range of acidic and alkaline conditions. therefore, sucralose can be used in baking or in products that require a longer shelf - life. artificial sweeteners have been considered contaminants by environmental scientists only recently. due to the human inability to metabolize these molecules, they are passed on to the environment via human excrement, and the highest concentration (2,800 1,000 ng / l) of combined artificial sweetener contaminants is found in wastewater treatment reservoirs. artificial sweeteners such as saccharin and cyclamates are found mostly degraded by the wastewater treatment process. degradation only occurs to a limited extent during hydrolysis, ozonation, and microbial processes indicating that breakdown of sucralose will likely be slow and incomplete leading to accumulation of sucralose in surface waters. sucralose has been detected in rivers in north carolina, in the gulf stream, and in the waters of the florida keys. scientists are detecting sucralose in various u.s. inland surface waters and monitoring its accumulation. most artificial sweeteners are either partially or completely broken down due to the wastewater treatment process using high temperatures and changes in ph and constant filtration. it would seem that the ability of sucralose to withstand drastic ph and temperature changes makes it an exception among artificial sweeteners. over time sucralose may spread to other aquatic and coastal ecosystems, increasing in concentration. these researchers also speculated that the persistent qualities of sucralose may lead to chronic low - dose exposure with largely unknown consequences for human and environmental health. however, studies of human oral and gut bacteria have shown an inhibition of bacterial growth in the presence of sucralose. in one study the incorporation of 126 mm sucralose into glucose agar medium caused total inhibition of growth of streptococcus sobrinus 6715 - 17, streptococcus sanguis 10904, streptococcus challis, streptococcus salivarius, and actinomyces viscosus wvu627. in a related study rats were infected with streptococcus sobrinus and, following a sucrose water diet, developed dental caries lesions. another group of rats given the same bacteria but sucralose water instead of sugar water had a significant decrease in caries lesions in their teeth. these researchers concluded that oral bacteria can not grow on the artificial sweetener hence causing less damage, indicating sucralose is noncariogenic. furthermore, if sucralose does inhibit bacterial growth, the type of inhibition would need to be identified as either bactericidal (killing the bacteria) or bacteriostatic (slowing bacterial metabolism), and the mechanisms of such inhibition should be elucidated. to elucidate the effect of sucralose on bacterial growth, bacterial isolates were sampled from diverse environments. if sucralose was found to be nonnutritive for the bacterium, the effect on healthy bacterial growth was observed via turbidity testing by culturing the bacterial isolates on tsb and amending the media with various concentrations of sucralose. any inhibition was typed as either bacteriostatic or bactericidal ; this was determined with a disk diffusion assay and reculturing. finally the mechanism of such inhibitory effect was identified by enzyme and transport assays. based on the molecular kinetics analysis six individual isolates were cultured in tryptic soy broth (n = 5) (tsb) (difco laboratories, mi, usa) and incubated at 25c. the control group consisted of 5 ml of tsb amended with additional 0.5 ml growth medium. the experimental groups included 5 ml tsb with 0.5 ml of 10, 20, 30, or 40% by volume sucralose added, yielding final concentrations of 27.8 mm, 55.78 mm, 83.75 mm, and 111.7 mm. turbidity of the cultures was measured at 620 nm once daily for 9 days using 24-hour intervals (sequoia turner 340 spectrophotometer). individual isolates were cultured in m9 broth medium (n = 6) (technova, ns, canada) and incubated at 25c. the control group consisted of 5 ml of m9 broth without a carbon source ; the experimental group included a 5 ml of m9 broth with sucralose as the only carbon source. turbidity of the cultures was measured over the next 9 days using 24-hour time intervals and a sequoia turner spectrophotometer set to 620 nm wavelength. disks were prepared by hole punching out cotton rounds, which were soaked with 1.6 m sucralose. the disks were then placed onto the surface of the media, 3 disks per petri dish (n = 9). samples were incubated over night at 25c, and diameters of the zones of inhibition were measured. each isolate was individually cultured onto six m9 agar plates with glucose and six m9 agar plates with sucrose. threefold serial dilutions of stock cultures were made and spread - plated ; then 350 l of 25.1 mm sucralose was poured onto the surface of each of the sucralose added groups shortly after inoculation. these were incubated at 25c for 48 hours, and then the plates were inspected and colonies counted. the isolate that exhibited the greatest percentage of cell death on the m9 sucrose medium compared to m9 glucose medium was selected for transport inhibition testing in order to elucidate an inhibitory mechanism. this was due to the significant degree of growth inhibition on m9 sucrose medium challenged with sucralose. a bradford coomassie assay was conducted to standardize protein concentration. from this, appropriate cell culture concentrations were selected in order to yield the appropriate amount of total protein for transport. three test groups were used to measure potential transport inhibition : (1) a 0.1 mm sucrose only group ; (2) a 0.1 mm sucrose and 0.1 mm sucralose group ; and (3) a 0.1 mm sucrose and 0.1 mm mannitol group which served as a control to ensure that osmotic shock was not occurring during the transport test. each group contained 700 l of diluted m9 salt aliquots (64 g na2hpo4, 15 g kh2po4, 2.5 g nacl, and 5 g nh4cl per 5 liters h2o) and 0.5 l of c - sucrose (0.41 ci / pmole). lastly 300 l of cell culture in stationary growth phase was extracted and placed into the mixture and shaken vigorously. contents of the culture tubes were then filtered onto 0.45 m pore size filter disks and washed with 2 ml of stop solution (ice cold m9 salt aliquots). filter disks were placed into a tube with scintillation fluid and the radioactivity was measured via a beckman 6500 scintillation counter. stock solutions were prepared of 0.3 u / l invertase, 1.5 m sucrose, 1 m sucralose, and standard benedict 's solution. two test groups were prepared : (1) a sucrose only set and (2) a sucrose and sucralose set. each reaction tube contained 1 ml 0.3 u / l of invertase, 0.25 ml of benedict 's solution, and 0.75 ml ph 4 buffer. each tube in the set contained different amounts of sucrose : 2.5 mm, 5 mm 10 mm, 15 mm 20 mm, and 25 mm. reaction tubes were incubated at 75c for 30 minutes ; the absorbance of each tube was measured at 485 nm on a sequoia turner 340 spectrophotometer every 2 minutes. at minute 5 each reaction tube contained 1 ml 0.3 u / l of invertase, 0.25 ml of benedict 's solution, 0.75 ml ph 4 buffer, and 0.55 mm sucralose. each tube contained a different concentration of sucrose, 2.5 mm, 5 mm 10 mm, 15 mm 20 mm, and 25 mm sucrose concentrations, respectively. reaction tubes were incubated at 75c for 30 minutes ; the absorbance of each tube was measured at 485 nm on a sequoia turner 340 spectrophotometer every 2 minutes. at minute 5 once these assays were completed, the velocities were analyzed and used to generate an enzyme kinetics plot to determine the type of inhibition sucralose exerted on invertase. all 6 isolates had fewer colony forming units (cfus) on the media exposed to sucralose than they had on the positive control groups of m9 sucrose and m9 glucose (figure 3) indicating an inhibitory effect. organisms did not metabolize sucralose as shown in figure 1, indicating that sucralose is nonnutritive for bacteria. to elucidate the effect of sucralose on bacterial growth, the isolates were subcultured (n = 5) in the presence of 27.8 mm, 55.78 mm, 83.75 mm, and 111.7 mm sucralose to further elucidate the effects of sucralose on bacterial growth. growth curves revealed a decrease in growth with those cultures receiving sucralose compared to the controls which received no sucralose (figure 2). in general, the greater the sucralose concentration the bacteria were exposed to, the lower the rate of bacterial growth. the least concentrated dilution (28.7 mm) showed no inhibitory effects on any of the six bacterial isolates. the 55.7 mm sucralose had minor inhibition on the isolates and was significantly different (p 0.05) but km values for the reactions that were significantly different (p < 0.05) (figure 5 ; table 2). this is indicative of competitive inhibition between sucrose and sucralose for binding to invertase, with sucrose having the higher binding affinity, which is why the inhibitory affect is concentration - based. sucralose reducing sucrose uptake and breakdown in bacteria by competing for a binding site serves as a potential mechanism for the bacteriostatic effect observed during growth trials. in previous dental studies other studies also noted that the lab mice given sucralose had less detectable fecal bacteria and that gut bacteria were inhibited by sucralose. also previous environmental microbiological studies indicated inhibition of bacterial growth by sucralose. it is possible that the inhibition in previous studies was bacteriostatic, and these oral and gut bacterial tests are in concurrence with the environmental bacterial testing results presented in this communication. it will accumulate in aquatic environments over time because it is not likely to break down (that would require bacterial metabolism). previous studies suggest that bacterial consortia can partially metabolize sucralose into a di - chloro - aldehyde form ; however, these studies indicate that the carbon from sucralose is not incorporated into the bacterial consortium 's biomass. this means that the consortium did not fully digest the sucralose, and these studies also point out that the members of their bacterial consortium could not individually metabolize sucralose as a carbon source. the current environmental levels of sucralose (around an average of 300 ng / l depending on location) may not have any effect on bacterial growth. we postulate that current environmental concentrations of sucralose are too low to be having an effect on environmental bacteria in high volume aquatic environments. bacteria living in microenvironments may experience growth inhibition due to the varying concentrations of water within the microenvironment. sucralose is, however, increasing in its concentration due to its inability to be degraded by ph and temperature changes. it is presently in wastewater effluents at levels of several g / l (ppb). the swedish environmental protection agency warns that its breakdown is slow and the ecological impact is largely unknown ; they emphasize that certain concentration levels may lead to damaging arthropod and cyanobacteria communities. the present sucralose environmental concentrations are too low to negatively affect bacteria presently living in freshwater or soil systems. microenvironments could experience inhibition due to sucralose buildup as these environments may have limited water volumes.	sucralose was developed as a low cost artificial sweetener that is nonmetabolizable in humans. sucralose can withstand changes in ph and temperature and is not degraded by the wastewater treatment process. since the molecule can withstand heat, acidification, and microbial degradation, it is accumulating in the environment and has been found in wastewater, estuaries, rivers, and the gulf stream. environmental isolates were cultured in the presence of sucralose looking for potential sucralose metabolism or growth acceleration responses. sucralose was found to be nonnutritive and demonstrated bacteriostatic effects on all six isolates. this growth inhibition was directly proportional to the concentration of sucralose exposure, and the amount of the growth inhibition appeared to be species - specific. the bacteriostatic effect may be due to a decrease in sucrose uptake by bacteria exposed to sucralose. we have determined that sucralose inhibits invertase and sucrose permease. these enzymes can not catalyze hydrolysis or be effective in transmembrane transport of the sugar substitute. current environmental concentrations should not have much of an effect on environmental bacteria since the bacteriostatic effect seems to be consecration based ; however, as sucralose accumulates in the environment, we must consider it a contaminant, especially for microenvironments.
polyphenols encompass several classes of compounds that produced in plant as secondary metabolites, and they were routinely consumed with human diet. until now, about 7000 different chemical molecules together with their metabolites were identified in many types of fruits and vegetables. they received increasing attention due to their well - documented therapeutic significance in many diseases and disorders. chemically, all polyphenols have one or more hydroxylated aromatic rings that account for both structural and physicochemical properties, and allow their classification into several chemical classes including lignans, flavonoids, stilbene, isoflavones and phenolic acid derivatives. all polyphenols have reducing properties ; they can donate hydrogen to oxidized cellular constituent, and play a significant role against oxidative stress - related pathologies, like cardiovascular diseases, cancer and variety of neurodegenerative disorders. moreover, many in vitro and in vivo studies suggested that the beneficial effects of polyphenols extended to involve cell signaling, since they act as regulatory factors of gene transcription that affect many important processes like cell growth and apoptosis [4 - 7 ]. flavonoids are the most abundant polyphenols that widely consumed by peoples worldwide ; therefore, many researchers focused on the effects of many flavonoids like resveratrol, quercetin, epigallocathechin-3-gallate (egcg), rutin and curcumin, as a health promoting compounds in treatments of several diseases [9 - 11 ]. however, low bioavailability of most polyphenols represents the main hurdle in their use as dietary supplements. bioavailability of polyphenols is closely related to the biotransformation process, which mainly based on phase ii conjugation reactions of the free hydroxyl groups with methyl group, sulfate or glucuronic acid. the diversity in polyphenols structure increases the possibility of different interaction patterns with membrane transporters at different anatomical sites. the balance between absorption and excretion of dietary polyphenols can be achieved by modulation of the tissue uptake system, suggesting that certain cells may readily incorporate them by specific mechanisms ; for instance, morin can cross the vascular endothelium by a rapid, energy - dependent transport system that can also transport other hydroxylated compounds. recently, kinetic studies showed that the functional integrity of both uptake and efflux transporters represent the basis behind different tissue distribution of orally administered drugs in certain organs such as liver, kidney, and brain in animals that chronically challenged with polyphenolic compound, and reflects the importance of these transporters as a site for food - drug interactions. on the other hand, such interaction can be utilized for treatment of central nervous system (cns) related disorders like depression, anxiety, and other psychoneuronal diseases associated with functional abnormalities of monoamine transporters (mats). accordingly, polyphenols may be considered as a potential modulators that can maintain homeostasis within brain tissues, and provide adaptation against neuronal stress. to maintain the normal cell functions, transport of organic and inorganic molecules across the lipid bilayer of the plasma membrane is vital for life and maintenance of homeostatic mechanisms. it represents a tough barrier for most polar molecules, while enables passage of hydrophobic molecules only through passive diffusion. transport of ions, polar organic compounds, in addition, to the transport against concentration gradient of many chemicals (e.g., nutrients and metabolites) requires a special transport system that rely on a source energy utilized either through the existed potential of chemical gradients or coupled with enzymatic reactions that consume anion transporting polypeptide (atp). with few exceptions, transport substrates of the rotary motor and p - type atpases are limited to metal ions or protons ; however, atp - binding cassette (abc) type transports a broad range of substrates, including amino acids, sugars, nucleosides, vitamins, peptides, lipid molecules, oligonucleotides and polysaccharides. there are more than 1300 membrane transporter proteins that are broadly classified into efflux and influx types relative to the direction of substrate flow. moreover, utilization of energy for transportation allow further sub - classification into active and passive transporters. the group of active transporters included three subclasses, primary, secondary and tertiary depending on their driving force, which could be either atp or the chemiosmotic gradient. these transport systems are mostly substrate - specific and saturable, and can be competitively or noncompetitively blocked, and genetically regulated. in addition, active membrane transport is vectorial, where the substrate is either transported into or out of the cell ; however, the same transporter does not perform both actions. in general, the term active transporters cover the following : atp - binding cassette protein (abc) : members are mainly expressed on the membrane of excretory organs, where they regulate extrusion of wide range of chemically different substrates against electrochemical gradient to the extracellular region. this group includes seven subfamilies represented by abca, abcb which also known as p - glycoprotein (p - gp) or multidrug resistance (mdr), abcc or mdr proteins, abcd, abcf and abcg which include breast cancer resistance protein (bcrp or abcg2).the solute carrier (slcs) transporters or uptake transporters : members are mainly located in cell membrane of organs having tubular lumen structures like liver, kidney and intestine ; they were organized into more than 50 families and have chemically related substrate specificity. they transported diverse substrates including charged and uncharged organic molecules, in addition to inorganic ions. the most characterized families of this class are the organic atps (oatps), which include oatp1, oatp2, oatp3, oatp4, oatp5, and oatp6. in addition, the organic anion transporters (oats), which include seven members represented by oat1, oat2, oat3, oat4, oat6, oat7 and oat10, perform the transport of substrates with molecular weights of 400 - 500 da. meanwhile, the organic cations transporters (octs) include twenty members, some are well identified like oct1, oct2, oct3, oc12 and the organic creatinine transporters, where the latter is recently included and involved in bidirectional transport of creatinine to maintain its physiological level. in aeneral, octs catalyzed transport of monoamines neurotransmitters, zwitter ions, and some anion substrates with different tissue distribution [37 - 39 ]. since slts have regulatory role in absorption, uptake and elimination of different drug molecules, trace elements and dietary nutrients, they are considered as important site of kinetic drug - drug and/or drug - nutrient interactions, where modulation of their function can influence the availability and therapeutic efficacy of many ligands including drugs and other health promoting supplements.mats : this class included three members of membrane transporters (net, set and dat), which catalyze transport of norepinephrine, serotonin, and dopamine. they are expressed at the presynaptic area within both cns and the periphery, and involved in regulating neurotransmission, utilizing na / cl gradient as driving energy that induce conformational changes to enhance uptake and release of monoamines. in spite of functional importance of peripheral mats, no sufficient information are available compared to those present in cns, which have been widely studied. impairment of neurotransmitter homeostasis is correlated with many cns disorders such as depression, anxiety, attention deficit hyperactivity disorder, schizophrenia, and parkinson s disease, and suggests mats as important therapeutic targets. in this regard, treatment of depression has been focused on modulating monoamine neurotransmission, mainly achieved through blockade of mats. meanwhile, development of non - selective tricyclic antidepressants, selective serotonin reuptake inhibitors and serotonin and norepinephrine reuptake inhibitors is the most valuable outcome of this concept. moreover, drugs of abuse including cocaine and amphetamines interfere with mats ; accordingly, these transporters are considered as potential targets for treatment of drug addiction. dysfunction or complete deletion of dat showed to decrease the clearance of dopamine that associated with spontaneous hyperactivity, sleep disturbances, motor deficiency, and cocaine abuse behavior. meanwhile, deletion of net in animal models showed resistant depressive - like effects of stressors with anti - nociceptive activity, and such models were less vulnerable to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine - induced neurotoxicity. the contribution of central serotonin in controlling mood and behavior was reported using set - deficient rats, and anxiety could be ameliorated by a 5-ht1a antagonist. another study revealed that depletion of serotonin level in gastrointestinal tract (git) was observed in patients with irritable bowel syndrome that often associated with increased expression of set in the colon, suggesting the role of set inhibitors in its treatment. atp - binding cassette protein (abc) : members are mainly expressed on the membrane of excretory organs, where they regulate extrusion of wide range of chemically different substrates against electrochemical gradient to the extracellular region. this group includes seven subfamilies represented by abca, abcb which also known as p - glycoprotein (p - gp) or multidrug resistance (mdr), abcc or mdr proteins, abcd, abcf and abcg which include breast cancer resistance protein (bcrp or abcg2). the solute carrier (slcs) transporters or uptake transporters : members are mainly located in cell membrane of organs having tubular lumen structures like liver, kidney and intestine ; they were organized into more than 50 families and have chemically related substrate specificity. they transported diverse substrates including charged and uncharged organic molecules, in addition to inorganic ions. the most characterized families of this class are the organic atps (oatps), which include oatp1, oatp2, oatp3, oatp4, oatp5, and oatp6. in addition, the organic anion transporters (oats), which include seven members represented by oat1, oat2, oat3, oat4, oat6, oat7 and oat10, perform the transport of substrates with molecular weights of 400 - 500 da. meanwhile, the organic cations transporters (octs) include twenty members, some are well identified like oct1, oct2, oct3, oc12 and the organic creatinine transporters, where the latter is recently included and involved in bidirectional transport of creatinine to maintain its physiological level. in aeneral, octs catalyzed transport of monoamines neurotransmitters, zwitter ions, and some anion substrates with different tissue distribution [37 - 39 ]. since slts have regulatory role in absorption, uptake and elimination of different drug molecules, trace elements and dietary nutrients, they are considered as important site of kinetic drug - drug and/or drug - nutrient interactions, where modulation of their function can influence the availability and therapeutic efficacy of many ligands including drugs and other health promoting supplements. mats : this class included three members of membrane transporters (net, set and dat), which catalyze transport of norepinephrine, serotonin, and dopamine. they are expressed at the presynaptic area within both cns and the periphery, and involved in regulating neurotransmission, utilizing na / cl gradient as driving energy that induce conformational changes to enhance uptake and release of monoamines. in spite of functional importance of peripheral mats, no sufficient information are available compared to those present in cns, which have been widely studied. impairment of neurotransmitter homeostasis is correlated with many cns disorders such as depression, anxiety, attention deficit hyperactivity disorder, schizophrenia, and parkinson s disease, and suggests mats as important therapeutic targets. in this regard, treatment of depression has been focused on modulating monoamine neurotransmission, mainly achieved through blockade of mats. meanwhile, development of non - selective tricyclic antidepressants, selective serotonin reuptake inhibitors and serotonin and norepinephrine reuptake inhibitors is the most valuable outcome of this concept. moreover, drugs of abuse including cocaine and amphetamines interfere with mats ; accordingly, these transporters are considered as potential targets for treatment of drug addiction. dysfunction or complete deletion of dat showed to decrease the clearance of dopamine that associated with spontaneous hyperactivity, sleep disturbances, motor deficiency, and cocaine abuse behavior. meanwhile, deletion of net in animal models showed resistant depressive - like effects of stressors with anti - nociceptive activity, and such models were less vulnerable to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine - induced neurotoxicity. the contribution of central serotonin in controlling mood and behavior was reported using set - deficient rats, and anxiety could be ameliorated by a 5-ht1a antagonist. another study revealed that depletion of serotonin level in gastrointestinal tract (git) was observed in patients with irritable bowel syndrome that often associated with increased expression of set in the colon, suggesting the role of set inhibitors in its treatment. numerous data have summarized the broad biological properties and the diversity of polyphenols targets in the biological systems that mediate their activities. both chemical structure and the nature of interaction of polyphenols with biomembranes are critical for their beneficial effects, and such interaction represents the underlying mechanism through which they affect the functional properties of membrane bound enzymes and transporter proteins, which alter transmembrane potential for endogenous and exogenous molecules. dietary polyphenols became increasingly popular, and some of them have a potential role in initiating adverse drug interactions that may be established through alterations in efflux and uptake transporters. similar to conventional drugs, many natural ingredients, including polyphenols, interact with various classes of drug uptake transporters. for example, the flavonoids apigenin, quercetin, and kaempferol block the transporter functions of oatp1a2 and oatp2b1, which are localized in the apical membrane of the intestinal lumen. furthermore, green tea catechins, herbal extracts, and citrus and grapefruit juice affect the oatp - mediated transport of many ligands [57 - 59 ]. mdr transporters are family of proteins that include p - gp as an important member, which was primarily characterized in mdr chinese hamster ovary (cho) cells. p - gp transports xenobiotics outward in a unidirectional pattern utilizing atp as energy source. other mdr - related transporters were discovered within different types of cells such as mdr related proteins (mrp s) and bcrp-1. ligands that inhibit these efflux transporters were expected to elevate the intracellular concentrations of many therapeutic agents in similar fashion to p - gp blockade. in addition to the potential role of p - gp in normal physiological processes, its overexpression on cancer cells decreases significantly the intracellular concentrations of a many chemotherapeutic agents. it has been reported that natural polyphenols or their synthetic analogs can modulate the mdr transporters responsible for chemotherapy resistance, including p - gp, mrp1, and bcrp. flavonoids and stilbenes are known as the third generation of p - gp blockers and produce comparable effects to those of the already known p - gp inhibitors like verapamil and cyclosporine. many flavonoids have the capacity to inhibit bcrp ; thus, consumption of flavonoids with high blocking activity can modify pharmacokinetics and levels of drugs that are extruded by bcrp. in addition, many polyphenols are well - known as p - gp blockers including egcg that down - regulates p - gp and bcrp but did not inhibit mrp1 in a tamoxifen resistant breast cancer cell line. other polyphenols with hydrophobic groups like prenyl substituents the activity of p - gp can be modulated by altering the physical state of the surrounding lipids and/or lipid composition. polyphenols, including biochanin a, morin, phloretin, and silymarin, have been reported to influence the transport activity of abcb1 protein. these effects resulted in a significant increase of daunomycin accumulation in p - gp expressing cells in a concentration - dependent manner, and explained by the competitive binding of the polyphenols to the ligand binding site on the p - gp molecule that end up with drug accumulation. others reported that quercetin inhibits the atpase activity of p - gp, a mechanism that based on structural properties of this polyphenol ; however, the mechanism through which genistein modulates drug transport across plasma membrane seems different, where its interaction with mrp1 increased daunorubicin accumulation in cell lines overexpressed mrp1 without expression of p - gp. in other studies that utilize membrane vesicle preparations to evaluate the direct inhibition of mrp1 in addition, they showed an increase in the activity of cystic fibrosis transmembrane conductance regulator (cftr ; abcc7) chloride channel. catechins were also found to interact with p - gp and can modulate its transport activity relative to the type of tested compound, where some of them affect the fluorescent markers transported by p - gp, while others increase the transport of these markers. polyphenols like mangiferin and the mangiferin aglycone derivative norathyriol, as well as catechin, gallic acid and quercetin were investigated for their potential ability to influence abcb1 gene and p - gp expression in hk-2 cells. western blot analysis demonstrated a time and concentration - dependent modulation in p - gp activity that correlated to relative changes in the abcb1 mrna content. resveratrol, a well - known polyphenol, was found to improve the cytotoxic profile of docetaxel and doxorubicin in solid tumors through blockade of p - gp efflux and down - regulation of mdr1 gene. more recently, silibinin dihemisuccinate improves the sensitivity of methotrexate - resistant human rhabdomyosarcoma cell lines to the cytotoxic activity of methotrexate in concentration - dependent pattern, most probably through modulation of methotrexate transport through the plasma membrane. oral drug delivery is the most acceptable way of administration, mainly because of patient compliance and ease of administration. many studies have suggested the role of specific transporters in git absorption of weak acids. in clinical practice, thus, drug - drug interactions that involve membrane transporters may directly affect safety and efficacy of many drugs and food components. it has been reported that ferulic acid, widely used as a functional food, modulates the transport of many clinically effective agents, and baicalin inhibits the specific transport system that mediate transport of the active metabolite of irinotecan through the intestinal epithelium and ameliorate severe diarrhea associated with high doses of this compound. inhibition of oatp2b1 by polyphenols in apple juice may also contribute to limit drug - induced git toxicity, and may be of value in prophylaxis of late - onset diarrhea reported during cpt-11 therapy. herbal extracts and dietary polyphenols were investigated for their broad bioactivities including maintenance of glucose homeostasis, neuroprotection and regeneration, which often attributed to the functional control of uptake transport processes. tea polyphenols showed tendency to attenuate degeneration of dopamine neurons and toxicity induced by 6-ohda and mpp by mechanisms not only related to anti - oxidant or metal - chelating properties, but may be directly mediated by modulation of transporters and intracellular signaling pathways. polyphenols are studied for their potential to alter the kinetic properties of other chemicals, mostly through their influence on metabolism and/or transportation at different tissue levels relative to their distribution. to date, few number of transporters were studied for their interaction with dietary polyphenols. although the precise molecular mechanisms by which polyphenols interact with uptake transporters are not well identified, several in vitro studies on cell lines expressing mats revealed that polyphenols could interact with membrane functional proteins, like enzymes and/or transporters, as competitive or non - competitive ligands through direct interaction with the active or allosteric sites, altering their configuration and functional activity. the tea polyphenols ecg and egcg are good ligands for oatp1b3 and oatp1a2 that widely expressed in liver and intestinal epithelium, and they can inhibit the uptake of dopamine and mpp by dat, thus protected embryonic rat mesencephalic dopaminergic neurons against mpp - induced injury. moreover, an in vitro study showed that quercetin rather than naringin can specifically transported by intestinal oatp2b1 expressed in caco2 cell line, and specific inhibition of these transporters can reduce uptake of quercetin. however, the conjugated polyphenols, as sulfated conjugates, were effectively taken up by oat1 and oat3. in neuropharmacology, the mechanisms by which polyphenols and their metabolites cross the blood - brain barrier (bbb) remain a hot spot for future research. many in vitro studies evaluated the neuroprotective effects of polyphenols, and many evidence suggested that both aglycones and the conjugates behaves as ligands for oat to cross the bbb. such transport mediated by oats and oatp1a2 may influence brain tissue levels of the administered flavonoids. in a kinetic study, galangin and apigenin competitively inhibit a and b isoforms of mao, while other polyphenols showed antidepressant effect by altering transportation of ne and se. the medicinal herb hypricum, contained 6 - 15% of proanthocyanidin and 5% phenolic acid, was known to exert antidepressant effect by non - competitive reuptake inhibition of monoamines ; however, its therapeutic potential remain questionable due to its poor bioavailability. the sensitivity of membrane transporters to polyphenols was examined in comparison with bupropion, a reference inhibitor for both dat / net, using recombinant technique for cho cell line expressed these transporters. the results showed that polyphenols have selectivity to inhibit mats, with high potency and efficacy for dat and net more than set, indicating competitive inhibition of dat / net. moreover, cells expressing oat1 showed increasing tendency to the uptake of the aglycone silibinin three folds than control cells. ginkgo biloba flavonoids including kaempferol, quercetin and apigenin showed competitive inhibitory effect of oatp1b1 and oatp1b3 expressed on hek293 cell line, with no significant effect on oct. in a study that investigates the role of hepatic mrp2 in the disposition of polyphenols, both mrp2 and bcrp exhibited an essential role in the efflux of glucuronidated quercetin and naringin. interestingly, hesperidin and egcg enhance the activity of the clinically used benzodiazepine through a modulatory effect on gaba - a receptor where they bind two sites. these modulatory effects of polyphenols may guide pharmacological research to develop natural products with therapeutic benefit for treatment of depression or other neurological disorders, besides their implication in drug - dietary supplement interactions. on the other hand, polyphenols may act as modulators of transporter proteins directly by either increasing or decreasing the activity of membrane proteins, or indirectly by modifying the signaling pathways and expression of mrna encoding these transporters. it has been shown that individual components of silymarin showed a significant but different inhibitory effect on oatp transporters in overexpressing cell lines in spite of their structural similarity and identical molecular weight ; this finding revealed the influence of stereochemistry in modifying the interaction potential with oatp transport proteins, as observed from variable values of ic50 among these components. other study showed that both morin and silibinin competitively inhibit oat1 with ic50 values of 0.5 and 25 m, respectively, while ellagic acid was a potent inhibitor of oat1 activity with ic50 of 207 nm. assessment of the modulatory effect of red wine polyphenols like resveratrol, quercetin and myricitin, using mpp as a reference substrates for oct1 and oct3 in caco2 cells expressing these transporters, indicated that these polyphenols increased the uptake of mpp in a concentration - dependent manner, just like the effect of grape seed proanthocyanidins. moreover, other investigators showed that myricetin and catechin decrease mpp uptake more than quercetin which displayed strong inhibitory effect. in 2010, zhao suggested that the cytoprotective effect of polyphenols could be mediated through modulation of the mats, where both transgenic cho and dopaminergic cell line (wild type) that specifically transported monoamines used to investigate the effect of the frutescens fruit polyphenols luteolin and apigenin. both provided a significant increase in the uptake of da and ne, with higher potency of luteolin over apigenin. these effects may be a consequence of conformational changes or translocation of transporter proteins induced by polyphenols. in addition, luteolin can counteract the inhibitory effect of cocaine, the competitive inhibitor of dat. inhibitors of set were known to prolong neuronal signaling of serotonin to improve depression and control intestinal function. investigation of polyphenols that founded in licorice like methyl glabridin, glabridin and glabrene using hek-293 cell line expressing set showed 53%, 60% and 47% inhibition of set, respectively, suggesting the impact of dietary polyphenols on mood through modulation of set. to date, little information are available about expressional modulatory effect of polyphenols. it has been postulated that stress signals induced down - regulation of oat1 and oat3, while treatment of cell lines expressing these transporters with curcumin results in two folds up regulation of these transporters, and reduced the expression of oatp1b1. the isoflavon genisten was reported to decrease expression of ne uptake transporters in human neoplastoma cells, suggesting its potential pharmacological action of on sympathetic neurons. the polyphenols of cynomorium songaricum extract were investigated on cho expressing mat, and the results indicated that they inhibit dat / net transporters ; however, more polar fractions possess dual glutamate / serotonin transporters inhibition suggested the multi - spectrum targeting effect of these polyphenols. for instance, the multifunctional modulation of cell signaling pathways in neuroprotection activities of tea polyphenols was investigated using 6-oh - da model of pd, where they decrease apoptosis through increasing the anti - apoptotic signaling proteins. the classic concept of transporters in the cns illustrated mechanisms that control many functions in the brain, including autonomic function, locomotion, hormones secretion, and behavioral and intellectual activities related to the emotion and reward. moreover, functional disturbances of these transporters predispose various cns pathologies. during neuronal transmission, the intensity and duration of synaptic signaling are determined, in part, through the reuptake of the signaling molecules through specific membrane - bound transporters, which are mostly belong to the slc6 family. in certain circumstances, these transporters can transport other substances including drug molecules and toxins, which may be associated with positive or negative modulation of their original function. in this regard, dopamine transporters enabled the transport of molecular toxins, such as mpp, 6-hydroxydopamine, and paraquat into the dopaminergic neurons leading to selective dopaminergic neuron damage. many researchers have reported the influence of polyphenols on dats ; pretreatment of mice with 7,8-dihydroflavone significantly attenuated the reduction of dats in the striatum after repeated doses of methamphetamine, and consequently reduced the associated behavioral abnormalities and neurotoxicity. in certain occasions, dats behave as molecular ports that accumulate neurotoxins and can be modulated by egcg, and this effect is considered neuroprotective against mpp - induced neurotoxicity. based on real time - pcr data, egcg did not interfere with the transcription of dat mrna, suggesting direct inhibitory effect on dat, probably through modulating its internalization to activate pkc. in concentration dependent pattern, both cis and trans resveratrol interfere with the uptake of noradrenaline and 5-ht in rat brain, suggested this polyphenol as a potential source for many cns acting drugs, including antidepressants. the natural polyphenol hispidulin produced anticonvulsant activity through the inhibition of glutamate release from cortical synaptosomes, mostly through the blockade of presynaptic voltage - dependent ca channels. moreover, the neuroprotective effect of procyanidin against ischemic injury was attributed to attenuating the reduction in glutamate uptake mediated through interference with the atp required for active reuptake at mitochondrial level. similar effect was observed for myricetin and quercetin in oxygen / glucose deprivation induced swelling in c6 glial cells. in another model of injury of astroglial cells, egcg significantly increases glutamate uptake in c6 glial cells, and this may contributes to the neuroprotective role of glial cells during excitotoxicity. other types of polyphenols, including luteolin and apigenin can act as activator of mats, which might have positive impact on many hypermonoaminergic psychological disturbances, especially during cocaine addiction. currently available data clearly showed that natural products may be of therapeutic benefits in many experimentally - induced neurological disorders. recently, many studies shed a light on natural polyphenols that may have therapeutic significance in the prevention and treatment of many specific neurological disorders. for example, berberine, curcumin, honokiol, and tanshinone iia, were capable to cross the bbb and protect brain tissue against damage in various animal models of neurological disorders [116 - 118 ]. these plant - derived polyphenols also have been demonstrated to decrease glutamate release in rat brain tissues [119 - 122 ]. in summary, dietary polyphenols may influence a person s mood and improve quality of life. several in vitro studies using cell line expressing uptake transporter proteins showed different potencies of polyphenols to modulate transporter proteins including mat, especially net, set and dat, either directly or indirectly. in this respect, the amount and duration of polyphenols consumed with diet may be the underlying factor involves modulation of both function and expression. this, in turn, could affect the bioavailability, distribution and transport of various substrates handled by these transporters. understanding interactions of polyphenols with transport proteins seems to be a pre - request to predict the structures of potential flavonoid - based drugs and match with the desired biological effects. moreover, this knowledge aid in prediction the possible side - effects associated with flavonoid usage to be minimized actually, challenge ahead and further research required to establish the exact mechanism and determine whether polyphenols and/or metabolites have an efficacy in treatment of disorders related to uptake transporters.	accumulated evidence has focused on the use of natural polyphenolic compounds as nutraceuticals since they showed a wide range of bioactivities and exhibited protection against variety of age - related disorders. polyphenols have variable potencies to interact, and hence alter the activities of various transporter proteins, many of them classified as anion transporting polypeptide - binding cassette transporters like multidrug resistance protein and p - glycoprotein. some of the efflux transporters are, generally, linked with anticancer and antiviral drug resistance ; in this context, polyphenols may be beneficial in modulating drug resistance by increasing the efficacy of anticancer and antiviral drugs. in addition, these effects were implicated to explain the influence of dietary polyphenols on drug efficacy as result of food - drug interactions. however, limited data are available about the influence of these components on uptake transporters. therefore, the objective of this article is to review the potential efficacies of polyphenols in modulating the functional integrity of uptake transporter proteins, including those terminated the effect of neurotransmitters, and their possible influence in neuropharmacology.
nicaragua reported 4,742 people living with hiv as of december 2009, 89% of whom were adults over the age of 18. the epidemic is in an early stage with most cases occurring in high risk populations such as utility workers, commercial sex workers, men who have sex with men, prisoners, street children, housewives, and police and military forces. antiretroviral therapy (art) first became available to nicaraguan patients with hiv early in 2003 and by later that year, there were five health centers in three of the 17 silais providing such therapy. by 2005, it was reported that art was available to 35% of those eligible for such treatment [3, 4 ]. in 2006, the ministry of health (minsa) decided to decentralize provision of hiv services including art and, in 2009, the usaid health care improvement project (hci) was asked to provide technical assistance to attain this goal. hci worked with minsa in health centers outside managua to improve the quality of the services they were providing to hiv patients. as of 2011, 32 out of 34 facilities that dispense art in all 17 silais have received technical assistance from hci. estimates from epidemiological modeling indicate that about 2,600 patients in nicaragua are eligible for art as defined by either clinical stage or cd4 + count. in the first half of 2011, minsa reported 1,442 persons with hiv on art. a baseline evaluation conducted in january 2009 found that 13% of patients were lost to follow - up and 16.5% were dying while on art. only 45% were reported to have good clinical outcomes and 71% of patients were fully compliant with follow - up (unpublished data). to strengthen the system that provides care to hiv patients, hci with minsa implemented an intervention to improve the quality of services in seven hospital outpatient departments and two health centers. the goals of the intervention were to improve the quality and continuity of services and thereby improve clinical outcomes among those on art. from an analysis of their causes, an intervention was formulated to address problems identified from the baseline assessment with the following components. these include the following : changes to medical records management to ensure availability of important patient data including phone numbers to allow appointment reminders to be sent;reporting of patients who missed appointments to trigger a home visit within 72 hours;extending clinic operating hours to allow access for patients who are unavailable during regular office hours due to their own work;improvements by clinicians in measuring and recording patient data (time on art, protocol followed, cd4 +, viral load, pcr results, drug reactions, opportunistic infections, prophylaxis, and patient 's functional status) to allow closer following of patient status and earlier initiation on art;coordination of all aspects of care in a multidisciplinary team approach;changes to medical care processes to ensure consistent implementation of prevention of mother to child transmission. changes to medical records management to ensure availability of important patient data including phone numbers to allow appointment reminders to be sent ; reporting of patients who missed appointments to trigger a home visit within 72 hours ; extending clinic operating hours to allow access for patients who are unavailable during regular office hours due to their own work ; improvements by clinicians in measuring and recording patient data (time on art, protocol followed, cd4 +, viral load, pcr results, drug reactions, opportunistic infections, prophylaxis, and patient 's functional status) to allow closer following of patient status and earlier initiation on art ; coordination of all aspects of care in a multidisciplinary team approach ; changes to medical care processes to ensure consistent implementation of prevention of mother to child transmission. these include the following : improvement in the supply chain to ensure medication availability;masaya which was able to provide patients with ambulance services when required. improvement in the supply chain to ensure medication availability ; masaya which was able to provide patients with ambulance services when required. these include the following : improvements in psychosocial care and support and providing links to self - help groups for patients;counseling for providers to promote more empathic and supportive care;promotion of family support of and involvement in patient care through the use of peer and family counselors. improvements in psychosocial care and support and providing links to self - help groups for patients ; counseling for providers to promote more empathic and supportive care ; promotion of family support of and involvement in patient care through the use of peer and family counselors. the objective of this research was to determine how patient status and other indicators of quality of services change using a pre- and postintervention design. the second objective was to determine the cost - effectiveness of the hci intervention by comparing costs and outcomes between the pre- and postintervention periods. there have been several evaluations of interventions to improve compliance with art in terms of their effectiveness [810 ], cost, and cost - effectiveness but these are mostly focused on the patient interventions and mostly set in high - income countries. of those examining provider or facility interventions, we found only one that evaluated an adherence improvement strategy in a low - income country setting. in nicaragua, only one study has examined economic issues of hiv care : a cost analysis of centralized viral load testing. economic analysis of strategies to improve the quality of care of hiv+ patients on art is of great importance because health policy officials in nicaragua and elsewhere are compelled to find the most efficient use of resources for care and treatment, especially given that a high proportion of those needing art are currently not receiving it. there were seven hospitals, all located outside managua, participating in the improvement intervention from which three facilities were chosen to participate based on the following selection criteria : exposure to at least one year of the improvement intervention;a multidisciplinary team working on the improvement intervention;implementation of all of the changes noted above;no other improvement intervention occurring at the same time or in the last 12 months prior to this intervention. exposure to at least one year of the improvement intervention ; a multidisciplinary team working on the improvement intervention ; implementation of all of the changes noted above ; no other improvement intervention occurring at the same time or in the last 12 months prior to this intervention. in these hospitals, patients were sampled based on the following : hiv status confirmed by laboratory status;patient at least aged 18 years;patient on art at both times of medical record review. hiv status confirmed by laboratory status ; patient at least aged 18 years ; patient on art at both times of medical record review. patients were excluded if they were using different drugs to the national protocol, changed drug regimens during the course of the study, abused drugs or alcohol, had mental disorders, or obtained their drugs through private sources. data were collected through three sources : patient medical records for inpatient and outpatient services, hospital expenditure records, and staff costs for following up with patients. a team of three registered nurses and one doctor received training on patient data collection from clinical records. cost data from the hospital expenditure records were collected by an external data collector and the results were confirmed by hospital administration staff. the four people in each hospital team the hiv program manager, team coordinator, nurse, and medical assistant in the comprehensive care unit in all three hospitals involved in following up patients kept a written log of their expenses incurred while following up noncompliant patients in the community. for all changes in patient outcomes between the pre- and postintervention periods, we analyzed the group as a whole and, separately, patients who started art prior to january 2008. for changes in cdc disease classification, we determined the proportion of patients assigned to categories a, a1, a2, b, b1, and b2 (patients without aids - indicator infections and with cd4 counts greater than 200 cells/l) in the two periods and performed fisher 's exact tests for the differences. the same analysis was performed for the proportions of patients with opportunistic infections, at least one hospitalization and cd4 counts below 200/mm. for the total number of opportunistic infections and the total days of hospitalization, student 's t - tests were performed. decision tree analysis was used to determine the incremental cost - effectiveness from the point of view of the improvement intervention implementers (usaid hci), minsa, and health workers using opportunistic infections as the effectiveness outcome. this was because data on the costs of opportunistic infection treatment were available for both in- and outpatient settings and the probability of both was known from patient medical records. the timeframe for the cost - effectiveness analysis was the one - year period of the intervention. currency was denominated in nicaraguan cordobas and converted to 2008 us dollars using the prevailing exchange rate of 20.34 cordobas to one us dollar. probabilistic simulations were used to determine a credibility interval around the point estimate for the cost - effectiveness result. most patients were from chinandega (47%) and masaya (43%) with rivas contributing less than 10%. the majority of the patients were male (80%), between ages 25 and 39 (62%), and diagnosed between 2006 and 2007 (62%). more than half started art before 2008 (table 1). for cdc disease classification, we analyzed data in two groups : those who started art before 2008 and those who started in 2008 or later. those starting later were more likely to improve due to the effects of being newly prescribed medications to control the hiv disease process. patients starting earlier were 22% more likely to be in a better clinical stage after the intervention compared to those starting later. among those starting art later, their clinical stage was mostly unchanged from the pre- to postintervention periods. those starting later experienced most improvement in clinical stage before the start of the intervention. table 2 shows approximate personal expenses of health staff from the three hospitals spent during follow - up visits and activities for people on art. the costs paid by nursing staff doing outreach activities as part of the intervention were $ 15.75 per patient. costs to the implementers of the program, hci, included transportation and other travel expenses, learning sessions, training materials, and technical assistance. the total amount was then divided by the number of patients served by that activity in the hospitals under investigation. other expenses were attributable to service delivery in just the three health units included in this study and so were divided by the 133 patient participants (table 3). there were statistically significant improvements in the number of patients diagnosed with ois, the total number of ois, the number of patients hospitalized, the total number of hospital days, and the proportion of patients with cd4s below 200 from the preintervention to the postintervention period for the group considered together and in the two subsets. improvements seen in the pre-2008 subset were greater than improvements in the patients starting art in 2008 or after except for the proportion of patients with cd4 counts below 200 mm. for the whole group, the risk of opportunistic infections decreased by 24% (95% ci : 14%34%) from the preintervention period to the end of the intervention. if a patient with hiv did develop an opportunistic infection, the probability of them being treated in hospital rather than in an outpatient setting was about 0.8 in both the preintervention and postintervention periods. the average per - patient cost of caring for patients decreased by $ 133/patient / year (95% ci : $ 29$249). with this result coupled with the decrease in opportunistic infections, the intervention when compared to the business - as - usual strategy saved money while also improving outcomes. for all outcomes, the probability of a cost - saving result with improved outcomes was one. results from this study indicate that the intervention to improve care for patients with hiv was associated with improvements in their health as measured by days in hospital, occurrence of opportunistic infections, and cdc clinical stage, while saving money for the health system. this result of the improvement strategy being dominant over the business - as - usual strategy is robust to uncertainties in the input variables. given that improvements in health are expected in those newly beginning on art, even in resource - poor settings, we separated out those who began art before 2008 from the whole group. improvements in the group that started art earlier were not worse than the group starting later. in fact, those beginning art earlier had slightly better improvements in hospitalizations and ois than those starting more recently. improvements in cd4 counts among those who started art later were significantly better, a result expected from the effects of beginning art earlier. the improvements in cd4 counts were not more closely associated with improvements in opportunistic infection, surprising finding given results from other studies comparing cd4 counts with the incidence of such infections [19, 20 ]. even allowing those opportunistic infections will still occur in those with higher cd4 counts ; those infections should be milder and therefore require shorter average hospitalizations. the decrease in the period prevalence of opportunistic infections from 38% before the intervention to 14% after the intervention was similar to the decrease in ois reported from an improvement intervention in san salvador. these authors found a decrease from 44.9% (95% ci : 34.4 to 55.0%) to 16.9% (95% ci : 9.8% to 26.3%) in the 24 weeks after starting an intervention which included provision of arts and prophylaxis, enrollment in self - help groups, education on adherence, and treatment of ois. three studies were found that examined cost - effectiveness of health care improvement interventions for those on art [14, 22, 23 ]. they showed that improvement strategies to increase adherence to drug regimens either were cost - saving, as in this study, or had modest costs for substantial benefits. the decrease in hospitalization due to the lower occurrence of opportunistic infections lowered the overall average cost of caring for patients with hiv by more than one - third. the cost of the intervention associated with this decrease in ois was $ 104, of which less than 15% was paid by the unreimbursed activities of the health workers following up on patients missing scheduled visits. for a relatively small initial investment by hci and minsa, the health system saved money that could have been used to enroll more hiv positive patients on treatment. given that other studies from the region have found that starting art sooner is itself a cost - effective strategy, the potential for benefits to minsa and patients is significant. therefore, we strongly recommend implementation of this strategy in other parts of the country. an important component of the costs was the personal expenditures by health workers in the hospital. this contributed about $ 16 per patient (15%) of the cost of the intervention. including the expenses due to the intervention borne by providers gave a more complete accounting of the cost of the intervention. however, in an equitable system, these expenses would have been reimbursed by minsa or hci. if this intervention is to be considered in the future for other parts of nicaragua or in other countries, it must be incumbent upon the institution financing the intervention such as the ministry of health or outside donor agency, to include these as part of their costs rather than relying on the beneficence of health workers. securing financing for outreach by health workers is an important factor in securing the sustainability of such interventions. this intervention was conducted in the study sites as sites in the two remote atlantic autonomous regions (raan and raas after their spanish acronyms). the considerable costs of participation of health workers from these regions increased the average cost of the intervention for those not in these remote areas. the cost per patient for transportation and other expenses associated with implementation would most likely be considerably lower than the costs in managua, where distances are much less and the density of patients is much higher. therefore it is likely that the intervention would be even more attractive from an economic perspective than the result from these remote areas indicates. had the health changes in patients from participating clinics been compared to those in similar patients from clinics not part of the intervention, the case for attributing the changes seen to the intervention would have been stronger. while no other interventions or major changes aside from those that were part of this program were ongoing during the time of implementation or in the 12 months prior, it can not be ruled out that other improvements at least a small part in patient status seen could have been due to factors outside the intervention under investigation. for example, if the stigma of being hiv positive decreased universally, this may have increased the proportion of hiv patients remaining on treatment. any future studies on this topic in this or other settings this economic analysis did not take into account the cost consequences to patients of their clinic 's participation in the intervention. it is likely that the decrease in opportunistic infections and hospitalization and the improvement in clinical status had a positive economic impact on patients and their families due to their improved overall functioning possibly allowing for more time for employment and other productive economic activities. this has been the case in other studies that have examined cost - effectiveness of treatments to improve the health of patients with hiv [26, 27 ]. in this study, the factor was not measured because we considered only the perspective of the minsa, the caregivers, and hci. if the improvements in care and the associated improvements in outcomes remained even at a diminished level beyond the period of the intervention, the cost - savings would have been even greater. this study demonstrates that an intervention to improve the quality of care for patients on art in this low - income setting was associated with substantive improvements in health outcomes while decreasing expenditures for that health care. such improvement in the efficiency of health services can allow more people with hiv in need of art to receive such therapy. given this encouraging result, it is recommended that the intervention be implemented in all facilities that deliver hiv services in nicaragua.	background. a 2010 evaluation found generally poor outcomes among hiv patients on antiretroviral therapy in nicaragua. we evaluated an intervention to improve hiv nursing services in hospital outpatient departments to improve patient treatment and retention in care. the intervention included improving patient tracking, extending clinic hours, caring for children of hiv+ mothers, ensuring medication availability, promoting self - help groups and family involvement, and coordinating multidisciplinary care. methods. this pre / postintervention study examined opportunistic infections and clinical status of hiv patients before and after implementation of changes to the system of nursing care. hospital expenditure data were collected by auditors and hospital teams tracked intervention expenses. decision tree analysis determined incremental cost - effectiveness from the implementers ' perspective. results. opportunistic infections decreased by 24% (95% ci : 14%34%) and 11.3% of patients improved in cdc clinical stage. average per - patient costs decreased by $ 133/patient / year (95% ci : $ 29$249). the intervention, compared to business - as - usual strategy, saved money while improving outcomes. conclusions. improved efficiency of services can allow more art - eligible patients to receive therapy. we recommended the intervention be implemented in all hiv service facilities in nicaragua.
igg4-related disease (igg4-rd) is characterized by an elevated serum igg4 level and the infiltration of igg4-positive plasma cells into various organs. with regard to renal involvement, interstitial nephritis recently, glomerular lesions in igg4-rd have been reported, although such reports are still scarce [1, 35 ]. we describe a patient with igg4-rd who developed membranous nephropathy (mn) with repeated flares but who was successfully treated with a combination of a steroid and cyclosporine a (cya). in august 1999, a 50-year - old japanese man with a 6-month history of bilateral submandibular and lacrimal gland enlargement was admitted to our hospital. the serum concentration of igg was elevated to 6227 mg / dl, whereas antinuclear antibody and ss - a / b antibodies were negative. the histological features of a submandibular gland specimen revealed acinar atrophy, infiltration of ductal lymphocytes and plasmacytes and focal fibrosis, which suggested chronic sialadenitis. chest - computed tomography revealed interstitial pneumonia, pleural effusion and thickening and enlargement of mediastinal and hilar lymph nodes. pathological findings of the mediastinal lymph node biopsy included lymphoplasmacytic infiltration and lymphoid follicular hyperplasia. the lung specimen obtained by a video - associated thoracic surgery revealed lymphoplasmacytic infiltration in the alveolar interstitium around the bronchi and artery. since other diseases could be excluded because of the negative findings, we made a diagnosis of lymphoproliferative disorder including mikulicz disease and started prednisolone (psl) at 40 mg / day. steroid therapy was effective for improving these symptoms and psl was maintained at 10 mg / day. in august 2004, laboratory findings were as follows : albumin 1.7 g / dl, creatinine (cr) 0.87 mg / dl, igg 1273 mg / dl and igg4 447 mg / dl. urinalysis showed the following data : 2050 red blood cells / high - power field, the presence of poikilocyte and granular casts, protein 11 019 mg / gcr (9.4 g / day), n - acetyl--d - glucosaminidase 16.6 mg / gcr and -1-microglobulin 28.0 mg / gcr. infiltration of inflammatory cells, fibrosis and tubular injury were not shown in the interstitium. a routine immunofluorescence study revealed diffuse and global igg and c3 deposition along the glomerular capillary walls. in addition, immunofluorescence staining for igg1 and igg4 showed granular global positivity in a capillary wall distribution. electron microscopy showed electron - dense subepithelial deposits on the glomerular basement membrane and tubular basement membranes. we also performed immunohistochemical staining of the pleural specimen that had been obtained 5 years before and found a strongly positive staining of igg4 (igg4-positive / igg - positive cells > 60%) on the cytoplasm of infiltrated plasma cells (figure 1d). moreover, a strongly positive staining of igg4 (igg4-positive / igg - positive cells > 80%) was observed in fat tissue surrounding the kidney. he was treated with intravenous pulse methyl - psl therapy followed by oral psl at 60 mg / day. six weeks later, cyclophosphamide was added at 100 mg / day because of worsening proteinuria. he achieved complete remission (cr) of mn, defined as decreased urinary protein excretion to 0.2/gcr with normalized serum creatinine 5 months later. at the same time, cyclophosphamide was stopped because of alopecia, and only psl at 5 mg / day was continued. 1.pathological findings of specimens obtained by renal (a c) and pleural (d) biopsy. (a) immunofluorescence of igg1 staining, (b) immunofluorescence of igg4 staining, (c) electron microscopy and (d) immunohistochemistry of igg4 staining (magnification 400). pathological findings of specimens obtained by renal (a c) and pleural (d) biopsy. (a) immunofluorescence of igg1 staining, (b) immunofluorescence of igg4 staining, (c) electron microscopy and (d) immunohistochemistry of igg4 staining (magnification 400). in may 2008, he developed a flare of mn with increased proteinuria at 2150 mg / gcr (2g / day) and an elevated serum igg4 level (414 mg / dl). we increased the dose of psl to 30 mg / day and started cya at 150 mg / day. after 4 months, cr of mn was achieved and treatment was maintained with psl at 5 mg / day and cya at 150 mg / day (trough blood concentration of cya : 100200 mg / dl). in june 2010, he developed sepsis and pneumonia due to streptococcus infection and cya was discontinued. the nephrotic syndrome relapsed after 1 month, but extra - renal lesions did not relapse. the combination of psl, increased to 30 mg / day, with cya was effective and cr was achieved 5 months later. he has remained in cr with psl and cya (figure 2). 2.changes in serum albumin levels (bold line and triangles), proteinuria (thin line and squares) and serum igg4 level (dashed line and diamonds) since the first clinical signs of igg4-related systemic disease. cyc, cyclophosphamide ; cya, cyclosporine a. changes in serum albumin levels (bold line and triangles), proteinuria (thin line and squares) and serum igg4 level (dashed line and diamonds) since the first clinical signs of igg4-related systemic disease. the histological characteristics of mn in igg4-rd include strongly positive igg4 staining on infiltrated plasma cells and diffuse staining of glomerular capillary walls or tubular basement membranes. however, the relationship between glomerular lesions and igg4-rd is poorly understood. the predominant igg4 staining in the glomerular capillary walls is similar to the immunofluorescence pattern of idiopathic mn. in addition, the predominance of t - helper (th) 2 cytokines in both idiopathic mn and igg4-rd has been reported.. demonstrated that igg4-related pancreatitis is characterized by an immune reaction that is mediated predominantly by not only th2 cells but also foxp3 + regulatory t cells (tregs). recently, interleukins (il)-4 secreted by th2 cells and il-10 secreted by foxp3 + tregs have been reported to induce the differentiation of b cells to produce igg4. secondary mn. recently, m - type phospholipase a2 receptor (pla2r) was identified as a target antigen in idiopathic mn, but not in secondary mn. the sensitivity and specificity of positive serum anti - pla2r antibodies were reported to be > 75 and 100%, respectively [9, 10 ]. did not detect circulating anti - pla2r antibodies in any of their patients with mn associated with igg4-rd, which suggested that it is secondary mn. therefore, the examination for anti - pla2r antibodies may be useful to distinguish primary and secondary mn. unfortunately, the recombinant pla2r that is required to detect pla2r antibodies by western blotting was not commercially available and therefore it was impossible to test for the presence of pla2r antibodies in the current patient. however, we considered that the patient had secondary mn, since the other symptoms of igg4-rd preceded the development of mn by 5 years and the infiltration of most igg4-posotive cells was observed in fat tissue surrounding the kidney. the probability of coincidental development of primary mn in patients with igg4-rd is extremely rare considering the incidence of these diseases. about one - third of the patients achieve spontaneous remission, another third remain active with fluctuating proteinuria, and the remaining third progress to end - stage renal disease (esrd). several reports with a follow - up duration of more than 10 years reported that 5060% of untreated patients died or progressed to esrd. therefore, patients with risk factors for progression to esrd, such as a presence of interstitial lesions at initial renal biopsy, renal insufficiency at presentation and the magnitude and persistence of proteinuria, should be treated with steroids and immunosuppressive agents. two regimens have been shown to be superior to steroids for the treatment of idiopathic mn in randomized controlled trials : the ponticelli regimen of six alternating months of steroid and alkylating agents and the cattran regimen of low - dose steroids and cyclosporine. however, the relapse rate is 30% and refractory or recurrent igg4-related pancreatitis usually requires treatment with immunosuppressive agents. in this case, we first started a treatment with psl but after failure of this treatment, we added cyclophosphamide. although the combination of psl and cyclophosphamide induced remission of mn that persisted for 4 years, we could not continue cyclophosphamide because of a side effect, and therefore we next used cya based on the cattran regimen. there was no correlation between the activity of nephrotic syndrome and the extra - renal manifestations at several relapses in this case. we considered that psl at a maintenance dose was effective for extra - renal manifestations, but was not enough to suppress mn. that steroid therapy improved extra - renal manifestations but did not improve proteinuria in mn associated with igg4-rd. with regard to the comparison between cyclophosphamide and cya, we could not make a definitive conclusion, as the doses of steroid concurrently used with these agents were different. in conclusion, we treated a patient who developed repeated relapses of mn without interstitial nephritis associated with igg4-rd. the combination of a steroid and cya was effective for the induction and maintenance of remission. in 2011, the guidelines for the diagnosis of igg4-rd were proposed by the organizing committee comprising 35 igg4-rd experts. we have to verify these guidelines and accumulate reports on various treatments, including cyclophosphamide, cyclosporine and azathioprine. a prospective study is warranted to evaluate the efficacy of this combination therapy for patients with frequently relapsed igg4-rd. in addition, the ideal duration of maintenance therapy should also be investigated in the future.	igg4-related disease (igg4-rd) is associated with the infiltration of igg4-positive plasma cells into various organs. nephropathy of igg4-rd is generally interstitial nephritis and glomerulonephritis is rare. we describe a case of membranous nephropathy (mn) without interstitial nephritis associated with igg4-rd symptoms including lymphadenopathy and pulmonary and pleural lesions. treatment with steroids improved these clinical symptoms, but withdrawal of steroids induced the repeated relapse of mn. finally, flaring of mn was prevented by the combination of steroids and cyclosporine. this is the first report of the successful treatment of mn associated with igg4-rd by this combination therapy.
micrornas (mirnas) are small (~22 nucleotides) noncoding rnas that regulate more than half of the genes in human cells.1 by complementary binding into the 3'-untranslated region (3'-utr) of mrnas, they suppress translation and induce degradation of mrnas. because of their broad targeting range, mirnas are expected to be involved in most cellular processes. accordingly, dysregulation of the expression of mirnas results in diverse disease states.2 analysis of mirna levels in human plasma and serum showed that extracellular mirnas are unexpectedly stable in body fluids.3 moreover, many studies showed that the mirna profile is altered in the blood of patients compared with that of healthy persons. these discoveries have attracted much interest in utilizing the level of extracellular mirnas as a novel biomarker in diverse diseases. in this review, i briefly introduce in chronological order the important discoveries that led to the establishment of the mirnas as novel biomarkers. i also discuss the possible origin of extracellular mirnas and the reliability of mirnas as biomarkers. finally, i make several suggestions for experimental processes to identify mirna biomarkers with higher consistency. because of the many such studies, reports of specific mirnas for disease markers are not dealt with thoroughly in this review. i recommend that researchers who want to identify novel biomarkers or who want to search the identified markers for a specific disease search the databases in which the published mirna markers for diverse diseases are collected, with links to their corresponding published studies.4 note that although diverse terms are used to define mirna in the extracellular space, including extracellular mirna, vesicular mirna, exosomal mirna, and circulating mirna, i will use the term extracellular mirna to represent all mirnas detected outside cells. after the discovery of the first mirna in caenorhabditis elegans in 1993, it took 7 years to encounter the second mirna, also in c. elegans (fig. 1).567 until that time, these tiny rnas were regarded as molecules specific to lower organisms. the importance of mirna as a regulatory molecule was first implied by the discovery that the second mirna identified, let-7, is conserved throughout bilateral animals.8 the identification of dozens of mirnas from worm, fly, and human suggested that mirnas indeed constitute a large group of previously unknown regulatory molecules.91011 the function of mirnas began to be discovered, and it was soon reported that mirnas are highly related to human diseases, such as chronic myeloid leukemia (cll).12 numerous studies to analyze the involvement of mirnas in human disease were triggered by the development of the microarray platform, which made the global profiling of mirna possible.13 strikingly, the classification of cancer phenotypes was more successful when the expression profile of mirna rather than that of mrna was used.13 the availability of profiling based on microarray, and subsequently next generation sequencing, established a foundation for those studies to discover mirna biomarkers for the classification and diagnosis of disease (fig. although the analysis of the mirna profile in human tissues showed the great potential of mirna as a disease marker, a less invasive method would make this analysis more practical. in this regard, extracellular mirnas were first discovered in cell culture medium.14 interestingly, encapsulated inside exosomes, the extracellular mirnas secreted from donor cells could be transferred into other recipient cells. the existence of extracellular mirnas in the body fluids of humans was soon reported in several studies.15161718 an important discovery was that the mirna profiles in the body fluids of diseased persons were considerably different from the profiles in healthy persons.moreover, the mirnas in body fluids remained stable in diverse severe conditions such as boiling, very low or high ph, repetitive freezing - thawing, and storage at room temperature for a long time.1518 these studies raised the possibility that mirnas from body fluids could be used to diagnose human diseases. after these discoveries, hundreds of research studies were conducted to find extracellular mirnas that could be used as diagnostic or prognostic markers for specific diseases (fig. it is much easier to profile the global level of mirnas rather than that of proteins or metabolites because of the high sensitivity and throughput of transcriptome profiling techniques. furthermore, thousands of mirnas with tissue- and disease - specific expression patterns exist in humans. for these reasons, a large amount of information in addition to these kinds of research, recent studies suggested that extracellular mirnas may be used as active signaling molecules. it was reported that some mirnas released from donor cells exert regulatory effects on the mrnas in recipient cells, functioning as endocrine signals.19 unexpectedly, both precursor mirnas (pre - mirnas) and the enzymes required for mirna biogenesis were observed in the extracellular exosomes, enabling the production of mirnas inside the exosomes.20 moreover, those exosomes derived from the cells and sera of breast cancer patients could make normal cells become cancerous.20 these studies and many other reports support the hypothesis that mirna can function as a previously unidentified hormone transferring signals between distant cells.21 one simple explanation for the origin of extracellular mirnas is that the death of cells as a consequence of disease or other necrotic events results in the passive release of mirnas in the cytoplasm, and that the released mirnas are detected in the blood. although this kind of mirna release is feasible, it is likely that a regulatory pathway is also involved in the cellular release of mirnas. initial study found that the mirna profile inside cells differs from the mirna profile in the culture media, which suggests the existence of a selective pathway for the release of mirnas.14 mirnas are found in multivesicular bodies (mvbs), the cellular structure containing vesicles that are released into the extracellular space as exosomes (fig. 3a).22 later, it was shown that neutral sphingomyelinase 2 (nsmase2) is involved in the secretion of mirna - containing exosomes into the extracellular space.23 the secretion of exosomes is triggered by ceramides, whose synthesis is regulated by nsmase2. also, heterogeneous nuclear ribonucleoprotein a2b1 (hnrnpa2b1) was identified to recognize specific sequence motifs in a subset of mirnas and to regulate their sorting into exosomes.24 although these studies identified the factors involved in the release of cellular mirnas into the extracellular space, we still do not understand the detailed mechanism governing this process. the elucidation of the mechanism by which mirnas are selected to be released from donor cells, how those specific groups of mirnas are embedded inside the exosomes, and when the release of mirnas is triggered would be helpful for studies attempting to use extracellular mirnas as biomarkers in diseases. extracellular mirnas have been discovered in diverse macromolecules in the blood and other body fluids (fig. because of their small size, mirnas can be incorporated into some proteins and protected from nuclease attack. ago protein is the most prevalent such protein, because normal biogenesis results in the incorporation of mirna into the ago protein. the majority of extracellular mirnas cofractionate with ago2 protein complexes, whereas only a small portion of mirnas are encapsulated in the extracellular vesicles or exosomes in the human plasma.2526 in the bloodstream, various extracellular vesicles or exosomes circulate throughout the body. the extracellular vesicles are made by direct budding of the cellular membrane, whereas the exosomes are released from the cells as a result of the fusion of mvbs into the plasma membrane.27 early studies identified diverse mirnas in these extracellular structures (fig. 3b).2829 in addition, many following studies determined the level of those mirnas and showed that the mirna level could be used to predict whether a person has a disease or not.3 another interesting discovery was that extracellular mirnas are embedded in high - density lipoprotein (hdl).30 the expression profile of mirnas in hdl showed that the mirna population clearly differs between samples from healthy persons and samples from persons with atherosclerosis. moreover, the nsmase2-dependent pathway was noted to be involved in the release of mirna - containing hdl from the cells.30 more studies are required to determine whether the alteration of the mirna level in hdl is linked to disease progression. in a recent study, it was shown that vesicle - embedded mirnas injected into the mouse bloodstream could be distributed into diverse tissues and suppress target mrnas in recipient cells.31 moreover, direct in vivo evidence of rna exchange between cells through exosomes was presented in living mice.32 these studies confirmed that mirnas actually circulate throughout the body fluids and function in targeted cells. compared with the mechanism of the release of mirna - containing macromolecules, there are no reports regarding the mechanism of uptake. although the receptor for the mirna - containing exosomes or mirna - ago2 complexes has not been identified, it is possible that the specific uptake by target cells might be determined by the presence of a cell surface receptor for those macromolecules. it is also plausible that the specificity is determined by the existence of target mrnas in the recipient cells, because only the mrnas containing mirna - binding sites would be influenced. more research is required to elucidate the mechanism of both cellular release and uptake of mirnas. although most studies to identify mirna biomarkers use blood, plasma, or serum, mirnas are observed in most body fluids (fig. 3c).433 because different mirnas are profiled from each body fluid, researchers should select the proper fluid sample for their purpose. widespread distribution of mirnas in the body fluids suggests that mirna biomarkers could be applicable for diverse diseases. compared to currently used biomarkers, which are generally based on the levels of specific proteins in the blood, a novel biomarker based on mirna levels has several merits. one of the strongest points is that the global mirna level can be measured rapidly and accurately. current sequencing technology enables the analysis of billions of sequences in a single run with very high precision.34 the entire mirna population, which is composed of thousands of different sequences in humans, can be rapidly measured owing to high - throughput sequencing technology.35 because diverse mirnas are expressed differentially in different tissues and cellular states, the combination of mirna levels would provide a wealth of information. an early study designed to classify the origin of cancer tissues on the basis of the mirna level showed that the combination of only 48 mirnas was enough to reach near perfect accuracy in the classification of most cancer tissues.36 although a similar study has not been systematically performed using mirna levels in body fluids, it is worth trying a similar approach with the combination of thousands of mirnas in the body fluids. for a new biomarker to be utilized, it is essential to have a reagent or a method that can be used to measure the level of the marker with high specificity. compared with the technique used to detect nucleic acids, it is more laborious and time - consuming to develop a specific antibody or other kind of detection agent against a protein - based marker. on the other hand, with the help of the robust polymerase chain reaction (pcr) and sequencing technologies, there is nearly no need to develop a new agent for the detection of novel rna molecules. although various biomolecules containing useful information for a disease state may exist in a sample, they would be less reliable if the amount of starting material is too small and the quantity of the molecules can not be measured. in this sense, compared with the measurement of protein or other kinds of molecules, for which no amplification method is applicable, pcr - based amplification enables the measurement of very low amounts of mirnas in a small volume of body fluids. finally, the high stability of mirnas in the body fluids makes mirna a good candidate for a biomarker. as discussed above, mirnas in the blood are protected from nuclease - mediated cleavage. other typical longer rnas such as messenger rnas are too long to be protected inside protein complexes or small vesicles. in summary, the diversity and stability of mirnas in combination with technical availabilities establish mirnas as novel and promising biomarkers for the diagnosis of human diseases. although many new mirnas that can be used as disease markers have been identified in body fluids, more studies are needed before mirnas can be used as reliable biomarkers. one of the most critical problems in utilizing mirnas as disease markers is the lack of consistency between reports. that is, different and nonoverlapping sets of mirnas have been reported as biomarkers for the same disease. in a study that collected data from several reports in which the mirna level was measured in plasma and serum to identify breast cancer - specific markers, there were no overlapping mirnas among all the previously published papers.37 although the exact reason for this discrepancy was not scrutinized, a major reason may be methodological differences in the experimental processes.38 to enable the discovery of more useful mirna biomarkers of diseases and to increase their consistency, several methodological aspects should be considered. first, although body fluids contain diverse macromolecules of different composition, subpopulation - specific rna preparation is not considered carefully. in a previous study, for example, it was shown that mirna profiles differ considerably between serum and plasma.39 the suspected reason for this difference was that the mirnas were released from blood cells into serum during coagulation. also, different sets of mirnas are observed in different populations of extracellular vesicles and exosomes. for example, it was shown that different molecules were profiled between exosomes that were morphologically similar but that differed in surface antigens.40 extracellular vesicles of different sizes also have different contents. for example, one kind of exosome called an oncosome is larger than typical exosomes and is similar in size to platelets.41 it was reported that a specific group of mirnas enriched in the oncosome enhanced the cancer phenotype. in addition, mirnas are also embedded inside different protein complexes. because of these diversities, the mirna profile can be influenced by the choice of subpopulation in the body fluids. second, because the amount of mirnas inside the body fluids is small, the profiling of mirnas is greatly affected by minute perturbations of experimental processes. for example, we showed that mirna profiles differed considerably when the initial amounts of total rna differed, even though the same rna was used for mirna extraction.42 this is because mirnas are small in size and their secondary structures are strikingly different, resulting in different degrees of precipitation during rna extraction. because it is not easy to standardize the initial amounts of rna among fluid samples, mirnas could be extracted with different efficiency from different body fluid samples. third, there is still no proper control for the normalization of the mirna level in the body fluids. the control rnas generally used for measurement of the cellular mirna level, which include u6 small nuclear rna (snrna) and 5s ribosomal rna (rrna), do not give consistent results when used for extracellular mirna control.15 moreover, there is no known mirna with a consistent expression level among the diverse body fluids. this problem makes the quantitation of the mirna level and the comparison of mirna levels between published data difficult. to overcome the aspects described above, diverse factors should be considered during the preparation of samples and the analysis of results. standardized sampling and processing protocols are required, including sample preparation methods, rna extraction methods, and profiling platforms. in addition, one should make comparisons only between published data derived from experiments conducted with the use of the same protocol. also, detailed protocols for complete processes should be described in the text for later comparison by other researchers. because a small amount of cell debris contains a large quantity of rna molecules, it is necessary to ensure that the samples are not contaminated by blood cells during rna extraction process.43 excessive mechanical force should be avoided during the removal of cells from the blood. even after excluding the possibility of blood cell contamination, one should be cautious when the identified biomarker is one of the well - known blood cell - enriched mirnas. the suspicious mirnas originating from blood cells include mir-150 from lymphoid blood cells ; let-7a, mir-197, mir-223, and mir-574 - 3p from myeloid blood cells ; and mir-16, mir-92a, mir-451, and mir-486 - 5p from red blood cells.43 it is better to exclude these mirnas. during rna preparation from blood samples, of the anticoagulants, edta has a minimal effect on the mirna profile during the sample preparation step.38 on the other hand, heparin and citrate inhibit the pcr, which is the inevitable step for amplifying the small amount of mirnas in body fluid samples. because the plasma or serum contains diverse sets of macromolecules, results will be more reliable if researchers measure the expression level of mirnas in a specific subpopulation. possible choices of macromolecules include exosomes, extracellular vesicles, hdl, and ago protein. the main drawback in purifying a subpopulation is that the experimental process is somewhat laborious and time - consuming. to circumvent this problem,. however, controversy exists over whether the data produced from those kits are more reliable than the data obtained by the traditional ultracentrifuge - based method.44 more studies and technical advances are required to make the purification of a subpopulation easier. it would also be better if one could purify the extracellular vesicles or exosomes originating from a specific tissue, namely, a diseased tissue. it is plausible that proteins or lipids in the membrane of the vesicle may vary among those vesicles originating from different types of cells, although more studies are required to determine whether this kind of approach is feasible. some mirnas were repeatedly observed to be increased or decreased in the blood of patients with different types of diseases. for example, the level of extracellular mir-21 is known to increase in many diseases, including diverse cancer types, hepatitis, multiple sclerosis, myocardial infarction, and lupus.45 other representative mirnas with expression changes in diverse diseases include mir-16, mir-126, mir-146a, mir-155, and mir-223. in the case of mirnas included in this list, instead, the combination of expression changes based on multiple mirnas would be more reliable as a biomarker. because of the lack of proper endogenous control for normalization, it is recommended to add spike - in rnas, the rna molecules used to normalize measurements, into the same amount of body fluid samples right after the rnasedenaturation step. several rnas used for normalization such as u6 snrna or 5s rrna are much more susceptible to degradation than are mirnas. representative spike - in rna is the synthetic mirna with the sequence from organisms other than human. examples of such spike - in rnas, which are commercially available, include mir-39, mir-67, and mir-239b in c. elegans. the body fluids may contain not only the mirnas that are altered by disease states, but also other mirnas that are secreted from diverse cells for the purpose of endocrine signals. as a result, it might be difficult to distinguish the disease - specific mirna biomarkers from other molecules. in this case, the identification of mirnas that are not detected in the body fluids under normal conditions, but are detected only in a specific disease state, could be a good strategy. since the discovery of mirnas in body fluids, many efforts have been made to find reliable biomarkers for diverse diseases on the basis of the mirna level. despite many new discoveries about extracellular mirnas, however, more research is needed to increase the reliability of mirnas as promising disease markers. because the experimental method for measuring the amount of mirnas in the body fluids is still not optimized, more technical advances are needed. moreover, many gaps still remain in our understanding about the physiological role of extracellular mirnas and the mechanism of cellular release and uptake of mirna - containing molecules. with the complementation of experimental techniques and the increase in our knowledge about extracellular mirnas, the use of mirnas as noninvasive biomarkers will become an invaluable tool.	dysregulation of microrna (mirna) levels is observed in diverse disease states. early studies showed that by analyzing the expression profile of mirnas in the tissue sample of a diseased person, it was possible to classify the disease into a specific subtype. to be used for diagnostic purposes more practically, however, a less invasive method than tissue biopsy is required. surprisingly, it was discovered that a notable amount of extracellular mirnas circulate throughout the body fluids with high stability. moreover, the expression profile of mirnas was shown to differ considerably between healthy and diseased people. in addition, evidence has been accumulating of extracellular mirnas acting as signaling molecules between distantly located cells. if the expression profile faithfully reflects the disease states, the profiling of extracellular mirnas will become a useful means of early warning or diagnosis of diverse diseases, replacing more invasive biopsy methods.
patients with acute coronary syndromes (acs) showing atypical symptoms other than chest pain are frequently misdiagnosed on initial evaluation and highly likely face unfavorable prognoses such as under - treatment and poor clinical outcome (1, 2). the primary complaint of the patients with acs is characterized predominantly by chest pain. however, a substantial number of patients may have atypical or no symptoms on initial evaluation (1, 2). atypical symptom indicates that the patient 's chief complaint is not chest pain but other gastrointestinal or respiratory symptoms with less intense chest pain. the absence of chest pain at the hospital presentation was the most significant factors predicting lower use of thrombolytic therapy (2, 3), and was associated with the hospital complications and with an increased risk of hospital death compared with a typical presentation (1, 2, 5). symptoms, which are a key component in the patients ' decision to seek care, are critical to appropriate triage, and influence the decision on whether to pursue further evaluation and initiation of treatment (4). previous research showed that typical symptoms including chest pain are predictive of acs in younger patients 6 hr to present to the hospital than did those with typical symptoms (p=0.012). in terms of the risk factors that patients had, the patients presenting with atypical symptoms were more likely to have a history of diabetes and greater prevalence of co - morbid conditions but they were less likely to have hyperlipidemia compared to the patients with typical symptoms (p 6 hr to present to the hospital than did those with typical symptoms (p=0.012). in terms of the risk factors that patients had, the patients presenting with atypical symptoms were more likely to have a history of diabetes and greater prevalence of co - morbid conditions but they were less likely to have hyperlipidemia compared to the patients with typical symptoms (p<0.001). the patients with atypical symptoms had significant longer hospital stays including a stay at a coronary care unit and the score predicting hospital mortality, global registry of acute coronary events (grace) score, was also significantly higher than the patients with typical symptoms (p<0.05) (table 3). first, logistic multiple regression analysis was conducted to determine the factors for the atypical presentation in whole patient group and found that aging (included as a continuous variable ; adjusted odds ratio (or) 1.023, 95% confidence interval (ci) 1.001 - 1.046, p=0.042) and the presence of comorbidities (adjusted or 2.634, 95% ci 1.542 - 4.498, p<0.001) were independent predicting factors, but female gender (p=0.432) and a history of diabetes (p=0.131) were not associated with atypical presentation. logistic regression analyses were then conducted to determine which variables predicted atypical symptoms in younger and older groups. the logistic regressions model testing the prediction of atypical symptoms in both groups (coded as 0=typical symptom, 1=atypical symptom) were significant (=29.50, df=8, p<0.001 ; =23.61, df=8, p<0.05). the models explained 46.0% to 109.0% of variances for the younger group and 44% to 80% for the older one in the atypical symptom category (cox & snell r=0.046, nagelkerke r=0.109 ; cox & snell r=0.044, nagelkerke r=0.080). after an adjustment was made for gender and acs type, diabetes and hyperlipidemia significantly predicted atypical symptoms in younger patients (table 4). this result indicates that younger adults with diabetes have 2.5 times more chances of experiencing atypical symptoms compared with the younger adults without diabetes. on the contrary, hyperlipidemic younger adults have 50% less chances of having atypical symptoms. in the older group, the result shows that the older adults with co - morbid chronic diseases such as stroke, chronic obstructive pulmonary disease (copd), asthma, congestive heart failure or renal failure likely have 3.3 times more chances of having atypical symptoms compared with healthy older adults. accurate recognition of acs on initial presentation is a key for healthcare providers inside and outside of the hospital setting to the minimization of morbidity and mortality. in this study, older patients (13.4%) visited the hospital significantly more frequently for other symptoms without chest pain, compared with younger patients (7.8%). this is comparable with previous observational studies in which as much as 16.6% of acute myocardial infarction (ami) patients (8) and 8.4% of the ami patients enrolled in the grace study experienced no chest symptoms (1). this finding is in support of the facts that an old age is a factor affecting atypical presentation (2, 12) and typical symptoms are positive predictors of acs in younger patients (4, 5). identifying the symptoms of acs is important for successful management and especially useful as a guide to their timely treatment of those with atypical symptom presentations. we found that the patients with atypical presentations had a considerable delay in seeking care and had a worse clinical outcome such as longer hospital stay. the dominant presenting symptoms in patients with atypical presentations in this study were abdominal pain / discomforts (38.8%) and dyspnea (36.6%). the grace study involving 95 hospitals in 14 countries (1999 - 2002) reported that 23.8% of the patients presented to the hospital without chest pain were not initially recognized as having an acs and dominant symptoms were dyspnea (49.3%) and diaphoresis (26.2%) (1). they were less likely to receive effective cardiac medications, and experienced greater hospital morbidity and mortality than did patients with typical symptoms. after adjustments for confounding variables, an increase in hospital mortality rates was noted in patients with dominant symptoms of syncope, nausea and vomiting, and dyspnea (1). this study for the whole patient group demonstrated that female gender and the histories of diabetes and hypertension were associated with atypical presentation in bivariate analyses, but were not supported as predicting factors by multivariate analysis. this finding is not consistent with previous studies demonstrated that patients with atypical symptoms were more likely to be older, female, hypertensive, diabetic, and to have a history of congestive heart failure (1, 9, 10). this controversy can be explained by the bivariate analyses of this study that diabetic younger patients were more likely to have atypical presentation compared to non - diabetic younger patients (12.6% vs. 5.9%, p=0.005), but no association was found in older patients (13.6% vs. 13.4%, p=0.950). therefore, diabetes should be carefully interpreted in view of confounding variables such as age distribution or clinical characteristics and the adjustment for them using a multivariate analysis may be required for whole patient group in future study. our findings show that dyspnea, indigestion, and nausea / vomiting were more likely to be accompanied by older patients, which is similar to the previous study results (8). in contrast, older adults with ami are less likely to complain of chest pain and arm or shoulder pains, which was also consistent with previous studies (8, 11). this finding supported a previous study that typical chest pain was significantly associated with acs in younger patients (12). the dyspnea was represented as a major component of dominant complaints in ami patients without chest pain (1). the ami patients without chest pain were more likely to complain of pulmonary edema (killip class ii and iii), require drug treatment for heart failure, and have a prior history of congestive heart failure than patients with chest pain (2). this study found diabetes, which was not a predictor in the whole patient group, to be an independent predicting factor in younger patients presented to the hospital with atypical symptoms when gender and acs type were controlled for. this finding, which was consistent with previous studies that patients with atypical symptoms were more likely to have diabetes compared with patients having typical symptoms (1, 9, 10), and identified diabetes as an independent predictor of atypical presentation in women with ami (13). about 29% of those sampled for this study had suffered from diabetes, and this was slightly higher than the 25% of the ami patients with a history of diabetes in the grace study (14). previous studies reported the impacts of diabetes on the prognosis after acs such as poor clinical outcomes including heart and renal failure, cardiogenic shock, and death (14 - 21). it is proposed that physicians and primary health care nurses should educate on the management of diabetes and their possible signs and symptoms of acs for middle - aged diabetic persons at risk for cardiovascular diseases. however, younger patients with hypercholesterolemia had 50% less chances of having atypical symptoms compared with those with normal serum cholesterol levels. this finding is associated with the fact that the 74% (n=231) of the patients with hyperlipidemia were younger than 70 yr of age in this study. the finding that hyperlipidemic persons were less likely to have atypical symptoms was consistent with the result of grace study (1). this study showed that female gender and smoking had slight meaningful negative relationships, which had 14% and 40% respectively less chances of having atypical symptoms in a younger group. many previous studies supported that women were more likely to have atypical symptoms but those studies were conducted for all age group (1, 2, 6, 7). women, in this study, were distributed more than double in older group 70 yr compared to younger group (23.0% vs. 51.1%). this supports aging is a more powerful factor on the atypical presentations and female gender should be interpreted with caution for their age distribution. a significant predicting factor that helps in identifying atypical symptoms in older patients was co - morbidities that they had. this finding was consistent with a previous observational study that the presentation of an atypical symptom was significantly related with a prior history of heart failure or stroke (2). a qualitative study also supported that women with a concomitant illness thought their symptoms were normal considering their current state of health at the time of their cardiac event (22). this suggests that the recognition of symptoms on the part of older adults could be masked by concurrent illnesses and that health professionals need to be more alert on the possibility of cardiac related symptoms. this study found about 20% of the older patients sampled had comorbid diseases such as stroke, copd / asthma, or congestive heart failure. the presence of chronic and persistent diseases was significantly higher in older patients compared with younger patients, who were not affected by atypical symptoms. this greater prevalence of co - morbid chronic diseases might be associated with the fact that having diabetes was not associated with the atypical symptoms among older patients. the 64% of the older patients had hypertension or diabetes (or both), and these risk factors were adjusted for the analysis. health care providers should have more concern about diabetic younger adults, and about older adults with chronic concomitant diseases such as stroke and copd when evaluating patients with no chest pains. nurse researchers recommended the education targeting individuals at the risk of acs as well as their families is more efficient method than mass public education campaigns to reduce pre - hospital delays (23 - 25). therefore, such educational efforts should focus on enhancing awareness of any acs signs and symptoms in this highrisk group. in addition, it is to be emphasized that the management of social, cognitive, and behavioral manifestations that accompany these symptoms and contribute to the delay. further research needs to be undertaken qualitatively for acs patients with atypical symptoms who delayed presentation to the hospital to have a better understanding the pattern of symptoms and their cognitive responses to their symptoms. in korea, diabetes and hyperlipidemia significantly predict atypical symptoms in the younger patients with acute coronary syndrome. in the older patients, the co - morbid conditions such as stroke or chronic obstructive pulmonary disease are positive predictors of atypical symptoms. health care providers need to have an increased awareness of possible presence of acs in younger persons with diabetes and older persons with chronic concomitant diseases when evaluating patients with no chest pain.	patients with acute coronary syndromes (acs) who are accompanied by atypical symptoms are frequently misdiagnosed and under - treated. this study was conducted to examine and compare the factors associated with atypical symptoms other than chest pain in younger (< 70 yr) and older (70 yr) patients with first - time acs. data were obtained from the electronic medical records of the patients (n=931) who were newly diagnosed as acs and hospitalized from 2005 to 2006. the 7.8% (n=49) of the younger patients and 13.4% (n=41) of the older patients were found to have atypical symptoms. older patients were more likely to complain of indigestion or abdominal discomfort (p=0.019), nausea and/or vomiting (p=0.040), and dyspnea (p<0.001), and less likely to have chest pain (p=0.007) and pains in the arm and shoulder (p=0.018). a logistic regression analysis showed that after adjustment made for the gender and acs type, diabetes and hyperlipidemia significantly predicted atypical symptoms in the younger patients. in the older patients, the co - morbid conditions such as stroke or chronic obstructive pulmonary disease were positive predictors. health care providers need to have an increased awareness of possible presence of acs in younger persons with diabetes and older persons with chronic concomitant diseases when evaluating patients with no chest pain.
the traditional approach to low back pain (lbp) has failed as an effective treatment for lbp patients1. accordingly, some researchers have recently suggested the necessity of a patient - centered approach to lbp1. the decreased lumbar spine lordosis induces changes in spinal discs, creating abnormal pressures when absorbing shock between vertebrae, and creating stresses in spinal muscles, tendons and ligaments2, 3. flat - back syndrome is characterized by forward inclination of the trunk, inability to stand upright, and lbp pain4. therefore, the exercises for flat back syndrome include trunk backward extension and pelvic anterior tilt exercises3, 5. clinicians recommend various anterior pelvic tilt exercises for lbp with flat back in the lying, sitting, quadriped or standing positions3, 5. however, the anterior pelvic tilt motion in these positions does n't apply powerful resistance for anterior pelvic tilt muscle strengthening. the purpose of this paper was to report showed the effect of individual strengthening exercises for anterior pelvic tilt muscles on back pain, pelvic tilt angle, and lumbar rom of a lbp patient with flat back. a 37 year - old male, who complained of lbp pain in l3 - 5 levels with flat back, was participated. ethical approval was obtained from yonsei university faculty of health science human ethics committee, and the subject provided written informed consent to participation prior to the commencement of the study. he complained of continuous lbp for 10 months, and an examination revealed that his pelvis was tilted posteriorly. he had not undergone any specific treatment for his condition, which included mechanical lbp without radiating pain, and in forward flexion in the standing position with his knees fully extended, he experienced pain and stiffness in his lower back. the visual analogue scale (vas) score of this back pain was 6. pelvic inclination was measured with a palpation meter (palm ; performance attainment associates, st. the intra - test and inter - test reliabilities of the palm are greater than 0.86. the subject removed his shoes and spread his feet during the measurement, stood upright with the anterior aspect of the thighs against a stabilizing table. the sagittal plane rotation was measured with the caliper tips of the palm in contact with the ipsilateral anterior superior iliac spine (asis) and posterior superior iliac spine (psis). at the initial assessment, the anterior pelvic tilt angles were 2 and 2 on the right and left sides (normal range, 11 4), respectively. the dual inclinometer (acumar, lafayette instrument co., lafayette, usa) was used to measure the trunk flexion and extension angles. the intra - test and inter - test reliabilities of the dual inclinometer are greater than 0.8. initially, the lumbar flexion angle was 55 and the extension angle was 34. the subject performed individual strengthening exercises for the anterior pelvic tilt muscles (erector spinae, iliopsoas, rectus femoris)5. the strengthening exercise for erector spinae was as follows : stand with the feet shoulder width apart with both hands holding 5 kg weights ; then flex the trunk slowly (5 seconds) until parallel with the floor while keeping the natural arch of the back with the shoulder blades back ; then slowly return (5 seconds) to the starting postition. the strengthening exercise for the iliopsoas was an above 90 hip flexion (so - called psoas isolation) exercise for both legs with 10 kg weights. the initial position was sitting with the hips and knees flexed at 90 on a table. reciprocal flexion to above 120 hip flexion on both sides was performed with knee flexion of 90. the strengthening exercise for the rectus femoris was an 80 knee extension exercise for both legs with 10 kg weights on a nk table. the subject performed the three individual strengthening exercises for two weeks in three sets of 30 repetitions per day. after the exercise intervention, the anterior pelvic tilt angle increased, the angles were 7 and 8 on the right and left sides, compared to the initial angles of 2 and 2 on the right and left sides. the lumbar roms were increased : the flexion angle was 62 and extension angle was 45, compared to the initial flexion angle of 55 and extension angle of 34. when in backward trunk extension, the vas score of back pain decreased to a score of 3, compared to the initial score of 6. pelvic anterior tilt motion is produced by couple - force of the erector spinae, iliopsoas and rectus femoris muscles5. during anterior pelvic tilt motion, clinicians ca n't directly apply a powerful resistance to patients for strengthening of pelvic anterior tilt muscles. so, in this study, we tried prescribing individual resistance exercises for pelvic anterior tilt for a lbp patient with flat back. after the intervention, pelvic tilt angles of the right and left sides had recovered to normal ranges. the patient 's lumbar roms had increased, and the vas score of low back pain had decreased. we think that these individual strengthening exercises for the strengthening of pelvic anterior tilt muscles are an effective approach for the treatment of lbp with flat back. therefore, we suggest that individual resistance exercises are necessary for effective and fast strengthening of pelvic anterior tilt muscles in lbp with flat back.	[purpose ] the purpose of this paper is to report the effect of individual strengthening exercises for the anterior pelvic tilt muscles on back pain, pelvic tilt angle, and lumbar rom of a low back pain (lbp) patient with flat back. [subject ] a 37 year - old male, who complained of lbp pain at l3 - 5 levels with flat back, participated. [methods ] he performed the individual strengthening exercises for anterior pelvic tilt muscles (erector spinae, iliopsoas, rectus femoris). [results ] pelvic tilt angles of the right and left sides were recovered to normal ranges. his lumbar roms increased, and low back pain decreased. [conclusion ] we suggest that individual resistance exercises are a necessary approach for effective and fast strengthening of pelvic anterior tilt muscles in lbp with flat back.
steroid hormone receptors mediate hormone signaling by acting as ligand dependent transcription factors. upon ligand binding, these receptors undergo conformational changes that are coupled with specific interactions with transcriptional co - factors and/or nuclear translocation, culminating with induction of specific transcriptional programs that control diverse processes from homeostasis and growth, to reproduction, development and metabolism [robinson - rechavi., 2003 ; gronemeyer., although ligand binding is the primary regulatory signal for receptor activation, selected members of the steroid hormone receptor family require additional cellular machinery to achieve a conformation capable of responding to ligand. extensive biochemical reconstitution and functional analysis of glucocorticoid receptor (gr) have revealed an obligatory role for the molecular chaperone hsp90 in gr structural maturation and function [pratt., 1992 ; pratt., it has been proposed that gr is normally associated with the hsp90 chaperone complex in the cytoplasm prior to ligand binding. this association allows gr to achieve a structural conformation that is competent for ligand binding, nuclear translocation and consequently, gene regulation. this view is supported by the observation that treating cells with the hsp90 inhibitor geldanamycin can effectively suppress gr ligand binding and transcriptional activity [tago., however, the critical issue as to whether the hsp90-gr functional interaction is regulated and what mechanisms are involved has not yet been addressed. our recent characterization of hsp90 acetylation may have provided an answer to this important question. in a search for proteins that associate with the microtubule - associated cytoplasmic deacetylase hdac6 [hubbert., inactivation of hdac6 leads to the accumulation of acetylated hsp90, which is accompanied by a failure of hsp90 to form a stable complex with gr, or with the critical co - chaperone p23. this results in gr that is defective in ligand binding, nuclear translocation and transcriptional activity. these findings provide experimental evidence that the hsp90-gr interaction and, consequently the structural maturation of gr are indeed subject to regulation by acetylation, and implicates hdac6-mediated deacetylation of molecular chaperones as a potential novel mechanism that impinges on steroid hormone signaling [kovacs., for a number of years hsp90 has been perceived as a stress - induced protein with a more general housekeeping function. a very different picture, however, has recently started to emerge. hsp90 and its co - factors, termed co - chaperones, form molecular chaperone complexes that facilitate the structural maturation of its substrates, termed client proteins. the hsp90-assisted maturation of client proteins often leads to an enhanced activity and stability for these client proteins [pratt and toft, 2003 ]. the characterization of hsp90 client proteins led to a surprising realization that, instead of proteins with housekeeping functions, many hsp90 client proteins are critical for cell signaling, including oncogenic kinases such as erbb2 akt, raf and bcr - abl and the aforementioned glucocorticoid receptor [pratt, 1997 ]. supporting the importance of hsp90 in cell signaling, hsp90 inhibitors, such as geldanamycin, display potent biological effects, and can induce growth arrest and apoptosis in tumor cell lines [blagosklonny., the emerging significance of hsp90 in both normal and oncogenic signaling highlights the need to understand how hsp90 is regulated, the characterization of the hdac6-hsp90 interaction now identifies acetylation as one potential regulatory mechanism for hsp90 activity. traditionally post - translational modification by acetylation has been linked to histone and chromatin - dependent processes. recent evidence, however, strongly suggests that reversible acetylation can regulate important biological processes independent of chromatin [cohen and yao, 2004 ]. for example, the characterization of hdac6 has implicated protein acetylation in the regulation of microtubule dynamics, growth factor - induced chemotaxis and the processing of misfolded protein aggregates [hubbert., 2002 ; haggarty., consistent with these apparently non - genomic functions, hdac6 is mainly localized to the cytoplasm where it dynamically associates with cytoskeleton. accordingly, identifying substrates for hdac6 would be critical to decipher how hdacs might regulate non - chromatin related processes. in a search for such targets, we identified hsp90 as a substrate for hdac6 [kovacs., although it remains unclear whether hsp90 also serves as a critical mediator for the established functions of hdac6 in cell motility and aggresome formation, acetylation of hsp90, induced by inhibiting hdac6 via specific sirna or through the use of an inhibitor trichostatin a (tsa), clearly reduces gr activity. this is particularly interesting as recent reports also found that tsa treatment inhibits glucocorticoid - mediated transcriptional activity [ito., this inhibition is, however, unexpected as tsa treatment often activates gene transcription nonspecifically by inducing histone hyperacetylation. our results help to reconcile these observations and point to an effect of tsa on cytoplasmic hdac6 rather than on histones or chromatin. in the presence of tsa, hsp90 is unable to properly bind gr, thus affecting the ability of gr to illicit a transcriptional response. importantly, these findings also indicate that hsp90-mediated gr maturation is not simply a constitutive or housekeeping process ; rather, it can be regulated through hsp90 acetylation, providing another level of regulation in steroid hormone signaling. the relationship that we have characterized between reversible acetylation and gr signaling begs a series of interesting questions. one prevalent question is whether or not other steroid hormone receptors are subjected to the same regulation. evidence indicates that ar, er, and pr [fang., 1996 ; the hsp90 inhibitor geldanamycin (ga) has been reported to inhibit the activity of ar, gr, and pr [solit., 2002 ; tago., 2004 ; if these receptors indeed require hsp90 for full activity, hdac6 might turn out to be an important modulator for more than just one steroid hormone receptor. similarly, given that several prominent hsp90 client proteins are intimately linked to human cancer [neckers and neckers, 2005 ], it would be of great interest to investigate whether hsp90 acetylation is also important for the maturation and activity of these oncoproteins. the answer to these questions not only would determine whether hsp90 acetylation plays a more general role in regulating chaperone activity toward a broad spectrum of client proteins, but also point to a potential cancer therapeutic approach through the suppression of hsp90 deacetylation. although the exact nature of this ligand - induced acetylation remains to be characterized, it is tantalizing to speculate that acetylation might be coupled with the maturation of gr. for example, hsp90 acetylation might allow the conversion of gr - hsp90 from a stable complex into a dynamic one by dissociating p23 from the hsp90 complex, thereby enabling gr to enter the nucleus for transcriptional activation. as acetylated hsp90 appears to have reduced binding toward gr and p23, the subsequent deacetylation by hdac6 would then allow hsp90 to re - enter the productive chaperone complex (figure 1). interestingly, it appears that certain cellular stresses, such as those associated with the transformation from normal to oncogenic state, can also cause hsp90 chaperone complex remodeling [kamal., we speculate that acetylation of molecular chaperones might play a role in the dynamic reorganization of chaperone complexes in response to such oncogenic stress. we suspect that oncogenic stress, which might be induced by high demand for growth and proliferation-associated signaling, may lead to a spike in the levels of acetylated hsp90 due to an increase in hsp90-client proteins during robust cellular growth. under this scenario, hdac6 may then be required for robust hsp90 activity by regenerating deacetylated hsp90 and thereby ensuring effective cell signaling. this model would also argue that hdac6 might play a more important role for cells under specific stress conditions, such as oncogenic transformation induced by hsp90 client proteins. steroid hormone receptors are critical for normal development and homeostasis. over - expression or misregulation of receptors and their signaling pathways, however, can lead to a myriad of disease states. for example, aberrant glucocorticoid levels have been associated with muscle atrophy including disuse atrophy and cachexia, a disorder characterized by muscle wasting and malnutrition [hasselgren, 1999 ]. indeed, increased levels of gr signaling can induce muscle atrophy, possibly through activation of foxo transcription factors and the atrophy - related ubiquitin ligases mafbx and murf1, which are involved in the increase of cellular proteolysis associated with muscle atrophy [bodine., 2001 ; glass, 2003 ]. in the case of ar and er, it is well documented that mutations and over - expression of ar are associated with prostate cancer [rahman., 2004 ; suzuki., 2003 ] while er has been intimately linked to both the progression and metastasis of breast cancer [osborne and schiff, 2005 ]. if hsp90 acetylation plays an important role in gr, ar and/or er signaling, it is conceivable that pharmacological manipulation of hsp90 acetylation could represent a critical therapeutic strategy to abrogate aberrant steroid receptor signaling. the development of selective high affinity inhibitors similar to tubacin [haggarty., 2003 ] may allow for an attenuation of oncogenic signaling while allowing hsp90 to manage house keeping cellular activities. the dynamic hsp90 acetylation in glucocorticoid receptor function has revealed another level of regulation in steroid hormone signaling. recent evidence has come forth to suggest that acetylation of hsp90 effects atp binding [murphy., what is the identity of the chaperone acetyltransferase (which we have dubbed chat) ? is hdac6 the only hsp90 deacetylase ? how is hsp90 acetylation regulated by selective cell signaling ? is the entire population or only a selected pool of hsp90 subject to the regulation by reversible acetylation ? are there other components of the chaperone complex regulated by reversible acetylation ? by elucidating the functional relationship between acetylation and chaperone - mediated signaling in various cellular processes, we may go a long way towards understanding how we might use these mechanisms to our own advantage to battle everything from cancer to muscle atrophy. the dynamic hsp90 acetylation in glucocorticoid receptor function has revealed another level of regulation in steroid hormone signaling. recent evidence has come forth to suggest that acetylation of hsp90 effects atp binding [murphy., what is the identity of the chaperone acetyltransferase (which we have dubbed chat) ? is hdac6 the only hsp90 deacetylase ? how is hsp90 acetylation regulated by selective cell signaling ? is the entire population or only a selected pool of hsp90 subject to the regulation by reversible acetylation ? are there other components of the chaperone complex regulated by reversible acetylation ? by elucidating the functional relationship between acetylation and chaperone - mediated signaling in various cellular processes, we may go a long way towards understanding how we might use these mechanisms to our own advantage to battle everything from cancer to muscle atrophy. reversible acetylation may regulate the recycling of hsp90 in and out of functional chaperone complexes. the deacetylation of hsp90 allows for the recruitment and binding of co - chaperones such as p23, and may allow for the recruitment of other co - chaperones (y and z) such as p50, hop, immunophilins, etc (1). the formation of this chaperone complex facilitates folding of gr that is competent for ligand binding (red receptor), translocation into the nucleus and transcriptional activation. ligand binding destabilizes the gr - hsp90 chaperone complex interaction (2) and induces hsp90 acetylation by the induction or activation of the chaperone acetyltransferase (chat ; (3)). the chat may also be activated in response to other cellular stresses or oncogenic stress(3). acetylated hsp90, which has a reduced affinity for p23 and possibly for other co - chaperones (4), may further destabilize the gr - hsp90 interaction, allowing for the nuclear translocation of gr and subsequent transcriptional activation (5). note that binding of certain co - chaperones may be insensitive to the acetylation status of hsp90 (z). acetylated hsp90 is then deacetylated by hdac6 (6), regenerating hsp90 that is competent for co - chaperone(s) complex assembly (7), productive chaperone cycles, and associating with inactive gr (pink) exported from the nucleus (8). inactivation of hdac6 by tsa, tubacin or specific sirna would inhibit the regeneration of deacetylated hsp90 required for gr or selected client protein maturation (9).	glucocorticoid receptor (gr) and related steroid hormone receptors are ligand - dependent transcription factors whose regulation is critical for both homeostasis and diseases. the structural maturation of the gr has been shown to require the hsp90 molecular chaperone complex. evidence indicates that hsp90-dependent maturation is critical for gr ligand binding capacity and activity. while the role for hsp90 in gr function is well established, the regulation of this process is not well understood. here we discuss a recent finding that identifies reversible protein acetylation controlled by the deacetylase hdac6 as a novel mechanism that regulates hsp90-dependent gr maturation. we will also speculate on the implications of this finding in steroid hormone signaling, oncogenic transformation and its potential therapeutic utility.
lysosomal storage diseases comprise a group of inherited metabolic diseases caused by genetic mutations that lead to enzymatic abnormalities in the lysosome organelle. gaucher 's disease (gd) includes several clinical subtypes with a continuum of clinical findings from a perinatal lethal disorder to an asymptomatic type. the clinical diagnosis of gd currently relies on demonstration of a deficient lysosomal enzyme acid -glucosidase (glucocerebrosidase [gba ]) which is responsible for the hydrolysis of glucocerebroside (glucosylceramide) into glucose and ceramide. gba gene is the only gene in which mutations are known to cause the gd. mutations of the gene encoding -gba (gcase) cause varying degrees of decreased gcase activity. the accumulated substrates lead to organ damage of diseased individuals, particularly in the liver, spleen, bone marrow, and brain. three major clinical forms of gd are mostly distinguished by clinical manifestations, age onset, and rate of disease progression. gd type 1 is characterized by the presence of clinical or radiographic evidence of bone symptoms, hepatosplenomegaly, anemia, and thrombocytopenia, and the absence of primary central nervous systemic symptoms. mature acid - gba is a 59 kd, 497 amino acid membrane glycoprotein encoded by the gba gene (genbank accession # j03059). gba gene is localized on chromosome 1q21, spans 7.6 kb and is composed of 11 exons and ten introns. to date, more than 420 mutations have been reported in gba gene, including point mutations (missense and nonsense), deletions and insertions, splice junction mutations, frame shifts alterations, and recombinant alleles. it is not enough of these known mutations for the study of gd, and much more novel mutations remain to be discovered. in jewish descent, n370s (c.1226a > g) was found to be the most common mutation. this study aimed to discover more mutations and provide data for the genetic pattern of gba gene, which will help the development of quick and accurate genetic diagnostic tools for this disease. all procedures were approved by the institutional review board of shanghai children 's hospital, china. experiments were carried out only after written informed consent had been obtained from the parents of subjects younger than 18 years. a 5-year - old boy was full - term delivered by his mother at the age of 36-year - old with a procedure of cesarean. physical examination identified that liver was located about 3 cm under the rib cage, and spleen was located about 15 cm under the left side of the rib cage. no touch pain was observed. x - ray showed no abnormal periosteal elevation or other signs except that slight endosteal scalloping enlargement was noted. bone marrow examination revealed the presence of lipid - engorged macrophages, typical gaucher cells appeared with fibrillary crumpled silk in the cytoplasm and eccentrically placed nucleus. to confirm the diagnosis of gd the enzyme activity in peripheral blood leukocytes was 1.94 nmolhmg, about 3.529.5% of normal activity (6.5655.10 nmolhmg). genomic dna was obtained from peripheral blood leukocytes using the qiaamp dna blood mini kit (qiagen, hilden, germany) according to the manufacturer 's instructions. gba gene is localized on chromosome 1q21, its pseudogene gbap1 is 16 kb downstream of gba. the similarity of them was 55% (9750 bp/17,575 bp) with a gap of 7025 bp. we designed long polymerase chain reaction (pcr) primers shown in table 1 to distinguish gba gene from gbap1. pcr was performed as follows : dna was predenatured for 5 min at 94c, followed by 25 cycles of denaturation at 94c for 30 s, annealing at 61c for 30 s and elongation at 72c for 2 min, and another 25 cycles of denaturation at 94c for 30 s, annealing at 58c for 30 s and elongation at 72c for 3 min, finally 72c for 2 min. then, designed primers are shown in table 2 for each exon to sequence long pcr segments. primers for long fragment pcr in this study pcr : polymerase chain reaction ; gba : glucocerebrosidase. primers for sanger sequencing of gba gene gba : glucocerebrosidase. sequencing reactions were performed with sanger sequencing chemistry using the big dye terminator v3.1 cycle sequencing kit (applied biosystems inc., foster city, ca, usa) on an abi 3130 automated sequencer (applied biosystems inc. sequencing reaction conditions were performed as follows : predenatured for 1 min at 96c, followed by 25 cycles of denaturation at 96c for 10 s, annealing at 50c for 5 s, and elongation at 60c for 4 min. data from sequencing were analyzed by sequencher demo 3.0 (gene codes corp, usa) and mutation surveyor demo version 4.0 (softgenetics llc, usa) with the reference sequences from ncbi (nm_001005741.2 for gba). phylogenetic analysis was performed by clustal 1.83 programs to compare the human wild - type gcase protein sequence (np_001005742.1) with orthologs from rat, mouse, pig, sheep, and cow. we used swiss - model (http://swissmodel.expasy.org) to predict possible structural changes caused by t219a mutation and analyzed with pymol (schrdinger, japan). the further analysis of the stability of gcase was based on the prediction of the hydrophobic property of the protein by protscale (http://web.expasy.org/protscale/). the pcdh plasmid vector was digested with ecori and noti for 2.5 h at 37c and used as the target fragment. gba and pcdh plasmid were ligated with neb t4 dna ligase (neb#m0202) at 16c overnight. g and c.1448t > c were successfully obtained using the kod - plus - mutagenesis kit (toyobo, osaka, japan). the two plasmids carrying the mutated loci and a recombinant plasmid without mutations were transfected into cos7 cells (african green monkey kidney fibroblast - like cell line, cell bank of chinese academy of sciences) cultured in a 6 cm dish using polyethylenimine. collected cells after 48 h and added cell lysis buffer to collected the protein. the 20 l lysate was used to carry on western analyses using flag tag antibody (dykddddk tag) to verify recombinant plasmid could express in cos7 cells [figure 1 ]. then, other two groups wild and mutated recombinant plasmids were expressed to test enzyme activity. after transfection, cells were collected in a new 2 ml centrifuge tube with 2 ml 1 phosphate buffered saline (pbs) buffer, and then washed with 1 ml 1 pbs buffer. the mixture was centrifuged (4000 g for 2 min) to separate cells from the supernatant. the final concentration of the homogenate was 12 g/l determined by the protein quantitative analysis kit from shanghai biocolor bioscience & technology company (shanghai, china). the activity of acid - gba was measured using the artificial fluorogenic substrate 4-methylumbelliferyl - glucopyranoside (sigma, usa). mixtures of 0.2 mmol / l citrate - phosphate buffer (ph 5.5) and 0.6% (w / v) sodium taurocholate were added to the substrate for a final concentration of 5 mmol / l. twenty microliters of the homogenates were mixed with 10 l of substrate and incubated for 1 h at 37c. the reaction was stopped by adding 200 l glycine / nahco3 buffer (ph 10.5). the fluorescence was read at an excitation wavelength of 365 nm and an emission wavelength of 450 nm using 4-mu to calibrate the fluorescence spectrometer. (b) other two groups prove activity of the variant is about 77% lower than the wild. all procedures were approved by the institutional review board of shanghai children 's hospital, china. experiments were carried out only after written informed consent had been obtained from the parents of subjects younger than 18 years. a 5-year - old boy was full - term delivered by his mother at the age of 36-year - old with a procedure of cesarean. physical examination identified that liver was located about 3 cm under the rib cage, and spleen was located about 15 cm under the left side of the rib cage. no touch pain was observed. x - ray showed no abnormal periosteal elevation or other signs except that slight endosteal scalloping enlargement was noted. bone marrow examination revealed the presence of lipid - engorged macrophages, typical gaucher cells appeared with fibrillary crumpled silk in the cytoplasm and eccentrically placed nucleus. to confirm the diagnosis of gd the enzyme activity in peripheral blood leukocytes was 1.94 nmolhmg, about 3.529.5% of normal activity (6.5655.10 nmolhmg). genomic dna was obtained from peripheral blood leukocytes using the qiaamp dna blood mini kit (qiagen, hilden, germany) according to the manufacturer 's instructions. gba gene is localized on chromosome 1q21, its pseudogene gbap1 is 16 kb downstream of gba. the similarity of them was 55% (9750 bp/17,575 bp) with a gap of 7025 bp. we designed long polymerase chain reaction (pcr) primers shown in table 1 to distinguish gba gene from gbap1. pcr was performed as follows : dna was predenatured for 5 min at 94c, followed by 25 cycles of denaturation at 94c for 30 s, annealing at 61c for 30 s and elongation at 72c for 2 min, and another 25 cycles of denaturation at 94c for 30 s, annealing at 58c for 30 s and elongation at 72c for 3 min, finally 72c for 2 min. then, designed primers are shown in table 2 for each exon to sequence long pcr segments. primers for long fragment pcr in this study pcr : polymerase chain reaction ; gba : glucocerebrosidase. primers for sanger sequencing of gba gene gba : glucocerebrosidase. sequencing reactions were performed with sanger sequencing chemistry using the big dye terminator v3.1 cycle sequencing kit (applied biosystems inc., foster city, ca, usa) on an abi 3130 automated sequencer (applied biosystems inc. sequencing reaction conditions were performed as follows : predenatured for 1 min at 96c, followed by 25 cycles of denaturation at 96c for 10 s, annealing at 50c for 5 s, and elongation at 60c for 4 min. data from sequencing were analyzed by sequencher demo 3.0 (gene codes corp, usa) and mutation surveyor demo version 4.0 (softgenetics llc, usa) with the reference sequences from ncbi (nm_001005741.2 for gba). phylogenetic analysis was performed by clustal 1.83 programs to compare the human wild - type gcase protein sequence (np_001005742.1) with orthologs from rat, mouse, pig, sheep, and cow. we used swiss - model (http://swissmodel.expasy.org) to predict possible structural changes caused by t219a mutation and analyzed with pymol (schrdinger, japan). the further analysis of the stability of gcase was based on the prediction of the hydrophobic property of the protein by protscale (http://web.expasy.org/protscale/). the pcdh plasmid vector was digested with ecori and noti for 2.5 h at 37c and used as the target fragment. gba and pcdh plasmid were ligated with neb t4 dna ligase (neb#m0202) at 16c overnight. g and c.1448t > c were successfully obtained using the kod - plus - mutagenesis kit (toyobo, osaka, japan). the two plasmids carrying the mutated loci and a recombinant plasmid without mutations were transfected into cos7 cells (african green monkey kidney fibroblast - like cell line, cell bank of chinese academy of sciences) cultured in a 6 cm dish using polyethylenimine. collected cells after 48 h and added cell lysis buffer to collected the protein. the 20 l lysate was used to carry on western analyses using flag tag antibody (dykddddk tag) to verify recombinant plasmid could express in cos7 cells [figure 1 ]. then, other two groups wild and mutated recombinant plasmids were expressed to test enzyme activity. after transfection, cells were collected in a new 2 ml centrifuge tube with 2 ml 1 phosphate buffered saline (pbs) buffer, and then washed with 1 ml 1 pbs buffer. the mixture was centrifuged (4000 g for 2 min) to separate cells from the supernatant. the final concentration of the homogenate was 12 g/l determined by the protein quantitative analysis kit from shanghai biocolor bioscience & technology company (shanghai, china). the activity of acid - gba was measured using the artificial fluorogenic substrate 4-methylumbelliferyl - glucopyranoside (sigma, usa). mixtures of 0.2 mmol / l citrate - phosphate buffer (ph 5.5) and 0.6% (w / v) sodium taurocholate were added to the substrate for a final concentration of 5 mmol / l. twenty microliters of the homogenates were mixed with 10 l of substrate and incubated for 1 h at 37c. the reaction was stopped by adding 200 l glycine / nahco3 buffer (ph 10.5). the fluorescence was read at an excitation wavelength of 365 nm and an emission wavelength of 450 nm using 4-mu to calibrate the fluorescence spectrometer. (b) other two groups prove activity of the variant is about 77% lower than the wild. a novel heterozygous c.655a > g (p.t219a) mutation and a heterozygous c.1448t > c (p.l483p) were identified by sanger sequencing in this patient. the c.655a > g (p.t219a) mutation was identified in his mother, while c.1448t > c (p.l483p) was identified in his father [figure 2a ]. we found that c.655a > g (p.t219a) mutation has never been reported neither in chinese patient nor other ethnic populations. (b) amino acids on 219 and 483 are well conserved in human, rat, mouse, pig, sheep, and cow. a comparison of the human wild - type gcase protein sequence (np_001005742.1) with orthologs from rat, mouse, pig, sheep, and cow indicated that gcase was conserved at p.t219a and p.l483p [figure 2b ]. protein structure models for the wild - type and c.655a > g mutant and c.1448t > c mutant proteins were generated by swiss - model and analyzed by pymol. the c.1448t > c (p.l483p) mutation is located in domain 2 of gcase which can influence the catalytic activity of gcase by changing the stability of the protein indirectly, and c.655a > g (p.t219a) is located in domain three which contains the catalytic center of the enzyme. p.t219a does not have an effect on enzyme activity directly because there are other acid, amino residues among p.t219, loop 1, 2, 3, and catalytic center e235, e340. t219 is near the surface of the protein and turns to be more hydrophobic when threonine changes to alanine. hydroxyl of t219 could bind to k225 and c287 to form hydrogen bonding [figure 4a and 4b ]. once mutation happened, the hydrogen bonding would disappear which lead to decrease of the stability of gcase in the area that results in activity declining [figure 4c4e ]. (a and b) integral and part view of the three - dimensional structure of gcase before mutation. (c and d) integral and part view of the three - dimensional structure of gcase after mutation. t219 provides hydroxyl to form hydrogen bonds with k225 and c287 but a219 can not. (a and b) oh (hydroxyl) of t219 can promote the formation of hydrogen bonds between t219 and c287 and k225. (c - e) oh disappears after mutation (carbon atoms are green, nitrogen atoms are blue, oxygen atom are red, and hydrogen atoms are gray). after verifying that the recombinant plasmid could express gcase in cos7 cells [figure 1a ] the activity of recombinant gcase analyzed by fluorescence spectrophotometry showed that the average activity of the wild - type was 114.69 nmolhmg, while the mutation was approximately 77% lower, at 26.37 nmolhmg [figure 1b ]. these data indicated that the heterozygous point mutation we identified in gba gene led to a gcase mutation that reduced its activity. this led to the accumulation of glucocerebroside in the phagocyte system, which led to the formation of gaucher cells, induced other manifestations of gd, and eventually led to gd. a novel heterozygous c.655a > g (p.t219a) mutation and a heterozygous c.1448t > c (p.l483p) were identified by sanger sequencing in this patient. the c.655a > g (p.t219a) mutation was identified in his mother, while c.1448t > c (p.l483p) was identified in his father [figure 2a ]. we found that c.655a > g (p.t219a) mutation has never been reported neither in chinese patient nor other ethnic populations. (b) amino acids on 219 and 483 are well conserved in human, rat, mouse, pig, sheep, and cow. a comparison of the human wild - type gcase protein sequence (np_001005742.1) with orthologs from rat, mouse, pig, sheep, and cow indicated that gcase was conserved at p.t219a and p.l483p [figure 2b ]. protein structure models for the wild - type and c.655a > g mutant and c.1448t > c mutant proteins were generated by swiss - model and analyzed by pymol. the c.1448t > c (p.l483p) mutation is located in domain 2 of gcase which can influence the catalytic activity of gcase by changing the stability of the protein indirectly, and c.655a > g (p.t219a) is located in domain three which contains the catalytic center of the enzyme. p.t219a does not have an effect on enzyme activity directly because there are other acid, amino residues among p.t219, loop 1, 2, 3, and catalytic center e235, e340. t219 is near the surface of the protein and turns to be more hydrophobic when threonine changes to alanine. hydroxyl of t219 could bind to k225 and c287 to form hydrogen bonding [figure 4a and 4b ]. once mutation happened, the hydrogen bonding would disappear which lead to decrease of the stability of gcase in the area that results in activity declining [figure 4c4e ]. (a and b) integral and part view of the three - dimensional structure of gcase before mutation. (c and d) integral and part view of the three - dimensional structure of gcase after mutation. t219 provides hydroxyl to form hydrogen bonds with k225 and c287 but a219 can not. (a and b) oh (hydroxyl) of t219 can promote the formation of hydrogen bonds between t219 and c287 and k225. (c - e) oh disappears after mutation (carbon atoms are green, nitrogen atoms are blue, oxygen atom are red, and hydrogen atoms are gray). after verifying that the recombinant plasmid could express gcase in cos7 cells [figure 1a ], we further investigated the effect of the mutation through other group tests. the activity of recombinant gcase analyzed by fluorescence spectrophotometry showed that the average activity of the wild - type was 114.69 nmolhmg, while the mutation was approximately 77% lower, at 26.37 nmolhmg [figure 1b ]. these data indicated that the heterozygous point mutation we identified in gba gene led to a gcase mutation that reduced its activity. this led to the accumulation of glucocerebroside in the phagocyte system, which led to the formation of gaucher cells, induced other manifestations of gd, and eventually led to gd. it is estimated that the global morbidity of gd is between 1:40,000 or 50,000 and up to approximately 1:450 in the ashkenazi jew population. however, this treatment is expensive and not effective for patients with types 2 and 3 gd a diagnosis of gd is suspected when there is an unexplained manifestation, such as hepatosplenomegaly, anemia, thrombocytopenia, or a bone marrow smear showing gaucher cells. the diagnosis can be confirmed by reduced gba activity (usually g (maternal disease haplotype) and c.1448t > c (paternal disease haplotype) of the patient. in combination with the clinical manifestations, we confirmed the patient 's diagnosis of type 1 gd. homozygous c.1448t > c (p.l483p) had been reported early in 1987 and was related to type 2 gd. compared to patients with this compound heterozygous mutation, patients with homozygous c.1448t > c mutation developed earlier in 13 years old. the pathogenic predictions for the point mutations c.655a > g and c.1448t > c were made by mutation taster (http://www.mutationtaster.org), which indicated that it was a clear mutation type and that both were disease causing. we found changes in two amino acids that altered the primary structure of gcase, which will be discussed later. the prediction of evolutionary conservation was based on human, rat, mouse, pig, sheep, and cow. as expected, the two amino acids are well conserved in most mammals. as is known to all, mature acid -gba is consists of two chains involving 497 amino acids according to rcsb database (http://www.rcsb.org/pdb/home/home.do). gcase has three domains including domain 1 (residues 129 and 384414), domain 2 (residues 3075 and 431497), and domain 3 (residues 76382 and 425430) [figure 3a ]. catalytic center e235 and e340 and could be seen in figure 3c surrounded by loop 1 (residues 345350), loop 2 (residues 393399), and loop 3 (residues 312319). mutant c.1448t > c is located in -strand (d482m489) and changed hydrophobic -sheet of d443d445. the spatial relationships of residue 219, catalytic center, and three loops before and after mutation were analyzed by pymol [figure 3 ]. it was obvious there were residues between t219 and catalytic center as well as a219. as a result, mutation t219a did not have an effect on e235 and e340, and the cap around them. the prediction of hydrophobic property of gcase by protscale was based on kyte 's method. this would directly lead to reaction changing of acid amino between mutation sites and others. our laboratory was focused on the mechanisms of neuronopathic gd and the development of therapeutic strategies. epigenetic studies on mouse models of neuronopathic gd are in progress, and the results will contribute to our understandings of gd. this study was supported by grants from natural science foundation of china (no. 81371269) and shanghai research program (no. this study was supported by grants from natural science foundation of china (no. 81371269) and shanghai research program (no. 14140902600, no.	background : gaucher 's disease (gd) is an autosomal recessive disorder caused by a deficiency of acid -glucosidase (glucocerebrosidase [gba ]) that results in the accumulation of glucocerebroside within macrophages. many mutations have been reported to be associated with this disorder. this study aimed to discover more mutations and provide data for the genetic pattern of the gene, which will help the development of quick and accurate genetic diagnostic tools for this disease.methods:genomic dna was obtained from peripheral blood leukocytes of the patient and sanger sequencing is used to sequence gba gene. sequence alignments of mammalian -gba (gcase) and three - dimensional protein structure prediction of the mutation were made. a construct of this mutant and its compound heterozygous counterpart were used to measure gcase in vitro.results:gcase is relatively conserved at p.t219a. this novel mutation differs from its wild - type in structure. moreover, it also causes a reduction in gcase enzyme activity.conclusion:this novel mutation (c.655a > g, p.t219a) is a pathogenic missense mutation, which contributes to gd.
non - alcoholic fatty liver disease (nafld) is a major cause of chronic liver disease worldwide. the prevalence of nafld in indian population ranges from 5 to 28%, which is comparable to the west. the spectrum of nafld ranges from simple steatosis, non - alcoholic steatohepatitis (nash), to cirrhosis. although nafld is more common in subjects with obesity and diabetes mellitus (dm), it does occur in lean and non - diabetic subject. furthermore, compared to the west, indians are known to develop nafld at lower degree of adiposity. in a recent population - based epidemiological study in india, 75% of individuals with nafld were non - obese and 54% were neither overweight nor had central obesity. another recent study revealed that lean, non - alcoholic, non - diabetic, non - smoking ethnic asian indians in comparison to matched caucasians, hispanics, black and eastern asians had 2- to 3-fold increase in insulin resistance (ir) and 2-fold increase in hepatic triglyceride content. recent concepts also suggest that the magnitude of adipose tissue dysfunction may have more metabolic impact than the severity of adiposity. obesity is not only a risk factor for nafld but also determine severity of nafld. the recommended body mass index (bmi) cutoff values for asians for defining overweight (23 - 25 kg / m) and obesity (> 25 kg / m) are lesser than those of western populations. also, lower preponderance of adiposity in indian nafld is well - documented, ; however, data on clinical characteristics, metabolic profiles, and histopathological severity in patients with lean nafld in comparison to the overweight or obese nafld patients is scant. it is not clear what proportion of lean nafld in india has abdominal obesity, ir, and features of metabolic syndrome (ms). therefore, the aim of this study was to evaluate the magnitude and clinical profiles, metabolic profiles, and histopathological severity of patients with lean nafld in comparison to overweight or obese nafld, and lean healthy control without fatty liver. the diagnosis of nafld was made on the basis of characteristics real time ultrasonography features, presence of ir or features of ms, and histologic confirmation whenever possible. nafld with bmi of less than 23 kg / m were defined as lean nafld. patients using alcohol > 20 g day, patients with liver diseases of other known causes, patients on certain medications known to induce fatty liver such as estrogens, amiodarone, methotrexate, and tamoxifen were excluded. for comparing characteristics of lean nafld patients, we also included 131 lean healthy subjects with normal liver on ultrasonography as control subjects. the consent for including data for the purpose of study was obtained from each patient at the time of enrollment. patients with bmi of more than 23 kg / m were defined as overweight and those with a bmi of > 25 were labeled as obese according to asian standards. patients having at least 3 of the following 5 components : hyperglycemia (fasting blood sugar > 110 mg%), central obesity (waist circumference > 90 cm for males and > 80 cm for females), hypertension (bp > 130/85), hypertriglyceridemia (serum triglyceride > 150 mg %), and low hdl cholesterol levels (33%-66%, 3 = steatosis > 66%. fibrosis was staged from 0 to 4 : stage 0 = absence of fibrosis ; stage 1 = perisinusoidal or portal ; stage 2 = perisinusoidal and portal / periportal ; stage 3 = septal or bridging fibrosis ; and stage 4 = cirrhosis. nafld activity score was calculated in each patient as sum of the scores for steatosis (0 - 3), lobular inammation (0 - 3), and ballooning (0 - 2) ; which ranged from 0 to 8. the aspartate aminotransferase (ast)-to - platelet ratio index (apri) was calculated as ast (/upper limit of normal)/platelet count (10/l) 100. fib-4 was calculated as age ast u / l)/platelet count (10/l) alt (u / l). the nafld fibrosis score was calculated according to the following formula : 1.675 + 0.037 age (years) + 0.094 bmi (kg / m) + 1.13 impaired fasting glycemia / diabetes (yes = 1, no = 0) + 0.99 ast / alt ratio-0.013 platelet (10/l) 0.66 albumin (g / dl). median value of the successful measurements was kept as representative of liver stiffness. only te - results obtained with 10 valid measurements with a success - rate of at least 60% and an interquartile range 30% were considered reliable. normally distributed continuous variables were expressed as mean (sd), and the continuous variables with skewed distribution were expressed as median (range). categorical data was presented as proportions. for the comparison of normal covariates between bmi categories, one way anova with bonferroni correction as a post - hoc test was used. similarly, the comparisons between these groups for skewed data were performed by kruskal - wallis followed by mann whitney test with adjusted p values. comparisons for categorical variables were done using x2 or fishers test for discrete variables, wherever applicable. data were analyzed by using spss software version 15.0 (spss, chicago, il, usa), and a p 25 were labeled as obese according to asian standards. patients having at least 3 of the following 5 components : hyperglycemia (fasting blood sugar > 110 mg%), central obesity (waist circumference > 90 cm for males and > 80 cm for females), hypertension (bp > 130/85), hypertriglyceridemia (serum triglyceride > 150 mg %), and low hdl cholesterol levels (33%-66%, 3 = steatosis > 66%. fibrosis was staged from 0 to 4 : stage 0 = absence of fibrosis ; stage 1 = perisinusoidal or portal ; stage 2 = perisinusoidal and portal / periportal ; stage 3 = septal or bridging fibrosis ; and stage 4 = cirrhosis. nafld activity score was calculated in each patient as sum of the scores for steatosis (0 - 3), lobular inammation (0 - 3), and ballooning (0 - 2) ; which ranged from 0 to 8. patients with activity score 5 or more were labeled having nash. the aspartate aminotransferase (ast)-to - platelet ratio index (apri) was calculated as ast (/upper limit of normal)/platelet count (10/l) 100. fib-4 was calculated as age ast u / l)/platelet count (10/l) alt (u / l). the nafld fibrosis score was calculated according to the following formula : 1.675 + 0.037 age (years) + 0.094 bmi (kg / m) + 1.13 impaired fasting glycemia / diabetes (yes = 1, no = 0) + 0.99 ast / alt ratio-0.013 platelet (10/l) 0.66 albumin (g / dl). median value of the successful measurements was kept as representative of liver stiffness. only te - results obtained with 10 valid measurements with a success - rate of at least 60% and an interquartile range 30% were considered reliable. normally distributed continuous variables were expressed as mean (sd), and the continuous variables with skewed distribution were expressed as median (range). categorical data was presented as proportions. for the comparison of normal covariates between bmi categories, one way anova with bonferroni correction as a post - hoc test was used. similarly, the comparisons between these groups for skewed data were performed by kruskal - wallis followed by mann whitney test with adjusted p values. comparisons for categorical variables were done using x2 or fishers test for discrete variables, wherever applicable. data were analyzed by using spss software version 15.0 (spss, chicago, il, usa), and a p 2 was present in only 7.4% (n = 02) patients of lean nafld, which was significantly lower than that in overweight (40%, p = 0.05), or obese nafld (61%, p = 0.001). interestingly, 89% (n = 24) of lean nafld patients were dyslipidemic, and compared to overweight or obese, lean nafld patients had the similar serum levels of total cholesterol, hdl cholesterol, ldl cholesterol, and triglycerides. the mean waist circumference of lean nafl patients was 80.1 5.8, and as per definition, only 2 (7.4%) patient satisfied the criteria for abdominal obesity. the metabolic syndrome tended to be less common in lean nafld patients compared to obese nafld (22% vs. 64%, p 4), which was statistically similar to the prevalence of nash in overweight (47%) and obese (38%) patients with nafld. the proportion of patients with liver fibrosis was significantly lower in lean compared to obese nafld (50% vs. 84%, p = 0.01), and advanced fibrosis tended to be lower in lean than in obese nafld, but the difference did not reach statistical significance (5.6% vs. 27%, p = 0.06). because liver biopsy could not be done in all patients, various non - invasive parameters (ast / ast ratio, apri, fib-4, and nafld fibrosis score) were also used to assess severity of nafld in all patients. however, none of parameters were significantly different between patients of 3 bmi categories [table 2 ]. liver stiffness values by measured fibroscan were also similar between lean, overweight, and obese nafld patients. the characteristics of lean patients with nafld were compared to 131 non - selected lean healthy control subjects without ultrasonographic evidence of fatty liver [table 3 ]. despite being in normal range, the mean bmi of lean nafld were still higher than of lean healthy controls (21.3 0.9 vs. 22.0 0.76 kg / m, p = 0.02). also, the prevalence of dyslipidemia and ms were significantly higher in lean nafld than the lean healthy controls. among 205 nafld patients, obesity was present in 141 (68.8%) patients, 37 (18%) patients were overweight, and 27 (13.2%) patients were lean (bmi 2 was present in only 7.4% (n = 02) patients of lean nafld, which was significantly lower than that in overweight (40%, p = 0.05), or obese nafld (61%, p = 0.001). interestingly, 89% (n = 24) of lean nafld patients were dyslipidemic, and compared to overweight or obese, lean nafld patients had the similar serum levels of total cholesterol, hdl cholesterol, ldl cholesterol, and triglycerides. the mean waist circumference of lean nafl patients was 80.1 5.8, and as per definition, only 2 (7.4%) patient satisfied the criteria for abdominal obesity. the metabolic syndrome tended to be less common in lean nafld patients compared to obese nafld (22% vs. 64%, p 4), which was statistically similar to the prevalence of nash in overweight (47%) and obese (38%) patients with nafld. the proportion of patients with liver fibrosis was significantly lower in lean compared to obese nafld (50% vs. 84%, p = 0.01), and advanced fibrosis tended to be lower in lean than in obese nafld, but the difference did not reach statistical significance (5.6% vs. 27%, p = 0.06). because liver biopsy could not be done in all patients, various non - invasive parameters (ast / ast ratio, apri, fib-4, and nafld fibrosis score) none of parameters were significantly different between patients of 3 bmi categories [table 2 ]. liver stiffness values by measured fibroscan were also similar between lean, overweight, and obese nafld patients. the median levels of serum transaminases, gamma - glutamyl transpeptidase, and alkaline phosphatase were similar between all 3 bmi categories [table 2 ]. the lean compared to obese or overweight nafld patients had lower levels of serum uric acid. the biochemical parameters and disease severity (histopathology and non - invasive markers of nafld patients in all 3 bmi categories) liver biopsy was available in 110 nafld patients (18 lean, 19 overweight, and 73 obese patients). the mean nafld activity score (nas) in lean patients (3.3 1.5) was significantly lower in comparison to mean nas (4.1 1.4) in obese nafld patients (p = 0.01). however, 28% (5 of 18) lean nafld patients met criteria for nash (nas > 4), which was statistically similar to the prevalence of nash in overweight (47%) and obese (38%) patients with nafld. the proportion of patients with liver fibrosis was significantly lower in lean compared to obese nafld (50% vs. 84%, p = 0.01), and advanced fibrosis tended to be lower in lean than in obese nafld, but the difference did not reach statistical significance (5.6% vs. 27%, p = 0.06). because liver biopsy could not be done in all patients, various non - invasive parameters (ast / ast ratio, apri, fib-4, and nafld fibrosis score) were also used to assess severity of nafld in all patients. however, none of parameters were significantly different between patients of 3 bmi categories [table 2 ]. liver stiffness values by measured fibroscan were also similar between lean, overweight, and obese nafld patients. the characteristics of lean patients with nafld were compared to 131 non - selected lean healthy control subjects without ultrasonographic evidence of fatty liver [table 3 ]. despite being in normal range, the mean bmi of lean nafld were still higher than of lean healthy controls (21.3 0.9 vs. 22.0 0.76 kg / m, p = 0.02). also, the prevalence of dyslipidemia and ms were significantly higher in lean nafld than the lean healthy controls. the lean nafld comprised approximately 13.2% (n = 27) of total nafld (n = 205) patients coming to our tertiary liver care center. in various study from india, the proportion of lean nafld has been reported to vary from 11% to 31.7% [table 4 ]. the most important metabolic risk factor among lean nafld patients was dyslipidemia, which was present in nearly 90% of them. the ir as indicated by homa - ir > 2 was present in only 7.4% (n = 2) patients of lean nafld, which was significantly lower than that in overweight (p = 0.05), or obese nafld (p = 0.001). only 2 (7.4%) of lean nafld patients had abdominal obesity. however, the mean bmi, hypertension, serum lipids, fasting blood sugar, and ms among lean nafld patients were significantly higher than those in lean healthy control. body mass indices of nafld patients in indian studies compared to obese nafld, the severity of liver histopathology was significantly lower in patients with lean nafld in terms of mean nas (p = 0.01) and liver fibrosis (p = 0.01). although not statistically significant [table 2 ], the proportion of patients with nash and advanced fibrosis tended to be lower in lean nafld compared to obese nafld. however, the effect size of difference in disease severity may not be large because histopathology were not available in all patients, and severity based on non - invasive parameters were similar different between patients of 3 bmi categories. the serum level of uric acid, one of the markers of nafld severity, was significantly lower among lean nafld compared to obese nafld. although obesity is an important risk factor, nafld has been reported in non - obese subjects from developing as well as developed countries. furthermore, nafld in india had been reported to develop at lower bmi. in a population - based study from rural india,. however, majority (87%) of screened population in this study were lean, and only 7% were obese. the lower preponderance of lean nafld (13.2%) in our hospital - based cohort suggests that many of lean nafld patients do not seek medical advice. interestingly, das. also found that individuals with normal bmi (18.5 - 24.9 kg / m) had two - fold increases in risk for nafld than those with a bmi 2 was present in only 7.4% (n = 2) patients of lean nafld, and such patients had lower degree of fasting hyperinsulinemia (p < 0.001) and homa - ir (p a recent study on effect of vitamin e in patients with nafld has shown a significant improvement in liver histology without any change in the degree of ir. furthermore, various genetic factors are known to confer susceptibility to nafld in individuals without increasing the level of ir. patients with mutations in either adipose triglyceride lipase (atgl) or comparative gene identification-58 (cgi58) have severe steatosis but no ir. individuals with inactivating mutations in apolipoprotein b (apo b) gene have increased levels of hepatic triglyceride yet no ir. a genetic variant in patatin - like phospholipase 3 gene (pnpla3) that is associated with hepatic steatosis also, it must be noted that we estimated ir by homa, which is an indirect method and has limitation that it reflects only hepatic insulin sensitivity. in lean nafld, peripheral (adipose tissues and skeletal muscles) regarding environmental factors, an increased intake of dietary fat has been suggested to lead to increased accumulation of lipids in the liver of lean subjects. a higher intake of soft drinks and meat is associated with an increased risk of nafld, independently of age, gender, bmi, and total calories. the lean subjects with nafld are frequently dyslipidemic. compared to obese or overweight nafld, patients with lean nafld have minor or no insulin resistance, and appear to have less severe histological disease at presentation. they do not have abdominal obesity, but their bmi was higher than lean healthy control.	background : obesity is an important risk factor for non - alcoholic fatty liver disease (nafld) ; however, nafld does occur in lean subjects. this study was aimed to evaluate the magnitude, clinical, pathological, and metabolic profiles of nafld in normal body mass index (bmi) subjects (defined as lean nafld) in comparison to overweight or obese nafld and lean healthy control.materials and methods:336 subjects (205 consecutive nafld, and 131 healthy controls) were studied.results:among 205 nafld patients, 27 (13.2%) were lean, while 141 (68.8%) and 37 (18%) patients were obese and overweight, respectively. the lean nafld compared to obese nafld had significantly lesser degree of fasting hyperinsulinemia (p < 0.001), homeostasis model assessment insulin resistance (homa - ir, p < 0.001), and lower prevalence of diabetes mellitus (p = 0.01) and metabolic syndrome (p < 0.001). the profiles of serum lipids were similar between all 3 bmi categories, and 89% of lean nafld were dyslipidemic. compared to obese subjects, patients with lean nafld had less hepatic necro - inflammation (p = 0.05) and fibrosis (p < 0.001). however, the proportion of steatohepatitis and advanced fibrosis were similar between all bmi categories. the profiles of overweight nafld were similar to those of lean nafld, except for higher homa - ir, uric acids and male gender in overweight group. despite being lean, the mean bmi of lean nafld were still higher than unselected lean healthy controls (p = 0.02).conclusions : lean nafld patients have less severe disease, minor, or no insulin resistance, but are frequently dyslipidemic and have bmi higher than lean healthy control.
laparoscopic assisted colectomies (lac) for colon and rectal cancer have recently become more common in japan. this procedure minimizes surgical stress and has been recognized as acceptable treatment for colorectal cancer based on long - term outcome studies and a low complication rate. long - term survival after lac is similar to survival after conventional surgery, but it is more expensive in terms of surgical instruments and surgical staff. we have developed a colon - lifting method using a suture that requires only 2 operators and 3 trocars. a 12-mm trocar is inserted below the navel through a small incision and pneumoperitoneum is created. two additional trocars are placed superior and inferior to the lesion and serve as the working ports (figures 1 and 2). a 10 nylon suture is introduced into the lower abdominal cavity with a grasping needle (granee needle, r - med, inc., oregon, oh, usa) and passed through the mesocolon (figure 3). the point of penetration of the mesocolon must be at least 10 cm from the edge of the tumor to avoid tumor implantation (figure 2). the colon is retracted anteriorly using the suture, exerting slow and steady pressure to avoid injury to the vessels in the mesocolon. lymph node dissection is performed easily because countertraction can be applied at the point of incision. the stability of the working space is achieved by fixing the colon to the abdominal wall. the main nutrient vessels are divided at their origin to facilitate lymph node dissection (figure 5). one port site for the trocars is enlarged, and the lesion is removed through it. the reconstruction is intracorporal for left - sided lesions and extracorporal for right - sided lesions. this method requires only a scopist in addition to the operator. in some cases, an extra traction suture is needed for lesions of the right colon or when the left or sigmoid colon is redundant. the open circles are manipulation ports. schematic diagram showing technique for resecting a rectal cancer. the inferior mesenteric artery is divided. the sigmoid colon is lifted using the suture at least 10 cm from the edge of the tumor. a 10 nylon suture is inserted into the abdominal cavity and passed through the mesocolon. the colon is retracted anteriorly by pulling on the 10 nylon suture, placing traction on the main nutrient artery in the mesocolon ; lymph node dissection is easily performed near the inferior mesenteric artery (arrow). from april 2000 to august 2002, 52 laparoscopic colectomies were performed with this method. thirty - one patients had colon cancer in the following locations : cecum, 2 ; ascending colon, 5 ; transverse colon, 3 ; descending colon, 1 ; and sigmoid colon, 21. twenty - one patients had rectal cancer, 17 in the upper rectum and 4 in the lower. the mean operative time was 27850 minutes (range, 115 to 380 min). the mean blood loss was 137158 ml (range, 10 to 800 ml). the disease stage of primary cancer was as follows : tis, 13 ; t1, 20 ; t2, 9 ; and t3, 10. the mean number of dissected lymph nodes was 16.99.0 (range, 5 to 41). thirty - three lesions were well - differentiated adenocarcinoma, 17 were moderately differentiated adenocarcinoma, and 2 lesions were carcinoid. all patients are alive, and one patient has experienced a hepatic recurrence during a mean follow - up of 16.08.4 months (range, 4 to 33). since lac for colon cancer was first reported in 1991, its use has increased worldwide. one long - term follow - up study of lac for stage 3 colon cancer reported results comparable to those of open colectomy (oc). this study found that lac was superior to oc in terms of morbidity, length of hospital stay, incidence of recurrence, and cancer - related survival. in economic studies of diverticular disease and cancer, the total hospital costs were similar to or less than those for lac than for oc, although the operating room charges were greater for lac due to the need for many disposable items. therefore, reducing the amount of instrumentation will increase lac 's attractiveness as a surgical option. in most reports, in our technique, only 3 trocar sites were needed, and one surgeon was able to perform the laparoscopic procedure assisted only by a scopist. we selected nylon suture for the lifting tool because there are advantages in terms of medical costs and cosmesis ; nylon is a very inexpensive tool, and wound to the abdomen is very slight. our method saves 1 or 2 trocar implements, so the difference is 13,640 yen (about 114 us dollars) per operation. in japan, the surgeon 's cost is inexpensive ; it is about 3,500 yen (about 29 us dollars) per hour. the length of time for a laparoscopic procedure is about 2.5 hours, so this method saves about 8,750 yen (about 73 us dollars) per operation. a similar method has been reported previously, but our method is different in that the colon is elevated using a ligature. this method allows the beginning lac surgeon to easily understand the operative anatomy. because of suspension and fixation of the colon, the surgical field becomes stable, and the colon and mesocolon are on the same plane. the dissection line was easily placed under tension by using the grasping forceps because the colon was fixed to the abdominal wall. another concern is the risk of tumor implantation of lymph node metastasis from the mesocolon to the abdominal wall. in fact, this method seems to be more of a nontouch technique than other procedures because the colon is manipulated only at points far from the cancer. but the learning curve has become shorter lately ; it was about 180 minutes for colon cancer and 240 minutes for rectal cancer in the last 10 cases. we performed 80 traditional laparoscopic procedures that required 4 or 5 ports and 3 surgical personnel between 1993 and 2001. the mean time of all cases was 33675 minutes. from 2000, it has been 29041 minutes in the last 25 cases. so, the time of our lifting method is the same as that of the traditional laparoscopic method. a unique advantage of this method is that the operator is much less dependent on the assistant 's laparoscopic skills, giving the surgeon greater control over the operation. it is likely that the introduction of robotics to handle the laparoscope will make it possible for a single operator to perform this procedure in the future. lifting the colon using a ligature is a useful technique for performing lac with lymph node dissection.	background and objectives : laparoscopic - assisted colectomy for colon and rectal cancer causes less surgical trauma than does open colectomy. however, current methods are more costly and require highly skilled staff. in addition, the technique for lymphadenectomy has yet to be standardized. we developed a technique that uses a nylon suture to elevate the colon. this method reduces costs without compromising the completeness of the resection.methods:three trocars are introduced and a 10 nylon suture is passed into the abdominal cavity and through the mesocolon. the colon is retracted anteriorly and is fixed by this suture to the abdominal wall. the main mesenteric vessels are under tension, and lymph node dissection is performed easily. this method requires only 2 surgeons, an operator, and a scopist, because the colon is fixed to the abdominal wall. in addition, the working space is more stable because the colon is fixed to the abdominal wall. the procedure is relatively independent of the skill of the first assistant.results:from april 2000 to august 2002, this method was performed in 52 patients. the mean number of dissected lymph nodes was 16.99.0 (range, 6 to 41). nine patients had lymph node metastases (17.3%). one patient developed hepatic recurrence ; all patients are alive. no complication occurred that was related to lifting the colon.conclusions:using a suture to lift the colon is a useful method for performing laparoscopic - assisted colectomy with lymphadenectomy. this method reduces the number of surgical staff and the expense of the procedure.
in healthy people reactive oxidant species are controlled by a number of enzymatic and nonenzymatic antioxidants. approximately 8590% of patients with cystic fibrosis (cf) suffer from pancreatic insufficiency (pi), which predisposes them to malabsorption of lipids and lipid soluble vitamins leading to a deficiency of nonenzymatic antioxidants. chronic pulmonary infection of cf patients results in a chronic activation of immune cells, especially neutrophilic granulocytes, leading to a permanent production of free radicals and lipid peroxidation (lpo) products, thus triggering inflammation [36 ]. as a result, antioxidants are permanently used up in cf patients to respond to increased oxidative stress leading to a depletion of these micronutrients [79 ]. the nutritional status of cf patients is recognized as strong predictor of the severity of cf lung disease. in order to overcome pi, a high energy intake, pancreatic enzyme replacement therapy, and supplementation of the lipid soluble vitamins a, d, e, and k have become standard of care (e.g., [10, 11 ]). carotenoids are lipid soluble micronutrients which were reported to be low in the plasma of cf patients (e.g., [12, 13 ]). -carotene is one of more than 50 carotenoids present in the human diet and is known as provitamin a. -carotene is seen as the major plant source of retinol. apart from that, -carotene may act as antioxidant and is an important singlet - oxygen - scavenger in the human body. in a number of studies, -carotene supplementation in cf patients led to positive effects such as increase of total antioxidant capacity and decrease of pulmonary exacerbations [1517 ]. although the role of carotenoids in inflammation and in the pathogenesis of cf is not completely understood, it can be assumed that a low status of carotenoids has harmful effects such as those seen also for other antioxidants. however, an alternative source rich in -carotene, -carotene, and tocotrienols (the latter have antioxidant properties similar to tocopherols) is red palm oil (rpo) that is produced in areas of africa and southeast asia and believed to have beneficial health effects [18, 19 ]. since daily food can be easily enriched with rpo as shown in previous studies [20, 21 ], we speculated that rpo may be a good source of -carotene for cf patients. the aim of this pilot study was to determine if -carotene blood levels in cf can be elevated using rpo in the daily diet. second, it was investigated if an increase in plasma -carotene concentrations by rpo supplementation modulates blood levels of retinol, -tocopherol, and other carotenoids. finally, we investigated if an increase of plasma -carotene has effects on tissue concentrations of antioxidants by measuring -carotene, lycopene, -tocopherol, and vitamin c in buccal mucosa cells (bmc) in patients with cf. between november 2009 and june 2010 16 cf patients from the cf centre heidelberg, germany, were recruited to take part in the study and 11 of them completed the study successfully. 20 cf patients were primarily proven for eligibility if they fulfilled the following criteria : presence of cf disease with pancreatic insufficiency, age six years, fev1 30%, no hospitalizations because of pulmonary exacerbations six weeks prior to recruitment, absence of severe liver disease as defined by clinical findings of portal hypertension, liver cirrhosis, or liver enzymes ast or alt > 2 of the upper limit of normal. subjects were also excluded if they had diabetes mellitus requiring insulin therapy or significant anaemia (hb 9 mg / dl) or in case of pregnancy. oral supplementation of vitamins a (retinol), d, e, and k prior to and during the study was allowed according to the daily dosages recommended by the european or us american consensus guidelines [10, 11 ]. cf patients were excluded from the study if they had oral supplementation of -carotene six months prior to the study or had participated in another interventional clinical trial within 90 days prior to the first visit. the study was approved by the ethical committee of the medical faculty of the university of heidelberg (s-175/2007). informed written consent was obtained from each participating subject older than 18 years. for subjects between six and 18 years of age an age - appropriate consent was obtained in addition to the written consent signed by the subject 's parents or legal guardian. the rpo used in that study was kindly provided from the malaysian palm oil board which is an agency of the malaysian government entrusted to promote the use of palm oil products. the whole carotenoid composition of rpo was published elsewhere and is given in table e1 in the supplementary material (available online at http://dx.doi.org/10.1155/2015/817127). the daily intake within this pilot study was about ~1.5 mg of -carotene which corresponds to approximately 30 ml of rpo (~2 - 3 tablespoons). considering rpo as mixed food this amount of -carotene and also the amount of -carotene would correspond at least to 162 retinol activity equivalents. participants were advised that at least two - thirds of the oil should be used unheated, for example, in salads. less than one - third of the oil was allowed to be used for cooking or frying. the study subjects received at least 1.5 litres of rpo and could request more, if necessary for any reason, to ensure sufficient amount of rpo for the study period. the intake of the oil and possible side effects had to be protocolled daily in a patient diary. measurements of vitamins, carotenoids, and clinical parameters were performed at baseline and at the end of the rpo intervention. for analysis of antioxidants, carotenoids (lutein, zeaxanthin, cryptoxanthin, lycopene, -carotene, and -carotene) were analysed by hplc with uv / vis detection with a second uv / vis detector connected in series for quantitation of retinol (vitamin a) and -tocopherol (vitamin e) [24, 25 ]. bmc of patients were taken at baseline and 8 weeks after start of rpo supplementation at the same time points as blood samples. -carotene, lycopene, -tocopherol, and vitamin c of the bmc samples were determined by biotesys gmbh (esslingen, germany) using an accredited method according to din en iso / iec 17025 as previously described. in summary, after cleaning the oral cavity, a tooth brush was used to obtain mucosa cells by wiping 25 times over each side of the buccal epithelium. next, the tooth brush was rinsed in buffer ; the proteins of the obtained cells were precipitated and extracted. after vigorous shaking and centrifugation the supernatant was used for analyses. for storage, the samples were frozen at 80c. after thawing samples were analysed by rp - hplc using an hplc system (waters corporation, milford ma, usa)., chelmsford ma, usa), -tocopherol was analysed by fluorometric detection (2475 multi - wavelength fluorescence detector, waters corporation, milford ma, usa), and the carotenoids were detected by uv - vis absorption (2487 uv / visible detector, waters corporation, milford ma, usa). bmc antioxidant content was given per g dna, after the dna content of the cells was determined by a diphenylamine assay. all data of the study subjects are presented as single values at baseline and after intervention by rpo supplementation. a sample size calculation was done before the pilot study. based on earlier observations we expected a minimal difference in means of 0.08 mol / l and a standard deviation of 0.08 before and after intervention with rpo. considering a power of 80% and an alpha of 0.05 a sample size of 10 would have been necessary to show statistical differences (calculated with sigmastat 4.0, systat software, san jose, ca, usa). statistical comparisons were performed with wilcoxon matched - pairs signed rank test for nonparametric data. statistical significance was defined as p < 0.05 and statistical analysis was performed with the graphpad prism 6 software (graphpad software, la jolla, ca, usa). sixteen of these cf patients agreed to participate in the study and 13 patients completed eight weeks of rpo supplementation. two other subjects had to be excluded from the study because of pulmonary exacerbations during the intervention time. eleven of the 13 subjects who completed the study had taken the required daily amount of 2 to 3 tablespoons of rpo and had documented the intake properly. the other two had a poor documentation of their rpo intake and were, therefore, excluded from evaluation. the demographics and clinical characteristics of the 16 cf patients who entered the study and of the 11 cf patients who were eligible for evaluation are given in table 1. at baseline, the data are in agreement with previous reports that showed decreased carotenoid plasma concentrations in patients with cf when compared to healthy controls [7, 13, 28 ]. cf patients are at risk of developing a low status of plasma carotenoids due to pi and consecutive malabsorption of lipid soluble micronutrients as well as increased antioxidant need due to chronic inflammation and chronic lung infection. a few previous studies demonstrated beneficial effects of -carotene supplementation in cf patients [1517 ]. patients supplemented with -carotene (1 mg / kg body weight over 24 weeks) showed decreased markers of oxidative stress and less pulmonary exacerbations compared to patients taking placebo. these positive effects may be related to the antioxidant function of -carotene as well as to its function as provitamin a. in third - world countries -carotene is known to be a very important source of retinol. for that reason, a number of -carotene supplementation studies were carried out in developing countries in africa and southeast asia. one approach to supplement -carotene safely in children and pregnant women was done by using rpo. in these studies it was shown that consumption of rpo enriched food led to increased plasma retinol levels [20, 21, 29 ]. in our pilot study, rpo was used for the first time to supplement -carotene in cf patients. we show that using rpo in food over eight weeks led to increased plasma concentrations of -carotene in all but one of our 11 cf patients (figure 1). further, -carotene was increased in all 11 cf patients after rpo supplementation (figure 1). the changes of -carotene and -carotene from baseline were statistically significant (p < 0.002 and p < 0.001, resp.). notably, previous supplementation studies in cf patients used -carotene doses of 1 mg / kg body weight to raise plasma -carotene levels [1517 ]. it is therefore noteworthy that we obtained an increase in plasma -carotene and retinol levels with an rpo supplementation regimen corresponding to -carotene doses as little as ~1.5 mg total per day (range of 0.02 to 0.05 mg / kg body weight in our patients). these results suggest that rpo may represent an ideal source for -carotene for cf patients with pi. notably, this result was seen despite the parallel supplementation of vitamin a which was administered continuously to maintain vitamin a plasma values in the normal range. one explanation for that result might be that -carotene from rpo may have a much better bioavailability than vitamin a from supplements. plasma concentrations of -tocopherol (vitamin e) and the carotenoids lycopene, cryptoxanthin, zeaxanthin, and lutein did not change under rpo supplementation (figures 2 and 3). this result is important since few studies reported that supplementation of -carotene in high dosages (e.g., 20 mg / day for 6.7 years or 100 mg / day for 6 days) may lead to depletion of other carotenoids in the plasma. however, beside -carotene, these other carotenoids are also of importance because of their particular functions. two examples are lutein and zeaxanthin which were also shown to be diminished in cf patients. as a consequence, affected cf patients were reported to show a significantly decreased macular pigment density in the retina. this effect is considered to be clinically relevant because lutein, its metabolite mesozeaxanthin, and zeaxanthin are localized in different regions of the human retina serving as optical filter and antioxidant to protect the retinal tissue [34, 35 ]. to determine the impact of increased -carotene plasma levels on tissue concentrations, we used highly sensitive methods to quantify -carotene, lycopene, -tocopherol, and vitamin c in bmc. in most samples only low concentrations of these antioxidants could be detected in bmc and some samples showed concentrations below the detection limit. in a previous study, back. measured antioxidant concentrations in bmc of cf patients. they showed in their population an increase of -carotene measured in bmc after -carotene supplementation that was paralleled by a decrease of oxidative stress markers. in the present study, we did not find an effect on the concentrations of -carotene or the other antioxidants after intervention with -carotene containing rpo enriched food. we speculate that this lack of effect on tissue antioxidant levels in our study may be explained by the limited number of patients, the low dose, and the duration of the -carotene supplementation in our study. on the other hand, it would have been difficult to obtain red coloured edible oil which tastes similar to rpo. since -carotene supplementation with supplement pills in cf patients and -carotene supplementation with rpo in non - cf subjects were shown to be successful, we forwent a control group. instead, the recruited cf patients served as their own control using their serum concentrations before intervention. second, we had a relatively high dropout rate. however, cf patients are always on risk to suffer acute pulmonary exacerbations which led to exclusion from the study since this would have influenced their antioxidant status. further, cf patients are advised to take high amounts of fat - containing food. it might be possible that inclusion of rpo in the daily diet was not as easy as thought before. these reasons may have contributed to the dropout of finally five of 16 cf patients participating in the study. because these potential problems were anticipated, our recruitment goal was more than 15 cf patients to end up with at least 10 patients, as aimed for based on our sample size calculation. third, we did not see a substantial increase of -carotene or retinol in the bmc of our subjects. one reason may be seen in the generally low tissue values of antioxidants in cf patients. alternatively, the duration of -carotene supplementation was not long enough to demonstrate a beneficial effect in bmc. we, therefore, recommend longer intervention periods in future studies evaluating rpo supplementation in cf patients. enrichment of daily food with 2 to 3 tablespoons of rpo over eight weeks was sufficient to elevate -carotene, retinol, and -carotene plasma concentrations in cf patients. supplementation of daily food with rpo is easy to achieve and did not have any adverse effects. our pilot study therefore suggests that low -carotene levels in cf patients may be elevated efficiently by consumption of rpo. further studies are needed to determine (i) if this approach can be used to correct deficient retinol levels in cf patients and (ii) if food oils enriched with other micronutrients in the daily diet may be an approach to supplement other antioxidants.	patients with cystic fibrosis (cf) show decreased plasma concentrations of antioxidants due to malabsorption of lipid soluble vitamins and consumption by chronic pulmonary inflammation. -carotene is a major source of retinol and therefore is of particular significance in cf. the aim of this study was to investigate the effect of daily intake of red palm oil (rpo) containing high amounts of -carotene on the antioxidant levels in cf patients. sixteen subjects were recruited and instructed to enrich their food with 2 to 3 tablespoons of rpo (~1.5 mg of -carotene) daily over 8 weeks. carotenoids, retinol, and -tocopherol were measured in plasma at baseline and after intervention. in addition -carotene, lycopene, -tocopherol, and vitamin c were measured in buccal mucosa cells (bmc) to determine the influence of rpo on antioxidant tissue levels. eleven subjects completed the study properly. plasma -carotene, retinol, and -carotene of these patients increased, but plasma concentrations of other carotenoids and -tocopherol as well as concentrations of -carotene, lycopene, -tocopherol, and vitamin c in bmc remained unchanged. since rpo on a daily basis did not show negative side effects the data suggest that rpo may be used to elevate plasma -carotene in cf.
in many developed and developing countries, there are many concerns about being overweight and obesity ; these concerns have become a universal and comprehensive problem progressing at different ages.[14 ] according to statistics by world health organization (who), about 10% of 5 - 17-year - old school children are overweight and 3% of them are obese. in us, this number is roughly 33% (10% obese) and, in europe, it is 20% (4% obese). nowadays, obesity in childhood is considered as one of the most important health problems in europe, especially in italy, greece, and spain. according to research on obesity by lobstin and ferlot, southern european countries have the most number of overweight children. in a study done at aragon (spain), the body mass index (bmi) - old children were overweight, while it was comparatively less in 13 - 14 year - old children. moreover, in asian and middle - east countries, the matter of overweight and obese children turned out to be a universal problem so that, in the past decade, a significant and major increase in the number of overweight children has been reported.[813 ] also, in iran, as a developing country facing increasing phenomenon of industrialization and urban living, the amount of prevailing overweight children has been more than the expected percentage in recent years and, as people are aging, this percentage is increasing. as such, prevailing rate of 17% epidemic of overweight and obesity at the beginning of primary school has made iran correspondent with the big cities in europe. among the reasons of rapid overweight growth is the nutrient transition that iran experienced from 1990s onward and then it confronted an increased amount of received energy and decreased physical activity, leading to overweight during recent years. in a study by tilaki., in 2011, the amount of overweight and obesity epidemic among 7 - 12-year - old children was reported, respectively, as 12.3% and 5.8% and, in another survey done at female primary school in tehran, this amounts were reported, respectively, as 13.2% and 7.7%. in addition to the annually increasing costs imposed on world health organizations by overweight and obesity, their relationship with mortality is fairly proved and is an issue that has been evaluated and revisited many times, which in long term can affect children 's health,[1921 ] and it is more probable that the adolescents afflicted by weight issues and obesity may be obese adults in future ; however, most of these children may experience negative consequences of obesity and being overweight in next decades. nevertheless, obesity affects musculoskeletal system including lower limbs ' misalignment, fracture risk, and mobility weakness, leading to appearance of some health problems for infants and adolescents. in comparison to other children of same age, obese children are less willing to do activities.[2628 ] also, the results of a previous reports shows that obese children have problems in gait, running, and flexibility, leading to appearance of some changes in their foot structure. overweight children may suffer a flat foot probably due to increase of fat layer amount in their mid - foot. moreover, by aging, stretching power of plantar increases and flat foot problem is diminished automatically. on the other hand, if being overweight lasts for a medium or long term, the weight gaining process overcomes the stretching power of plantar and foot flatness forms at mid - foot. executed studies show physical changes in children due to obesity as it could reduce their balancing ability. berrigan., in 2006 demonstrated that body fat mass increase in adults causes decrease of their postural stability. in 2003 utilized romberg 's test in order to control posture in 13 - 17-year - old adolescents and concluded that control posture of these children is weaker than in other same age adolescents. according to the related literature, being overweight has mal - effects on children 's physical features, so it seems that also balance, as one of the most important factors of physical fitness, is affected by these features. however, since musculoskeletal system is a consolidated and interrelated collection, disorder in one of its parts affects the other parts too. hence, the researchers in this study attempted to determine if being overweight affects balance and footprint parameters. we selected 22 participants randomly and divided them equally in two groups of normal and overweight., (2000) table of bmi, which is based on age and sex. physical details of participants in normal and overweight groups at the beginning, we asked parents of the participants to fill in the personal consent questionnaire. they also filled in self - report questionnaires of health that showed no disorder in visual and vestibular balance systems, proprioceptive sensory system, and every kind of injury, especially in the lower limb. in order to record the footprint of participants, we used roll papers of 200 70 cm and gouache color, which were not harmful to their health. after explaining the protocol, in order to record static footprint, we asked participants to stand on a stamp painted with gouache and while they were gazing at the horizon, they should step comfortably by their right foot on the paper and then with their left foot. participants exercised this process several times before the final record of their footprint was done. then, we selected the best footprint after 3 repetitions and scanned it using canon 550 scanner with dpi of 200. then, we used imagej software (for 32 bit windows) to calculate the anterior area, mid area, posterior area, total area, arch index (ai). to find these information to calculate the variables of area, we considered footprint without toes [figure 1 ]. different sections of footprint for determining area variables instructions for determining the variables using software are given in analogous studies. the footprint was divided in to three sections : anterior, mid, and posterior areas. the total area was determined through sum of the area of anterior, mid, and posterior sections. the ai was determined through dividing the mid area by total area. to test the balance of participants previous studies have reported a good reliability of this test (icc = 0.85 - 0.91). when we explained the protocol to all participants, we asked them to try the test in three trials. during the test, all participants stayed on the center of the grid with a single leg while they were wearing sport shoes. we asked them to maintain this position and make their contralateral lower limb to touch as far as possible along three lines of posteriolateral, posteriomedial, and anterior. after completion of all three trials in three lines, we determined the average value of each line. to determine the total score of each participant, we divided the average value by the length of participants ' legs, which were from the anterior superior iliac spine to medial malleolus. then, we multiplied the product by 100 in order to convert it into a percent of leg length. smirnov test to make sure about the normal distribution of scores, and one - way analysis of variance (p 0.05) was used to compare the characteristics of footprint and balance of participants with overweight and normal children. the mean and standard deviation of the data of footprint and balance of participants were determined, and the results from descriptive analysis showed that the area of anterior, medial and posterior sections in overweight children was higher than in normal children (m = 4519.20, m = 2691.18, m = 3055.7, respectively). thus, the total area in this group was also higher than in the normal group (m = 10266.09). the ai was the same in both groups (normal group : m = 0.2590 ; overweight group : m = 0.2573). however, participants in the normal group had a better status in balance indices of y test in posteriolateral, posteriomedial, and anterior lines (m = 110.23, m = 106.7, m = 99.86) and, therefore, their total balance indices were higher too (m = 105.6). we used one - way analysis of variance to compare footprint characteristics and balance of normal participants and overweight participants. one - way analysis of variance to compare variables in normal and overweight groups (significant difference p.0.05) results from one - way analysis of variance between normal and overweight groups show that there is a significant difference among anterior, posterior, and total areas between overweight and normal participants (p 0.05). in addition, there was significant difference between the total areas of these two groups (p 0.05). we found a significant difference between the two groups when comparing parameters of y test in anterior line (p < 0.05). we also found no significant association between weight and balance of the participants [table 3 ]. the aim of this study was to investigate the effect of being overweight on the balance and footprint parameters of children. based on the findings of this study, there is a significant difference between parameters of footprint, anterior, posterior, and total area of the subjects, while there was no significant difference in the mid area., who carried out their study with participation of two groups of male and female students aged 11.6 0.5 years with normal and overweight characters ; the findings of this study, taking into consideration the mid area of the subjects ' feet, showed that there was no significant difference between subjects who were in normal and overweight condition, which again approves the findings of nieto., also, there is significant statistical difference in the parameter of total foot area of both groups of subjects ; this finding corresponds to that in, riddiford- harland. and nieto.[2937 ] in this study, the method of footprint was used to record the trace of foot on the paper but, in previous studies, riddiford- harland. and nieto., the methods that were applied to record the trace of foot were pedograph and photopodogram, respectively. results indicated that these methods are more reliable than the method used in the current study. after calculating different segments of the foot with method of footprint, another factor, ai, was calculated by dividing mid area of the foot on total area of the foot, which showed no significant difference between the two groups of (overweight and normal) subjects ; this does not agree with results reported by the abovementioned researchers. furthermore, another study by mickal., stated that subjects who are overweight have more noticeable ai than those with normal weight, this difference in result may be because the factor of total area between these two groups showed no significance difference based on the literature of the current study. on the other hand, concerning the mid area of the foot based on the results of balance testing that was carried out in this study, there was no significant difference between both groups of subjects, which is in contrast with the findings of goulding., which included teenage boys aged 10 - 21 years and which reported significant difference between body weight, bmi, and percent of total fat mass with balance examination. teenagers who suffer from obesity have less balance than others with a normal weight. according to these findings, bernard., reported the same result on examining obese subjects aged 13 - 17 years, stating that the existing differences between these two result could have been due to the differences between the age of subjects., was single - leg stance test on the pedograph that is a static test and can be considered as a laboratory method of balance testing. biodex was used by bernard., to assess and calculate the balance factors, the main reason of difference between the findings of this study with the current one could be due to the difference in the methods applied in these researches as the current study is based on field test method that evaluates dynamic balance of subjects. therefore, study of dynamic balance on the special devices such as pedograph may lead to different results, this attitude is relevant to specialist claim that recording of foot area in dynamic status represents more precisely the features of foot structure. in order to evaluate and define the pathology of foot structure, most of specialist use ai. according to the findings of this study, in static condition, being overweight has no significant effect on ai. further studies need to be done to survey the effect of being overweight on dynamic balance.	background : the present study was done in order to compare balance and footprint parameters in two groups of normal and overweight children.methods:this semi - experimental study included randomly selected 22 male children (11 normal and 11 overweight boys). to measure the footprint parameters, an ink paper system was used, i.e., after putting their feet in the ink, the subjects were asked to stand comfortably on paper and their footprints were recorded. then, with the use of imagej software, the areas of anterior, middle, and posterior parts, the total area, and the arch index parameter were calculated. for measuring balance in three posterolateral, posteromedial, and anterior directions as well as the total balance, y - balance test was done. finally, to analyze the data, mean and standard deviation were calculated and anova test was used to compare the parameters.results:data analysis showed a significant difference between normal and overweight subjects in the anterior and posterior areas, whereas, in balance test, only the anterior areas showed significant difference (p < 0.05).conclusions : it seems that area parameters in these two groups do not have significant difference ; hence, it can not be used as the criteria for analyzing the effects of being overweight on these parameters. in addition, it is probable that, in a dynamic situation, recorded footprints are more valid parameters for analyzing foot structure.
gliomas are the most common primary brain tumour, and gbm accounts for up to 70% of cases. the prognosis is poor, and while adjuvant cranial irradiation has been shown historically to significantly improve survival rates [1, 2 ], the treatment of patients with gbm remains challenging. the median survival for patients with gbm treated with postresection radiation alone has been of the order of 11 months. recent advances in chemotherapy have increased overall survival to around 14.6 months with 26% survival at 2 years with the addition of concurrent and adjuvant temozolomide. this improvement in survival is even greater for those patients with favourable molecular profiles. in the phase 3 trial from the european organisation for research and treatment of cancer published by hegi., there was a 46% 2 year survival for those patients who had epigenetic silencing via methylation of the promoter of the gene which metabolises temozolomide (o-6-methylguanine - dna - methyltransferase, mgmt). while these advances in systemic treatment, cancer genomics, and the availability of highly conformal treatments such as imrt are encouraging, they have not fully translated into clinical practice for treatment of these challenging tumours. while there have been a small number of contemporary series employing conventionally fractionated imrt published to date [6, 7 ], the dosimetric advantages of imrt have not translated into an improvement in reported survival. however, the presence of a small number of long - term survivors, the resultant increase in clinically evident radiation - related late neurocognitive effects, and the promising utility of imrt at other treatment sites justify further investigation in the management of glioblastoma multiforme. this retrospective study from our centre reports a consecutive contemporary series of patients treated with either conventionally fractionated imrt or hypofractionated imrt for those with poor performance status. following institutional review board approval, the electronic medical records of eligible patients with histologically proven gbm who were treated with imrt were reviewed. all patients underwent computed tomographic (ct) simulation and were immobilised using a commercially available thermoplastic mask system. ct image data was reconstructed in 2 mm slice thickness and then coregistered with preoperative and postoperative magnetic resonance imaging (mri). treatment volumes were as per our institutional protocol based on the australian cancer network clinical practice guidelines for the management of adult gliomas. the gross tumour volume (gtv) was defined as the enhancing lesion on t1 postgadolinium and t2 flair mri sequences. the clinical target volume (ctv) included the gtv with a 2 centimetre expansion, constrained by anatomical boundaries. planning target volume was delineated as the ctv plus a concentric expansion of 5 mm. all patients were treated to either 40.05 gy or 60 gy prescribed to the international commission of radiological units and measurements reference point using a single phase imrt technique. all patients underwent inverse planning on the xio treatment planning system (elekta, crawley, uk) and patients were treated with a five - field technique. the median prescribed dose for all patients was 60 gy (range 40.05 gy to 60 gy). all patients who received concurrent temozolomide received 75 mg / m daily during imrt and received temozolomide 150 mg / m for five days in each 28-day cycle for six cycles following completion of imrt with doses increasing to 200 mg / m as tolerated. baseline toxicity prior to initiation of imrt and on treatment toxicity was available for all patients. toxicity was prospectively assessed according to the common terminology criteria for adverse events (ctcae) v3.0 and later v4.0. no patient had grade 4 or grade 5 toxicity at any time, and the most commonly reported events were grade 2 cognitive disturbance, grade 2 concentration impairment, or grade 1 headache. no patient required amendment of their treatment plan due to any acute toxicity which could be ascribed to their treatment. all patients had baseline toxicity assessment prior to initiation of imrt and were seen weekly with weekly toxicity assessment on treatment. patients were offered reoperation or retreatment with temozolomide or enrollment in a clinical trial on progression. of 20 patients who had progressed at the time of analysis, 2 patients had reoperation alone, 1 patient had reoperation followed by bevacizumab therapy, and 1 patient was treated with carboplatin combined with bevacizumab. the remaining patients died of disease without further intervention and no patient underwent reirradiation in this series. progression - free survival was measured from the date of diagnosis to the first clinically evident date of radiologically proven progression or date of death in those patients who had not been diagnosed with progression of disease. survival curves were generated according to the kaplan meier methods and compared using the log rank test. all analyses were conducted using the stata 11 statistical software package (statcorp, college station, tx, usa). from april 2007 to june 2012, there were 31 patients with histologically proven gbm who underwent imrt at the north coast cancer institute. all patients had prior neurosurgery, of whom 3 patients (9.7%) had biopsy only, 9 patients (29%) had subtotal tumour resection, and 18 patients (58.1%) had gross total tumour resection. of the 31 patients, 19 patients (61.3%) received 60 gy at daily doses of 2 gy and all but one of these patients received temozolomide as per the current standard of care. the remaining 12 patients (38.7%) received 40.05 gy at daily doses of 2.67 gy, because of poor performance status (eastern cooperative oncology group score 2) or patient preference. of the 12 patients who received hypofractionated treatment, 6 patients were enrolled on a clinical trial which randomised elderly patients to temozolomide and hypofractionated radiation versus hypofractionated radiation alone, of whom 5 patients received temozolomide. of the 31 patients, 19 (61.3%) were deceased at the time of last followup and 1 patient was alive with disease, with a median follow - up time of 9.4 months (range 3.231.6 months). the median survival was 17.4 months for those receiving 60 gy and 7.3 months for those receiving 40.05 gy (p = 0.0006, log rank and wilcoxon analysis, figure 2), which is likely due to the more favourable patient characteristics of the group selected to receive 60 gy. the difference in overall survival according to extent of surgical resection was also statistically significant (p = 0.034, figure 3). a median progression - free survival of 9.1 months was observed for the entire group, and the difference in progression - free survival between those receiving 40.05 gy and those receiving 60 gy was statistically significant (p = 0.005, figure 4). to our knowledge, the current series represents one of the largest published series of patients with primary gbm treated with imrt combined with temozolomide chemotherapy in the modern literature. our series employed a standardised imrt technique and temozolomide chemotherapy schedule, and those patients receiving 60 gray had a median overall survival of 17.4 months. while this is a retrospective series subject to the usual biases, this still compares favourably to previously published series of three - dimensional conformal radiation and temozolomide, irrespective of mgmt methylation status as this was not available for our patients. in the paper by stupp and colleagues, median overall survival was 14.6 months for those patients on the combined radiation therapy and temozolomide arm, independent of mgmt methylation status. the multimodality care of patients with glioblastoma multiforme has been evolving for the last several decades, but prognosis remains poor. regarding systemic therapy, the use of concurrent and adjuvant temozolomide combined with cranial irradiation compared to irradiation alone has been shown to significantly improve overall survival. advances in the field of radiation therapy have been the addition of cranial irradiation to debulking surgery alone, the establishment of a dose response relationship, and the use of altered fractionation schedules. these altered fractionation schedules have included abbreviated hypofractionated schedules in those patients with gbm with poor performance status and dose escalation strategies, with the latter producing mixed results [13, 14 ]. employed an integrated boost imrt technique in which 72 gy at 2.4 gy per fraction was prescribed to a clinical target volume derived from positron emission tomography scans. median overall and progression - free survival were 14.8 months and 7.8 months, respectively. in a radiation therapy oncology group phase one study, tsien. employed a sequential conformal boost technique to evaluate four dose levels ; 66 gy, 72 gy, 78 gy, and 84 gy. median overall survival at 19.3 months was highest for those patients receiving 84 gy with planning target volumes less than 75 cm. a number of studies have been published which investigated the use of conventionally fractionated imrt but in contrast to the current series described heterogenous populations. fuller. reported the use of tomotherapy, either for the entire treatment course or as a boost following three - dimensional conformal radiation therapy. however, a number of patients were treated for recurrent disease, and the use of chemotherapy was variable. of a total of 42 patients described, only 7 patients received imrt with temozolomide. fuller. reported a median overall survival of 8.7 months and cautioned against the use of imrt in this population. reported a series from memorial sloan kettering cancer centre of 58 patients with high grade gliomas which included 41 patients treated for glioblastoma multiforme. in that series, one - quarter of patients had biopsy only and 80% of patients received adjuvant or concurrent chemotherapy. it is not clear what proportion of these patients had glioblastoma multiforme and the type of chemotherapy was not specified. the median progression - free survival and median overall survival in their study was 2.5 months and 9 months, respectively. dosimetric comparison of imrt and 3dcrt plans showed that imrt did not yield clinically significant advantages in terms of planning target volume coverage. this might be expected, as contemporary conformal techniques give good target coverage, irrespective of intracranial tumour location. imrt did offer an advantage in terms of reducing dose to critical normal structures and reduced dose to normal brain. this reduction in dose to critical normal structures as well as a reduction in integral dose to normal brain tissue has also been replicated in planning studies comparing imrt to 3dcrt. this has also been demonstrated in studies of imrt at other disease sites, including head and neck cancer and prostate cancer. the outlook for patients with glioblastoma multiforme is improving incrementally, in part due to an increasing armamentarium of biologically active drugs, which include integrin inhibitors and antiangiogenic agents. these developments, in combination with greater knowledge of glioblastoma genomics and proteomics, better neuroimaging modalities including functional imaging, more targeted surgical techniques, and evolving radiation therapy technology, are increasing the proportion of patients, however small, that are becoming long - term survivors. as in our study, the combination of imrt at standard radiation doses with temozolomide can lead to an increase in median overall survival. it is likely that the biggest contribution of imrt will be for those long - term survivors in the prevention of long - term neurocognitive morbidity which may be achieved by a reduction in dose to critical normal structures and normal brain tissue, even while escalating dose to the planning target volume. we conclude that imrt may thus facilitate a therapeutic gain for patients with glioblastoma multiforme.	purpose. glioblastoma multiforme (gbm) is optimally treated by maximal debulking followed by combined chemoradiation. intensity modulated radiation therapy (imrt) is gaining widespread acceptance in other tumour sites, although evidence to support its use over three - dimensional conformal radiation therapy (3dcrt) in the treatment of gliomas is currently lacking. we examined the survival outcomes for patients with gbm treated with imrt and temozolomide. methods and materials. in all, 31 patients with gbm were treated with imrt and 23 of these received chemoradiation with temozolomide. we correlated survival outcomes with patient functional status, extent of surgery, radiation dose, and use of chemotherapy. results. median survival for all patients was 11.3 months, with a median survival of 7.2 months for patients receiving 40.05 gray (gy) and a median survival of 17.4 months for patients receiving 60 gy. conclusions. we report one of the few series of imrt in patients with gbm. in our group, median survival for those receiving 60 gy with temozolomide compared favourably to the combined therapy arm of the largest randomised trial of chemoradiation versus radiation to date (17.4 months versus 14.6 months). we propose that imrt should be considered as an alternative to 3dcrt for patients with gbm.
obesity is a major public health problem, with a prevalence of 10% to 20% in western europe. obesity is characterized by both a large increase in body weight and an increase in body fat exceeding standard measures. currently, obesity is classified on the basis of body mass index (bmi), and patients with bmi > 30 kg / m are considered obese. a bmi > 30 kg / m has a negative impact on health and is associated with premature atherosclerosis, increased risk of myocardial infarction, and heart failure. severe obesity is associated with decreased survival, largely because of cardiovascular deaths [3, 4 ]. most echocardiographic studies assessing left ventricular (lv) systolic function in obese patients used ejection phase indices like lv ejection fraction and lv fractional shortening. they reported normal or hyperdynamic lv systolic function and no or little differences in lean and obese subjects [5, 6 ]. impaired lv systolic function in persons with obesity was only found in the presence of coexistent heart disease. more recent echocardiography technics like tissue - doppler and strain imaging have revealed evidence of subclinical lv systolic dysfunction in subjects with obesity, even in the presence of normal lv ejection phase indices [8, 9 ]. alterations in cardiac function have also been shown to be reversible with weight reduction strategies [10, 11 ]. weight loss after interventions like bariatric surgery and dietary weight reduction can be beneficial to cardiovascular structure and function and result in a decrease in cardiovascular risk and total mortality [1214 ]. the purpose of this study was to examine systolic left ventricular function and the effect of diet - induced weight loss in patients with severe obesity by transthoracic two - speckle - tracking echocardiography (ste) with lv strain imaging. the study was approved by the ethics committee of the state medical council of hessen, germany (approval number ff 112/2015). all patients were participants in the optifast-52 diet program (nestl health science, frankfurt, germany), which ran for a total of 52 consecutive weeks. the specifics of the program included a fasting phase of 12 weeks with ingestion of food restricted to formula products with a high protein content. a subsequent transitional phase and a final stabilization phase aim to introduce the patients to a balanced diet. for the duration of the program, all patients received psychological, physiotherapeutic, medical, and nutritional care. inclusion criteria were as follows : age 18 and 65 years, bmi > 30 kg / m, secondary and accompanying conditions requiring treatment such as hypertension, hypercholesterolemia, diabetes mellitus, and illnesses of the locomotor system. all patients had made repeated (at least three) unsuccessful attempts to reduce weight. exclusion criteria were cardiac arrhythmia, recent myocardial infarction, severe (malign) general illnesses, pregnancy and nursing, or a documented eating disorder. total body composition and fat content was also measured using the dual energy x - ray absorptiometry (dxa) in week 1 and in week 12. echocardiography was performed using a commercially available ultrasound machine (vivid 7, ge healthcare, horten, norway) and a 3.5 mhz (3s - rs) transducer. patients were examined in a resting, left - lateral position and, for specific parts of the examination, in end - expiration by an experienced examiner. all images were obtained from standard parasternal and apical position using 2d and m - mode echocardiographic techniques. lv ejection phase indices like lv ejection fraction and fractional shortening were calculated from parasternal m - mode measurements. two - dimensional ste analysis was performed offline using dedicated automated software (echopac pc, version 6.0, ge healthcare, horten, norway). from the apical and parasternal short - axis datasets, the software divided the lv into six segments and performed speckle - tracking analysis throughout one cardiac cycle. finally, the software automatically created the time - domain lv strain curves in six segments, from which end - systolic strain was calculated. global longitudinal peak systolic strain (glps) was defined as the averaged longitudinal strains at end - systole in 18 segments from three apical views. global radial strain (grs) was defined as averaged radial strain at end - systole in 18 segments from three levels of short - axis views. dxa is a common measurement of human body composition based on a three - compartment model. it divides the body into total body mineral, fat - free soft mass, and fat tissue mass. body composition was evaluated by dxa with the use of a hologic densitometer (qdr discovery wi, hologic inc., measurements were taken with the patient lying in the supine position on the scanning table. the results are expressed as mean standard deviation (sd) for continuous variables. for the descriptive statistics, the arithmetic mean, sd, median, minimum and maximum, and first and third quartiles were calculated. for the comparison of two measurements at different times, statistical analyses were performed using a statistical software package (bias for windows, version 11.0). body weight decreased significantly from week 1 to week 12 of the weight loss program (figure 2). the number of patients with arterial hypertension defined as blood pressure > 140 mmhg systolic and > 90 mmhg diastolic decreased from 9 patients to 1 patient. mean systolic blood pressure was significantly reduced from 148 16 to 130 17 mmhg and diastolic blood pressure from 95 14 to 82 9 mmhg. the mean heart rate also decreased significantly from 94 16 to 82 9 beats per minute, respectively. total body fat mass decreased by 19% (mean) from 50.9 20.9 kg to 41.1 16.9 kg. changes in fat distribution resulting from the 12 week fasting phase are reported in table 2. grading of the image quality before weight loss was good in 9, moderate in 7, and poor in 5 patients. after weight loss, image quality improved to good in 11, moderate in 7, and poor in 3 patients. lv ejection phase indices, lv ejection fraction and fractional shortening, were within normal range at baseline and remained unchanged after weight loss (table 3). glps at baseline was 18.7 3.2 in week 1 and 18.8 2.4 in week 12 (figure 3). no significant correlation was noted between glps and bmi (r = 0.36, p = ns). we found a weak but not significant correlation between percentage weight loss and increase in glps (r = 0.39, p = ns). also, no significant change in grs after weight loss was noted (41.1 22.0 versus 43.9 23.3, p = 0.09). the left atrial diameter (anterior - posterior) measured in the parasternal long - axis view weight reduction after 12 weeks of diet was associated with a decrease in left atrial size, but the difference was not significant (table 3). left atrial volume, lv wall thickness, and lv end - diastolic diameter were within normal range at baseline and remained unchanged after weight loss. variable findings have been reported with respect to systolic function in obese subjects, including preserved or mildly reduced left ventricular function. interestingly, these alterations have been shown to be reversible with weight reduction therapies [10, 17 ]. lv ejection fraction appears to be clinically the most relevant parameter. however, lv ejection fraction has some limitations. the most important, it is not sensitive enough to detect subtle alterations in the contractile function and therefore not suitable for detecting subclinical myocardial damage. in some studies, tissue - doppler echocardiography has been able to show the presence of subclinical systolic contractile abnormalities, although the left ventricular ejection fraction remained within the normal range [8, 9, 1922 ]. two - dimensional ste is a new gray - scale based technique that provides angle - independent measurements of myocardial deformation and has the potential for quantitative assessment of systolic left ventricular function [18, 23 ]. speckles are produced as a result of the scatter of the ultrasound beam by the tissue. by tracking frame by frame the displacement of the speckles during the cardiac cycle, strain, software automatically resolves the magnitude of myocardial deformation in different directions and generates strain. strain is the percentage change in the length of a myocardial segment during a cardiac cycle and has the unit %. in the present study, lv ejection phase indices, lv ejection fraction and fractional shortening, were normal at baseline and unchanged at follow - up. also, systolic left ventricular function quantified by glps and grs was normal. we found glps and grs values in a range comparable to values defined as normal in a large meta - analysis including 2,597 subjects from 24 studies. other studies in obese individuals without cardiac disease reported similar lv ejection fraction but worse systolic mechanics as assessed by glps when compared with nonobese controls [2527 ]. a recent study by leung. found a significant improvement in both systolic and diastolic myocardial function measured by longitudinal strain in obese patients with type 2 diabetes and weight loss 9 months after sleeve gastrectomy. a behavioural intervention program including dietary restrictions and exercise training in obese patients found an increase in strain measured by tissue - doppler myocardial imaging in patients with significant reduction of weight after 6 months. in contrast to other studies we could not find a significant increase in glps or grs after weight loss. this might be due to a shorter follow - up period, a lower rate of concomitant diseases, and different weight loss strategies [30, 31 ]. in moderate - to - severe cases of obesity, increased cardiac output as a result of the high metabolic activity of excessive fat may lead to left atrial and ventricular dilation, increased lv wall stress, and compensatory (eccentric) lv hypertrophy [32, 33 ]. in the present study, mean lv diameter and thickness of the lv wall were normal at baseline and remained unchanged after 12 weeks on the diet. an echocardiographic study in obese patients with a bmi of 50.0 1.4 who underwent bariatric surgery reported a decrease in lv dilatation and hypertrophy after a longer follow - up period of 13 4 months. other studies have also shown a decrease in lv mass and size one to three years after weight reduction interventions [7, 35, 36 ]. similar findings were reported in patients with obesity after gastric bypass surgery [36, 37 ]. lifestyle and diet therapies have demonstrated some cardiovascular benefits. the data from a number of recent meta - analyses, however, suggests that bariatric operations result in larger benefits to cardiovascular risk parameters than other weight loss therapies. however, no randomized controlled trials currently exist comparing the effects of bariatric surgery with standardized nonsurgical treatments, specifically focusing on cardiovascular end points. the small number of the study groups limits interpretation of the results, in particular p values. we were unable to demonstrate cardiac changes due to obesity such as lv hypertrophy and enlargement or atrial dilatation as described by other authors. however, patients in our group were relatively young (mean age 43 years) in terms of the risk of other causes of structural cardiac abnormalities. glps measured by ste in order to determine systolic function is in part heart rate and blood pressure - dependent and is subject to change within any given patient. finally, when studying people with obesity, echocardiographic measurements may be error - prone or imprecise. in our study, obesity was not associated with systolic dysfunction measured by ste with strain imaging. dimensions of left atrial and ventricular structures were normal at baseline and not altered after weight loss. diet with successful weight reduction goes along with reduction in blood pressure and heart rate.	obesity is associated with an increased risk of heart failure. little is known about the impact of dietary changes on the cardiac sequelae in obese patients. twenty - one obese subjects underwent a 12-week low calorie fasting phase of a formula diet. transthoracic two - dimensional speckle - tracking echocardiography was performed to obtain systolic left ventricular strain before and after weight loss. body mass index decreased significantly from 38.6 6.2 to 31.5 5.3 kg / m2, and the total percentage fat loss was 19%. weight reduction was associated with a reduction in blood pressure and heart rate. left ventricular longitudinal global peak systolic strain was in the lower normal range (18.7 3.2%) before weight loss and was unchanged (18.8 2.4%) after 12 weeks on diet with substantial weight loss. also, no significant change in global radial strain after weight loss was noted (41.1 22.0 versus 43.9 23.3, p = 0.09). left atrial and ventricular dimensions were in normal range before fasting and remained unchanged after weight loss. in our study obesity was associated with normal systolic left ventricular function. a 12-week low calorie diet with successful weight loss can reduce blood pressure and heart rate. systolic left ventricular function and morphology were not affected by rapid weight reduction.
breast cancer is most commonly diagnosed nonskin cancer in women and represents the second leading cause of cancer death in women of all ages and the leading cause of cancer mortality in women between 20 and 59 years of age. early detection of breast cancer has been demonstrated to significantly decrease breast cancer mortality, even in women 40 - 49 years of age, despite the lower incidence of disease in younger cohorts. although the mortality benefits of early cancer detection by screening mammography are indisputable, quantitative and qualitative limitations of mammographic technique, including the large size of lesions at initial detection and challenges of resolving subtle soft - tissue changes suggestive of cancer, are well documented in the literature. in order to improve sensitivity and specificity of detecting and characterizing breast cancer technologies as varied as digital breast tomosynthesis and molecular breast imaging techniques such as positron emission mammography are presently under development, as are improvements in existing modalities such as ultrasound. cone - beam breast computed tomography (cbbct) provides an additional imaging technique with a unique subset of advantages for diagnostic breast imaging. this study represents a continuation of our earlier investigation, now turning our attention to the imaging of biopsy - proven pathology in mammographic lesions with high probability of malignancy by accepted mammographic and/or sonographical criteria. all lesions in this study were categorized under the breast imaging reporting and data system (bi - rads) as category 4 or 5 lesions. in the present study, our minimum acceptable benchmark in terms of radiation dose and lesion visualization firstly, the radiation dose administered by the device and our protocol needs to be no greater than the dose from diagnostic mammography, the present standard of care in evaluation of lesions detected during screening mammography or clinically suspected in women over the age of 40. secondly, as a roentgenographic technique, cbbct must offer, at a minimum, equivalent visualization of lesions identified in standard - of - care diagnostic mammography. we did not limit our evaluation to mammographic lesions ; however, several patients with similarly high - risk sonographical lesions not identified in diagnostic mammography were also included in our analysis. thirdly, if cbbct is to have a role in further evaluating mammographical lesions, it must be capable of providing additional advantages to the mammographer and the patient in the evaluation of breast disease to warrant continued development of a new technology. in addition to noting perceived advantages in the use of cbbct in the evaluation of a variety of breast lesions in a range of breast compositions, we surveyed patients on the relative comfort of cbbct relative to conventional mammography. this study was conducted at the university of rochester medical center (urmc) - highland breast imaging center, rochester, ny, from july 2006 to august 2008 under an irb approved protocol with informed consent from each patient prior to cbbct imaging and inclusion in this study. this was a prospective study in which patients undergoing diagnostic breast imaging for abnormal screening mammograms or palpable breast abnormalities were invited to undergo cbbct in addition to standard - of - care diagnostic mammography or ultrasound. thirty - six consecutive subjects with ages ranging from 41 to 77-year old (mean, 56.0 yrs 9.8 sd) with bi - rads 4 or 5 findings on diagnostic mammography or ultrasound underwent cbbct in addition to the standard additional diagnostic mammographic views, where appropriate. most patients received cbbct scan the same day as diagnostic mammography, and all were scanned within one week. thirty - five (35) subjects had unilateral findings and one (1) had bilateral findings, resulting in a total of 37 breasts studied. a variety of breast densities (as defined by bi - rads) and types of mammographic and/or sonographic abnormalities were represented. the number and type of additional mammographic views and use of ultrasound varied according to the patient 's presentation and screening findings. each patient subsequently underwent percutaneous stereotactic or ultrasound - guided biopsy and the pathology reports were reviewed and correlated with the imaging findings. images were obtained according to our standard cbbct protocol, as previously reported. in brief, the real time flat panel detector (fpd)-based cbbct system consists of the following : a ct gantry (geometrically optimized for breast imaging), a special high - power mammography x - ray tube (with a 0.3-mm focal spot size) (rad71sp, varian medical system, salt lake city, ut), an x - ray flat panel detector (fpd) (paxscan 4030cb, varian medical system, salt lake city, ut) mounted on the gantry, an ergonomically designed patient table, and a personal computer (pc). the fpd is designed especially for cone - beam ct applications with a real - time dynamic gain mode with 0.388-mm pixel pitch (22 binning) and an image acquisition rate of 30 frames per second (fps). the panel has an inherent pixel depth of 14- bits that is extended to > 16-bits in the dynamic gain mode. the diameter of the patient table opening is 39 cm with a maximum imaging volume of 28 28 16 cm ; various inserts are used to optimize patient comfort and positioning. the subject was placed on the imaging table in the prone position in a left or right anterior oblique position so that the targeted breast was suspended through the table opening into the image acquisition field with no external compression. a radiological technologist, registered in radiography and mammography through the american registry of radiologic technologists (arrt) and trained in cbbct acquisition, positioned the subject using laser cross - hairs. for a single continuous acquisition scan, the real time fpd - based prototype acquires 300 two - dimensional projection images (1024 768 14 bits / projection) by rotating the x - ray tube and the fpd 360 around the breast located at the rotation center in 10 seconds. x - ray pulses are 8 milliseconds in duration at 30 hertz (hz). a pc computer controls the operation of the prototype, including the gantry rotation, kvp, ma, x - ray pulse width, and projection data acquisition. the pci - bus - based frame grabber is synchronized to the fpd and programmed to allow the image data to flow directly into memory for real time data acquisition. once all of the projection data are acquired from a single scan, the two - dimensional projection images are stored on the hard drive for subsequent image processing, 3d reconstruction, and visualization. reconstructed cbbct matrices of the breast images were loaded into the specialized 3d visualization software (visage cs thin client / server, visage imaging, carlsbad, ca) for 3d rendering, visualization, and display. the 3d reconstructed images can be visualized in three orthogonal planes (transverse, sagittal, and coronal) as well as with 3d rendering. cbbct transverse and sagittal views correspond to the mammographical craniocaudal (cc) and mediolateral - oblique (mlo) views, respectively. postacquisition image processing and reconstruction to achieve isotropic reconstructed volumes are performed with a soft tissue filter and (0.273 mm) 3 voxel size (standard mode). regions with calcifications were reconstructed with the volume - of - interest higher resolution mode with a sharp ramp filter at (0.155 mm) 3 as a standard post - processing protocol. for each patient, we obtained dose measurements for both cbbct and routine digital diagnostic mammography. the average glandular radiation dose (mgy) as a function of x - ray tube current (ma) [when voltage (kvp) and time (ms) are constant ] was determined from prior dose phantom studies. the ma - to - mgy relationship was verified using an fda - approved 16-cm pmma head dose phantom to measure the weighted computer tomography dose index (ctdiw). 20% with one 360 scan at 49 kvp, 100 ma, and 8 ms. two orthogonal low - dose scout images of the breast were obtained prior to the scan. the optimal tube current (ma) to obtain a sufficient contrast - to - noise ratio in the reconstructed cross - sectional images at a minimum dose was determined from these scout images. in this way, the dose was tailored to each individual breast, depending on breast size and density. the dose for each breast scanned was documented based on the ma - to - mgy relationship as mentioned above, in which the dose (ctdiw) is scaled to ma linearly by a factor of 0.08 (dose = ma 0.08). dose from the cbbct scan was then compared to the dose of each subject 's digital mammogram. student 's paired t - test with two - tailed distribution was used to test for differences between the conventional mammography dose and the cbbct dose. diagnostic mammograms for bi - rads 4 and 5 patients were obtained and patients subsequently received cbbct scans, usually on the same day as the diagnostic exam and all within one week. patients subsequently underwent image - guided percutaneous core needle and/or excisional biopsy with tissue samples submitted for pathology. image analysis was not blinded ; cbbct image data sets (transverse, sagittal, coronal, and 3d views) were compared to the prebiopsy diagnostic mammograms (cc and mlo views with additional views as required). the average number of images generated in each of the three planes (axial, sagittal, and coronal) for one breast on cbbct is ~500 - 1000 slices depending on the breast size and the plane viewed. the imaging software enables a reader to target a finding of interest in one plane or in 3d and the finding is automatically displayed in the other planes. image analysis was performed by two board- and mammography quality standards act (mqsa)-certified radiologists with 5 and 25 years of experience reading mammography, respectively. the radiologists independently compared the mammographical and cbbct images side - by - side at a workstation and scored the cbbct findings relative to the mammographic findings as not visualized, less distinct / conspicuous, more distinct / conspicuous, and were given the opportunity to comment on additional considerations as they deemed appropriate. a third radiologist, similarly certified and with 20 years of experience reading mammography, was available to cast a deciding opinion on lesions scored as not visualized or less distinct / conspicuous by one reader and equally distinct / conspicuous or more distinct / conspicuous by the second reader. each patient underwent percutaneous stereotactic (8 g or 11 g vacuum - assisted) or ultrasound - guided (9 g or 11 g vacuum - assisted, or 14 g mechanical) core needle biopsy and all malignant or high - risk lesions also underwent surgical excision. all of the patients were administered a brief paper questionnaire after completing the cbbct exam. patients were asked to choose a single best response for comfort of exam vs. mammogram by marking one of the following options : better, equal, or this study was conducted at the university of rochester medical center (urmc) - highland breast imaging center, rochester, ny, from july 2006 to august 2008 under an irb approved protocol with informed consent from each patient prior to cbbct imaging and inclusion in this study. this was a prospective study in which patients undergoing diagnostic breast imaging for abnormal screening mammograms or palpable breast abnormalities were invited to undergo cbbct in addition to standard - of - care diagnostic mammography or ultrasound. thirty - six consecutive subjects with ages ranging from 41 to 77-year old (mean, 56.0 yrs 9.8 sd) with bi - rads 4 or 5 findings on diagnostic mammography or ultrasound underwent cbbct in addition to the standard additional diagnostic mammographic views, where appropriate. most patients received cbbct scan the same day as diagnostic mammography, and all were scanned within one week. thirty - five (35) subjects had unilateral findings and one (1) had bilateral findings, resulting in a total of 37 breasts studied. a variety of breast densities (as defined by bi - rads) and types of mammographic and/or sonographic abnormalities were represented. the number and type of additional mammographic views and use of ultrasound varied according to the patient 's presentation and screening findings. each patient subsequently underwent percutaneous stereotactic or ultrasound - guided biopsy and the pathology reports were reviewed and correlated with the imaging findings. images were obtained according to our standard cbbct protocol, as previously reported. in brief, the real time flat panel detector (fpd)-based cbbct system consists of the following : a ct gantry (geometrically optimized for breast imaging), a special high - power mammography x - ray tube (with a 0.3-mm focal spot size) (rad71sp, varian medical system, salt lake city, ut), an x - ray flat panel detector (fpd) (paxscan 4030cb, varian medical system, salt lake city, ut) mounted on the gantry, an ergonomically designed patient table, and a personal computer (pc). the fpd is designed especially for cone - beam ct applications with a real - time dynamic gain mode with 0.388-mm pixel pitch (22 binning) and an image acquisition rate of 30 frames per second (fps). the panel has an inherent pixel depth of 14- bits that is extended to > 16-bits in the dynamic gain mode. the diameter of the patient table opening is 39 cm with a maximum imaging volume of 28 28 16 cm ; various inserts are used to optimize patient comfort and positioning. the subject was placed on the imaging table in the prone position in a left or right anterior oblique position so that the targeted breast was suspended through the table opening into the image acquisition field with no external compression. a radiological technologist, registered in radiography and mammography through the american registry of radiologic technologists (arrt) and trained in cbbct acquisition, positioned the subject using laser cross - hairs. for a single continuous acquisition scan, the real time fpd - based prototype acquires 300 two - dimensional projection images (1024 768 14 bits / projection) by rotating the x - ray tube and the fpd 360 around the breast located at the rotation center in 10 seconds. x - ray pulses are 8 milliseconds in duration at 30 hertz (hz). a pc computer controls the operation of the prototype, including the gantry rotation, kvp, ma, x - ray pulse width, and projection data acquisition. the pci - bus - based frame grabber is synchronized to the fpd and programmed to allow the image data to flow directly into memory for real time data acquisition. once all of the projection data are acquired from a single scan, the two - dimensional projection images are stored on the hard drive for subsequent image processing, 3d reconstruction, and visualization. reconstructed cbbct matrices of the breast images were loaded into the specialized 3d visualization software (visage cs thin client / server, visage imaging, carlsbad, ca) for 3d rendering, visualization, and display. the 3d reconstructed images can be visualized in three orthogonal planes (transverse, sagittal, and coronal) as well as with 3d rendering. cbbct transverse and sagittal views correspond to the mammographical craniocaudal (cc) and mediolateral - oblique (mlo) views, respectively. postacquisition image processing and reconstruction to achieve isotropic reconstructed volumes are performed with a soft tissue filter and (0.273 mm) 3 voxel size (standard mode). regions with calcifications were reconstructed with the volume - of - interest higher resolution mode with a sharp ramp filter at (0.155 mm) 3 as a standard post - processing protocol. for each patient, we obtained dose measurements for both cbbct and routine digital diagnostic mammography. the average glandular radiation dose (mgy) as a function of x - ray tube current (ma) [when voltage (kvp) and time (ms) are constant ] was determined from prior dose phantom studies. the ma - to - mgy relationship was verified using an fda - approved 16-cm pmma head dose phantom to measure the weighted computer tomography dose index (ctdiw). 20% with one 360 scan at 49 kvp, 100 ma, and 8 ms. two orthogonal low - dose scout images of the breast were obtained prior to the scan. the optimal tube current (ma) to obtain a sufficient contrast - to - noise ratio in the reconstructed cross - sectional images at a minimum dose was determined from these scout images. in this way, the dose was tailored to each individual breast, depending on breast size and density. the dose for each breast scanned was documented based on the ma - to - mgy relationship as mentioned above, in which the dose (ctdiw) is scaled to ma linearly by a factor of 0.08 (dose = ma 0.08). dose from the cbbct scan was then compared to the dose of each subject 's digital mammogram. student 's paired t - test with two - tailed distribution was used to test for differences between the conventional mammography dose and the cbbct dose. diagnostic mammograms for bi - rads 4 and 5 patients were obtained and patients subsequently received cbbct scans, usually on the same day as the diagnostic exam and all within one week. patients subsequently underwent image - guided percutaneous core needle and/or excisional biopsy with tissue samples submitted for pathology. image analysis was not blinded ; cbbct image data sets (transverse, sagittal, coronal, and 3d views) were compared to the prebiopsy diagnostic mammograms (cc and mlo views with additional views as required). the average number of images generated in each of the three planes (axial, sagittal, and coronal) for one breast on cbbct is ~500 - 1000 slices depending on the breast size and the plane viewed. the imaging software enables a reader to target a finding of interest in one plane or in 3d and the finding is automatically displayed in the other planes. image analysis was performed by two board- and mammography quality standards act (mqsa)-certified radiologists with 5 and 25 years of experience reading mammography, respectively. the radiologists independently compared the mammographical and cbbct images side - by - side at a workstation and scored the cbbct findings relative to the mammographic findings as not visualized, less distinct / conspicuous, equally distinct / conspicuous, or more distinct / conspicuous, and were given the opportunity to comment on additional considerations as they deemed appropriate. a third radiologist, similarly certified and with 20 years of experience reading mammography, was available to cast a deciding opinion on lesions scored as not visualized or less distinct / conspicuous by one reader and equally distinct / conspicuous or more distinct / conspicuous by the second reader. each patient underwent percutaneous stereotactic (8 g or 11 g vacuum - assisted) or ultrasound - guided (9 g or 11 g vacuum - assisted, or 14 g mechanical) core needle biopsy and all malignant or high - risk lesions also underwent surgical excision. all of the patients were administered a brief paper questionnaire after completing the cbbct exam. patients were asked to choose a single best response for comfort of exam vs. mammogram by marking one of the following options : better, equal, or radiation dose resulting from cbbct was compared with dose resulting from diagnostic mammography for each patient [figure 1 ]. diagnostic mammography was highly variable in dose, ranging from 6 to 36 mgy with a mean of 16.9 mgy (6.9 sd) ; cbbct was less variable, ranging from 6.4 to 16, with a mean of 9.4 mgy (3.1 sd). the number of views taken during the mammographic exam ranged from 2 to 11 in this study with a mean of 5 and standard deviation of 1.94.the difference between total mammography dose (screening and diagnostic) and cbbct dose was statistically significant in favor of cbbct (p<0.001). even when removing the dose attributable to the screening mammography views, difference between cbbct and diagnostic mammography alone (mean 13.7 mgy, 3.1 sd) remained statistically significant (p=0.02 ; 95% confidence interval 0.77 - 7.1). cbbct images of bi - rads 4 and 5 lesions were reviewed following mammography and prior to definitive histopathological diagnosis by percutaneous core needle or excisional biopsy. the classification of the abnormal lesions at time of initial imaging evaluation by mammography with or without ultrasound is summarized in table 1. breast lesion characteristics breast imaging reporting and data system (bi - rads) categorization of breast composition four bi - rads 4 and 5 lesions were identified by diagnostic breast ultrasound and were not seen in conventional mammography, although 2/4 of these were subsequently identified by cbbct. one of these lesions and the corresponding mammographic and ultrasound findings is depicted in figure 2. a forty - two - year - old woman with palpable lump in upper outer breast. no abnormality was present on mammographical (a) r cc (b) r mlo views (c) biopsy of sonographical mass demonstrated invasive ductal carcinoma. cbbct demonstrates mass with convex margins arising from glandular tissue in the posterior lateral breast / axilla in both (d) transverse (e) sagittal 1-mm thick sections, which approximate cc and mlo views, respectively. the single mammographic finding not identified in cbbct, classified as a developing asymmetry was proven to be benign fibrocystic changes at time of biopsy and can be attributed to summation artifact, as seen in figure 3. even allowing for this discordant result, the observed agreement between mammography and cbbct for lesions initially seen in mammography was 97.0% (32/33). a fifty - two - year - old woman with developing focal asymmetry in screening mammography. (a) r ml (b)rcc mammographical views of focal asymmetry in 12 oclock position in the anterior 1/3 of the right breast, which persisted in spot compression views (not shown). cbbct (c) sagittal (d) transverse views in the expected location do not demonstrate any suspicious lesion. (e) volume - rendered cbbt image demonstrates no evidence of mammographical lesion in the anterior breast. we anticipated a greater degree of discordance between mammographers in assessing the relative conspicuity of lesions between conventional mammography and cbbct. in practice, mammographers were in complete agreement in ranking lesions as not visualized or in the aggregate category of equally distinct / conspicuous and more distinct / conspicuous. no lesions were ranked as less distinct / conspicuous in cbbct by either examiner. across all four categories, the observed cohen 's unweighted kappa of 0.84 (95% ci : 0.66 1). examples of common mammographic and sonographical lesions with cbbct correlation were identified, including palpable lump in extremely dense breast [figure 2 ], developing asymmetry [figure 3 ], mass with benign features [figure 4 ], microcalcifications [figure 5 ], and partially obscured mass in the posterior breast [figure 6 ]. a forty - five - year - old woman with mass on screening mammography with benign features. diagnostic (a) rcc mammographical view transverse cbbct 0.27-mm section image demonstrate circumscribed mass in the posterior breast (arrowheads). (c) three - dimensional reconstruction from same cbbct data set more clearly delineates lesion, demonstrated to be a fibroadenoma following ultrasound - guided biopsy. despite small size, these calcifications are more conspicuous in (b) volume - rendered images at standard 0.27-mm resolution. a fifty - eight - year - old woman with mammographical mass in the posterior breast. diagnostic (a) l cc (b) mlo views with detail of region of interest (inset) ; cbbct images in (c) transverse and sagittal (through the d) medial and (e) lateral portions of the lesion, respectively) 3.0-mm sections demonstrate spicules extending from the mass anteriorly (arrowheads, c and e) and additional possible satellite nodules (arrows, d). patients were administered a survey in order to assess the degree of comfort before and during the cbbct exam relative to diagnostic mammography [table 3 ]. data from 40 survey participants are included, including four patients ultimately categorized as bi - rads 3 and not included in dose or histopathological correlation due to lack of biopsy data. in all, patients reported higher degrees of comfort in the cbbct examination relative to diagnostic mammography. thirty six out of forty patients (90%) indicated that the cbbct examination was equal to or better than mammography in terms of comfort. radiation dose resulting from cbbct was compared with dose resulting from diagnostic mammography for each patient [figure 1 ]. diagnostic mammography was highly variable in dose, ranging from 6 to 36 mgy with a mean of 16.9 mgy (6.9 sd) ; cbbct was less variable, ranging from 6.4 to 16, with a mean of 9.4 mgy (3.1 sd). the number of views taken during the mammographic exam ranged from 2 to 11 in this study with a mean of 5 and standard deviation of 1.94.the difference between total mammography dose (screening and diagnostic) and cbbct dose was statistically significant in favor of cbbct (p<0.001). even when removing the dose attributable to the screening mammography views, difference between cbbct and diagnostic mammography alone (mean 13.7 mgy, 3.1 sd) remained statistically significant (p=0.02 ; 95% confidence interval 0.77 - 7.1). cbbct images of bi - rads 4 and 5 lesions were reviewed following mammography and prior to definitive histopathological diagnosis by percutaneous core needle or excisional biopsy. the classification of the abnormal lesions at time of initial imaging evaluation by mammography with or without ultrasound is summarized in table 1. breast lesion characteristics breast imaging reporting and data system (bi - rads) categorization of breast composition four bi - rads 4 and 5 lesions were identified by diagnostic breast ultrasound and were not seen in conventional mammography, although 2/4 of these were subsequently identified by cbbct. one of these lesions and the corresponding mammographic and ultrasound findings is depicted in figure 2. a forty - two - year - old woman with palpable lump in upper outer breast. no abnormality was present on mammographical (a) r cc (b) r mlo views (c) biopsy of sonographical mass demonstrated invasive ductal carcinoma. cbbct demonstrates mass with convex margins arising from glandular tissue in the posterior lateral breast / axilla in both (d) transverse (e) sagittal 1-mm thick sections, which approximate cc and mlo views, respectively. the single mammographic finding not identified in cbbct, classified as a developing asymmetry was proven to be benign fibrocystic changes at time of biopsy and can be attributed to summation artifact, as seen in figure 3. even allowing for this discordant result, the observed agreement between mammography and cbbct for lesions initially seen in mammography was 97.0% (32/33). a fifty - two - year - old woman with developing focal asymmetry in screening mammography. (a) r ml (b)rcc mammographical views of focal asymmetry in 12 oclock position in the anterior 1/3 of the right breast, which persisted in spot compression views (not shown). cbbct (c) sagittal (d) transverse views in the expected location do not demonstrate any suspicious lesion. (e) volume - rendered cbbt image demonstrates no evidence of mammographical lesion in the anterior breast. we anticipated a greater degree of discordance between mammographers in assessing the relative conspicuity of lesions between conventional mammography and cbbct. in practice, mammographers were in complete agreement in ranking lesions as not visualized or in the aggregate category of equally distinct / conspicuous and more distinct / conspicuous. no lesions were ranked as less distinct / conspicuous in cbbct by either examiner. across all four categories, the observed cohen 's unweighted kappa of 0.84 (95% ci : 0.66 1). examples of common mammographic and sonographical lesions with cbbct correlation were identified, including palpable lump in extremely dense breast [figure 2 ], developing asymmetry [figure 3 ], mass with benign features [figure 4 ], microcalcifications [figure 5 ], and partially obscured mass in the posterior breast [figure 6 ]. a forty - five - year - old woman with mass on screening mammography with benign features. diagnostic (a) rcc mammographical view transverse cbbct 0.27-mm section image demonstrate circumscribed mass in the posterior breast (arrowheads). (c) three - dimensional reconstruction from same cbbct data set more clearly delineates lesion, demonstrated to be a fibroadenoma following ultrasound - guided biopsy. a fifty - five - year - old woman with microcalcifications in screening mammogram. (a) diagnostic rcc demonstrates clusters of microcalcifications within overlapping glandular tissue. despite small size, these calcifications are more conspicuous in (b) volume - rendered images at standard 0.27-mm resolution. stereotactic biopsy demonstrated dcis. a fifty - eight - year - old woman with mammographical mass in the posterior breast. diagnostic (a) l cc (b) mlo views with detail of region of interest (inset) ; cbbct images in (c) transverse and sagittal (through the d) medial and (e) lateral portions of the lesion, respectively) 3.0-mm sections demonstrate spicules extending from the mass anteriorly (arrowheads, c and e) and additional possible satellite nodules (arrows, d). patients were administered a survey in order to assess the degree of comfort before and during the cbbct exam relative to diagnostic mammography [table 3 ]. data from 40 survey participants are included, including four patients ultimately categorized as bi - rads 3 and not included in dose or histopathological correlation due to lack of biopsy data. in all, patients reported higher degrees of comfort in the cbbct examination relative to diagnostic mammography. thirty six out of forty patients (90%) indicated that the cbbct examination was equal to or better than mammography in terms of comfort. in light of recent increased attention regarding the importance of radiation dose exposure to patients during imaging studies, the findings of comparable or lower administered dose from cbbct relative to standard diagnostic mammography is a particularly promising result. as we have demonstrated here, in the diagnostic setting the cumulative dose from diagnostic mammography with spot compression and magnification can be considerable. the radiation dose range in diagnostic mammography was also greater than cbbct in this pilot study, which accurately reflects the need for a variable number of mammographic views and/or magnification in the diagnostic evaluation of mammographic lesions. in cbbct, all additional views are generated from a data set obtained in a single acquisition ; additional scans are not required. despite the small size of the patient group analyzed, a wide range of patient body types were included in the study and similar dose profiles were obtained in the use of cbbct. in this regard, cbbct met our goal of providing a potential alternative and/or complementary imaging modality at radiation dose levels less than that of diagnostic mammography. while low dose is an attractive feature in isolation, the ability of cbbct to demonstrate similar accuracy in detecting and depicting breast lesions relative to standard - of - care mammography was a second and equally critical feature that needed to be satisfied in order to consider cbbct as a breast imaging modality. in a wide array of breast lesions assessed as bi - rads 4 or 5 by two experienced mammographers, cbbct allowed equivalent or superior visualization of the lesion or lesions in question, with the notable exception of a lesion subsequently found to be benign (mammographic false positive) at biopsy. in addition, two malignant lesions identified with diagnostic ultrasound and not visualized with conventional mammography were identified with cbbct. because breasts in the study were predominantly heterogeneously or extremely dense [table 2 ], we feel that these findings are representative of real - world cases in which mammographical abnormalities may be subtle or otherwise difficult to detect. therefore, cbbct met our goal of depicting mammographical abnormalities to a similar degree as diagnostic mammography, with the additional benefit of visualizing two additional malignant lesions not seen in mammography. this particular cbbct system acquires images more rapidly than other cone - beam - type scanners described in the literature. as previously described, this system acquires data in a single 10 sec scan, which compares favorably to other systems requiring 12 48 seconds, sometimes depending on the resolution of the images acquired. short acquisition times are desirable as decreased imaging time results in less motion artifact to obscure fine structures, including but not limited to spiculations and microcalcifications. microcalcifications were apparent in similar detail to digital mammography, an advantage over magnetic resonance imaging of the breast. our mammographers felt that the distribution of microcalcifications was better characterized in cbbct due to the anatomical positioning of the breast and the ability to remove overlapping soft tissue via reconstruction of the ct images, which more than offset the nominally lower spatial resolution of cbbct relative to digital mammography. the mammographers also noted that the lesion margins were often more conspicuous in cbbct relative to conventional mammography, attributed primarily to the ability to exclude tissue outside the plane of interest which would otherwise be superimposed. we anticipate two primary advantages of being able to remove tissue overlap in the use of tomographic sections ; firstly, features of benign lesions are identified with a higher degree of confidence, reducing or eliminating the need for biopsy for what would otherwise represent false positive mammographical findings. secondly, improved characterization of margins and extent of disease may significantly reduce the need for repeat surgeries by improving preoperative evaluation of a lesion prior to excision. conventional breast - imaging techniques have substantial room for improvement in depicting extent of disease ; 30 - 50% of lumpectomies have positive margins at time of initial resection. the positioning of the breast during the cbbct exam confers unique advantages over other imaging modalities. the pendant breast allows evaluation of potential breast lesions without the anatomic distortion intrinsic to techniques that require breast compression. it is reasonable to infer that the dimensions and geographical features of a surgical lesion are better assessed in the noncompressed state. in particular, compression views may lead to underestimation of the overall dimensions of a lesion and increase the likelihood of positive surgical margins at time of excision, as may have been the case for our patients [figure 4 ]. cbbct offers potentially improved presurgical planning that may result in a smaller number of positive margins at excision. patients reported improved subjective comfort relative to diagnostic mammography, which has been described in previous surveys. in addition, acquisition of images in 360 eliminated the need for patient repositioning and additional views, all of which may be generated from the initial data set. no special or additional views are required to more completely visualize posterior lesions partly seen in digital mammography. also, the lack of additional views contributed to the favorable dose profile of cbbct relative to diagnostic mammography. the relative ease of positioning the patient and the natural pendant positioning of the breast limits the opportunity for operator variability and/or error. images were acquired rapidly and in the span of a single breath - hold, decreasing the potential for motion artifacts, which may seriously compromise the depiction of lesions and microcalcifications in standard mammography. with the exception of a single patient with breast tissue too extensive to be fully visualized in a single field of view, the same imaging protocol and projection was obtained for all patients in the study. unlike conventional mammography, which include a portion of the pectoralis major in only 30% of exams performed, readers routinely visualized portions of the anterior chest wall including ribs. although cbbct scans the breast in 360, the breast is fixed and for some subjects the axillary tail is not included in the field of view to the same degree as in standard mlo views. firstly, the current table top design limits excursion of the lateral soft tissue of the breast. secondly, the body habitus of some patients prevents the portions of the lateral breast to be positioned in the imaging field. provisions for the use of standard stereotactic and ct - guided biopsy equipment with cbbct are presently under development. mri requires dedicated coils with limited access to the breast and requires mr - specific nonferromagnetic biopsy devices. stereotactic biopsy, while utilizing similar imaging principles as diagnostic mammography, presents unique challenges in identifying and localizing abnormal findings evident in standard mammography. cbbct may allow the use of the same technology and positioning for both characterization and biopsy of breast lesions. our initial experiences with cbbct have been promising. at the expense of similar radiation exposure to the patient, this pilot study of patients with a variety of high - risk findings demonstrated cbbct to be similar to the standard - of - care diagnostic mammography in depicting lesions. added benefits in this small group of patients included visualization of additional malignant lesions not identified in diagnostic mammography, excellent characterization of lesion margins, and a high degree of patient comfort. we also saw potential for improved characterization of pathology - proven lesions due to true three - dimensional visualization of the breast and lack of compression - related distortion and tissue overlap. these findings are encouraging and we believe that cbbct clearly warrants additional investigation as an alternative or adjunct to conventional diagnostic mammography in the characterization of high - risk breast lesions identified in screening mammography or ultrasound.	objective : this pilot study was undertaken to compare radiation dose, relative visibility / conspicuity of biopsy - proven lesions, and relative patient comfort in diagnostic mammography and dedicated cone - beam breast computed tomography (cbbct) in breast imaging - reporting and data system (bi - rads) 4 or 5 lesions.materials and methods : thirty - six consecutive patients (37 breasts) with abnormal mammographic and/or ultrasound categorized as bi - rads 4 or 5 lesions were evaluated with cbbct prior to biopsy. administered radiation dose was calculated for each modality. mammograms and cbbct images were compared side - by - side and lesion visibility / conspicuity was qualitatively scored. histopathology of lesions was reviewed. patients were administered a survey for qualitative evaluation of comfort between the two modalities.results:cbbct dose was similar to or less than diagnostic mammography, with a mean dose of 9.4 mgy (3.1 sd) for cbbct vs. 16.9 mgy (6.9 sd) for diagnostic mammography in a total of 37 imaged breasts (p<0.001). thirty - three of 34 mammographic lesions were scored as equally or better visualized in cbbct relative to diagnostic mammography. characterization of high - risk lesions was excellent. patients reported greater comfort in cbbct imaging relative to mammography.conclusion:our experience of side - by - side comparison of cbbct and diagnostic mammography in bi - rads 4 and 5 breast lesions demonstrated a high degree of correlation between the two modalities across a variety of lesion types. owing to favorable radiation dose profile, excellent visualization of lesions, and qualitative benefits including improved patient comfort, excellent field - of - view, and more anatomical evaluation of lesion margins, cbbct offers a promising modality for diagnostic evaluation of breast lesions.
diabetes is currently the leading cause of 44% of newly diagnosed cases of renal failure as sustained hyperglycemia damages the filtration membranes of the kidneys resulting in albuminuria and proteinuria. in fact, proteinuria is often used as a surrogate marker for renal disease [24 ]. as the incidence of diabetes continues to increase throughout the world, rates of albuminuria and diabetic kidney disease (dkd) are likewise expected to increase. the mechanisms leading to the development of chronic kidney disease (ckd) in subjects with metabolic syndrome, however, are not as well - understood. according to the world health organization, the criteria for diagnosing metabolic syndrome indicate that an individual must have insulin resistance, type 2 diabetes, impaired glucose tolerance, or impaired fasting glucose along with two additional criteria : abdominal or overall obesity, dyslipidemia, hypertension, or microalbuminuria. these characteristics of metabolic syndrome also increase the risk of developing cardiovascular disease and diabetes, which subsequently increase the risk of renal dysfunction and failure. examined data from the framingham heart study that explored the relationship between renal fat accumulation, hypertension, and ckd. positive associations were identified between fatty kidney and hypertension and between fatty kidney and ckd. after adjusting for visceral adipose tissue these data indicate that there may be an independent association between hypertension, renal fat accumulation, and ckd.. showed that feeding 6-week - old mice a high fat diet (60% fat) for 12 weeks increased body mass, plasma glucose, insulin, and triglyceride concentrations and induced hypertension and kidney disease as evidenced by increased albuminuria, alterations in renal morphology, and renal lipid accumulation. similarly, altunkaynak. demonstrated that feeding adult female sprague - dawley rats a moderate fat diet (30% fat) for 12 weeks caused the animals to become overweight and to develop increased kidney masses and volumes with significant morphological changes indicative of renal disease. moreover, renal fat accumulation is evident with even moderate fat intake in rabbits (10% corn oil + 5% lard for 812 weeks). stemmer. compared lean chow - fed wistar rats with hfd - fed rats that were either sensitive or partially resistant to diet - induced obesity after eleven months of hfd (40% butter fat). a positive correlation was established between levels of adiposity and the severity of renal damage. their results indicate that lipotoxicity is not a strong contributor to renal dysfunction as they found that plasma triglyceride and free fatty acid as well as renal triglyceride levels did not differ significantly between the treatment and control groups. while long - term feeding protocols are found in the literature, the effects of shorter - term feeding protocols to mimic early onset pathological changes within the kidney following high fat feeding are limited. a variety of rodent models have been used to investigate the effects of consuming hfd over the course of eight weeks to 11 months [5, 8, 10, 11 ], and although the effects of hfd on kidney morphology have been studied at four weeks, to our knowledge there are currently no studies that have examined the effects of shorter - term intake of high fat (as opposed to combined high carbohydrate, high fat) diets on renal function. for this reason, the present study was designed to examine the short - term effects of feeding rats a hfd (60% fat) for six weeks on renal morphology and biomarkers of function. prior studies have shown that young (1.5-month - old) male sprague - dawley rats fed on a hfd (60% kcal from fat) for as few as six weeks develop indices of metabolic syndrome and cardiovascular disease : increased visceral adiposity, hyperglycemia, impaired glucose tolerance, hyperleptinemia, systemic inflammation (plasma tnf), lipid peroxidation (tbars), and impaired endothelium - dependent vasodilation [13, 14 ]. other studies have shown that increased visceral adiposity, endothelial dysfunction, hypertension, inflammation, and oxidative stress (characteristics shared by these animals) increase blood pressure in the kidneys and promote renal damage, although this has yet to be examined in the 6-week hfd rat model. therefore, exploring the effect of short - term hfd on the kidneys will fill a gap in the literature and allow for a better understanding of early pathological changes that occur due to consuming a hfd. it was hypothesized that six weeks of high fat intake (60% fat) would lead to early stages of renal disease in 1.5-month - old male sprague - dawley rats, as evidenced by morphological and functional changes in the kidney, compared to control rats on a standard rodent chow diet (5% fat). prior studies in our laboratory have shown that feeding young male (1.5-month - old) sprague - dawley rats (140160 g body weight, harlan teklad industries (madison, wi, usa)) a hfd (60% kcal from fat ; cat. number d12492, research diets inc., new brunswick, nj, usa) for six weeks results in symptoms associated with metabolic syndrome including increased adiposity, hyperleptinemia, hyperglycemia, endothelial dysfunction, and hypertension in comparison to animals fed on standard rodent chow [13, 14 ]. the current study examined isolated kidneys, plasma, and urine samples from a subset of animals examined in these prior iacuc - approved studies from september 2009 to may 2010. blood samples were obtained via cardiac puncture and centrifuged at 13,000 rpm at 4c for 15 minutes to separate formed elements from the plasma, which was then stored at 80c until analyses. the urine was then centrifuged at 13,000 rpm at 4c for 10 minutes to remove debris and the supernatant was then stored at 80c until analyses. following a midline laparotomy, kidneys were removed and stored at 80c until analyses while a separate subset was embedded in optimal cutting temperature (oct ; cat. torrance, ca, usa) compound prior to freezing in isopentane cooled by liquid nitrogen and storing at 80c. animal morphometrics (body mass, epididymal fat pad mass, waist circumference, and tail length) and renal tissue masses were measured. epididymal fat pad mass was used to determine variations in adiposity between hfd and chow - fed rats because the epididymal fat pad can be easily removed from the animal objectively. moreover, recent studies have shown that this fat pad is highly correlated (r = 0.94) with total fat volume from the base of the skull to the distal tibia as measured by in vivo microct scans. a subset of frozen kidneys (n = 4 chow and n = 5 hfd rats) embedded in oct compound were sectioned using a cryostat (leica biosystems cm1950 ; buffalo grove, il, usa) and sections (14 m) were collected onto (+) -glass microscope slides (histobond adhesive slides, vwr vistavision, radnor, pa, usa). sections were allowed to air - dry for 10 mins and were then fixed with 10% formalin for an additional 10 mins. following 3 - 4 washes with tap water, sections were stained with mayer 's hematoxylin (cat. number 6194a16 ; hardy diagnostics, santa maria, ca, usa) for 2 mins and then rinsed with warm tap water. the slides were then dipped in acid alcohol (0.5% hcl in 70% ethanol) and washed in scotts tap water substitute (cat. number 26070 - 06 ; electron microscopy sciences, hatfield, pa, usa) for 5 mins followed by a rinse with deionized water. number is4054 ; aldon corporation, avon, ny, usa) for 3 mins followed by a rinse with tap water and coverslips were mounted onto the glass microscope slides using shur / mount (cat. number lc - w ; triangle biomedical sciences, durham, nc, usa). sections were viewed using a light microscope (olympus bx50) and images collected with an olympus dp70 camera (melville, ny, usa) to assess morphology. measuring the excretion of total proteins in the urine, proteinuria, is a marker of early renal disease [3, 4 ]. in fact, multiple studies have found a stronger association between proteinuria and renal disease outcomes than any other tested factors. moreover, clinical studies on humans have identified proteinuria as among the first clinical symptoms of kidney damage [17, 18 ]. total urinary protein concentrations were measured on a random set (n = 8/group) using the bradford technique (cat. number 500 - 0006 ; bio - rad, hercules, ca, usa). urinary creatinine concentrations were measured on the same set of urine samples (n = 8/group) using an available kit (cat. number cr01 ; oxford biomedical research, rochester hills, mi) and values were used to calculate the protein : creatinine ratio. cystatin c produced by nucleated cells is filtered by the glomerulus and then catabolized by tubular cells in the kidney. for this reason, plasma concentrations of cystatin c can be used as a biomarker of glomerular filtration rate. urinary changes in cystatin c can be used as markers of acute renal injury, although not often used in ckd assessment. serum creatinine concentrations are likewise often assessed as a marker of renal function ; however, more recent studies indicate that serum or plasma cystatin c is a stronger, and more consistent, surrogate indicator of glomerular filtration rate and renal function [1927 ]. concentrations of cystatin c in the serum increase as much as 1 - 2 days prior to serum creatinine in conditions of acute kidney injuries as well as in individuals with type 2 diabetes who have normoalbuminuria. while serum creatinine levels can be affected by sex, age, diet, muscle mass, and body mass, cystatin c levels are independent of gender, muscle mass, and malignancy [21, 27 ]. plasma cystatin c was therefore measured on a subset of samples (n = 10 per group) using an available elisa kit (cat. number msctco ; r&d systems, minneapolis, mn, usa) according to the manufacturer 's protocol. urinary h2o2, a biomarker of inflammation, oxidative stress, and renal function, was likewise measured on a subset of samples (n = 6 per group) using an available kit (cat. mi, usa) and the urinary h2o2 : creatinine ratio was calculated. the increased renal perfusion pressure that is associated with hypertension has been found to elevate excretion of h2o2. since h2o2 can stimulate proteinuria, it is sometimes used as an indicator of the initiation of renal pathology. chronic inflammation is often associated with multiple disease states and has been hypothesized to contribute to both morbidity and mortality in ckd patients. studies on animals fed on hfd have found lipid accumulation in glomeruli and proximal tubules within the kidneys along with increased expression of inflammatory markers, particularly tumor necrosis factor alpha (tnf) and interleukin-6 (il-6) [5, 32 ]. tnf production is elevated with high fat intake and may in part cause insulin resistance and both inflammatory cytokines can predict risk for chronic kidney disease. briefly, a subset of kidneys from both chow and hfd rats were transferred to a ground glass homogenizer containing tris - hci buffer (10 mm tris (ph 7.6 ; cat. number 161 - 0716 ; biorad, hercules, ca, usa), 1 mm edta, 1% triton x-100, 0.1% sodium deoxycholate, 0.03% protease inhibitor cocktail (cat. louis, mo, usa), and 1 mm phenylmethanesulfonyl fluoride (pmsf)). samples were then centrifuged at 14,000 rpm for 10 minutes at 4c to remove insoluble debris. number 500 - 0006 ; bio - rad). each sample (100 g total protein) was mixed with 6 l 5x sample buffer (0.6 ml 1 m tris - hcl, ph 6.8 ; 5 ml 50% glycerol ; 2 ml 10% sodium dodecyl sulfate ; 1 ml 1% bromophenol blue ; 0.9 ml deionized water and 2% -mercaptoethanol as a reducing agent) and then boiled for 3 minutes. the mixture was then resolved using 415% gradient tris - hcl sds - page gels (cat. number 456 - 1083 ; bio - rad) and transferred to pvdf membranes (cat. number 152 - 0176 ; bio - rad) for 90 minutes at 200 v. membranes were then blocked for two hours in tris buffered saline containing 0.05% tween 20, 3% bsa fraction v, and 5% nonfat milk followed by an overnight incubation at 4c in primary antibodies for il-6 (1 : 250 ; cat. number ab6672 ; abcam, cambridge, ma, usa), tnf (1 : 500 ; cat. number 11948 ; cell signaling, danvers, ma, usa), or the loading control beta - actin (1 : 2000 ; cat. primary antibodies were prepared in tris buffered saline with 0.05% tween 20 (ttbs). membranes were then exposed to anti - rabbit igg secondary antibody (1 : 1000 for il-6 and tnf and 1 : 2000 for beta actin ; cat number 7074s ; cell signaling technology, danvers, ma) in ttbs for one hour at room temperature followed by exposure to pierce enhanced chemiluminescence western blotting substrate (cat. number 32279 ; thermo scientific, rockford, il, usa) for 1 min. number 34090 ; thermo scientific, rockford, il, usa) and analyzed using nih imagej software. protein expression of il-6 and tnf were normalized to beta - actin to determine the level of il-6 (n = 5 chow and 6 hfd animals) or tnf (n = 8/group) in each kidney sample. kidneys are especially susceptible to oxidative stress due to a high concentration of long - chain polyunsaturated fatty acids, which easily undergo lipid peroxidation when exposed to reactive oxygen species. lipid peroxidation forms malondialdehyde as an end product, which can be detected via a thiobarbituric acid reactive substance (tbars) assay, a marker of oxidative damage that is often examined. a subset of samples (n = 5/group) were used to evaluate renal lipid peroxidation using a commercially available tbars assay kit (cat. 8-hydroxy-2-deoxyguanosine (8-ohdg) is a sensitive biomarker of oxidative stress in tissue and bodily fluids and is a major product of damage caused by oxidative stress to dna. 8-ohdg is produced by enzymatic cleavage of the guanine base, the base most prone to oxidation. plasma samples (n = 10 chow ; n = 11 hfd) were filtered with a 30 kda ultrafilter (cat. number ufc503096 ; emd millipore, billerica, ma, usa) and 8-hydroxyguanosine, 8-ohdg, and 8-hydroxyguanine were examined as biomarkers of oxidative dna and rna damage using a commercially available kit (cat. number 589320 ; cayman chemical, ann arbor, mi, usa), as oxidative stress has been shown to be elevated during early renal failure. statistical analyses were computed using sigmaplot (systat software inc., version 13.0 ; san jose, ca, usa). data were tested for normality and then analyzed using student 's t - tests or the mann - whitney u tests, as appropriate. although the hfd rats tended to weigh more than the chow - fed rats, this difference was not statistically significant for the animals examined in this study (table 1). rats fed on a hfd demonstrated significantly increased epididymal fat pad mass compared to chow - fed animals, establishing that adiposity was increased by the hfd (table 1). the waist circumferences of the hfd animals were significantly increased when compared to chow - fed controls, indicating that the hfd increased abdominal adiposity (table 1). tail lengths, a marker of overall growth, were not significantly different (table 1). the renal masses of the hfd rats were significantly greater compared to the renal masses of animals in the chow group (table 1). morphological analyses using hematoxylin and eosin - stained tissue sections showed no structural differences between the chow and hfd groups, indicating that although the mass of the hfd kidneys was increased, damage to the microstructure of the kidneys was not evident (figure 1). the urine protein : creatinine ratios of the chow and hfd rats did not differ significantly, indicating that the filtering ability of the hfd rat kidneys was not damaged (table 2). there was also no difference in the urine creatinine concentrations of the two groups (table 2). although hfd plasma cystatin c concentrations tended to be higher than chow rats, the difference was not sufficient to merit statistical significance (table 2).. however, the h2o2 : creatinine ratios were not significantly different between the chow and hfd groups (table 2). western blot analyses of renal tissue established no significant difference in the tnf protein expression of the chow and hfd rat kidneys (figure 2). quantification of western blots of il-6 expression in renal tissues likewise showed no difference between the kidneys from chow and hfd rats (figure 3). renal tbars, a measure of tissue oxidative stress via lipid peroxidation, was not significantly elevated in the hfd rats (table 2). plasma levels of oxidized dna and rna, quantified as plasma levels of multiple oxidative stress markers including 8-hydroxyguanosine from rna, 8-ohdg from dna, and 8-hydroxyguanine, were examined. there were no significant differences between the chow and hfd rat groups (table 2). young (1.5-month - old) male sprague - dawley rats fed on hfd (60% fat) for six weeks developed significant increases in waist circumference and epididymal fat pad mass along with a trend towards increased body mass (table 1). there was no significant difference in the tail lengths of the animals on the hfd and chow diets (table 1), indicating that the animals were of similar body size. these data also indicate that the rats used for the present study developed increased adiposity. the use of an animal model that mimics the effects of metabolic syndrome and prediabetes is consistent with prior studies of hfd intake by both mice and rats [5, 8, 33, 3539 ]. previous studies from our laboratory also demonstrate that 6 weeks of hfd results in hyperglycemia, impaired glucose tolerance, hypertension, endothelial dysfunction, oxidative stress (plasma tbars), and inflammation (plasma tnf) in these animals, indicating that the hfd rats are also models of metabolic syndrome [13, 14 ]. the renal masses of the hfd rats examined in the present study were significantly higher than the chow rats (table 1). the lack of difference in tail lengths (table 1) signifies that the increased mass was not caused by overall growth of the animals and instead suggests structural damage to the kidneys.. found similar increases in body and renal masses of rats fed on hfd (30% fat) for 12 weeks. the increased renal mass may be attributed to hyperglycemia as proliferation and hypertrophy of mesangial cells and thickening of the glomerular basement membrane promote increased renal mass along with vasodilation, inflammation, and increased connective tissue. despite the increased overall mass of the kidneys, hematoxylin and eosin staining of the hfd kidneys showed no evidence of morphological damage (figure 1). this is in contrast to long - term studies of hfd that have been shown to cause morphological renal changes such as glomerular capillary dilation, enlarged lumens in the tubules and bowman 's capsule, amassing of extracellular proteins, nephron degradation, glomerular membrane thickening, glomerulosclerosis, renal and tubular interstitial cell necrosis, and shortened tubular epitheliums [5, 8, 41 ]. proteinuria indicates that the filtering ability of the glomerulus is compromised and allowing proteins, which normally remain in the blood, to be passed through the filtration membrane and excreted. in evaluating renal function, albumin is sometimes specifically examined ; however, by studying total protein excretion, a wider picture of filtration ability can be ascertained. proteinuria, specifically, can be used as a marker of endothelial dysfunction as well as a surrogate outcome for renal disease progression. urinary protein concentrations were normalized to urinary creatinine concentrations in order to account for variations in urine output. creatinine is also filtered by the kidneys and was therefore evaluated for differences between the hfd and chow - fed groups.. found no significant changes in creatinine levels after c57bl mice consumed a 45% fat diet for sixteen weeks ; the authors mentioned this indicated early stages of renal damage without severe functional damage (table 2). in the present study, no statistically significant differences were observed between the urinary protein to creatinine ratio for animals ingesting the hfd as compared to the chow - fed animals (table 2), indicating that the filtration abilities of the glomeruli were not damaged by the hfd or at least not to the extent of allowing large proteins to be excreted. with a longer duration feeding protocol, research suggests that the hfd may result in sustained elevations in blood glucose concentrations further leading to increased stress on the kidneys. plasma cystatin c is considered a marker of early renal dysfunction and the lack of difference between the cystatin c concentrations of the hfd and chow - fed rats indicates that the six - week feeding protocol may not have been long enough to initiate functional renal damage (table 2). the hfd group did develop higher concentrations of plasma cystatin c ; however, this difference was not statistically significant (table 2). although cystatin c levels in plasma have been shown to be an early sensitive marker of renal dysfunction, these results indicate that the kidneys of the hfd - fed rats were not damaged enough so as to prevent cystatin c from being filtered [2224, 43 ]. muntner. demonstrated that serum cystatin c can be elevated in subjects who do not exhibit signs of micro- or macroalbuminuria or kidney disease. rather, the authors concluded that serum cystatin c was correlated with cardiovascular disease in overweight subjects. h2o2 is an early marker of oxidative stress and inflammation. despite the increased renal perfusion pressure that is associated with hypertension and elevated h2o2 excretion, there was no significant difference in urinary h2o2 : creatinine ratio between the two groups (table 2). elevated h2o2 in the hfd group would have indicated early renal damage, as h2o2 has been found to be elevated prior to gfr decline, proteinuria, and more robust inflammatory and fibrotic responses following high fat feedings [30, 37, 38 ]. overall, these results demonstrate that although prior studies indicate that the hfd rats develop plasma and vascular oxidative stress and inflammation in addition to endothelial dysfunction [13, 14 ], these pathologies were not sufficient to impair renal function. western blot analyses established no significant difference between the tnf concentrations of renal tissue isolated from hfd and chow - fed rats (figure 2). although increased tnf expression in adipose tissue has been shown to promote to insulin resistance in overweight and obese rodent models [45, 46 ], there was no indication that the hfd increased renal tissue expression of this inflammatory cytokine (figure 2). there was also no increase in il-6 expression (figure 3), a proinflammatory cytokine. other experimental models of renal injury indicate that increases in il-6 secretion are not necessarily an integral step in progressive renal failure. overall, the lack of significant findings in markers of early renal dysfunction, such as proteinuria and urinary h2o2, supports the lack of increases in cytokine expression. chronic increased il-6 levels are an indication of continued tnf production and activation of inflammatory pathways. despite the controversy regarding the differing effects of il-6 as a cytokine and myokine, it continues to be studied as a marker of inflammation in hfd - induced obesity. studies on both overweight and obese women have found that serum tnf and il-6 levels were positively correlated while ozay. found that hfd - induced obesity in male wistar albino rats (22% fat for 12 weeks) increased plasma tnf without altering plasma il-6. conversely, kaya. found that il-6 levels in obese human subjects were higher in both plasma and adipose tissue compared to tnf. stemmer. examined the effect of hfd (40% of calories from butter fat for 11 months) on male wistar rats and the creation of an inflammatory renal environment. their results indicate an increase of il-6 and tnf in retroperitoneal fat and in the kidneys, while there was no increase in circulating il-6. previous studies of the 6-week hfd rats showed that plasma tbars, a measure of whole body oxidative stress, was increased in comparison to chow - fed controls. despite the increased plasma tbars, renal tbars were not significantly different between chow and hfd - fed rats (table 2). these results indicate that although the hfd rats exhibited systemic oxidative stress, oxidative stress within the kidneys is not yet evident. moreover, no significant difference between oxidative dna / rna damage between the experimental and control groups was observed (table 2). oxidative stress, examined via tbars and dna / rna oxidation, is positively correlated. the lack of significant tnf and il-6 expression in renal tissue examined in the present study is consistent with the observed lack of oxidative stress within the kidneys as inflammation and oxidative stress are typically correlated. in conclusion, aside from morphological changes, the only major statistically significant findings in this study were an increase in visceral adiposity and renal mass following a short - term hfd. this study is novel in that it is the first to examine a hfd for only six weeks ; prior to this study, the shortest feeding protocol that is evident in the literature is four weeks at which point only morphological changes were examined as opposed to measures of renal function. previous research conducted on the six - week hfd rat model showed evidence of metabolic syndrome including significant vascular oxidative stress and inflammation, endothelial dysfunction, hypertension, hyperglycemia, hyperleptinemia, and impaired glucose tolerance [13, 14 ]. it is possible that the methods used in this study might not have been sensitive enough to detect subtle changes in renal function. in prior studies by our laboratory, 6 weeks of hfd significantly increased plasma concentrations of the ketone beta - hydroxybutyrate from 4.72 0.31 in chow rats to 7.18 0.77 mg / dl in the hfd animals. considering that ketogenic diets can reduce renal responses to glucose, it is also possible that the hfd exerts a protective effect in the kidney. this was shown in a prior study of mouse models of type 2 diabetes with nephropathy in which 8 weeks of consuming a ketogenic diet fully normalized albumin : creatinine ratios and the expression of stress - related genes. therefore, it is apparent from the current study that prolonged hyperglycemia and inflammation are likely necessary to induce significant changes within the kidneys or that hfd may exert some protective effects through increased generation of ketones.	chronic high fat feeding is correlated with diabetes and kidney disease. however, the impact of short - term high fat diets (hfd) is not well - understood. six weeks of hfd result in indices of metabolic syndrome (increased adiposity, hyperglycemia, hyperinsulinemia, hyperlipidemia, hyperleptinemia, and impaired endothelium - dependent vasodilation) compared to rats fed on standard chow. the hypothesis was that short - term hfd would induce early signs of renal disease. young male sprague - dawley rats were fed either hfd (60% fat) or standard chow (5% fat) for six weeks. morphology was determined by measuring changes in renal mass and microstructure. kidney function was measured by analyzing urinary protein, creatinine, and hydrogen peroxide (h2o2) concentrations, as well as plasma cystatin c concentrations. renal damage was measured through assessment of urinary oxdna / rna concentrations as well as renal lipid peroxidation, tumor necrosis factor alpha (tnf), and interleukin 6 (il-6). despite hfd significantly increasing adiposity and renal mass, there was no evidence of early stage kidney disease as measured by changes in urinary and plasma biomarkers as well as histology. these findings suggest that moderate hyperglycemia and inflammation produced by short - term hfd are not sufficient to damage kidneys or that the ketogenic hfd may have protective effects within the kidneys.
the occurrence of liposarcomas in the gastrointestinal tract is very low and the reported incidence of gastrointestinal liposarcoma is 0.1% to 5.8% at autopsy. the incidence of liposarcomas occurring at the esophagus is particularly low, where they form only 1.2% to 1.5% of all gastrointestinal lipomas. the optimal treatment method for primary esophageal liposarcoma has not been established yet, but all reported cases so far have been treated by surgical means. although the use of therapeutic esophageal intervention has become increasingly common, nonsurgical therapy of primary esophageal liposarcomas has not been described yet in the literature. here, we present a case of a large esophageal liposarcoma which was resected by endoscopic submucosal dissection (esd) under general anesthesia. a 44-year - old male patient was admitted to our hospital for 4 months of dysphagia which was exacerbated during the recent weeks. an abdominal computed tomography (ct) scan showed a 15 cm long mass protruding into the esophageal lumen on coronal image. the majority of the tumor showed fat attenuation, internal septa - like structures, and soft tissue density (fig., there was a yellowish, soft, and movable subepithelial tumor (set) located 20 to 35 cm away from the upper incisor. endoscopic ultrasonography showed a nonhomogeneous submucosal mass located in the posterior wall of upper to mid esophagus (fig. although the tumor had a stalk, the stalk was too huge to use a snare. the procedure was done using a cap - fitted gastroscope (gif - q260 ; olympus, tokyo, japan). after submucosal injection of cerol mixture (glycerin 10%, fructose 5% ; cheiljedang pharma corp., seoul, korea), the first incision was made using a fixed flexible knife (kachu technology, seoul, korea) at the center of the stalk. after exposing the submucosal tissue, the mass was dissected along the stalk using the it-2 knife (kd-611l ; olympus medical systems co., tokyo, japan) (fig. macroscopically, the tumor had a three fingers - like shape and was measured 8.76.03.0 cm. the cut end of the mass revealed multilobulating contoured mass, which was located in the submucosal layer and had yellow color (fig. histologically, the neoplasm consisted predominantly of mature looking fat tissues which were in variable sizes and the shape of adipocytic element. some lipocytes showed big and bizarre nucleuses, suggesting liposarcoma rather than lipoma (fig. the tumor had the characteristic features of well - differentiated liposarcoma in general. in some other areas, there were lobules of mature adipose tissue with a delineated myxoid tumor in the subepithelial stroma. following esd, the patient was followed up for 4 months by chest ct and egd, and signs of recurrence and metastasis have not been found so far (fig. four main subtypes of liposarcoma include well - differentiated liposarcoma, myxoid liposarcoma, pleomorphic liposarcoma, and dedifferentiated liposarcoma. the only established methods for the diagnosis of liposarcoma are surgical excision and histological examination. although indications for resection have not been established, unconditional resection is not generally recommended because of rare incidence of esophageal liiposarcoma. the prognosis after the resection of esophageal liposarcoma is not well known because the occurrence of esophageal liposarcoma is so rare that there is no long term follow - up study. when we reviewed previous records, recurrence occurred in two patients among 15 patients whose medical records were available, so the recurrence rate of esophageal liposarcoma does not seem so high. although there is no esablished guideline on the follow - up after the resection of esophageal liposarcoma yet, it seems that too frequent monitoring is not required because esophageal liposarcoma is known as a slow - growing tumor. here, we showed that esd can be a good alternative method for esophageal set to avoid aggressive surgical procedures. previously esophageal liposarcoma cases were treated by various surgical methods including simple enucleation and partial or total esophagectomy via transcervical, transthoracic, and transgastric routes.1,2 however, such surgical approaches are expensive and more invasive, resulting in longer hospital stays compared to endoscopic methods. esd is a technique which was originally developed in japan as a method for endoscopic resection of early gastric cancer and adenoma. the use of esd has been expanded to include the removal of gastric sets following reports of its usefulness in the treatment of gastric sets.3 today, esd is also considered to be a useful therapeutic option for the resection of high grade dysplasia or early cancer in the esophagus. there have been several studies investigating the efficacy of esd for the resection of esophageal sets. shi.4 reported the usefulness of esd in treating esophageal sets originating from the muscularis propria layer. in this study, the curative resection rate was 100% (28/28) and there were no recurrences during the follow - up of 3 to 27 months. perforation, which occurred in two cases, were closed with metal endoclips and the patients recovered quickly without surgery. recently, there have also been some reports about cases for which submucosal tunnel dissection was used to treat upper gastrointestinal sets.5,6 in these studies, sets were successfully resected in patients with tumors sized 2 to 4 cm without severe complications. to our knowledge, there have been no previous reports about the use of esd for the treatment of esophageal liposarcoma, perhaps due to its rare occurrence. although the postoperative follow - up has been only 4 months long, there have not been any signs of recurrence or complications. we believe that the endoscopic approach is superior to more aggressive surgical approaches (such as esophagectomies) because it allows more detailed resection as well as early recovery and less pain for the patient. considering the fact that the use of esd has been increasing recently, we believe this case report is meaningful and will help to validate the use of esd as a feasible option for the treatment of esophageal liposarcomas.	liposarcoma is one of the most common soft tissue sarcomas occurring in adults, but it rarely occurs in the gastrointestinal tract and more uncommonly in the esophagus. to the best of our knowledge, there are only 19 reported cases of esophageal liposarcoma in the literature published in english language up to the year 2008, and they were all treated by surgical methods. here, we report a case of primary liposarcoma of the esophagus which was treated with endoscopic submucosal dissection (esd). esd was well tolerated in this patient, suggesting that it may be a therapeutic option for primary esophageal sarcomas.
hybrid poplars are extensively cultivated worldwide for wood production and have recently received growing attention for bioenergy research programs. during the last decades, breeders have generated a collection of hybrid poplars with complete resistances to m. larici - populina. nevertheless, culture practices in monoclonal plantations enhanced the rapid breakdown of selected poplar resistances. nowadays, almost all poplar cultivars are susceptible to the rust fungus, and dramatic damages are observed in plantations. thus, m. larici - populina represents the major threat of poplar in plantations, and it is crucial to identify key determinants controlling the outcome of the poplar - poplar rust interaction in order to define new strategies to contain the disease. in addition, the study of this pathosystem should also provide new insights into the molecular mechanisms associated with fungal biotrophy and host resistance in perennial plants. m. larici - populina is a basidiomycete biotroph pathogen belonging to the pucciniales order (pucciniomycotina, pucciniomycetes, pucciniales, melampsoraceae). this leaf rust fungus has a complex heteroecious macrocyclic lifestyle ; that is, the biological cycle is completed on two different hosts and implies five different spore forms (detailed in figure 1(a)). in early spring, overwintered diploid teliospores (2n) that have undergone karyogamy and meiosis in ground decaying poplar leaves (telial host) produce haploid basidiospores (n). after dissemination by the wind, these spores achieve a single infection on larch (aecial host) needles leading to the production of pycniospores (n). fusion of opposite mating types generates aecia and dikaryotic aeciospores (n+n, sexual phase). these wind - borne spores then infect poplar leaves and differentiate another sporulation structure called the uredinium, which corresponds to an orange pustule formed on the abaxial epidermis of mature leaves, the typical symptom of the disease on poplar trees. large amounts of urediniospores (n+n, asexual phase) are released from uredinia and dispersed over very large distances [3, 4 ]. several vegetative infection cycles can be completed on poplar leaves during spring and summer. in autumn, black telia pustules containing teliospores (n+n) are produced in senescent poplar leaves. since damages observed in poplar plantations occur during the asexual development of the rust fungus (detailed in figure 1(b)), this specific phase has received attention from several research groups focusing on different aspects of the poplar - poplar rust interaction (for review, see [1, 5 ]). the major developmental transitions of the fungus (i.e., differentiated infection cell types) have been described by microscopy during colonisation of poplar leaves in controlled experimental conditions [69 ]. first, urediniospores (n+n) germinate on the abaxial surface of poplar leaves and produce germ tubes that penetrate through stomata within the first 6 hours postinoculation (hpi). after 12 hpi, substomatal vesicles are formed in the spongy mesophyll, from which infection hyphae extend into the mesophyll and differentiate the first haustorial structures as soon as 17 hpi. in the case of a compatible interaction, biotrophic growth goes on and the fungal biomass strongly increases between 48 and 96 hpi (i.e., > 30-fold) [7, 10 ], forming a dense network of infection hyphae and haustoria in the mesophyll nearby primary infection sites. around seven days after inoculation (168 hpi), fungal pressure generates a breach in the abaxial epidermis and leads to the formation of uredinia releasing newly formed urediniospores at the surface of the leaves [7, 9 ]. in the case of an incompatible interaction, fungal growth is arrested early during the colonisation process, concomitant with strong plant defense reactions [6, 7, 10 ]. cytological observations revealed a highly localized hypersensitive response (hr), with collapsed infected plant cells and accumulation of monolignols around infection sites after 48 hpi in the incompatible interaction [6, 7 ]. at later time points in the compatible interaction, anthocyanidins, lignin, pectin, and hydrogen peroxide accumulate around infection sites and likely participate in late defense responses and partial resistance in poplar [5, 8, 11 ]. in spite of the efforts initiated to describe this pathosystem,, the lack of efficient systems for genetic transformation of hybrid poplars susceptible to the rust fungus, and the long generation time of poplar all together represent a serious bottleneck for molecular investigations. fortunately, recent advances in tree and fungal genomics have helped in defining new strategies to facilitate the study of this tree - rust fungus model pathosystem. nisqually-1 was the first tree genome sequenced by the joint genome institute (jgi, department of energy, usa). as part of a community - sequencing project aiming to decipher lifestyles of poplar microbiome, the genome of m. larici - populina (strain 98ag31) has been sequenced by the jgi along with those of symbiotic fungi interacting with poplar roots [13, 14 ]. the availability of both the host and the parasite genome sequences offers unparalleled opportunities to study gene families involved in plant defense and pathogen virulence within an integrated pathosystem [5, 16, 17 ]. comparative genomic studies with other plants and biotrophic fungi or oomycetes also help to decipher the evolutionary trends underlying plant - pathogen interactions in perennial plant species. the access to these reference genomes is also a great opportunity to perform transcriptome analyses through the use of whole - genome custom exon oligoarrays or high - throughput sequencing technologies (rna - seq). with the complete genome sequences of p. trichocarpa and m. larici - populina, performing in silico gene family analyses is a critical step to decipher expression, evolution, and biological functions of genes and proteins participating or regulating a wide variety of mechanisms related to plant immunity or fungal pathogenesis. genome - wide analyses of poplar gene families previously reported to be related to pathogen response in plants have been summarized in table 1, taking as a basis a previous report by yang and collaborators in 2009. globally, researches were mostly devoted to the study of functions such as secondary metabolism associated with plant cell wall and wood formation, hormone biosynthesis, transcription factors, signalling pathways, and redox homeostasis (table 1). considering the flow of data available, here we essentially focus on analyses performed from the standpoint of the poplar - poplar rust pathosystem. kohler and collaborators reported in 2008 the genome - wide analysis of poplar genes coding for nucleotide - binding leucine - rich repeat (nb - lrr) proteins, representing a large class of plant resistance genes (r genes) responsible for pathogen effector recognition and leading to complete resistance through effector - triggered immunity in many pathosystems [20, 21 ]. approximately 400 nb - lrr genes were identified in the genome of p. trichocarpa, which is twice larger than nb - lrr genes reported in arabidopsis thaliana (402 versus 178, resp.). the presence of about 500 nb - lrr genes in the rice genome does not support a specific increase of this gene family in perennial species ; however, the content in nb - lrr gene classes (tir - nb - lrr and non - tir - nb - lrr) differs between monocot and dicot genomes. interestingly, many of the poplar nb - lrr genes (more than 70 according to) are gathered into a supercluster localized on the chromosome 19, in the neighbourhood of many transposable elements (retrotransposons). since retroelements are known to impact gene family increase and diversification, it is tempting to hypothesize that this supercluster is likely a nursery for new poplar r genes. recently, the fine mapping of two rust resistance loci associated with complete resistance and partial resistance to m. larici - populina was achieved on the peritelomeric end of the chromosome 19 in the nb - lrr genes supercluster, which strongly suggests that rust - related r genes belong to the nb - lrr class. in addition to the coiled - coil (cc) and toll - interleukine receptor (tir) nb - lrr classes, a third class of nb - lrr genes containing a bed finger domain (called bed - nb - lrr, henceforth called bnl) has also been reported in the poplar genome [19, 24 ]. the discovery of the bed domain was first published in 2000 and was termed bed finger, after two drosophila proteins named beaf and dref containing this domain. the bed motif corresponds to a ubiquitous zinc - finger dna - binding domain, raising the possible involvement of such bnl proteins in interaction with dna and eventually regulation of transcription, although no evidence for such mechanism has been provided yet. upon recognition of a pathogen, plant r proteins trigger defence response reactions, marked by the strong induction of pathogenesis - related proteins (pr proteins) at the transcript and protein levels. interestingly, in addition to the large number of r genes, the poplar genome also contains an expanded gene family encoding thaumatin - like proteins (tlps), corresponding to the pr-5 proteins. this gene family illustrates an overrepresentation of defense - related genes in poplar compared with annual species with 42 genes identified in p. trichocarpa versus 22 in the a. thaliana genome sequence [12, 27 ]. a study conducted on a total of 600 tlps retrieved from 100 species in international databases revealed a cluster of phylogenetically related tlps, enriched in poplar and tree sequences, that might represent a specific innovation in perennial species. beyond the dramatic expansion of these defense - related genes in the poplar genome, diversification and subsequent sub- or neo - functionalisation likely occurred in poplar tlps as exemplified by diversifying selection so far, other pr gene families have not been explored at the genome - wide scale in poplar, and it would be interesting to determine whether other expansions of specific gene family related to plant immunity occurred in trees, representing possible innovations in these long - living species. the genomic hallmarks reflecting the biotrophic lifestyle of the rust fungus m. larici - populina were recently uncovered. among the 16,399 genes reported in the poplar rust genome, a strikingly large number of expanding lineage - specific gene families were identified (909 lineage - specific gene families among 5,304 in total, corresponding to 5,798 genes). several expanded gene families were also observed in the only other pucciniales genome sequenced so far (the wheat stem rust puccinia graminis f. sp. tritici), including oligopeptide and amino acid transporters. among the expanded gene families unique to the poplar rust, 54 (462 genes in total) in addition, other striking features of the poplar rust genome include a reduced set of carbohydrate active enzymes and impaired nitrogen and sulfur assimilation pathways. the genomes of other plant biotrophic pathogens revealed striking similarities with rust fungi genomic hallmarks [29, 30 ]. a particular attention was given to the genes encoding ssps in m. larici - populina (figure 2). indeed, many effector proteins secreted by biotrophic oomycete and fungal plant pathogens are ssps of unknown function and their virulence or avirulence activities could determine the outcome of the interaction with the host [20, 21, 31, 32 ]. concept between the plant immune system and pathogen effectors, ssps could display accelerated evolution rate (i.e., positive / diversifying selection) likely to evade plant r protein - mediated recognition [33, 34 ]. in m. larici - populina, the detailed annotation of predicted ssp genes, followed by expression and adaptive evolution investigations, helped the identification of candidate rust effectors likely involved in the molecular cross - talk between the rust fungus and poplar [17, 35 ] (figure 2). a total of 1,184 ssp genes have been identified and represent 7.2% of the total number of genes in the m. larici - populina genome (figure 2). these genes are organized in 169 gene families (the largest contains 111 gene members) dispersed in the genome, and their number supports the current view of fungal effectors as a redundant and diversified reservoir, contrasting with restricted effectors repertoire of biotrophic bacteria. interestingly, although some ssps display similarities with effectors previously characterized in related rust species such as melampsora lini (flax rust) and uromyces fabae (bean rust), the majority of ssps reported in m. larici - populina (69%) are specific to this rust fungus [15, 17 ]. similar observations were made after the analysis of the genome of the obligate biotrophic fungus blumeria graminis, supporting the importance of clade- and lineage - specific effectors in fungi. a striking feature of m. larici - populina ssps is the high content of cysteine residues (63% contain more than 4 cysteines). although the function of these residues in candidate ssp effectors is not known at the moment, it may be hypothesized that they could have a structural role through disulfide bond formation, known to stabilize proteins and enhance resistance to host proteases [37, 38 ]. some of these cysteines reside in a short string of residues conserved between gene members of several ssp families ([y / f / w]xc). such a motif was also reported in candidate effectors of the barley powdery mildew b. graminis and in the wheat rust fungi p. graminis f. sp. tritici and puccinia triticina, preferentially in the n - terminal region of the proteins [29, 39 ]. godfrey. proposed a possible involvement of the motif in the translocation of effectors in host plant cells, similar to the conserved n - terminal rxlr motif of oomycete effectors [4042 ]. however, the [y / f / w]xc motif is also detected in the c - terminal region of some m. larici - populina ssps and is highly represented in larger nonsecreted proteins of diverse functions ; thus, the exact role of this motif remains to be determined. some of the ssps belonging to gene families were grouped in clusters of paralogous genes (cpgs) of at least three and up to 39 members with high levels of similarities (hacquard., unpublished data). interestingly, the c - terminal region of ssps of some cpgs show significant evidence of positive selection, which is strongly suggestive of a diversification of these effector - like gene families upon interaction with the host, likely to evade recognition. such a diversification is a hallmark of biotroph effectors with avirulence functions [4347 ]. interestingly, some members of these positively selected cpgs harbour relatively well - conserved n - terminal secretion peptide as well as k / r- and d / e - rich regions (hacquard., unpublished data), reminiscent of the host - cell translocation motifs reported in some fungal and oomycete effectors [4042 ]. these ssps represent potential avirulence factor for which biochemical characterisation is ongoing (figure 2). beyond the extensive description of the repertoire of putative effectors in the poplar rust fungus genome, such evidence of selection in paralogs argues for the use of large - scale sequencing of candidate effector genes across genus and species (i.e., isolates with distinct pathotypes) to complete the molecular landscape of effector diversity. while genomic analyses reveal the genetic potential of organisms, transcriptomics allow deciphering the regulatory networks controlling the expression of such genetic programs in space and in time. in complex biotrophic systems involving two species, fine - tune genetic reprogramming occurs in both the host and the parasite to determine the outcome of the interaction [20, 48 ]. indeed, plant host - specific resistance mechanisms rely on expression of inducible defense genes, whereas the biotrophic pathogen lifestyle is based on the temporal and local expression of virulence effectors in infection structures (i.e., spores, germ - tubes, invasive hyphae, haustoria). transcriptome studies conducted on poplar - poplar rust interactions revealed the early induction of defense responses during the incompatible interaction, referred to as complete or host - specific resistance, whereas a late induction of defense responses was observed in the case of compatible interactions and partial resistance [7, 8, 11, 49, 50 ] (figure 3). these studies indicate that defense reactions are governed by common molecular bases in both perennial and annual species. indeed, defense responses in poplar include the typical set of inducible defense genes such as pr proteins, gsts (glutathione s - transferases), and redox homeostasis enzymes, as well as genes of the phenylpropanoid pathways. among the genes induced during host - specific resistance, only a few show no homology with known proteins and might represent innovations in perennial species [7, 27 ]. besides, differences in poplar defense reactions set during complete and partial resistances are mainly quantitative and timely regulated. transcriptome analyses in the model plant a. thaliana already demonstrated the quantitative nature of differences between compatible and incompatible interactions. thus, poplar and arabidopsis (and by extension perennial and annual species) seem to share a conserved set of genes to actively react upon biotroph pathogen attacks. this statement is widely applicable regarding global transcriptome analyses ; however, some specificities have been described. indeed, phylogenetically related groups of tlps are preferentially induced in infected poplar leaves during partial or complete resistance to the rust fungus. as specified above, a cluster of eleven tlp genes, so far unique to perennial species, is induced during partial resistance of poplar to rust fungi (i.e., at late infection stages of compatible interactions with melampsora spp.). this regulation pattern contrasts with another clade of poplar tlps conserved in all plants and that is mostly induced early during incompatible poplar - poplar rust interaction. transcriptome analyses of poplar leaves infected by either virulent or avirulent strains of m. larici - populina at early stages of infection (i.e., earlier than 48 hpi) are ongoing to dissect genetic reprogramming in poplar upon infection by the rust fungus (petre., unpublished data). preliminary results indicate repression of expression of genes coding for defense - related proteins and secondary metabolism enzymes at 48 compared to 18 and 24 hpi in the compatible interaction. from the zig - zag model standpoint, this could reflect the effector - triggered susceptibility (ets) that promotes fungal virulence by inhibiting the plant pamp - triggered immunity (pti). no more than 10 genes were induced at this stage of the compatible interaction, including a dramatically induced sulphate transporter gene (figure 3). such an observation is puzzling since sulphate assimilation pathway seems to be impaired in rust fungi. this opens interesting perspective to address the role of sulphate transport, assimilation, and metabolism in rust fungi during compatible poplar - poplar rust interactions and how it could impact host metabolism. m. larici - populina genetic programs triggered during poplar leaf infection (from urediniospore germination to uredinia formation on poplar leaves ; see figure 1(b)) have been recently investigated with whole - genome custom exon oligoarrays [9, 15, 52 ]. interestingly, the set of induced fungal genes greatly differs during host colonisation with preferential transcript expression at early time points (2448 hpi, haustoria formation), intermediate time points (4896 hpi, biotrophic growth), and later stages (96168 hpi, biotrophic growth, uredinia formation and sporulation) (figure 3). strikingly, several classes of ssp genes are successively expressed all along the infection, from germination to uredinia formation, suggesting that distinct sets of effectors are expressed to set up, promote, and maintain fungal biotrophy. ssp expression during urediniospore germination or at early stages of infection (i.e., 2448 hpi) supports an early manipulation of the plant defense system by the fungus in order to promote virulence (figure 3). in contrast, transcripts encoding proteases and transporters were preferentially induced at 96 hpi when the fungus has already formed many haustoria in host cells, supporting the uptake of host resources and nutrients by the fungal structures as previously reported for the bean rust fungus u. fabae (see for a complete review). at later stages of infection, the induction of transcripts encoding various lipases and carbohydrate active enzymes (cazymes) was observed concomitantly with uredinia formation (96168 hpi) reflecting a potential switch in lipid metabolism during the sporulation process (figure 3). quite interestingly, four genes encoding ssps belonging to the same gene family (m. lini hesp-417 homologs) were expressed at different infection stages, and their expression profiles were confirmed by rt - qpcr. this result suggests that waves of expression of ssp genes could likely contribute to the turnover / renewal of ssps at the interface with the host or inside host cells during the biotrophic interaction. in transcriptomic studies of biotrophic interactions, isolation of transcripts from infected tissues the purification of haustoria from rust - infected bean leaves has paved the way for the molecular analysis of these fungal cell types that play a key role in the establishment of obligate biotrophy. such an approach has allowed the sequencing of haustoria - specific cdna and the identification of genes expressed in these infection structures [5356 ]. this approach was successfully used to identify several candidate effectors in haustorially expressed secreted proteins (hesps) of the model rust fungus m. lini, including several avirulence genes. however, specific in planta gene expression in other cell types (i.e., infection hyphae, sporogenous hyphae) was not assessed so far in rust fungi. isolation of biotrophic infection hyphae from colletotrichum higginsianum was successfully applied to arabidopsis infected leaves for transcriptome analysis, and rust infection hyphae and derived infection structures were obtained artificially for the bean rust fungus u. fabae (see for details). the use of laser capture microdissection (lcm) was a major breakthrough to dissect the genetic programs related to biotrophy and sporulation at a late stage of rust infection (168 hpi), whereas various fungal structures are formed in planta. lcm allowed the successful isolation of infected mesophyll tissues containing infection hyphae and haustoria, as well as uredinia containing sporogenous hyphae and newly formed urediniospores for downstream expression analysis using m. larici - populina whole - genome custom exon oligoarrays. strikingly, among the most highly induced transcripts detected in fungal biotrophic structures in the lcm - isolated palisade mesophyll (> 100-fold induction compared to lcm - isolated uredinia), almost all encode ssps. this unexpected high number of candidate effectors expressed at this late stage of rust infection might be essential for the maintenance of biotrophy during uredinia formation and sporulation. preventing structures like haustoria from host detection in photosynthetically active mesophyll might be crucial to preserve the capability of the rust fungus to extract nutrients from the plant toward sporulating structures. indeed, in nature, sporulation structures are maintained in infected leaves and can produce thousands of urediniospores over several weeks. transcripts induced in lcm - isolated uredinia are more diverse and include several cell - cycle- and cell - rescue - related transcripts. the induction of cell cycle transcripts is supportive of the intense cell division activity observed in the microdissected sporulation area, while cell - rescue- and defense - related transcripts might reflect an active defense from the rust fungus in response to the late activation of poplar reactions such as oxidative burst or expression of defense genes reported in compatible poplar - poplar rust interactions [5, 8 ] (figure 3). interestingly, transcripts accumulated in the sporulation area were predominantly detected in resting urediniospores and at 168 hpi in the time - course expression study. in contrast, genes induced in the microdissected - infected mesophyll and encoding ssps were predominantly expressed at 96 hpi during the time - course infection, at a stage that only consists in haustoria and infection hyphae. such observations support a transcriptional switch between different fungal cell types in infected plant tissues at the stage of uredinia formation and sporulation. the combination of tools like transcriptomics and lcm clearly demonstrates that a deeper and comprehensive view of rust fungi genetics can be gained from the study of in planta infection structures. future directions will concern the identification of the fungal determinants that control the switch leading to uredinia formation in the host and the molecular bases controlling biotrophy. combination of genome and transcriptome analyses led to the definition of a very large repertoire of candidate m. larici - populina effectors [15, 17 ]. ongoing studies based on high - throughput genome and transcriptome sequencing of additional poplar rust isolates with defined pathotypes will complete and precise the list of candidate effectors. thus, the step defined as effector discovery by alfano is rather advanced and almost complete, with an exhaustive inventory of putative effectors for this rust fungal pathogen. the next step will consist in the characterisation of effector virulence / avirulence functions (figure 2). these functional investigations will be based on the heterologous expression of candidate effector coding sequences in escherichia coli or other production systems for subsequent purification of recombinant proteins. protein expression patterns, subcellular localisation, biochemical features analyses, and resolution of tridimensional structures as well as protein - protein interaction assays will help to address major questions concerning the role(s) of the highly diverse and redundant set of ssp genes in virulence and biotrophy. how do cytoplasmic effectors enter host cells ? where do they localize and is this localisation dynamic upon infection ? what are the targets or interactors of fungal effectors in host cells and how do they interact ? in order to have an accurate vision of effector functions, putative effector targets should be analyzed in a similar way. beyond in vitro analyses, in vivo experiments are also required to validate the effector actions on the host. many efforts are currently underway to establish assays for genetic transformation in poplar and/or in melampsora to study in vivo the function of genes involved in the poplar - poplar rust interaction. characterisation of virulence function of m. larici - populina effectors using a bacterial - based protein injection system in arabidopsis is currently in development (h. germain and a. sguin, personal communication). in this system, bacterial growth inside plant leaves is used as a reporter of effector - triggered plant defense inhibition. in addition, transient expression assays of effector proteins in poplar leaves could lead to the characterisation of avirulence functions reported by localized hypersensitive response. molecular analyses of the flax - flax rust pathosystem represent the most advanced rust pathosystem in the field [57, 6163 ] and is inspiring to set strategies toward functional characterisation of poplar rust effectors and avirulence genes. the large range of hybrid poplars harbouring up to eight complete resistances constitutes a robust basis for such future screening experiments.	poplars are extensively cultivated worldwide, and their susceptibility to the leaf rust fungus melampsora larici - populina leads to considerable damages in plantations. despite a good knowledge of the poplar rust life cycle, and particularly the epidemics on poplar, the perennial status of the plant host and the obligate biotrophic lifestyle of the rust fungus are bottlenecks for molecular investigations. following the completion of both m. larici - populina and populus trichocarpa genome sequences, gene families involved in poplar resistance or in rust fungus virulence were investigated, allowing the identification of key genetic determinants likely controlling the outcome of the interaction. specific expansions of resistance and defense - related genes in poplar indicate probable innovations in perennial species in relation with host - pathogen interactions. the genome of m. larici - populina contains a strikingly high number of genes encoding small secreted proteins (ssps) representing hundreds of candidate effectors. transcriptome analyses of interacting partners in compatible and incompatible interactions revealed conserved set of genes involved in poplar defense reactions as well as timely regulated expression of ssp transcripts during host tissues colonisation. ongoing functional studies of selected candidate effectors will be achieved mainly on the basis of recombinant protein purification and subsequent characterisation.
exaggerated systolic blood pressure (sbp) response to exercise is a risk factor for the future development of hypertension1, 2, 3 and left ventricular hypertrophy (lvh)4 and has been associated with greater cardiovascular disease (cvd) mortality.5, 6, 7 during exercise, sbp rises as a result of increasing heart rate (hr) and stroke volume at a higher rate than the proportional increase in vascular compliance.8 however, physiological changes in older age cause either elevation or decline in the hr and sbp responses to exercise, through several mechanisms including reduced physical fitness, increased vascular stiffness, impaired baroreceptor sensitivity, and chronotropic incompetence.9, 10, 11, 12, 13, 14 traditional modifiable risk factors also play an important role in determining the cardiovascular response to exercise. in this context, factors that determine the evolution of exercise sbp and hr responses over time and with age have not been evaluated in a longitudinal study. elevated resting sbp is associated generally with exaggerated sbp during exercise,9 but the patterns of resting and exercise sbp over time can also diverge. for instance, it is conceivable that an individual with a stable clinical measure of resting sbp across 2 decades may demonstrate a substantial increase in exercise sbp during that same time period. understanding factors that influence baseline exercise sbp and hr responses is critical to our appreciation of how these same or additional factors may also influence the evolution of exercise responses over time in individuals. such knowledge may inform us about strategies to prevent agerelated increases in exercise responses and their prognostic implications. in the present investigation, we examined the sbp and hr responses during a submaximal exercise test at 2 time points (2 decades apart) in a large communitybased sample. the use of submaximal exercise responses was preferred for this investigation (instead of responses to maximal test) to avoid issues of differing workload for individuals reaching different levels of the exercise test. the purpose of this investigation was to determine how changes in cvd risk factors influence the evolution of exercise sbp and hr responses in adults at baseline and during a 2decade period of observation. we hypothesized that greater burden of risk factors in midlife and an increase in levels of these risk factors across midlife would be associated with an increased exercise sbp and hr response at followup in later life. results from this study will help us understand the factors affecting change in exercise responses over time and provide insights into key factors that could be potentially modified to maintain an optimal exercise response over the life course, defined strictly in this study as remaining in the lowest 3 quartiles of exercise sbp (< 180 mm hg) at followup, a level consistent with a lower risk for cvd.7 an optimal exercise response was also defined broadly as preventing large increases in exercise hr or sbp over time. in 1948, enrollment began for the framingham heart study (fhs), a prospective epidemiological study of cvd. between 1979 and 1983, 3333 participants from the second generation (the framingham offspring study, composed of the children of the original cohort, and their spouses) completed stage 2 of the baseline exercise treadmill test (ett) at the fhs. about 20 years later (19982001), 1730 participants repeated the ett (completing stage 2) at a followup fhs examination. we excluded people if they had prevalent cvd (myocardial infarction, angina, stroke / transient ischemic attack, peripheral vascular disease, and congestive heart failure, n=43) or diabetes mellitus (dm) (defined as fasting glucose 126 mg / dl or taking diabetes medications, n=5) or used lipidlowering medications (n=8), at baseline only. we also excluded people who used blockers (n=158) or antihypertension medications (n=285) at baseline or followup. after exclusions, there remained 1231 subjects (55% women) who underwent serial ett. the institutional review board at the boston university medical center approved the study protocols, and all participants gave written informed consent. the baseline ett occurred when most participants were adults (mean age 39 years, only 7 participants were < 20 years) by using the bruce protocol. after a brief warmup, participants completed at least 2 stages of ett, with each stage lasting 3 minutes : stage 1 (1.7 mph, 10% grade) and stage 2 (2.5 mph, 12% grade). the baseline ett continued after stage 2, but none of the measurements beyond stage 2 were used in the current investigation. in total, 2.5% of participants who undertook the ett at baseline were excluded because they did not complete stage 2 of the ett. the followup ett (mean age 58 years) was performed by using the same protocol as the first ett, with the exception that it was terminated after completion of stage 2. at followup, 8% of participants were excluded for not completing stage 2 of the ett. at baseline and followup, bp and hr were measured at rest (before exercise onset) and midway through stage 2 of ett. risk factors and other covariates were measured during the fhs visit on the same day as each ett. the following covariates and the change in these covariates across the 2 examinations (cycles 2 and 7) were included in our analysis : age, sex, smoking status (defined as smoking cigarettes regularly in the year preceding the fhs examination), sbp, diastolic blood pressure (dbp), and hr at rest, body mass index (bmi), total cholesterol (tc)/highdensity lipoprotein (hdl), dm, lipidlowering treatments. we present descriptive statistics as means and standard deviations for continuous variables and as counts and percentages for categorical variables. we used t and tests to determine whether there were differences among demographic variables. we used multiple linear regression to predict exercise sbp and hr responses in crosssectional data, at the baseline and at the followup examinations using risk factors from the corresponding examination. we calculated changes in risk factors (followup minus baseline) for continuous variables and change in status across the 2 examinations for categorical variables. we used multiple linear regression to predict exercise sbp and hr (dependent variables) at followup with baseline ett variables, baseline risk factors, and interim change in risk factors. baseline physical activity index15 was not associated with exercise sbp or hr at followup in multivariable models (data not shown) and therefore was removed from all models. we also used multiple logistic regression to predict being in the highest quartile of exercise sbp at followup (180 mm hg) by using baseline ett variables, baseline risk factors, and interim change in risk factors. we did not evaluate predictors of quartiles of exercise hr because the prognostic implications of a high exercise hr are less clear. collinearity diagnostic testing did not reveal highly intercorrelated predictor variables that could affect the models tested. all analyses were performed with the use of sas version 9.3 (sas institute). the baseline ett occurred when most participants were adults (mean age 39 years, only 7 participants were < 20 years) by using the bruce protocol. after a brief warmup, participants completed at least 2 stages of ett, with each stage lasting 3 minutes : stage 1 (1.7 mph, 10% grade) and stage 2 (2.5 mph, 12% grade). the baseline ett continued after stage 2, but none of the measurements beyond stage 2 were used in the current investigation. in total, 2.5% of participants who undertook the ett at baseline were excluded because they did not complete stage 2 of the ett. the followup ett (mean age 58 years) was performed by using the same protocol as the first ett, with the exception that it was terminated after completion of stage 2. at followup, 8% of participants were excluded for not completing stage 2 of the ett. at baseline and followup, bp and hr were measured at rest (before exercise onset) and midway through stage 2 of ett. risk factors and other covariates were measured during the fhs visit on the same day as each ett. the following covariates and the change in these covariates across the 2 examinations (cycles 2 and 7) were included in our analysis : age, sex, smoking status (defined as smoking cigarettes regularly in the year preceding the fhs examination), sbp, diastolic blood pressure (dbp), and hr at rest, body mass index (bmi), total cholesterol (tc)/highdensity lipoprotein (hdl), dm, lipidlowering treatments. we present descriptive statistics as means and standard deviations for continuous variables and as counts and percentages for categorical variables. we used t and tests to determine whether there were differences among demographic variables. we used multiple linear regression to predict exercise sbp and hr responses in crosssectional data, at the baseline and at the followup examinations using risk factors from the corresponding examination. we calculated changes in risk factors (followup minus baseline) for continuous variables and change in status across the 2 examinations for categorical variables. we used multiple linear regression to predict exercise sbp and hr (dependent variables) at followup with baseline ett variables, baseline risk factors, and interim change in risk factors. baseline physical activity index15 was not associated with exercise sbp or hr at followup in multivariable models (data not shown) and therefore was removed from all models. we also used multiple logistic regression to predict being in the highest quartile of exercise sbp at followup (180 mm hg) by using baseline ett variables, baseline risk factors, and interim change in risk factors. we did not evaluate predictors of quartiles of exercise hr because the prognostic implications of a high exercise hr are less clear. collinearity diagnostic testing did not reveal highly intercorrelated predictor variables that could affect the models tested. all analyses were performed with the use of sas version 9.3 (sas institute). we analyzed 1231 adults in the framingham offspring study who attended 2 routine examinations almost 2 decades apart. the mean age at baseline was 39 years, with a mean age at followup of 58 years (table 1). over 2 decades, people gained weight : the mean bmi was 24.2 kg / m at baseline and 27.1 kg / m at followup. hypertension prevalence rose from 4% to 14% of participants, and 3.4% developed newonset dm. in contrast, many smokers quit : there were 32% smokers at baseline but only 14% at followup. average sbp response to exercise (stage 2) was 151 mm hg at baseline and 163 mm hg at followup ; average exercise hr (stage 2) was 131 bpm at baseline and 128 bpm at followup. characteristics of the framingham offspring cohort at baseline and followup (n=1231) values are meansd or n (%). exercise sbp and hr were measured during stage 2 of the exercise treadmill test. bmi indicates body mass index ; bpm, beats per minute ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. baseline exercise sbp related positively to age, male sex, bmi, and resting sbp but negatively to resting hr (table 2). roughly, increments of 5 years in age and 1mm hg resting sbp or 1 kg / m bmi were associated with a 1mm hg higher baseline exercise sbp, whereas a decrement of 8bpm in resting hr had the same effect. at followup (examination 7), exercise sbp associated positively with age, bmi, resting sbp, resting hr, smoking, tc / hdl, and prevalent dm. multivariable linear regression analysisa of crosssectional correlates of exercise sbp at baseline and followup bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. regression model for correlates of exercise sbp at followup also adjusted for lipid medications at followup. there were few cases of dm or people taking lipid medications at baseline, so they were not included in the baseline model. when we analyzed followup exercise sbp (stage 2) taking into account baseline exercise sbp, we found higher exercise sbp related to older age, female sex, higher baseline resting sbp and hr, and betweenexamination increases in resting sbp, resting hr, bmi, and newonset dm (table 3). in addition, smoking and high tc / hdl at baseline were associated with higher exercise sbp at followup. kg / m in bmi was associated with 1mm hg higher exercise sbp at followup ; newonset dm was associated with 6mm hg higher exercise sbp ; and smokers (at baseline) had 5mm hg higher exercise sbp at followup. age, sex, and baseline exercise sbp accounted for 28.8% of the variance in exercise sbp at followup (r = 0.288, data not shown), whereas the other correlates listed in table 3 accounted for an additional 22.5% of the variance in exercise sbp at followup (r = 0.513 for full model, table 3). multivariable linear regression analysisa to assess correlates of exercise sbp at followup, adjusting for baseline exercise sbp (r = 0.513 for the model) bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. regression model also adjusted for baseline exercise sbp and change in lipid medications. exercise sbp was measured during stage 2 of the exercise treadmill test ; change variables () were calculated as the change from baseline to followup for the continuous variables and change in status for the categorical variables. correlates associated with being in the highest quartile of exercise sbp at followup (180 mm hg) were displayed in table 4. similar to linear regression analysis described here, we found that older age, higher baseline resting sbp and hr, and betweenexamination increases in resting sbp, resting hr, and bmi were predictive of placement in the highest quartile of exercise sbp at followup, after adjusting for other factors including baseline exercise sbp. sex and development of dm, on the other hand, did not significantly relate to being in the highest exercise sbp quartile at followup (after adjusting for baseline exercise sbp and other factors), although they were significantly associated with exercise sbp at followup in linear regression analysis ; however, quitting smoking was a significant predictor of remaining in the lowest 3 quartiles of exercise sbp at followup compared with continuing to smoking. multivariable logistic regressiona to assess correlates associated with the highest exercise sbp quartile (180 mm hg) at followup, adjusting for baseline exercise sbp bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. logistic regression model also adjusted for baseline exercise sbp and change in lipid medications. exercise sbp was measured during stage 2 of the exercise treadmill test ; change variables () were calculated as the change from baseline to followup for the continuous variables and change in status for the categorical variables. in crosssectional data (table 5), higher resting hr, bmi, and female sex were associated with higher exercise hr (stage 2), whereas smokers had 2 to 3bpm lower exercise hr. tc / hdl was only significantly associated with exercise hr at baseline. in our longitudinal data analysis, higher followup exercise hr (taking into account baseline exercise hr) was associated with older age, female sex, and baseline resting hr, plus interim increases in resting hr and bmi (table 6). an increase between examinations of 3 kg / m in bmi or 3bpm resting hr was associated with 2bpm higher exercise hr at followup. age, sex, and baseline exercise hr accounted for 38.4% of the variance in exercise hr at followup (r = 0.384, data not shown), whereas the other correlates listed in table 6 accounted for an additional 13.2% of the variance in exercise hr at followup (r = 0.516 for full model, table 6). multivariable linear regression analysisa of crosssectional correlates of exercise hr at baseline and followup bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. regression model for correlates of exercise hr at followup also adjusted for lipid medications at followup. there were few cases of dm or people taking lipid medications at baseline so they were not included in the baseline model. multivariable linear regression analysisa to assess correlates of exercise hr at followup, adjusting for baseline exercise hr (r = 0.516 for the model) bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. exercise hr was measured during stage 2 of the exercise treadmill test ; change variables () were calculated as the change from baseline to followup for the continuous variables and change in status for the categorical variables. baseline exercise sbp related positively to age, male sex, bmi, and resting sbp but negatively to resting hr (table 2). roughly, increments of 5 years in age and 1mm hg resting sbp or 1 kg / m bmi were associated with a 1mm hg higher baseline exercise sbp, whereas a decrement of 8bpm in resting hr had the same effect. at followup (examination 7), exercise sbp associated positively with age, bmi, resting sbp, resting hr, smoking, tc / hdl, and prevalent dm. multivariable linear regression analysisa of crosssectional correlates of exercise sbp at baseline and followup bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. regression model for correlates of exercise sbp at followup also adjusted for lipid medications at followup. there were few cases of dm or people taking lipid medications at baseline, so they were not included in the baseline model. when we analyzed followup exercise sbp (stage 2) taking into account baseline exercise sbp, we found higher exercise sbp related to older age, female sex, higher baseline resting sbp and hr, and betweenexamination increases in resting sbp, resting hr, bmi, and newonset dm (table 3). in addition, smoking and high tc / hdl at baseline were associated with higher exercise sbp at followup. an increase between examinations of 1 kg / m in bmi was associated with 1mm hg higher exercise sbp at followup ; newonset dm was associated with 6mm hg higher exercise sbp ; and smokers (at baseline) had 5mm hg higher exercise sbp at followup. age, sex, and baseline exercise sbp accounted for 28.8% of the variance in exercise sbp at followup (r = 0.288, data not shown), whereas the other correlates listed in table 3 accounted for an additional 22.5% of the variance in exercise sbp at followup (r = 0.513 for full model, table 3). multivariable linear regression analysisa to assess correlates of exercise sbp at followup, adjusting for baseline exercise sbp (r = 0.513 for the model) bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. exercise sbp was measured during stage 2 of the exercise treadmill test ; change variables () were calculated as the change from baseline to followup for the continuous variables and change in status for the categorical variables. correlates associated with being in the highest quartile of exercise sbp at followup (180 mm hg) were displayed in table 4. similar to linear regression analysis described here, we found that older age, higher baseline resting sbp and hr, and betweenexamination increases in resting sbp, resting hr, and bmi were predictive of placement in the highest quartile of exercise sbp at followup, after adjusting for other factors including baseline exercise sbp. sex and development of dm, on the other hand, did not significantly relate to being in the highest exercise sbp quartile at followup (after adjusting for baseline exercise sbp and other factors), although they were significantly associated with exercise sbp at followup in linear regression analysis ; however, quitting smoking was a significant predictor of remaining in the lowest 3 quartiles of exercise sbp at followup compared with continuing to smoking. multivariable logistic regressiona to assess correlates associated with the highest exercise sbp quartile (180 mm hg) at followup, adjusting for baseline exercise sbp bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. logistic regression model also adjusted for baseline exercise sbp and change in lipid medications. exercise sbp was measured during stage 2 of the exercise treadmill test ; change variables () were calculated as the change from baseline to followup for the continuous variables and change in status for the categorical variables. in crosssectional data (table 5), higher resting hr, bmi, and female sex were associated with higher exercise hr (stage 2), whereas smokers had 2 to 3bpm lower exercise hr. tc / hdl was only significantly associated with exercise hr at baseline. in our longitudinal data analysis, higher followup exercise hr (taking into account baseline exercise hr) was associated with older age, female sex, and baseline resting hr, plus interim increases in resting hr and bmi (table 6). an increase between examinations of 3 kg / m in bmi or 3bpm resting hr was associated with 2bpm higher exercise hr at followup. age, sex, and baseline exercise hr accounted for 38.4% of the variance in exercise hr at followup (r = 0.384, data not shown), whereas the other correlates listed in table 6 accounted for an additional 13.2% of the variance in exercise hr at followup (r = 0.516 for full model, table 6). bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. regression model for correlates of exercise hr at followup also adjusted for lipid medications at followup. there were few cases of dm or people taking lipid medications at baseline so they were not included in the baseline model. multivariable linear regression analysisa to assess correlates of exercise hr at followup, adjusting for baseline exercise hr (r = 0.516 for the model) bmi indicates body mass index ; bpm, beats per minute ; dm, diabetes mellitus ; hdl, highdensity lipoprotein cholesterol ; hr, heart rate ; sbp, systolic blood pressure ; tc, total cholesterol. regression model also adjusted for baseline exercise hr and change in lipid medications. exercise hr was measured during stage 2 of the exercise treadmill test ; change variables () were calculated as the change from baseline to followup for the continuous variables and change in status for the categorical variables. we assessed correlates of submaximal exercise variables at a baseline examination and again 2 decades later in a large cohort of adults who were relatively healthy that is, not taking blocker or antihypertension medication. we found several cvd risk factors associated with exercise responses at baseline and at followup 2 decades later. followup exercise responses also related to interim changes in some risk factors (notably bmi, as well as resting sbp and hr). traditional cvd risk factors at baseline, age, male sex, and resting sbp were associated with higher exercise sbp ; whereas blood lipid level was the only traditional cvd risk factor associated with higher exercise hr at baseline (older age, male sex, and smoking status were associated with lower exercise hr at baseline). this investigation also suggests that development of dm in midlife is associated with a higher sbp response to exercise (adjusting for baseline exercise sbp) but was not predictive of being in the highest quartile of exercise sbp at followup. smoking and higher blood lipid levels at the baseline examination were also associated with higher followup exercise sbp despite not being independently associated with baseline exercise sbp. importantly, quitting smoking (compared with continuing to smoke) was associated with a lower risk of being in the highest quartile of exercise sbp at followup. on average, american adults gain weight each year throughout midlife.16, 17 weight gain is also associated with a decrease in physical fitness18 and increased resting hr19 and may be associated with increased arterial stiffness in young adults20 (although supporting evidence is not as clear in middleaged adults).21, 22 elevated resting hr is a measure of greater sympathetic activation and lower physical fitness, which may directly impact arterial stiffness21, 23, 24 and cvd risk.25 exaggerated sbp exercise response has been linked to cvd risk, and it is also influenced by arterial stiffness and cardiorespiratory fitness.9 in the current investigation, greater betweenexamination weight gain was associated with higher followup exercise sbp and hr, adjusting for baseline exercise sbp and other covariates. circulating metabolic factors including insulin, glucose, or inflammatory factors are elevated with weight gain, which may contribute to vascular dysfunction.26, 27 we observed an association between the development of dm and increase in exercise sbp (after adjusting for changes in bmi), thus supporting the potential role of metabolic factors in increasing exercise sbp ; but dm development did not predict placement in the highest quartile of exercise sbp, so it may not be the most important factor relating to exaggerated exercise sbp. additionally, a higher body weight imposes a greater work load on the cardiovascular system during exercise, which may explain the impact of weight gain on exercise sbp and hr at followup. the timing of risk factor exposure may also play a role in their pathogenic consequences. smoking status and an unfavorable lipid profile did not significantly affect exercise sbp at baseline but were associated with higher exercise sbp at the followup examination. our investigation demonstrates that being a smoker or having an unfavorable lipid profile in early adulthood has consequences that may not be apparent until years later, as supported by previous studies.12 smoking damages the artery wall and contributes to arterial stiffness,28 but the effect of smoking on resting bp has not been consistent across large observational studies even after adjusting for age and weight status.29 smoking has also been implicated in diminishing the baroreflex sensitivity,30 which disrupts the control of bp and hr, increasing the variability of ambulatory bp and hr.31 the effects of smoking on impaired baroreflex sensitivity may also explain our observation that baseline smoking was associated with an elevated exercise sbp at followup. smoking has been reported to increase resting hr but has also been observed to reduce exercise hr in previous studies.32 in agreement, our results support a relationship between smoking status and lower exercise hr across midlife. small studies have not found cessation of smoking to affect large artery compliance,33 and it is associated with other cardiovascular benefits.34 we observed that those who quit smoking had a 53% lower risk of having exaggerated exercise sbp at followup compared with those who continued smoking. however, we did not consider the duration of smoking or smoking cessation or quantify the pack / years of smoking, which may limit our findings. results from this investigation suggest that it may be more important to avoid the development of risk factors in the first place, such as smoking and unfavorable lipid profile, which were associated with higher exercise sbp at followup, regardless of changes in these risk factors. we may have introduced a selection bias due to exclusions ; however, the design may also be a strength, because it allowed us to examine relations of exercise responses at 2 time points with cvd risk factors in healthy adults. we chose to focus this study on the correlates of submaximal exercise sbp, the submaximal exercise response most strongly associated with vascular dysfunction,9 instead of submaximal exercise dbp, which may be affected by declining left ventricular function35 and often decreases with age (data not shown). we also chose not to focus on normal versus abnormal hr responses in the present analysis but decided instead to analyze how risk factors relate to exercise hr responses and to the change in these responses over time (in a linear regression analyses). the relations of traditional risk factors to exercise dbp and abnormal hr responses will be important to assess in future studies. in the current investigation, we used an abbreviated exercise test, equivalent to 6 minutes of increasing exercise until a maximum of 2.5 mph (or a pace of 24 minutes per mile) at a moderate 12% grade. use of a standardized, submaximal test further improves the strength of our study design. athletes may have a slower rate of increased bp and hr during moderate exercise but often reach very high levels of sbp during maximal exercise ; thus, the dose of exercise must be accounted for, as an exaggerated sbp response to maximal exercise can paradoxically be a marker of high fitness level. this phenomenon may explain the findings in some studies that reported a lack of association of sbp at maximal exercise with cvd risk.36 at lower levels of exercise, such as the design used in the current investigation, we were able to observe the rate at which sbp and hr rose during exercise, which has been suggested as a better marker for target organ damage than maximal exercise hemodynamics,37 because the dose of exercise was the same for all participants. however, we are unable to control for the percent oxygen consumption that participants achieve or whether they exhibit chronotropic incompetence during the submaximal ett. additionally, the fitness level of participants would affect their responses to low levels of exercise, as in our investigation. indeed, sbp and hr responses to a maximal exercise test could provide incremental information above and beyond that provided by the present investigation, but these data were unavailable in the current study (an unavoidable limitation because of the submaximal exercise protocols used at the fhs examinations). it is noteworthy, though, that moderate levels of exercise (eg, the submaximal ett that was used in our investigation) may mimic the type of moderate walking speed encountered during normal daily activities. we may have introduced a selection bias due to exclusions ; however, the design may also be a strength, because it allowed us to examine relations of exercise responses at 2 time points with cvd risk factors in healthy adults. we chose to focus this study on the correlates of submaximal exercise sbp, the submaximal exercise response most strongly associated with vascular dysfunction,9 instead of submaximal exercise dbp, which may be affected by declining left ventricular function35 and often decreases with age (data not shown). we also chose not to focus on normal versus abnormal hr responses in the present analysis but decided instead to analyze how risk factors relate to exercise hr responses and to the change in these responses over time (in a linear regression analyses). the relations of traditional risk factors to exercise dbp and abnormal hr responses will be important to assess in future studies. in the current investigation, we used an abbreviated exercise test, equivalent to 6 minutes of increasing exercise until a maximum of 2.5 mph (or a pace of 24 minutes per mile) at a moderate 12% grade. use of a standardized, submaximal test further improves the strength of our study design. athletes may have a slower rate of increased bp and hr during moderate exercise but often reach very high levels of sbp during maximal exercise ; thus, the dose of exercise must be accounted for, as an exaggerated sbp response to maximal exercise can paradoxically be a marker of high fitness level. this phenomenon may explain the findings in some studies that reported a lack of association of sbp at maximal exercise with cvd risk.36 at lower levels of exercise, such as the design used in the current investigation, we were able to observe the rate at which sbp and hr rose during exercise, which has been suggested as a better marker for target organ damage than maximal exercise hemodynamics,37 because the dose of exercise was the same for all participants. however, we are unable to control for the percent oxygen consumption that participants achieve or whether they exhibit chronotropic incompetence during the submaximal ett. additionally, the fitness level of participants would affect their responses to low levels of exercise, as in our investigation. indeed, sbp and hr responses to a maximal exercise test could provide incremental information above and beyond that provided by the present investigation, but these data were unavailable in the current study (an unavoidable limitation because of the submaximal exercise protocols used at the fhs examinations). it is noteworthy, though, that moderate levels of exercise (eg, the submaximal ett that was used in our investigation) may mimic the type of moderate walking speed encountered during normal daily activities. our investigation suggests that presence of cvd risk factors and their worsening over time are associated with a higher exercise sbp response both at baseline and at a followup examination 2 decades later. our findings also underscore the importance of maintaining or adopting a healthy risk factor profile over the life course to promote better exercise responses in later life. this study was funded by the framingham heart study 's national heart, lung, and blood institute contract (n01hc25195, hhsn268201500001i) with additional support from the following national institutes of health grants : (r01ag047645, r01hl131029, t32hl07224) and american heart association award (15gpsgc24800006).	backgroundbeyond their resting values, exercise responses in blood pressure (bp) and heart rate (hr) may add prognostic information for cardiovascular disease (cvd). in crosssectional studies, exercise bp and hr responses correlate with cvd risk factors ; however, it is unclear which factors influence longitudinal changes in exercise responses over time, which is important for our understanding of the development of cvd.methods and resultswe assessed bp and hr responses to lowlevel exercise tests (6minute bruce protocol) in 1231 framingham offspring participants (55% women) who underwent a routine treadmill test in 19791983 (baseline ; mean age 398 years) that was repeated in 19982001 (followup ; mean age 588 years). adjusting for baseline exercise responses, we related the followup exercise responses to baseline cvd risk factors and to their changes between examinations. compared with men, women had greater rise in exercise systolic (s)bp and hr at 20year followup (both p<0.005). baseline blood lipid levels, resting sbp and hr, and smoking status were associated with greater exercise sbp at followup (all p<0.05). weight gain across examinations was associated with higher exercise sbp and hr at followup (both p<0.0001). smoking cessation was associated with a 53% reduced risk of attaining the highest quartile of exercise sbp (180 mm hg) at followup (p<0.05).conclusionan adverse cvd risk factor profile in young adults and its worsening over time were associated with higher sbp and hr responses to lowlevel exercise in midlife. maintaining or adopting a healthy risk factor profile may favorably impact the exercise responses over time.
fracture resistance of the root - post - core assembly is a key factor to sustain the mechanical stability and clinical success of the restored endodontically treated teeth. in some cases, roots are weakened due to the caries, trauma, pulp pathology, or iatrogenic events in endodontic treatment. such weakened roots with a thin dentinal wall, stand at a higher risk of fracture which seriously compromise the long - term prognosis of the tooth - restoration success. structurally compromised roots were conventionally restored with casting posts and cores with the advantages of post stiffness, optimum adaptation, and high retention ; however, they unfortunately may experience unrestorable root fractures. therefore, fiber posts were introduced with lower elastic modulus, similar to that of dentin ; and better biomechanical performance that might offer increased fracture resistance to the fragile compromised roots. they are also compatible with bis - gma bonding techniques, allowing chemical and micromechanical bonding to the root dentin that leads to a more uniform stress distribution than metal posts. recently, several methods were introduced to enhance the post adaptation in over flared canals and to compensate the remaining gaps. they included canal reinforcement with composite resins, accessory fiber posts (afps), woven bondable ribbond fiber, and constructing direct or indirect anatomic fiber posts. some researchers showed that using afps resulted in comparable improvement in fracture resistance of compromised roots, close to that of composite reinforcement, while others failed to corroborate it. li., concluded that adding accessories has a positive effect on stress distribution. mortazavi., also stated that ribbond fiber restores most of the tooth fracture resistance. on the other hand, anatomic fiber post construction is a time consuming technique and also needs canal undercut elimination, which further jeopardizes the root resistance. although, there is no evident consensus in afps effectiveness due to controversial results, however, this method seems time saving and offers the advantage of more favorable fracture patterns over single post placement. tomazinho., showed that the d. t. light quartz fiber posts have higher flexural strength than the exacto glass fiber posts, and akkayan and gulmez found higher fracture strength in teeth restored with quartz fiber posts than those with glass fiber posts., in their recent 10-year prospective study stated that the tooth type and number of remaining cavity walls are significant predictors for the survival of glass fiber posts supported endodontically treated teeth and the anterior teeth experience 2-fold increase in failure rate compared to the posteriors. therefore, the purpose of this study was to evaluate the effectiveness of these two most popular post systems, glass and quartz ; and also to evaluate the two methods, accessory post versus conventional single post placement, on fracture resistance and failure patterns of structurally compromised mandibular premolar root. the null hypothesis was set as neither post composition nor root reinforcing method influenced the fracture resistance, and both lead to similar fracture patterns. in this experimental study, 40 freshly extracted first mandibular premolars that had similar dimensions and morphologies (radius of 3.5 0.2 mm and length of 13 0.5 mm) were selected from teeth that were extracted for orthodontic purposes. they were hand scaled and stored in distilled water with 0.2% thymol solution at room temperature. the cervical area of the selected teeth, mesiodistaly and buccolingualy, had the minimums diameters of 6 and 8 mm, respectively. also, the roots were at least 14 mm in length. all of the teeth were examined with a stereomicroscope (motic k-500l, motic incorporation ltd, hong kong) under 10 magnification to verify the absence of caries and cracks. clinical crowns were removed 1 mm above the buccal cementoenamel junction (cej) with a double - faced diamond disk (diaswiss, geneva, switzerland) and subsequently, the root canals were prepared at 1, 3, and 5 mm from the apex using gates glidden drills # 2, 3, and 4 (mani, japan), respectively. canals were irrigated with 1% sodium hypochlorite during the preparation and finally rinsed with 10 ml of distilled water to eliminate the sodium hypochlorite. then, they were thoroughly dried with the absorbent paper points and obturated by gutta percha points (gapadent co., ltd, china) and sealer (ah plus, dentsply detrey gmbh, konstanz, germany) with the lateral condensation technique. radiographs were taken to ensure the length and quality of root fillings [figure 1a ]. to simulate the periodontal ligament, root surfaces were dipped into melted wax up to 2 mm below the cej, resulting in 0.2 - 0.3 mm thick wax layer on root surfaces. afterward, roots were mounted in cold cure acrylic blocks (2 cm diameter and 2.5 cm height) with the flattened occlusal surfaces placed 2 mm above the acrylic top. blocks were placed in cold water to dissipate the heat and prevent wax layer deformation during acryl polymerization. after polymerization, roots were removed from the blocks and wax was removed from the root surface and acrylic socket using warm water. the acrylic blocks were filled with polysiloxan impression material (speedex, coltene, switzerland) using a molding syringe. the roots were reinserted into their respective acrylic sockets and excess impression material was removed with # 12 scalpel blade. therefore, the polysiloxan filled the space previously occupied by wax, so providing a standard simulated periodontal ligament with a thickness of 0.2 - 0.3 mm. the top 8 mm of gutta percha was removed with a peezo reamer # 3 (mani, japan) [figure 1b ] and the canals were subsequently enlarged with a round end taper diamond bur 850 023 (diaswiss, geneva, switzerland). remaining dentin wall was approximately 1.5 mm thick, measured with a digital caliper accurate to 0.05 mm [figure 1c ]. (c) the canal was flared till the remaining dentinal wall thickness reached 1.5 mm materials used in the experimental procedure the specimens were randomly divided to four groups (n = 10). each canal was etched with a 32% phosphoric acid gel (etch-32, bisco, inc, schaumburg, il, usa) for 15 s, thoroughly rinsed with water for 30 s and then dried with absorbent paper points to avoid root dentin desiccation., schaumburg, il, usa) were applied in with a microbrush (tpc, tpc advanced technology, china) for 15 s followed by absorbent paper point insertion to prevent adhesive pooling and then it was light cured for 20 s using a light - emitting diode (led) curing unit with output intensity of 1,100 mw / cm (demi, kerr, usa). canals were filled with a dual - cured resin cement (duo - link, bisco, inc, schaumburg, il, usa) using a needle tube provided by the manufacturer and the posts were placed as follows ; in ex group, one glass fiber post # 2 (exacto, angelus, londria, pr, brazil) was covered with the resin cement and inserted in the center of the canal. exr group were restored as group ex + two accessory glass fiber posts (reforpin, angelus, londria, pr, brazil). dt group was restored with one quartz fiber post # 2 (d. t. light, rtd, st egreve, france.) and dtf group restored like dt group + two accessory quartz fiber posts (fibercone, rtd, st egreve, france). before the cementation, all posts had been cleaned with 70% ethanol for 10 s, silanizated (ultradent silane, ultradent product, inc, usa) and finally coated by one step plus, which was light cured for 10 s. excess cements were removed with a microbrush, and then light cured for 40 s. experimental groups are displayed in [figures 2a d ]. (b) group exr, (exacto glass fiber post + two reforpin accessories). (d) group dtf (d. t. light quartz fiber post + 2 fibercone accessories) all cemented posts were cut by diamond disk 927 104 (diaswiss, geneva, switzerland), 3 mm above the flattened root surfaces. each flattened surfaces was etched for 15 s, rinsed for 10 s and dried with tissue papers (wet bonding). subsequently, they were covered with two consecutive coats of adhesive resin (singlebond 2, 3 m espe, st. adhesive resin was gently air dried for 5 s then light cured for 10 s. cores were built in three increments with the particulate filler composite resin (z250, 3 m espe, st. paul, mn, usa) using 5 mm height and 4 mm width cylindrical polyethylene molds. each layer was light cured for 20 s. the molds were removed and the occlusobuccal third of the cores were beveled at 45 angle to the root long axis, providing a bevel with 2 mm height and width. a custom made jig was fabricated with a 45 sloping surface to the horizon to standardize the position of specimens in the universal testing machine (instron, zwick / roell z020, zwick, ulm, germany). all samples were subjected to incremental static loads at an angle of 45 to the long axis of roots. loads were applied through a flattened end cone on core bevels with the crosshead speed of 0.5 mm / min [figure 3 ]. the uppermost load to produce fracture was recorded and the failure patterns at fracture sites were also categorized as are displayed in [figures 4a f ]. (f) post cracking data were statistically analyzed with spss version 11.5 software (ibm, armonk, ny, usa serial # : 30001359390). the two - way anova test was performed to compare the effects of post material and reinforcing method on fracture resistance. also, fisher 's exact test was performed to find a significant difference among failure patterns. clinical crowns were removed 1 mm above the buccal cementoenamel junction (cej) with a double - faced diamond disk (diaswiss, geneva, switzerland) and subsequently, the root canals were prepared at 1, 3, and 5 mm from the apex using gates glidden drills # 2, 3, and 4 (mani, japan), respectively. canals were irrigated with 1% sodium hypochlorite during the preparation and finally rinsed with 10 ml of distilled water to eliminate the sodium hypochlorite. then, they were thoroughly dried with the absorbent paper points and obturated by gutta percha points (gapadent co., ltd, china) and sealer (ah plus, dentsply detrey gmbh, konstanz, germany) with the lateral condensation technique. radiographs were taken to ensure the length and quality of root fillings [figure 1a ]. to simulate the periodontal ligament, root surfaces were dipped into melted wax up to 2 mm below the cej, resulting in 0.2 - 0.3 mm thick wax layer on root surfaces. afterward, roots were mounted in cold cure acrylic blocks (2 cm diameter and 2.5 cm height) with the flattened occlusal surfaces placed 2 mm above the acrylic top. blocks were placed in cold water to dissipate the heat and prevent wax layer deformation during acryl polymerization. after polymerization, roots were removed from the blocks and wax was removed from the root surface and acrylic socket using warm water. the acrylic blocks were filled with polysiloxan impression material (speedex, coltene, switzerland) using a molding syringe. the roots were reinserted into their respective acrylic sockets and excess impression material was removed with # 12 scalpel blade. therefore, the polysiloxan filled the space previously occupied by wax, so providing a standard simulated periodontal ligament with a thickness of 0.2 - 0.3 mm. the top 8 mm of gutta percha was removed with a peezo reamer # 3 (mani, japan) [figure 1b ] and the canals were subsequently enlarged with a round end taper diamond bur 850 023 (diaswiss, geneva, switzerland). remaining dentin wall was approximately 1.5 mm thick, measured with a digital caliper accurate to 0.05 mm [figure 1c ]. (c) the canal was flared till the remaining dentinal wall thickness reached 1.5 mm materials used in the experimental procedure each canal was etched with a 32% phosphoric acid gel (etch-32, bisco, inc, schaumburg, il, usa) for 15 s, thoroughly rinsed with water for 30 s and then dried with absorbent paper points to avoid root dentin desiccation. two consecutive coats of adhesive resin (one step plus, bisco inc., schaumburg, il, usa) were applied in with a microbrush (tpc, tpc advanced technology, china) for 15 s followed by absorbent paper point insertion to prevent adhesive pooling and then it was light cured for 20 s using a light - emitting diode (led) curing unit with output intensity of 1,100 mw / cm (demi, kerr, usa). canals were filled with a dual - cured resin cement (duo - link, bisco, inc, schaumburg, il, usa) using a needle tube provided by the manufacturer and the posts were placed as follows ; in ex group, one glass fiber post # 2 (exacto, angelus, londria, pr, brazil) was covered with the resin cement and inserted in the center of the canal. exr group were restored as group ex + two accessory glass fiber posts (reforpin, angelus, londria, pr, brazil). dt group was restored with one quartz fiber post # 2 (d. t. light, rtd, st egreve, france.) and dtf group restored like dt group + two accessory quartz fiber posts (fibercone, rtd, st egreve, france). before the cementation, all posts had been cleaned with 70% ethanol for 10 s, silanizated (ultradent silane, ultradent product, inc, usa) and finally coated by one step plus, which was light cured for 10 s. excess cements were removed with a microbrush, and then light cured for 40 s. experimental groups are displayed in [figures 2a d ]. (b) group exr, (exacto glass fiber post + two reforpin accessories). (d) group dtf (d. t. light quartz fiber post + 2 fibercone accessories) all cemented posts were cut by diamond disk 927 104 (diaswiss, geneva, switzerland), 3 mm above the flattened root surfaces. each flattened surfaces was etched for 15 s, rinsed for 10 s and dried with tissue papers (wet bonding). subsequently, they were covered with two consecutive coats of adhesive resin (singlebond 2, 3 m espe, st. adhesive resin was gently air dried for 5 s then light cured for 10 s. cores were built in three increments with the particulate filler composite resin (z250, 3 m espe, st. paul, mn, usa) using 5 mm height and 4 mm width cylindrical polyethylene molds. each layer was light cured for 20 s. the molds were removed and the occlusobuccal third of the cores were beveled at 45 angle to the root long axis, providing a bevel with 2 mm height and width. a custom made jig was fabricated with a 45 sloping surface to the horizon to standardize the position of specimens in the universal testing machine (instron, zwick / roell z020, zwick, ulm, germany). all samples were subjected to incremental static loads at an angle of 45 to the long axis of roots. loads were applied through a flattened end cone on core bevels with the crosshead speed of 0.5 mm / min [figure 3 ]. the uppermost load to produce fracture was recorded and the failure patterns at fracture sites were also categorized as are displayed in [figures 4a f ]. (f) post cracking data were statistically analyzed with spss version 11.5 software (ibm, armonk, ny, usa serial # : 30001359390). the two - way anova test was performed to compare the effects of post material and reinforcing method on fracture resistance. also, fisher 's exact test was performed to find a significant difference among failure patterns. the mean standard deviation (sd) of fracture resistance in experimental groups are presented in table 2 and [figure 5. ] the order of the fracture resistance was recorded as follows : ex > dt > exr > dtf but two - way anova test showed neither reinforcing method (p = 0.094), nor post composition (p = 0.462) had statistically significant differences on fracture resistance of the structurally compromised premolar teeth. the mean fracture resistance value (n) of the experimental groups fracture resistance mean and sd. ex : exacto glass fiber post, exr : exacto glass fiber post + two reforpin accessories, dt : d. t. light quartz fiber post, dtf : d. t. light quartz fiber post + 2 fibercone accessories patterns of change in the experimental groups failure pattern classification and distributions are provided in [table 3 ]. the order of the favorable fracture prevalence was documented as follows : exr > ex = dtf > dt ; but fisher 's exact test demonstrated no statistically significant difference regarding two variables (p = 0.695). structurally compromised roots encounters the clinicians with the challenge of selecting post composition and reinforcing method. glass and quartz fiber posts have been evaluated in several studies and are extensively used in restoration of the endodontically treated teeth. since these fiber posts have elastic modulus near to dentin and are capable of bonding to root dentin, they present some reinforcing effect to the structurally compromised roots. although the d. t. light posts have higher flexural strength than the exacto post, and teeth restored with quartz fiber posts have higher fracture strength than those with glass fiber posts, both glass and quartz fiber posts performed the same in the present study. maccari., also reported the same fracture resistance in flared roots restored with glass and quartz fiber posts, which is in accordance with this study. it has been reported that in glass and polyethylene fiber reinforced tooth colored restorations, bulk of fiber and type of bonding agent are important factors for increasing fracture load and flexural strength. also, post composition and bulk of post and resin cement affect stress distribution and fracture resistance in weakened roots. clavijo., stated that although afps reduce the bulk of resin cements, there are still some empty spaces between fibers, which will be filled by the resin cement. this results in thicker cement layer that possibly contains more voids and bubbles, thus leading to a lower cohesive strength of the resin cements. nevertheless, in the present study, groups with afps showed reduced fracture resistance with respect to single post groups, but this was not statistically significant. this outcome could be related to the introduction of more filled resin cements with higher strength value that can strengthen the remaining root dentin. in single post placement technique, highly filled resin cement can strengthen the remaining root but in afps method, multiple spaces between afps weaken the resin cement. on the other hand, mortazavi., showed that restoration of weakened roots with d. t. light post in combination with ribbond fibers restore most of the root fracture resistance. n in male and 314.7 96.5 n in female, which are approximately in the range of the fracture resistance we obtained in the present study. however, functional and parafunctional cyclic habits, as well as time and oral environmental factors result in fatigue and adhesive failures. according to table 3 favorable fractures imply to those such as core detachment, core fracture, and supracrestal root fracture in which tooth can be restored. core fracture was the most common failure pattern and was more prevalent with the afps. this could be related to the voids and multiple spaces between fibers and the consequent reduction in cohesive strength of cores. moosavi., reported that more incidence of core fracture with afps results from the frictional forces between multiple posts. incorporating crown as a final restoration will significantly reduce the risk of core fractures, but increase root fracture. in one prospective study, cagidiaco., concluded that endodontically treated premolars should be restored with fiber posts and complete crowns to obtain the highest success. in order to eliminate the ferrule effect, crown margin passes greater compression force to root cervical third, which diminishes the role of the post and core foundation in load transmission to whole root canal surface. crown application also imparts some variables such as differences in their morphologies and additional interfacial bond surfaces, which both may lead to errors in interpreting the results. one of the concerns in reinforcing procedures is the establishment of efficient bonds between components such as dentin, resin cement, resin composite, and the fiber post. although numerous researchers affirmed that loss of post retention was the most prevalent failure mode, none of the specimen in this study showed this failure type. the surface available for bonding has much more desirable condition and improved bond surface due to decreased tubular diameter and increased intertubular dentin. clavijo., reported that silanization created a monoblock as a result of chemical bond between resin cements and the epoxy resin in fiber posts, while others have different concepts. they believe that the chemical bond may be achieved only between the exposed glass or quartz fibers on the post and resin composite or cement, because the epoxy resin in fiber post has a high degree of conversion and is highly cross linked. silanization of the exposed glass and quartz fibers on the post play an important role especially in the case of non self - adhesive resin cements such as the one we used in this study. moreover, application of an eugenol - free sealer such as ah - plus in root canal obturation reduces the probability of eugenol - resin interaction. core detachment from the occlusal surface represents a stable adhesion between composite core and fiber posts that prohibits core fracture. according to [table 3 ], they have mostly happened in the quartz fiber posts (12.5% of 15% total). aksornmuang., have also reported the same result in their research and concluded that this is due to the differences in the fiber 's composition. qualtrough., similarly declared that quartz fibers have higher retentive values with respect to glass ones, which is again in accordance with our finding. one of the roots in the dt group was fractured supracrestaly that might be resulted from the stronger adhesion between quartz fiber, composite core, and occlusal dentin ; which transferred the load, essentially, to the root cervical third. post fracture and root fracture are considered as unfavorable fractures that can not be repaired. according to [table 3 ], they were distributed nearly equal in glass and quartz fiber posts and also in both post placement techniques. two posts were cracked in dt group, which may have resulted from more stress concentration in quartz fibers because of its crystalline and harder nature. this might be due to better stress distribution as a consequence of increase in the final post diameter. mortazavi., also declared that ribbond fibers result in more desirable fracture patterns. the null hypotheses were strongly accepted and this study showed that glass and quartz fiber posts, with or without accessories ; were equally effective in structurally compromised roots. assuredly, in clinical situations, several factors such as oral cavity conditions and masticatory force may affect these in vitro results. based on the findings and within the limitations of this in vitro study, it could be concluded that in the structurally compromised roots, glass and quartz fiber posts with or without accessories, were equally effective in improving the fracture resistance and failure patterns.	background : glass and quartz fiber posts are used in restoration of structurally compromised roots. accessory fiber posts are recently introduced to enhance the fiber post adaptation. this study evaluated the effectiveness of glass versus quartz accessory fiber posts.materials and methods : in this experimental study, 40 mandibular premolar roots with similar dimension (radius of 3.5 0.2 mm and length of 13 0.5 mm) were selected and their root canals were flared until 1.5 mm of dentin wall remained. they were randomly assigned to four groups (n = 10) and restored as follows : exacto glass fiber post (ex), exacto glass fiber post + 2 reforpin accessories (exr), d. t. light quartz fiber post (dt), and d. t. light quartz fiber post + 2 fibercone accessories (dtf). all posts were cemented with duo - link resin cement and the cores were built with the particulate filler composite. following 1-week water storage, specimens were subjected to fracture loads in a universal testing machine. the maximum loads and failure modes were recorded and analyzed with the two - way analysis of variance (anova) and fisher 's exact tests (= 0.05).results : the mean fracture resistance values (n) were 402.8 (ex), 378.4 (exr), 400.1 (dt), and 348.5 (dtf). two - way anova test showed neither reinforcing method (p = 0.094), nor post composition (p = 0.462) had statistically significant differences on fracture resistance of the structurally compromised premolar teeth. fisher 's exact test also demonstrated no statistically significant difference regarding two variables (p = 0.695). core fracture was the most common failure mode (62.5%).conclusion : glass and quartz fiber posts with or without accessories restored the weakened premolar roots equally.
the vast increase in the number of new psychopharmacologic agents has made more therapeutic options available, but has also complicated patient treatment. combination therapy used in psychiatric practice makes drug interactions more likely and increases the risk of adverse outcomes to the patients. many interactions have minor clinical significance ; however, there are many potentially hazardous interactions that should always be considered. the significance of a drug interaction can also vary between individuals, depending on factors such as co - morbidities, gender, and age. according to a recently published study, psychiatric medications can account for up to 50% of the adverse drug reactions (adrs) for hospitalized patients with mental illness, many of which can be attributed to drug drug interactions. it has been estimated that 26% of adrs requiring hospital admissions may be due to drug drug interactions. haloperidol is a psychotropic drug of the butyrophenone family and is used for both chronic and short - term therapy. parkinsonism is one of the most common extrapyramidal side effects (eps) of haloperidol. there are reports on drug drug interactions of haloperidol with neuroleptics, drugs known to prolong the qt interval, and drugs known to cause electrolyte imbalance, and the interactions are pharmacodynamic in nature. we are reporting a case of drug interaction of haloperidol with levodopa in a parkinsonism patient. a 60-year - old female weighing 52 kg was admitted to the hospital with the complaints of excessive drooling, involuntary movements of upper and lower limbs, slurring of speech, and difficulty in walking with stiffness in arms and legs since 12 weeks. ten years back, she was diagnosed to have parkinsonism disease and initiated on antiparkinsonian drugs. she was on tablet syndopa 110 mg tid and tablet trihexyphenidyl (thp) 1 mg tid for past 3 years. four months ago, she had consulted a local doctor for decreased sleep and headache and was prescribed tablet haloperidol 5 mg tid. a month latter, she visited our hospital and was admitted to the inpatient psychiatric unit with an additional diagnosis of neuroleptic - induced parkinsonism. on physical examination, she was found to have bradykinesia, lip smacking, flexed posture, and cogwheel rigidity. findings from her routine blood work including complete blood cell count with differential and comprehensive metabolic profile were within normal limits. based on literature search and detailed review of the patient medical history, haloperidol was suspected to be the causative agent for current episode in this patient and was replaced with tablet risperidone 1 mg bd. however, she continued to receive syndopa (110 bd) and thp (2 mg in the morning) during the remaining 11 days of her hospital stay. three days later, she was discharged with tablet syndopa 110 bd, tablet thp 2 mg one in the morning and one in the noon, and tablet clonazepam 0.5 mg hs, and advice for review after 2 weeks. a drug interaction occurs when the toxicity or effectiveness of a drug is altered by the concurrent administration of another drug. a pharmacokinetic drug interaction occurs when a drug alters the absorption, distribution, metabolism, or excretion of another drug. pharmacodynamic interactions occur when two drugs act on interrelated receptor sites, resulting in either additive or antagonistic effect. drug interactions have been documented to occur with many agents commonly used in conjunction with antipsychotics such as anticholinergics, anticonvulsants, antidepressants, anxiolytics, and lithium. it is widely recognized that neuroleptic drugs can induce a state of parkinsonism, a major adverse reaction attributed to antagonism at striatal dopamine receptors. the temporal relationship between starting of haloperidol and progression of the patient 's parkinsonian signs confirms that this clinical observation is very likely to be due to haloperidol. one explanation of our finding is the possibility of drug drug interaction of haloperidol and levodopa. haloperidol reduces the efficacy of levodopa in parkinson 's disease by blockade of dopamine receptors in the corpus striatum. the result may be worsening motor function, a relapse of psychosis, or a combination of both. positron emission tomography (pet) studies have indicated that the therapeutic effects of antipsychotics are achieved at a blockade of 60 - 70% of dopamine receptors, and antipsychotic - induced parkinsonism (aip) was observed at d2 occupancy of 34 - 80%. a greater affinity of conventional antipsychotics for dopamine d2 receptors may account for their increased risk of aip. several studies have reported that between 26% and 67% of patients using conventional antipsychotics develop aip. the interval between initiation of antipsychotics and onset of aip is highly variable, ranging from a few days to several months. in our case, although no rechallenge was attempted, the symptoms were improved after 11 days of cessation of haloperidol, which is suggestive of possible association between haloperidol and the current episode of patient condition. besides that, elderly people are more prone to develop adverse drug interactions because of their age - related changes in the pharmacokinetic and pharmacodynamic parameters. it is well documented that younger people tend to metabolize the drug faster than older people, and men faster than women. according to different studies, most likely, a combination of these factors, i.e. dopamine blocking, drug interaction, age, high dose of the drug, and gender, may have given rise to this episode of parkinsonism. the probability of a causal relationship between a potential drug interaction and the event was possible, as assessed by drug interaction probability scale (dips). in practice, only a few of the possible drug interactions may be clinically relevant ; the practitioner must still consider the critical factors associated with drug drug interactions. such factors include the potency and concentration of the drugs involved, the therapeutic index balanced between efficacy and toxicity, the presence of active metabolites, and the extent of the metabolism of the substrate drug. it is imperative that all healthcare professionals working with older adult population should take a comprehensive medication history and do careful monitoring for identification, management, and prevention of negative clinical consequences. the influence of aip on the quality of life of elderly patients should be evaluated. with the increase in the number and types of medications being prescribed for or used by patients, it is important to look at all medications, including over - the - counter ones.	drug interactions are known to play a significant role in the incidence of adverse drug reactions (adrs) both in the community and in hospitals. both the newer atypical antipsychotics and their more traditional counterparts are subject to drug drug interactions amongst themselves, with other psychotropics, and with the agents used in the treatment of various physical ailments. the most common interactions encountered in clinical practice are pharmacodynamic in nature. it is well established that antipsychotic drugs reduce the efficacy of levodopa in parkinson 's disease by blockade of dopamine receptors in the corpus striatum. the case reported here illustrates a common pharmacodynamic drug interaction of haloperidol with levodopa in a 60-year - old female patient.
since the cases of tertiary syphilis can be seen very rarely in western society today, it is very difficult for us to diagnose as a syphilitic aneurysm preoperatively when we encounter the thoracic aortic aneurysm whose etiology is unknown. major cardiovascular manifestations of tertiary syphilis are asymptomatic aortitis, aortic regurgitation, coronary ostial stenosis and aortic aneurysm. here, we report the patient who had suffered from giant ascending aortic aneurysm with positive syphilitic test, moderate aortic regurgitation and fistula between aorta and superior vena cava (svc). a 52-year - old man had suffered from severe edema of his face and upper extremity. he was diagnosed with svc syndrome and referred to our institution for the treatment of svc syndrome. computed tomography scan revealed giant ascending aortic aneurysm with the dimension of 79 mm in size and svc was compressed severely by ascending aorta (fig. 1). although we had checked serodiagnostic tests for syphilis, treponema pallidum hemagglutination reaction (tpha) and fluorescence test assay absorption (fta - abs), the results of their examination were not revealed preoperatively. we performed surgical repair of the aortic aneurysm via median sternotomy in a usual manner. cardiopulmonary bypass (cpb) was established between bilateral vena cava drainage and right femoral artery perfusion. the patient was cooled to the core temperature of 25 c, the aneurysm was opened under deep hypothermic circulatory arrest and selective cerebral perfusion was established. the marked adhesion was detected around distal aortic arch suggesting the inflammatory process around the aorta. the distal anastomosis was performed at 6 cm distal site from left subclavian artery. after the distal anastomosis under open distal technique, three neck vessels were reconstructed individually. when we started systemic rewarming, we detected the bleeding from the hole of the opened aortic wall. the hole was slit shape and 8 1 mm in size. we diagnosed the fistula between ascending aorta and svc, and closed the fistula with 4 - 0 polypropylene in a running fashion. postoperatively, we suspected syphilitic aneurysm because we could find that the preoperative serodiagnostic tests were all positive. although postoperative histological examination of the aneurysmal wall did not show typical syphilitic features, obliterative endarteritis and fibrosis at vasa vasorum, the severely changed tunica media could be detected (fig. 1preoperative computed tomography showing giant ascending aortic aneurysm with the dimension of 79 mm in size and severely compressed svcfig. 2histological examination. a low - power magnification of tunica media showing medial necrosis with destruction of elastic fibers (h&e staining, 20). b low - power magnification of adventitia showing no endarteritis obliterans within the adventitia (elastica masson staining, 10) preoperative computed tomography showing giant ascending aortic aneurysm with the dimension of 79 mm in size and severely compressed svc histological examination. a low - power magnification of tunica media showing medial necrosis with destruction of elastic fibers (h&e staining, 20). b low - power magnification of adventitia showing no endarteritis obliterans within the adventitia (elastica masson staining, 10) a 52-year - old man had suffered from severe edema of his face and upper extremity. he was diagnosed with svc syndrome and referred to our institution for the treatment of svc syndrome. computed tomography scan revealed giant ascending aortic aneurysm with the dimension of 79 mm in size and svc was compressed severely by ascending aorta (fig. 1). although we had checked serodiagnostic tests for syphilis, treponema pallidum hemagglutination reaction (tpha) and fluorescence test assay absorption (fta - abs), the results of their examination were not revealed preoperatively. we performed surgical repair of the aortic aneurysm via median sternotomy in a usual manner. cardiopulmonary bypass (cpb) was established between bilateral vena cava drainage and right femoral artery perfusion. the patient was cooled to the core temperature of 25 c, the aneurysm was opened under deep hypothermic circulatory arrest and selective cerebral perfusion was established. the marked adhesion was detected around distal aortic arch suggesting the inflammatory process around the aorta. the distal anastomosis was performed at 6 cm distal site from left subclavian artery. after the distal anastomosis under open distal technique, three neck vessels were reconstructed individually. when we started systemic rewarming, we detected the bleeding from the hole of the opened aortic wall. the hole was slit shape and 8 1 mm in size. we diagnosed the fistula between ascending aorta and svc, and closed the fistula with 4 - 0 polypropylene in a running fashion. postoperatively, we suspected syphilitic aneurysm because we could find that the preoperative serodiagnostic tests were all positive. although postoperative histological examination of the aneurysmal wall did not show typical syphilitic features, obliterative endarteritis and fibrosis at vasa vasorum, the severely changed tunica media could be detected (fig. 1preoperative computed tomography showing giant ascending aortic aneurysm with the dimension of 79 mm in size and severely compressed svcfig. a low - power magnification of tunica media showing medial necrosis with destruction of elastic fibers (h&e staining, 20). b low - power magnification of adventitia showing no endarteritis obliterans within the adventitia (elastica masson staining, 10) preoperative computed tomography showing giant ascending aortic aneurysm with the dimension of 79 mm in size and severely compressed svc histological examination. a low - power magnification of tunica media showing medial necrosis with destruction of elastic fibers (h&e staining, 20). b low - power magnification of adventitia showing no endarteritis obliterans within the adventitia (elastica masson staining, 10) syphilitic aortitis manifests clinically as aortic regurgitation, coronary ostial stenosis and aortic aneurysm more than 1020 years after the primary infection [1, 2 ]. the spirochetal invasion of the aortic adventitia causes an obliterative endarteritis of the vasa vasorum. blood supply to the aortic wall is impaired, which results in weakening of the tunica media and formation of the aneurysm. in our case, we could not detect typical obliterative endarteritis, but severely changed tunica media could be detected. the most frequently involved segment is the ascending aorta, next is the aortic arch and last is the descending aorta. the prognosis for patients with syphilitic aneurysms is extremely poor with the 2-year mortality rate of unrepaired syphilitic aneurysm of 80 %. the majority of death due to aortic aneurysms are caused by rupture [4, 5 ]. since cardiovascular syphilitic infection has disappeared in developed countries since 1990, we rarely encounter tertiary syphilis today. but we should consider syphilitic aneurysm in the differential diagnosis of thoracic aneurysms especially when the patient does not have manifestations of connective tissue diseases and has no risk factors for atherosclerosis. giant syphilitic aortic aneurysm may compress around structures including the trachea, esophagus, pulmonary artery and svc as in our patient. although the reports of the arterial fistula to pulmonary artery and the svc syndrome can be found, our case of the arterial fistula to svc is first reported case [810 ]. we misdiagnosed as the atherosclerotic aneurysm complicated with simple svc syndrome when we checked preoperative - enhanced computed tomography. the most recommended antibiotics is benzylpenicillin potassium (pcg) of 1.22.4 million units daily for 3 weeks. although the patient remains asymptomatic 1 and half years later, we should follow the patient carefully for a long time. although syphilitic aortitis has become extremely rare today, syphilis should still be considered as a differential diagnosis of the etiology of aortic aneurysm, especially when the patient does not have manifestations of connective tissue diseases and any risk factors for atherosclerosis.	syphilitic aortitis is usually associated with thoracic aortic saccular aneurysm, aortic regurgitation and coronary ostial stenosis. however, syphilitic aneurysms have rarely been reported today. here, we report a patient with ascending aortic aneurysm with aorta - superior vena cava (svc) fistula with positive syphilitic test. a 52-year - old man was admitted to our institution with a giant ascending aortic aneurysm complicated with svc syndrome. computed tomography revealed a giant ascending aneurysm 79 mm in diameter. the result of serodiagnostic tests for syphilis had not been judged yet preoperatively. total arch replacement concomitant with elephant trunk was performed. intraoperatively, we detected the ascending aorta to svc fistula. postoperatively, we suspected the syphilitic aneurysm strongly, because preoperative serodiagnostic test was concluded to be positive. however, histological examination did not show typical syphilitic features. the patient remains asymptomatic 1 year later. although extremely rarely today, syphilitic aneurysm should be still considered in the differential diagnosis of ascending aortic aneurysm.
orthodontic force application to the teeth is responsible for a series of biological responses in the bone tissue, which lead to bone modeling and remodeling, allowing tooth movement. the resulting neoformed bone has a low degree of mineralization, with short - term reduction of the mineral density of the tooth - surrounding alveolar bone, which may impair its structural resistance. besides causing obvious structural changes in the bone tissue, animal studies have shown orthodontic movement to have effects on the dental tissue, causing odontoblast activation and increased dentin mineralization. such tissue reactions maybe due to the presence of specific proteins (dentin matrix protein 1 dmp1, and dentin sialophosphoprotein - dspp), which have their levels upregulated by mechanical stress. once such proteins are present in dentin and bone, mineralization of these 2 tissues may be likewise influenced by mechanical perturbations. alveolar bone mineral density is already associated with the formation of areas of hyalinization and root resorption units during orthodontic treatment. although this process might also be influenced by the degree of mineral density of the roots, there is a lack of studies investigating this issue. computed tomography (ct) and cone beam computed tomography (cbct) scanners are the most frequently used instruments to assess the mineral density of craniofacial bone structures [4,1519 ]. however, because the intensity values of cbct images are influenced by the scanning device, image - acquisition settings and positioning, these variables should be controlled for in order to guarantee the reliability of the results. the purpose of this controlled study was to assess the degree of mineral density of the apical third of the roots of upper central incisors and of the periapical bone, through cbct images, comparing orthodontically treated and untreated subjects. they were consecutively selected from a postgraduate orthodontic program of the juiz de fora federal university. they were divided into 2 groups : the untreated group (15 males, 15 females ; mean age 23.1 years), which had not undergone orthodontic treatment ; and the treated group (7 males, 8 females ; mean age 22.8 years), which had finished their orthodontic treatment at least 1 year (mean time 6.52 years) prior to the study. all had full permanent dentition (with the exception of the 3 molars) and no endodontic treatment in the teeth examined, root resorption, history of injury to the upper central incisors, or any kind of bone pathology. this study was approved by the human research ethics committee of the juiz de fora federal university. mineral density of the roots of the upper central incisors and the alveolar bone was calculated from cbct images. the cbct images were obtained with i - cat (imaging sciences international inc., hatfield, usa), using a 160 mm diameter and 100 mm height field of view (fov). the nominal beam was 120 kv and 38 ma, with 26.9 s rotation time. the individual s head was aligned with a chin rest and laser lines, with the frankfurt plane parallel to the floor and the median sagittal plane perpendicular to the floor. as for fov positioning, the occlusal plane was positioned in its vertical center and the anterior nasal spine 35 mm from its anterior surface. the images were analyzed with the i - cat vision (imaging sciences international inc., hatfield, usa) software, with 0.5 mm - thick slices. at mpr viewing modality, each upper central incisor was positioned vertically, so that the intersection of the sagittal and coronal sections coincided with its long central axis, with the coronal section parallel to the incisal border (figure 1). in the sagittal section, the root length was measured as the distance between the most apical point of the root and the middle point of the vestibular and lingual cementum - enamel junctions. one calibrated investigator (b.p.) randomly and blindly assessed the cbct images of all patients, and determined the bone and root mineral densities. the rmd was determined as the mean of 4 regions of interest (roi) within the apical third of the roots, 2 areas in the coronal section (right and left figure 2) and 2 areas in the sagittal section (vestibular and lingual figure 3), encompassing as large an area as possible, but without impinging on the images corresponding to the periodontal ligament and the pulp. bmd was determined in the same sagittal section used for rmd assessment for each tooth. bmd was determined as the mean density of 4 regions of interest (roi) at the alveolar bone, 3 11 mm areas located on the lingual side of the apical third of the root (superior, middle and inferior) and another 1 mm - high supra - apical area, localized above the root apex, extending from the vestibular cortical wall to 2 mm lingual to the apex center (figure 4). although this was a controlled study, palatal bone areas were assessed in order to compare the md of similar structures not affected by orthodontic movement, in both groups, as well as to assess the reliability of the measurements of symmetrical areas from the same individuals. likewise, the md of bone areas not influenced by tooth movement or occlusal stress were assessed in order to compare similar structures of the 2 groups, as well as to assess the reliability of the measurements of symmetrical areas of the same individuals. the bmd of 8 reference areas in the maxilla, 4 on each side, symmetrically positioned in the anteroposterior and mediolateral directions, was assessed. the maxilla was initially positioned with the axial and sagittal planes intersecting the anterior and posterior nasal spines. afterwards, the lowermost axial section, where the posterior wall of the incisal foramen could be visualized, was selected. coronal views of the maxilla were selected at 4 and 6 mm posterior to the distal wall of the incisal foramen, and the bmd was measured in 4 3 mm - wide areas in each coronal views, 1.5 and 4.5 mm lateral to the midline, on both sides (figure 5). intra - rater agreement values of bmd of alveolar and reference areas and rmd measurements were examined by intraclass correlations (icc), being based on 15 randomly chosen incisors, which were measured twice, with an interval of 15 days. due to the different size of the 2 groups, the normality of the variables was tested with the shapiro - wilks test for the treated group and with kolmogorov - smirnov test for the untreated group. additionally, the homoscedasticity of the variables was tested with levene s test for the treated and the untreated groups. comparison of the bmd values of reference and alveolar areas between left and right sides, for each group, was undertaken with student s dependent t test, the independent t test being used for between - group comparison. for rmd values, student s dependent t test was used to compare the left and right sides, the independent t test being used for between - group comparison. the mann - whitney test was used to confirm the results of the parametric test for between - group comparison. the statistical analysis was made with =.05 significance level and processed with spss statistics 17.0.0 (spss inc., the rmd was determined as the mean of 4 regions of interest (roi) within the apical third of the roots, 2 areas in the coronal section (right and left figure 2) and 2 areas in the sagittal section (vestibular and lingual figure 3), encompassing as large an area as possible, but without impinging on the images corresponding to the periodontal ligament and the pulp. bmd was determined in the same sagittal section used for rmd assessment for each tooth. bmd was determined as the mean density of 4 regions of interest (roi) at the alveolar bone, 3 11 mm areas located on the lingual side of the apical third of the root (superior, middle and inferior) and another 1 mm - high supra - apical area, localized above the root apex, extending from the vestibular cortical wall to 2 mm lingual to the apex center (figure 4). although this was a controlled study, palatal bone areas were assessed in order to compare the md of similar structures not affected by orthodontic movement, in both groups, as well as to assess the reliability of the measurements of symmetrical areas from the same individuals. likewise, the md of bone areas not influenced by tooth movement or occlusal stress were assessed in order to compare similar structures of the 2 groups, as well as to assess the reliability of the measurements of symmetrical areas of the same individuals. the bmd of 8 reference areas in the maxilla, 4 on each side, symmetrically positioned in the anteroposterior and mediolateral directions, was assessed. the maxilla was initially positioned with the axial and sagittal planes intersecting the anterior and posterior nasal spines. afterwards, the lowermost axial section, where the posterior wall of the incisal foramen could be visualized, was selected. coronal views of the maxilla were selected at 4 and 6 mm posterior to the distal wall of the incisal foramen, and the bmd was measured in 4 3 mm - wide areas in each coronal views, 1.5 and 4.5 mm lateral to the midline, on both sides (figure 5). intra - rater agreement values of bmd of alveolar and reference areas and rmd measurements were examined by intraclass correlations (icc), being based on 15 randomly chosen incisors, which were measured twice, with an interval of 15 days. due to the different size of the 2 groups, the normality of the variables was tested with the shapiro - wilks test for the treated group and with kolmogorov - smirnov test for the untreated group. additionally, the homoscedasticity of the variables was tested with levene s test for the treated and the untreated groups. comparison of the bmd values of reference and alveolar areas between left and right sides, for each group, was undertaken with student s dependent t test, the independent t test being used for between - group comparison. for rmd values, student s dependent t test was used to compare the left and right sides, the independent t test being used for between - group comparison. the mann - whitney test was used to confirm the results of the parametric test for between - group comparison. the statistical analysis was made with =.05 significance level and processed with spss statistics 17.0.0 (spss inc., chicago, usa) software. intra - rater agreement values of bmd (reference and alveolar areas) and rmd from the cbct measurements were over 0.9, showing excellent agreement. the bmd mean values of the reference areas of treated and untreated individuals, and the comparison between the right and left sides and between the groups, are shown in table 1. the reference bone areas in the maxilla showed a significant difference (p=.010) only between the 4.5 mm right and left areas in the 6 mm section of the untreated group. for all the other comparisons, between right and left sides and treated and untreated groups, there was no statistically significant difference. table 2 shows the mean values of bmd and rmd of treated and untreated individuals, and the comparison between groups. the mean values for bmd and rmd were 674.84 and 1282.26 for the untreated group and 630.28 and 1370.29 for the treated group, respectively. a significant difference was observed between the groups only for rmd values (p<.05). descriptive statistics suggested that bmd and rmd variances might differ between the groups, levene s test being necessary for homoscedasticity verification. the groups did not significantly differ in bmd variance (p=.754), whereas there was a significant difference in rmd variance (p=.037). when the mann - whitney non - parametric test was used to verify the between - group rmd difference, the result was similar to that obtained with the t test (p=0.002), thus indicating a significant difference between the groups. the forces resulting from the action of orthodontic appliances move irregular teeth to better positions and produce mechanical stimuli that trigger biological responses which, in turn, lead to bone modeling and remodeling. while modeling is the sculpting mechanism that uses the raw materials of bone growth to shape structures, remodeling is the mechanism involving lifelong skeletal turnover and maintenance. because such bone responses are difficult to observe, few experimental studies in animals [10,2225 ] and clinical short - term studies are available, pointing to the need for greater investigation of the effects of tooth movement on the alveolar bone. hsu. and chang. found a 24% bmd reduction around the teeth of the anterior maxilla in 8 patients investigated 7 months after orthodontic treatment. the results of this study indicated that the bmd of the closely root - associated alveolar bone of the orthodontically - moved upper central incisors did not differ from the bmd of the untreated group. this difference may be related to the post - treatment assessment time (mean 6.52 years), because a long period is necessary for bone recovery and mineralization after tooth movement, which allows the bmd to return to baseline (before tooth movement) values. the fact that the groups did not have a significant difference in the bmd of the maxillary reference areas suggests that the influence of tooth movement on bone quality is limited to a certain period of time after treatment. in contrast with the bmd, the patients who had undergone orthodontic treatment had significantly higher rmd values than untreated patients. although orthodontics - related alterations in the dentin surface, with increased mineralization rate, have already been reported, effects on the dentin matrix have not. dentin matrix has a peculiar morphology, being composed of 12 m diameter tubules surrounded by a hyper - mineralized layer called peritubular dentin, and of a softer intertubular matrix, where the organic material concentrates as collagen fibrils and noncollagenous proteins. two proteins, dmp1 and dspp, are responsible for similar structural alterations in the dentin matrix and surface, being present in predentin, odontoblasts and dentinal tubules. these proteins are thought to play key biological roles in the mineralization of dentin because they are prominent in this mineralized tissue and are secreted into the extracellular matrix of dentin during formation and mineralization. dmp1 and dspp expression and levels are increased by mechanical stress, which may account for not only the increased dentin mineralization rate, but also for the increased mineral density of the peritubular extracellular matrix during tooth movement, because of acceleration of dentin mineralization. such structural alteration enhances biomechanical function, allowing a tougher foundation that helps to prevent propagation of cracks from the brittle enamel. dmp1 and dspp are also expressed by osteocytes, being involved in the development and/or maintenance of bone tissue and responding to mechanical stress as occurs in dentin. however, significant bmd increases were not observed, probably due to the complete bone renewal during tooth movement, with resorption alongside the movement direction and deposition in the opposite direction. mineral density determination is the best indicator for the quality of mineralized tissues, and cbct has been proposed as a low - radiation - dose method for achieving such a purpose, because the density evaluated shows a linear relationship with the attenuation coefficients of the materials and hu values obtained with medical ct and dexa. however, the arbitrary gray levels and artifacts displayed in cbct systems do not allow the assessment of bone quality, which can be performed with hu in medical ct. such instability of grey levels was associated with different imaging devices, image - acquisition settings, positioning of the object in the fov, the mass presented outside the fov (dubbed the exo - mass) [3739 ], the mass in the slice (inside and outside the fov) and the size of fov. controlling for these variables has thus become essential for measurements of mineral density in cbct images. all patients, treated and untreated, were scanned with the same large - volume cbct scan, which may yield more consistent density values than limited - volume cbct scans, and under the same exposure conditions, which eliminated equipment and image - acquisition setting - related variations. according to araki., in a cbct system designed to scan a large fov with large - sized detectors, the influence of artifacts might be small and the hu application is possible. in spite of the disagreement on the correlation between the cbct and hu md values, we used the hu values as a comparative rather than an absolute measurement. in cbct images, the ct number of the same material tends to increase (brighter in gray scale) as the roi approximates the to exo - mass, and/or the exo - mass increase and/or the mass in slice increase, resulting in varied readings of the mineral density of a given structure. in the assessment of adults, standardization of the head orientation and its position in the fov and the use of a standardized fov size allowed the control of variables related to the structure mass, as the mass in slice (estimated as 7 g for each 0.4 mm slice of the adult head), localization of the exo - mass and positioning of the upper incisors in the fov were similar across the patients, resulting in the same distortion of the gray levels in the areas of interest assessed in this study. the object position inside the fov modifies the relation between the roi and the exo - mass and influences mineral density determination, as reported by nackaerts., who demonstrated a significant variation when the object was repositioned in fov between acquisitions. these authors used a fov with a volume 35 times greater than ours, which may have influenced the results. nevertheless, no conclusive information on the influence of fov size on md determination has been reported to date. katsumata. described the possible influence of fov size on md, reporting a 381 hu (266647) bmd variation in a half - mandible, in 51, 102, 153 and 200 mm diameter fovs. yet, these authors did not eliminate the exo - mass (present in the 51 mm fov) and roi positioning inside the fov, adding the influence of other variables to their results, and leaving the issue of the influence of fov size on md determination in large - volume cbct images unresolved. in spite of the number of possibly influential variables of md values in cbct images this may be verified by analysis of the maxillary reference areas, where no significant differences between treated and untreated individuals were observed. a significant difference was only verified between the right and left sides in the 4.5 mm lateral area in the 6 mm section of the untreated group, with 3 patients presenting discrepantly reduced bmd values on the right, with no apparent reason. individuals who had finished an orthodontic treatment at least 1 year previously had higher root mineral density means, compared with untreated individuals. on the other hand,	summarybackgroundorthodontic force application to the teeth is responsible for a series of biological responses in the bone and dentin, which lead to some alterations of the mineral density of the tissues. our objective was determine, through cone - beam computed tomography (cbct), the mineral density of the apical third of the roots of the upper central incisors and of the periapical bone portion surrounding these teeth, in patients submitted to orthodontic treated and untreated individuals.material/methods30 untreated individuals and 15 treated ones (treatment cessation at least 1 year before the study) underwent cbct. mineral density was assessed in the apical third of the root of the upper central incisors and in the alveolar bone in the periapical region of these teeth. in order to reduce cbct - related mineral density variability, we standardized the cone - beam tomography device, the image - acquisition settings and the field of view positioning and size. student s t test was used for the analyses.resultsbone mineral density (bmd) and root mineral density (rmd), in hounsfield units, were 674.84 and 1282.26 for the untreated group and 630.28 and 1370.29 for the treated group, respectively. the differences between the group means were statistically significant for rmd (p<0.05).conclusionsuntreated individuals had a significant lower mean rmd in comparison with those submitted to orthodontic treatment.
the incidence and prevalence varies, 0.1251% and 516%, depending upon the criteria used for the diagnosis. the usual predisposing factors are diabetes mellitus, obesity, hyperlipidemia, rheumatoid arthritis, hypothyroidism, recurrent twisting turning of hands while working, work with vibrating tools and postpartum period. cts is primarily a clinical diagnosis and is clinically detected by stress tests such as phalen test, tinel 's test, hand elevation test, pressure provocation test, tethered median nerve stress test, tourniquet test, and others. nerve conduction study (ncs) is considered as gold standard for diagnosis. however, recent years have shown a surge in research papers on the utility of ultrasonography (usg) in diagnosis of cts. magnetic resonance imaging (mri) too has been studied in this field, and has shown some importance. however not much study of has been done on this topic in india. we undertook this study to study the efficacy of clinical tests, ncs, usg, and mri in diagnosing cts, and the correlation between them. we also planned to study the correlation between boston carpal tunnel questionnaire symptom (bctq - s) and function (bctq - f) score with ncs and usg. patients attending outdoor department of neurology department and referred from medicine and orthopedics outdoor departments were included in the study. patients were screened for symptoms suggestive of cts and clinical provocative tests of cts were done. phalen test, tinel 's test, hand elevation test, pressure provocation test, tethered median nerve stress test, and tourniquet test were performed in all patients. of a total of 60 patients (100 hands) screened with symptoms of upper limb paresthesias, 54 patients (93 hands) were diagnosed as having cts clinically. twenty - three control hands were included, of which 4 patients (8 hands) were completely asymptomatic, whereas 15 had unilateral cts and opposite hand (15 hands in all) was taken as control. then, patients were subjected to ncs on medelec synergy machine, oxford, uk measuring sensory and motor latency, amplitude, and velocity. patients were also subjected to orthodromic mixed median nerve study, median to ulnar nerve, and median to radial nerve comparative study. all ncs positive patients were classified into subgroups for sake of analysis as follows : mild - prolonged sensory latency and/or decreased sensory velocity, normal sensory amplitude and motor study ; mild - moderate - prolonged latency and/or decreased velocity in sensory and motor nerves, with normal amplitude ; moderate - above with mildly decrease sensory and/or motor amplitude ; severe - absent sensory potentials or severely reduced sensory and/or motor amplitudes. usg was performed by aloka prosound 6 machine using a 10 mhz linear probe measuring anterior - posterior diameter, transverse diameter, circumference (cir), and cross - section area (csa) each, at the inlet (i), middle (m), and outlet (o) of the carpal tunnel. mri of wrists for carpal tunnel and median nerve was done in 26 of the patients (39 hands) on a philips achieva, netherland 1.5-tesla mri machine. for statistical analysis the data was entered in microsoft excel format and analyzed using stata for windows, statacorp usa, version 11.1 and statistical package for the social sciences software (spss inc. released 2007. pearson 's correlation coefficient was used for comparing bctq - s and bctq - f with both ncs and usg and between ncs and usg. usg of cases and controls were compared by kruskal - wallis test, and comparison of mri among the ncs severity groups was carried out by fischer 's exact test. informed consent was obtained from all patients and the study was performed with approval of the institutional ethics committee. for statistical analysis the data was entered in microsoft excel format and analyzed using stata for windows, statacorp usa, version 11.1 and statistical package for the social sciences software (spss inc. released 2007. pearson 's correlation coefficient was used for comparing bctq - s and bctq - f with both ncs and usg and between ncs and usg. usg of cases and controls were compared by kruskal - wallis test, and comparison of mri among the ncs severity groups was carried out by fischer 's exact test. informed consent was obtained from all patients and the study was performed with approval of the institutional ethics committee. the patients mean age was 43.9 14 years, and most of them were females, with male to female ratio being 13:79. the most common risk factor was obesity (15%) followed by hypothyroidism (12.9%), diabetes mellitus (10.75%), work related (8.6%), and postpartum state (7.53%). rheumatoid arthritis was associated in only one patient (1.1%). among clinical tests, phalen 's test and hand elevation tests had high sensitivities (84.9% each) and specificities (7483%), whereas tinel 's test had a moderate sensitivity (78.5%) but high specificity (91%). pressure provocation test had high sensitivity (81.7%) but moderate specificity (69.6%), while tethered median nerve test and tourniquet tests had only moderate sensitivities (~70%) and specificities (6570%). among the subgroups, phalen test had greater sensitivity in mild - moderate, moderate, and severe groups, while tinel 's had greater sensitivity in mild group. rest of the tests had greater sensitivities in mild and mild - moderate groups [table 2 ]. usg had a sensitivity and specificity of 30.1% and 91.3% respectively, while mri had a sensitivity of 53.8%. usg in patients was significantly abnormal compared to controls in csa - i and cir - i in all patient groups, and also in csa - o in all - cts (acts) group by kruskal - wallis test. pearson 's correlation between bctq - s and bctq - f with both, ncs and usg and also between ncs and usg were calculated. symptoms score in bctq showed significant correlation with sensory latency, sensory amplitude, and sensory velocities in most groups, while moderate and severe groups also had correlation with motor amplitude. function score showed significant correlation with sensory latency, sensory amplitude, and motor amplitude [figure 1 ]. symptom score compared to usg showed significant correlation only in mild group in cir - o, while function score showed no correlation with usg [table 3 ]. comparing usg with nerve conduction velocity showed significant correlation between cir - m with sensory latency in acts group and between cir - o with sensory latency in mild and sensory amplitude in moderate groups. csa - i correlated with sensory latency, motor latency, and motor amplitude in acts group [table 4 and figure 2 ]. mri between moderate and nonmoderate groups was statistical significant by fischer 's exact test, as was the combined moderate and severe groups compared to the mild and mild - moderate groups [table 5 ]. clinical profile of study population with risk factors and hand involvement in cts sensitivity and specificity of clinical tests in diagnosing cts correlation between boston carpal tunnel questionnaire symptom (s) and function (f) scores and nerve conduction study in all - carpal tunnel syndrome patient group. (a) boston carpal tunnel questionnaire - s with sl in all - carpal tunnel syndrome group. (b) boston carpal tunnel questionnaire - s with sa in all - carpal tunnel syndrome group. (c) boston carpal tunnel questionnaire - s with sv in all - carpal tunnel syndrome group. (d) boston carpal tunnel questionnaire - f with sl in all - carpal tunnel syndrome group. (e) boston carpal tunnel questionnaire - f with sa in all - carpal tunnel syndrome group. (f) boston carpal tunnel questionnaire - f with ma in all - carpal tunnel syndrome group (sl = sensory latency, sa = sensory amplitude, sv = sensory velocity, and ma = motor amplitude) pearson 's correlation (r) between bctq - s score and bctq - f score with ncs and usg pearson 's correlation (r) between ncs and usg correlation between ultrasonography and nerve conduction study. (a) cross - sectional area at inlet of carpal tunnel with sl in all - carpal tunnel syndrome group. (b) cross - sectional area at inlet of carpal tunnel with ml in all - carpal tunnel syndrome group. (c) cross - sectional area at inlet of carpal tunnel with ma in all - carpal tunnel syndrome group. (d) sl with cross - sectional area at inlet of carpal tunnel in all - carpal tunnel syndrome group. (e) sl with cross - sectional area at middle of carpal tunnel in all - carpal tunnel syndrome group. (f) sl with circumference at middle of carpal tunnel in all - carpal tunnel syndrome group. (g) sl with cross - sectional area at middle of carpal tunnel in mild - moderate carpal tunnel syndrome group. (h) sl with circumference at outlet of carpal tunnel in mild carpal tunnel syndrome group (sl = sensory latency, ml = motor latency, and ma = motor amplitude) mri diagnosis distributed as per ncs severity groups most of the studies done till date have taken into account comparison between only ncs and csa or bowing of the flexor retinaculum on usg. we thus conducted this study to evaluate all available diagnostic parameters, that is, clinical tests, ncs, usg, and mri and compare between them. we also compared them with bctq as previous studies have conflicting results, some showing a correlation while others not. other include bowing of the flexor retinaculum, change in csa of median nerve and flattening ratio. various ranges for normal usg parameters have been reported with csa ranging from 9 mm to 15 mm. however, a lack of a consensus leads to difficulties in using usg as a diagnostic modality. sensitivity of csa in diagnosing cts ranges from 48% to 89% and specificity from 47% to 100%. usg becomes more sensitive for moderate and severely affected patients compared to mildly affected ones. however, it has been reported to be positive in up to 30% of patients with false negative ncs. herein lays the importance of usg in detecting cts. ncs tend to become abnormal after significant compression leads to ischemic demyelination of the median nerve. this occurs first in the fast conducting fibers which travel deep to the flexor retinaculum. thus, routine ncs measuring superficial sensory branch of median nerve may fail to pick up the pathology. thus as per the aaem guidelines, orthodromic mixed nerve studies and comparative studies (median to ulnar digit 4, median to radial thumb) should be done. however, many patients experience discomfort during ncs and the same are more willing to undergo usg or mri instead. in addition, adding usg in the diagnostic armamentarium helps increase sensitivity of ncs from 76% to 84% but decreases the specificity from 97% to 84%, mondelli. reported combined sensitivity of 76%. our study showed significant difference between patients and controls in csa - i in all the groups, including mild, mild - moderate, moderate, severe, and acts groups, and between csa - o and acts group. a new finding noted in our study which has not been studied previously is the median nerve cir. we found a significant difference in cir - i of patients with cts compared to controls in all the groups, including mild, mild - moderate, moderate, severe, and acts groups. comparison between usg and ncs in our study showed the overall significant correlation of both, area and cir, with ncs. among the subgroups, correlation was found between cir - m and sensory latency in acts group, between cir - o and sensory latency in mild group, and sensory amplitude in moderate group. also, csa - m correlated with sensory latency in mild - moderate group and in acts group, and csa - i correlated with sensory latency, motor latency, and motor amplitude in acts group. other studies also show a significant correlation between csa and ncs, but have not studied cir of the median nerve. some studies have shown a correlation between bctq and ncs or usg, whereas few have shown no correlation. bctq symptom score correlated with sensory latency in mild group, sensory latency and velocity in severe group, and with sensory latency, amplitude and velocity in mild - moderate, moderate and acts group. the function score correlated with sensory latency in mild, moderate and acts groups, with sensory amplitude in mild - moderate and acts groups and sensory velocity in moderate group. function score also correlated with motor latency in mild - moderate group and with motor amplitude in moderate, severe and acts group. in contrast, usg showed significant correlation only between cir - o and symptom score, while no correlation was found between function score and any of the usg parameters. mri was performed in 39 of our cts patients detected cts in 21 patients (53.85%). median nerve swelling and t2-weighted hyperintensity of median nerve and thenar muscles is considered as cts on mri [figure 3 ]. other parameters considered likely suggestive of cts were flattening of median nerve and to measure differing canal size. an important indication for the use of these mri is preoperatively, and also for recurrent cts after surgical release to look for real canal widening, inflammation, incomplete resection of ligament, and scarring or algodystrophy. our study documented associated pathologies such as osteoarthritis (41.03%), cyst (12.82%), ganglion (5.13%), and incidental fracture (5.13%). however, the associated pathologies (total 58.97% of mris done) detected were significant as they could not be detected on ncs or usg. this is important whenever surgical intervention, especially endoscopic intervention is planned for. as mentioned previously, mri also plays a role in patients who have previously undergone carpal tunnel release operation and develop recurrent symptoms, to know the underlying anatomy and deformities, if any. magnetic resonance imaging of carpal tunnel showing t2-weighted hyperintensity of median nerve (arrow) and thenar and hypothenar muscles (asterisks) there are a few limitations of our study. one limitation of this study was that mri was not done in controls, due to financial constraints. thus, we were unable to find the combined sensitivity of ncs, usg, and mri. for the same reason, also, among our controls we included both completely asymptomatic patients (8 hands) and the asymptomatic hand of patients with unilateral cts (15 hands). some consider inclusion of asymptomatic hand as a control to be beneficial as it helps eliminate the bias of the normal anatomical variation in median nerve and the carpal tunnel structures. however, others are of the opinion that inclusion of asymptomatic hand leads to selection bias. although some may consider this as a limitation of our study, we have deliberately included such controls in order to eliminate this controversy and to derive an overall unbiased result. clinical tests even today have a role as phalen test, hand elevation test, and pressure provocation test have a high sensitivity, whereas tinel 's test has a high specificity, which approach that seen with ncs, and may even exceed that of usg and mri. also, although even today ncs may be the gold standard for diagnosing, usg and mri play a complimentary role in ncs negative patients and those planning for surgery or having recurrent symptoms even after surgery. mri is particularly abnormal only in moderate and moderate to severely affected patients. in our study, we also found that the median nerve cir is an important measurement and further larger multi - centric studies may show whether it is significant or not.	background : carpal tunnel syndrome (cts) is the most common entrapment neuropathy, but not adequately studied in india.objectives:to study clinical tests, nerve conduction studies (ncs), ultrasonography (usg), and magnetic resonance imaging (mri) in diagnosing cts.materials and methods : we diagnosed cts in 54 patients (93 hands) out of 60 screened patients with symptoms compatible with cts, including 19 control patients (23 hands). we conducted provocative tests and calculated boston carpal tunnel questionnaire (bctq) symptom (s) and function (f) scores. ncs positive patients were classified into mild, mild - to - moderate, moderate, severe, and all - cts groups. median nerve anteroposterior, transverse, circumference (cir), and cross - sectional area (csa) at inlet (i), middle (m), and outlet (o) each was measured by usg in all patients. mri was done in 26 patients (39 hands).results : phalen, hand elevation and pressure provocation tests had higher sensitivity, tinel 's test had higher specificity and tethered median nerve and tourniquet tests had low sensitivity and moderate specificity. usg had low sensitivity but high specificity, and mri had moderate sensitivity. usg in patients compared to controls was significantly abnormal in csa - i, cir - i, and csa - o. significant correlation was found between bctq - s and ncs and bctq - s and cir - o. cir - m, cir - o, csa - m, and csa - i had correlation with ncs. mri was significant in moderate and in moderate + severe groups combined and associated pathologies were detected in 59% patients.conclusion:ncs remain gold standard but usg and mri help increase sensitivity and detect mass lesions amenable to surgery.
the present study is based on the 20-year follow - up of the population of the kuopio osteoporosis risk factor and prevention study cohort. a self - administered baseline postal questionnaire was sent to all women aged 4756 years who were residents of kuopio province, eastern finland (n = 14,220), in february 1989. the reasons for nonresponse were lack of address or residence not detected (n = 119) and death (n = 4). in addition, 947 women did not respond for other reasons and 50 returned a blank form. the 5-year follow - up in 1994, 10-year follow - up in 1999, 15-year follow - up in 2004, and 20-year follow - up in 2009 was mailed to the 13,100, 12,562, 12,075, and 11,420 women, respectively. a total of 11,954 (91.2%), 11,538 (91.8%), 10,926 (90.4%), and 8,195 (71.8%) women responded to the 5-, 10-, 15-, and 20-year follow - ups, respectively. the questionnaires were sent to women who had responded to the baseline inquiry, were alive, and had a valid postal address at that time. the baseline questionnaire covered demographics, lifestyle, medical issues, and other characteristics such as age, height, weight, smoking, alcohol consumption, health disorders diagnosed by a physician, reproductive history, type and duration of ht use, operations, occupation, and physical activity. the present study included those 8,195 women who had complete data on confounders and self - reported exposure. these diagnoses from 19992009 were identified from the finnish special reimbursement register maintained by the social insurance institution (sii). the register contains information on the reimbursed drugs used for chronic illnesses such as ad. the finnish special reimbursement register possesses high validity and positive predictive value for ad diagnosis. the finnish current care guideline recommends that all persons with ad are treated with antidementia drugs unless there is a specific contraindication (such as gastric ulcer / intestinal tract operation 0.6) and thus stratified analyses were not performed. the present study is based on the 20-year follow - up of the population of the kuopio osteoporosis risk factor and prevention study cohort. a self - administered baseline postal questionnaire was sent to all women aged 4756 years who were residents of kuopio province, eastern finland (n = 14,220), in february 1989. the reasons for nonresponse were lack of address or residence not detected (n = 119) and death (n = 4). in addition, 947 women did not respond for other reasons and 50 returned a blank form. the 5-year follow - up in 1994, 10-year follow - up in 1999, 15-year follow - up in 2004, and 20-year follow - up in 2009 was mailed to the 13,100, 12,562, 12,075, and 11,420 women, respectively. a total of 11,954 (91.2%), 11,538 (91.8%), 10,926 (90.4%), and 8,195 (71.8%) women responded to the 5-, 10-, 15-, and 20-year follow - ups, respectively. the questionnaires were sent to women who had responded to the baseline inquiry, were alive, and had a valid postal address at that time. the baseline questionnaire covered demographics, lifestyle, medical issues, and other characteristics such as age, height, weight, smoking, alcohol consumption, health disorders diagnosed by a physician, reproductive history, type and duration of ht use, operations, occupation, and physical activity. the present study included those 8,195 women who had complete data on confounders and self - reported exposure. the main outcome of our study was clinically verified ad diagnosis. these diagnoses from 19992009 were identified from the finnish special reimbursement register maintained by the social insurance institution (sii). the register contains information on the reimbursed drugs used for chronic illnesses such as ad. the finnish special reimbursement register possesses high validity and positive predictive value for ad diagnosis. the finnish current care guideline recommends that all persons with ad are treated with antidementia drugs unless there is a specific contraindication (such as gastric ulcer / intestinal tract operation 0.6) and thus stratified analyses were not performed. they also reported less physical activity and were more likely to be unemployed than women who were not diagnosed with ad during the follow - up. number of childbirths, abortions, and pregnancies was similar between groups, but women who developed ad were more likely to be menopausal at baseline than those who were not diagnosed with ad. register - reported ht or oophorectomy / hysterectomy was not associated with ad in these univariable analyses (table e-1 at neurology.org). table 1 shows the relative risk of ad according to both register - based and self - reported ht use (yes / no). neither register - based nor self - reported ht use was associated with ad risk. the results were similar in the sensitivity analyses conducted among those with data on education (n = 2,383 ; tables e-2 and e-3), i.e., no association was detected between ht use (any ht, estrogen, or combination therapy ; either register - based or self - reported) and ad. risk of developing alzheimer disease (ad) among hormone therapy (ht) users (according to type of therapy used) in the whole cohort (n = 8,195) ht use when categorized according to duration register - based ht use was not associated with ad (table 2). however, when self - reported data were used, those with longest self - reported ht use > 10 years had lower risk of ad in comparison to nonusers (table 3) also after adjusting for lifestyle and socioeconomic confounders and variables related to estrogen status. sensitivity analyses with any dementia as an outcome produced similar results to those shown in tables 13, although the association between > 10 years ht use and ad was attenuated and its confidence also included 1 in the sensitivity analyses (tables e-4 to e-6). risk of developing alzheimer disease (ad) among hormone therapy (ht) users (register - based) with different durations of ht use in the whole cohort (n = 8,195) risk of developing alzheimer disease (ad) among women using postmenopausal hormone therapy (ht) (self - reported) in the whole cohort (n = 8,195) the findings from our large prospective cohort study do not provide strong evidence for an association between postmenopausal ht use and ad or dementia, although a protective association between long - term (> 10 years) self - reported use of ht and ad was observed. this finding indirectly favors the effectiveness of ht if started in the early postmenopausal period (critical window theory). another explanation for this association can be reverse causation, i.e., ad (or more precisely, its preclinical symptoms) affecting the exposure to ht (or reporting of ht duration in the self - reported data), or a chance finding. the association with longer duration of ht use was only found in self - reported postmenopausal estrogen use, not for register - based ht use after 1995, and the association was less evident when all dementia diagnoses instead of clinically verified ad diagnosis were used as an outcome. one explanation for the different results with self - reported and register - based exposure could be different time period as register data were not available before 1995, which is 7 years after the baseline inquiry. thus, the register - based data after 1995 would misclassify those who discontinued ht use before 1995 as nonusers. it is unlikely that this misclassification was differential in those who later developed ad and those who did not. therefore it would lead to an underestimation of the association between ht use and ad with the register - based data after 1995. an alternative explanation is recall bias, but this is unlikely as previous validation study from the same cohort showed that a postal inquiry is a reliable method of recording long - term ht use in finnish postmenopausal women. our result is in line with the extended follow - up of the cache county study, which detected a reduced ad risk if ht was started within 5 years of menopause and continued for more than 10 years. the largest clinical trial on ht all cause dementia association, i.e., whims, assessed cognitive performance of women > 65 years old, assigned to conjugated equine estrogen (cee ; unopposed therapy) vs placebo or continuous cee + medroxyprogesterone acetate (cee + mpa ; opposed therapy) vs placebo. the use of opposed ht increased the dementia risk, but this did not occur with unopposed ht. in the whims trial, women were randomized to receive opposed therapy as cee combined with mpa. in finland, estradiol in combination with norethisterone or levonorgestrel (not mpa) is used among women with intact uterus and only estradiol is used mainly among women undergoing hysterectomy. the difference between these 2 studies may be attributable to the differences in the effects exerted by the different estrogen preparations. in addition, the women in our cohort were around 10 years younger than women in the whi trial, and the main outcome in our study was ad, while it was all - cause dementia in whims. one cohort study reported that an early initiation of ht around menopause was protective against ad. similar findings were reported from the multi - institutional research in alzheimer genetic epidemiology study, where ht use in the youngest age tertiles (5063 years) protected against ad in comparison to those in the older age tertiles. the lack of association in our cohort between any ht use (all users of ht, not taking into account either the time of initiation or the duration of therapy) and ad / dementia is consistent with previous observational studies where ht was categorized as former or current use and lifetime estrogen exposure was taken into account. postmenopausal estrogen therapy was not protective against ad in 2 of the case - control studies. this discrepancy in observational studies is explained by differences in outcome measurement, number of observations, duration, type, and the time of initiation of ht use. the strengths of our study include its large sample size, long follow - up time, relatively homogenous population, clinically verified ad cases, prescription - based validation of ht use, and control for various important comorbidities. in addition, the positive predictive value of ad diagnosis in the special reimbursement register is high. however, it is likely that this register does not capture all ad cases, or persons with other forms of dementia. therefore we conducted sensitivity analysis with any dementia as an outcome. despite these strengths, our study has some limitations : first, information was collected by self - reported postal inquiries, which may be subject to recall bias ; second, the effect of healthy user bias among the long - term users can not be overlooked ; third, register data on ht use and ad diagnosis were available from 1995 to 1999 onwards, respectively ; fourth, we can not eliminate the chance of a survival bias contributing to the protective association observed among the longest ht users ; fifth, we were not able to control the results for genetic predisposition to ad (apoe status and familial ad). however, it is unlikely that these genetic factors would influence start of ht use and thus it is unlikely that the results are confounded by genetic background. misclassification of outcome (i.e., undiagnosed ad or dementia cases) is possible and this would dilute our estimates towards the null. however, the proportion of misclassified persons is likely to be small. due to our outcome data source in sensitivity analyses for dementia, we captured only those persons with dementia who required inpatient admission (due to dementia or other disease / accident). the diagnostic process for dementia often begins in an outpatient setting, but these settings were not included in the hospital discharge register. therefore, those persons with dementia who did not have any hospital admissions or antidementia medications were misclassified. our study examined a homogenous population (residents of kuopio province, all accessed via the national social security system), thus decreasing the chances of selection bias or confounding by socioeconomic - related factors. some previous observational studies carried out in sociodemographic homogenous populations have observed decreased risk of ad among ht users. estrogen replacement therapy was protective against ad in these studies and sociodemographic heterogeneity may account for the contrasting results obtained in the 2 observational studies. our results based on 2 decades of follow - up of a large homogenous population did not provide strong evidence for a protective association between postmenopausal ht use and ad or dementia. dr. imtiaz : planned the research project, drafted the first version of the manuscript, performed statistical analyses, acts as guarantor, accepted the submitted version of the manuscript, and made important intellectual contribution to draft versions. tuppurainen : planned the research project, participated in data collection, accepted the submitted version of the manuscript, and made important intellectual contribution to draft versions. rikkonen : participated in data analysis, accepted the submitted version of the manuscript, and made important intellectual contribution to draft versions. kivipelto : accepted the submitted version of the manuscript and made important intellectual contribution to draft versions. soininen : planned the research project, accepted the submitted version of the manuscript, and made important intellectual contribution to draft versions. krger : planned the research project, participated in data collection, accepted the submitted version of the manuscript, and made important intellectual contribution to draft versions. tolppanen : planned the research project, supervised data analyses and the research project, accepted the submitted version of the manuscript, and made important intellectual contribution to draft versions. a.m.t. acknowledges funding from european regional development fund (regional council of pohjois savo), m.k. is a recipient of academy of finland and center for innovative medicine (cimed), and h.s. acknowledges the finnish cultural foundation (central fund) and funding by doctoral program of molecular medicine, university of eastern finland.	objective : to explore the association between postmenopausal hormone therapy (ht) and alzheimer disease (ad).methods : twenty - year follow - up data from the kuopio osteoporosis risk factor and prevention study cohort were used. self - administered questionnaires were sent to all women aged 4756 years, residing in kuopio province starting in 1989 until 2009, every 5th year. register - based information on ht prescriptions was available since 1995. probable ad cases, based on dsm - iv and national institute of neurological and communicative disorders and stroke alzheimer 's disease and related disorders association criteria, were identified from the special reimbursement register (19992009). the study population included 8,195 women (227 cases of incident ad).results : postmenopausal estrogen use was not associated with ad risk in register - based or self - reported data (hazard ratio/95% confidence interval 0.92/0.681.2, 0.99/0.751.3, respectively). long - term self - reported postmenopausal ht was associated with reduced ad risk (0.53/0.310.91). similar results were obtained with any dementia diagnosis in the hospital discharge register as an outcome.conclusions:our results do not provide strong evidence for a protective association between postmenopausal ht use and ad or dementia, although we observed a reduced ad risk among those with long - term self - reported ht use.
we describe the case of a 1-year - old male persian cat diagnosed with congenital hepatic fibrosis (chf) associated with renal polycystic disease and, for the first time, we have shown that there was no c > a mutation in exon 29 of pkd1 (polycystic kidney disease 1). the cat presented with a history of chronic weight loss, anorexia, vomiting, depression and lethargy, with profuse salivation and ascites on clinical examination. owing to the cat s deteriorating condition, it was euthanized. during necropsy, the liver was found to be enlarged, firm and reddish, and the kidney had multiple small cortical cysts. immunohistochemistry revealed that bile duct cells and epithelial cells of renal cysts showed positive immunoreactivity to keratin 19. collagen fibers surrounding bile ducts within portal areas demonstrated reactivity to type iv collagen antibody, confirming the congenital nature of the process. a diagnosis of ductal plate malformation consistent with chf associated with polycystic kidney in a young persian cat was made. interestingly, genetic testing revealed a wild - type sequence at position 3284 in exon 29 of pkd1. the absence of the classic genetic mutation associated with the particular clinical presentation supports the hypothesis of a distinct etiopathogenesis among fibropolycystic diseases in domestic cats. moreover, congenital hepatic fibrosis is a rare but important differential diagnosis for young persian cats and their crosses with clinical signs of chronic end - stage liver disease. congenital hepatic fibrosis (chf) represents one of many fibrocystic hepatic diseases derived from biliary dysgenesis secondary to ductal plate malformation. the condition is described in humans and some animal species, characterized by the persistence of embryonic bile ducts, abnormal branching of the intrahepatic portal veins and progressive fibrosis of the portal tracts. in humans, chf is often associated with other cyst - forming syndromes, such as autosomal recessive polycystic kidney disease (arpkd), autosomal dominant polycystic kidney disease (adpkd) (rarely), meckel gruber syndrome, jeune syndrome and with many other genetic abnormalities. in veterinary medicine, chf has been described in dogs, swiss freiberger foals, bovine fetuses and calves, and in an african green monkeys. although only a single mutation in pkd1 has been identified in feline adpkd, the phenotypic spectrum is diverse, with most cats demonstrating renal rather than biliary malformations, with isolated cysts in the liver with or without involvement of the pancreas. hepatic fibrosis has been reported in 2248% of cats with feline polycystic kidney disease (pkd) ; however, clinical signs associated with liver failure have rarely been reported, and the congenital nature of this process has not been established. moreover, these cases of hepatic fibrosis in cats with pkd were described before the discovery of the c > a transversion in exon 29 of feline pkd1, so genetic testing had not been performed. here we describe the clinical, morphological and genetic features of chf associated with pkd in a persian cat, in order to advise on a possible alternative genetic mutation for this specific clinical presentation. a 1-year - old male persian cat weighing 3.1 kg was admitted to a veterinary teaching hospital (faculty of veterinary medicine, methodist university of so paulo, sp, brazil), with a 4 week history of chronic weight loss, anorexia, vomiting and lethargy. ascites fluid was classified as a modified transudate characterized by an albumin : globulin ratio of 0.89 (ri > 1.0) and mild cellularity (1.500 cell/l) composed of neutrophils and small lymphocytes. serum biochemistry findings included mild increases in alanine aminotransferase (108 u / l ; ri 2070 u / l), -glutamyl transferase (7 u / l ; ri 15 u / l) and aspartate aminotransferase (67 u / l ; ri 140 u / l). albumin was low (1.4 g / dl ; ri 2.13.3 mg / dl). a commercial immunoassay for feline leukemia virus antigen detection and feline immunodeficiency virus antibody (idexx laboratories) detection was negative. owing to financial reasons and the cat s clinical status, the owner opted for euthanasia. at necropsy, there was an increased amount of slightly turbid abdominal fluid and fibrin clots throughout the hepatic serosa. the liver was enlarged, firm and red, with multifocal pale, white - to - tan circular areas measuring 0.51.0 cm in diameter restricted to the liver capsule. tissue samples were obtained, formalin - fixed, paraffin - embedded, sectioned and stained with hematoxylin and eosin for microscopic examination. microscopically, the liver was divided by portal - to - portal bridging bands of dense fibrous tissue, with numerous, small, irregular bile duct profiles that were often mildly to moderately ectatic. these ducts were lined by oval - to - cuboidal epithelial cells with finely stippled chromatin and a variably prominent nucleolus (figure 1). a few small, non - portal - associated bile ducts with spindle cells were dispersed throughout the liver section. small amount of lymphocytes, plasma cells and macrophages infiltrated fibrous bands and portal areas. masson s trichrome stain revealed dense collagenous tissue in the periportal area (figure 2). islands of hepatocytes are separated by irregular bands of fibrous tissue (portal portal bridging fibrosis). scale bar = 200 m the kidneys showed multiple, sometimes multi - loculated cysts that were 0.52.0 mm in diameter in the renal cortex, lined by cuboidal or squamous epithelium. some cysts contained abundant mild eosinophilic material (protein) and multiple detached epithelial cells (figure 3). scale bar = 500 m for immunohistochemical analysis, liver and kidney histological sections were deparaffinized, rehydrated and submitted to antigen retrieval in citrate buffer solution (10 mm, ph 6.0) in a pressure cooker for 3.5 mins. after blockade of endogenous peroxidase with 6% h2o2 solution (merck) for 30 mins, the slides were incubated in a humidified chamber overnight at 4c with the following primary antibodies : keratin 19 (k19) (novocastra ; leica microsystems) for liver and kidney, and type iv collagen (dako north america) for liver. the slides were then incubated with a goat anti - mouse horseradish peroxidase polymer from a commercial kit (zymed laboratories) for 30 mins. kidney tissues were used as a positive control for k19 and type iv collagen expression. bile duct cells and epithelial cells lining kidney cystic structures showed positive granular cytoplasmic immunoreactivity to k19 (figure 4). collagen fibers surrounding bile ducts within portal areas demonstrated prominent reactivity to type iv collagen antibody (figure 5). scale bar = 200 m for pcr, restriction fragment length polymorphism (rflp) analysis and sequencing, genomic dna was isolated from formalin - fixed, paraffin - embedded 5 m - thick tissue sections and immediately placed into 1.5 ml sterile dna / rna - free plastic microtubes with 1 ml of xylol to remove paraffin and 100% ethanol. subsequently, a genomic dna mini kit was used accordingly to manufacturer s instructions (qiaamp dna ffpe tissue kit ; qiagen). pcr was performed to amplify exon 29 of pkd1, as previously described. for the pcr - rflp analysis, approximately 5 l amplification product was digested with 10 u mly1 (new england biolabs) in a 10 l reaction that contained 1 ne buffer 4 at 37c for 3 h followed by inactivation of the enzyme at 65c for 10 mins. residual amplification primers and deoxynucleotide triphosphates were removed from the pcr product using a qiaquick pcr purification kit (qiagen). amplicons were then subjected to nucleotide sequence determination and analyzed on an abi prism 377 sequencer (applied biosystems). in both techniques, the result was negative for the c > a transversion in exon 29 of pkd1 in this cat (figure 6). (a) pcr fragment length polymorphism typing for feline polycystic kidney disease (pkd) mutation. persian cat with congenital hepatic fibrosis and pkd without c > a mutation of exon 29 of pkd1 in lane 4. lane 1 = ladder ; lane 2 = blank ; lane 3 = positive control. (b) nucleotide sequences of the wild - type in exon 29 of feline pkd1 in a persian cat with congenital hepatic fibrosis. (c) nucleotide sequences of the c > a transversion at position 3284 in exon 29 of pkd1 in a persian cat with pkd (positive control) chf features a ductal plate malformation of interlobular bile ducts associated with fibrosis, and in humans often coexists with caroli s disease, von meyenburg complexes (intrahepatic bile duct hamartomas), arpkd and adpkd. portal bridging fibrosis, with marked increase in small or irregular bile duct profiles, minimal to absent inflammation, and lack of nodular regeneration or other histologic evidence of chronic hepatitis. primitive bi - potential progenitor cells in the liver express keratins 8, 18 and 19. during gestation, progenitor cells that are committed to form hepatocytes lose k19 expression, whereas those destined to form bile ducts retain it and gain k7 expression. previous studies on ductal plate malformations in humans have documented the expression of keratins 7, 8 and 19 in ductal plate cells. in the present case, a diffuse positive k19 immunoexpression was observed in all ductular structures, identifying them as bile ducts or progenitor cells rather than mature hepatocytes. regarding the immunoreactivity for type iv collagen, several studies have attempted to establish the pathophysiological mechanism behind the abnormal and excessive fibrotic response associated with chf. degradation of the basement membrane and extracellular matrix (ecm) constituents, and the remodeling of the ecm are important processes of embryonic development. type iv collagen, which is present in the mesenchymal tissue surrounding the ductal plate cells, may help in the migration of these cells, as well as in their differentiation and maturation into intrahepatic bile ducts. additionally, type iv collagen is present in mesenchyme surrounding ductal plates early in gestation. in this context, persistent type iv collagen immunoreactivity in the present report case supports the diagnosis of a ductal plate malformation. some humans with chf have concurrent renal cystic disease, similar to this case, and this clinical presentation has been mainly associated with arpkd. arpkd is a severe form of human pkd that primarily presents itself in infancy and childhood, being characterized by enlarged kidneys and dilated cystic bile ducts, extensive hepatic brosis and hepatic failure. mutations at a single locus, pkhd1 (polycystic kidney and hepatic disease 1), are responsible for all typical forms of arpkd. adpkd is the most common inherited renal cystic disease, occurring worldwide and across all ethnicities. two main genes have been identified (pkd1 [chromosome region 16p13.3 ; 85% cases ] and pkd2 [chromosome region 4q21 ; 15% cases ]). clinically relevant aspects include both renal (impaired urinary concentrating capacity, renal failure, hypertension and pain) and extrarenal manifestations where involvement of the liver is the most common, owing to slow and variable expansion of the cysts. in cats, adpkd is a well - described disease, especially in persian cats. congenital cysts originate from both the proximal and distal tubules, and can be found in both renal cortex and medulla. the disease is progressive, and both the size and number of cysts can increase over time and may result in chronic renal failure later in life. also, it is fairly well described that adpkd in most cats is associated with congenital biliary cystic lesions, as multiple large cysts. however, the renal form is the more common variant in cats and is most commonly associated with clinical disease. hepatic fibrosis is reported in 2248% of cats with pkd, with an age range of 114 years. clinical signs of liver failure, such as emaciation, diarrhea and coma, secondary to severe chf have been reported only four times before in cats with pkd. in none of these cases was the genetic test for c > a transversion in exon 29 of feline pkd1 performed. in the present case, the cat exhibited chronic weight loss, anorexia, vomiting, lethargy and altered mental status, consistent with hepatic failure and hepatic secondary encephalopathy. hepatic enzymes were slightly elevated, but in chf, the liver function tests may be normal with no regenerative hyperplasia present in contrast to end - stage disease or cirrhosis. this clinical presentation is uncommon in young cats, with the cat described herein only 12 months of age. owing to the low ratio of globulin to albumin in the ascitic fluid, feline infectious peritonitis was clinically suspected. however, no gross and histological evidence was observed to support this assumption. because of the paucity of portal vein profiles, congenital portosystemic shunt or portal vein hypoplasia might be considered in the differential diagnosis but were unlikely given the presumed portal hypertension in this case. prominent biliary proliferation in these cases of chf might prompt the consideration of chronic extrahepatic biliary obstruction. chf can be distinguished from chronic extrahepatic biliary obstruction by the typical lack of inflammation or evidence of cholestasis, but in some cases, the history and clinical and imaging data will need to be evaluated carefully. feline adpkd can be diagnosed by ultrasound screening, which is recommended when cats are older than 10 months, in order to avoid a false - negative result, associated with the pkd1 genetic test or with kidney biopsy, which may show lesions suggestive of adpkd at an earlier stage. the pathogenesis of adpkd in cats is unknown ; however, in humans, abnormalities in gene expression, cell polarity, fluid secretion, apoptosis and ecm are hypothesized. in cats, only a c > a transversion in exon 29 of pkd1 was described as the genetic cause of adpkd. although several studies showed that about 5% of animals observed with ultrasound or histopathological changes consistent with pkd are negative for this point mutation, none of them directly describes the relationship between renal cysts, chf and the absence of c > a transversion. because information on littermates was not available in the current case, a hereditary basis could not be investigated. therefore, this is the first case to show, through sequencing, chf in a cat with pkd not linked to c > a transversion in exon 29 of feline pkd1. it is likely that, as in humans, chf and pkd should be assigned to a specific gene and its mutation in juvenile persian and persian families of cats. although we did not find the c > a transversion in pkd1 in this case, it is possible that other regions of this gene or even other genes, such as pkhd1 (characteristic of the human arpkd form), which have not yet been described in cats, are involved in the pathogenesis of this particular phenotype. linkage, candidate gene or genome - wide analyses should be considered in further genetic investigations. the absence of the classic genetic mutation associated with the particular clinical presentation supports the hypothesis of a distinct etiopathogenesis among fibropolycystic diseases in domestic cats. moreover, chf is a rare but important differential diagnosis for young persian cats and their crosses with clinical signs of chronic end - stage liver disease.	case summarywe describe the case of a 1-year - old male persian cat diagnosed with congenital hepatic fibrosis (chf) associated with renal polycystic disease and, for the first time, we have shown that there was no c > a mutation in exon 29 of pkd1 (polycystic kidney disease 1). the cat presented with a history of chronic weight loss, anorexia, vomiting, depression and lethargy, with profuse salivation and ascites on clinical examination. a mild elevation in liver - associated plasma enzymes suggested a hepatic disease. owing to the cat s deteriorating condition, it was euthanized. during necropsy, the liver was found to be enlarged, firm and reddish, and the kidney had multiple small cortical cysts. immunohistochemistry revealed that bile duct cells and epithelial cells of renal cysts showed positive immunoreactivity to keratin 19. collagen fibers surrounding bile ducts within portal areas demonstrated reactivity to type iv collagen antibody, confirming the congenital nature of the process. a diagnosis of ductal plate malformation consistent with chf associated with polycystic kidney in a young persian cat was made. interestingly, genetic testing revealed a wild - type sequence at position 3284 in exon 29 of pkd1.relevance and novel informationthe absence of the classic genetic mutation associated with the particular clinical presentation supports the hypothesis of a distinct etiopathogenesis among fibropolycystic diseases in domestic cats. moreover, congenital hepatic fibrosis is a rare but important differential diagnosis for young persian cats and their crosses with clinical signs of chronic end - stage liver disease.
since the dramatic changes in lifestyle worldwide, diabetes has become one of the most common metabolic disorders globally. in 2013, the international diabetes federation (idf) reported 382 million people with diabetes and the number was projected to reach 592 million by 2035. of note, another piece of data from idf also revealed 45.8% or 174.8 million of undiagnosed diabetes in all diabetes cases globally. prediabetes (pre - dm) is defined as either fasting or postchallenge glycemia, including impaired fasting glucose (ifg), impaired glucose tolerance (igt), and combined ifg and igt (impaired glucose regulation, igr). as an intermediate state between normal glucose tolerance (ngt) and type 2 diabetes (t2 dm), pre - dm is characterized by insulin resistance and impaired insulin secretion [4, 5 ]. besides, the chronic low - grade inflammation also contributes to the progression of pre - dm to t2 dm. though most subjects with pre - dm remain clinically asymptomatic, the micro- and macrovascular complications of diabetes already exist in this stage. recent data have showed that pre - dm is closely associated with poor cardiovascular outcomes. ifg was also found to be correlated with unrecognized myocardial infarctions in patients without fundamental cardiovascular disease. it is estimated that up to 70% of individuals with pre - dm will progress to diabetes at a rate of 510% per year. in china, the age - adjusted prevalence of pre - dm is 15.5%, accounting for 148.2 million people with pre - dm. the c1q / tumor necrosis factor- (tnf-) related protein-3 (ctrp-3) belongs to the ctrp family which shares a highly conserved paralog of adiponectin. ctrp-3 is abundantly expressed in the adipose tissue, kidney, uterus, and testis in adult animals. it is well established that ctrp-3 plays an important role in modulating the hepatic glucose and lipid metabolism [13, 14 ]. in normal c57bl/6 and leptin - deficient ob / ob mice, recent clinical studies demonstrate that circulating ctrp-3 is associated with t2 dm and obesity [15, 16 ]. choi. reported increased circulating levels of ctrp-3 in subjects with pre - dm and t2 dm, while other groups showed lower levels of circulating ctrp-3 in newly diagnosed t2 dm patients [16, 17 ]. furthermore, ctrp-3 is considered an anti - inflammatory cytokine. in a high - fat fed transgenic mouse model, it has been reported that ctrp-3 could reduce the secretion of interleukin-6 (il-6) and tumor necrosis factor- (tnf-) by suppressing the nuclear factor-b (nf-b) signaling. it was originally regarded as an important factor for maintaining the structure and stability of the chromosome. so far, several studies have revealed that hmgb-1 also exerts extracellular functions via hmgb-1 related receptors. for instance, exogenous hmgb-1 can promote the release of proinflammatory cytokines by binding to their receptors such as rage, tlr2, and tlr4. in addition, several studies indicate that hmgb-1 is related to insulin resistance, obesity, and t2 dm. wang. found plasma hmgb-1 levels were increased in subjects with t2 dm and/or obesity. found hmgb-1 was elevated in both t2 dm patients and high - glucose cultured sv40 mes 13 cells. though previous studies have reported the role of circulating ctrp-3 and hmgb-1 in t2 dm and obesity, there is little information concerning the associations of circulating ctrp-3 and hmgb-1 with pre - dm. pre - dm is a high risk factor of cardiovascular events and plays an important role in the development of diabetes, so studies on biomarkers to predict pre - dm deserve further investigation. in this study, we aim to explore the association of plasma ctrp-3 and hmgb-1 with newly diagnosed pre - dm and t2 dm. a total of 420 subjects (age ranged from 40 to 75) with newly diagnosed t2 dm (nt2 dm) or pre - dm or healthy controls were recruited from the outpatients of the first affiliated hospital of chongqing medical university between june 2014 and october 2015. after the 75 g oral glucose tolerance test (ogtt) and routine biochemical check - up, a total of 224 eligible participants were included (the exclusion criteria were presented in supplemental figure 1 in supplementary material available online at http://dx.doi.org/10.1155/2016/9438760). all participants were divided into normal glucose tolerance group (ngt, n = 62), pre - dm group (n = 111), and nt2 dm group (n = 56). the diagnosis of pre - dm and nt2 dm was based on the ada criteria. all enrolled participants have not received any hypoglycemic agents, diet - control, or exercise prior to screening. present study was in accordance with the declaration of helsinki of the world medical association and was approved by the ethics committee of the first affiliated hospital of chongqing medical university, chongqing, china. height, body weight, waist circumference, and hip circumference were measured by standardized methods in all subjects. blood pressure was measured using an automated electronic device (omron model hem-725 fuzzy, omron company, dalian, china) three times consecutively after a 5-minute rest ; the three readings were averaged for further analyses. blood samples were collected in the morning (810 a.m.) after an overnight fasting (8 hours). plasma samples were obtained by centrifugation at 2000 g for 10 minutes at 4c and were kept at 80c before analyses. plasma glucose levels were measured using the glucose oxidase method, while hba1c was measured using the high - performance liquid chromatography (varianttm ii and d-10tm systems, bio - rad, usa). fasting insulin (fins) was measured using an autoanalyzer (architect i2000sr system, abbott laboratories, usa). lipid profiles such as triglyceride (tg), total cholesterol (tc), high - density lipoprotein cholesterol (hdl - c), and low - density lipoprotein cholesterol (ldl - c) were assayed by enzymatic methods, while the liver and kidney functions were determined using a biochemical aut - analyzer (architect c16000 system, abbott laboratories, il, usa). the body mass index (bmi) formula is computed as weight in kilograms divided by height in meters squared. the waist - to - hip ratio (whr) formula is the waist circumference in centimeters divided by the hip circumference in centimeters. the homeostasis model assessment of insulin resistance (homa - ir) = fasting insulin (mu / l) fasting plasma glucose (mmol / l)/22.5. plasma ctrp-3, hmgb-1, and il-6 levels were determined by commercial elisa kits according to the manufacturers ' instructions (human elisa kit, uscn life science inc., the intra - assay coefficients of variation were less than 8%, while the interassay coefficients of variation were less than 10%. all the assays were carried out in duplicate, and no significant cross - reactivity or interference was observed. the spss software (ibm, armonk, ny, version 19.0) was used for all statistical analyses. interrelationships between variables were assessed using a partial correlation analysis by controlling for age and gender. the distributions of plasma ctrp-3 (455, ng / ml) and hmgb-1 (5.38, ng / ml) were further divided into tertiles, and the linear trend was estimated by a linear - by - linear association of the chi - square test. a multivariate linear regression was performed to identify the risk factors of plasma ctrp-3 and hmgb-1. associations among plasma ctrp-3 and hmgb-1 levels and pre - dm and nt2 dm were examined using the multiple logistic regression analyses. the main characteristics of the subjects are presented in table 1. subjects in nt2 dm group were older than those of the ngt and pre - dm group (p 0.05). as shown in figures 1(c) and 1(d), there were no significant differences in plasma ctrp-3 ([420.39 64.16 ] versus [432.14 65.12 ], ng / ml) and hmgb-1 ([5.13 0.65 ] versus [5.22 0.78 ], ng / ml) concentrations between men and women (all p > 0.05). compared with the ngt group (486.548 37.09, ng / ml), subjects displayed a decreased trend of plasma ctrp-3 concentrations in pre - dm (419.649 46.34, ng / ml) and nt2 dm group (356.107 49.5, ng / ml) (figure 1(a), p for trend 455, ng / ml). similarly, the tertiles of plasma hmgb-1 were divided as the low (5.38, ng / ml). the presence of pre - dm was 53.9, 77.2, and 43.2%, respectively, across the hmgb-1 tertiles (x2 = 3.108, p trend = 0.026), whereas the presence of nt2 dm was 10.5, 12.7, and 54.1%, respectively (x2 = 44.07, p trend < 0.001). besides, the proportion of pre - dm was 41, 73.3, and 30.3%, respectively, across the tertiles of ctrp-3 (x2 = 16.424, p trend < 0.001), while the proportion of nt2 dm was 56.4, 14.7, and 6.3%, respectively (x2 = 35.607, p trend < 0.001). partial correlation analyses adjusted by age and gender showed that plasma ctrp-3 was negatively correlated with fpg, 2 h pg, fins, homa - ir, hba1c, bmi, whr, tg, ldl - c, and il-6 and was positively associated with hdl - c (all p < 0.05). however, after controlling for age and sex, plasma hmgb-1 was positively correlated with variables including fpg, 2 h pg, fins, homa - ir, hba1c, bmi, whr, tg, ldl - c, and il-6 and was negatively associated with hdl - c (all p < 0.05) (table 2). further multiple linear regression analyses showed that the plasma ctrp-3 concentrations were independently correlated with homa - ir (= 0.247, p = 0.009), hba1c (= 0.437, p < 0.001), hdl - c (= 0.144, p = 0.048), and il-6 (= 0.346, p < 0.001). in contrast, plasma hmgb-1 concentrations were independently associated with homa - ir (= 0.297, p < 0.001), il-6 (= 0.262, p = 0.001), and creatine (= 0.118, p = 0.017). moreover, further multivariate logistic regression analyses revealed that both plasma ctrp-3 and hmgb-1 concentrations were significantly correlated with pre - dm and nt2 dm after controlling for several covariates including age, gender, bmi, whr, blood pressure, tc, tg, ldl - c, hdl - c, and liver and kidney function (p < 0.001 for all) (tables 3 and 4). recently, c1q / tnf - related protein-3 (ctrp-3) is considered a secreted hormone that plays a role in the hepatic glucose and lipid metabolism. several researches have reported the association of circulating ctrp-3 with obesity and t2 dm in rodent models and in human [13, 26, 27 ]. [13, 14 ] showed that both infusion of recombinant ctrp-3 protein and transgenic overexpression of ctrp-3 in mice were involved in regulating the hepatic gluconeogenesis and lipid metabolism. recombinant ctrp-3 administration overtly lowered the blood glucose levels in c57bl/6 mice and leptin - deficient obese (ob / ob) mice. in our study, we found plasma ctrp-3 concentrations were significantly lower in subjects with pre - dm and nt2 dm compared with the ngt group. a multiple linear regression analysis showed the plasma ctrp-3 levels were independently associated with insulin resistance, hba1c, and hdl - c. further multiple logistical analyses indicated that plasma ctrp-3 concentrations were significantly correlated with pre - dm and nt2 dm after adjusting for potential confounders. these data manifest that ctrp-3 is an independent and strong predictor for prediabetes and diabetes. however, our study was contrary to choi. who reported higher ctrp-3 concentrations in pre - dm and t2 dm increased ctrp-3 may activate the akt signaling pathway in the liver while simultaneously suppressing the hepatic gluconeogenic gene expression, since ctrp-3 administration suppressed g6pase and pepck (two main gluconeogenic enzymes) by 80% in the murine liver. however, recent study by wolf. found no significant change in the whole body glucose metabolism, insulin sensitivity, and fasting - induced hepatic gluconeogenesis in ctrp-3-deficient mice treated with lfd or hfd. conflicting results also remain among several clinical studies regarding the association between circulating ctrp-3 and t2 dm [1517 ]. furthermore, recent data uncovers the anti - inflammatory properties of ctrp-3 in various models in vivo [28, 29 ], in vitro, and ex vivo. ctrp-3-deficient mice showed remarkably deteriorated inflammatory joint pathology in a collagen - induced rheumatoid arthritis model. in ctrp-3 knock - out mice, high - fat diet suppressed its liver and adipose expression of profibrotic tgf1 and serum tgf1 concentrations, while greatly increasing serum il-6 levels. previously, schmid. reported recombinant ctrp-3 administration could attenuate the systemic inflammation in wild - type mice challenged with a sublethal dose of bacterial - derived lipopolysaccharide (lps).. found neither overexpression nor deficiency of ctrp-3 could affect circulating il-1b, il-6, or tnf- levels in acute lps - challenged mice. moreover, high - fat feeding is considered a chronic low - grade inflammatory state. in high - fat fed mice, overexpression of ctrp-3 reduced the proinflammatory cytokines such as serum il-5 and tnf- and elevated soluble gp130 (sgp130) levels. soluble gp130 is known to antagonize the inflammatory responses by binding to the cytokines of il-6 family, and its serum levels are higher in older individuals with metabolic syndrome. tnf- is a potent inducer of insulin resistance, whereas il-5 can activate the eosinophil cells to participate in inflammation. in high - fat fed ctrp-3- transgenic mice, plasma il-6 concentrations were significantly higher in subjects with pre - dm and nt2 dm, and the multiple linear regression analyses also showed that il-6 was an independent risk factor for ctrp-3. though the causality can not be concluded, our results suggest that ctrp-3 may participate in the pathogenesis of inflammation mediated diabetes. it was not until 1999 that the cytosolic hmgb-1 was found to be a proinflammatory mediator and can be secreted by activated macrophages in the context of infection, injury, or other inflammatory status. first, hmgb-1 can upregulate the advanced glycation end - product (rage) signaling by binding to the rage receptor, thus boosting inflammation response. second, hmgb-1 can activate the nuclear factor-b (nf-b) in metabolic disease. in cells, activated nf-b enables the biosynthesis of several proinflammatory mediators such as tumor necrosis factor- (tnf-), interleukin-6 (il-6), and il-1, which participate in the pathological inflammatory response. in addition, hmgb-1 can bind to the toll - like receptor 2 (tlr2) and tlr4. as a classical innate immunity pathway, the tlrs can affect the development and progression of diabetes through the nf-b signaling. through myd88 signaling, activated tlr2 and tlr4 can trigger the release of proinflammatory factors such as il-6, tnf-, and il-1 and the aggregation of inflammatory cells. inflammatory microenvironment could cause -cell dysfunction and trigger insulin resistance, which in turn causes gradual progression to t2 dm [43, 44 ]. as mentioned above, inflammation and insulin resistance already exist in prediabetic stage and are important contributors to the development of diabetes. in our study, we found the plasma hmgb-1 and il-6 levels were gradually increased across the pre - dm and nt2 dm group. partial correlation and linear regression analyses showed a significant association among plasma hmgb-1, homa - ir, and il-6. further multiple logistical analyses also demonstrated that plasma hmgb-1 levels were associated with pre - dm and nt2 dm after adjusting for several confounders., circulating hmgb-1 levels were increased in adipocytes from insulin - resistant subjects, while serum hmgb-1 could promote insulin release in ins-1 cells. in a recent study, giacobbe. reported that hmgb-1 was associated with the presence of gestational diabetes mellitus (gdm) and insulin resistance in the third trimester of pregnancy. insulin resistance and inflammation are involved in the pathogenesis of gdm ; women with gdm have higher risk to develop t2 dm after pregnancy. combined with above evidence, we speculate that the increased plasma hmgb-1 concentrations may largely be due to the presence of insulin resistance and the low chronic inflammation in the context of hyperglycemia. first, this cross - sectional study could not conclude the causality between plasma ctrp-3/hmgb-1 and pre - dm or diabetes ; thus a prospective study is required in future research. second, due to the small sample size in our study, it is important to determine the cut - off value of circulating ctrp-3 and hmgb-1 to predict pre - dm and t2 dm in a large sample size including the sex, race, and other potential confounders. besides, contrary to other studies, we found no significant difference in plasma ctrp-3 and hmgb-1 by gender ; more researches are needed to clarify the influence by gender. in conclusion, we found plasma ctrp-3 levels were lower whereas plasma hmgb-1 concentrations were higher in subjects with prediabetes and newly diagnosed t2 dm. circulating ctrp-3 and hmgb-1 concentrations might be promising biomarkers to predict prediabetes and t2 dm.	aims. to detect the association of c1q / tnf - related protein-3 (ctrp-3) and high - mobility group box-1 (hmgb-1) in subjects with prediabetes (pre - dm) and newly diagnosed type 2 diabetes (nt2 dm). methods. 224 eligible participants were included. the 75 g oral glucose tolerance test (ogtt) and several clinical parameters of metabolic disorders and cytokines were measured. all participants were divided into three groups : normal glucose tolerance (ngt, n = 62), pre - dm (n = 111), and nt2 dm group (n = 56). results. plasma ctrp-3 concentrations were significantly lower in subjects with pre - dm and nt2 dm than that of the ngt group, while plasma hmgb-1 levels were higher in pre - dm and nt2 dm group compared with the ngt group (p < 0.05). a multiple linear regression analysis showed both plasma ctrp-3 and hmgb-1 concentrations were independently associated with homeostasis model assessment for insulin resistance (homa - ir) and interleukin-6 (il-6) (p < 0.05 for all). further multiple logistical regression analyses revealed that both plasma ctrp-3 and hmgb-1 levels were significantly associated with pre - dm and nt2 dm after adjusting for several confounders (p < 0.001 for all). conclusions. circulating ctrp-3 and hmgb-1 concentrations might be promising biomarkers to predict prediabetes and type 2 diabetes.
frailty is a common issue facing older adults, their families, and society in general. frailty predicts adverse outcomes such as death, worsening functional status, and institutionalization. while there are numerous definitions and theoretical models of frailty, all agree that frailty is associated with increasing vulnerability and a reduced reserve to deal with stressors. to date, a large body of literature has accumulated on the adverse outcomes of frailty, the theoretical framework and definitions of frailty, and the physical and medical predictors of frailty. there has been research into psychological and social predictors of frailty, but further inquiry into social and psychological predictors of frailty is needed. the attitude to aging and disability health beliefs, such as locus of control, predict a wide variety of adverse health outcomes : death, health service utilization, and heart disease. williamson and fried have shown that the belief that disability is due to aging is strongly associated with walking speed, disability, and medical conditions. the authors conclude that identifying and reducing the impact of these conditions may prove to be a useful approach to preventing or minimizing functional loss. in the work done by the study of osteoporosis fractures group, this association was also present. the authors went on to find that those who attributed poor mood to aging were less likely to seek medical care. the study of osteoporosis fractures consisted entirely of women, and the study by williamson and fried was also predominantly female. in addition, the temporal nature of the association is not clear ; those with disability may feel that their disability is due to aging. conversely, the sense that disability is due to aging may change their behaviours, and engage in less healthy behaviours, or be less likely to engage in activities which maintain their health. this may be a marker of someone who is in the early phases of frailty, and may be a warning sign of impending frailty. this belief may result in behaviours which predispose to frailty, such a lower levels of physical activity or lower levels of social engagement. seeing poor outcomes as inevitable may cause older adults to simply accept frailty rather than attempting measures to prevent it. we have, therefore, conducted a secondary analysis of an existing cohort study, the manitoba study of health and aging (msha), in order to determine if the belief that discomfort and disability are due to aging. specifically, the objectives of these analyses are : to determine if accepting disability as a part of aging is associated with frailty in older adults living in the community ; andto determine if accepting disability as a part of aging is associated with becoming frail over a five - year period in older adults who are not frail. to determine if accepting disability as a part of aging is associated with frailty in older adults living in the community ; and to determine if accepting disability as a part of aging is associated with becoming frail over a five - year period in older adults who are not frail. we conducted a secondary analysis of the manitoba study of health and aging (msha), a population - based study conducted in the canadian province of manitoba, done in conjunction with the canadian study of health and aging (csha). the original aims of this study were to determine the prevalence and risk factors for dementia in manitoba, and to examine social correlates of aging. in 1991/1992, the original sampling frame was from a list provided by manitoba health, the provincial ministry of health. since health - care coverage is universal in manitoba, this represents a comprehensive representative sampling frame. older age groups (over 85) were over - sampled, and sampling was stratified by region, with representation from the entire province. persons residing in institutions (nursing homes and chronic care hospitals) did not undergo the screening interview and were not included in these analyses. initially, 2,890 persons were selected. of these, 443 refused to participate, 480 were not eligible (had died, had entered a nursing home, or were too ill), 162 could not be located, and 54 did not complete the screening questionnaire. the final sample at time 1 was 1,751. at time 1, 1,735 had no missing variables for health beliefs. the follow - up sample included those who had survived to 1996/7, who underwent the screening questionnaire with complete data at time 2, who were living in the community, and who agreed to participate in the study (n = 1,028). those who were living in institutions at time 2 were excluded since they did not undergo the screening questionnaire. in manitoba, nursing homes are not used for convalescence, and those in institutions are very frail. for the prospective analyses, we excluded those who were frail at time 1, leaving a final sample of 851. there were too few participants with mild / moderate frailty who survived and were living in the community to determine if attitudes to disability and aging predicted becoming more frail. the research was approved by the research ethics committee of the faculty of medicine of the university of manitoba, and adhered to the declaration of helskinki. data gathered were : age, gender, educational level (years of education), and marital status. income security was measured with the item : how do you think your income and assets satisfy your needs ? and was scored as : very well / adequately / with some difficulty / not very well / totally inadequately. we considered this as a continuous measure. since it was not normally distributed and some cells contained few observations, we also considered it as a dichotomous variable in sensitivity analyses. these results were similar, and we present the models with this variable included as a continuous factor. the modified mini - mental state examination (3ms) was used as the screening test for cognitive impairment and dementia. those who scored less than 78 on the 3ms were invited to participate in a clinical examination to determine the presence of cognitive impairment or dementia. those with cognitive impairment not meeting these criteria were diagnosed with cognitive impairment no dementia (cind). this is a heterogeneous group of people with different conditions and circumstances interfering with cognition. participants were asked about their ability to perform basic activities of daily living (adl ; eating, dressing, grooming, getting in and out of bed, taking a bath or shower, and ability to use the bathroom), instrumental activities of daily living (iadl ; using the telephone, getting to places out of walking distance, going shopping, preparing meals, doing housework, taking medication[s ], managing money), and ambulation. the item : when you reach my age, you have to accept a fair degree of discomfort and physical disability was asked and scored on a five - point scale. since there were few people who answered mixed and the data were not normally distributed, we also dichotomized this response into agree (strongly agree, agree) vs. disagree (mixed, disagree, and strongly disagree) for sensitivity analyses. these results were similar to the primary analyses, and we present the results of models with this item entered as a continuous variable. this is a measure of frailty based upon the accumulation of deficits model of frailty, which has good construct validity and predicts a variety of adverse outcomes. it categorizes individuals as : not frail walk without help, perform basic activities of daily living, continent of bowel and bladder, and are not cognitively impaired.incontinencebladder incontinence only.mildone (two if incontinent) or more of needing assistance with mobility ; or activities of daily living, or has cind, or has bowel or bladder incontinence.moderate/severetwo (three if incontinent) or more of totally dependent for transfers or one or more activities of daily life, incontinent of bowel and bladder, or diagnosis of dementia. not frail walk without help, perform basic activities of daily living, continent of bowel and bladder, and are not cognitively impaired. one (two if incontinent) or more of needing assistance with mobility ; or activities of daily living, or has cind, or has bowel or bladder incontinence. moderate / severe two (three if incontinent) or more of totally dependent for transfers or one or more activities of daily life, incontinent of bowel and bladder, or diagnosis of dementia. as a sensitivity analysis, we also considered the frailty index. forty deficits in multiple domains were considered, and each was considered as present or absent. the number of deficits was summed and divided by the number of possible deficits to yield a score from 0 to 1. we considered this score as a continuous variable and as a dichotomous variable, using a cut - point of 0.25. the frailty index and the brief frailty measure were correlated (spearman s correlation coefficient 0.42, p <.001). we also conducted a sensitivity analysis using disability as our outcome. here, we considered the oars at time 1 and time 2 as our outcome. for these analyses, we summed the oars items from 0 to 28 at both times. we considered the statement when you reach my age, you have to accept a fair degree of discomfort and physical disability as the predictor variable of interest. categorical variables were compared using chi - square tests and continuous variables were compared using t - tests (assuming unequal variance) or one - way analysis of variance (anova). logistic regression models were constructed, with the outcome of mild / moderate to severe frailty vs. no frailty / incontinence at time 1. as well, logistic regression models were constructed for the outcome of mild / moderate to severe frailty vs. no frailty / incontinence at time 2. continuous variables were entered directly into the model, and categorical variables entered as categories. bivariate analyses and graphs were conducted in spss version 10, and statistical models were constructed using stata version 10 (college station texas). we conducted a secondary analysis of the manitoba study of health and aging (msha), a population - based study conducted in the canadian province of manitoba, done in conjunction with the canadian study of health and aging (csha). the original aims of this study were to determine the prevalence and risk factors for dementia in manitoba, and to examine social correlates of aging. in 1991/1992, the original sampling frame was from a list provided by manitoba health, the provincial ministry of health. since health - care coverage is universal in manitoba, this represents a comprehensive representative sampling frame. older age groups (over 85) were over - sampled, and sampling was stratified by region, with representation from the entire province. persons residing in institutions (nursing homes and chronic care hospitals) did not undergo the screening interview and were not included in these analyses. initially, 2,890 persons were selected. of these, 443 refused to participate, 480 were not eligible (had died, had entered a nursing home, or were too ill), 162 could not be located, and 54 did not complete the screening questionnaire. the final sample at time 1 was 1,751. at time 1, 1,735 had no missing variables for health beliefs. the follow - up sample included those who had survived to 1996/7, who underwent the screening questionnaire with complete data at time 2, who were living in the community, and who agreed to participate in the study (n = 1,028). those who were living in institutions at time 2 were excluded since they did not undergo the screening questionnaire. in manitoba, nursing homes are not used for convalescence, and those in institutions are very frail. for the prospective analyses, we excluded those who were frail at time 1, leaving a final sample of 851. there were too few participants with mild / moderate frailty who survived and were living in the community to determine if attitudes to disability and aging predicted becoming more frail. the research was approved by the research ethics committee of the faculty of medicine of the university of manitoba, and adhered to the declaration of helskinki. data gathered were : age, gender, educational level (years of education), and marital status. income security was measured with the item : how do you think your income and assets satisfy your needs ? and was scored as : very well / adequately / with some difficulty / not very well / totally inadequately. we considered this as a continuous measure. since it was not normally distributed and some cells contained few observations, we also considered it as a dichotomous variable in sensitivity analyses. these results were similar, and we present the models with this variable included as a continuous factor. the modified mini - mental state examination (3ms) was used as the screening test for cognitive impairment and dementia. those who scored less than 78 on the 3ms were invited to participate in a clinical examination to determine the presence of cognitive impairment or dementia. those with cognitive impairment not meeting these criteria were diagnosed with cognitive impairment no dementia (cind). this is a heterogeneous group of people with different conditions and circumstances interfering with cognition. participants were asked about their ability to perform basic activities of daily living (adl ; eating, dressing, grooming, getting in and out of bed, taking a bath or shower, and ability to use the bathroom), instrumental activities of daily living (iadl ; using the telephone, getting to places out of walking distance, going shopping, preparing meals, doing housework, taking medication[s ], managing money), and ambulation. the item : when you reach my age, you have to accept a fair degree of discomfort and physical disability was asked and scored on a five - point scale. since there were few people who answered mixed and the data were not normally distributed, we also dichotomized this response into agree (strongly agree, agree) vs. disagree (mixed, disagree, and strongly disagree) for sensitivity analyses. these results were similar to the primary analyses, and we present the results of models with this item entered as a continuous variable. this is a measure of frailty based upon the accumulation of deficits model of frailty, which has good construct validity and predicts a variety of adverse outcomes. it categorizes individuals as : not frail walk without help, perform basic activities of daily living, continent of bowel and bladder, and are not cognitively impaired.incontinencebladder incontinence only.mildone (two if incontinent) or more of needing assistance with mobility ; or activities of daily living, or has cind, or has bowel or bladder incontinence.moderate/severetwo (three if incontinent) or more of totally dependent for transfers or one or more activities of daily life, incontinent of bowel and bladder, or diagnosis of dementia. not frail walk without help, perform basic activities of daily living, continent of bowel and bladder, and are not cognitively impaired. one (two if incontinent) or more of needing assistance with mobility ; or activities of daily living, or has cind, or has bowel or bladder incontinence. moderate / severe two (three if incontinent) or more of totally dependent for transfers or one or more activities of daily life, incontinent of bowel and bladder, or diagnosis of dementia. as a sensitivity analysis forty deficits in multiple domains were considered, and each was considered as present or absent. the number of deficits was summed and divided by the number of possible deficits to yield a score from 0 to 1. we considered this score as a continuous variable and as a dichotomous variable, using a cut - point of 0.25. the frailty index and the brief frailty measure were correlated (spearman s correlation coefficient 0.42, p <.001). we also conducted a sensitivity analysis using disability as our outcome. here, we considered the oars at time 1 and time 2 as our outcome. for these analyses, we summed the oars items from 0 to 28 at both times. we considered the statement when you reach my age, you have to accept a fair degree of discomfort and physical disability as the predictor variable of interest. categorical variables were compared using chi - square tests and continuous variables were compared using t - tests (assuming unequal variance) or one - way analysis of variance (anova). logistic regression models were constructed, with the outcome of mild / moderate to severe frailty vs. no frailty / incontinence at time 1. as well, logistic regression models were constructed for the outcome of mild / moderate to severe frailty vs. no frailty / incontinence at time 2. continuous variables were entered directly into the model, and categorical variables entered as categories. bivariate analyses and graphs were conducted in spss version 10, and statistical models were constructed using stata version 10 (college station texas). the baseline characteristics of the cross - sectional sample and the prospective sample are shown in table 1. those who agreed with the statement (80.4% of the time 1 sample), when you reach my age, you have to accept a fair degree of discomfort and physical disability, were older, more likely to be women, and had lower levels of education. there was no difference in mortality or institutionalization over the five - year period between those who agreed or disagreed with the statement (table 1). there was a strong and graded association between accepting disability and frailty in the cross - sectional analyses (figure 1). the proportion of those who were frail was : 4.8% (strongly disagree) ; 12.2% (disagree) ; 22.4% (undecided) ; 23.4% (agree) ; 30.9% (strongly agree) (p <.001, chi - square test). older age, lower education, less adequate income, and never having married were also associated with frailty. we sought potential interactions in these associations by entering interaction terms between predictor variables and did not detect any interactions. however, the numbers for some factors (e.g., marital status) may have been insufficient to detect interactions. association between accepting disability as a part of aging and frailty in cross - sectional analysis of participants at time 1 results of logistic regression models for time 1 associations ; the odds ratio (or) and 95% confidence interval (ci) are shown for various models adjusting for potential confounding factors accepting disability is agreeing with the statement that disability is due to aging, scored on a five point scale. the prospective analysis included those who were not frail at time 1, and who were alive and available for follow - up at time 2 (n = 851). accepting disability as part of aging also predicted becoming frail in those who were not frail at time 1 (figure 2). the proportion of those who were frail at time 2 was 8.3% (strongly disagree) ; 9.8% (disagree) ; 18.8% (undecided) ; 19.8% (agree) ; 30.2% (strongly agree) (p =.007, chi - square test). this association was also seen in logistic regression models adjusting for potential confounding factors (table 3). analyses using the frailty index were similar. accepting disability as a part of aging predicted frailty at time 2 in those who were not frail at time 1 results of logistic regression for the risk of being frail at time 2 ; analyses include those who were not frail at time 1 and had data available at both times (followed over five years), and the odds ratio (or) and 95% confidence interval (ci) are shown for various models adjusting for potential confounding factors accepting disability is agreeing with the statement that disability is due to aging, scored on a five point scale. the analyses considering disability as an outcome were very similar. attributing disability as a result of growing old was associated with more disability on the oars at both time 1 and five years later (figure 3). this association, between accepting disability as part of aging and disability at both time 1 and time 2, persisted in multivariable models adjusting for age, gender, and education (data available upon request). accepting disability as a part of aging is associated with higher levels of disability at time 1 and time 2 we also sought interactions in the effects. we did not find any interactions in these associations, and the effect was seen in men and women, and in all educational and age groups. we have found that the belief that disability is due to aging is associated with frailty and, indeed, predicts frailty over a long time interval. williamson and fried have found that believing disability is a part of aging is strongly associated with disability. have also found that those who were disabled were more likely to report that their disability is due to aging. we go on to show this association in men and women in a general, representative population. previous studies have used a question specific to the person (i.e., what caused your disability ?, rather than what causes disability ?) the question asked in our study would be easier to generalize to a wide population in other settings, as well as being easier to interpret. as well, our study included a large number of older men, and we found that the association between attitudes to disability and frailty was present in both men and women. the participants in the msha were less well - educated than some other study populations, and the data are somewhat older. there may be cohort effects in these beliefs with younger birth cohorts having a different sense of control or different attitudes to aging. the measure we used may simply be very specific to the risk of frailty and/or disability. another explanation is that other factors may play a larger role in predicting death and nursing home admission. first, the original study was conducted in the 1990s and health beliefs may have changed in the intervening time. it is less likely that the association between health beliefs and frailty has changed in these years, however. a second limitation is the simplicity of the measure. only a single item was considered in these analyses. third, we have used a measure of frailty which is consistent with the frailty as an accumulation of deficits model used in the csha. the definition we used also weights disability very highly. indeed, we may simply be measuring the association between attitudes to disability and disability itself. other alternative models, such as the frailty as a phenotype model, may have yielded different results. the causal nature of the association is thus less clear, and longitudinal associations over long periods of time are needed. a final limitation is that there may be factors which we have not considered, which may confound or interact with attitudes to health and disability. previous studies in this area have been conducted primarily in women. while there were gender differences in the belief that disability was due to aging, this lack of an association may be due to the definition of frailty we used, which weighted cognition heavily. a final explanation may be that the effect of gender is mediated through health beliefs and attitudes. another strength is that reliable, valid measures of disability were used, and were gathered by trained interviewers in person. first, clinicians should be aware that older adults who view disability as a part of aging may be at higher risk for frailty. second, it is possible that interventions to increase the sense of control over health may be useful in reducing the risk of frailty. addressing depressive symptoms, social isolation, and other factors may increase a sense of control. since the belief that disability is due to aging is widespread, the potential intervention could benefit a large number of people. further research into the causal relationship between this association is of course needed prior to any intervention study. future research would need to focus on the stability of these beliefs over time, and how they change with changing disability and frailty.	backgroundthe objectives are to determine if : 1) accepting disability as a part of aging is associated with frailty ; and 2) accepting disability is associated with becoming frail over a five - year period.methodssecondary analysis of a prospective cohort study of 1,751 community - dwelling adults aged 65 +. participants were asked to rate their agreement with the statement : when you reach my age, you have to accept a fair degree of discomfort and physical disability on a five - point scale. frailty was categorized as not frail or frail. the sample was re - interviewed five years later.resultsthe mean age was 75.5 years, 62.3% were women, and the mean education was 10.2 years. accepting disability as a part of aging was strongly associated with frailty at time 1 ; the unadjusted odds ratio (or) and 95% confidence interval (ci) was 1.47 (1.25, 1.72) and this association persisted after adjusting for confounding factors. accepting disability was also associated with becoming frail ; the unadjusted or and 95% ci was 1.51 (1.20, 1.90), and this association also persisted after adjusting for potential confounding factors.conclusionsaccepting disability as a part of aging is associated with being frail and becoming frail.
both nonalcoholic fatty liver disease (nafld) and type 2 diabetes mellitus (t2 dm) are highly prevalent in the community and are frequently associated with each other, as part of the metabolic syndrome. the link between the two diseases is insulin - resistance and compensatory hyperinsulinemia progressing to -cell dysfunction in t2 dm or to defective lipid metabolism and hepatic triglyceride accumulation in nafld. this also explains why nafld is very common in t2 dm (around 70% using ultrasound techniques) and why nafld patients are at high risk of t2 dm. notably, in subjects with t2 dm hepatic fat accumulation is more likely to progress to nonalcoholic steatohepatitis (nash) and fibrosis than in non - t2 dm cases [4, 5 ] and ultimately to bridging fibrosis / cirrhosis or to hepatocellular carcinoma (hcc). finally, whereas nafld per se and t2 dm increase the risk of cardiovascular events and chronic kidney disease, their combination accelerates the progression of macro- and microvascular complications, independent of which disease comes first. given the burden of t2 dm and nafld in the community and the gloomy perspectives for the future considering the high prevalence of obesity, it would be important to increase the low awareness of this ominous association between the general practitioners and the specialists caring for hospital patients, who frequently miss to diagnose nafld. normal liver enzymes do not exclude nafld and ultrasonography of the liver is needed. screening with routine noninvasive scores might help diagnose nafld, select patients for ultrasonography, and plan the most appropriate glucose - lowering therapy to prevent both hepatic and systemic complications. we used the fatty liver index (fli) as a proxy of diagnosis of nafld to investigate the prevalence of nafld in a large population of t2 dm subjects without at - risk alcohol intake and its correlations with cardiovascular risk factors and renal dysfunction markers. fli is based on simple anthropometric data and routine biochemistry and proved effective in identifying subjects with fatty liver in the community and in the insulin - resistance setting, as well as identifying cases at risk of all - cause, cardiovascular, and liver - related outcomes. for our purpose we used the database of the italian association of clinical diabetologists (associazione medici diabetologi (amd)) annals [18, 19 ]. the amd (associazione medici diabetologi) annals initiative, a continuous quality improvement initiative, has been described in more detail elsewhere [18, 19 ]. briefly, a set of indicators to be used for benchmarking activities is collected annually from participating diabetes centers in a standardized format (amd data file) and centrally analyzed anonymously. quality indicators include process measures evaluating diagnostic, preventive, and therapeutic procedures and outcome indicators measuring favorable and unfavorable modifications in patient health status. furthermore, the use of antidiabetic, antihypertensive, and lipid lowering drugs is evaluated. the entire project is conducted through a physician - led effort, without allocation of extra resources or financial incentives. clinical data extracted from electronic medical records used for everyday management of patients and collected during the period 20042011 in the database of amd - annals includes 942,784 t2 dm patients from 302 diabetes centers. in this database we searched for patients with the complete dataset to calculate fli (117,291 patients, from 160 diabetes units). after exclusion of 22,714 cases for incomplete laboratory values (figure 1), 94,577 cases were left. only 38,880 of them were definitely alcohol - free or with an alcohol intake below 30 g / day (males) or 20 g / day (females), as required by international associations for the diagnosis of nafld and this was the sample used to calculate the prevalence of fli - nafld. in cases of multiple records collected during the year for the same patient, data were generally captured in the same visit, but if data were not complete, missing data were captured in a period of 6 months. the fib-4 score, a noninvasive test for hepatic fibrosis, was also used to evaluate the severity of nafld in the patients with fli > 60 (probable nafld). due to incomplete data presence in the database the fib-4 was calculable in 15882/38880 patients (40.8%) with complete alt, ast, and platelet count. the fli uses an algorithm based on body mass index (bmi (kg / m)), waist circumference (cm), triglycerides (mg / dl), and gamma - glutamyltransferase (ggt (iu / l)) as follows : fli = 100 exp{0.953 ln(triglycerides) + 0.139 bmi + 0.718 ln(ggt) + 0.053 waist circumference 15.745}/(1exp{0.953 ln(triglycerides) + 0.139 bmi + 0.718 ln(ggt) + 0.053 waist circumference 15.745 }), where ln indicates the natural logarithm. the fib-4 algorithm is based on age (years), serum alanine aminotransferase (alt (iu / l)), aspartate aminotransferase (ast (iu / l)), and platelet count (plt count (10/l)) according to the following formula : fib-4 = (age ast)/(platelet count (square root of alt)). a fib-4 score > 3.25 has a positive predictive value to confirm the existence of a significant hepatic fibrosis. two cut - offs of alt values were considered ; the standard cut - off of the italian laboratories of 41 u / l and 31 u / l for males and females, respectively, and the updated reference values of 31 albuminuria was defined as albumin excretion rate 20 mg / min, or albumin - creatinine ratio > 2.5 (men) or > 3.5 (women) mg / mmol, or microalbuminuria > 30 glomerular filtration rate (gfr) was calculated with the chronic kidney disease epidemiology collaboration formula (egfr). finally, in all cases the quality of care was estimated by the previously validated summary q score, able to predict long - term outcomes in the amd initiative dataset. fli, used as a proxy of the diagnosis of nafld is based on simple parameters (bmi, waist circumference, triglycerides, and gamma - glutamyltransferase (ggt)), available in the database. fli 38, alt > 41, hdl cholesterol 3.25, was 4.4%, so a relatively low proportion of nafld patients seem to have progressed to advanced liver disease. however from an epidemiological point of view if we consider the high prevalence of type 2 diabetes in general population and the very high prevalence of nafld in diabetic patients we are going to face a very large impact of nafld - related advanced liver disease on the health care system. diabetes specialists should diagnose nafld in their patients, but relying on normal liver enzymes to exclude nafld carries a high risk of underestimating the problem. in the present setting, mean alt levels were higher in patients with fli 60, but nearly half of patients with fli 60 showed normal alt values, also when grouped according to the updated reference cut - offs. noninvasive and inexpensive tests as fli and fib-4 may be very useful to diagnose the disease and to assess its degree of progression and finally to select patients for ultrasonography and additional work - up. in subjects diagnosed with nafld, any effort should be done to achieve glucose control by treatment(s) likely to reduce the burden of liver disease. lifestyle intervention is the cornerstone of therapy for both diabetes and nafld, but pharmacological therapies for hyperglycemia may influence significantly the progression of nafld to nash, cirrhosis, and liver cancer. a few drugs for the treatment of hyperglycemia, hypertension, and dyslipidemia (metformin, thiazolidinediones, ace inhibitors, arbs, statins, and ezetimibe) might have protective activity on liver disease, while others are expected to worsen the disease. in our dataset the pharmacological treatment of hyperglycemia seemed to be tailored to phenotypic characteristics of patients, and subjects with fli 60, who had higher bmi and waist circumference, were more frequently treated with insulin sensitizers (metformin and particularly thiazolidinediones, that could improve the evolution of nafld) and less frequently with insulin and sulphonamides, as compared to patients with fli < 30. in the same way ace inhibitors and angiotensin receptor blockers (arbs), which seem to reduce insulin - resistance and give some advantages in nafld, were more frequently used in fli 60. low quality of care, assessed by q score, is associated with an increased risk of fli assessed nafld. the strengths of our study are the large size of the sample, the unique data source, and the nonselection of patients, which makes the population representative of the general condition of nafld in t2 dm outpatients of centers of diabetes care in italy. using formulas (fli, fb4) as a proxy of diagnosis prevents the possibility of calculating the absolute prevalence of nafld (only a structured study directed to this aim with appropriate instruments as ultrasonography may be suitable for this purpose). clinical data were extracted from electronic medical records used for everyday management out of any research design (only exams included in usual diagnostic protocols of participating centers were included), so only part of patients had the complete data - setting to calculate the fli and could be included in the study ; for this reason a selection of patients can not be excluded. nevertheless some data suggest that fli availability did not select a sample with specific characteristics : in another analysis performed on data extracted from the same database, with a different sample and different purposes, the metabolic and clinical characteristics of patients were identical to the patients included in our study. another limitation is the lack of possibility of ruling out chronic viral hepatitis. hepatitis c virus (hcv) may be responsible for the presence of hepatic steatosis, for elevation of ast / alt, and for the progression of the disease. the positivity of the markers of viral hepatitis (hbv + hcv) in italian diabetic patients has been reported in different centers between 5.2 and 10.8%, so the prevalence of nafld might be in part overestimated in our study and above all the rate of progression of the hepatic disease might be significantly linked to the presence of viral infections. in conclusion we could confirm on a very wide population that nafld is largely present in type 2 diabetes and correlates with a worse metabolic profile and with organ damage. nafld must be searched for and regarded with special attention in type 2 diabetic patients. when nafld is present in type 2 diabetes a tailored approach to therapy is mandatory to prevent the progression of comorbidities and complications of diabetes (hepatic, renal, and cardiovascular).	objective. we studied the prevalence of nonalcoholic fatty liver disease (nafld) and its clinical correlates in a population of patients with type 2 diabetes mellitus (t2 dm). methods. clinical data of 94,577 t2 dm patients were retrieved from 160 diabetes clinics in italy in a standardized format and centrally analyzed anonymously. after exclusion of 5967 cases (high or uncertain alcohol intake), in 38,880 the fatty liver index (fli) was used as a proxy for the diagnosis of nafld. factors associated with fli assessed nafld (fli - nafld) were evaluated through multivariate analysis. results. fli - nafld was present in 59.6% of patients. compared to non - nafld, fli - nafld was associated with impairment in renal function, higher albumin excretion, hba1c and blood pressure, lower hdl cholesterol, and poorer quality of care. alt was within normal limits in 73.6% of fli - nafld patients (45.6% if the updated reference values were used). the prevalence of fli - nafld did not differ if the whole sample (94,577 cases) was examined, irrespective of alcohol intake. conclusions. fli - nafld was present in the majority of t2 dm patients of our sample and metabolic derangement, not alcohol consumption, was mainly associated with the disease. fli - nafld patients have a worse metabolic profile. alt levels are not predictive of nafld.
thyroid cancer accounts for approximately 2% of all cancers diagnosed worldwide and 95% of all endocrine cancers. recent reports describe a continuous increase in thyroid cancer incidence worldwide. in certain geographical areas, this increase exceeds 100% (and is as high as 250% in some cases). it has been suggested that this generally steady trend of increasing thyroid cancer incidence may be only apparent, and that it depends on higher detection rates of small tumors due to the technological advances in morphological and functional imaging techniques over the last few decades. thyroid goiter is a pathological condition with epidemic dimensions in some areas because of several geographical, nutritional, and genetic factors. it has been linked to a higher risk of thyroid cancer, especially the follicular histotype. the aim of this population - based study was to analyze and describe the epidemiological characteristics and trends of thyroid cancer in the province of sassari (sardinia, italy), an area with epidemic thyroid goiter, in the period 19922010. the epidemiological data presented in this paper were obtained from the registry of the tumors of the province of sassari. this registry was created in 1992 by the local health agency for the epidemiological surveillance of tumors in the province. in 1999, it became part of a wider web of tumor registries, coordinated today by the italian association for tumor registries (associazione italiana registri tumori (airtum)). the association coordinates 34 registries in the country, collects and publishes data, and collaborates with international organizations in the field. every registry collects data on tumoral diseases affecting inhabitants in the territory of jurisdiction through the local hospitals and health care services, as with other registries (e.g., death registries). demographic, clinical, pathological, and prognostic data are collected for each case of cancer and are registered in a digital database. crude incidence and mortality rates per 100,000 inhabitants per year were calculated, as were standardized rates adjusted for european population standards. a comparison between incidence and mortality in the province of sassari and those in other italian provinces was performed. additionally, the cumulative risk of developing the disease and of dying between zero and 74 years of age was estimated. the age class distribution and time trends of incidence, mortality, mean age of disease onset, and histology were also evaluated. diagnosis was confirmed by histological or cytological reports in 1,089 cases (98.3%) and using other information sources (clinical reports, death certifications, etc.) in the remaining 19 cases (1.7%). among the 1,108 individuals registered, 237 were males and 871 females, with a male - to - female ratio of 1 : 3.7. the cumulative risk of developing the disease was 0.42% for males and 1.49% for females. the crude incidence of thyroid malignancies in the period under investigation was 5.8/100,000 for men and 20.5/100,000 for women. table 1 shows the distribution of incidence in relation to age in percentages while table 2 shows the distribution of incidence rates in relation to age. incidence rates were also calculated for the following three time periods : 19922000, 20012005, and 20062010 (figure 1). there was a progressive increase in the incidence rate in males, from 3.37/100,000 in the first period to 5.87/100,000 in the second period and 8.13/100,000 in the last period. the corresponding figures for females were 11.85/100,000, 22.14/100,000, and 26.93/100,000, respectively. a twofold increase in incidence occurred between 1992 and 2010. analysis of the trend of mean age at disease onset for the same periods of time did not reveal any relevant changes (figure 2). concerning histology, 866 lesions (79.5%) were papillary tumors, 123 (11.3%) follicular, 20 (1.8%) medullary, and 28 (2.6%) other histological subtypes. in the remaining cases (4.8%), an increasing trend with regard to the principal histotypes (papillary and follicular) was observed from 1992 to 2010, while medullary and other rare histotypes remained stable (figure 3). table 3 shows the comparison of the incidence and mortality in the province of sassari with those in other italian provinces. there were 71 deaths in the period under investigation (32 males and 39 females). the cumulative risk of death was extremely low (0.05% for males and 0.04% for females). table 2 shows the age - class distribution of mortality rates. there was a steady increase in mortality in relation to age after the fifth decade of life. figure 1 shows the time trend of mortality between 1992 and 2010 ; there were no significant changes. thyroid cancer accounts for approximately the 2% of all cancers diagnosed worldwide and 95% of all endocrine cancers. recent data suggest there were more than 213,000 new cases of thyroid cancer worldwide in 2008, with a crude incidence rate of 3.1/100,000 and a cumulative risk of developing the disease of 0.31. the male - to - female ratio was approximately 1 : 3.3, while the crude incidence for men was 1.4/100,000 and that for women was 4.9/100,000. the cumulative risk was 0.15 for males and 0.47 for females. concerning the italian population, we obtained information using the same data source, and the following picture for 2008 was created : 7,448 new cases (1,618 males and 5,830 females), a crude incidence of 12.5/100.000 (5.6 for males and 19 for females), and a cumulative risk of 0.88 (0.4 for males and 1.35 for females). italy ranks third in europe in terms of new cases, after the russian federation and france. the standardized incidence of thyroid cancer in the province of sassari was similar to that estimated for the entire country (table 3). this is somewhat surprising as sardinia is an area of epidemic thyroid goiter, which is associated with increased incidence of cancer, particularly the follicular type. this seems not to be the case in our province, where the percentage of follicular thyroid cancers was similar to that in large national and international reports, with only a slight tendency to increase from 1992 to 2010. our findings are confirmed by surgical reports published by surgeons employed in local hospitals. in these reports, less than 30% of the patients who underwent thyroidectomy for thyroid disease were affected by cancer and the percentage of the follicular subtype, as determined by pathological examination of surgical specimens, was comparable to that found in the present study. comparisons of the incidence rates with those of other italian provinces place our province approximately in the middle, between provinces with higher incidences, such as ferrara, modena, and reggio emilia, and provinces with lower incidences, such as ragusa and trento. considering the distribution of the disease in relation to age, only approximately 10% of the cases occurred in individuals younger than 30 years and older than 75. it is interesting to observe that the peak incidence in men occurred at age 8084 years, while in women it occurred earlier (at 5054 years of age). while women generally develop the disease earlier in their lives, when they are professionally active and have a long life expectancy, men develop the disease later, probably after their retirement from work and when their life expectancy and probability of dying from the disease are lower. the time trends analysis showed a stable increase in incidence in the province of sassari. this trend is common in numerous national and international geographical areas, which have contributed to the global increase in the number of new thyroid cancer cases reported in several publications. as we mentioned before, in certain geographical areas such increases are greater than 100% and as high as 250% in some cases. it is not clear whether this is a real increase in incidence, as was demonstrated in some areas after nuclear incidents, or whether it reflects a general improvement in the technological means and expertise employed to detect small thyroid malignancies, which in the past may have remained undiscovered [3, 7 ]. several autopsy studies demonstrated a prevalence of thyroid microcarcinomas ranging from 2% to 35% [8, 9 ]. concerning mortality, only 71 deaths occurred in the 18 years we studied. crude overall mortality was 0.8/100,000 for men and slightly superior for women (0.9/100,000). these values are similar to those observed in other provinces in italy and in recent european reports [5, 10 ], but somewhat higher than some worldwide estimates. considering the age - class mortality trend, a natural increase in relation to age was observed in both sexes, with peaks after the eighth decade of life and without significant variations between 1992 and 2010. the relative 5-year survival was lower in males than in females, but by global standards it can be considered excellent, especially in relation to other types of malignancies, and suggests that a good local health care system is available for the sufferers. our data show an increasing trend in the incidence of thyroid cancer in the province of sassari. this trend seems to follow the general worldwide trend and does not seem to be related to the high incidence of thyroid goiter in the area. the frequencies of the different histological subtypes were similar to those reported in numerous national and international reports. women are affected earlier than men and therefore suffer greater professional, economic, and social impacts. overall mortality is low and a relative 5-year survival is excellent, especially in comparison to other malignancies.	the aim of this study was to analyze and describe the epidemiological characteristics and trends of thyroid cancer in the province of sassari (sardinia, italy), an area with epidemic thyroid goiter, in the period 19922010. data were obtained from the local tumor registry which makes part of a wider registry web, coordinated today by the italian association for tumor registries. an increasing trend in the incidence of thyroid cancer in the province of sassari was evidenced. this trend seems to follow the general worldwide trend and does not seem to be related to the high incidence of thyroid goiter in the area. the frequencies of the different histological subtypes were similar to those reported in numerous national and international reports. women are affected earlier than men and, therefore, suffer greater professional, economic, and social impacts. overall mortality is low and a relative 5-year survival is excellent, especially in comparison to other malignancies.
the grunwald - winstein equation (equation 1) was originally developed in 1948 for the correlation of specific rates of solvolysis of initially neutral substrates reacting by an ionization (sn1 + e1) mechanism. in equation 1, k and ko are the specific rates of solvolysis in a given solvent and in the standard solvent (80% ethanol), respectively, m represents the sensitivity to changes in the solvent ionizing power y (initially set at unity for tert - butyl chloride solvolyses), and c is a constant (residual) term. it is now realized both that the scales are leaving - group dependent and that adamantyl derivatives provide better standard substrates, and a series of yx scales are available. it was immediately realized that bimolecular (sn2 and/or e2) reactions can not be expected to follow such a relationship because solvent nucleophilicity (n) will also be an important factor. however, for a given type of binary solvent (such as a series of aqueous - ethanol mixtures) a linear plot based on equation 1 was frequently observed due to collinearity between the n and y scales. such plots had m values considerable lower than unity and these values were taken as evidence for a bimolecular reaction. it was further realized that, in principle, the correlation could be extended (equation 2) to include a term governed by the sensitivity to changes in solvent nucleophilicity (n). however, in practice, an n scale could not be developed because the appropriate m value for insertion into the equation (= 1 for the standard substrate) could not be obtained. schleyer and bentley estimated the m values at 0.3 for the solvolyses of methyl p - toluenesulfonate, and arrived at the nots scale. at the present time, scales are usually based on the solvolyses of s - methyldibenzothiophenium ion, in which the leaving group is a neutral molecule, which is little influenced by solvent change, and the my term can be neglected. the nt values obtained indicated that the m for methyl p - toluenesulfonate is best set at 0.55 and revised nots values are in good agreement with nt values. when aromatic rings are bonded, at the transition state, to the carbon which is developing positive charge, the charge will be partially distributed into the aromatic rings. this causes changes in the solvation of the rings in going from the substrate to the activated complex, which in turn leads to a perturbation of analyses in terms of equation 1 or 2. this can be accommodated by use of similarity model scales in which the standard substrate contains similarly situated aromatic rings and new ionizing power scales are devised. alternatively, a third variable term can be added to the linear free energy relationship (equation 3), governed by the sensitivity h to changes in the aromatic ring parameter (i). the development and uses of extended forms of the grunwald - winstein equation was recently reviewed in more detail than is presented in this manuscript. in recent correlations, using the three forms of the grunwald - winstein equation (equations 13), evidence was found for a modest hi contribution in the solvolyses of n, n - diphenylcarbamoyl chloride even although the aromatic rings are not directly attached to the carbon at the reaction center. this gave support to the claim by liu, based on both experimental and theoretical considerations, that in these solvolyses positive charge is transferred to the aromatic rings through contributions from non - canonical resonance structures. if such an effect can be operative in the solvolyses of aromatic carbamoyl chlorides (ar2ncocl), it could also be present in the solvolyses of aromatic chloroformate esters (arococl), such as p - methoxyphenyl chloroformate (1) or phenyl chloroformate (2). while the h value of 0.35 0.19 was essentially negligible for 2, a much larger value of 0.85 0.15 was calculated for 1. however, it was pointed out that the 31 solvents used in the analyses of the specific rates of solvolysis of 1 included only two with a fluoroalcohol component. fluoroalcohols are extremely important, either as pure solvents or as a component of binary mixtures, in studies leading to analyses in terms of the grunwald - winstein equations [1315 ]. accordingly, it was suggested that a more detailed investigation of the solvolyses of 1 was desirable. in this contribution we have augmented the study of the specific rates of solvolyses of 1 by adding additional solvents, with almost all of them having an appreciable fluoroalcohol component. values for the specific rates of solvolyses at 25.0 c were previously available for 31 pure and binary solvents and 13 additional values, presented in table 1, have been determined. correlations with all 44 solvents are considerably improved, primarily due to an improved variety of solvents, as regards the relationship between nt and ycl values, and only secondarily due to an increase in the number of data points. of the binary mixtures with water, five involve an appreciable proportion of 2,2,2,-trifluoroethanol (tfe) and four an appreciable proportion of 1,1,1,3,3,3- hexafluoro-2-propanol (hfip). table 1 also includes the additional nt, ycl, and i values needed within the correlation analysis. a major goal of the analyses is to examine the extent of the improvement (if any) in going from application of equation 2 to application of equation 3, involving the absence or presence of the hi term. the results of the correlations are presented in table 2. for comparison, the results reported earlier for the solvolyses of 1 in 31 solvents and for the solvolyses of 2 in 49 solvents are both included in the table. also, the correlation of the specific rates of solvolysis of 2 is reported with restriction to exactly the same 44 solvents used in the correlation with 1 as the substrate. the correlation of the specific rates of solvolysis of 1 gave a good correlation in terms of equation 2 (figure 1), which showed virtually no improvement in the multiple correlation coefficient (0.981 to 0.982) on advancing to the application of equation 3. in particular, the h value of 0.29 0.18 was much lower than the 0.85 0.15 reported for 31 solvents and it was associated with a large (0.114) probability that the hi term was statistically insignificant. with the application of equation 2, the multiple correlation coefficient improves considerably (0.964 to 0.981) on inclusion of the 13 data points from table 1. the values in table 2 illustrate the need for a good selection of solvents for a meaningful application of extended forms of the grunwald - winstein equation. the observed and m values are within the range previously observed for other reactions at acyl carbon which are believed to proceed by an addition - elimination (association - dissociation) mechanism (shown for 1 in scheme 2 below), with the addition step rate - determining. for solvolyses of 2, the and m values change only slightly on reducing the number of solvents from 49 to 44, so as to correspond to the study with 1 as the substrate. the already lower value for h (0.35 0.19) becomes slightly lower (0.19 + 0.20) on limiting to 44 solvents. in comparing the specific rates of solvolyses of 1 and 2 in these 44 solvents, this observation suggests that a very good direct linear relationship should exist between their specific rates of solvolysis. it can be seen from figure 2 that this is indeed the case and a plot of log (k / ko) values for 1 against those for 2 gives an excellent linear plot with a correlation coefficient of 0.998, f - test value of 9302, slope of 0.991 + 0.010, and intercept of 0.075 + 0.015. the presently reported analyses strongly support the proposal of very similar mechanistic characteristics for the solvolyses of 1 and 2. they demonstrate that the previous indication of a meaningful hi contribution associated with the extended grunwald - winstein treatment of 1 but not of 2 was, as suspected at the time, an artifact, resulting from an inadequate selection of solvents being available when the specific rates of solvolysis of 1 were treated in terms of equation 3. with the addition of data for the solvolysis in several fluoroalcohol - containing solvents, the linear free energy relationship behavior becomes essentially identical to that previously observed for 2. solvents were purified and the kinetic runs carried out as described previously. a substrate concentration of approximately 0.03 the calculation of the specific rates of solvolysis (first - order rate coefficients) used the experimental infinity titers, at about ten half - lives, except for the runs in 97% hfip, when portions were added to equal volumes of water and allowed to stand for 4 weeks prior to the usual titration of developed acid, and for the runs in 97% tfe, when the conventional guggenheim treatment was modified so as to give the infinity titer, which was then used to calculate for each run a series of integrated rate coefficients. the specific rates and associated standard deviations, as presented in table 1, are obtained by averaging all of the values from, at least, duplicate runs.	a recent correlations analysis of the specific rates of solvolysis of p - methoxyphenyl chloroformate (1) in 31 solvents using the three - term grunwald - winstein equation led to a sensitivity (h) towards changes in the aromatic ring parameter (i) of 0.85 0.15. this value, suggesting an appreciable contribution from the hi term, is in contrast to the h value of 0.35 0.19 that was reported for the parent phenyl chloroformate (2). however, for 1, only two specific rate values were available for the important fluoroalcohol containing solvents. values are now reported for 13 additional solvents, 12 of which have appreciable fluoroalcohol content. with all 44 solvents considered, it is found that the solvolytic behavior indicated for 1 now parallels very closely that previously reported for 2.
hemoglobin (hb) was accidentally discovered by hnefeld in 1840 in samples of earthworm blood held under two glass slides. he occasionally found small plate - like crystals in desiccated swine or human blood samples [1, 2 ]. these crystals were later named as haemoglobin by hoppe - seyler in 1864. around 1870, claude bernard discovered its role as oxygen carrier [4, 5 ]. however the discovery of the detailed three - dimensional structure of hb by x - ray crystallography is credited to perutz. for which he was awarded the nobel prize (1962) in chemistry along with sir john kendrew. hb is an iron - containing oxygen - transport metalloprotein found majorly in the red blood cells (rbcs) of all vertebrates except in the fish family channichthyidae as well as in some invertebrates. the main function of hb in mammals is to transport oxygen (o2) from the lungs to various tissues of the body, but it is also known to interact with three other gases such as carbon dioxide (co2), carbon monoxide (co), and nitric oxide (no). hb is a tetramer made up of two -globin chains and two -globin chains which are encoded by two genes located on chromosomes 16 and 11, respectively. the -globin gene cluster is packaged into inactive heterochromatin in nonerythroid cells, whereas the hb- genes are imbedded in open chromatin conformations in all cell types. each of these chains has a heme moiety attached ; thus individual chains can transport oxygen. under physiological conditions it is involved in transport of oxygen from respiratory organs like lungs to various tissues through red blood cells (rbcs). the old belief that hb and its derived peptides are expressed only by the cells of the erythroid lineage has recently been challenged by many groups who have proved that hb expression is much more versatile than previously assumed. recent advances in hb research have shown its expression in a wide variety of nonerythroid cells ranging between macrophages, alveolar epithelial cells [12, 13 ], lungs, retinal pigment epithelial cells, mesangial cells of rat and human, hepatocytes, neuronal / glial cells, endometrial cells, and cervical cells. studies from our laboratory revealed that hb is expressed by epithelial cells from cervicovaginal tissue of rabbit. we have also proved that, apart from maintaining the oxygen homeostasis, hb and peptides derived from it play an important role in the protection of the vaginal epithelium by exhibiting antimicrobial properties. non erythroid expression of hb was first reported in murine macrophages by liu.. on treating with lps and interferon (ifn-4), they found the activation and expression of only hb- minor gene in the stimulated macrophage raw264.7 cells. the induction of -globin was shown from 3.5 hrs posttreatment and it lasted for at least 24 hrs. globin genes have been known to be activated in cell lines transformed by viruses [22, 23 ]. the authors thus speculated that maybe the hb expression in these macrophages was due to the virus transformation. to rule this out, they repeated their study in peritoneal macrophages collected from balb / c mice and confirmed the expression of hb- minor gene in the stimulated cells. the authors hypothesized that the transcriptional machinery involved in the expression of hb in the activated macrophages is different and may involve erythroid - specific transcription activators like erythroid krppel - like factor (eklf) or erythropoiesis - inducing transcription factor hypoxia inducible factor 1 (hif-1), which may play a role in the transcription of globin genes in activated macrophages in response to hypoxia- or oxidant - related stress. they further speculated that hb has a different functional role in nonerythroid cells by metabolizing no and giving protection against nitrosative stress. however, they did not find any relationship between the hb expression and no decay rate in both stimulated and nonstimulated cells. so they concluded that monomeric globin might function in facilitating oxygen transfer to sites where its extensive use is required or have an alternative enzymatic function or help as o2/no sensor. though the authors have shown hb expression, they have only found hb- minor gene and that too only in the stimulated macrophages. bhaskaran. reported significant expression of hb- and hb- genes in type ii alveolar epithelial cells (aecs) while characterizing differentially regulated genes in type i aecs and type ii aecs using dna microarray analysis. type ii aecs are in close proximity to the environmental oxygen and hence authors have proposed that hb might be involved in sensing the oxygen concentrations, facilitation of oxygen transport across air - blood barrier, and scavenging oxygen / nitrogen to reduce oxidative / nitrosative stress. extended these studies on human alveolar epithelial cells and demonstrated the presence of hb subunits in atii adenocarcinoma cells line (atii cells), clara - like adenocarcinoma cells (h441), and mouse alveolar epithelial cells (mle-15). however, they have not determined the presence of heme prosthetic group in these cells. they propose that individual globin chains might have functional roles in these cells and hb might be involved in pathologies associated with respiratory diseases. idiopathic pulmonary fibrosis (ipf) and chronic obstructive lung disease (copd) are the major lung associated pathologies. ishikawa. characterized the proteomes of lung tissues taken from the normal individuals and individuals affected with these two pathologies to identify biomarkers for better prognosis of these diseases. they found that hb levels are affected severely in the lung epithelium in patients suffering from ipf ; however the levels remained unaffected in individuals with copd. the reduced hb levels in ipf cases were due to modification of thiol group in cysteine residue (c105) of hb- monomer. this residue is involved in complex formation between two hb- monomers which is essential for optimal function. the modification of this residue in hb- due to oxidative stress in ipf individuals does not allow the formation of hb complexes. the authors have shown presence of hb in tetrameric form in bronchoalveolar lavage fluid (balf) and sputum and have shown that hb is secreted into these fluids from lung tissues. have shown enhanced hb- and hb- expression in atii cells and mle-15 cells after induction with hypoxia, where they have clearly determined the relation between oxidative stress and hb expression. in this study, authors have reported that regulation of hb synthesis in the atii cells occurs in similar fashion as it takes place in erythroid precursor cells. however, alveolar macrophages did not show expression of any of the genes involved in hematopoietic development. they have determined that hypoxia inducible factors (hifs) play essential role in hb expression in these cells. in this study these authors have proved that the transcription factor gata-1 is required for expression of hb genes in atii cells. long term knockdown of gata-1 with shrna construct showed up to 70% reduction in hb expression at both transcript and protein levels. the authors conclude that hifs play crucial role in maintaining the homeostasis in lungs where fluctuations in o2 concentrations may lead to detrimental effects. retinal epithelial cells, especially photoreceptors, require high amounts of oxygen which is supplied by choroidal circulation via diffusion. were intrigued about the proper functioning of the photoreceptors in cases of systemic hypoxia, where inner retinal neurons failed to work normally. they studied the proteome of retinal epithelial cells and showed that its major constituent is hb and it compensates their need for excess oxygen. the authors further proved that hb is secreted from retinal epithelial cells at the rate of 1.9 1.2 attomoles per cell per hour. electron microscope studies reveal that the secretion of hb in vivo is through basolateral membrane. these new findings would be useful to understand the oxygen transport to outer retina and pathogenesis of age related macular degradation. kidney is very sensitive to the oxygen changes due to oxygen diffusion between arterial and venous blood vessels. in a study to investigate pathogenesis of chronically hypoxic kidneys, nishi the significance of hb expression in these cells was determined by in vitro overexpression studies. primary rat mesangial cells were cultured and stimulated with hydrogen peroxide (h2o2) to induce chronic hypoxia, which resulted in significant increase of hb- and hb- transcripts. when these cells were transfected with vectors carrying hb- and hb- genes, overexpression of these proteins was observed. these transfected cells were then stimulated with 1000 m h2o2 to analyze if the hb expression has antioxidative properties. it was observed that intracellular generation of reactive oxygen species (ros) was inhibited significantly in the cells expressing excess of hb as determined by immunofluorescence studies. lactate dehydrogenase (ldh) assay showed increase in the viability of hb overexpressing cells compared to normal cells in the presence of 1000 m h2o2. liu. have studied the pathogenesis of nonalcoholic steatohepatitis (nash). while analyzing microarray data to identify differentially expressed genes in nash they found that free hb- and hb- subunits in serum were significantly increased from normal controls to steatosis and to nash. they hypothesized that oxidative stress upregulates hb expression and hb overexpression suppresses oxidative stress in hepg2 cells suggesting that maybe hb plays a protective role in nash. nash biopsies showed hb-1 and hb- protein expression in the cytoplasm of the hepatocytes and there was a 6.7-fold increase and a 7.9-fold increase in the relative copy numbers respectively. in hepg2, hb-1 transcript expression was about 17-fold higher than hb- transcript ; however they were unable to detect hb- protein in hepg2 cells. overexpressing hb- and hb- in hepg2 cells and treating them with h2o2 showed significant reduction of oxidative stress in h2o2 treated hb overexpressing cells, compared to h2o2 treated control cells. they speculated that increased hb in nash was due to the induction of erythropoiesis. but the absence of significant increase in the expression of erythrocyte specific genes such as delta aminolevulinate synthase 2 (alas2), glycophorin a (gypa), - and -spectrin (spta, sptb), and hematopoietic transcription factor gata1 raised the possibility of a different mechanism other than erythropoiesis. they suggested that transcription factor, nuclear factor- (erythroid - derived 2-) like 2 (nrf2), which is known to be a crucial mediator of oxidative stress, might be involved in the induction of hb expression in these cells. while studying gene expression profiles found the presence of - and -chain transcripts of hb in the subpopulation of dopamine (da) neurons, cortical and hippocampal astrocytes, and all mature oligodendrocytes of mouse brain. gene expression analysis of mn9d cells stably transfected with hb- and hb- showed that hb expression acts on the genes responsible for o2 homeostasis. so, they suggested that hb may act as an oxygen reservoir for anoxic and hypoxic conditions and control mitochondrial function. thus, hb may play a key role in the normal physiology of the brain and neurodegenerative diseases. further extended their study and showed that hb is present as 22 tetramer when overexpressed in dopaminergic mn9d cell line. they suggested that neuronal hb may retain some of the biochemical activities and biological functions of hb of erythroid lineage laying down the foundation for a better understanding of its role in brain physiology and in neurodegenerative diseases. they showed hb expression by immunostaining in only the cerebral cortex, hippocampus, striatum, and cerebellum of the mouse brain, but not in astrocytes and oligodendrocytes, which is contradictory to what biogioli group had reported. overexpressing hb in the e18 cortical neurons cultured from rat brain showed better oxygenation when subjected to hypoxia. therefore, they hypothesized that hypoxia induces production of growth factor epo which in turn stimulates hb expression in the mouse brain and thus hb may play a role in improving the oxygen situation. also, they were the first to report the presence of total hb along with its prosthetic group, heme. they showed the presence of heme indirectly by showing an 8.8-fold increase in the expression of alas which is a key enzyme in heme synthesis, after epo injection. recently, richter. showed hb-2 and hb- expression in the nigral, cortical, and striatal neurons from rat brains and striatal neurons in mice. immunostaining showed presence of hb- chains in the cortex, basal ganglia structures, hippocampus, and hypothalamus and hb- chains in cortical and thalamic dendrites, hippocampal cells, and substantia nigra pars reticulata of rat and human brain. systemic treatment of rats with low doses of rotenone (a mitochondrial toxin) showed downregulation of hb-2 and hb- expression in the dopaminergic neurons of the snc as well as in cortical pyramidal neurons and in gabaergic projection neurons of the striatum. treatment with rotenone has been shown to result in inhibition of the mitochondrial complex i and elevation of oxidative stress. heme is known to be a strong activator of globin - chain transcription whose synthesis takes place in the mitochondria. also, hb gene expression in erythroid cells is known to be dependent on the activity of the -subunit of hypoxia - inducible factor 1 (hif-1a). thus, they attributed the downregulation of hb expression to the reduced production of heme or inactivation of hif-1a. they also concluded that maybe hb plays a protective role against oxidative and nitrosative stress by binding to no, since no is the strongest known ligand of the ferrous heme iron of hb, with a higher affinity than oxygen. heme is known to be a strong activator of globin - chain transcription whose synthesis takes place in the mitochondria. also hb gene expression in erythroid cells is dependent on the activity of the -subunit of hif-1a. oxygen homeostasis in endometrium is crucial during earliest stages of embryo development ; fluctuations in the oxygen concentrations during 1st trimester may lead to miscarriages by disruptions of villous tissue. have reported expression of hb in endometrial epithelial cells at transcript as well as protein levels. these authors observed in this study that hb expression in endometrium is not regulated by hormones. immunolocalization studies with pan - hb antibody revealed that hb is expressed by epithelial cells as well as endothelial cells. stromal cells also showed presence of hb. in this study, the expression of cytoprotective enzyme, hemeoxygenase-1 (ho-1), was observed in the epithelial cells of endometrium. ho-1 is an enzyme that catalyzes degradation of heme moieties to biliverdin, iron, and co. heme is synthesized by all nucleated cells and its involvement in the metabolic reactions depends on the protein with which it binds as a prosthetic group. in case of hb, heme has iron molecule that binds with oxygen molecule and thus transports oxygen in the system. however excess of free heme moieties is toxic to the cells : they carry out various oxidative reactions and protein aggregations and also damage dna due to oxidations. the presence of hb and ho-1 enzyme in the endometrial tissue signifies the importance of these molecules in the tissue to regulate heme, iron, and oxygen concentrations. oxidative stress is caused by an imbalance between the formation of active oxygen metabolites and the rate at which they are scavenged, and it has been associated with the pathogenesis and complications of several diseases, including cancer. the overproduction or inadequate removal of ros such as h2o2, hydroxyl radicals, and superoxide anion is associated with cancer. immunohistochemistry studies showed diffused cytoplasmic staining. on carrying out microarray, they found increased expression of both hb-1 and hb- in the patient tissue sample as compared to the normal. however they did not find any increase in the expression of transcription factors for erythroid differentiation and erythroid cell markers or in the other hb genes such as hb-, hb-, hb-, hb-1, and hb-. they further confirmed these findings by qrt - pcr and immunostaining. expression of hb was also confirmed in the cancerous cell lines such as siha and caski as well as in human embryonic kidney 293 cells (hek293) by qrt - pcr. they found the expression of hb-1 to be 9.6-fold higher than that of hb-. hb expression was also found to be upregulated in the presence of h2o2 in hek293, siha, and caski cell lines. transient transfection of siha and caski cells overexpressing hb-1 and hb- showed reduced intracellular ros and also improved cell viability in the presence of h2o2. the authors thus hypothesized that hb is part of the endogenous antioxidant defense system and protects cells against oxidative damage in cervical cancer patients. recent studies from our laboratory revealed the expression of hb in cervicovaginal epithelial cells in rabbits. in one of the studies, we identified hb subunits in the antimicrobial fraction of rabbit vaginal lavage. further a peptide, rvfhbp, was designed from hb- subunit which has shown antimicrobial activity. the peptide has lps binding activity and thus neutralizes the inflammatory effects caused by lps. in order to evaluate the localization of hb in cervicovaginal tissue we used anti - rvfhbp antibodies where it was observed that hb- was localized in the glandular epithelial cells. this expression was further confirmed by commercially available antibodies against whole hb molecule where similar expression was observed (figure 1). preincubated mixture of hb antibody and 10 g hb was used as a specificity control, where no or negligible localization was observed. in our subsequent studies, three cell lines derived from cervicovaginal tissue of human and immortalized with hpv e6e7 were used. we observed the expression of both subunits hb- and hb- in these cells using commercially available antibodies against these proteins (figure 2). the expression of hb- and hb- was also observed at transcript level using gene specific primers. our preliminary results indicate that the expression of hb increases 2 - 3-fold when the cells are treated with physiological concentration (20 m) of hydrogen peroxide which is found in human vaginal fluid. the expression also increased on treatment with lps (10 g). at some instances spontaneous oxidation of ferrous heme ion (fe) to ferric iron (fe) occurs after attachment of oxygen leading to generation of superoxide radicals (o2) and h2o2, which exerts oxidative stress to the host. antioxidative enzymes like catalase and superoxide dismutase produced by rbcs carry out breakdown of superoxide radicals and h2o2 and also reduce fe to fe which can bind again to oxygen atom. although approximately 13% of total hb remains in oxidized form and it is known as methemoglobin (methb), cell - free hb is always in oxidized form due to reaction of hb with environmental oxygen. h2o2 is toxic to the cells and recently it has been shown that hb also possesses antioxidative pseudoperoxidase activity. hb in the ferrous state reacts with h2o2 resulting in the formation of oxoferryl hb (hb - fe = o). this protein - oxygen complex reacts further with h2o2 and leads to autooxidation of hb leading to formation of ferric hb or methemoglobin. this reaction leads to extensive cross - linking between the globin chains and oxidation of cysteine residues in globin protein, which further leads to heme degradation. this reaction can neutralize significant amounts of reactive oxygen species and protect cells by the adverse effects of h2o2. moreover, heme liberated during these reactions is reduced to biliverdin, iron, and co, protecting the cells from heme toxicity. lower female reproductive tract (frt) functions to protect inner vaginal mucosal epithelial structures from microorganisms. cellular oxidative stress leading to acute and chronic inflammation contributes to the bacterial and viral infections. cervicovaginal cells are constantly in contact with h2o2 secreted by various lactobacilli, inhabiting vagina as commensals. hb, as mentioned earlier, may thus be involved in reducing the oxidative stress caused by various stimuli. also, at the vaginal mucosal surface, where the host physically interacts with a nonsterile environment, the ability to detect and contain invading pathogens is regularly tested. escherichia coli which are gram - negative bacteria are one of the major causative agents for infections in vaginal cells. a major constituent of their outer membrane is lipopolysaccharide (lps), which is a potent stimulator of the immune system. lps molecules shed from the bacterial surface contribute to the pathology of gram - negative bacteria sepsis. during gram - negative sepsis lps, an endotoxin produced by gram - negative bacteria, stimulates various proinflammatory cytokines and mediators. as mentioned earlier, hb is an lps binding protein and the structure and biological activity of hb are altered in the presence of lps. lps can oxidize hb and convert methb, which facilitates iron release and generation of free radicles, a condition known to contribute to hb related antibacterial activity. recently it has also been shown that hb can synergize with lps and lta during macrophage activation and enhance innate immune responses by inducing expression of cytokines and chemokines [42, 43 ]. we hypothesize that the expression of hb in these cells increases due to inflammation and might be required to neutralize the cytotoxic effects of h2o2 and lps. our preliminary observations support this hypothesis and further studies to corroborate these results are ongoing. it is known that the expression of the hb- and hb- genes is balanced and coordinated. that is, both genes are expressed at comparable levels in erythrocytes and both are reportedly silenced in nonerythroid cells [9, 44 ]. then why are the hb genes expressed in nonerythroid cells and why is there a difference between the expression level of and genes ? some studies have reported increase in expression of hb- as compared to hb- [12, 19, 20 ] while others have shown the expression levels to be similar. in contrast to these studies, liu. have shown an increase in hb- minor and complete absence of hb- subunit in the stimulated macrophages. for example, hemoglobin expression was observed to be upregulated in response to oxidative stress and is believed to alleviate it [16, 17, 20 ]. it is established that erythroid hb plays an important role in oxygen transfer and transport. similarly, in some nonerythroid cells, hb expression was found to be upregulated in response to hypoxia [15, 24, 26 ]. it appears that, to compensate for the increased oxygen demand, hb is expressed in these cells. therefore, expression of hb genes in nonerythroid cells under de novo and specific conditions needs to be investigated in detail. cell - free hb molecules have intrinsic toxicity to tissues since harmful ros is produced during autoxidation of oxyhb to methb. maybe the amount of hb produced in these nonerythrocytes is way below the amount present in rbcs and, thus, inefficient to cause cytotoxicity to the host cells. as noted above, expression of hb- and hb- various studies have analyzed the transcription factors involved in regulating the expression of these genes in nonerythrocytes. gata-1 is an important transcription factor ; it plays a major role in switching fetal hemoglobin to adult hemoglobin during erythropoiesis. some studies have shown its expression in cells such as neural, alveolar, cervical, hepatocytes [17, 18, 20, 24 ], while richter. apart from gata-1, transcription factors like nfe2, klf1/eklf, hif1-, and so forth are expressed de novo or after stimulation. this raises the question whether there are different regulatory mechanisms acting in different cell types. hence, it is important to study the interplay of various transcription factors depending upon their specific functions in different nonerythroid cells. it would also be interesting to understand whether hb expression is regulated by environmental stress and if its regulation is mediated by different transcription factors depending on the external stimuli. while showing the expression of hb at protein and transcript level, most authors have shown the presence of only the globin chains and not the prosthetic group, heme and/or complete hb tetramer. they have shown the presence of heme through an indirect observation : increased transcription of alas, a key enzyme in heme synthesis. however, this may not necessarily mean that heme is associated with globin chains since heme is synthesized in all human nucleated cells (it is a component of myoglobin, cytochrome, catalase, etc.). since it is now known that the expression of both the globins is not comparable in nonerythrocytes, hb or its constituents may have different functional significance wherein only the globin monomers, not the entire hb tetramer, are required. further studies to elucidate the complete structure of hb expressed in nonerythroid cells and whether it varies from the hb found in the erythroid cells need further confirmation. till date, hb expression has been found in different cells ranging from macrophages to alveolar, lungs, hepatocytes, mesangial, retinocytes, endometrium, cervix, vaginal, and neuronal cells. maybe with further research we will see that hb has more unique functions and is ubiquitously expressed in various other cell types of our body. hence, further studies are required to elucidate the exact mechanism of hb expression and its functions in nonerythroid cells.	hemoglobin (hb) is a major protein involved in transport of oxygen (o2). red blood cells (rbcs) contain maximum amount of hb and because of their unique structure and plasticity they transport o2 to various tissues of the body at an optimal concentration. recently, it has been reported that, apart from rbcs, hb is also expressed by nonerythroid cells such as epithelial cells of different origin. the cells expressing hb are from the tissues where maintenance of o2 homeostasis is of paramount importance. hb expression has been observed in the epithelial cells from human tissues including lungs, neurons, retina, and endometrium. our group has recently demonstrated that hb is expressed by the cervicovaginal epithelial cells. we further showed that, apart from maintaining o2 homeostasis, hb and the peptides derived from it play an indispensable role in the protection of vaginal epithelium by exhibiting antimicrobial activity. in this review, we discuss the significance of hb expression in vaginal epithelial cells and its role in the recognition of pathogens thereby reducing the risk and/or severity of inflammation and/or infections and the possible mechanism by which hb exhibits antimicrobial and antioxidative functions.
several cases have been reported in the medical literature, and the diagnostic and therapeutic approaches must be applied in a multi - faceted and differentiated manner. we describe our diagnostic procedure with laparoscopic removal of the appendix due to fixation of the object in the right lower abdomen. the ingestion of foreign bodies is an old medical problem, although its incidence has decreased drastically due to changes in lifestyles. today, it is rather the unusual cases and intentional ingestion that are in the forefront. initial endoscopic treatment attempts are followed by the wait - and - see attitude in hopes of spontaneous passage that can be monitored via radiological methods. if the object does not pass naturally and is localized in the colon, what remains as a treatment option is endoscopy followed by surgery that can be performed in a minimally invasive manner. foreign bodies are ingested either accidentally or during autoaggressive behavior by patients suffering from psychiatric illnesses. the first reports go back to the early 1700s. at that time, not only was dressmaking / tailoring purely manual work leading to the swallowing of sewing needles often held between the lips, but eating of shot game was also still widespread. up to 1971, a total of 225 cases of foreign bodies in the appendix had been documented. one interesting series stems from reddy, who examined 62 inuit, who often showed ingestion of lead shot due to their natural way of life still practiced today and the associated tradition of hunting. the cases collected by reddy show deposits of lead shot in the appendix, but with no complications during follow - ups after 2 to 13 years. in addition to pediatric ingestions, those involving adults occur from time to time. in small children, especially in the case of benign objects like coins, spontaneous passage can be expected, not necessitating an invasive intervention ; however, there are those cases requiring an interventional procedure. we report the case of a 54-year - old female patient who accidentally swallowed a sewing needle. after an initial cervical sensation of a foreign body, treated by the patient by drinking liquids, the patient was completely free of symptoms upon admission. she had been referred by her general practitioner for monitoring. the initial abdominal x - ray (figure 1) already showed the needle projecting into the right lower abdomen. conventional ap x - ray of the abdomen showing the needle in the right lower quadrant. after repeated x - rays of the abdomen without moving the needle, a computed tomographic (ct) scan (figure 2) of the abdomen was performed, where the needle seemed to be localized in front of bauhin 's valve. this was followed by an orthograde intestinal irrigation intended to mobilize the needle in the direction of the rectum, and also in preparation for endoscopic retrieval. the colonoscopy in conjunction with ileoscopy resulted neither in retrieval nor in a visualization of the object. ct scan of the abdomen showing the needle in the area of the cecum or bauhin 's valve. with the patient under general anesthesia in a supine position, laparoscopy and intraoperative simultaneous manipulation of the intestine, the localization matched to the appendix. during mobilization of the appendix base, the perforated needle showed up in the area of the small mesentery (figure 3). the postoperative course was normal, and the patient was discharged 3 days after the surgical procedure in excellent medical condition. the histological examination showed a 4 cm long and 0.8 cm wide appendix with a sewing needle in situ. the ingestion of foreign bodies is a diagnosis first found in literature in 1735, but undoubtedly occurs to this day in the form of accidental or intentional pathology, and not only in populations with unusual lifestyles, such as the inuit. the incidence has, without a doubt, drastically decreased due to a change in lifestyle, because accidental ingestion of lead shot in game, for instance, only happens rarely today. in our own patient cohort, we also found the random case of an accidental lead shot ingestion (figure 4). balch, in 1971, determined an incidence of 0.005% in 13,000 appendectomies compared with collins who, in 1963, described an incidence of 3% in his examination of 71,000 appendectomy specimens, but includes natural foreign bodies, such as gall stones, in the appendix. independent of the incidence, there is the question of the diagnostic and therapeutic approach. first, there is the consciousness or lack thereof of the fact that an ingestion has occurred. in the case of an ingestion of course, the size of the passage is a limitation to the ingestion of the object, because objects that are too big either get stuck at one of the narrow sections of the esophagus or at the pylorus. however, if the size and condition of the object are known and passage is possible, the question of the next approach arises. among the objects, in addition to the needles and lead shot, there are things such a tongue studs or pieces of tooth replacement material. the cautious approach of pediatricians who even recommend dispensing with a radiological passage if there are no clinical irregularities can surely only be implemented in the case of benign objects such as the observed coins. if potentially dangerous objects are involved, and subject to their shape and condition, a diagnostically observant approach is indicated, 95% of all ingested objects pass through the intestine without incidents. the time of passage depends on the shape and weight of the object so that as we also observed a needle can reach the cecum within hours. in the cecum, there now exists the danger of the foreign body sinking due to its own relative weight compared with the stool in the surrounding small intestine and the location in the appendix lumen. nevertheless, the location in front of or inside of the appendix must not necessarily result in a clinical symptom, as reddy observes. of course, pointed, thin objects that can lead to a perforation caused by the movement of the appendix and the cecum are dangerous. once an object is stuck in the appendix, the risk of becoming symptomatic is 93% in case of sharp foreign bodies with inflammation in 88% and perforation in 70%. even round, the patho - physiological explanation is not only the acute perforation due to sharpness of ingested bodies but also the fetal coating of objects with obstruction of the appendix lumen due to chronic inflammation with later decubital perforation. this pathomechanism of a one - way street with the danger of perforation does not only exist in the appendix, however, but also if a meckel 's diverticulum is present. if the object no longer moves and projects into the right lower abdomen or another rigid location in the abdomen, the decision regarding the next approach is difficult, especially in clinically unremarkable patients. neither a ct scan nor other procedures can completely preclude ambiguities, especially because mobility is not out of the question after the examination. what remains as a diagnostic and possibly therapeutic alternative is a colonos - copy, in the course of which even nails can be retrieved from the appendix. if the result of this procedure remains negative, the next approach must be weighed in close consultation with the patient. if it is clinically unre - markable, a wait - and - see approach is possible if this is what the patient wants. every clinical change, however, must be an indication for surgical treatment, which is the last remaining option. in pediatric surgery, sinha first and foremost recommends surgical treatment in the case of a needle ingestion, but only in isolated cases. hadi, on the other hand, describes surgery as the procedure of choice if the foreign object is located in the right lower abdomen, so that a position in the appendix must be assumed. the laparoscopic procedure has been described and has been supplemented by ekingen with the use of fluoroscopy guided laparoscopy such as we used in our case. here, the disadvantage of the lack of a tactile examination of the intestine is offset by the visual evidence of the object on the 2-dimensional x - ray. if, however, even this approach does not succeed in locating the object, an expansion of the intervention in the sense of a laparotomy is indicated for the safety of the patient and the prevention of unnecessary resections. the ingestion of foreign bodies is an old medical problem, although its incidence has no doubt decreased drastically due to a change in lifestyles, but the problem is still present and must be considered as a differential diagnosis. also incidental, asymptomatic findings of lead shot in the appendix are documentable especially in hunters and their family. today, it is rather the unusual cases and intentional ingestion that are in the forefront. initial endoscopic treatment attempts are followed by the wait - andsee attitude hoping for spontaneous passage that can be monitored via radiological methods. if the object does not pass naturally and is localized in the colon, what remains as a treatment option is endoscopy followed by surgery that can be performed in a minimally invasive manner. a longer wait and see technique will bring no better outcome to the patient 's health when an object is stuck in the area of the appendix. an initial laparoscopic procedure can avoid further problems due to perforation in common with peritonitis. future limitations will be in the form of industrial production of modern materials, which can escape radiological visualization despite the fact that they may be stronger than steel. then we will again be faced with diagnostic difficulties and regress to the 18th century when the diagnosis could only be made intraoperatively.	background : ingestion of foreign bodies is an old medical problem of decreasing occurrence. several cases have been reported in the medical literature, and the diagnostic and therapeutic approaches must be applied in a multi - faceted and differentiated manner.case report : our case concerns a 54-year - old female with accidental swallowing of a needle. we describe our diagnostic procedure with laparoscopic removal of the appendix due to fixation of the object in the right lower abdomen.discussion:the ingestion of foreign bodies is an old medical problem, although its incidence has decreased drastically due to changes in lifestyles. today, it is rather the unusual cases and intentional ingestion that are in the forefront. initial endoscopic treatment attempts are followed by the wait - and - see attitude in hopes of spontaneous passage that can be monitored via radiological methods. if the object does not pass naturally and is localized in the colon, what remains as a treatment option is endoscopy followed by surgery that can be performed in a minimally invasive manner.
escherichia coli o157:h7 is an enterohemorrhagic strain of e. coli that produces a powerful shiga - like toxin. it is capable of causing bloody stools, hemorrhagic colitis, and hemolytic uremic syndrome. most outbreaks have been associated with the consumption of contaminated, undercooked, bovine food products. there also have been reports of e. coli o157:h7 outbreaks associated with both drinking and recreational water [37 ]. e. coli o157:h7 is ubiquitous on farms where healthy cattle and sheep harbor the pathogen in their gastrointestinal tracts. as a consequence, farm animal manure is a source for spreading e. coli o157:h7 into the environment and potentially to the human food chain. one of the most common modes by which e. coli o157:h7 is introduced onto food crops is through contaminated irrigation water. in addition, the propagation of this pathogen through the environment has been linked to runoff contaminated with bovine manure or by use as soil amendment. the contamination of surface and ground water in rural areas of the united states is becoming increasingly more common as a result of concentrated animal feeding operations. escherichia coli o157:h7 can survive in varying habitats under a wide range of conditions. in the environment, cells are exposed to rapidly changing conditions such as changes in ph, nutrient availability, temperature, oxidative stress, and osmotic challenge. e. coli o157:h7 pollution of water and soil is dependent on the ability of this pathogen to adapt to these changes. however, there is limited information concerning the survival of e. coli o157:h7 in soil and water as growth of bacteria, if any, in these environments is not well understood or documented. e. coli o157:h7 may respond to adverse conditions in the environment by expressing various stress response genes that enable survival. the master regulator of the general stress response is an alternative sigma factor (rpos). this sigma factor may be induced in response to stresses such as weak acids, starvation, high osmolarity, and high or low temperature. there is evidence that stress responses may enable survival under more severe conditions, increase pathogenicity, and enhance resistance to secondary stresses. in other words, when e. coli cells are stressed, they become harder to kill and are more resistant to starvation and toxic chemicals typically used in distribution systems such as chlorine. this has significant public health implications because e. coli o157:h7 could develop a disinfectant - resistant phenotype during transport to water treatment plants. therefore, understanding the effects of stress on gene expression in response to altered environmental conditions may be crucial in understanding the survival of this organism as it moves from one environment to another. limited work has been conducted to investigate e. coli o157:h7 survival and functional genomics in the environment. further research is needed to understand the mechanisms that enable e. coli o157:h7 to survive in such a wide variety of environments. this study compared genetic expression profiles of escherichia coli o157:h7 under two environmental conditions (soil and natural water) to expression in growth media using dna microarrays. in addition, we investigated the long - term survival of e. coli o157:h7 in microcosms simulating these environments. soil and water were collected from newby ditch in june of 2006 within 24 hours of a rainfall event (1.93 cm or 0.76 inches). newby ditch is located within the mississinewa watershed on the tipton till plain of east central indiana (usa). environmental samples were placed in sterile bottles and stored in a cooler with ice packs for transport to the lab. the samples were processed within 24 hours for use as soil and water microcosms according to the methods described below. e. coli o157:h7 strain atcc 35150 was used to investigate survival and differences in gene expression under two different environmental conditions compared to luria broth (lb) (bd, rockville, md). for long - term storage, the culture was maintained in 10% glycerol at 50c. in the short term, cells were cultured on nutrient agar (bd) slants at 4c. the e. coli o157:h7 experiment cultures were prepared by transferring a loopful of a slant culture into a 100 ml flask containing 30 ml of lb. this culture was used to inoculate the three treatment conditions : 30 ml lb control, 90 ml sterile stream water microcosms, and 100-g sterile soil microcosms. the 30 ml lb control (100 ml flask) was inoculated with 1 ml of the culture and incubated at 15c for 48 hours with shaking at 60 rpm. the remaining cells were harvested by centrifugation at 10,000 g for 10 minutes at 4c (sorvall rc-5b), washed twice with sterile deionized water, and resuspended in 10 ml of sterile stream water or 10 ml of sterile deionized water. the control and water experiments were performed using ten replicates each, four for microarray analysis and six to monitor survival with replacement. the soil treatment was prepared with 34 replicates, four for microarray analysis and 30 to monitor survival without replacement. the water microcosms were incubated at 15c with shaking at 60 rpm, and the soil microcosms were incubated at 15c without shaking. four microcosms, each of soil and water, were removed after 14 days for dna microarray analysis. four flasks of the 15c lb control were removed after 48 hours for dna microarray analysis. aliquots of water (90 ml) were placed into 250 ml sterile bottles and autoclaved at 121c at 15 psi for 15 minutes. following sterilization, the water microcosms were stored at 4c until inoculation. following inoculation with 8.8 10 cfu / ml of e. coli o157:h7 atcc 35150 the soil used in this study was a fox silt loam with a ph of 6.95. it is a well - drained soil with a moderate available water capacity, medium runoff, and poor filtering capacity. soil ph was determined by placing 20 g of soil into a 50 ml beaker, adding 20 ml of deionized water, and stirring for 30 minutes. this suspension was allowed to settle for an hour, and ph was measured with a ph meter. soil moisture content was determined using the gravimetric method ; soil was weighed, oven dried at 105c, and then reweighed until the sample weight was constant. the soil moisture content was determined to be 0.323 (32.3%), which is a slightly moist soil. large rocks and debris were removed from the dried soil, and 100-g aliquots were placed in 250 ml glass bottles. the soil microcosms were autoclaved at 121c at 15 psi for 15 minutes following sterilization, the soil was returned to the drying oven for 24 hours at 105c to remove any residual moisture. sterile soil, as checked by plate counting, was stored at room temperature prior to inoculation. soil moisture content was adjusted to field conditions by adding 32.3 ml of sterile deionized water. following inoculation with 8.8 10 cfu / ml of e. coli o157:h7 atcc 35150 the initial (zero - time postinoculation) concentration e. coli o157:h7 was determined for each condition prior to incubation. e. coli o157:h7 concentrations were determined for each condition by using the spread plate method. for extraction of bacteria from soil, 100 ml 0.1% polyethylene glycol (peg) was added to 100 g of soil. this suspension was shaken (150 rpm) for 15 minutes at 15c and then allowed to settle for five minutes. the supernatant from this suspension was centrifuged for ten minutes (10,000 g, 4c), and the resulting supernatant was used to enumerate the cells. viable cell counts were performed in duplicate by serial dilution in 0.9% sterile saline and spread plate culturing 0.1 ml onto r2a agar (bd) plates. the plates were incubated at 37c for 48 hours. following incubation, plates with colony counts between 25 and 250 the average number of colonies was divided by the volume or mass of the original solution to estimate the number of cfu / ml and cfu / g, respectively. total rna was isolated using the fastrna pro soil - direct kit (qbiogene, inc., ca) with minor modifications (described below) to improve quality and yield. the kit - supplied lysing matrix e tubes were placed at 10c for 2 days prior to rna extraction to minimize heating and rna degradation. one gram of the sample was placed into the kit - supplied lysing matrix e tubes for lysis. sample lysis was performed using a mini - beadbeater-1 instrument (biospec products, inc., bartlesville, ok) for 80 seconds at a speed setting of 48 (maximum speed). rna was centrifuged through the kit - supplied quick - clean spin filters to remove residual inhibitors following extraction and stored in 100 l of depc - h20 at 50c. rna quality was determined by 1.0% (w / v) agarose gel electrophoresis and by spectrophotometric analysis (od260/od280) using a thermo scientific spectronic genesys 5 spectrophotometer. howard edenberg 's laboratory at the indiana university school of medicine center for medical genomics where the microarray analysis was performed. dna microarrays were used to evaluate the genetic expression profiles of e. coli o157:h7 atcc 35150 maintained under three environmental conditions. the microarray system used for e. coli was the genechip e. coli genome 2.0 array (affymetrix, inc., the microarray analysis was performed with four biologically - independent replicates (with respect to e. coli growth, rna isolation, sample preparation, and array hybridization) for each treatment condition. the standard protocol for prokaryotic sample and array processing recommended by affymetrix in their genechip expression analysis technical manual (affymetrix, santa clara, ca) was used. cdna was synthesized using a t7 promoter - dt24 oligonucleotide as a primer with the invitrogen life technologies superscrip choice system. following second - strand cdna synthesis and incubation with t4 dna polymerase, the products were purified using the affymetrix cleanup module. biotinylated crna was made using the affymetrix ivt kit. the crna was purified using the qiagen rneasy column, quantitated, and then fragmented by incubation at high temperature with magnesium. biotinylated crna was then added to a hybridization solution and hybridized to the genechip after adding control oligonucleotides at 45c for 17 hours with constant rotation. the hybridization mixture was removed, and the genechip was washed and stained with phycoerythrin - labeled streptavidin using the affymetrix fluidics station. the genechip was washed again, incubated with biotinylated antistreptavidin, and then restained with phycoerythrin - labeled streptavidin to amplify the signals. the microarray expression data were generated using affymetrix gcos software. the affymetrix microarray suite algorithm was used to analyze the hybridization intensity data from genechip expression probe arrays and to calculate a set of metrics to describe probe set performance. the average intensity of each array was normalized by global scaling to a target intensity of 1000. an average expression value for each treatment group was calculated via geometric mean because it is better applied to data with large fluctuations. two treatments were compared by determining the log 2 ratio of gene expression for the corresponding averaged intensities for each treatment. fold change was calculated from log 2 data such that values for induction range from 1 to 100 while values for repression are restricted to the space between 0 and 1. for example, a value of 2 indicates a 2-fold upregulation while a value of 0.5 indicates a 2-fold downregulation for a gene comparing the environmental condition to the luria broth. a t - test on the log 2 transformed data was performed using microsoft excel. significant gene selection was performed using the microsoft excel filter function to select for genes with greater than or equal to a 2-fold up- or downregulation and a p - value less than.05. functions of significantly expressed genes were determined using the affymetrixs netaffx analysis center (http://www.affymetrix.com/analysis/netaffx/index.affx) and ecocyc (http://ecocyc.org/) database. soil microcosms were inoculated with 10 ml of 8.8 10 cfu / g of e. coli o157:h7 strain atcc 35150. immediately after inoculation, the average preincubation concentration of e. coli o157:h7 was 1.8 10 cfu / g. following incubation at 15c, survival was monitored on a regular basis for 179 days. no significant decrease in the e. coli o157:h7 concentration was observed during the first 30 days of incubation (figure 1). the last measurement was taken on day 179, and the average concentration of cells was 7.7 10 cfu / g (data not shown). sterile water was inoculated with 10 ml of 8.8 10 cfu / ml of e. coli o157:h7 strain atcc 35150. on day 0, the mean concentration of e. coli o157:h7 was 1.1 10 cfu / ml. the microcosms were incubated at 15c with gentle shaking at 60 rpm, and survival was monitored for 234 days. a decrease in the e. coli o157:h7 concentration below the postinoculation concentration the final measurement was taken on day 234 (nearly 8 months following inoculation), and the mean concentration of cells was 2.98 10 cfu / ml (data not shown). the genomic expression profiles of e. coli o157:h7 atcc 35150 incubated in sterile soil, water, and lb were evaluated. the log expression ratios of the e. coli o157:h7 genome for cells grown in lb at 15c for 48 hours with shaking at 60 rpm versus fourteen - day incubation in sterile stream water at 15c are illustrated in figure 3. the whole genome analysis indicated that 705 genes were more highly expressed in lb (plotted with a negative value) while 751 genes were more highly expressed in sterile stream water (plotted with a positive value) (figure 3). figure 4 shows the log expression ratios of the e. coli o157:h7 genome for cells grown in lb at 15c for 48 hours versus fourteen - day incubation in sterile soil at 15c. the analysis of the whole genome indicated that 2,664 genes were more highly expressed in lb (plotted with a negative value) while 1,823 genes were more highly expressed in sterile soil (plotted with a positive value). an analysis of gene ratios with significant expression levels (2 folds and p - value <.05) revealed that the majority of genes did not differ significantly between conditions. this was especially true of the cells grown in lb compared with the cells incubated in sterile stream water ; 26 genes were more significantly expressed in lb compared to 12 genes in cells incubated in sterile stream water (table 1). the comparison of cells incubated in sterile soil compared to cells grown in lb yielded more differences in expression ; 89 genes were expressed at significantly higher levels in lb while 308 genes were more highly expressed in sterile soil (table 2). a functional group analysis was performed for significantly expressed genes in lb versus sterile soil (table 2) and lb versus sterile stream water (table 1). functional group analysis of lb versus sterile soil revealed that cells incubated in sterile soil expressed more genes for antibiotic resistance, biosynthesis, dna replication / repair and restriction / modification, metabolism, pathogenesis and virulence, phages, transposons, and plasmids, ribosomal proteins, stress response, transcription, rna processing, and degradation, translation and posttranslational modification, and transport and binding proteins (table 2). functional group analysis of lb versus sterile stream water revealed that cells incubated in sterile stream water expressed more genes of unknown function while cells grown in lb expressed more genes for ribosomal proteins, signaling and motility, stress response, transcription, rna processing, and degradation, translation and posttranslational modification, and transport and binding proteins (table 1). the nature of these differences in genomic expression is described in detail in tables 3 and 4. for example, seven of the genes for amino acid biosynthesis were expressed at significantly higher levels in soil than in lb (table 3). there were no differences in expression of these amino acid biosynthesis genes between cells grown in lb and cells incubated in sterile natural water (table 4). of the 55 genes that are known to encode ribosomal proteins, 45 were expressed at significantly higher levels in soil compared to luria broth (table 2). only one ribosomal protein gene (rpmc) was significantly expressed in cells grown in lb compared to water (table 1). the genes responsible for the stress response include those that function in temperature shock, acid tolerance, the sos response, and osmotic challenge. eighteen stress response genes were significantly expressed in cells incubated in sterile soil compared to lb (table 2). on the other hand, three stress response genes were more significantly expressed in lb compared to cells incubated in sterile natural water (table 1). the rpos gene is induced in response to entry into stationary phase and also by stresses such as weak acids, starvation, osmotic challenge, and temperature changes. the expression of rpos was significantly elevated in soil (2.68-fold induction) (table 3). the rpoh heat shock sigma factor 32 (), which regulates the heat shock response, was more highly expressed in soil compared to lb (3.19-fold induction) (table 3). cells grown in soil expressed heat shock genes dnak and htpx at significantly greater levels (table 3). in addition, table 3 shows that rsea, an antisigma regulator of the rpoe envelope heat stress system, was induced in cells incubated in soil (3.29-fold induction). numerous cold shock genes were significantly expressed in cells incubated in soil compared to cells grown in lb : cspa, cspe, cspg, ymce, dead, yfia (table 3). only one cold shock gene (cspc) was expressed at significantly lower levels in cells incubated in sterile water compared to cells grown in lb (0.48-fold repression) (table 4). two genes involved in the sos response were significantly expressed in cells grown in soil compared to lb : reca and sula. the osmotically inducible gene osmb was expressed at significantly higher levels in cells incubated in soil (4.77-fold induction). seven genes that aid in pathogenesis and virulence were significantly expressed in cells incubated in soil compared to those grown in lb (table 2). in particular, the vacb gene was expressed (2.26-fold induction) (table 3). tola, a gene involved in colicin production, was significantly expressed in cells incubated in soil compared to cells grown in lb (2.26-fold induction) (table 3). also, the soxs gene was more highly expressed in cells incubated in sterile soil microcosms (2.44-fold induction) (table 3). finally, three antibiotic resistance genes (marr, mara, and marb) were expressed at significantly higher levels in cells incubated in sterile soil microcosms compared to lb (table 2). e. coli o157:h7 may encounter conditions that are less than optimal for growth in soil and water and must adapt to these conditions in order to survive. various stress response mechanisms allow this pathogen to adapt to sublethal environmental conditions. extended exposure to these stresses enables e. coli o157:h7 to survive under more severe conditions, increases its pathogenesis, and enhances its resistance to chemicals typically used in water distribution systems. this has significant public health implications because e. coli o157:h7 could develop a disinfectant - resistant phenotype during transport to water treatment plants. therefore, this study investigated the survival and genetic expression profiles of e. coli o157:h7 in sterile soil and sterile natural water. our results indicate that e. coli o157:h7 can persist for long periods of time in sterile soil and sterile stream water. in addition, we found that e. coli o157:h7 exhibits differential gene expression profiles in sterile soil and sterile stream water compared to cells freshly grown in lb. this survival does not account for the possible effects of competition with other bacteria or interactions with predatory protozoa. under natural conditions, where predators and other bacteria are present, it is also possible that the environmental persistence of e. coli o157:h7 cells initially grown in fecal extracts could be different. microarray analysis revealed that cells incubated in sterile soil for 14 days remain very active. in fact, 308 genes were found to be more highly expressed in these cells compared to cells grown in lb. a functional group analysis revealed that the majority of these genes were involved in amino acid biosynthesis, dna replication and repair, pathogenesis and virulence, the stress response, ribosomal proteins, antibiotic resistance, transcription, and translation. on the other hand, microarray analysis of cells placed in sterile stream water for 14 days typically, faster - growing cells synthesize proteins more rapidly and contain more ribosomes [19, 20 ]. these researchers found that 42 ribosomal protein genes were expressed at significantly higher levels in cells grown under high nutrient conditions. the present study, on the other hand, revealed that 45 ribosomal protein genes were more highly expressed in cells incubated in sterile soil compared to cells grown in lb. the exception to growth - rate - dependent regulation of ribosome number occurs at very low growth rates. when e. coli cells adjust to a slow growth rate from a fast one, rna accumulation is attenuated for a short time until the rna content is reduced to that characteristic of cells grown at the slower rate. it is thought that the same mechanism that functions during amino acid starvation also functions during growth rate transitions. in fact, the continued accumulation of rna in cells under partial amino acid starvation has been shown to be accompanied by a continued synthesis in ribosomal proteins. this could account for the higher expression of genes for ribosomal proteins observed in the present study as genes encoding the enzymes needed for amino acid biosynthesis were more highly expressed in cells incubated in sterile soil microcosms. in e. coli, there are 97 known genes responsible for encoding the enzymes needed for amino acid biosynthesis. previous results indicate that these genes are induced for growth in low nutrient environments as appears to be the case in the present study. growth conditions that lead to a decreased rate of ribosome synthesis typically result in an excess of ribosomal proteins, and their transcript levels are higher in faster growing cells. the regulatory mechanism that controls the general stress response is the rpos sigma factor () and is encoded by the rpos gene. this gene, which controls the expression of more than 50 proteins, is induced in response to entry into stationary phase and also by stresses such as weak acids, starvation, osmotic challenge, and temperature changes. the expression of rpos in cells in sterile soil microcosms was 2.68-fold higher when compared to cells cultured in luria broth. in addition, the expression of 18 genes involved in the stress response was more highly expressed in cells from soil. these genes regulate cellular response to cold shock, heat shock, acid tolerance, osmotic challenge, and the sos response. this indicates that the soil environment stressed these cells, and they turned on genes to cope with sublethal environmental conditions. the heat shock response is a protective mechanism to cope with heat - induced damage to proteins ; however, there is evidence suggesting that these genes are also induced in response to acidic conditions, sos - inducing treatments, and sublethal exposure to chlorine. most heat shock proteins act as molecular chaperones that bind to and stabilize unfolded proteins and promote protein refolding and proper assembly. the dnak gene product has been shown to regulate other heat shock proteins, such as htpx, and play a major role in digesting irreversibly heat damaged polypeptides. in addition to heath shock proteins, numerous cold shock genes were significantly expressed in cells incubated in soil compared to cells grown in lb : cspa, cspe, cspg, ymce, dead, yfia. a specific sigma factor has not yet been identified in the case of the cold shock response. two genes involved in the sos response were significantly expressed in cells grown in soil compared to lb : reca and sula. the reca protein functions as a positive control for sos regulation, is required for all homologous recombination in e. coli, and catalyzes synapsis and strand exchange between homologous molecules. when cells are exposed to sos - inducing environments, they will continue to elongate but fail to septate and thus form filaments. several genes responsible for the pathogenesis and virulence of e. coli o157:h7 were significantly expressed in cells from sterile soil microcosms. the vacb gene, which is required for the full expression of the virulence phenotype in e. coli, was highly expressed in cells incubated in soil. moreover, a gene involved in colonic acid biosynthesis, wcal, was more highly expressed in soil compared to lb. colanic acid forms a protective capsule around the bacterial cell surface and plays a role in pathogenesis.. demonstrated that colonic acid synthesis is upregulated in biofilms and is not synthesized in planktonic cells under normal laboratory conditions. this may account for the differences in colonic acid gene expression observed between the cells incubated in sterile soil microcosms (in which biofilms are likely) compared to the lb control. a gene involved in colicin production, tola, was significantly expressed at a higher level in cells incubated in soil compared to cells grown in luria broth. colicins are antibacterial proteins produced by some strains of e. coli that kill competing strains of bacteria by inhibiting energy metabolism, protein synthesis, or dna synthesis. in addition, three genes (marr, mara, and marb) responsible for multiple antibiotic resistance were more highly expressed in sterile soil. the multiple antibiotic resistance (mar) locus in e. coli is composed of two operons (marc and marrab). moreover, the elevated expression of the soxs gene product has been associated with the multiple antibiotic resistance (mar) phenotype. the collective expression of these genes and the genes involved in the general stress response may contribute to bacterial survival and virulence during infection. in fact, there is evidence that antibiotic treatment increases the development of hemolytic uremic syndrome (hus) in children with e. coli o157:h7 infection. in conclusion, affymetrix genechip e. coli genome arrays were used to demonstrate that e. coli o157:h7 cells placed in sterile soil and water microcosms at 15c for 14 days exhibit differential gene expression compared to cells grown in lb at 15c for 48 hours. the cells incubated in sterile soil microcosms were undoubtedly stressed and therefore in a different physiological state than cells grown in lb at 15c for 48 hours. these cells exhibit a phenotype that may lead to stress - associated disinfection resistance, increased pathogenesis, and virulence. this has important implications in water treatment and public health because surface and ground waters are the source for municipal drinking water. further research on the mechanisms and regulation of the stress response of e. coli o157:h7 is needed to prevent potential risk of disease. it is also possible that the genetics expression could be different in nonsterile environments, and this needs to be investigated.	the in vitro survival of escherichia coli o157:h7 at 15c under two experimental conditions (sterile soil and sterile natural water) was examined. dna microarrays of the entire set of e. coli o157:h7 genes were used to measure the genomic expression patterns after 14 days. although the populations declined, some e. coli o157:h7 cells survived in sterile stream water up to 234 days and in sterile soil for up to 179 days. cells incubated in soil microcosms for 14 days expressed genes for antibiotic resistance, biosynthesis, dna replication and modification, metabolism, phages, transposons, plasmids, pathogenesis and virulence, antibiotic resistance, ribosomal proteins, the stress response, transcription, translation, and transport and binding proteins at significantly higher levels than cells grown in luria broth. these results suggest that e. coli o157:h7 may develop a different phenotype during transport through the environment. furthermore, this pathogen may become more resistant to antibiotics making subsequent infections more difficult to treat.
attention deficit or / and hyperactivity disorder (adhd) mainly appears in pre - school children. children with adhd usually demonstrate hyperactivity, impulsivity, aggression, and simultaneously, they achieve limited academic results and ignore social rules due to attention deficiency. adhd morbidity has been reported to be 3 - 20% on average and there are some variations of this result across the body of research. the neurophysiological causes of adhd have been reported ; these functional disorders in the right side frontal lobe and dorsal side frontal lobe may evoke decreased functional ability in personal relations and coordination. in particular, hyperactivity, attention deficiency, impulsivity, and aggression in school age children can still be persisted into adulthood and thus, earlier intervention to relieve adhd is urgently required to ensure successful social adaptation and social relations [7 - 9 ]. generally, central nervous system (cns) stimulant drugs, such as methylphenidate or amphetamine, are recommended as the most effective medicine for the management of adhd. however, these drugs temporarily improve adhd symptoms and do not perfectly result in eradicating the condition. therefore, these drugs are not an appropriate treatment for curing the fundamental causes of adhd. to make up for the weak points of adhd treatment, various intervention studies have been conducted to overcome the frontal lobe malfunction ; these studies have explored the effect of participating in physical activity for at least 20 minutes and doing so regularly [12 - 14 ]. previous studies examined how participating in therapeutic horse - riding and/or hippotherapy as well as in general physical activity might improve social role behavior, quality of life, and motor function in children with adhd. this suggests the need for various and in - depth studies to improve adhd treatment. however, few studies have applied hippotherapy in adhd children in korea and thus, such a local study is necessary. until now, the best well known part of hippotherapy is its effective treatment for improving gross motor function. it has been reported that when children with cerebral palsy (a gross motor function disorder) participated in hippotherapy 1 - 2 times per week, their neuromuscular and psychological functions were improved. accordingly, we can expect that hippotherapy for children with adhd may induce positive changes in brain function and brain - derived neurotrophic factor (bdnf). therefore, the purpose of this study was to examine the effects of hippotherapy on brain function and basal bdnf changes in children with adhd. adhd participants in this study were screened from j and k university psychiatric patients and 20 children diagnosed as adhd patients were selected. twenty adhd children who participated in a horse - riding rehabilitation therapy program were selected for inclusion in the hippotherapy group (hrg) and 19 children who participated in a physical rehabilitation activity program were selected for inclusion in the control group (cg). informed consent from all participants and their parents was collected and their basic demographical information was acquired (see table 1). a preliminary report of their physical and mental disease history, which might affect their functional mri (fmri) result, was compiled before the participants engaged in this study. additionally, all participants were screened for physical and mental health using the kiddie - schedule for affective disorders and schizophrenia. to evaluate the effectiveness of hippotherapy, all participants ' physical characteristics, muscle and cardiorespiratory fitness, fmri scan, and bdnf levels were measured at baseline and 32 weeks after undergoing a program of hippotherapy (pre and post). this study was a randomized block research design that investigated the effects of hippotherapy on brain function in children with adhd over 32 weeks (1 time per week). hippotherapy training was conducted and combined with the horse - riding rehabilitation program provided once a week by the k area boucher business program for 32 weeks. for the first 5 weeks of hippotherapy training, all participants experienced and learned to walk, trot, canter, and gallop and for the next 5 weeks, all participants did a half seat posture training exercise. on horse - back, they learned how to walk and trot for the first 23 weeks and canter between the 23 week until the 28 week. all training included a 15-minute warm - up, a 35-minute horse ride, and a 10-minute cool down. to secure all participants safety, one leader and two assistants walking on either side of the horse accompanied each participant. before and after participating in hippotherapy, participants height, weight, and body mass index (bmi), as well as their physical strength and cardiorespiratory fitness were measured. the bmi of all participants was calculated using a bmi formula [weight(kg) / height(m) ]. body fat was estimated using dual energy x - ray absorptiometry (dexa ; hv - ps 7681, lunar, usa). knee extension strength (angular velocity at 60, dominant leg) represented muscular strength. this was measured by the isokinetic machine (isomed 2000, germany) and a standing long jump was conducted. a graded treadmill test was also conducted to identify cardiorespiratory (vo2max) changes induced by an increase in regular physical activity. to confirm the effect of hippotherapy on the brain, 8 participants from 2 groups were randomly selected. subsequently, an fmri scan of the interior insular and cerebellar area was conducted to compare the results before and after hippotherapy. a fmri was used by the 3.0 tesla ge mri scanner (general electric medical systems, milwaukee, wi) and a t-1 image was scanned to collect 240 sagittal images of the brain using a 3d spoiled gradient echo pulse sequence (spgr). when the ir - prepared 3d spgr sequence was performed, zerofill interpolation processing (zip) was used to reconstitute images. to identify abnormalities in the brain structure, a t-2 image was also used and all fmri scans used quadrature type head coils. to estimate bdnf, blood was taken and analyzed using human enzyme - linked immunosorbant assay kits (ab frontier). blood from the forearm vein was centrifuged by 1000 xg (rcf) for 15 minutes and 0.1 ml of centrifuged serum was analyzed using the microplate model 680 (bio - rad, usa) with enzyme - linked immunosorbent assay (elisa) method. concentration values were obtained by the measured optical density (o.d) and by calculating density. spss 18.0 for window (chicago, il, usa) was used to process this study data and the collected data was tested using descriptive statistics (mean and standard deviation). a between group difference test was conducted using an independent t - test that considers the delta t value (pre and post) to correct the type ii error according to the baseline difference between the two groups. in addition, a significant fmri result comparison was conducted ; this comparison considered the corrected p - value to be below 0.05. the fmri result comparison (between the groups, test conditions, and test condition x between groups) was conducted using a t - test that employed the brain voyager program, which considers age and gender. adhd participants in this study were screened from j and k university psychiatric patients and 20 children diagnosed as adhd patients were selected. twenty adhd children who participated in a horse - riding rehabilitation therapy program were selected for inclusion in the hippotherapy group (hrg) and 19 children who participated in a physical rehabilitation activity program were selected for inclusion in the control group (cg). informed consent from all participants and their parents was collected and their basic demographical information was acquired (see table 1). a preliminary report of their physical and mental disease history, which might affect their functional mri (fmri) result, was compiled before the participants engaged in this study. additionally, all participants were screened for physical and mental health using the kiddie - schedule for affective disorders and schizophrenia. to evaluate the effectiveness of hippotherapy, all participants ' physical characteristics, muscle and cardiorespiratory fitness, fmri scan, and bdnf levels were measured at baseline and 32 weeks after undergoing a program of hippotherapy (pre and post). this study was a randomized block research design that investigated the effects of hippotherapy on brain function in children with adhd over 32 weeks (1 time per week). hippotherapy training was conducted and combined with the horse - riding rehabilitation program provided once a week by the k area boucher business program for 32 weeks. for the first 5 weeks of hippotherapy training, all participants experienced and learned to walk, trot, canter, and gallop and for the next 5 weeks, all participants did a half seat posture training exercise. on horse - back, they learned how to walk and trot for the first 23 weeks and canter between the 23 week until the 28 week. all training included a 15-minute warm - up, a 35-minute horse ride, and a 10-minute cool down. to secure all participants safety, one leader and two assistants walking on either side of the horse accompanied each participant. before and after participating in hippotherapy, participants height, weight, and body mass index (bmi), as well as their physical strength and cardiorespiratory fitness were measured. the bmi of all participants was calculated using a bmi formula [weight(kg) / height(m) ]. body fat was estimated using dual energy x - ray absorptiometry (dexa ; hv - ps 7681, lunar, usa). knee extension strength (angular velocity at 60, dominant leg) represented muscular strength. this was measured by the isokinetic machine (isomed 2000, germany) and a standing long jump was conducted. a graded treadmill test was also conducted to identify cardiorespiratory (vo2max) changes induced by an increase in regular physical activity. to confirm the effect of hippotherapy on the brain, 8 participants from 2 groups were randomly selected. subsequently, an fmri scan of the interior insular and cerebellar area was conducted to compare the results before and after hippotherapy. a fmri was used by the 3.0 tesla ge mri scanner (general electric medical systems, milwaukee, wi) and a t-1 image was scanned to collect 240 sagittal images of the brain using a 3d spoiled gradient echo pulse sequence (spgr). when the ir - prepared 3d spgr sequence was performed, zerofill interpolation processing (zip) was used to reconstitute images. to identify abnormalities in the brain structure, a t-2 image was also used and all fmri scans used quadrature type head coils. to estimate bdnf, blood was taken and analyzed using human enzyme - linked immunosorbant assay kits (ab frontier). blood from the forearm vein was centrifuged by 1000 xg (rcf) for 15 minutes and 0.1 ml of centrifuged serum was analyzed using the microplate model 680 (bio - rad, usa) with enzyme - linked immunosorbent assay (elisa) method. concentration values were obtained by the measured optical density (o.d) and by calculating density. the bmi of all participants was calculated using a bmi formula [weight(kg) / height(m) ]. body fat was estimated using dual energy x - ray absorptiometry (dexa ; hv - ps 7681, lunar, usa). knee extension strength (angular velocity at 60, dominant leg) represented muscular strength. this was measured by the isokinetic machine (isomed 2000, germany) and a standing long jump was conducted. a graded treadmill test was also conducted to identify cardiorespiratory (vo2max) changes induced by an increase in regular physical activity. to confirm the effect of hippotherapy on the brain, 8 participants from 2 groups were randomly selected. subsequently, an fmri scan of the interior insular and cerebellar area was conducted to compare the results before and after hippotherapy. a fmri was used by the 3.0 tesla ge mri scanner (general electric medical systems, milwaukee, wi) and a t-1 image was scanned to collect 240 sagittal images of the brain using a 3d spoiled gradient echo pulse sequence (spgr). when the ir - prepared 3d spgr sequence was performed, zerofill interpolation processing (zip) was used to reconstitute images. to identify abnormalities in the brain structure, a t-2 image was also used and all fmri scans used quadrature type head coils. to estimate bdnf, blood was taken and analyzed using human enzyme - linked immunosorbant assay kits (ab frontier). blood from the forearm vein was centrifuged by 1000 xg (rcf) for 15 minutes and 0.1 ml of centrifuged serum was analyzed using the microplate model 680 (bio - rad, usa) with enzyme - linked immunosorbent assay (elisa) method. concentration values were obtained by the measured optical density (o.d) and by calculating density. spss 18.0 for window (chicago, il, usa) was used to process this study data and the collected data was tested using descriptive statistics (mean and standard deviation). a between group difference test was conducted using an independent t - test that considers the delta t value (pre and post) to correct the type ii error according to the baseline difference between the two groups. in addition, a significant fmri result comparison was conducted ; this comparison considered the corrected p - value to be below 0.05. the fmri result comparison (between the groups, test conditions, and test condition x between groups) was conducted using a t - test that employed the brain voyager program, which considers age and gender. there was no significant difference in physical fitness, fmri scans, and bdnf levels between the two groups before hippotherapy (see table 2). after 32 weeks of hippotherapy, body fat in adhd children had changed ; body fat of the hrg had decreased (-1.12 4.20%) and the cg had increased (2.38 6.35%), which represented a significant difference between two groups (p = 0.049) (see fig., the standing long jump results followed by hippotherapy did not show a significant difference between the two groups, although there was an increased tendency in the hrg (12.60 24.49 cm) compared to the cg (2.73 36.62 cm) (p<0.05) (see fig. standing long jump results were tested using a delta t value (pre and post) to correct type ii error according to the baseline difference between two groups. knee extension 60 results showed an increased tendency in the hrg (37.75 40.79 nm) compared to the cg (12.53 42.85 nm). however, there was no significant difference between the two groups (p<0.05) (see fig. cardiorespiratory fitness results after hippotherapy showed an increased tendency in the hrg (0.86 14.65 ml / kg / min) compared to the cg (0.55 8.02 ml / kg / min). also, there was no significant difference between the two groups (p<0.05) (see fig. the activated insular area in the brain after hippotherapy was decreased in the hrg (-1.59 0.99) compared to the cg (-1.14 1.41) although there was no significant difference between the two groups (p<0.05) (see fig. the activated cerebellum after hippotherapy was increased in the hrg (1.97 1.45) compared to the cg (1.92 1.81). however, there was no significant difference between the two groups (p<0.05) (see fig. changes in bdnf levels after hippotherapy showed an increased tendency in the hrg (166.29 277.52 pg) compared to the cg (21.13 686.33 pg). with regards to these levels there was not any significant difference between the two groups (p<0.05) (see fig. this present study investigated physical characteristics and overall changes in brain functions in children with adhd children after 32 weeks of hippotherapy. the hippotherapy training program included horse - riding rehabilitation, which ranged from basic training to independent horse riding that was recommended by the rehabilitation horse - riding association. after completion of the hippotherapy program, there was a significant decrease in body fat in hrg compared to the baseline. however, there was no significant changes in bdnf levels and activated brain function scanned by fmri in the hrg. the primary benefit of horse riding is to enhance gross motor function and positively change psychological factors. although previous studies focused on children with cerebral palsy [17 - 20 ], who differ from children with adhd, we could expect that in this study hippotherapy might lead to positive changes in brain function. accordingly, the results of the present study showed that there was a higher increase in bdnf levels in the hrg compared to the cg. however, there was no significant difference in the bdnf levels between the two groups. nevertheless, hippotherapy showed a positive tendency to improve bdnf levels in the hrg and, based on this result, we can expect that increased frequency in hippotherapy for adha children may have a significant positive effect on neuroplasticity. it is a known fact that the bdnf level is subordinate to blood concentration changes in the recovery phase due to intensity and frequency of exercise and platelet counts play an important role in changing bdnf levels during exercise. moreover, the bdnf level is an essential factor for the neuronal system and directly affects energy metabolism in the central and peripheral nervous area. therefore, this present study resulted in no significant change in bdnf levels because of low intensity and frequency of hippotherapy training, despite long term hippotherapy in children with adhd. the appropriate way to overcome neurophysiological problems, such as dopamine and norepinephrine decreases, in children with adhd is to participate in regular physical activity. in particular, participating in a long term horse - riding program similar to that used in this study is likely to have a positive effect on neurophysiological problems due to the graded nature of the physical activity. in addition, regular long term participation in physical activity may enhance physical fitness ; therefore, a long term horse riding program might induce positive physical fitness level changes in the hrg. there was a higher increase in muscular fitness and cardiorespiratory fitness in the hrg compared to the cg. however, there was no significant difference between the two groups. based on this result, we can assume that long term hippotherapy training might induce a long - lasting threshold point after the adaptation of training, which might not continuously enhance physical fitness in this study. we expected hippotherapy to result in positive changes in bdnf levels and brain function due to the changing neuroplasticity in children with adhd. these changes particularly pertain to the activated cellular energy metabolism and adenosine monophosphate - activated protein kinase (ampk) enhancement that improves lipid metabolism in skeletal muscles. moreover, horse riding has been known to positive change motor control and is likely to decrease anterior insula area activity and increase cerebellum area activity in children with adhd. however, this present study showed that there was no significant difference in the brain function of adhd children after hippotherapy, although there was a positive tendency in brain function. this study also expected to see positive changes in the awareness of children with adha according to the activated anterior insula area after hippotherapy. however, it seems that big individual differences in the severity of adhd in the study participants might cause no significant results. further studies should consider effective sampling methods an a large enough sample based on previous studies statistical values to find out the clear causes of changing bdnf levels in children with adhd. recent studies reported that there was a positive association between cognitive function and fitness level in children with adhd following increased physical activity. therefore, this study also expected to show a significant increase in the activation of the cerebellum area and that this increase would be directly related to cognitive function. however, there was an increased tendency of activation in the cerebellum area in the hrg compared to the cg without significant increase. we assumed that these results might be the result of the low intensity and frequency of hippotherapy training. thus, a modified hippotherapy training model for children with adhd would be ideal in order to evoke positive changes in physical and psychological factors. such a program would consider training volume including intensity and frequency, threshold point, and the level of training adaptation. this study found that, for children with adhd, hippotherapy (once a week for 32 weeks) significantly decreased body fat and increased bdnf levels, activated the anterior insula and cerebellum areas with no significant changes. therefore, this study suggests that hippotherapy training should be modified and developed further to increase the efficacy of hippotherapy for children with adhd.	[purpose]the purpose of this study was to examine the effects of hippotherapy on brain function and levels of blood - derived neurotrophic factor (bdnf) in children with attention deficit and/or hyperactivity disorder (adhd).[methods]the hippotherapy group (hrg) included twenty children with adhd and the control group (cg) included 19 children. all participants physical fitness, fmri brain scans, and blood bdnf levels were measured at baseline and after 32 weeks of participating in hippotherapy.[results]after 32 weeks of participating in hippotherapy, the body fat of the hrg was significantly decreased (-1.12 4.20%) and the body fat of the cg was increased (2.38 6.35%) (p=0.049). there was no significant difference of physical fitness in both groups (p>0.05). although there was a higher decrease in the activated insular area in the hrg (-1.59 0.99) than in the cg (-1.14 1.41), there was no significant difference between the two groups (p>0.05) also, there was a higher increase in the activated cerebellum area in the hrg (1.97 1.45) than in the cg (1.92 1.81). however, there was no significant difference between the two groups (p>0.05). bdnf levels showed an increased tendency in the hrg (166.29 277.52pg) compared to the cg (21.13 686.33pg) ; otherwise, there was not any significant difference in these blood levels between the two groups (p>0.05). it can be assumed that big individual differences in the level of adhd in the study participants might not cause any significant results, although there might be positive changes in the brain function of children with adhd.[conclusion]therefore, this study suggests that hippotherapy training would need to be modified and developed to increase the efficacy of hippotherapy in children with adhd.
according to the recent terminology of lower urinary tract function in children, enuresis (which is also called nocturnal enuresis to add extra clarity) is defined as intermittent incontinence while sleeping regardless of the presence or absence of concomitant daytime symptoms. this idea was first proposed by pace., who noted that a proportion of enuretic children had absorptive hypercalciuria. since that time some strategies were made to measure urinary calcium excretion in the evaluation of nocturnal enuresis. other pathogenic factors that have been suggested are nocturnal desmopressin deficiency, disorder of circadian rhythm of renal functions (sodium and osmotic excretion), dysregulation of prostoglandins excretion, etc. treatment with desmopressin is effective only in 3060% which demonstrates that other pathogenic factors may play a role in development of nocturnal enuresis. several italian studies[479 ] demonstrated a strong association between desmopressin resistance and hypercalciuria, with desmopressin responsiveness increasing when a calcium restricted diet was implemented. neveus. in a study concluded that the urinary calcium excretion does not differ between enuretic and dry children. kamperis. in another study observed no significant difference among calcium excretion of children with or without nocturnal enuresis. although there are some reports about the role of hypercalciuria in polysymptomatic enuresis, but it is insufficient in monosymtomatic enuresis. considering the controversy surrounding the role of hypercalciuria in the pathogenesis of nocturnal enuresis, we investigated the incidence of hypercalciuria (calcium / creatinine ratio greater than 0.20 mg / mg) among children with monosymptomatic nocturnal enuresis and age- and sex - matched controls. this case control study was approved by the university scientific and ethical review boards. considering the prevalence rate of 8% and 20% for hypercalciuria, respectively, in healthy and enuretic children, with a statistical power of 0.8 and statistical significance level of 0.05, calculation of sample size indicated that a minimum sample size of 100 enuretic and 100 controls would be adequate to investigate any probable correlation between hypercalciuria and nocturnal enuresis. nocturnal enuresis was defined as the involuntary loss of urine that occurs only at night and without a history of bladder dysfunction is defined as monosymptomatic enuresis (mse). bedwetting several nights a week is less likely to resolve without intervention, so we selected patients with mse with bedwetting 3 times a week. by an announcement, parents of 1800 school students were asked to inform the study group if their child wet the bed at least three times per week by filling a checklist. our exclusion criteria were the presence of vesico - ureteral reflux, history of urinary tract infection during the last month, nutrition with ketogenic diet, any treatment with corticosteroids, or diuretics in the last month, or high - dose vitamin d in the last 6 months (medications like drops, syrup, or ampul), major fracture in lower extremities or bed rest for a long time, symptoms (including urgency, frequency, dysuria) or abdominal pain, untreated constipation (to avoid coincidence of above - mentioned urinary symptoms), height and body weight outside normal reference frame (less than 5 and greater than 95 percentile), usually wearing tights pants (this may predispose children to develop urinary symptoms or urinary tract infection), or children who did not undergo circumcision. the presence of exclusion criterion was determined by interviewing the parents of the subjects, and no other clinical investigation was done in this regard. none of our participants received desmopressin or used any alarm system for the treatment of enuresis. they were screened via a questionnaire and none of them had a history of seeking any clinical consultation for the complaint of nocturnal enuresis. all remaining 124 subjects were asked to collect two urine samples one at home in the morning and the other at school. we asked the parents to deliver the urine samples to the laboratory of motaharri hospital to be investigated for their calcium and creatinine level. one hundred age- and sex - matched healthy children without any history of nocturnal enuresis were recruited as the control group from the same educational district from which the case group was selected in order to prevent probable diversity in socioeconomic status. hypercalciuria was defined as urinary calcium / creatinine ratios higher than 0.2 mg / mg. all laboratory studies were performed by only one laboratory technician who was expert in the investigation of urine calcium level using the standard hitachi 9/2 autoanalyzer device. for investigating urine creatinine level according to the jaffe method, first we diluted the urine sample 50 times, and then evaluated it by the autoanalyzer device and the number was multiplied in 50 to yield the urine random creatinine level. all laboratory investigations were performed during the maximum time of 3 hours after urine collection. after determining the urine calcium / creatinine ratio for subjects in both case and control groups, subjects with hypercalciuria were investigated for the etiology of their hypercalciuria via blood samples including measuring alkaline phosphatase, phosphorus, calcium, potassium, sodium, blood urea nitrogen, serum creatinine, and parathyroid hormone (pth) (using the chemoluminescence method). informed consent was obtained from all participants and their parents, but limited data regarding the details of urine analysis were provided for parents in order to prevent their misunderstanding about possible consequences of high calcium (milk) intake for children. collected data were analyzed by independent and paired t-, chi - square, and pearson correlation tests using spss software ver. the information regarding the age and sex distribution, and mothers employment and educational status in both case and control groups is depicted in table 1. subject characteristics in the case and control groups the urine samples were obtained from each subject on the two above - mentioned occasions. the mean urine calcium levels in the morning sample were 7.585.01 and 5.853.49 mg / dl respectively in the case and control groups. the mean urine creatinine level in the morning urine sample was 114.252.4 and 117.754.7 mg / dl respectively in the case and control groups. the mean urine calcium level in the second sample was 5.144.11 and 3.893.03 mg / dl respectively, in the case and control groups. the mean urine creatinine level in the second sample was 8437.7 and 91.136.8 mg / dl respectively, in the case and control groups. the mean urine calcium to creatinine ratio in the morning urine sample was 0.0770.056 and 0.0610.057 mg / mg respectively, in the case and control groups (p=0.047). the mean urine calcium to creatinine ratio in the second urine sample was 0.0700.06 and 0.0500.046 mg / mg respectively in the case and control groups (p=0.008). by considering a urine calcium to creatinine ratio higher than 0.2 in the second urine sample as hypercalciuria, there were 12/118 in the case group and 3/100 in the control group. chi - square analysis revealed a significant difference in the frequency of hypercalciuria among children with and without nocturnal enuresis (p=0.032). the absolute frequency of hypercalciuria based on the 8:00 am samples was 3 in the case and 1 in the control group (p=0.562), applying a 0.2 mg / mg cutoff point for determining hypercalciuria cases. the frequency of hypercalciuria is much higher in the second samples (10:00 am) compared to the first samples in the morning (8:00 am). applying a paired t - test in order to compare the urine calcium to creatinine ratio between two sampling occasions (after wakening and at school) suggested a significant difference (0.0690.057 in the morning vs. 0.0610.055 in second sample ; p=0.025). however the same analysis for each subject group revealed no significant difference among the ca / cr ratio of two urine samples (in the morning and at school) of each subject. it yields a p value of 0.153 and 0.087, respectively, in the case and control groups. five of 55 girls and 10 of 163 boys were documented to have hypercalciuria, but there was no correlation seen between sex and hypercalciuria. six of 151 subjects (3.9%) whose mothers were homemakers, and 9 of 67 subjects (13.4%) whose mothers were employed outside the house, demonstrated to have hypercalciuria. pearson correlation analysis revealed a significant correlation among hypercalciuria and mothers employment status (p=0.015). considering mothers educational status, among children of 130 mothers with diploma or lower educational degree, 12 (9.2%) demonstrated to have hypercalciuria, whereas only 2 cases of 35 mothers (5.7%) with diploma from college (fogh - e diploma), and 1 of 53 mothers with a bachelor or higher degree, demonstrated to have a child with hypercalciuria. however there was no significant correlation between mothers educational status and hypercalciuria (p=0.196), even with categorizing mothers educational level into two groups of primary and higher education (p=0.078). all 15 hypercalciuric subjects (12 in case and 3 in control groups) were tested for their serum bun, cr, na, k, ca, p, alkaline phosphatase and parathyroid hormone levels, and all laboratory tests were in normal range [table 2 ]. some other studies claimed that urinary calcium excretion does not differ among children with and without enuresis. in 2006, extensive discussions were held by the board of the international children 's continence society (iccs), which yielded new definitions and terminology of lower urinary tract function in children and adolescent. before the consensual definitions, different publications did not differentiate clearly enuresis from other dysfunctional voiding. the discrepancy between studies such as the frequency of the effect of ddavp or incidence of hypercalciuria could be attributed to this fact. the current study was performed considering the conflicting evidence about the possible relationship between hypercalciuria and bedwetting. also these new iccs definitions could be the aim of the current article to clearly demonstrate the true frequency of hypercalciuria in enuresis. in this study many studies have a selected population of patients consulting for enuresis in a medical center. other important recent studies, with the same model (school population), are lacking for comparison.[1820 ] parental feedback was received in 1600 cases. among them this yields a prevalence rate of 8.12% for bedwetting in the elementary school students population. this rate is to some extent lower than the rate which was reported by gur. from turkey (12.4%) or raes. this was similar to findings of gur., but we should not forget the impact of cultural problems (some traditions) while public community is usually antipathic to report the bedwetting of their girl children in iran. in our study iran, has reported the prevalence rate of hypercalciuria among children with enuresis to be 9.2% which is almost similar to our results. another study by pace. in italy demonstrated a lower rate for hypercalciuria (5.17%) among 406 children with nocturnal enuresis. an important factor resulting in various prevalence rates among two different studies in a similar population is the cutoff point of those studies for the definition of hypercalciuria. for example, pace. considered subjects with a urine calcium / creatinine ratio more than 2.1 mg / mg as hypercalciuric, but this cutoff point in our study was 0.2 mg / mg. all 15 hypercalciuric subjects in our study had normal serum ca, p, na, k, and parathyroid hormone (pth). thus absorptive or reabsorptive type of hypercalciuria could be ruled out and the diagnosis of idiopathic hypercalciuria (ih) was proposed in all cases. we did not perform any ultrasound - based evaluation for the cases with enuresis to rule out anomalies of the urinary system. however according to the study of pace., urinary tract abnormalities were observed only in 7.1% of subjects with enuresis, and the relationship among anatomic anomalies and nocturnal enuresis is rare. but the study of azhir. from iran, reported higher urinary system abnormalities to be 33% in children with nocturnal enuresis (small bladder with a thick wall in 27%, and large bladder capacity with a thin wall in 6% of cases). in the study of penido, this problem was resolved by the treatment of hypercalciuria (high water intake, adjusting diet for sodium and protein amount, administration of potassium citrate and thiazide diuretics). in a study by valenti. ; the effect of a therapeutic intervention in 46 enuretic children has been analyzed and their results indicated that urinary calcium levels modulate aquaporin 2 excretion and is likely to be useful for treatment of children with enuresis. a recent report from iran indicated that hypercalciuria can negatively affect the responsiveness to desmopressin therapy, so there are several studies which pointed out the therapeutic approach of patients with and without hypercalciuria in children with nocturnal enuresis. in our study, although all hypercalciuric cases were advised to visit a pediatric nephrologist, but unfortunately the data regarding the implemented actions and the outcome of treatment if done were not available. having data about the nutritional parameters (such as calcium intake) could be effective in the interpretation of findings, even though these data can be difficult to evaluate and so were not evaluated in this study. some studies used orally calcium loading in order to diagnosis the etiology of hypercalciuria (absorptive or renal), but we did not use this test in our study. in this study the subtypes of hypercalciuria were not determined among the hypercalciuric patients. there are several reports which indicated that the classic distinction among absorptive, renal, and resorptive hypercalciuria seems insufficient to explain the many cellular and tissue modifications observed in patients with primary hypercalciuria. it is possible that absorptive and renal hypercalciuria may represent a continuum of a single disease. in this regard there are some studies that pointed out that renal and absorptive hypercalciuria may not be distinct entities, as indicated by the lack of increased bone turnover in hypercalciuric children. have demonstrated that children initially diagnosed with having either renal or absorptive hypercalciuria had a different result when tested 37 years later. so the authors did not use or even suggest formal assessments for subtypes of hypercalciuria in similar studies. considering the controversy which exists about the role of hypercalciuria in the pathogenesis of nocturnal enuresis, the authors suggest a meta - analysis to be implemented in this regard. in our study there was a significant difference among the frequency of hypercalciuria among children with nocturnal enuresis and healthy controls. so we can suggest adding the measurement of urine electrolytes especially calcium level in the process of looking for the etiologies in a patient referred with nocturnal enuresis. this study confirmed the association between nocturnal enuresis and hypercalciuria, so based on accompanying enuresis and hypercalciuria, its therapeutic approach may need to be changed.	nocturnal enuresis is a common problem among children. hypercalciuria has been proposed as an important etiology of bedwetting. we investigated the incidence of hypercalciuria among children with nocturnal enuresis and age- and sex - matched healthy controls. in this case control study 118 children with nocturnal enuresis and 100 age-, sex-, and educational district - matched healthy controls were recruited. urine samples were obtained from each subject twice : immediately after awakening and 2 hours later at school. urinary calcium and creatinine levels were measured and the subjects with a urinary calcium / creatinine ratio more than 0.2 were considered as hypercalciuric. serum ca, p, na, k, and pth levels were measured for all hypercalciuric subjects. the mean urine calcium to creatinine ratio in the second urine sample was 0.0700.06 mg / mg and 0.0500.046, respectively in the case and control groups (p=0.008). there were 12/118 and 3/100 hypercalciuric subjects in the case and control groups respectively (p=0.032). the serum ca, p, na, k, and pth levels were in normal range in all hypercalciuric subjects. in our study there was a significant difference in the frequency of hypercalciuria among children with nocturnal enuresis and healthy controls, so we can suggest adding the measurement of urine electrolytes especially the calcium level in patients with nocturnal enuresis.
gallstones are among the most prevalent clinical problems all around the world. based on published studies, the prevalence of gall stones in europe is about 5 - 20% in the general population, rising with age. the incidence of gallstones is three times more common in women than in men (13). twelve percent of patients with symptomatic gall stone disease have common bile duct stones (4). choledocholithiasis may be asymptomatic ; or it may cause serious problems, such as obstructive jaundice, pancreatitis and cholangitis, which can complicate disease management, especially in older patients. according to previous studies, it is recommended that common bile duct investigation should be done in order to rule out choledocholithiasis in all patients with symptomatic cholelithiasis. bile duct calculi in majority of cases are predictable on the basis of clinical, biochemical and radiological examinations. ultra - sonography (uss) is an available, low cost, non - invasive test, with no need for ionizing radiation. uss can measure the diameter of intra and extra hepatic bile ducts, indicating whether it is dilated or not. however, it misses approximately 65% of bile duct stones because of the interference with bowel gas and also because ultra - sonography is a procedure highly operator dependent (36). intra - operative cholangiography (ioc) is the gold standard procedure in the diagnosis of bile duct stones. but it is invasive, needs anesthesia, elongate the duration of operation and anesthesia and may increase intra and post - operative complications. studies recommend trying to move to a procedure much safer, more cost effective with less complication. magnetic resonance cholangiopancreatography (mrcp) is a non - invasive procedure that gives high resolution images of the biliary tree without any exposure to ionizing radiation (3, 7). its role in identifying uncertain anatomy and visualizing the bile duct stones is well - established (8). investigations show that comparing to direct cholangiography, mrcp has found to be sensitive and specific (3, 7, 9, 10). therefore, given that ioc is an invasive procedure with probable complications, it would seem that mrcp could replace the direct cholangiography when it used for diagnostic purposes based on studies indicate that it is a sensitive and specific diagnostic procedure (7). we performed this study to compare the efficacy of ioc and mrcp in patients thought to have biliary stones, considering the sensitivity, specificity, positive predictive value and negative predictive value of these two procedures. through this study we can help answering the question below : can pre - operative mrcp obviate the need for ioc ? fifty - nine consecutive inpatients with suspected common bile duct (cbd) stones admitted to the surgery unit of imam hossein medical center, tehran, iran, were recruited in the study over a period of 24 months. patients had the mean age of 556 sd years (range 36 - 68). we studied them after obtaining their approval from the ethics committee of the university hospital, imam hossein hospital, tehran, iran. after taking a history and examination, blood tests and routine biochemical assays including serum liver enzymes, bilirubin, amylase and alkaline phosphatase an abdominal uss was performed to look for the presence of gallstones and any signs of a cbd stone or bile duct dilation. patients included in this study all had normal sonography but higher than normal alkaline phosphatase level (alph > 200) and were clinically suspicious to common bile duct (cbd) stones. any patient with derangement in other liver tests (such as bilirubin) or documented biliary stone diagnosed by uss were excluded from the study. if in a patient scheduled for cholecystectomy according to these investigations there was a strong suspicion to choledocholithiasis, the patient received preoperative mrcp, and then undergone ioc along with subsequent cholecystectomy. all mrcp scans were analyzed by a radiologist who was unaware of ioc and lab test results. cholecystectomies were performed in a standard manner by one surgeon, the operating surgeon initially assessed ioc, and the film was subsequently reported by one, blinded radiologist who was unaware of mrcp scan results either. based on recorded data, specificity, sensitivity, positive and negative predictive values were individually calculated for both procedures (mrcp and ioc). sensitivity was the ability to identify patients with cbd stones using the number of positive mrcp diagnoses divided by the total number of patients with confirmed cbd stones by ioc. specificity was the ability to identify patients without cbd stones using the number of negative mrc diagnoses as a percentage of the total number of patients without ioc - proven cbd stones. positive and negative predictive values of mrc were determined by the proportion of mrcp diagnoses (positive or negative) confirmed by ioc. fifty - nine consecutive inpatients with suspected common bile duct (cbd) stones admitted to the surgery unit of imam hossein medical center, tehran, iran, were recruited in the study over a period of 24 months. patients had the mean age of 556 sd years (range 36 - 68). we studied them after obtaining their approval from the ethics committee of the university hospital, imam hossein hospital, tehran, iran. after taking a history and examination, blood tests and routine biochemical assays including serum liver enzymes, bilirubin, amylase and alkaline phosphatase an abdominal uss was performed to look for the presence of gallstones and any signs of a cbd stone or bile duct dilation. patients included in this study all had normal sonography but higher than normal alkaline phosphatase level (alph > 200) and were clinically suspicious to common bile duct (cbd) stones. any patient with derangement in other liver tests (such as bilirubin) or documented biliary stone diagnosed by uss were excluded from the study. if in a patient scheduled for cholecystectomy according to these investigations there was a strong suspicion to choledocholithiasis, the patient received preoperative mrcp, and then undergone ioc along with subsequent cholecystectomy. all mrcp scans were analyzed by a radiologist who was unaware of ioc and lab test results. cholecystectomies were performed in a standard manner by one surgeon, the operating surgeon initially assessed ioc, and the film was subsequently reported by one, blinded radiologist who was unaware of mrcp scan results either. based on recorded data, specificity, sensitivity, positive and negative predictive values were individually calculated for both procedures (mrcp and ioc). sensitivity was the ability to identify patients with cbd stones using the number of positive mrcp diagnoses divided by the total number of patients with confirmed cbd stones by ioc. specificity was the ability to identify patients without cbd stones using the number of negative mrc diagnoses as a percentage of the total number of patients without ioc - proven cbd stones. positive and negative predictive values of mrc were determined by the proportion of mrcp diagnoses (positive or negative) confirmed by ioc. in this study the mean age of the patients was 55 with the standard deviation of 6 years. mean level of alkaline phosphtase was 492 with the standard deviation of 26 (table 1). statistics and its relative 95% confidence interval tp= true positive, tn= true negative, fp = false positive, fn = false negative, ppv= positive predictive value, npv = negative predictive value, da= diagnostic accuracy, lr= likelihood ratio, do= diagnostic odds the positive predictive value for ioc was 88%, comparing to mrcp which was 43%. the difference was significant with the p - value less than 0.05 (p = 0.04). these findings show that we had lots of false positive results performing mrcp comparing with ioc. the diagnostic accuracy difference of these two procedures were significant either (p = 0.02) which means ioc is much more accurate. there were no significant and meaningful differences between the sensitivity and specificity statistics based on statistical analysis (table 2). the incidence of common bile duct (cbd) stones among the patients undergoing cholecystectomy is reported as approximately 12%. there are some symptoms, signs and invesigations that should arouse suspicion of a cbd stones including derangement in liver function test (lft)s, dilated cbd in ultrasound (us). routine intra - operative cholangiography (ioc) is performed, by some surgeons, for several reasons. firstly through this procedure we can confirm that cbd is clear and find unsuspected stones in cbd. but according to the evidences 1% of patients with normal lft and ultra - sonography have stones in their cbd and 75% of these stones passes spontaneously (4, 1921). the disadvantage of this procedure is that we force an unnecessary cbd exploration to the patient and prolongation of the operation, because of the radiography and also because of surgical dissection and cannulation. preoperative evaluation of the biliary tree has assumed a great importance in patients suspicious to choledocolithiasis and may help us avoiding intra - operative difficulties. performing a confident assessment of the cbd prior to the surgery may reduce or obviate the need for hazardous and timeconsuming ioc (3, 11). several diagnostic and therapeutic strategies have been suggested for clinical diagnosis and management of cbd stones such as routine mrcp, selective endoscopic retrograde cholangiopancreatography (ercp), routine ioc or endoscopic us with cbd exploration. however no single method is both risk free, highly sensitive and specific currently in use(1114). results from different studies demonstrate that sensitivity and specificity of mrcp for detection of cbd stones is high and the resolution of the biliary tree images is excellent. these investigations confirm the accuracy of mrcp in diagnosis of cbd stones (1517). recent studies comparing mrcp with ioc or ercp confirmed that mrcp has the accuracy up to 95% (7, 22, 23). studies comparing ercp with mrcp indicates that reliance upon mrcp findings may have reduced the requirement for ercp and sphincterotomy by up to 75% (22, 24). in our study there were no significant differences in sensitivity, specificity between the two procedures mrcp and ioc. but based on our study the diagnostic accuracy of ioc was higher than mrcp (98% vs 85%) and this difference was statistically significant (p = 0.02). the positive predictive value of ioc was 88%, compared to mrcp that was 43% (p = 0.04). these findings indicates that mrcp has significant false positive results compare to the ioc and based on mrcp only, we may perform unnecessary operations to a few number of patients. considering these results, we feel that although using pre operative mrcp reduces the duration of operation and is less invasive comparing with routine ioc (7, 9, 10, 18), it does not have the diagnostic accuracy of the ioc. it may reduce unpredictable damages to the cbd during the ioc but it has significant false positive cases. dalton (7) reported that mrcp should be the only modality used to exclude cbd stones so individual centers must design their own strategies based on local factors including geographical location, personnel, equipment and facilities such as ercp and mrcp, economic factors (time resources, private or teaching hospital) and the experience of the operating team. in conclusion the suggestion advocating routine use of mrcp instead of ioc or as a substitute for ioc needs further investigations on more patients. not only should we consider all the advantages and disadvantages of these two procedures (ioc, mrcp) but also we should perform some further investigations in order to find out which of these two procedures is the most cost - effective based on local circumstances in different centers. with further studies we may be able to choose a procedure less invasive, less expensive, with lower rate of complications and of course more diagnostic accuracy	aimthis study was performed to compare the efficacy of preoperative magnetic resonance cholangiopancreatography (mrcp) and intra - operative cholangiography (ioc) methods in patients suspicious to gall stones.backgroundaccording to previous studies, it is recommended that common bile duct investigation should be done in order to rule out choledocholithiasis in all patients with symptomatic cholelithiasis. ioc is an invasive procedure with probable complications, it would seem that mrcp could replace the direct cholangiography.patients and methodsin a diagnostic clinical trial, fifty - nine patients with symptomatic biliary stones or cholecystitis were recruited in this study. the included patients had normal size biliary ducts in sonography but high serum alkaline phosphatase level. preoperative mrcp and ioc were performed for the patients and the obtained results were analyzed and compared.resultsthe positive predictive value for ioc was 88% and for mrcp was 43%. the diagnostic accuracy of ioc and mrcp were 98% and 85% respectively, suggesting that ioc is much more diagnostically accurate. there were no significant difference in specificity and sensitivity of these two methods.conclusionaccording to the results, we can conclude that mrcp may not obviate the need for ioc. the suggestion for routine use of mrcp instead of ioc and as a substitution of that procedure needs further investigations on more patients.
	this paper presents the development and evaluation of an ambient particle concentrator for conducting animal inhalation exposure studies. the system utilizes the principle of virtual impactors to concentrate ambient particles in the size range 0.1 - 2.5 microns (aerodynamic diameter ; dp) by drawing them through a series of three virtual impactors. each impactor contains the majority of ambient fine mass (dp < 2.5 microns aerodynamic diameter) in a bleed flow (minor flow) that is 20% of the total flow entering the virtual impactor. the virtual impactors have been characterized using indoor air samples as test aerosols. fine mass and sulfate concentrations at the outlet of the concentrating system were compared to the ambient fine mass and sulfate levels, which were determined using harvard - marple impactors. in each of the stages, particle concentration was increased by a factor of approximately 3. thus, an overall concentration factor of about 25 - 30 was achieved. the main goal of this study was to demonstrate the feasibility of conducting animal exposures using the newly developed ambient fine particle concentrator.imagesfigure 1.figure 2.figure 3.figure 4.figure 5.figure 6.
we report on the inheritance of a familial t(x;15)(p22.3;p10) translocation in a fetus referred for short long bones. these events lead to partial nullosomy of x chromosome genes in males and to premature ovarian failure and lri - weill syndrome (mim 127300) in females (due to nonrandom inactivation of the undeleted x chromosome). here, we report on what we believe to be the first prenatal diagnosis of a der(x)t(x;15)(p22.33;p10) translocation in a fetus with shortened long bones at a second trimester ultrasound examination. we also demonstrated the utility of array comparative genomic hybridization (acgh) analysis for clearly defining the size of the x chromosome nullosomy and thus enabling appropriate genetic counseling. a 30-year - old woman (gravida 2 para 1, iii:1) was referred to our unit at 26 weeks of gestation because her male fetus (iv:2) had abnormally short long bones (below the third percentile at 23 weeks). the patient 's previous pregnancy had been uneventful and her second pregnancy had been conceived naturally with a 30-year - old man. the mother presented with madelung deformity and relatively short stature (1.53 m, which is two standard deviations (sds) below the mean). no dysmorphic features or mental disabilities were apparent in and the family 's medical history was unremarkable. the first - trimester ultrasound scan was normal, with a crown rump length of 60.0 mm and a nuchal translucency measurement of 1.2 mm. the second - trimester, integrated risk screening for trisomy 21 yielded a value of 1/5000 (hcg : 0.41 multiple of the median (mom) and fp (feto protein) : 1.21 mom). a post referral ultrasound scan confirmed these findings but did not identify other anomalies (other than asymmetric ears). a two - dimensional ultrasound examination confirmed the abnormally short femur length, with a value corresponding to 2223 weeks of gestation. there were no feature suggestive of achondroplasia or incomplete osteogenesis (i.e., fracture, curvature or cupping of the edge in the long bones). the couple agreed to undergo an amniocentesis for chromosome analysis. on the basis of (i) a conventional cytogenetic analysis of the fetus, the parents, the maternal grandparents, and the maternal grandmother 's parents and (ii) an acgh analysis of the fetus and the mother, we diagnosed a 46,y, der(x)t(x;15)(p22.33;q10)mat associated with a terminal par1 deletion and a partial xp22.33 short nullosomy (encompassing the xg, gyg2, and arsd genes). on the basis of the literature and in accordance with the french legislation, our institution 's clinicians, cytogeneticists, and obstetricians provided the parents with extensive genetic counseling. they notably explained the characteristics of lri - weill syndrome and idiopathic short stature (iss) associated with deletion of the short stature homeobox - containing (shox) gene (mim : 312865), the high probability of infertility and the lack of knowledge concerning the partial nullosomy. under french law, parents may choose to continue or terminate the pregnancy at any time (regardless of the gestational age) ; after thought, the parents in this case decided to continue with the pregnancy. after an uneventful pregnancy, a male infant was born at term (birth weight : 3.270 kg [0.5 sd ] ; birth length : 47 cm [1 sd ]). the boy 's weight was 7.4 kg (1 sd) and his height was 67 cm (1 sd). the boy is of short stature (height : 86 cm (1.5 sd), with short limbs ; weight : 12 kg (1 sd) due to shox haploinsufficiency but does not have madelung deformity. given that abnormally short long bones on ultrasound are suggestive of a chromosomal abnormality, fluorescent in situ hybridization (fish) was performed on 100 interphase nuclei with an aneuvysion kit (vysis, abbott molecular, des plaines, il). an analysis of amniotic fluid cells (using standard gtg, rhg, cbg and nor banding) revealed a 46,y, der(x) fetal karyotype, with an acrocentric satellite at the top of the short arm of the der(x) chromosome (fig.1a). further fish analysis (using probes for wcpx [metasystems, altlussheim, germany ], shox [kreatech ; amsterdam, the netherlands ] and dxys130 [kreatech ]) enabled us to better define the fetal karyotype. we hypothesized that the fetus had inherited an unbalanced translocation between an acrocentric satellite and the top of the short arm of the x chromosome (combined with shox gene deletion). (a) the proband 's derivative x chromosome, with r and g banding : fluorescent in situ hybridization on the maternal derivative x chromosome using (b) cep x (dxz1) sg and telvysion xp / ypter (so) probes (abbott molecular, vysis), (c) shox (so) and cep x (sg) probes (abbott molecular, vysis) and (d) a wcp x probe (sg) (abbott molecular, vysis) and a nor probe (so). the results of parental karyotyping and fish analyses (fig.1b d) prompted us to diagnose a maternally inherited, unbalanced, derivated chromosome (iii:1). karyotyping of the maternal grandparents then enabled us to confirm the unbalanced inheritance of a t(x;15)(p22.3;q10) translocation from the maternal grandmother (ii:2) with normal stature (1.61 m). this resulted in a 46,x, t(x;15)(p22.3;q10)dn karyotype, since the great - grandparents ' karyotypes were normal (fig.2). we then performed an acgh analysis, in order to define (i) the size of the fetal deletion and the potentially associated nullosomy and (ii) the mother 's deletion on the x chromosome. genomic dna was extracted from cultured amniotic cells and from the mother 's blood using a perfect pure dna blood kit (magna pure, roche, indianapolis, in), according to the manufacturer 's instructions. using a 180-oligonucleotide array (agilent, santa clara, ca ; mean resolution : 5 kb), dna analytix software (agilent) and the hg 19 build, a maternal deletion was confirmed (fig.3a). it spanned from 0 (probe : a_18_p17041097 (61,091 - 61,138)) to 2,822,216 (probe : a_16_p03642083 (2,822,157 - 2,822,216)) and encompassed the whole par1 region (a 2.6 mb region containing 24 genes) and its three most proximal genes : xg (chrx : 2,670,093 - 2,707,747), gyg2 (chrx:2,746,863 - 2,800,861), and part of arsd (2,822,011 - 2,847,416 pdb). 180k array cgh analysis (agilent) (a) the mother (iii:1) (b) the proband (iv:2). it was associated with a nullosomy encompassing the three above - mentioned genes (fig.3b). the final fetal karyotype was, therefore, 46,y, der(x)t(x;15)(p22.3;q10)mat.arrxp22.33(0 - 2,689,408)x1mat, xp22.33(2,701,273 - 2,822,216)x0mat. translocations between chromosomes x and 15 are rare. as is the case for all translocations, different breakpoints lead to the inheritance of unbalanced chromosomes. inheritance of der(x) (an x chromosome derived from an x - autosome translocation) results in deletion of the x chromosome and duplication of chromosome 15. when unbalanced chromosomes are inherited in males, der(x) might lead to the partial nullosomy of x chromosome genes as is observed for the inheritance of partial x chromosome deletions. the nullosomies described to date result in a variety of contiguous gene syndromes, all of which are associated with mental retardation. in general, females with this type of deletion are phenotypically normal, since biased inactivation of the deleted x chromosome is frequently found in this context. however, premature ovarian failure can be caused by haploinsufficiency of genes that are essential for oogenesis and that probably escaped x inactivation. when the deletion encompasses the par1 region, lri - weill syndrome or iss results from the shox deletion. here, we report on what we believe to be the first prenatal diagnosis of a der(x),t(x;15)(p22.33;p10) in a fetus with abnormally short long bones in a second - trimester ultrasound examination. a conventional cytogenetic analysis of the family clearly showed that the der(x) was maternally inherited from a t(x;15)(p22.33;p10). next, acgh analysis enabled us to define the size of the x chromosome nullosomy, interpret the karyotype and to provide in - depth genetic counseling. however, there was still doubt as to the impact of the partial nullosomy, with a 2.6 mb deletion and a 200 kb nullosomy encompassing the three most proximal genes in the par1 region (xg, gyg2 and arsd). par1 and par2 are short, pseudoautosomal (par), homologous regions on mammalian x and y chromosomes (at the top of the short and long arms of these chromosomes, respectively). par1 encompasses 2.6 mb of the short - arm tips of both x and y chromosomes in humans and other great apes. to date, 24 genes have been assigned to par1 and half of these have a known function. in particular par1 is required for pairing of the x and y chromosomes during male meiosis and is the only crossing - over point for the gonosomes. when par1 (and thus the shox gene) is absent, the fetus presents iss (explaining the ultrasound findings) and short femur length both of which are classical features of lri - weill syndrome. furthermore, deletion of par1 on the x chromosome makes meiotic pairing of the x and y chromosomes impossible ; in turn, meiotic arrest occurs at the pachytene stage. spermatozoa are unlikely to be retrieved with a testicular biopsy (with a view to use in intracytoplasmic sperm injection). for these affected individuals, the xg gene is located within the xp22.32 locus at position 2,670,093 - 2,734,541, which is at the pseudoautosomal boundary on the short arm of the x chromosome. the three 5 exons are inside the pseudoautosomal region and the remaining exons are within the x - specific end region. the xg gene encodes the homo sapiens xg blood antigen (a cell - surface antigen with 48% homology with cd99 and one of the 34 currently known human blood group antigens). no disease or syndrome has been linked to abnormalities in the xg locus, even though the latter reportedly escapes x chromosome inactivation. the copy on the y chromosome is truncated (xgpy2 : homo sapiens xg pseudogene, y - linked 2 (genomic sequence : chry:2,620,337 - 2,643,037)) and transcribed but is not expected to yield a y chromosome - specific gene product. in fact, the genes on the y chromosome (other than those in the pars) can be classified into three categories, (i) x - transposed genes with 99% sequence identity with the homolog on chromosome x, (ii) x - degenerated genes (mainly pseudogenes and relics of autosomal sequences), and (iii) amplicon genes. this x - linked gene is preferentially expressed in liver, heart, and pancreas. the other gene in the family is located on chromosome 3 (gyg1, on 3q24) and encodes muscle glycogenin. both glycogenins are involved in blood glucose homeostasis. to date, no diseases have been linked to gyg2 abnormalities. a short, 3 truncated version (homo sapiens glycogenin 2 pseudogene 1 (gyg2p1), non - coding rna) has been identified on the y chromosome (14,517,915 - 14,533,389 pdb). the lysosomal protein encoded by arsd is a member of the arylsulfatase (ars) family, which is essential for the correct composition of bone and cartilage matrix. the arsd gene (encoding a lysosomal protein) is the most distal in the ars cluster (arsd, arse, arsf, and arsh) and has not been linked to a human disease. arsd has the typical features of genes that map to the pseudoautosomal region of the x chromosome : (i) it escapes x inactivation and (ii) it has a related pseudogene (assigned to yq11). in contrast, abnormalities in the arse gene in same cluster have been associated with x - linked recessive punctata chondrodysplasia, (omim 302950). our genetic counseling took account of the absence of reported abnormalities for xg, gyg2, and arsd and the pregnancy was uneventful. he is healthy and the only apparent clinical sign is short stature. this case has been entered in the ecaruca database.	key clinical messagetranslocations between x and acrocentric chromosomes are rare. we report on the inheritance of a familial t(x;15)(p22.3;p10) translocation in a fetus referred for short long bones. cytogenetic analysis revealed an unbalanced translocation combined with a three - gene nullosomy. after genetic counseling, a prognosis was established and a healthy boy was delivered.
dissimilatory metal - reducing bacteria (dmrb) may generate nanowire structures that help them exploit insoluble mn and fe oxides as electron acceptors for the oxidation of organic matter in anoxic soils and sediment (1). understanding how protein - based nanowires are able to conduct electrons is intriguing, as proteins are generally considered to be electrical insulators. dmrb have been employed in microbial fuel cells and in bioremediation techniques, and bioengineered nanowires have been proposed for future use in nanobioelectronics (2). recently, a potential role for nanowires in pathogenesis was shown when nanowire - producing bacterial biofilms were identified in bone samples from patients suffering from bisphosphonate - related osteonecrosis of the jaw (3). hence, a complete understanding and control of electron transport in nanowires could have great implications for the management of environmental processes, the construction of bioelectrochemical systems, the fighting of pathogenesis, and the development of the next generation of electronics. nanowire conductivity was first demonstrated in geobacter sulfurreducens by conducting - probe atomic force microscopy of individual nanowire pili (2). in addition, the conductive properties of g. sulfurreducens biofilms were measured with microbial fuel cells. in situ measurements showed a conductivity of 5 ms cm, which is comparable to that of synthetic organic metallic conductors such as polyaniline (4, 5). sheared off g. sulfurreducens nanowires displayed a conductivity of 4 s cm and had a temperature dependence similar to that of organic metals (5). by using scanning tunneling microscopy, nanofabricated electrodes, and conducting - probe atomic force microscopy, a number of other studies have demonstrated nanowire conductivity of 1 s cm in shewanella oneidensis pili (1, 6). the metal - like conductivity (mlc) and sec hypotheses were put forward to explain the mechanism of electron transport in nanowires, and a great deal of effort has since been put into providing conclusive evidence to support one or the other hypothesis (5, 7). one group of scientists suggested that pila itself has the propensity to transport electrons through stacking of aromatic residues, aligning the pi orbitals in the quaternary structure of the pilus, and allowing the electrons to be conducted through these pi - pi interchain stackings, conferring metal - like properties (5). according to this hypothesis, it was suggested that the role of attached multiheme cytochromes is to mediate direct contact with the electron acceptors and transfer the electrons from the pilus nanowire to the metal (5). it was observed that acetate oxidation was carried out at a finite rate and that biofilms of finite thickness would grow on anodes. these data supported a finite rate of electron transfer between aligned cytochromes, as described by the sec hypothesis (7). further reinforcement of this hypothesis was obtained from indications of reversible oxidation and reduction of biofilm - associated redox factors based on spectroelectrochemical, conductivity, and cyclic voltammetry measurements (7). the debate has been going on without any conclusive or overwhelming evidence excluding either hypothesis (810). (11) is based on a quintuple - mutant pila protein from g. sulfurreducens. vargas. targeted the five aromatic residues in the c - terminal part of pila for alanine substitutions on the basis of the hypothesis that the aromatic residues of the g. sulfurreducens pila c - terminal region are involved in pi - pi stacking and electron conductivity, reasoning that the conductive properties would be impaired by mutagenesis. pila from g. sulfurreducens deviates from known structures of type iv pilins (t4ps) in the apparent lack of a c - terminal head domain. the pila mutant was shown to have proper decoration (similar to the wild type) with multiheme c - type cytochrome omcs, as demonstrated by immunoelectron microscopy. the mutant showed diminished conductivity and a lowered ability to reduce fe(iii) oxide, demonstrating that association of cytochromes is not enough for efficient reduction to occur. only 10% of the current production of the control was observed in mutant biofilms when using a graphite anode as an electron acceptor, and current levels of the mutant were comparable to that of a pila - deficient mutant strain. likewise, conductivity measurements in biofilms grown on gold electrodes showed a 10-fold reduction in conductivity compared to that of the control. taken together, these data suggest that pili have to be conductive for effective long - range electron transfer, which supports the mlc hypothesis. this is consistent with the hypothesis that the aromatic amino acids replaced with alanine in the mutant account for the conductivity observed in nanowires. although the analyses presented by vargas. (11) are important contributions to the elucidation of electron conductivity in nanowires and the results can be interpreted as supporting the mlc hypothesis, some important issues need to be addressed. first, the brute force approach of mutating five amino acids in a small protein might have unintentional effects on the structural integrity of the protein studied. aromatic residues are normally important for stabilization of the hydrophobic core of protein domains, and mutagenesis could also affect the correct packing in the hydrophobic core of the pilus. the data presented indicate that the mutant produces structurally intact nanowires and that multiheme cytochromes can attach to the nanowires, but the alignment of associated cytochromes might well be impaired by the mutations. careful analysis of the functional roles of the individual aromatic residues mutated in the study by vargas., structural studies resulting in an atomic model for pila and the nanowire pilus are essential to fully explain the role of aromatic residues in pilus conductivity and could provide a satisfying mechanism for electron transfer through nanowires. g. sulfurreducens pila aligns quite well with pseudomonas aeruginosa pak pilin, for which a high - resolution crystal structure is known (12). on the basis of the sequence alignment presented by vargas., four of the five mutated aromatic residues can be identified in the known crystal structure (fig. 1). by inspection of the positions of these amino acids in the context of the monomeric pilin and in the polymeric pilus, it can be seen that two of the aromatic residues (corresponding to f53 and y56 in unprocessed g. sulfurreducens pila) are located at the base of the head domain and point toward the hydrophobic core of the pilus (13). the two remaining residues (corresponding to y61 and f80 in unprocessed g. sulfurreducens pila) are located at the bottom and top, respectively, of the head domain of pak pilin and point outward from the pilus. all four residues are located in the highly conserved t4p core structure, and they do not show a continuous stacking of the identified aromatic residues in either the monomer or the pilus polymer. this raises the intriguing possibility that conducting nanowire pilus structures deviate substantially from known t4ps. cartoon representation of the p. aeruginosa pak pilin structure (blue) docked into the cryoelectron microscopy density map (gray) of the type iv pilus of neisseria gonorrhoeae to show the positions of the residues corresponding to four of the five mutated aromatic residues in g. sulfurreducens pila in the context of the pilus. residues corresponding to f53 and y56 are shown in space fill and are colored red. residues corresponding to y61 and f80 are shown in space fill and are colored orange. these residues are located at the bottom and top of the head domain of the pilin, and they are pointing outward from the pilus. the figure was made with ucsf chimera (14) and protein data bank entries 2hil and 1oqw, as well as emdb entry em-1236.	abstractthe discovery of bacterial conductive structures, termed nanowires, has intrigued scientists for almost a decade. nanowires enable bacteria to transfer electrons over micrometer distances to extracellular electron acceptors such as insoluble metal oxides or electrodes. nanowires are pilus based and in geobacter sulfurreducens are composed of the type iv pilin subunit pila. multiheme c - type cytochromes have been shown to attach to nanowire pili. two hypotheses have been proposed for electron conduction in nanowires. the first (termed the metal - like conductivity or mlc hypothesis) claims that the pilus itself has the electron - conductive properties and the attached cytochromes mediate transfer to the final electron acceptor, whereas the second hypothesis (termed the superexchange conductivity or sec hypothesis) suggests that electrons are hopping between heme groups in cytochromes closely aligned with the pilus as a scaffold. in their recent article in mbio, vargas. [m. vargas, n. s. malvankar, p.- l. tremblay, c. leang, j. a. smith, p. patel, o. snoeyenbos - west, k. p. nevin, and d. r. lovley, mbio 4(2):e00210 - 13, 2013 ] address this ambiguity through an analysis of strain aro-5, a g. sulfurreducens pila mutant lacking aromatic residues in the nonconserved portion of pila. these residues were suspected of involvement in electron transport according to the mlc hypothesis. the g. sulfurreducens mutant had reduced conductive properties, lending important support to the mlc hypothesis. the data also highlight the need for further and more conclusive evidence for one or the other hypothesis.
foreign - body aspiration into the airway is harmful and even life threatening.1 foreign - body aspiration occurs more often in children but its incidence in, and damage to, adults can not be ignored. in adults, foreign - body aspiration often occurs in elderly people and its incidence increases with aging.1,2 the most common type of material aspirated into the lower airway is organic substance, in particular, bone fragments.1,3,4 the nature of the aspirated foreign body has been proposed to be different in asian and western adults.2,5 chinese people have a fondness for eating hot and spicy food with tasty cayenne pepper. cayenne aspiration into the lower airway is an unusual type of foreign - body aspiration in adults and, to the best of our knowledge, has never been reported. in the past few years, we diagnosed eight cases of cayenne aspiration, most of which were in elderly patients and there was a different period of delay to accurate diagnosis in each. for these patients, the history of cayenne aspiration was not obvious, the symptoms were not specific, the presentation of chest computed tomography (ct) was obscure, and the application of flexible bronchoscopy was delayed. the peppery and hot diet has become more popular in the people s republic of china and there is an increased risk of aspiration of cayenne pepper. herein, we report the cases of cayenne aspiration for better understanding of the clinical features of the rare condition. we analyzed the medical data of patients with cayenne aspiration in peking university first hospital and anhui chest hospital between january 2010 and august 2014. the symptoms, aspiration history, chest ct image presentation, and treatments were reviewed. the equipment used to remove the foreign bodies were foreign - body forceps and biopsy forceps. the data of the patients, including age, sex, symptoms, chest ct image, process of diagnosis and treatment, and endoscopic findings including the features and locations of cayenne, were collected and analyzed. we analyzed the medical data of patients with cayenne aspiration in peking university first hospital and anhui chest hospital between january 2010 and august 2014. the symptoms, aspiration history, chest ct image presentation, and treatments were reviewed. the equipment used to remove the foreign bodies were foreign - body forceps and biopsy forceps. the data of the patients, including age, sex, symptoms, chest ct image, process of diagnosis and treatment, and endoscopic findings including the features and locations of cayenne, were collected and analyzed. the range of age was from 41 to 75 years with a median age of 68 years. the most common symptoms were cough (eight cases, 100%) and sputum (five cases, 62.5%). only one patient (12.5%) could supply the history of cayenne aspiration on his first visit to the doctor and was diagnosed definitively without delay. the other seven patients could not supply the history of aspiration on their initial visits to doctors. the time range of delay to accurate diagnosis was from 1 month to 6 months. interestingly, all seven patients could recall the history of cayenne aspiration after confirmed diagnosis by flexible bronchoscopy. the most common presentation of cayenne aspiration on chest ct was pneumonic consolidation or opacity (eight cases, 100%). other findings on chest ct included atelectasis (two cases, 25.0%), obstructive pneumonia (one case, 12.5%), and bronchial stenosis (one case, 12.5%). the cayenne was most often lodged in the right bronchus tree (seven cases, 87.5%), especially the right lower bronchus (four cases, 50%). the segment of cayenne was complete in five cases (62.5%) and scattered in three cases (37.5%). as shown in figure 1f, the aspirated cayenne may be in tiny fragments after chewing by teeth or in one big segment with tiny fragments (figure 3c). it can also be dispersed as two relatively big segments lodged in two bronchial lumens (figure 3f). flexible bronchoscopy was performed in all the patients and revealed the cayenne lodged in the bronchus (figure 2). the mucosa surrounding the cayenne was severely inflamed and hypertrophic with purulent secretion. in three cases (37.5%), follicular change of the mucosa, granulation tissue hyperplasia, and different degrees of luminal stenosis were observed (figure 2, cases 1, 3, and 6). it is worth pointing out that the cayenne was distributed as tiny fragments in one case (12.5%) (figure 1e) and it was important to remove all the fragments completely and carefully. in another case, the patient aspirated two big segments of cayenne, which lodged in two different bronchial lumens (figure 2, case 4 and figure 3f). careful and thorough examination under bronchoscopy was essential and crucial to make sure that all parts of the cayenne had been removed. the pathology of the removed foreign body showed evidence of plant cells (figure 3d and e). the range of age was from 41 to 75 years with a median age of 68 years. the most common symptoms were cough (eight cases, 100%) and sputum (five cases, 62.5%). only one patient (12.5%) could supply the history of cayenne aspiration on his first visit to the doctor and was diagnosed definitively without delay. the other seven patients could not supply the history of aspiration on their initial visits to doctors. the time range of delay to accurate diagnosis was from 1 month to 6 months. interestingly, all seven patients could recall the history of cayenne aspiration after confirmed diagnosis by flexible bronchoscopy. the most common presentation of cayenne aspiration on chest ct was pneumonic consolidation or opacity (eight cases, 100%). other findings on chest ct included atelectasis (two cases, 25.0%), obstructive pneumonia (one case, 12.5%), and bronchial stenosis (one case, 12.5%). the cayenne was most often lodged in the right bronchus tree (seven cases, 87.5%), especially the right lower bronchus (four cases, 50%). the segment of cayenne was complete in five cases (62.5%) and scattered in three cases (37.5%). as shown in figure 1f, the aspirated cayenne may be in tiny fragments after chewing by teeth or in one big segment with tiny fragments (figure 3c). it can also be dispersed as two relatively big segments lodged in two bronchial lumens (figure 3f). flexible bronchoscopy was performed in all the patients and revealed the cayenne lodged in the bronchus (figure 2). the mucosa surrounding the cayenne was severely inflamed and hypertrophic with purulent secretion. in three cases (37.5%), follicular change of the mucosa, granulation tissue hyperplasia, and different degrees of luminal stenosis were observed (figure 2, cases 1, 3, and 6). it is worth pointing out that the cayenne was distributed as tiny fragments in one case (12.5%) (figure 1e) and it was important to remove all the fragments completely and carefully. in another case, the patient aspirated two big segments of cayenne, which lodged in two different bronchial lumens (figure 2, case 4 and figure 3f). careful and thorough examination under bronchoscopy was essential and crucial to make sure that all parts of the cayenne had been removed. the pathology of the removed foreign body showed evidence of plant cells (figure 3d and e). foreign - body aspiration into the lower airway is rare in adults and accounts for about 20% of the reported cases. however, its incidence increases with advancing age and increases steadily with age from the sixth decade on.6 it can be a serious medical problem and is associated with morbidity and mortality. the majority of foreign bodies aspirated are food, primarily bone.6 the nature of the aspirated foreign bodies varies across different countries and regions due to different eating habits. chinese people have different eating patterns to western people, resulting in different aspirated foreign bodies.7,8 in the people s republic of china, the peppery and hot diet has become more and more popular and fashionable in recent years. cayenne may be used variously in its fresh form, dried and powdered, or as dried flakes as ingredients to improve the taste of food. cayenne is not only a delicious ingredient but also a potentially dangerous foreign body that may be aspirated into the airway. in the past few years, we diagnosed eight cases of cayenne aspiration and most of them were in elderly patients. in most of these patients, diagnosis was delayed for months, which led to various degrees of complication. in our study, we found that the clinical features of cayenne aspiration into the airway are usually obscure, which may cause delay in diagnosis. in particular, the non - specificity of symptoms, the absence or the ignorance of aspiration history, the lack of direct evidence of the existence of cayenne on chest ct, and the delayed application of bronchoscopy were the probable reasons for misdiagnosis. these are discussed following. clinical manifestations of foreign - body aspiration into the lower airway are often variable and nonspecific in adults. if the foreign body is lodged into the trachea, inspiratory stridor and bouts of coughing can occur. if the foreign body is aspirated into the bronchi, the symptoms may be variable, and can include cough, sputum, and wheezing. untreated or unrecognized cayenne aspiration can result in obstructive pneumonitis, atelectasis, or airway hyper - responsiveness. our study showed that a sudden onset of coughing was common in all the cases and may last for several months, accompanied by sputum or not. this was probably due to the active ingredients of cayenne, which can induce chronic respiratory symptoms, including cough and dyspnea. for example, capsaicin, a neurotoxin derived from chili peppers, can cause shortness of breath and cough.9,10 animal experiments indicate that the ingestion of less than 40 g of capsaicin may be fatal.11 because the cayenne was soft and hollow, the taper - like cayenne or tiny fragments were seldom lodged in the tracheal or main bronchus, so the classic triad of cough, wheezing, and choking in foreign - body aspiration was not observed in our study. the symptoms of cough and sputum associated with cayenne aspiration may be obscure, nonspecific, and mimic those of other respiratory diseases such as pneumonia, bronchitis, or asthma. thus, nonspecific respiratory symptoms may be mistakenly attributed to other medical conditions, unless there is a clear history of aspiration of cayenne. nonspecific symptoms may contribute little toward confirmation of diagnosis of airway aspiration, so aspiration history should be investigated carefully. in our study, only one patient could confirm the history of aspiration on his first visit to the doctor and received a definite diagnosis and immediate management under bronchoscopy. what was interesting and thought provoking was that all the other seven patients who did not initially supply history of cayenne aspiration could recall the history of aspiration clearly and accurately after the confirmed diagnosis by bronchoscopy. the low proportion of recognition of cayenne aspiration was probably due to the ignorance or neglect of aspiration event. the aspiration event might be covered up by an accompanying cough that was mistakenly attributed to the stimulating effect of cayenne. because cayenne was soft and thin, the aspiration event may be difficult to be noticed. if their doctors had been alert to foreign - body aspiration during their history taking, the aspiration history could probably have been collected. both doctors and patients should pay more attention to the history of aspiration of foreign body. generally speaking, if the aspiration history is not suggestive, chest ct may assist in detecting the foreign body.12 as shown in another study by our group, chest ct can demonstrate the existence of a foreign body directly in about 30% of patients.4 the common presentations of foreign - body aspiration include pneumonic patch, atelectasis, high - density lesion in airway, pleural effusion, space - occupying lesion, and lung abscess.4 in the present study, the ct findings in patients with cayenne aspiration were indirect and nonspecific. the positive detection rate by ct is largely dependent on the physical properties of the aspirated material and the slice thickness relative to the size of the foreign body. metal or bone, which is radiopaque, is easier to detect on chest ct. a chest ct scan that does not provide evidence of the direct existence of a foreign body should never be accepted as proof that there is no foreign body in the airway. flexible bronchoscopy is effective both in the diagnosis and removal of aspirated cayenne. in our study, most of the patients had been misdiagnosed with pneumonia for months until the aspiration of cayenne was confirmed through flexible bronchoscopy. first, although cayenne may be added to food variously in its fresh form, dried and powdered, or as dried flakes, in our study, only cayenne in fresh form was observed. secondly, foreign bodies in the airway tend to localize in the right bronchial tree, as reported in the literature.7 cayenne is no exception. in our study, the cayenne was more often lodged in the right bronchus tree, especially the right lower bronchus. this right - side predominance can be explained by the vertical nature of the right main bronchus, its larger diameter, and the greater airflow through it. the cayenne aspirated in all the cases was removed by flexible bronchoscopes successfully without complication. our study shows that the application of flexible bronchoscopy is safe and effective for patients with cayenne aspiration. moreover, we should be alert to the distribution and location of cayenne during management with bronchoscopy, because, in some patients, the cayenne was scattered as tiny fragments or different parts lodged in different bronchial lumens. careful and thorough examination under bronchoscopy was essential and crucial to make sure that all parts of the cayenne were removed. gustav killian performed the first bronchoscopy in 1897 to treat a patient with foreign - body aspiration by esophagoscope.13 since then, bronchoscopy has become a useful and effective practice in the evaluation, diagnosis, and treatment of foreign - body aspiration. with the development and progress of this technique, the mortality rate associated with foreign - body aspiration has decreased dramatically.14,15 due to the high rate of misdiagnosis in patients with cayenne aspiration, flexible bronchoscopy should be performed actively in suspected cases of foreign - body aspiration.16,17 cayenne in the airway can be removed safely and effectively with flexible bronchoscopy by an experienced expert. cough is the prominent symptom, which is not specific, and aspiration history may be obscure. chest ct may be helpful but the negative result of the existence of cayenne should not exclude the possibility of cayenne aspiration. flexible bronchoscopy has been demonstrated to be both safe and effective in the diagnosis and treatment of cayenne aspiration.	purposecayenne aspiration is an unusual type of foreign - body aspiration that is usually misdiagnosed. this article analyzes the clinical features of cayenne aspiration in the lower airway.patients and methodsclinical data on eight adult patients with cayenne aspiration were retrospectively analyzed. six were elderly patients. the data were collected from peking university first hospital and anhui chest hospital between january 2010 and august 2014.resultsthe most common symptoms of cayenne aspiration were cough (eight cases, 100%) and sputum (five cases, 62.5%). only one patient (12.5%) could supply the history of aspiration on his first visit to doctor and was diagnosed definitely without delay. the other seven cases were misdiagnosed as pneumonia and the time to accurate diagnosis was from 1 month to 6 months. the history of aspiration could be recalled after confirmed diagnosis for the other seven cases. the most common presentation shown by chest computed tomography (ct) was pneumonic opacity (eight cases, 100%). the existence of cayenne could not be detected by chest ct in any of the patients. all the patients were diagnosed definitively and managed successfully with flexible bronchoscopy. cayenne was more often lodged in the right bronchus tree (seven cases, 87.5%), especially the right lower bronchus (four cases, 50%). the segment of cayenne was complete in five cases (62.5%) and scattered in three cases (37.5%).conclusionthe clinical features of cayenne aspiration are usually obscure and nonspecific which may lead to delay in diagnosis. flexible bronchoscopy is safe and useful for early diagnosis and effective management.
according to the 2002 world health organization (who) health report, a diet poor in fruits and vegetable is the third preventable risk factor for chronic diseases (specific types of cancers, cerebrovascular diseases and ischemia) which have replaced infectious disease as the leading cause of morbidity and mortality in the world. the same report showed that among the twenty countries with the highest life expectancy in the world, four of them are mediterranean countries (france, italy, spain, and greece) (who 2001). mediterranean countries share a common dietary pattern first defined by ancel keys (keys 1986) when he observed important geographical differences in the incidence rates of cardiovascular disease, certain cancers and other nutrition - related diseases that were mostly attributable to supposedly unhealthy food patterns whereas the mediterranean dietary pattern was considered as the responsible factor for health advantages. such pattern was the main focus of study in 1993 at the international conference on the diets of the mediterranean, although the mediterranean dietary pattern had been previously defined in other meetings (helsing 1989 ; serra majem 1993 ; nestle 1995 ; willett 1995). mediterranean dietary patterns are comprised of : abundant plant foods (fruits, vegetables, breads, other forms of cereals, pulses, nuts and seeds) ; minimally processed, seasonally fresh and locally grown foods ; fresh fruits as the typical daily dessert with sweets elaborated from nuts, olive oil and concentrated sugars or honey that are consumed during feast days ; olive oil as the principal source of dietary lipids ; dairy products (mainly cheese and yoghurt) consumed in low to moderate amounts ; fewer than four eggs consumed per week ; red meat consumed in low frequency and amounts ; wine consumed in low to moderate amounts, and generally taken with meals. such a dietary pattern assures a sufficient intake of certain nutrients that have been related in some way with a reduced risk of several chronic diseases. various scores or indexes have been developed to assess the adherence to the mediterranean diet pattern in the population and to link such patterns with several nutrient - related diseases (bach 2006). there is increasing available evidence that following a mediterranean style diet correlates to higher longevity and delays the onset of the deterioration in health, not only in countries from the mediterranean basin but in other non - mediterranean countries as well (kouris - blazos 1999 ; havenam - nies 2003). however, what ageing people aspire for is not only longer life but also optimal quality of life free of disability or disease that implies being dependent on others. as higher self - rating of health is associated to reduced mortality not only among elderly people but among the general population as well (idler and benyamini 1997), identifying which factors contribute to manage healthy aging is key for increasing the percentage of the population who enjoys their longevity. in this context, the relevant question should be : does the mediterranean diet have any relationship to better self - rated health ? the purpose of this article is to review literature regarding the mediterranean diet and its effects on healthy aging. mediterranean diet or related term (mediterranean diet score, mediterranean dietary pattern) were included as a criterion search. as a second search the following words were included : cardiovascular disease, coronary syndrome, dislipaemia, blood cholesterol, hypertension, diabetes, obesity, overweight, waist circumference, metabolic syndrome, inflammatory markers, endothelial function, cancer, neurodegenerative diseases, dementia, depression, alzheimer disease, mental health, health, longevity, quality of life. only those studies which evaluate the mediterranean diet as a dietary pattern where taken into account, excluding those which evaluated single food items or nutrients, only studies which included individuals of 65 years or older at the starting point of the study were analyzed. we excluded studies that evaluated the effect of a single mediterranean diet meal on the subjects under study and studies conducted in animals. a total of 39 publications were selected, three of them were rejected because they did not accomplish the criterion of inclusion regarding the disorders they investigated. publications were classified into four groups according to the main outcome they assessed : cardiovascular disease (including risk factors such as high blood pressure, hypercholesterolemia, diabetes, obesity, the metabolic syndrome and inflammatory markers of cardiovascular damage), cancer, mental health (including dementia, alzheimer s disease and depression) and longevity and quality of life. characteristics of selected studies about the effectiveness of the mediterranean diet in the elderly abbtreviation : acs, acute coronary syndrome ; ad, alzheimer disease ; ahei, alternate healthy eating index ; amed, alternate mediterranean diet index ; apob, apo lipoprotein b ; arcd, age - related cognitive decline ; bc, breast cancer ; bk, bradykinin ; bmi, body mass index ; bp, blood pressure ; cad, coronary artery disease ; chd, coronary heart disease ; chei, canadian healthy eating index ; crp, c - reactive protein ; cvd, cardiovascular disease ; das28, disease activity score ; dqi - r, diet quality index - revised ; dsm - iii - r, diagnostic and statistical manual of mental disorders, revised third edition ; ec50, 50% effective concentration ; ffq, food frequency questionnaire ; fmd, flow mediated vasodilatation ; gtn, glyceryl - trinitrate ; haq, health assessment questionnaire ; hba1c, glycated haemoglobin ; hdi, healthy diet indicator ; hdl - c, hdl cholesterol, hei, healthy eating index ; homa index, homeostasis model assessment index ; icam-1, intracellular adhesion molecule-1 ; ihd, ischemic heart disease ; il-6, interleukin-6 ; ldl - c, ldl cholesterol ; md, mediterranean diet ; mda, malondialdehyde ; mdqi, mediterranean diet quality index ; mdscore, mediterranean diet score ; mi, myocardial infarction ; mmse, mini - mental state examination ; ms, metabolic syndrome ; mufa, monounsaturated fatty acids ; ncep atpiii, national cholesterol education program s adult treatment panel iii ; nincds - adrda, national institute of neurological and communicative disorders and stroke - alzheimer s disease and related disorders association ; nmd, nitroglycerin - mediated dilatation ; nsaid, non - steroidal anti - inflammatory drugs ; or, odds ratio ; orp, outpatient based rehabilitation programme ; pad, peripheral arterial disease ; pufa, polyunsaturated fatty acids ; rct, randomized clinical trial ; rfs, recommended food score ; sfa, saturated fatty acids ; sf36, short form-36 health survey ; sicam-1, soluble intercellular cell adhesion molecule ; svcam-1, soluble vascular cell adhesion molecule ; tc, total cholesterol, tg, tryglicerides, tnf - alpha, tumor necrosis factor ; tmd, traditional mediterranean diet ; t2 dm, type 2 diabetes mellitus ; vcam-1, vascular cell adhesion molecule-1 ; vldl - c, vldl cholesterol. twenty - one of the studies were about mediterranean diets and cardiovascular disease, 8 of them being clinical trials. two of the publications were about mediterranean diets and cancer, three about mediterranean diets and mental health and 11 about longevity or mental health. twenty - two of the publications showed results from mediterranean countries (italy, spain, france, and greece), 10 from non mediterranean countries (united kingdom, canada, australia, usa, denmark, germany, and the netherlands) and 4 from multicenter studies in europe and the united states. an overwhelming majority of them were beneficial, with very little evidence of null findings and no evidence of harm in any study (table 1). since the seven countries study publication, an increasing number of studies have supported the beneficial role of the mediterranean diet on health prevention. there is a rapidly growing recent trend of good - quality observational studies and trials assessing the cardioproctetive role of mediterranean diets (martnez - gonzlez 2004). the present review focused on existing evidence for the role of the mediterranean dietary pattern on aging, or better stated, on successful aging. modern medicine has managed to add years to life but not to delay the onset of chronic diseases, which implies a greater prevalence of disabilities and dependent people who suffer from any one of the most prevalent chronic diseases. in fact, much of the health - care costs associated to aging are attributed not to chronic disease per se but to activity limitations and all that this represents (chan 2002). the research was restricted to the most prevalent non - communicable diseases leading to disability in older individuals from developed countries (cardiovascular diseases, certain types of cancer and neurodegenerative diseases) (lopez 2006). referring to cardiovascular diseases, the review showed that the mediterranean diet might exert some effect not only through its impact on the principal risk factors for such diseases but also on the severity of the disease once it appears. several observational studies (psaltopoulou 2004 ; polychronopoulos 2005 ; panagiotakos, pitsavos, chrysohoou, 2005 ; panagiotakos, pitsavos, matalas, 2005 ; fung 2005 ; serrano martinez 2005 ; panagiotakos 2006) and intervention studies (singh 2002 ; sondergaard 2003 ; fit 2007 ; salas - salvad 2007) have associated the mediterranean diet pattern to lower levels of blood pressure, blood cholesterol, diabetes, inflammation and improved coagulation process and endothelial function, even in individuals with diabetes (ciccarone 2003) or the metabolic syndrome (pitsavos 2003 ; lvarez len 2006). recently, a cross sectional study conducted in cyprus reported that individuals from 65 to 100 years with a higher adherence to the mediterranean diet showed lower levels of blood cholesterol even among those treated with statins (polychronopoulos 2005). moreover, certain observational studies showed that the severity of acute coronary syndrome in hospital death and rehospitalization (the greecs study, in males aged 65 and women aged 72 years) and the likelihood of having acute coronary syndromes (the cardio2000 study, in individuals from 61 10 years) were lower among individuals following a mediterranean style diet (martnez - gonzlez 2002 ; panagiotakos 2005 ; panagiotakos 2006). these results were in accordance with the findings reported by lorgeril in the lyon heart study or by barzi in the gissi prevezione trial (de lorgeril 1999 ; barzi 2003). the predimed study, a primary prevention trial conducted in samples of elderly individuals showed that after three months of following a mediterranean diet, individuals improved their lipid profile and reduced blood concentrations of inflammatory molecules (estruch 2006 ; fit 2007). with respect to obesity, although some observational and prospective studies in younger individuals (schroder 2004 ; mendez 2006 ; panagiotakos 2006) reported an inverse relationship with adherence to the mediterranean diet and bmi and obesity, trichopoulou s data of older individuals from the epic study (trichopoulou 2005b) and the sun prospective cohort (sanchez - villegas 2006) found lower bmi among subjects more adherent to the mediterranean diet but they did not show any independent significant relationship. in a study comparing individuals from the framingham and the seneca study, a lower waist circumference and bmi were reported in individuals representing high dietary quality not only for the mediterranean diet but also for scores evaluating other types of dietary patterns (havenam - nies 2001). a cross sectional study conducted in france with a small sample showed that, especially among older individuals, a poor qualification of the mediterranean diet quality index was associated to a higher prevalence of obesity (scali 2001). these results were corroborated in the predimed study, which demonstrated that the intervention did not imply an increase in body weight of participants (estruch 2006). recent clinical trials have reported benefits of the mediterranean diet for several aspects of factors related to the incidence or prognosis of cardiovascular disease in individuals with given risk factors such as the diabetic population (rodriguez villar 2004 ; antonopoulou 2006), even when relatively high dietary fat content and unrestricted salt intake were permitted. the metabolic syndrome, a constellation of risk factors for cardiovascular disease, has also been related to the mediterranean diet, but not without a certain degree of controversy. data from a cross sectional study in the canary islands in spain revealed that higher adherence to the mediterranean diet was not related to a lower prevalence of metabolic syndrome (lvarez 2006). another cross - sectional study with data from five mediterranean countries showed no relationship between the mediterranean diet and the prevalence of the metabolic syndrome (thanopoulou 2006), although a randomized clinical trial from esposito (esposito 2004) showed that after two years of intervention following a mediterranean diet, a sample of middle age individuals had reduced the prevalence of metabolic syndrome, inflammatory markers and insulin resistance had declined and endothelial function had improved. on the contrary, another intervention study conducted in germany showed no impact of adoption of the mediterranean diet on inflammatory and metabolic risk markers in a sample of patients with coronary artery disease (michaelsen 2006), results that some authors attribute to the study design or the effect the mediterranean diet had on plasma fatty acid concentrations (serrano - martnez and martnez - gonzlez 2007). moreover, the predimed study did not show a statistically significant relationship between a higher mediterranean diet score and lower inflammatory biomarkers in the baseline cross - sectional assessment (salas 2007). however, these markers of inflammation significantly improved with the mediterranean diets after three months of intervention (estruch 2006). there are no cohort studies of mediterranean diets assessing the incidence of the metabolic syndrome as the outcome. adiponectin, a beneficial adipose tissue secreted cytokine, has been shown to improve insulin sensitivity, to regulate glucose and lipid metabolism, and to have pronounced antiatherosclerotic effects. the levels of circulating plasma adiponectin have been reported to be positively associated with the adherence to a mediterranean - type dietary pattern among diabetic women (mantzoros 2006). the role that the mediterranean diets may have on cancer prevalence has been studied for breast cancer and upper aerodigestive tract cancer. in a cohort of canadian individuals with a family history of breast cancer or ovarian cancer, no significant association was found between adherence to a mediterranean diet pattern and risk of brca mutation - related breast cancer (nkondjock and ghadirian 2007). as the authors stated, alcohol consumption linked to the mediterranean dietary pattern may have had some effect on such results. on the contrary, data from three case - control studies in italy showed a reduced risk of cancer of the oral cavity and pharynx, esophagus, and larynx for increasing levels of the mediterranean diet score (bosetti 2003). in addition, a four year follow - up of the lyon heart study showed a protective effect of the mediterranean diet for certain cancers (de lorgeril 1998). greater adherence to mediterranean diet has been related to improved mental depression, age related cognitive decline and alzheimer s disease. age related cognitive decline has recently been defined as an objective decline in cognitive functioning associated to aging but within the normal limits according to the person s age. the mediterranean dietary pattern may exert its effects on mental health through different mechanisms : ensuring an adequate intake of b vitamins, folate, and -3 fatty acids, which are all involved in the synthesis of certain central nervous system neurotransmitters and phospholipids. in addition, other favorable factors include its effect on vascular mechanisms (lowering certain risk factors such as hypertension, dyslipemia and diabetes or assuring lower homocysteine levels) through its antioxidant properties. the relationship between alzheimer s disease and nutrients are being widely explored (solfrizzi 2003 ; luchsinger and mayeaux 2004) but little data on the relationship with the mediterranean diet is available. data from the washington heights - inwood columbia aging project in a non mediterranean population showed that higher adherence to the mediterranean diet was associated with a reduction in the risk for alzheimer s disease and a slower cognitive decline, in a dose - response manner, taking into account other confounding factors for alzheimer s disease (scarmeas, stern, mayeux, 2006 ; scarmeas, stern, tang, 2006). after almost nine years of follow up, the italian longitudinal study on aging showed that a diet high in monounsaturated and polyunsaturated fatty acids was associated with better cognitive performance in elderly individuals following a typical mediterranean diet (solfrizzi 2006). depression is known to be the leading cause of years of life lived with disability especially among females (lpez 2006). the sun (seguimiento universidad de navarra) study, a prospective cohort study that analyzed the relationship between dietary intake and some chronic diseases reported an inverse association between vitamin b12 and -3 fatty acids intake and depression among women, and folate intake and depression among men (sanchez villegas 2006). studies developed in mediterranean countries (trichopoulou 1995 ; lasheras 2000 ; trichopoulou 2003) and non - mediterranean countries (osler and schroll 1997, kouris - blazos 1999) have shown a decrease in overall mortality in relation to a high score evaluated by various types of mediterranean diet indexes. some of the studies had small samples (trichopoulou 1995 ; osler and schroll 1997, kouris - blazos 1999 ; lasheras 2000), whereas others had large samples of the population (trichopoulou 2003). the studies showed that a one point increment in the diet score was associated with a percent reduction in total mortality that ranged from 17% (trichopoulou 1995, kouris blazos 1999) to 31% (lasheras 2000) and that a two point increase in such a score reduced overall mortality by 25% (trichopoulou 2003). although the protective effect has been shown to be stronger for individuals older than 55 years, some authors reported benefits in young women as well (lagiou 2006). data from the seneca and fine studies conducted in europe also showed that a mediterranean diet score of 4 or more was associated with a lower risk of all - cause mortality (havenam - nies 2003 ; knoops 2004). moreover, a modified mediterranean diet score developed to take into account the different patterns in the use of added lipid in northern european countries showed that a two unit increment corresponded to an 8% reduction in overall mortality (trichopoulou 2005). when evaluating the role the mediterranean diet had on overall mortality in individuals suffering from a previous myocardial infarct, a higher adherence to mediterranean diet was also associated to lower overall mortality (trichopoulou 2005 ; iestra 2006). in a recent nationwide study on greek centenarians, on the other hand studies conducted in non mediterranean countries reported that their own healthy traditional diet was more accurate to predict longevity than a mediterranean style diet (waijers 2006). the results found in this review support the role investigators have attributed to the mediterranean diet. unfortunately, although the number of publications about the mediterranean diet and its health benefits is increasing (serra - majem 2006), the adherence to such dietary pattern is declining, even in the heart of the area where the seven countries study was conducted (kafatos 1997). as barzi (2003) remarks, when simple dietary advice adopted as therapeutic clinical intervention yields the type of results seen in the gizzi study, such advice should be translated into dietary guidelines and should be addressed not only to coronary patients but to the entire population, especially when such an intervention is as cost - effective as demonstrated (dalziel 2006). otherwise, such efforts are naught as there will be no application of the findings in terms of what component / s of the mediterranean diet is / are responsible for the health effects of such a dietary pattern.	the mediterranean diet is known to be one of the healthiest dietary patterns in the world due to its relation with a low morbidity and mortality for some chronic diseases. the purpose of this study was to review literature regarding the relationship between mediterranean diet and healthy aging. a medline search was conducted looking for literature regarding the relationship between mediterranean diet and cardiovascular disease (or risk factors for cardiovascular disease), cancer, mental health and longevity and quality of life in the elderly population (65 years or older). a selection of 36 articles met the criteria of selection. twenty of the studies were about mediterranean diets and cardiovascular disease, 2 about mediterranean diets and cancer, 3 about mediterranean diets and mental health and 11 about longevity (overall survival) or mental health. the results showed that mediterranean diets had benefits on risks factors for cardiovascular disease such as lipoprotein levels, endothelium vasodilatation, insulin resistance, the prevalence of the metabolic syndrome, antioxidant capacity, the incidence of acute myocardial infarction, and cardiovascular mortality. some positive associations with quality of life and inverse associations with the risk of certain cancers and with overall mortality were also reported.
from july 30 to august 20, 2002, a total of 5 persons in a group of 20 became ill with symptoms consistent with tick - borne relapsing fever during or following their visit to western montana (table). the common site of exposure was a cabin on the south shore of wild horse island (475030 n ; 1141230 w) in southwest flathead lake, lake county, montana. the 875-hectare island became a state park in 1978, although 56 privately - owned properties exist, many of which have cabins. no one lives permanently on the island, and camping overnight (by day visitors to the island) is not allowed. the island is approximately 4.6 km wide from east to west and 3.2 km wide from north to south ; its elevation varies from 881 m at the shoreline to its highest point of 1,141 m. the island is separated from the mainland by 2.0 km to the south and 2.4 km to the north. the habitats include ponderosa pine and douglas fir forests, native grassland, and steep rocky outcroppings. red squirrels (tamiasciurus hudsonicus) and deer mice (peromyscus maniculatus) are abundant. confirmed cases with demonstration of spirochetes in blood ; presumptive cases with appropriate manifestations but no spirochetes detected. ifa, immunofluoresence assay on july 22, the first of four related families arrived at the cabin, and on july 25, a 54-year - old man (case 1, table) entered the east end of the attic and removed nest material that had accumulated there. he slept at night and napped during the day in one of two bedrooms located immediately under the area of the attic where the nest material had been partially removed. on july 30, he became ill with fever, headache, arthralgia, myalgia, and rash, and 2 days later he visited the emergency room of a local hospital but a diagnosis was not made. over the next several days he improved, and on august 6, he and his family began driving back to their home in seattle, washington. during the trip, he relapsed with another febrile episode. that evening, he was taken to the emergency room of a seattle hospital and admitted early the next morning. on the basis of his history, a diagnosis of relapsing fever was considered, although spirochetes were not detected in the blood. three additional families (17 persons) arrived at the cabin on july 31 and on august 5 and departed on august 8 and 9. one family of five returned to their home in seattle, and three of them became ill on august 12, 17, and 20 (cases 24). relapsing fever was suspected immediately, and spirochetes were detected in wright - stained blood smears from two patients (cases 2, 3). on august 10, a family of six returned to st. louis, missouri, where a 13-year - old boy (case 5) became ill the next day. on august 12, his mother communicated with the family in seattle, where a young girl (case 2) was ill, and spirochetes had been detected in her blood. this discovery led to the detection of spirochetes in a blood smear from the boy. all patients had fever and other clinical manifestations consistent with tick - borne relapsing fever (table). blood smears from three of the seattle patients (cases 24) were prepared and stained separately with monoclonal antibodies h9724, which recognizes all known species of borrelia (11), and h9826, which is specific for b. hermsii (12), and rabbit hyperimmune serum to b. hermsii (figure 2a). indirect immunofluorescence assays (ifa) and microscopic analysis demonstrated spirochetes from two patients (cases 2, 3) that were reactive with all antibodies, which identified these bacteria as b. hermsii. blood from the third patient (case 4) was negative for spirochetes with all antibodies. edta - treated whole - blood samples from these patients were injected intraperitoneally into mice, and the two samples positive by microscopic examination also produced detectable levels of spirochetemia in mice. whole blood obtained from the infected mice was injected into modified kelly s medium (bsk - h supplemented with 12% rabbit serum ; sigma - aldrich corp., st. (a) borrelia hermsii in the blood of one patient (case 3) stained with rabbit hyper - immune serum and anti - rabbit fluorescein isothiocyanate. scale bar = 20 m. a convalescent - phase serum sample from the first case - patient (case 1) was collected 55 days after the onset of his illness. this sample was examined by ifa with whole cells of b. hermsii (13) and by immunoblot with a whole - cell lysate of b. hermsii and recombinant glpq (13). the patient s ifa titer to b. hermsii was positive at 1:1,024, and the sample was positive by immunoblot at 1:100 dilution. the five persons with confirmed or presumptive relapsing fever slept in two adjacent bedrooms in the east end of the cabin under the attic where animal nest material had been partially removed. people who slept only on the outside porch or in other bedrooms did not become ill. on august 24, 2002 the remaining nest material was collected from the attic and taken to rocky mountain laboratories. during the next several weeks, the material was processed with two small berlese extraction funnels, which separate live arthropods from nonliving debris. fourteen o. hermsi were recovered, including 1 larva, 10 nymphs, 2 males, and 1 female (figure 2b). the postlarval stages of o. hermsi are very similar to those of o. sparnus, which parasitizes woodrats and deer mice in utah and arizona, but the latter species is an incompetent vector of b. hermsii (14,15). voucher specimens (one nymph, one larva) of o. hermsi collected at the study site were deposited in the u.s. national tick collection, georgia southern university, under accession number rml 123385. the 12 remaining ticks were allowed to feed on a laboratory mouse to determine whether they were infectious. the blood of the mouse did not become spirochetemic during the 10 days after tick bite. these ticks were not examined for infection by other methods and were kept alive to establish a laboratory colony. on june 21, 2003, the attic, utility room, and bedrooms where the infected persons slept were treated with an over - the - counter insecticide - acaricide (ortho indoor insect fogger, the ortho group, columbus, oh). sentinel o. hermsi ticks (late stage nymphs and adults) from a laboratory colony were confined in open flasks in one treated bedroom (46 m) and a family room that was not treated to examine the efficacy of treatment. after the 4-hour application with two 141-gm cans of fogger, all 54 ticks in the treated bedroom were dead, whereas all 52 ticks in the untreated room were alive. tick - borne relapsing fever caused by b. hermsii is acquired only within the geographic range of its specific tick vector, o. hermsi. this tick has been found in southern british columbia, washington, idaho, oregon, california, nevada, colorado, and the northern regions of arizona and new mexico (2,4,16). as this and other outbreaks demonstrate, patients often become ill after they leave disease - endemic areas where they were bitten by infectious ticks (2,6). one patient (case 1) remained untreated early in his illness in spite of seeking medical attention at a hospital near the site of exposure. the cabin where the patients were infected has been owned by the same family for nearly 40 years. none of the members of the four related families questioned recalled any prior illnesses consistent with what they experienced with this outbreak of relapsing fever. the event that appears to have instigated this outbreak was the partial removal and disturbance of animal nest material in the east end of the attic. some ticks presumably fell through the spaces between the ceiling boards to the two bedrooms below. the boy (case 5) slept all but part of one night on the porch, but during the night of august 6 a thunderstorm forced him indoors, and he moved to the front east bedroom. louis was on the afternoon of august 11, which equates to an incubation period of approximately 4.5 days. the animals that maintained the enzootic cycle with b. hermsii and o. hermsi in the cabin are unknown. red squirrels are highly susceptible to infection with b. hermsii (17), are important hosts for these ticks (1), and were abundant in the forest surrounding the cabin. deer mice were routinely in the cabin, and the owners used poison bait stations to control the indoor population. one dead mouse was found near the cabin, and two carcasses were in the attic material that had been removed on july 25. american robins (turdus migratorius) had nested in the attic, and two dead robin chicks were found in the material collected from the attic on august 24. recently, a b. hermsii like spirochete was implicated in the death of a northern spotted owl (strix occidentalis) in kittitas county, washington (18), and many years ago, 26 o. hermsi were collected from the nest of a bluebird (either sialia mexicana or s. currucoides) in summerland, british columbia (19). the role of birds in perpetuating relapsing fever spirochetes and their tick vectors in nature is worthy of further investigation. a serologic survey of red squirrels and deer mice in the vicinity of the cabin for immunologic evidence of exposure to b. hermsii might also help explain the enzootic involvement of these rodents. this outbreak demonstrated for the first time that b. hermsii and its tick vector o. hermsi exist in montana and caused multiple cases of relapsing fever. owners of cabins in the vicinity of where the outbreak occurred met with the montana state epidemiologist and received information regarding the epidemiology and prevention of tick - borne relapsing fever. although the outbreak was localized, a large area of western montana has the appropriate ecologic parameters to support enzootic cycles that provide the potential for relapsing fever caused by b. hermsii to occur. a diagnosis of relapsing fever should therefore be considered when patients who have resided or vacationed in western montana seek treatment for a recurrent febrile illness.	five persons contracted tick - borne relapsing fever after staying in a cabin in western montana. borrelia hermsii was isolated from the blood of two patients, and ornithodoros hermsi ticks were collected from the cabin, the first demonstration of this bacterium and tick in montana. relapsing fever should be considered when patients who reside or have vacationed in western montana exhibit a recurring febrile illness.
leaf rust, caused by the heteroecious basidiomycete puccinia triticina eriks, is one of the most important diseases of wheat worldwide. serious yield losses can result as a consequence of its broad distribution and potential to develop rapidly under optimal environmental conditions. furthermore, the ability of p. triticina to form new races that can attack previously resistant cultivars, along with the capacity of fungal spores to travel long distances, can make full control of leaf rust difficult. due to its importance, epidemiological, genetic [2, 3 ], and molecular aspects [4, 5 ] of the disease have been studied extensively. as a consequence, the wheat - p. triticina interaction is well defined in genetic terms and stages of infection [4, 68 ]. scanning electron microscopy work by hu and rijkenberg identified important time points in infection structure formation by p. triticinia on susceptible and resistant lines of hexaploid wheat. after12 hours, the fungus has successfully penetrated into the stoma, formed substomatal vesicles (ssv), and primary infection hyphae are visible. after ssv formation, the primary infection hypha grows and attaches to a mesophyll or epidermal cell. at 24 hours postinoculation (hpi), a septum appears separating the haustorial mother cell from the infection hypha after which the fungus forms haustorium and penetrates the cell. nevertheless, numerous genes involved in the wheat - pathogen response have been identified. these include genes encoding leaf rust resistance, antifungal hydrolases such as glucanase and chitinase [10, 11 ], protein kinases, and enzymes involved in the production of reactive oxygen species [10, 13 ]. of the leaf rust resistance genes, lr1 is described as one of those conferring resistance to leaf rust low pathogenic races in wheat seedlings [2, 14 ]. until recently, however, molecular studies of the host response to pathogen attack were restricted to the analysis of a relatively small number of genes or proteins. this has changed with the development of high - throughput technologies, such as cdna and oligonucleotide microarrays that allow expression profiling of thousands of genes simultaneously. thus, microarrays represent important tools for the global analysis of many plant processes, including the response to pathogen attack [1520 ]. there are already a number of studies that have used cdna and oligonucleotide microarrays to characterize plant - pathogen interactions. arabidopsis cdna microarray analysis demonstrated a substantial network of regulatory coordination among different defence signaling pathways. in another study, microarray analysis of the arabidopsis transcriptome during systemic acquired resistance revealed groups of genes with common regulation patterns. for instance, oligonucleotide arrays were used to analyze maize challenged with the pathogen cochliobolus carbonum, barley challenged by blumeria graminis f. sp. hordei, and fusarium to identify genes that showed expression changes during the interactions. in wheat lines carrying the leaf rust resistance gene lr1, however, little is known regarding the expression of genes during differential responses following inoculation with compatible and incompatible races of the pathogenic leaf rust fungus p. triticina. in this report, we describe the development and use of a wheat cdna microarray to examine changes in gene expression in the wheat line rl6003 in response to challenge by compatible and incompatible races of p. triticina. wheat near isogenic line rl6003 (thatcher 6/centenario), carrying the lr1 leaf rust resistance gene, was used throughout the study because thatcher is known to strongly express the introgressed lr genes. seeds were sown in 12 cm diameter plastic pots filled with a 3 : 1 soil / sunshine professional growing mix 5 soil mixture (sun gro horticulture, vancouver, british columbia, canada), at a rate of one seed per pot. seedlings were maintained in a growth room at 20c with a 16-hour photoperiod and a photon flux density of approximately 145 mol ms. plants were inoculated at the 2 - 3 leaf stage with urediniospores of p. triticina virulence phenotypes bbb (incompatible) or tjb (7 - 2) (compatible) mixed with a light mineral oil (bayol - esso canada, oak bluff, manitoba, canada). twenty five l of a 16.6 mg uredinispores / ml of mineral oil inoculum were applied to each pot. seedlings were sprayed until runoff with the spore suspensions using a devilbis - type sprayer, connected to an air line and operated at a pressure of 17 kpa. control plants were sprayed only with mineral oil, referred to as mock inoculation. the inoculated plants were allowed to dry for at least 30 minutes to let the oil volatilize and then incubated overnight in a 100% humid chamber (percival model i-60d) (percival scientific, perry, iowa, usa). they were subsequently transferred to a growth chamber and kept under the conditions described above. four cdna libraries were constructed from either thatcher lr1 leaf tissue (4-leaf stage) sampled 24 hours after inoculation with p. triticina race bbb or developing seeds of glenlea sampled at 5, 15, or 25 days postanthesis. plasmid dna, pbk - cmv (stratagene, la jolla, calif, usa), and psport 6.0 (invitrogen, burlington, ontario, canada), respectively, for the leaf and seed libraries, were isolated using the perfect prep direct bind kit (eppendorf, hamburg, germany), adapted for the qiagen 3000 liquid handling robot (qiagen, mississauga, ontario, canada). est sequencing was performed with m13f and m13r universal primers using the big dye v2.0 (abi, foster city, calif, usa) and resolved on an abi 377 genetic analyzer. high - quality sequence was obtained using the softwares phred and cross_match (default settings except for minscore = 20 and minmatch = 12). a total of 24 959 ests were obtained from the libraries and were submitted to genbank (accessions be417910-be418911, bg903972-bg910140, bq619578-bq620868, bq235898-bq252370, es316459). the sequences were assembled using cap3 software (default parameters except overlap length cutoff = 40 and overlap identity cutoff = 95), and in combination with some manual annotations, a unigene set of approximately 12 500 sequences was identified. plasmids of the unigene set members were used as template for pcr amplification of the inserts using universal m13 primers. amplicons were visualized on agarose gels and selected for use on the microarray based on their quality and uniqueness. a subset of 7728 selected amplicons was consolidated to 384-well plates and purified using multiscreen 384 pcr filtration plates (millipore, nepean, ontario, canada). aliquots of the purified products were run on 1% (w / v) agarose gels, sized and quantified using known amounts of lambda hind iii markers. they were then diluted in 1 microspotting plus solution (telechem, sunnyvale, calif, usa) to a final concentration of 100 ng/l. a total of 384 controls provided with the spotreport-3 (stratagene) kit, consisting of arabidopsis cab, rbcl and rca genes, human -cell actin gene, cot-1, ssdna and polya, as well as wheat cab, rbcl, rca, and human -cell receptor genes, were also included as were 96 empty wells. all 8208 samples were printed by telechem onto superamine substrates according to the company standard procedures (www.arrayit.com) in 48 blocks of a 19 18 array using side - by - side double spotting. approximately 1 g of leaf tissue was frozen in liquid n2 and ground to a fine powder with a mortar and pestle. total rna was extracted using the rnawiz isolation reagent (ambion, austin, tex, usa) and fursther purified using rneasy columns (qiagen), according to manufacturer 's instructions. fluorescent probes were synthesized by reverse transcription of the rna in the presence of cy3-dctp or cy5-dctp (amersham biosciences, baie - d'urf, quebec, canada), using a modification of the protocol for the preparation of unamplified cdna. each labeling reaction was performed in a 40 l volume containing 10 g total rna, 0.75 g oligo(dt)1218 (invitrogen), 500 m each of datp, dgtp, and dttp, 50 m dctp, 25 m of either cy3-dctp or cy5-dctp, 8 l of 5 superscript ii first strand buffer (invitrogen), 10 mm dithiothreitol, and 40 u of rnasin rnase inhibitor (promega, madison, wis, usa). the reaction mixture was heated at 65c for 5 minutes and then cooled to 42c. four hundred units of superscript ii reverse transcriptase (invitrogen) were added, and the labeling reaction was allowed to proceed for 2 hours at 42c. the rna was then degraded by treatment with 5 l of 50 mm edta (ph 8) and 2 l of 10 n naoh at 65c for 20 minutes. after the addition of 4 l of 5 m acetic acid, the mock and tjb (mt) or mock and bbb (mb) samples were pooled, and the cdna was precipitated by the addition of one volume of isopropanol. the pellet was washed with 70% ethanol, air dried, resuspended in 5 l of nuclease - free water, and added to 60 l of digeasy hyb solution (roche, indianapolis, ind, usa) containing 0.45 g of yeast trna and 0.45 g of denatured salmon sperm dna. slides were prehybridized by incubating for 45 minutes at 42c in a preheated solution of 5 ssc, 0.1% (w / v) sodium dodecyl sulfate, and 1% (w / v) bovine serum albumin. denatured dual cy3/cy5-labeled target cdnas were added directly to each slide and sealed under a 22 mm 60 mm hydrophobic coverslip (sigma - aldrich, oakville, ontario, canada). microarray slides were placed on top of support slides in a slide staining box (diamed, west chester, pa, usa) containing approximately 20 ml digeasy hyb at the bottom, and incubated at 42c for 18 to 20 hours. after hybridization, the slides were quickly rinsed with 1 ssc (until coverslips fell off), washed three times with 1 ssc and 0.1% sds (w / v) for 10 minutes at 50c, then washed three more times with 0.1 ssc for 1 minute at room temperature. the slides were dried by centrifugation and scanned for fluorescence emission using a genepix 4000b scanner (axon instruments, union city, calif, usa). photomultiplier (pmt) voltages were adjusted manually to balance the amount of red and green signals in the images obtained. feature intensities were quantified using genepix pro 5.1 array analysis software and acuity 4.0 (axon instruments). microarray spots flagged as bad, not found, or with specific unwanted feature parameters were removed automatically by imposing stringent filtering criteria to the entire microarray dataset (acuity criteria dia 60 and circularity 80). the log2 median (logm) ratio of expression values for genes, incompatible versus mock (mb) and compatible versus mock (mt), that met the filtration criteria and were found in both treatment sets, was subjected to further statistical analysis. an analysis of variance using the sas procedure mixed (sas, cary, nc, usa) was carried out on the (logm) ratio data for incompatible (mb) and compatible (mt) interactions, and contrasts were used to identify genes with significant differences in expression at one or more time points as defined by their p values. the model included compatibility type (mb or mt), time, and the interaction between compatibility type and time. main plots were replicate by interaction type (representing mb or mt pairs of batches of inoculum) in a randomized complete block arrangement, and subplots were individual slides. genes with a significant f value (f.055) for a contrast between interaction type by time were selected and verified by resequencing the dna used to create the spot on the microarray. in addition to the anova, a t test was used to determine at which time point(s) the treatments yielded significantly different expression values (p.05). putative gene function was assigned based on blastx analysis against the genbank nonredundant protein database. the best hit with an e value less than or equal to 1 10 was used to assign the est annotation. in some cases, the second best hit had a more informative description of the gene function and was used to assign an annotation. if a significant blastx hit could not be found, then the annotation from the dana - farber cancer institute (dfci) wheat gene index cluster that contained the est was used http://compbio.dfci.harvard.edu/tgi/, if available. gene ontology (go) annotation was performed by using blastx to compare wheat genes to the predicted protein sequences for arabidopsis thaliana from the arabidopsis information resource (tair) genome release version 6. the best hit with an e value less than or equal to 1 10 was used to assign the ests an arabidopsis homolog and the tair annotation tool was used to place the genes into go categories. to unravel global changes in the host transcriptome during leaf rust interactions, wheat rl6003, which carries the lr1 resistance gene, was challenged with two different races of the leaf rust fungus, puccinia triticina. virulence phenotype bbb carries the avirulence gene avr lr1 and provokes an incompatible reaction on rl6003, while race tjb lacks the avirulence gene and therefore produces a compatible interaction. the tjb interaction displayed a compatible 3 + 4- infection type characterized by large pustules and abundant sporulation while interaction with bbb yielded an incompatible ; 1- infection type (figure 1). the presence of small pustules or no sporulation was typical of a hypersensitive response (hr). no symptoms were observed on mock - inoculated seedlings (figure 1). to identify genes whose expression profile can distinguish compatible from incompatible interactions, we designed an experiment using the pathosystem outlined in the previous section : one host genotype, rl6003, inoculated with the two rust races, bbb and tjb, each compared to a mock control sample. infection ensued and samples were taken at four time points : 3, 6, 12, and 24 hpi. sequences on the microarray were taken from an assembly of approximately 12 500 unigenes generated from an est set of 24 959 sequences. parameters to the assembly program, cap3, were the same as those used by tigr for its unigene assemblies (www.tigr.org). these parameters favoured assembly of homoeologous genes into single sequences without the inclusion of paralogous genes. spots met the filtration criteria outlined in the materials and methods, 4439 of which were shared between the mb and mt datasets and were used for statistical analysis. statistical analysis of the microarray data using sas and confirmation of the identity of ests by sequencing revealed 192 genes that were significantly differentially regulated across at least one of the four times points between the compatible and incompatible interactions (p.055 for the pathogen type by time interaction anova effect)supplementary table 1 available online at doi:10.1155/2007/17542). seventy one percent of the genes had different expression values between the two treatments, as determined using tests (p.05), at a single time point, 18% of genes showed differential expression at 2 time points, and 1% at 3 time points, while no genes in this set were differentially expressed at all four of the time points investigated. at 6 hpi, 46% of the genes were differentially expressed, followed by 40% at 24 hpi. the 3- and 12-hour time points showed much less differential gene expression at 11% and 10% of the genes, respectively. using blast analysis, we were able to assign, with various degrees of confidence, a potential function to 150 of the differentially regulated genes. forty two gene sequences did not share sequence homology to any sequences in the genbank nonredundant protein database at our threshold e value (1 10 5), and therefore, no annotation could be assigned. gene ontology (go) annotation was performed using the tair annotation tool and the genes were placed into goslim categories (figure 2). molecular function assignment revealed members in a broad range of categories (figure 2(a)) including those genes with putative hydrolase activity, nucleotide binding activity, and protein binding activity. the differentially regulated genes were also members of a variety of cellular components with a large representation from the chloroplast and mitochondria (figure 2(b)). the biological process go assignment illustrated that genes involved in protein metabolism, electron transport or energy pathways, and response to abiotic / biotic stimuli were well represented in our dataset (figure 2(c)). of the 7728 cdnas spotted on the chip, 2142 came from the p. triticina challenged est library raising the possibility that some of the cdnas spotted to the array were fungal in origin. of the 2142 ests, only 2 sequences found a significant match (e value < 1 10) against the phytopathogenic fungi and oomycete est database available from cogeme (http://cogeme.ex.ac.uk) and had no match against ests from non - p. comparison of the 2142 ests to an in - house p. triticinia library of over 40 000 ests (bakkeren, unpublished) found that 22 had significant matches to fungal sequence using blast (e value < 1 10). of these, only one was found to be differentially expressed in this study, and closer examination revealed that the sequence (talr1013e06r) was a gene from a conserved pathway and had stronger homology to a rice gene than to the fungal sequence. a number of genes involved in the energy status of the cell were differentially regulated. for example, the interaction between rl6003 and an incompatible or compatible rust race produced a differential expression pattern for ribulose 1,5-bisphosphate carboxylase / oxygenase (rubisco) small subunit (talr1140f12a, talr1150f09f). rubisco is the main source of energy production for the plant cell, generating atp and reductive potential (nadph) through photosynthesis. in the incompatible interaction, the expression of the gene was reduced at 6 hpi but returned to levels identical to the mock inoculation at 12 and 24 hpi. the compatible interaction, however, was characterized by a strong increase in the transcription of the rubisco small subunit at 24 hpi (figure 3). along with differential expression of rubisco, there was a change in the transcription of its major regulatory protein, rubisco activase (talr1173g10f, talr1175g08f). at 3 hpi, there was a small reduction in the transcription of rubisco activase relative to basal levels for both the compatible and incompatible interactions. at 6 hpi the plants involved in an incompatible interaction continued to repress the expression of rubisco activase, while in the compatible interaction, expression of the transcript returned to near basal levels. chlorophyll a / b - binding protein genes (talr1131b12a, talr1142e01a, and talr1167e07a), an ftsh like aaa - metalloprotease (talr1134f10f), and a photosystem ii phosphoprotein (talr1130a12a) were down regulated at 6 hpi in the incompatible interaction relative to basal and compatible interaction levels. in both treatments, the expression of these genes was at basal levels for the other time points. an important enzyme involved in photorespiration, glycolate oxidase (talr1162d03a), was also found to be differentially regulated. its expression was repressed at 3 and 6 hpi in plants involved in an incompatible interaction but not in a compatible one. the production of reactive oxygen species (ros) is central to the defence mounted by plants in reaction to challenge with an incompatible pathogen [31, 32 ]. shortly after challenge, the plant produces an oxidative burst which is believed to have three roles : (i) induces damage on the invading organism, (ii) bolsters structural defences, and (iii) acts as a biochemical signal to induce other defence mechanisms in the plant. the production of ros presents a challenge to a plant because of the damage these compounds can cause to its own proteins, dna, and other cellular components. the plant must therefore invoke a balanced system that produces ros for defence at the same time as a number of antioxidants to protect against oxidative damage. ascorbate peroxidase (apx : tae25014d09f), a central component of the ros scavenging system, was differentially expressed in the compatible and incompatible interactions. at 6 hpi, transcription of apx in plants challenged by the incompatible race was significantly upregulated relative to transcription in those challenged by the compatible race (figure 4). another critical protein for maintaining redox balance in the face of oxidative stress is glutathione, which acts as ubiquitous supplier of reduction power for cellular processes. glutathione is a conjugate of cysteine and glutamate and therefore relies on both of these amino acids for synthesis. cysteine synthase (tae25012d06r) is the final catabolic step in the production of cysteine and was found to be differentially regulated between the two treatments (figure 4). plants in an incompatible interaction increased the transcription of this gene at 6 hpi, while those in a compatible interaction reduced it. at the 12-hour time point, the incompatible plants had reduced transcription of the gene relative to basal levels while the compatible plants had upregulated transcription. recognition of p. triticina infection by rl6003 occurs through a gene - for - gene system where resistance only occurs if the plant possesses an r - gene encoding a product able to detect the presence or action of a specific avirulence factor (avr - gene) produced by the pathogen [3335 ]. if either of these components is missing, the plant is unable to mount an effective defence against the invader. r - genes identified to date fall into five different categories and commonly contain a leucine - rich repeat region (lrr), a domain known to be involved in protein - protein interactions. a significant portion of the microarray cdna content used in this study was derived from a library of rl6003 (thatcher lr1) leaf tissue collected 24 hpi with an incompatible p. triticina race. although we have recently confirmed (by cloning of lr1 in a separate study) that lr1 was not present on the array (unpublished data), three of the differentially regulated genes identified in our experiment nevertheless contained lrr domains, two of which are of the nbs - lrr class of r - genes (tae05012c12f, talr1134c01r). there did not appear to be a coordinated pattern of expression among these three genes at the time points tested (supplementary table 1). recently, a cyclophilin was found to be necessary for host - pathogen recognition in a. thaliana. a cyclophilin - like protein (tae25043b07r) was differentially regulated in our experiment and it shared an expression profile very much like that of one of the identified nbs - lrr genes (tae05012c12f, figure 5). two other disease - associated genes were also identified, an mlo4-like gene (talr1140f02a) and a multidrug resistant - associated protein 1-(mrp1-) like gene (talr1143b08f). they were generally repressed in this treatment, with the strongest repression at 6 hpi. in the compatible interaction, initial repression of these genes occurred at 3 and 12 hpi, but returned to near - basal levels at the other time points (figure 6). these include ubiquitin associated proteins (tae05010c02f, tae15029b06r, and tae012c02a), a ubiquitin conjugating enzyme (tae25042d03a), and components of ubiquitin ligase complexes (tae05014d09f, tae15001b10r). there did not appear to be a coordinated expression pattern among the differentially expressed ubiquitination components. in addition to genes already mentioned, a large collection of genes with an identified role in disease or stress response were significantly differentially regulated between plants challenged with incompatible and compatible races of p. triticina. components of the shikimate - phenylpropanoid pathway, caffeoyl - coa - o - methyltransferase (tae05029c04f), 3-deoxy - d - arabino - heptulosonate 7-phosphate synthase (talr1013e06r), farnesyl - pyrophosphate synthetase (talr1161d04r), and udp - glucose glucosyltransferase 1 (talr1148b05f), revealed differential transcription patterns as did genes involved in signal transduction (myb - like transcription factor tae05012h07f, wrky11 transcription factor talr1159c08f, calmodulin talr1021e02r, mitogen activated protein kinase kinase talr1106b01r, and phosphatidylinositol-4-phosphate 5-kinase - like gene tae05025c08f), and stress - associated genes such as heat shock proteins (hps70tae05013a12r, hsp80tae05005c08a), osmotic control genes (betaine aldehyde dehydrogenase tae25007b01r, s - adenosylhomocysteine hydrolase 2talr1174g05r, clc - f chloride channel to gain insight into the transcriptional changes that occur in incompatible and compatible reactions of the wheat isogenic line, rl6003, challenged with avirulent and virulent races of the leaf rust pathogen p. triticina, we conducted a cdna microarray gene - profiling experiment. in this study, we used an anova to identify 192 wheat genes that showed differential expression profiles resulting from two different pathogen challenges. our results revealed a clear differentiation between incompatible and compatible interactions and led to the identification of differentially regulated genes putatively involved in defence reactions. we examined four time points early in the infection stages of virulent and avirulent races of p. triticinia on the wheat line rl6003. at 6 and 24 hpi, 46% and 40% of the differentially expressed genes, respectively, were found to have different degrees of change between the two pathogen treatments. in contrast, only 11% and 10% of genes were differentially expressed at 3 and 12 hpi. upon inoculation, p. triticinia urediospores germinate within hours on the wheat leaf surface, form a germ tube, and grow until a stomatal guard cell is reached. at this point, the fungus forms an appressorium over the stoma, enters by force into the substomatal space, and creates a substomatal vesicle. the fungal growth into the intercellular space occurs at 6 hpi and coincides with the highest differential gene expression in our study. at 24 hours, when 40% of the identified genes reveal changes in expression, the fungus has already produced a septum which separates the primary infection hypha from the newly formed haustorial mother cell which initiates contact with adjacent mesophyll or epidermal cells as shown by hu and rijkenberg. those authors have studied the infection process of p. triticinia on susceptible (thatcher) and resistant wheat lines (rl6040 which contains the lr19 leaf rust resistance gene and rl6043 which contains the lr21 leaf rust resistance gene) of wheat and no significant differences were observed between the three lines during these early infection events. moreover, very similar results were obtained during p. triticinia infection of nonhost species such as maize, oat, sorghum, and barley. based on these studies, it is likely that the growth of the two races of p. triticinia used on rl6003 in this study invoke very similar responses during the early infection stages as that of the p. triticinia races used by hu and rijkenberg on other resistant wheat lines. if this is the case, rl6003 was responding to the leaf rust pathogen before any cellular penetration had occurred. this suggests that the plant is able to perceive fungal movements on the leaf surface and past the guard cells, possibly through cell membrane rearrangements or cell wall degradation products caused by compounds excreted by the fungus. our early stage data for differential expression of host genes contrast the findings of caldo. where no differences in expression among barley genes were observed up to 16 hpi after treatment with blumeria graminis f. sp.hordei. those authors found differential gene expression only during the stages involving haustoria - plant epidermal membrane contact. however, differential plant gene expression has been detected in other plant systems during the initial hours of pathogen infection [19, 40, 41 ]. this study is therefore the first to show such early differential gene expressions in wheat using the pathogen p. triticinia. resistance of wheat genotypes to leaf rust pathogens can often be attributed to a gene - for - gene interaction. in general, its visible defence response, the hypersensitive response (hr), reflects a multitude of metabolic changes in affected cells [42, 43 ] and results in localized plant cell death. rl6003 challenged with an incompatible race of p. triticinia exhibits an hr (figure 1) and it is believed to be mediated through pathogen elicitor detection by lr1. one of the hallmarks of the hr disease response is the generation of reactive oxygen species (ros) in an oxidative burst across the plasmalemma of plants cells, perturbing the redox state of cells and allowing controlled oxidation, which may have an immediate antimicrobial effect [4345 ]. in asparagus sprengeri mesophyll, hr induction by a g - protein activator, mastoparan (mp), resulted in significant changes in photosynthesis. the authors demonstrated that during the elicitor - induced hr and oxidative burst, light was stimulating the hr, that o2 evolution ceased due to a disruption of photosystem ii (psii) and electron transport and that photosynthesis was eventually inhibited by mp. recent work to identify ests involved in a rice - rice blast fungus interaction found that transcription of photosynthetic genes, such as ribulose 1,5-bisphosphatase carboxylase (rubisco), photosystem i-(psi-) associated genes, psii - associated genes, and chlorophyll a / b - binding protein (cab) genes, were suppressed in both resistant and susceptible interactions. in soybean, it has been shown that in addition to known defence regulated genes, challenge with pseudomonas syringae induced a rapid downregulation of photosynthesis and that this effect was hr specific. in their study, zou. found that chloroplast - related genes had reduced expression 8 hours after challenge and found a decrease in psii activity and an interruption in the photosynthetic electron transport chain. it is speculated that the over - reduction of psii components and an interruption of electron transport result in electron leakage and the formation of ros [19, 41, 46 ]. our data also identified photosynthesis - related genes that were downregulated during pathogen challenge (figure 3). six hours after inoculation, we observed a coordinated decrease in transcription of these genes in the resistant but not susceptible interactions. if this decrease in photosynthetic gene expression is linked or due to the hr as observed in other studies [40, 41, 46, 47 ], one may reasonably ask what would be the purpose ? six hours into the infection, the fungus has just entered the substomatal space and has yet to directly invade a mesophyll or epidermal cell. if the decrease in photosynthesis is used to generate ros for an oxidative burst, then this burst does not likely have any antimicrobial activity since p. triticinia growth is identical in the first 24 hours of infection in susceptible and resistance reactions with wheat. one of the key enzymes involved in removing h2o2, apx, was identified as being differentially expressed in our study. although apx has been shown to be translationally inhibited during programmed cell death, based on its expression profile in this study, we speculate that the cellular h2o2 concentration increased 6 hours after challenge with an incompatible race of p. triticinia and that apx levels were likely increased in an attempt by the cell to curtail oxidative damage. if ros are generated at this stage, it is more likely that they act on nonhost defence responses and have a role in cellular fortification, intercellular signaling, or act to change the redox state of the cell for regulatory purposes. additional experiments to measure ros generation during the wheat - rust interaction would be needed to determine if an oxidative burst is occurring at 6 hpi. the interruption in the electron transport chain in the chloroplast during the hr is believed to be mediated by a zn - dependent aaa - metalloprotease called ftsh. during stress, a component of psii, d1, can become damaged and has to be replaced by a newly synthesized d1 protein in order to restore psii function. ftsh degrades damaged d1, allowing for a functional version of the protein to take its place [49, 50 ]. we identified a wheat aaa - metalloprotease ftsh - like gene (talr113410f) with reduced expression in the incompatible reactions at 3 and 6 hpi. where the expression of a chloroplast ftsh protein was reduced and electron transport interrupted 6 hours following the induction of an hr by tobacco mosaic virus. those authors believed that the disruption of photosynthesis perturbed cellular homeostasis (possibly by consuming reductive power) which accelerated the hr. they suggested that it was also possible that reducing photosynthesis reduced sugar production, limiting the food source for the invading pathogen. it seems likely that the downregulation of photosynthesis and the interruption of the electron transport chain may be conserved features of the defence response to pathogen challenges as it is shared by rice, tobacco, and soybean and we observed evidence of this mechanism in wheat. plant responses to biotic stress involve multiple interlinked regulatory pathways that transduce suitable signals for efficient defence reactions [33, 34, 42, 51, 52 ]. in addition to the ros pathway described earlier, our microarray profiling detected a number of genes in the shikimate and phenylpropanoid pathways that were differentially regulated. the shikimate pathway leads to the biosynthesis of phenylpropanoid, phytoalexins (terpenoids, flavonoids), lignin, and salicylate which are main secondary metabolites of the disease resistance machinery [18, 53 56 ]. our analysis identified that 3-deoxy - d - arabino heptulosonate-7-phosphate synthase, the entry point into the shikimate pathway, was differentially regulated between the two pathogen treatments. at 6 hpi, transcription was found to be increased in the incompatible interaction but the greatest difference occurred at 24 hpi when the expression was increased in the compatible interaction and downregulated in the incompatible interaction. other components downstream in the shikimate - phenylpropanoid pathway were also differentially regulated, such as 3-beta hydroxysteroid dehydrogenase - isomerase, which is involved in metabolism of alkaloids, caffeoyl - coa o - methyltransferase, which is involved in lignin biosynthesis and cell wall fortification, and farnesyl - pyrophosphate synthetase, which is involved in the biosynthesis of terpenoid compounds. all of the genes identified in the shikimate - phenylpropanoid pathway had their strongest expression in plants challenged with a compatible pathogen. this may illustrate an important distinction in the lr1 pathosystem in which the plants involved in an incompatible interaction dedicate cellular resources to redox systems, as evidenced by early expression of ros enzymes and downregulating photosynthetic genes, while plants in a compatible interaction trigger nonspecific defence responses, such as cellular fortification and alterations in their secondary metabolism. in our data, we identified three genes that contain lrr domains, regions involved in protein - protein interactions, and two of the three were of the nbs - lrr class, with homology to putative r - genes, although neither of them encodes the lr1 gene (unpublished data). one of the nbs - lrr genes (tae05012c12f) shares homology with the rice protein xa1, which confers bacterial blight resistance. interestingly, yoshimura. showed that xa1 expression was induced by wounding and pathogen attack, which prompted the authors to speculate that xa1 may be involved in enhancing the disease response to bacterial blight. although it is not responsible for avr lr1 recognition, this xa1-like nbs - lrr gene may be activated to serve a similar purpose, which is the enhancement of the defence response ; it is possible that other, yet undescribed, fungal factors present in race bbb interact with this resistance - like gene. plants in the incompatible interaction showed a spike of induction of this gene at 6 hpi, which coincided with the expression of other defence systems genes. it was also recently found that a cyclophilin protein plays a role in an r - gene signaling pathway. the bacterial effector, avrrpt2 from pseudomonas syringae, relies on an arabidopsis cyclophilin to initiate its protease activity. once activated, avrrpt2 cleaves rin4, which is then recognized by the nbs - lrr protein rps2 and triggers an incompatible response. in our study, a wheat cyclophilin had a nearly identical expression pattern to that of the xa1-like gene (figure 5) and may indicate that they operate in the same pathway and that this method of avr - gene activation described in a. thaliana exists in wheat. the recognition of invading pathogens activates a signal cascade that leads to a change in gene expression. a number of important components in the transduction of stress and disease signals have been identified. these include several mitogen - activated protein (map) kinases, map kinase kinases, and transcription factors [58, 59 ]. our data revealed coordinated expression among components involved in map pathway signaling, transcription factors, and genes that have been found to be expressed during a disease response. their coordinated expression may indicate that these genes operate in the same signal transduction pathway. plant defence response to pathogen attack can also include the modification of proteins by ubiquitin [60, 61 ]. many members of the ubiquitination cascade were found differentially regulated in our experiment, including ubiquitin activating enzymes, ubiquitin conjugating enzymes, and components of scf ubiquitin ligase complexes. despite the lack of a unified expression profile among the members of the pathway, it is clear that the process of protein modification by ubiquitin plays a role in the disease response of wheat to races of p. triticinia. there were a number of genes identified in this study that have protein products regulated by changes in the redox state of the cell : apx, glycolate oxidase, rubisco activase, rubisco, plastid glucose-6-phosphate dehydrogenase, and 3-deoxy - d arabino heptosonate-7 phosphate synthase. it is likely that, in addition to regulating protein activity, the reductive power of the cell plays an important role in regulating the transcription of these genes, possibly through a feedback mechanism involving an interruption in the photosynthetic apparatus. we also observed that a number of genes were differentially expressed from basal levels in both treatments but at different time points. in the incompatible response, these genes were differentially regulated relative to basal level at 6 hpi while in the compatible response the transcriptional differences occurred at 12 hpi. the reason for this difference is unknown but it is tempting to speculate that the coordinated expression of pathways at 6 hpi rather than simply the induction or suppression of defence pathways at early stages of infection might determine the outcome of the pathogenic interaction. a microarray experiment examining gene expression differences between compatible and incompatible interactions of p. syringae and a. thaliana found that the expression of genes in the early hours of the incompatible infection resembled the expression of the same genes at much later stages in the compatible interaction. they stated that this may indicate that incompatible and compatible interactions share signaling pathways but are induced at different times. to determine if this is the case between wheat and leaf rust as well, additional expression profiling experiments over a broader time span would need to be performed. it is not known that the gene expression changes that were measured at the early stages of infection lead to the induction of hr. it could be that the induction did not occur until later in the infection process. the possibility exists that this study did not measure thatcher lr1 undergoing compatible and incompatible reactions due to the presence or absence of the avr lr1 gene, but instead measured differential expression due to other genetic difference that exists between fungal races bbb and tjb. however, given that many of the genes identified in this study are differentially expressed during the hr and gene - for - gene recognition responses in other systems, it is likely that the start of the incompatible and compatible reactions due to avr lr1 lr1 was being observed. taken together, this study allowed us to show that phenotypic differences between the incompatible and compatible interactions in the wheat near - isogenic line rl6003/p. triticinia pathosystem are also reflected by differential expression of mrna transcripts that occur very early after infection. enzymes involved in photosynthesis and in the scavenging of reactive oxygen species, signal transduction and ubiquitination, as well as those of the shikimate - phenylpropanoid pathway, are strongly implicated as key determinants in rl6003 metabolism against incompatible pathogenic fungi. these findings indicate that synergistic and conserved strategies are utilized by the incompatible wheat host to fight against p. triticina.	in this study, we detail the construction of a custom cdna spotted microarray containing 7728 wheat ests and the use of the array to identify host genes that are differentially expressed upon challenges with leaf rust fungal pathogens. wheat cultivar rl6003 (thatcher lr1) was inoculated with puccinia triticina virulence phenotypes bbb (incompatible) or tjb (7 - 2) (compatible) and sampled at four different time points (3, 6, 12, and 24 hours) after inoculation. transcript expression levels relative to a mock treatment were measured. one hundred ninety two genes were found to have significantly altered expression between the compatible and incompatible reactions. among those were genes involved in photosynthesis, the production of reactive oxygen species, ubiquitination, signal transduction, as well as in the shikimate / phenylpropanoid pathway. these data indicate that various metabolic pathways are affected, some of which might be used by rl6003 to mount a coordinated defense against an incompatible fungal pathogen.
for intracellular pathogens whose proliferation requires nutritional supplies from the host cell cytosol, the death of the cell before the completion of a productive infection is disastrous. furthermore, cells actively executing the apoptotic processes often secrete chemical signals or display specific molecules on their surface so that phagocytes can recognize and engulf them, leading to the termination of infection. even if such engulfment did not occur, pathogens released prior to mature infection often are not primed for the second round infection and can be recognized and destroyed more easily by the immune system. therefore, it is not unexpected to learn that hijacking host cell death pathways constitutes an important pathogenic strategy for almost all well adapted intracellular pathogens. as detailed in the several excellent articles of this review series, legionella pneumophila is a facultative intracellular pathogen that uses similar strategies to replicate in phylogenetically distant eukaryotic cells, ranging from amebae to human alveolar macrophages. within these evolutionarily distant host cells, the l. pneumophila - containing vacuole (lcv) undertakes a unique maturation pathway characterized by the evasion of endocytic fusion and the interception of membrane trafficking vesicles originating from the endoplasmic reticulum (er ; isberg., 2009 ; hubber and roy, 2010). as the bacterium begins to multiply, active acquisition of membrane materials from the er - derived vesicles compensates the expansion of the lcv. the result of such remodeling is the formation of a compartment morphologically and cell biologically resembling the er (isberg., 2009). whereas the interaction with the host membrane trafficking pathways is probably the best understood process during intracellular l. pneumophila growth, it is becoming clear that modulation of several other pathways, including lipid metabolism, autophagy, ubiquitination, and host cell death, is also critical for successful infection (hubber and roy, 2010). to accomplish this feat, l. pneumophila delivers more than 200 bacterial proteins via the dot / icm type iv secretion system into host cells where they engage in distinct host pathways to facilitate the biogenesis of the lcv permissive for bacterial replication (ensminger and isberg, 2009). here, i will discuss recent progress in the interplays between l. pneumophila and the host cell death pathways and how such interplays contribute to successful bacterial infection in mammalian cells. in mammalian cells, programmed cell death is divided into at least four categories : apoptosis, pyroptosis, necrosis, and necroptosis (fink and cookson, 2005 ; vandenabeele., 2010). apoptosis is the best characterized programmed cell death mode ; it plays critical roles in development, maintaining tissue homeostasis, shaping the immune repertoire, and restricting the progress of infections (danial and korsmeyer, 2004). this cell death mode can be initiated by two distinct but partially overlapping pathways : the extrinsic, receptor - mediated pathway and the intrinsic mitochondrial pathway (salvesen and riedl, 2008). in both cases, biochemical cascades triggered by extracellular ligands or intracellular damage led to the activation of caspases, which are a family of cysteine - dependent aspartate - specific proteases. these enzymes mediate most of the apoptotic program and some of them can be blocked by inhibitor of apoptotic proteins (iaps ; scott., 2005). the mitochondrion is the central controlling site for the intrinsic apoptotic pathway because it harbors cytochrome c and second mitochondrion - derived activator of caspase (smac or diablo). the release of cytochrome c into the cytosol leads to the assembly of a supramolecular complex known as the apoptosome, which initiates the caspase activation cascade (riedl and salvesen, 2007). in parallel, smac neutralizes the caspase - inhibitory activity of xiap, thereby indirectly contributing to the maximal activation of the caspase cascade (riedl and salvesen, 2007). the release of these two apoptosis - initiating molecules is caused by perturbation of the integrity of the outer mitochondrial membrane (omm), which is delicately regulated by members of the bcl-2 protein family. based on their roles in controlling apoptosis, bcl-2 family proteins can be divided into two subsets : pro- and anti - apoptotic molecules. members of this protein family can form homo- as well as heterodimers (chipuk., 2010). indeed, the formation of heterodimers between pro- and anti - apoptotic members, a process that alters the cellular ratios between these two subsets of proteins, determines at least in part the susceptibility of cells to a death signal (cory and adams, 2002). first, they possess up to four conserved bcl-2 homology (bh) domains, designated bh1, bh2, bh3, and bh4 (chipuk., 2010) ; however, a number of pro - apoptotic bcl-2 family proteins, such as bid, bim, bad, and bnip3 contain only the bh3 domain and are classified as the second, most members of this protein family contain a carboxy - terminal hydrophobic domain, which in many cases is critical for their biological activities by membrane insertion and membrane remodeling (lomonosova and chinnadurai, 2008). upon sensing cell stress caused by various insults such as dna damage, cytokine deprivation, or infection, these bh3-only proteins trigger the insertion of the two pro - apoptotic, pore - forming proteins bax and/or bak, into the omm (chinnadurai., 2008), causing the release of the cytochrome c and smac. members of the pro - survival proteins, including bcl-2, bcl - xl, and mcl1, inhibit apoptosis by directly sequestering bak, bax, and bh3-only proteins to prevent permeabilization of omm (chipuk., 2010). apoptosis plays an important role in the defense against pathogens on the level of both the reaction of an individual host cell to an invading microorganism and the reacting immune system (creagh.,, successful pathogens have evolved different but often equally effective mechanisms to manipulate host cell death pathways to benefit their proliferation. such manipulation can be achieved by targeting the activity of one or more host proteins critical in each step of the apoptotic pathways. for example, many viruses code for proteins that specifically inhibit apoptosis of infected cells by directly interacting with pro - apoptotic members of the bh3-only proteins (roulston. similarly, some obligate intracellular bacterial pathogens such as chlamydia trachomatis and rickettsia rickettsii actively inhibit apoptosis (clifton., 1998 ; fan., 1998) of particular interest is that c. trachomatis prevents infected cells from undergoing apoptosis by specifically degrading members of the pro - death bh3-only proteins (dong., 2005), probably by the chlamydia protease - like factor (cpaf ; accumulating evidence indicates that l. pneumophila is able to manipulate host cell death pathways by targeting regulatory molecules with diverse mechanisms at different points of the signaling cascade. earlier studies suggest that l. pneumophila actively induces apoptosis of infected cells via the activation of the executioner caspase, caspase-3 (gao and abu kwaik, 1999a, b ; molmeret., 2004). in permissive cell lines such as u937 or human peripheral blood monocytes, infection by l. pneumophila caused high level apoptosis within the first 3 h of bacterial uptake, and, in some cases, apoptotic cells reached 100% (gao and abu kwaik, 1999b). however, a later study found that despite vigorous bacterial replication over a time span of 13 h, the proportion of apoptotic cells did not significantly increase in permissive macrophages, suggesting that in permissive host cells, l. pneumophila actively inhibits infected cells from undergoing apoptosis (derre and isberg, 2004). this notion was validated by the discovery of sdha and sidf, two dot / icm substrates involved in the inhibition of host cell death. mouse bone marrow macrophages infected with a sdha mutant became apoptotic, displaying increased nuclear degradation, mitochondrial disruption, membrane permeability, and caspase activation, indicating a role for sdha in inhibiting host cell death (laguna., 2006). interestingly, the requirement for sdha is cell - type specific because the growth defect was less severe in the ameba dictyostelium discoideum or the more permissive u937 cell - derived macrophages (laguna., 2006). sdha appears to be multifunctional because it also plays a key role in the suppression of type i interferons (ifn) response in macrophages infected by l. pneumophila (monroe., 2009). although less severe, cells infected by mutants lacking sidf also exhibited higher levels of apoptosis, which led to marginal but detectable defects in intracellular growth (banga. sidf interacts and inhibits the cell death - inducing activity of bnip3 and bcl - rambo, two non - canonical pro - apoptotic members of bcl-2 protein family (banga., 2007 ; figure 1). both mitochondrial proteins, bnip3 and bcl - rambo appears to induce apoptosis by different mechanisms. bnip3 appear to play a role in cellular response to stress (chinnadurai., 2008). on the other hand, bcl - rambo induces cell apoptosis specifically blocked by the caspase inhibitors, iaps (kataoka. thus, it is attempting to speculate that sidf plays a role in making infected cells less sensitive to stress caused by l. pneumophila infection. nevertheless, the activities of sdha and sidf indicate that l. pneumophila inhibits host apoptosis by directly targeting host proteins involved in controlling the cell death pathways at the mitochondrion (figure 1). internalized l. pneumophila translocates a large number of effectors into host cytosol via the dot / icm type iv secretion system. a yet unidentified set of effectors trigger an imbalance between the pro - death and pro - survival members of the bcl-2 protein family, leading to the insertion of bax / bak into the mitochondrial out membrane, thus the release of cytochrome c and subsequent activation of the caspases 3 and 7. another set of effectors, including legk1 and lnab, activate nf- b, most likely by initiating the kinase cascade that ultimately causes phosphorylation and subsequent degradation of i b, the inhibitor of nf- b, leading to nucleus translocation of nf- b and the induction of anti - apoptotic genes such as xiap and pai-2, whose product inhibits cell death by targeting caspases 3 and 7. activation of the map kinase pathway by another set of unknown effectors can lead to similar effects. a third set of proteins such as sidf and sdha, which inhibit host cell death by targeting pro - apoptotic proteins bnip3 and bcl - rambo or by unknown mechanisms. in non - permissive mouse macrophages, flagellin reached the cytosol probably via the dot / icm transporter is sensed by the nlr receptor naip5, which together with ipaf and the inflammasome activates caspase-1, leading to pyroptotic cell death. creb, camp response element - binding protein ; lcv, legionella containing vacuole ; mapk, mitogen - activated protein kinases ; mito, mitochondrion ; n, nucleus ; naip5, nlr family, apoptosis inhibitory protein 5 ; pai-2, plasminogen activator inhibitor-2 ; xiap, x - linked inhibitor of apoptosis protein. another layer of cell death inhibition mechanisms utilized by l. pneumophila is revealed by experiments designed to examine host gene expression profiles in response to low dose bacterial challenge (abu - zant. several groups of genes known to be directly or indirectly involved in regulating host cell death were significantly induced, including stress response genes such as heat shock protein genes s and pro - survival members of the bcl-2 protein family (losick and isberg, 2006 ; abu - zant. interestingly, the most striking induction was observed in a collection of anti - apoptotic genes positively regulated at a transcriptional level by the regulator nuclear factor-b (nf-b ; losick and isberg, 2006 ; abu - zant., 2007 ; figure 1). consistently, in human and permissive mouse macrophages, infection by wild type l. pneumophila led to nuclear translocation of nf-b (losick and isberg, 2006 ; abu - zant. thus, l. pneumophila is able to inhibit mammalian cell death by increasing the levels of anti - apoptotic proteins at transcriptional level. two lines of evidence indicate that the induction of these anti - apoptotic genes is important for productive l. pneumophila infection. first, bacterial challenge of macrophages lacking one such anti - apoptotic gene, the plasminogen activator inhibitor-2 (pai-2), led to significantly higher levels of apoptosis and reduction in bacterial replication (losick and isberg, 2006). second, inhibition of nuclear translocation of nf-b by genetic or pharmaceutical agents caused extensive cell death upon low dose bacterial challenge (losick and isberg, 2006). proteins like bcl-2 can interact and inhibit the activity of several pro - death bh3-only proteins (chipuk., 2010). on the other hand, iaps such as xiap can directly neutralize the activity of caspase-3 and -7 (scott. interestingly, the observed nf-b activation is involved in a signaling pathway independent of the toll - like receptor (tlr) adaptor myd88 and the cytoplasmic sensor nod1, but is absolutely dependent upon the dot / icm secretion system (losick and isberg, 2006). consistent with this notion, legk1 and lnab, two dot / icm substrates with such activity have been identified in screenings using nf-b responsive reporters and constructs that direct the expression of individual bacterial genes (ge., 2009 ; losick., 2010 ; whereas the biochemical mechanisms of lnab is unknown, legk1, appears to directly target ib and other ib family of inhibitors including p100 in the non - canonical nf-b pathway by phosphorylation (ge., 2009). similar to most characterized dot / icm substrates, deletion of legk1 or lnab resulted in little or only partial reduction in nf-b activation. consistently, such mutants did not exhibit defects in intracellular bacterial growth (ge. first, proteins such as sdha and sidf that target host cell death proteins can provide the protection in these mutants. second, other yet unidentified effectors may contribute to the activation of nf-b during the infection by these mutants. this is very likely because functional redundancy has been observed in effectors targeting other cellular pathways important for l. pneumophila intracellular growth (isberg., 2009). third, as documented in a recent report, nf-b activated by a non - canonical mechanism may also contribute to the induction of anti - apoptotic genes. in the study, fontana. (2011) found that in conjunction with classic pathogen associated molecular pattern (pamp) molecules, inhibition of host protein synthesis by several dot / icm substrates led to prolonged activation of nf-b, thus strong induction of a set of inflammatory cytokines such as interleukin (il)-23 and granulocyte macrophage colony stimulating factor. such activation was achieved by the failure to resynthesize ib, the short - lived inhibitor of the nf-b transcription factor in the presence of these protein synthesis inhibitors (fontana., 2011). finally, some substrates of the dot / icm transporter also potently activate the map kinase pathway, which could also lead to induction of the anti - apoptotic genes such as pai-2 (shin., 2008). given the high level of conservation in the mapk pathway in eukaryotes, it is not unexpected that the activation of this pathway also occurs in the ameba d. discoideum (li., 2009). clearly, inhibition of host cell apoptosis by l. pneumophila is achieved by collective activities of various bacterial proteins ; these proteins either directly or indirectly, reprogram the various cell death pathways to ensure maximal bacterial replication. in contrast to the many lines of evidence directly supporting active inhibition of host cell death by l. pneumophila, evidence pointing to the induction of apoptosis by this bacterium mostly is indirect. the apoptotic phenotypes associated with host cells infected with mutants lacking one or more cell death inhibiting dot / icm substrates such as sdha and sidf suggested the existence of effectors capable of inducing cell death (laguna., 2006 ; banga., 2007). apoptosis induced by l. pneumophila is extremely apparent in specialized phagocytes such as dendritic cells. in these cells, infection by l. pneumophila induced a caspase-3-dependent apoptotic pathway that aborted intracellular bacterial replication in the early phase of infection (nogueira., 2009 ; figure 1). interestingly, dendritic cells from mice deficient in bak and bax (bak bax) or mice overexpressing the pro - survival protein bcl-2 are able to support intracellular bacterial infection without undergoing apoptosis (nogueira., 2009), indicating that infection by l. pneumophila activates the mitochondrial pathway of apoptosis by inducing an imbalance between the pro - apoptotic and pro - survival members of bcl-2 protein family. the activation of the mitochondrial apoptotic pathway also occurs in macrophages but at a much slower pace (abu - zant. the drastic differences between macrophages and dendritic cells in response to cell death stimuli such as those caused by l. pneumophila infection may be due to higher level or more active of the putative receptors or sensor proteins responsible for engaging the cell death signals from the bacterium in the latter cell type. it has been proposed that the sensitivity to pathogens exhibited by dendritic cells serves a protective role to the host by preventing infectious agents from using these cells as vehicles to reach deep tissues of the organism (nogueira., 2009). for example, shiga toxins trigger apoptosis in many cell types, probably by inducing stress in the er through inhibition of protein synthesis (lee., 2008). although a number of dot / icm substrates toxic to both yeast and mammalian cells have been identified, none of them has been shown to specifically induce host cell death. for example, at least five l. pneumophila proteins capable of inhibiting host protein synthesis have been reported. when overexpressed, these proteins are highly toxic to host cells (belyi., 2006, 2008 ; shen., 2009 ; fontana., 2011). however, whether these proteins play roles in the induction of host cell death under infection conditions is unknown. it is worth noting that a mutant lacking all five genes failed to induce prolonged nf-b activation, suggesting that these toxic proteins contribute to protect host cell death during infection (fontana., 2011). such outcomes clearly are opposite to the phenotypes observed by overexpressing these proteins in host cells. nevertheless, since the dot / icm transporter but not bacterial replication is required for the activation of the apoptotic pathway (abu - zant., 2005 ; either the activities of one or more dot / icm substrates or the stress caused by the collective impact of multiple effectors, or a combination of both can be the mechanism used by the bacterium for such activation. interestingly, macrophages lacking bak and bax or overexpressing bcl-2 still undergo extensive apoptosis upon being challenged by the sdha mutant (nogueira., 2009), suggesting that l. pneumophila is able to activate a cell death pathway independent of several critical components of the mitochondrial apoptotic pathway. besides the mitochondrial apoptotic pathway, l. pneumophila also induces pyroptosis, a form of inflammatory cell death in macrophages from mice harboring a functional naip5 allele (fortier., 2005). naip5 is a member of the nod - like receptor (nlr) family, and an important component of the cytosolic protein complexes called inflammasomes, which induce autoactivation of caspase-1 (figure 1). the nlrs are considered functionally equivalent to the tlrs localized on the surface or within endosomes of immune cell (davis., 2011), which recognize components of the pathogen called pamps such as bacterial flagellin, peptidoglycan, and nucleic acid variants (west., 2006). caspase-1 induced pyroptosis, which is accompanied by the release of mature il-1 and il-18 and other cytokines, and is inherently proinflammatory (fink and cookson, 2006). the observation that flagellin deficient l. pneumophila mutants gained the ability to grow productively in macrophages expressing functional naip5 without activating caspase-1-dependent cell death indicates that flagellin activates naip5 in the cytoplasm (molofsky., 2006 ; ren., 2006). a subsequent study using a retroviral transduction to express flagellin directly in macrophages clearly showed that flagellin is necessary and sufficient for the pyroptosis induction via a pathway controlled by the ipaf inflammasome (lightfield., 2008). consistently, macrophages from naip5-deficient mice completely failed to activate caspase-1 and were able to support robust growth of wild type l. pneumophila, further indicating that flagellin - mediated pyroptosis induction absolutely requires a functional naip5 (lightfield., 2008). thus, the induction of pyroptosis in immune cells from restrictive mice by l. pneumophila flagellin is accidental, but has provided an excellent model to dissect the host immune surveillance mechanisms (vance, 2010). clearly, in permissive mammalian cells, infection by l. pneumophila activates the classic mitochondrial apoptotic pathway and possibly other yet unrecognized cell death processes, leading to activation of several caspases, including caspases 3 and 7. concurrently, the bacterium employs a combination of mechanisms to inhibit infected cells from fully executing the apoptotic cascade to allow productive bacterial replication. whereas the benefit of inhibiting apoptosis by l. pneumophila is obvious, the benefit for activation this pathway is less clear. activated caspases may participate in cellular processes in not directly related to cell death but important for the biogenesis of the lcv. for example, active caspase-3 appears to cleave rabaptin-5, an rab5 effector, and cell treated with caspase-3 inhibitor (devd - fmk) or the pan inhibitor of caspases (z - vad - fmk) abolished intracellular bacterial growth (molmeret., 2004). however, in contrast to this observation, macrophages from permissive mice (a / j) lacking caspase-3 (casp3) still support robust intracellular bacterial growth (zamboni. these discrepancies may result from the non - specificity of the caspase inhibitors or the different host cells used in these studies. 2010) showed that cleavage of bacterial effectors by caspase-3 is important for pathogenicity of salmonella enterica serovar typhimurium. it is possible that active caspases also participate in cellular processes that are not directly related to cell death but are important in the biogenesis of the lcv. a number of important questions remain outstanding in our understanding of the modulation of host cell death pathways by l. pneumophila. first, it is believed that amebae but not metazoan play a role in the evolution of l. pneumophila pathogenicity. however, nf-b signaling and many components of apoptosis have now been documented to be targeted by proteins of this bacterium are not present in amebae cells. it is possible that l. pneumophila co - evolved with some as yet unrecognized lower metazoan. in support of this notion, two recent studies found that l. pneumophila can infect caenorhabditis elegans (brassinga., 2010 ; komura., 2010), an organism with well - defined cell death pathways (conradt, 2009). alternatively, l. pneumophila can acquire genes specific for metazoan pathways from other more adapted mammalian pathogens which also are parasites of amebae (moliner., 2010). second, the nature of the bacterial signals that triggers the mitochondrial cell death pathway remains elusive. particularly, the sdha mutant appears to elicit a cell death pathway independent of the canonical mitochondrial pathway controlled by the bcl-2 protein family (nogueira., 2009). research in this field aiming at characterizing both pro - survival and pro - death l. pneumophila proteins and their host targets will surely generate more exciting discoveries in years to come. the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	programmed cell death is considered the ultimate solution for the host to eliminate infected cells, leading to the abolishment of the niche for microbial replication and the ablation of infection. thus, it is not surprising that successful pathogens have evolved diverse strategies to reprogram the cell death pathways for their proliferation. using effector proteins translocated by the dot / icm type iv secretion system, the facultative intracellular pathogen legionella pneumophila manipulates multiple host cellular processes to create a niche within host cells to support its replication. investigation in the past decade has established that in mammalian cells this bacterium actively modulates two host cell death pathways, namely the canonical apoptotic pathway controlled by the mitochondrion and the pyroptotic pathway controlled by the nod - like receptor naip5 and the ipaf inflammasome. in this review, i will discuss the recent progress in understanding the mechanisms the bacterium employs to interfere with these host cell death pathways and how such modulation contribute to the intracellular life cycle of the pathogen.
table 1 summarizes vaccination schedule base on wsava vaccination guidelines in 2010 and aaha vaccination guideline in 2011. table 1 summarizes vaccination schedule base on wsava vaccination guidelines in 2010 and aaha vaccination guideline in 2011.	this guideline contains the recommended vaccination schedules of dogs and cats from world small animal veterinary association (wsava) and american animal hospital association (aaha). in 2010, wsava published guidelines for the vaccination of dogs and cats. and, in 2011, aaha also published guidelines for vaccination of dogs. in korea, there is no published guideline for vaccination of dogs and cats yet. therefore, the plane of vaccination also reports the present situation of vaccination schedule of dogs and cats in korean animal hospitals.
early interaction with a marginally inappropriate extra - uterine environment in preterm infants could play a crucial role in short- and long - term sequelae. results from previous studies confirm the presence of high rates of neurodevelopmental impairment among preschool children with preterm birth history that span neuromotor functioning, cognition, language, and emotional / behavioral adjustment (1). the average rate of preterm birth is 9.6% worldwide (2). in the last two decades, the rate of survival after preterm birth, especially in socio - economically developed countries, studies investigating brain structural development in prematurely born group consistently show structural alterations in both cortical and sub - cortical structures at birth and, considerably, throughout childhood and adolescence (4). vestibular evoked myogenic potential (vemp) is a short - latency response of the sternocleidomastoid muscle following high level of acoustic stimulation. it is a manifestation of the vestibulocollic reex, originated in the saccular macula, which moves through the vestibular nerve and nucleus, the vestibulospinal tract, on to the motor neurons of the sternocleidomastoid muscle (5). vemps are used for diagnoses ranging from otologic disorders to neuropathies and brainstem lesions (6). if there is no conductive hearing loss, the lesions of the end - organs, primary afferents, and the nerve root entry zone lead to absence of response (5). although studies on vemps in preterm groups are rare in the literature, the available results of studies on preterm infants consistently have shown that they are at risk of disability related to maturation of the vestibulocollic reflex (7 - 9). the vestibular system is important to motor development ; vestibular dysfunction may lead to delayed postural control and locomotor development at later ages (10). children with histories of preterm birth are at greater risk for motor disabilities and poor postural control than those with normal deliveries (11, 12). this group should be followed closely for vestibular deficiency - related complications. the present study investigated the long term effects of preterm birth on the vestibulocollic reflex pathway. this comparative - analytic study was performed on 31 children with histories of preterm birth (18 males, 13 females) and 20 with term births as controls (9 males, 11 females). the subjects were 5.5 to 6.5 yr of age and enrolled in the audiology clinic at school of rehabilitation between february and july of 2013. children with preterm history were divided into very preterm (vp ; less than 32 wk) and mildly preterm (mp ; 32 to 37 wk) groups. the vp group comprised 10 children (6 males, 4 females) and the mp group 21 children (12 males, 9 females). the mean gestational age for the vp, mp, and control groups were 30.6 0.94 (28 - 31 wk), 34.9 1.28 (33 - 37 wk), and 39.6 0.74 (38 - 41 wk), respectively. the exclusion criteria for all groups were a history of congenital abnormalities, ototoxic drug use, recurrent ear infections, previous ear surgery, high fever, head trauma, mental retardation, and psychological problems (based on parental report). parental approval, good general health of the child, absence of abnormalities of the external and middle ear, normal peripheral hearing (tested by conventional pure - tone audiometry and normal results for tympanometry) were considered as inclusion criteria for all children. the subjects were selected through a review of their medical records for the past 5.5 to 6.5 yr. an ics charter ep device was used to record surface electromyographic activity of the scm muscle. the active electrodes were attached to the upper half of the bilateral scm muscles ; a reference electrode was attached to the suprasternal notch and a ground electrode to the forehead. to elicit the desired response from each ear, the child was trained to rotate his or her head toward the contralateral side and keep his or her head in this position for several seconds (13). short tone bursts (95 db nhl, 500 hz each, rise - and - fall time = 2 ms, plateau time = 0 ms) were delivered monaurally using an er-3a insert receiver. the 150 responses to stimuli were then averaged, and their band - pass filtered (10 - 1500 hz) and amplified (5000) (14). the one - way anova post - hoc lsd ctest was used to compare the results. for statistical analysis, the data were presented as a mean (standard deviation (sd)). this study was approved by the ethics committee of tehran university of medical sciences. no statistically significant differences were observed between results of the both ears (p 0.215). the mean latencies of the p13 and n23 waves for all groups are compared in fig. 1. comparison of the mean p13 and n23 latency between three groups. according to the one - way anova statistical test the difference between three groups was significant in p13 latency (f=5.68, p=0.005), but not significant for n23 latency (f=2.33, p=0.10), p13-n23 amplitude (f=0.12, p=0.88) and inter - aural amplitude difference ratios (f=0.49, p=0.60). results from precise analysis by anova post - hoc lsd test are shown in table 1. significant differences were observed in the latency of the p13 (p= 0.002) and n23 (p= 0.041) waves between the vp group and control group. 2 shows sample responses recorded from the right ear in one vp and one normal child. a significantly prolonged p13 latency moreover there was no significant difference between the mp and control groups for all test parameters (p 0.773). vemps result of very preterm child (a) verses normal child (b). there was no significant difference between the three groups in p13-n23 amplitude (p 0.627) and interaural amplitude difference ratios (p 0.348). no significant differences were observed between the left and right ears for each group. although, no similar study has been published on preschool aged children with preterm birth history, previous studies on term children reported non - significant differences between the right and left ears (15 - 17). this reflective response generates from the lower brainstem and laterality has little effect on this potential. ecevit. (7) studied 17 late preterm infants (mean gestational age : 35.11 wk 0.78) at 8 wk postnatal and found that the latencies of p13 and n23 in preterm infants were significantly longer than for term infants. (8) studied 50 newborns with a mean gestational age of 31.7 2.7 wk (range= 26 - 36 wk). the results showed a significant difference between abnormal vemps rates for preterm and full term infants. (9) studied 27 low - risk preterm neonates and found that mean latency of peaks p13 and n23 in the preterm group were significantly longer than those in the full - term group. it has been reported that conditions affecting the vestibulospinal tract result vemps delay and that vestibule disorders frequently led to lack of response (18).imaging studies confirmed structural alterations in cortical and sub - cortical structures at birth, and in childhood and adolescence in the preterm group (4). in other hand, previous studies have shown that the auditory brainstem response (abr) was affected by preterm birth in infancy and at preschool age. (19) studied 30 children with histories of preterm birth with 4 - 6 yr of age. significant differences in the abr test results were observed for the inter - peak intervals of the i - iii and iii - v waves and the absolute latency of the iii wave. overall, prolonged vemps in vp children may reflect incomplete maturation (especially myelination) and deficits in their vestibulospinal tract. in the present study, no significant difference was found between the mp and control groups for wave latency of vemps. in contrast, ecevit. (7) reported that wave latency for vemps in late preterm infants (34 - 36 wk) was significantly longer than those with full term. this condition may relate to the delay in maturation of the sacculocollic pathways in the mp group in infancy. in other hand, the vp was significantly different from the mp group for p13 latency. previous studies have shown that the risk of mortality, morbidity, and neurodevelopmental impairment was tightly linked to gestational age and reached the highest rate for infants born at less than 32 wk (very preterm) (2, 20). consequently, increased gestational age (ga) in children born at ga > 32 wk gestation showed less long - term sequelae than children with ga < 32 wk. the p13-n23 amplitude did not differ between the three groups of children in this study. (9) on preterm and term infants ; these groups showed no significant differences in the raw and corrected p13-n23 amplitudes. vemps amplitude is dependent upon sound intensity and constriction of the scm muscle (21). accordingly, since there are large variability in response amplitude, especially for the very young, fewer studies have considered it. the interaural amplitude difference ratio is the more informative parameter for investigating unilateral vestibular disorders (14). in the present study, these findings support the possibility of a symmetrical function of the vestibular system for both ears. previous studies have also reported no effect for gender on vemps responses (15, 22, 23). these findings could be a consequence of the elicitation of these reflecting responses from the lower brainstem (24). findings of the present study revealed the positive effect of augmented in age on the improvement of vemps results. (9) study which vemps was not appeared in 74% of preterm neonates, in the present study, vemps was obtained in all children of the studied groups. although, in the present study, abnormal vemps results were still observed, especially in the vp group.the early exposure to an extra - uterine environment for the vp group could exposed the neurodevelopmental process of these infants to physiological, psychological, and environmental hazards (25). it can be concluded that deficits in the central vestibular pathway could be related to incomplete myelinization of the neural pathways and the consequent delay in nerve conduction can leads to abnormalities such as delayed p13 and n23 waves in vemps. improvements in hygiene and reductions in the birth rate have decreased the incidence of preterm birth in iran and, consequently, decreased the pool of these children with a history of preterm birth (especially very preterm). future studies should expand access to the population sample of preterm children in different regions so that longitudinal studies can be designed to obtain more precise information about the effect of preterm birth on vestibular evoked myogenic potentials and the neurodevelopmental process on improvements in this response. moreover, behavioral assessments of the vestibular system, especially on static balance skills, and electrophysiological tests can clarify the role of structural disabilities in balance and provide subtle information for counseling and planning useful treatment programs. the significant finding of the current study is the prolonged latency of p13 and n23 waves in the vemps in children with very preterm birth histories compared with those with histories of mildly preterm and full term births. possibly, the delay in and deficit of the neural pathway of the vestibulocollic reflex and inadequate neural synchronization were the main causes for the difference. the results of this study provide information about effects of preterm birth for both specialists and parents. since the vemps test evaluates the function of a part of the vestibular system, the probable effects of preterm birth on other aspects of the vestibular and balance systems should be studied. other area of future research should explore the usage of vemps testing on performance of vestibulocollic reflex among children with preterm birth at the preschool age. this study was approved by the tehran university of medical sciences, grant number 91/d/260/4955. we are grateful to the mofid, akbarabadishaheedand comprehensive women hospitals for their assistance in the implementation of this project. we also extend our appreciation to the parents of our subjects for their help in this research.	background : preterm birth is a significant global health problem with serious short- and long - term consequences. this study examined the long term effects of preterm birth on vestibular evoked myogenic potentials (vemps) among preschool - aged children. methods : thirty - one children with preterm and 20 children with term birth histories aged 5.5 to 6.5 years were studied. each child underwent vemps testing using a 500 hz tone - burst stimulus with a 95 db nhl (normal hearing level) intensity level. results : the mean peak latencies of the p13 and n23 waves in the very preterm group were significantly longer than for the full - term group (p 0.041). there was a significant difference between very and mildly preterm children in the latency of peak p13 (p= 0.003). no significant differences existed between groups for p13-n23 amplitude and the interaural amplitude difference ratio. the tested ear and gender did not affect the results of the test. conclusion : prolonged vemps in very preterm children may reflect neurodevelopmental impairment and incomplete maturity of the vestibulospinal tract (sacculocollic reflex pathway), especially myelination. vemps is a non - invasive technique for investigating the vestibular function in young children, and considered to be an appropriate tool for evaluating vestibular impairments at the low brainstem level. it can be used in follow - ups of the long - term effects of preterm birth on the vestibular system.
a 25-year - old active young woman (weight 57 kg, height 1.64 m) suffered a left patella fracture due to a slip and fall. she had a medical history of right knee arthroscopy in 2001 due to a cruciate ligament injury. complete blood count, electrolyte panel, coagulation screening, electrocardiography, and plain radiographic findings were all within normal limits. a physical examination revealed moderate tenderness and swelling in the left thigh and knee area. open reduction and internal fixation with a tension band wiring was performed under spinal anesthesia three days after admission to the emergency room. a pneumatic tourniquet was inflated to 370 mmhg at the onset of the procedure and was deflated 80 minutes after surgery. her leg was elevated to 30 degrees immediately after surgery, and an ice bag was applied to the operation site. she had marked pain in the left knee area, difficulty in extending the knee, and weakness of the quadriceps muscle. she was referred to a rehabilitation physician and a neurologist for electromyography - nerve conduction velocity (emg - ncv) testing, but she refused the test. eight weeks after being discharged, she was readmitted because of persistent pain and neurologic symptoms. at that time, manual muscle testing of the left lower limb showed grade iv hip abduction, grade v adduction, grade iii hip flexion, grade ii knee extension, grade v ankle dorsiflexion, and grade v plantar flexion. pinprick sensation of the femoral nerve and lateral cutaneous nerve in the thigh area was decreased to 8 points on a scale from 0 to 10 points. mri of the knee showed no evidence of abnormalities of the anterior cruciate ligament, posterior cruciate ligament, lateral collateral ligament, medial collateral ligament, or meniscus abnormality, except for slight increase in the amount of joint effusion. however, evaluations of the patella, infrapatellar fat pad, quadriceps tendon, patellar tendon, and anterior horn of medial / lateral menisci were limited due to severe metallic artifacts. diffuse t2 high signal intensity was observed in the anterior compartment of the left thigh, suggesting an acute denervation change related to left femoral neuropathy. furthermore, the whole volume of the muscles of the left thigh was reduced, suggesting combined disuse atrophy (fig. 1). mri of the lumbar spine depicted a normal spinal cord, l4 nerve roots, and lumbar plexus, except for bulging discs with an annular tear at l3 - 4, l4 - 5, and l5-s1. in addition, mildly increased echogenicity was noted in the left anterior compartment muscle with decreased volume by joint ultrasonography, suggesting disuse atrophy or a denervation change. an emg study was performed on the left tibialis anterior, gastrocnemius medialis, vastus lateralis, vastus medialis, rectus femoris, adductor brevis, gluteus medius, and lumbar paraspinal (l3 and 4) muscles. positive sharp waves and fibrillation potentials were observed in the vastus lateralis, vastus medialis, and rectus femoris muscles by needle electromyography. furthermore, a sensory nerve conduction study (ncs) revealed reduced conduction for the left saphenous nerve. one week after the test, a follow - up emg study was done by another neurologist, and the results were the same. accordingly, the study established the presence of partial peripheral neuropathy of the left femoral nerve. the patient was referred for electrical stimulation therapy and steroid therapy but refused any further treatments. the internal fixation device was removed at two months after surgery due to severe pain, and subsequently, the knee pain scale improved to visual analogue scale 3 five days after the device removal. deficits of motor and sensory function resulting from femoral neural injury are probably underestimated because most cases are self - limited and thus underreported. hence, the significance of this report is that it presents the first reported case of femoral neuropathy accompanied by patella fracture. the femoral nerve has its origins in the posterior divisions of the l2, l3, and l4 branches of the lumbar plexus6). the main sensory branches of the femoral nerve are the anterior femoral cutaneous and saphenous nerves, which supply the anteromedial aspect of the thigh and medial side of the leg, respectively. the motor branches supply the sartorius, iliacus, pectineus, rectus femoris, vastus lateralis, vastus intermedius, and vastus medialis muscles6,7). innervation to the vastus lateralis muscle runs in a space restricted by the fascial surfaces of the vastus intermedius and rectus femoris muscles anteriorly and posteriorly and the edges of the vastus medialis and vastus lateralis muscles on each side. consequently, neuropathy can occur due to entrapment of the nerve by the vastus lateralis muscle3). furthermore, femoral nerve injury can give rise to severe difficulty in ambulation, due to loss of innervation of the anterior thigh musculature, which is essential for walking7). as mentioned above, femoral neuropathy may manifest in several ways. in our case, the patient had femoral neuropathy and atrophy of the left quadriceps muscle group accompanied by sensory changes in the distribution of the lateral cutaneus nerve of the thigh. the initial differential diagnosis for this weakness included disuse atrophy, neuropraxia caused by a pneumatic tourniquet, femoral neuropathy, lumbar plexopathy, and radiculopathy at the l3 or l4 level. other potential causes had been ruled out by blood test, medical history, clinical examination, emg - ncv, joint ultrasonography, and mri of the knee, thigh, and lumbar spine. routine blood test results and vital signs were examined to rule out diabetes, hypotension, and drug abuse. electrodiagnostic testing showed showed abnormalities in only the muscles innervated by the femoral nerve with sparing of the iliopsoas, suggesting an injury to the femoral nerve at or near the inguinal ligament. and we could rule out lumbar plexopathy and lumbar radiculopathy based on the mri findings. stretch injuries of the femoral nerve following hip hyperextension have been reported in previous studies. miller and benedict8) reported the case of a dancer who suffered femoral neuropathy following exercises involving extreme hip extension and knee flexion. serial evaluation could not be performed in the case because of loss to follow - up. as determined by electrodiagnostic testing and mri, stretch injury at or near the inguinal ligament, distal to the muscular branches of the iliopsoas and sensory branches of the lateral cutaneus nerve of thigh, was a probable cause5). therefore, it is conceivable that femoral neuropathy or neuropraxia in this case was caused by a stretch injury of the femoral nerve at the time of the slip and fall or during the operation. clinicians should have a high index of suspicion for neurological compromise following all types of fractures, and if needed, further evaluations should be conducted promptly. surgeons should be aware of this potential morbidity and take care not to compress over the inguinal area during operation to eliminate the risk of this complication.	femoral neuropathy may be associated with various etiologies and can cause severe walking disability. we present the case of a 25-year - old woman who underwent surgical repair for a patella fracture and complained of lower extremity pain, paresthesia, and weakness postoperatively. electromyography and magnetic resonance imaging (mri) revealed partial peripheral neuropathy of the left femoral nerve associated with the patella fracture. to our knowledge, this is the first reported case of femoral neuropathy associated with a patella fracture.
kawasaki disease (kd), also known as mucocutaneous lymph node syndrome, predominantly affects infants and young children. due to lack of specific diagnostic tests, the diagnosis of kd however, as an acute systemic vasculitis, kd may be involved in multiple organs and systems, causing unusual manifestations and thus making the diagnosis difficult. here we report a case of kd which initially manifested as parapharyngeal abscess (ppa), leading to delayed diagnosis. furthermore, this case included unnecessary surgery and thus the risk of surgical complications was increased. a previously healthy 3-year - old male patient was admitted into our pediatric department with fever (up to 39), neck swelling, dysphagia, and drooling for 3 days. on physical examination, the patient was toxic and irritable, and showed hyperemic throat, enlarged tonsils and bilateral tender cervical lymphadenopathy. laboratory investigations revealed white blood count (wbc) : 23,800/l (neutrophils : 79.2%, lymphocytes : 11.6%), hemoglobin : 12.7 g / dl, platelet count : 256,000/l and c - reactive protein (crp) 210 mg / l. purulent cervical lymphadenitis was considered and vancomycin (40 mg / kg / day) was prescribed. on the following day, the painful cervical lymphadenopathy did not show any improvement and the patient developed trismus and restricted neck movement. computed tomography (ct) of the neck revealed a 2 cm 1.5 cm low - density lesion in the right parapharyngeal space (figure 1 : asterisk), with peripheral enhancement (figure 1 : arrow) as well as multiple lymph node enlargements in the posterior cervical space. ppa was suspected and the patient was transferred to the otorhinolaryngologic department for surgery. on the 3rd day following admission, the patient developed bilateral bulbar conjunctival injection and red lips. due to the possibility of upper airway obstruction, incision and drainage of the ppa after surgery, his neck pain and trismus alleviated, however high fever persisted. during the 5th day of hospitalization, the patient manifested fissured red lips and strawberry tongue. on the 6th day, edema of the hands and feet and polymorphous generalized erythematous skin rash appeared. laboratory investigations revealed wbc : 39,780/l (neutrophils : 75%, lymphocytes : 18%), hemoglobin : 12.3 g / dl, platelet count : 395,000/l, erythrocyte sedimentation rate : 132 mm / h, crp : 171 mg / l, pro - albumin : 72 mg / l, and nonseptic pyuria. despite antibiotic treatment with vancomycin and cefoperazone, the fever persisted. the patient was transferred back to the pediatric department from the otorhinolaryngologic department on the 8th day following admission. upon re - evaluation of his clinical and laboratory findings, the diagnosis of kd was considered and intravenous immunoglobulin (ivig) at 2 g / kg along with aspirin at 30 no coronary artery abnormalities were found on repeated echocardiogram. due to the parapharyngeal operation, finally, the patient was discharged on the 20th day of hospitalization, on a low dose of aspirin. during the 2 months of follow - up neck ct scan showing a hypodense lesion (asterisk) in the right parapharyngeal space with peripheral enhancement (arrow). parapharyngeal abscess (ppa)-like lesion is a very rare manifestation of kd. to the best of our knowledge, there has only been one similar case reported, occurring in the usa., kd can mimic other kinds of deep neck infections, such as peritonsillar abscess, peritonsillar cellulitis, or retropharyngeal abscess (rpa). the rarity of these presentations often leads to missed or delayed diagnosis and treatment. in this patient, although infection can not be ruled out at the early stage, the fact that blood and throat cultures were negative and there was an excellent response within 24 hours after administration of intravenous immunoglobulin (ivig) and aspirin makes the diagnosis of kd presenting as a parapharyngeal abscess - like lesion more plausible than an infection coexisting with kd. in this case, the boy manifested like infectious ppa at the beginning : fever, dysphagia, neck rigidity, remarkably elevated wbc and crp, and an abscess - like lesion on the ct. similarly, in most of the previously reported kd cases mimicking rpa, fever and deep neck infection like - symptoms were the only clinical findings at admission. after carefully comparing children with kd accompanied by retropharyngeal edema to, those with rpa, nomura concluded that close attention to core manifestations but not laboratory examinations of kd helps clinicians to differentiate these 2 conditions. obviously, our findings agree with nomura 's report. in our opinion, both pediatricians and otolaryngologists should draw lessons from this case. indeed, the patient had already developed bilateral bulbar conjunctival injection and red lips on the 3rd day following admission. from this case we need to realize that ppa - like lesion can be the initial presentation of kd. therefore, when some signs of non - septic vasculitis emerge, pediatricians must carefully observe for other signs of kd. otolaryngologists are excellent at managing deep neck infections, but not at diagnosing and treating kd. in this case, although the patient had already met the criteria of kd on the 6th day following admission, proper diagnosis was not made by surgeons in the otorhinolaryngologic department. treatment with ivig and aspirin was initiated after the patient was transferred back to the pediatric department. to avoid delayed diagnosis, otolaryngologists should be aware of the manifestations of kd and include it as a routine differential diagnosis for ppa. the exact pathophysiology through which kd leads to ppa is unknown. as with kd - associated rpa, ppa in kd histopathological study of cervical lymphadenopathy in kd revealed non - purulent inflammation and ischemic necrosis due to fibrin thrombi in small vessels of affected lymph nodes. inflammatory infiltration of the lymph node capsule was present in most of the affected cervical lymph nodes. mri scan found that affected lymph nodes had capsular and hilar but not parenchyma enhancement. in this case, we speculate that the abscess - like lesion originated from a lymph node : the hypodense central area found by ct (figure 1 : asterisk) may be caused by nonseptic inflammatory edema, and peripheral enhancement (figure 1 : arrow) may be due to capsule inflammatory infiltration. future evidence is needed to confirm this pathological hypothesis. how to treat kd mimicking deep neck abscess is a challenging question. in a review of 24 previously reported kd cases with rpa - like lesion, all of them were unresponsive to antibiotics. seven of the 24 cases received surgical aspiration or drainage but no abscess or bacterial infection evidence was found. fever and other symptoms resolved rapidly after the administration of ivig and aspirin in all of the 24 patients. as the deep neck abscess - like lesion is formed by local inflammation and edema under the condition of systemic vasculitis, it will be absorbed and disappear when systemic vasculitis is controlled by ivig and aspirin. therefore, in our opinion, kd mimicking deep neck abscess is not an indication for surgery. operations should not be arranged hastily for these patients, as surgical complications, such as incision infection in our case, can be thusly avoided. for those patients with upper airway compression due to the abscess future well - controlled trials are needed to prove the safety and effectiveness of non - surgical treatment for kd mimicking deep neck abscess. in conclusion, both pediatricians and otolaryngologists should keep in mind that, in addition to bacterial infection, kd can cause ppa - like lesion. careful observation for major signs of kd during the clinical course can help to achieve an early and correct diagnosis.	abstractparapharyngeal abscess (ppa)-like lesion is a very rare manifestation of kawasaki disease (kd). here we report a chinese case of kd initially mimicking ppa, which is the first one reported in asia.a 3-year - old male patient presented with fever, drooling, and bilateral painful cervical lymphadenopathy for 3 days. chest x - ray and echocardiogram were normal. with substantial elevation of white blood count and c - reactive protein, purulent cervical lymphadenitis was considered. symptoms did not improve after treatment with vancomycin, and the patient further developed trismus and restricted neck movement. neck ct revealed a 2 1.5 cm hypodense lesion in the right parapharyngeal space with peripheral enhancement. ppa was suspected and on the 3rd day following admission, the patient received surgical incision and drainage. one milliliter of serous fluid was drained without bacterial growth on cultures. fever persisted after surgery. as the clinical course proceeded, additional major signs of kd gradually evolved, and on the 6th day following admission the patient completely fulfilled the diagnostic criteria for kd. rapid clinical improvement was observed following treatment with high - dose immunoglobulin and aspirin. due to the parapharyngeal operation, the patient was fed milk through a nasogastric tube for 15 days. his neck incision became infected but healed gradually following dressing change and antibiotic treatment. currently he remains asymptomatic during regular follow - up and repeated echocardiograms are normal.both pediatricians and otolaryngologists can learn from this case that kd may initially manifest as ppa. careful observation for major signs of kd during the clinical course can help to achieve a prompt and correct diagnosis. thus, unnecessary surgery and cardiac complications of kd may be avoided.
primary hyperparathyroidism (phpt) is a common endocrine disease that mainly affects the elderly population, especially women.1 the epidemiology of phpt in saudi arabia has not yet been reported. in a study that aimed to determine the incidence and prevalence of phpt in a racially mixed population in 2012, the mean annual incidence of phpt was about 66 per 100,000 women and 25 per 100,000 men ; conversely, the prevalence of phpt was around 233 per 100,000 in women and 85 per 100,000 in men.2 among children, the true incidence and prevalence of phpt are not currently known. slipped capital femoral epiphysis (scfe) is a relatively common hip disorder among adolescents. the estimated incidence of scfe is around 11 per 100,000 children annually, with a mean age of 12 and 13.5 years in girls and boys, respectively.3 phpt and scfe are rarely concomitant in one individual. only 10 cases have been reported in the literature to date.413 review of ours and previous published cases should help the physicians to develop an effective approach for the management of such cases. a 13-year - old saudi female, previously healthy and not known to have any chronic medical illnesses, presented to our endocrine clinic complaining of bilateral knee pain for 1 year, which was progressive and had disrupted her daily activities ; this pain was associated with bilateral lower limb weakness and a waddling gait. there was no history of trauma, fracture, hematuria, skin changes, hair loss, and loss of appetite or a history of any metabolic disorders. on examination, the patient looked well ; she was not in acute pain or distress. her blood pressure was 116/69 mmhg, and her pulse was 110 beats / minute. bony prominence tenderness was seen bilaterally at greater trochanters, with painful movements but normal range of motions. the muscle power of the upper limbs was normal (5 out of 5), and in lower limbs, it was 4 out of 5 at hip joint bilaterally with exacerbation of pain during movements. the patient s serum biochemistry revealed a corrected calcium of 2.91 mmol / l (normal range : 2.092.54 mmol / l), phosphates of 0.7 mmol / l (normal range : 0.871.45 mmol / l), and an alkaline phosphatase level of 2,008 iu / l (normal range : 44147 nmol / l (normal range : 50250 nmol / l), and her 24-hour urinary calcium level was 12.64 mmol / day) normal range : 2.57.5 mmol / day). skeletal imaging showed findings suggestive of bone resorption of skull, pelvis, and hands (fig. c). the skull demonstrated trabecular bone resorption that had resulted in the salt - and - pepper appearance of the calvarium. similar findings were noted along the subcapital region of the femoral neck with subsequent fracture leading to scfe. subperiosteal resorption was noted along the radial and the ulnar aspect of the middle phalanges, more pronounced along the second, third, and fourth bilaterally. subperiosteal bone resorption was noted at the distal radius and ulna more involving the left side. the finding of phpt in our patient prompted us to suspect multiple endocrine neoplasia syndrome (men-1), but due to the absence of family history of any endocrinopathy and lack of features suggestive of pituitary or pancreatic mass, we did not screen her further. she was advised to maintain good oral hydration, prescribed vitamin d supplement, and was given a follow - up appointment to our endocrine clinic, where an ultrasound of her parathyroid gland and kidneys was performed. the ultrasound of the patient s parathyroid showed a well - defined parathyroid adenoma measuring 3.0 cm 1.7 cm 1.2 cm (fig. the ultrasound of her kidneys showed a tiny, non - obstructive right renal calculus. later, a dual - phase parathyroid scan revealed increased focal tracer uptake projecting to the right lower lobe of the thyroid gland, where early tracer uptake and delayed washout were noted, compatible with a parathyroid adenoma (fig. she was referred to the breast and endocrine surgery clinic for further assessment, where an elective parathyroid adenoma resection was planned. meanwhile, the patient visited the emergency department complaining of right hip pain ; she was unable to stand and became wheelchair dependent. mmol / l (normal range : 2.092.54 mmol / l) ; her skeletal survey and a computed tomography scan of the pelvis showed a generalized bone demineralization. there was severe subperiosteal resorption at the subcapital region of the femoral neck, bilaterally, with subsequent fracture leading to scfe. she was advised admission to hospital, which she refused, claiming her elective admission will be in a few weeks later. three weeks later, the patient was electively admitted for right inferior parathyroidectomy, which was performed without any complications. mmol / l (normal range : 2.092.54 mmol / l), and her pth dropped to 5.9 pmol / l (normal range : 1.66.9 nine days after the parathyroidectomy, the patient underwent bilateral femoral head pinning in situ with immobilization and rest for 6 weeks (fig. she was followed up 1 year later in clinic as an outpatient, and presently she is able to mobilize without any assistance or gait defects. her mmol / l (normal range : 2.092.54 mmol / l), serum phosphate 1.17 mmol / l (normal range : 0.871.45 mmol / l), and pth level 4.8 pmol / l (normal range : 1.66.9 pmol / l). although the coexistence of phpt and scfe is rare, a fair association between these two conditions has been reported previously, and it has been further exemplified in the current case report. phpt is a rare cause of scfe, of which only 11 cases including ours have been reported. pth receptors are present in large numbers in cells of hypertrophied cartilage zone of epiphyseal plate the same zone where slipping of femoral epiphysis occurs.14 pth plays a significant role in the induction of various metalloproteinases for cartilage ossification, and it controls the cartilage matrix degradation during endochondral bone formation.15 actions of pth on growth plate s chondrocytes, through its mediators and metalloproteinases, may get deranged due to any pth imbalance, resulting in abnormal cartilage mineralization, which elongates the time needed for completion of epiphyseal fusion.16 this elongated period during which cartilage remains uncalcified may be one of the factors provoking development of scfe as it is well known that during early years of adolescence, strong shearing stress is exerted on upper femoral epiphysis because of increasing body weight and changes in planarity of growth plate. any pth imbalance may trigger the entire process by exposing growth plate to destabilizing effects of other contributing factors (ie, physical activity, body weight, trauma, planarity of growth plate, increased femoral retroversion, etc) for much longer time period.16 vitamin d deficiency is commonly seen in phpt patients, and hyperparathyroidism becomes exacerbated in its presence. severe scfe can be caused by concomitant vitamin d deficiency in patients with phpt,17 and vitamin d deficiency itself can be strongly associated with scfe.18 in view of serum phosphate and urinary calcium levels, vitamin d deficiency should be considered a coincidence and not a cause in our case. though, in cases of scfe with phpt, it must be treated carefully, as it may worsen the severity of scfe.3 adolescents with unstable scfe should be managed with caution, as they are at significant risk to develop avascular necrosis of the joint. chronic (stable) unilateral scfe would benefit from long - term management to prevent further slippage and progression, as in the case of osteonecrosis of the femoral head and chondrolysis.3 severe hypercalcemia manifestations and complications should be considered thoroughly if a patient develops cardiac abnormalities, neurological symptoms, and profound musculoskeletal aches. in such conditions, a parathyroidectomy should be prioritized to scfe fixation.13 in our case, parathyroidectomy was performed prior to scfe fixation and repair, which was recommended in previous case reports for unstable scfe. in 2012, el scheich reported a case of a patient with concomitant phpt with scfe. the authors designed a systematic and structured algorithmic approach for managing such patients.13 this approach may help clinicians and surgeons in an effective and efficient way to deal with such rare cases. this algorithm was followed in our case, and we recommend to be used in clinical practice. this rare association and its manifestations should be managed effectively based on the patient s clinical status to improve the patient s long - term outcomes and quality of life, with the ultimate aim of preventing any future disability.	the aim of reporting this case is to highlight the association of two disorders, primary hyperparathyroidism (phpt) and slipped capital femoral epiphysis (scfe). they are usually seen in two different age groups and rarely together. phpt is a rare cause of scfe and only 10 cases have been reported in the literature worldwide. the patient in our report is a 13-year - old girl who presented to our clinic with bilateral knee pain and a waddling gait. subsequent investigations showed that she had phpt and scfe with low bone mass. on admission, a parathyroidectomy was performed ; then, the slipped femoral epiphyses were fixed with satisfactory results. a systematic algorithmic approach that was illustrated in a previously published case was used. such cases should be managed with a systematic approach based on the patient s clinical status to prevent future morbidity. a literature review was conducted by performing a medline search of all reported cases of phpt and scfes.
a 67-year - old woman with known hypertension, otherwise healthy, was admitted to our hospital for acute chest pain. a suspicion of myocardial infarction was not confirmed, and computed tomography (ct) showed a type a aortic dissection with a large intramural haematoma in the ascending aorta. surgical repair was performed urgently with implantation of a biological aortic valve as a composite graft in the ascending aorta with reimplantation of coronary arteries by way of bentall procedure. the surgery, performed with extracorporeal circulation, hypothermia, circulatory arrest, and retrograde cerebral perfusion, lasted for 21 min. at the end of surgery, the patient showed signs of right heart failure, possibly caused by air embolization to the right coronary artery. extracorporeal perfusion was reinstituted, and a 14f venting catheter was placed through the apex of the left ventricle. the catheter was subsequently removed and the hole in the apex wall closed with a suture. the postoperative period was uncomplicated with the exception of a pacemaker implantation due to atrioventricular block ii. consecutive ct examinations, performed 1 and again at 2 months after surgery, showed slowly increasing size of the pseudoaneurysm extending from the apex of the left ventricle (fig. an echocardiogram confirmed the findings, and additional ct also showed a minor leakage from the aortic graft suture into the false lumen of the dissection. due to expected technical difficulties with surgical repair in this otherwise stable patient, endovascular closure of the pseudoaneurysm was attempted.fig. c exclusion of the pseudoaneurysm by amplatzer septal occluder (arrow) the procedure was performed with the patient under general anesthesia and prepared for emergency surgery in the hybrid angiography / operating room. after puncture of the right common femoral artery using a micropuncture set, a 6f introducer sheath was inserted. a 5f, 100-cm cobra catheter (cook medical, bjaeverskov, denmark) was used jointly with a 0.035-inch glidewire (terumo, tokyo, japan) to negotiate through the aortic valve to the left ventricle. however, due to heart movements, visualization of the exact localization of the channel to the pseudoaneurysm at angiography was not possible. after exchange over the wire, a 5f h1 catheter (cordis, johnson & johnson, miami, fl) was used jointly with the glidewire to navigate into the lumen of the pseudoaneurysm. during relatively time - consuming manipulations, several episodes of ventricular arrhythmia occurred, which, however, were under control due to the function of the pacemaker. after the tip of the catheter was positioned in the pseudoaneurysm, angiography was performed (fig. the catheter was exchanged over the 260 cm long, 0.035-inch amplatz wire (boston scientific, natic, ma) to the 6f inner diameter guiding catheter (boston scientific). through the guiding catheter, a 5-mm amplatzer septal occluder (aga medical, plymouth, mn) was advanced to the psudoaneurysm. after deployment of the distal part, the occluder and the guiding catheter were jointly pulled back until the operator could feel resistance, and then the other part of the occluder was deployed and the device released (fig. 1c). angiography performed after approximately 10 min verified occlusion of the channel to the pseudoaneurysm as well as a persistent small leakage, which was expected to close spontaneously. all of the devices were removed, and the puncture site in the right common femoral artery closed by manual compression. ct performed 10 days later verified absence of contrast flow to the treated pseudoaneurysm ; however, the other pseudoaneurysm extending from the base of the apex was visualized (fig. this pseudoaneurysm was previously not diagnosed most probably due to compression by the first pseudoaneurysm. a new attempt at endovascular exclusion of the pseudoaneurysm was performed, using the same setting and technique, as described previously (fig. angiography, performed after deployment of the 4-mm amplatz septal occluder in the second pseudoaneurysm, showed successful exclusion (fig. again, hemostasis was obtained by manual compression of the access site to the femoral artery after removal of all devices. the patient was discharged the day after procedure. at the next ct examinations 3 weeks and 3 months after the procedure, total exclusion of both pseudoaneurysms was seen (fig. a ct after 1 week demonstrates exclusion of the first pseudoaneurysm and the second aneurysm (arrow). three - dimensional reconstruction confirms exclusion of both pseudoaneurysms second pseudoaneurysm at the bottom of the apex. a ct after 1 week demonstrates exclusion of the first pseudoaneurysm and the second aneurysm (arrow). c the second pseudoaneurysm excluded with the amplatzer ct performed 3 months after the procedure. the mortality rate of patients with type a aortic dissection is high, and emergency surgical repair is mandatory. symptoms of type a aortic dissection may be similar to those of heart infarction or other serious thoracic disorders. surgical repair with extracorporeal circulation in hypothermic circulatory arrest is warranted [1, 2 ]. transapical catheterization of the left ventricle is the common access route for catheter placement for venting or unloading of the left ventricle and currently also for replacement of the heart valve [4, 5, 10 ]. development of an apical pseudoaneurysm after cannulation is rare, but it has been described in several case reports [614 ]. the pseudoaneurysm is located inside the heart muscle, which makes surgical repair difficult, and a part of the apex must often be resected. conservative treatment may also be attempted, but in cases of progressive enlargement of the pseudoaneurysm, invasive treatment is necessary. in our patient, the pseudoaneurysm appeared on ct examination 1 month after surgery. at the next ct examination 1 surgical repair was considered potentially difficult and unsafe ; thus, endovascular treatment was performed. to avoid any possible risk the procedure was performed in the hybrid angiography / operating room with patient prepared for open surgery. the second pseudoaneurysm was not seen at the end of the first procedure. it could have arisen secondary to compression by the primarily treated pseudoaneurysm or it may have developed later due to fragility of the ventricular wall. endovascular exclusion of the cardiac pseudoaneurysm has been described [1418 ] ; however, to our knowledge, closure of two ventricular pseudoaneurysms in the same patient has not been reported. we conclude that endovascular treatment of multiple apical ventricular pseudoaneurysms with a septal occluder is feasible and may be performed without complications and with excellent results.	a 67-year - old woman resented with an acute type a aortic dissection, which was treated surgically with aortic valve replacement as a composite graft with reimplantation of the coronary arteries. at the end of surgery, a left - ventricular venting catheter was placed through the apex and closed with a buffered suture. consecutive computed tomography (ct) examinations verified a growing apex pseudoaneurysm. communication between the ventricle and the pseudoaneurysm was successfully closed with an amplatz septal plug by the transfemoral route. follow - up ct showed an additional pseudoaneurysm, which also was successfully closed using the same method.
in vitro, th1-type cytokine interferon- (ifn-) induces the tryptophan - degrading enzyme indoleamine 2,3-dioxygenase (ido) in monocyte - derived macrophages, dendritic cells and in a variety of other cell types including tumor cells. in vivo, accelerated tryptophan degradation can be detected in body fluids by measurements of kynurenine and tryptophan concentrations. calculating the kynurenine to tryptophan ratio (kyn / trp) serves as an estimate of ido functional activity. a large proportion of patients with a variety of disorders like viral or bacterial infections, autoimmune syndromes or during allograft rejection presents with increased kyn / trp in serum / plasma or cerebrospinal fluid. tryptophan degradation in these individuals reflects the extent, activity and the course of disease. in patients with malignant tumors, tryptophan degradation parallels disease progression, loss of immunocompetence and the development of cachexia and anemia. in addition, higher kyn / trp and lower tryptophan concentrations predict shorter overall survival. the rate of tryptophan degradation in malignant cell lines is usually low but can be significantly enhanced by pro - inflammatory stimuli such as ifn-. data suggest that tryptophan degradation in patients with cancer predominantly relates to enhanced ido activity, which is stimulated during th1-type immune response. this conclusion is further supported by the observation that kyn / trp in humans usually correlates closely with neopterin concentrations, which is released by human monocyte - derived macrophages and dcs particularly upon stimulation with ifn-, but not by stimulated tumor cells themselves. degradation of essential amino acid tryptophan represents an effective anti - proliferative strategy, which is established during immune response. it is directed to stop malignant proliferation as is to halt growth of pathogens in infected cells. in 1996 we demonstrated accelerated tryptophan degradation correlating to neopterin levels in normal human pregnancy, and 1998 munn revealed ido activity to be critical for the induction of maternal immunotolerance. subsequent studies were able to substantiate the central role of ido activation in the development of immunodeficiency and immunotolerance. thereby ido expression in dc is crucial in the control of regulatory t - cells. degradation of tryptophan in cancer patients suggests that ido activity may be involved in several typical symptoms of chronic inflammatory conditions. ido is also related to impaired quality of life, and this correlation is obviously due to the close association between tryptophan and the biosynthesis of neurotransmitter serotonin. therefore, tryptophan deficiency could represent an important aspect in the pathogenesis of cognitive impairment and depression in patients with immunopathologic clinical conditions. data on ido thereby provide a basis to better understand the complex interplay between immune activation cascades and the development of immunodeficiency, or in other words, of the pro- and anti - inflammatory consequences of ifn-, among which ido is a central component. ifn--induced ido activity during malignant tumor diseases is part of the physiologic tumoricidal immune defense strategy, which in the long run might be detrimental to the host, when tryptophan deprivation and production of pro - apoptotic tryptophan catabolites, counteracts t - cell responsiveness. we are only beginning to understand the complexity of pathophysiological cascades in the tumor microenvironment, where particular immune cells play important roles in terms of tumor development and progression. the th1-type cytokine ifn- has been shown to be crucial in this process via serving as a stimulus for anti - proliferative biochemical pathways. these include the kynurenine pathway in which the immunomodulatory enzyme ido and its recently discovered relative ido2 initiate the first step in the degradation of the essential amino acid l - tryptophan to ultimately form a plethora of immunomodulatory metabolites. encoded by the indo gene at human chromosome 8p12, ido is an isoenzyme of hepatic tryptophan 2,3-dioxygenase (tryptophan pyrrolase, tdo) which was first described and isolated in 1963.1,2 over decades it has been reported that ido plays an immunosuppressive role in a variety of chronic infections, including viral, parasitic and bacterial infections such as human immunodeficiency virus (hiv), malaria, hepatitis c, toxoplasma gondii and chlamydia.13 ido is widely expressed in human tissues and cell subsets and its immunoregulatory properties have been shown to play a dominant role in immune responses and regulation towards self and foreign antigens. a better understanding of these mechanisms will not only allow us to unveil the pathogenesis of many diseases but also discover new therapeutic approaches in terms of prevailing tumor escape and inducing immune tolerance.4 maternal tolerance towards the semi - allogeneic fetus is only one example in which ido has been shown to mediate immune privilege by preventing t - cell driven rejection.5 this ground - breaking discovery paved the way for further research addressing the immunoregulatory potential of ido including a series of studies focusing on the role of ido - mediated tryptophan metabolites in the immune escape of tumors.6 this review highlights the experimental and clinical findings of ido - induced tryptophan degradation in the pathogenesis of malignant tumor disease and discusses potential novel anti cancer - therapeutic strategies by targeting ido. the two intracellular enzymes ido and tdo initiate the rate limiting step in l - tryptophan degradation along the kynurenine pathway and ultimately form immunomodulatory metabolites like l - kynurenine, 3-hydroxykynurenine, 3-hydroxyanthranilic acid and picolinic acid. in case the immune system gets activated, high amounts of ifn- are released mainly by leukocytes. this results in sustained ido activation most prominently in antigen presenting cells (apcs) like dcs, which leads to the afore - mentioned accumulation of downstream tryptophan products. besides that, a small amount of tryptophan is used for melatonin synthesis in the pineal gland or metabolized to serotonin in the nervous system. leucocytes are furthermore the cell source to produce redox active compounds like superoxide (oh), which generates fe2 + from fe3 + within the heme - prosthetic group of ido allowing it to proceed tryptophan metabolism (fig. this mechanism suggests that ido activity is restricted to sites of infection or inflammation.79 furthermore the redox potential of the microenvironment seems to influence the function of tryptophan metabolites as well.9 two main theories have been proposed either involving tryptophan metabolites or starving cells of tryptophan. after ido activation has been described through the course of successful pregnancy,10 in 1998 munn and mellor discovered that ido expression at the feto - maternal - interface was crucial to prevent fetal rejection in pregnant mice. pharmacologic enzyme inhibition with 1-methyl - tryptophan (1-mt) resulted in t cell mediated rejection of allogeneic but non - syngeneic fetuses.5 this maternal tolerance concept was based on the theory that local tryptophan depletion would maintain pregnancies through suppression of t - cell driven fetal rejection. tryptophan depletion induces cell cycle arrest in lymphocytes11 ultimately driving these cells into apoptosis.12 this is mainly regulated through the amino acid sensitive general control non- depressible 2 (gcn2) stress kinase pathway which becomes activated upon ido - induced tryptophan degradation and production of uncharged trna in t cells.13 a tryptophan threshold in order to inhibit t cell proliferation could not been defined yet. munn reported that tryptophan concentrations in vitro had to decrease below 0.51 m to inhibit t - cell proliferation,11 others report that even completely tryptophan free cell culture medium could not sufficiently inhibit t lymphocytes from growing.14 in humans, plasma tryptophan levels range between 50100 m. it is currently unclear to what extent tryptophan degradation and starvation accounts for ido mediated immunosuppression since minimum tryptophan threshold limit values have not been defined and probably can not be defined in vivo. in case of inflammation and tumor growth necrotic cells release their intracellular stocks and thereby supply an additional source of tryptophan to the particular microenvironment. furthermore, local decrease in tryptophan can easily be replaced through diffusion from surrounding tissues. taken all of these afore mentioned results into consideration it is currently unclear to what extent tryptophan starvation accounts for ido - mediated immunosuppression. the tryptophan metabolite theory is nourished by the fact that downstream metabolites of tryptophan cause cell cycle arrest and apoptosis in lymphocytes.1416 furthermore, they foster via to date largely unknown mechanisms the differentiation of nave cd4 + t cells into t regulatory cells (treg).17 however one study suggests that 3-hydroxyanthralinic acid directly blocks t cell antigen receptor - triggered nuclear factor-b (nf-b) activation through kinase 3-phosphoinositide - dependent protein kinase 1 (pdk1) signaling which ultimately leads to activated type 2 t helper cell death.18 in summary, both theories are not necessarily mutually exclusive but rather a concerted contribution of both mechanisms might contribute to ido - mediated immune suppression in vivo. immune escape is a fundamental trait of cancer.19 a variety of tumor escape mechanisms have been elucidated over the past.6,20 key players in this crucial escape mechanism are tregs and regulatory dcs, which create tolerance to the antigen they are presenting. furthermore, ido also seems to play a detrimental role in tumor immunity by acting in a forward feedback loop to instruct nave cd4 + t cells to become tregs but also by mediating tregs to drive naive dcs into a regulatory status.21,22 by provoking a cycle of antigen tolerance ido might switch the tumor microenvironment from hostile to supportive for tumor cells and also initiate a peripheral immune escape mechanism that facilitates progression to a more invasive tumor status.19 supporting the fact that ido has a fundamental role in immune control, recent evidence suggests that the immunosuppressive drug dexamethasone operates upon ido induction in dcs by reverse signaling through the glucocorticoid induced b7 inhibitory t cell co - receptor.23 ido does not seem to be involved in tolerizing self - antigens but rather in creating a tolerant state for non - self antigens (e.g. fetal antigens) where immune non - responsiveness is important.24 however in the eventuality of cancer, immune unresponsiveness to tumor antigens results in disease aggravation. in addition, t cells also appear to be predominantly sensitive to ido activation, since upon tryptophan starvation they can not proliferate and become activated by means of antigen presentation and they rather translate into an anergic state. tryptophan starvation furthermore triggers a gcn2-dependent stress - signaling pathway that ultimately leads to cell growth arrest through phosphorylation and translational initiation at the ribosome.13 furthermore t cells seem to be preferentially vulnerable to kynurenine derivatives and other catabolites generated by the ido pathway25 which along with tryptophan restriction appears to be important for induction of tregs and immune suppression.22,26 ido expression can be detected in most human cancers including prostate, colorectal, pancreatic, cervical, endometrial, gastric, lung, bladder, ovarian, esophageal and renal cell carcinomas, glioblastomas, mesotheliomas, and melanomas.2733 clinical studies stress that high ido expression of tumor cells correlates with outcome (table 1). in endometrial cancer, ovarian cancer and high - grade osteosarcomas, respectively, ido expression correlates with poor overall survival.3436 furthermore, our own group was able to show that ido had a significant prognostic value in terms of liver metastasis in patients with colorectal cancer. ido expression goes along with reduced cd3 lymphocyte infiltration suggesting a suppressive function on tumor reactive t - cells.37 in patients with hepatocellular carcinoma similar findings were reported.38 furthermore a significant relationship was found between the amount of ido positive tumor infiltrating cells and overall survival in non small cell lung cancer.39 in addition the presence of metastatic infiltrating ido positive cells into the lymph node at initial diagnosis correlated with a significantly worse clinical outcome in malignant lymphoma.40 in contrast ido expression in tumor endothelial cells in patients with renal cell carcinoma correlates with long - term survival.41 apart from ido, pyrazinopyrimidine compound neopterin has been shown to be a reliable prognostic marker for human malignancies.42 neopterin is released as an inflammatory marker in large amounts from human monocyte - derived macrophages and dcs preferentially following stimulation with the pro - inflammatory cytokine ifn-, thus reflecting the immune activation status. increased neopterin levels in patients with melanomas, breast cancers, squameous cell carcinomas, gynecological tumors, and colorectal carcinomas have been shown to go along with poor prognostic outcomes.32,4346 since ifn- is one of the strongest inducers of ido expression47 and due to its sustained effects on tumor cell proliferation the cross - linked interplay of ifn- and ido seems to be of great importance. this hypothesis is additionally supported by in vivo studies in an ovarian carcinoma mouse model where il-12, a cytokine with anti - tumor activity, induced complete regression of fibrosarcomas and ovarial carcinomas due to ifn- induced ido activity.48 besides its anti - proliferative effects on transformed cells49 ifn- seems to exert even stronger inhibitory effects on human cancer cell proliferation upon ido expression. almost two decades ago it has been shown in vitro that ifn- induced ido expression leads to tryptophan degradation in cell culture medium resulting in cell proliferation arrest. however tryptophan supplementation of growth medium reversed the anti - proliferative effects of ifn-.50 in conclusion, ido induction seems to be one mechanism by which ifn- inhibits malignant cell outgrow thereby being a decisive mechanism of tumor attack. since ido plays a major role in the escape of malignant cells from immunological attack it is obvious that blocking its activity should increase the anti - tumoral response and halt tumor progression. in vitro studies showed that 1-mt treatment delayed outgrowth of mouse melanoma cells that have been engrafted into syngeneic hosts.51 furthermore over - expression of ido promotes tumor growth, which again could be partially reversed by pharmacologic inhibition.28 however, in a murine breast cancer model it has been shown recently that 1-mt, although present in sufficient concentrations, only slightly retarded autochthonous breast cancer. because 1-mt only seems to be able to slow down and not to prevent tumor growth it was combined with several chemotherapeutic drugs or radiotherapy resulting in even more pronounced anti - tumoral effects.52,53 the molecular mechanism by which ido inhibition contributes to the beneficial partnership with chemotherapy still remains to be elucidated. 1-mt exists in two isoforms, l-1-mt and d-1-mt which both inhibit ido and its relative ido2, respectively. in subsequent murine tumor models it turned out that only d-1-mt significantly prolonged survival when combined with conventional chemotherapeutics.53 however, ido has a tenfold higher affinity for the l - isomer than the d - isomer, indicating that d-1-mt is less efficient in blocking ido enzymatic activity. interestingly d-1-mt did not block ifn- treated tumor cell lines or ido transfected cell lines.53 however, in some other experiments it was able to block tryptophan degradation of ido expressing dcs that were used as stimulator cells in allogeneic mixed lymphocyte culture and accordingly increased t - cell proliferation in the co culture system. the question why d-1-mt inhibits ido activity in only some cells and does not inhibit the activity of the purified ido enzyme was answered when another ido isoform was discovered. the gene ido2 encodes an ido - like protein and has recently been detected on the human chromosome 8. ido2 is inhibited by d-1-mt but unaffected by l-1-mt54 and is constitutively expressed in several tissues.55 when compared to ido, ido2 has only 3%5% of enzymatic activity, however this activity can be increased through modified assay conditions.4,55 although d-1-mt has recently entered clinical trials (nct00567931 ; new link genetics corporation ; patent storm) therapeutic effects in humans still have to be figured out. current data have revealed that only the levo - isoform of 1-mt has ido blocking capacities in human malignancies where only ido but not ido2 is expressedv.56 furthermore, even if ido2 would be active, only a subset of patients would benefit from therapy with d-1-mt as 50% of caucasians lack functional ido2 alleles.4,54 summarizing the experimental and clinical data above, there is clear evidence that ido interferes with immune regulation. ido has evolved from a simple tryptophan catabolizing enzyme into an important immune regulator and an important player in tumor immunosurveillance. there is a great body of evidence that ido is expressed by tumor cells, tumor infiltrating immune cells and in tumor draining lymph nodes and that the expression of ido contributes to the ability of tumors to evade the immune system. taken together these facts offer a rationale for the clinical investigation of the capacity of ido inhibitors to increase the efficacy of anticancer immunotherapy, in addition to conventional tumor radiation and chemotherapeutic agents. in particular, combining chemotherapy with pharmacologic ido inhibition seems to be key to success in preventing ido mediated immunologic tolerance when chemotherapy has already destroyed tumor cells and released tumor antigens. studying ifn--induced ido activity in tumors may also lead to a better general understanding of immunoregulation in cancer and foster novel therapeutic strategies for modern cancer warfare.	immune escape is a fundamental trait of cancer in which the th1-type cytokine interferon- (ifn-) seems to play a key role. among other tumoricidal biochemical pathways, ifn- induces the tryptophan - degrading enzyme indoleamine 2,3-dioxygenase (ido) in a variety of cells including macrophages, dendritic cells (dcs) and tumor cells. ido activity has been shown to reflect the extent and the course in a plethora of malignancies including prostate, colorectal, pancreatic, cervical, endometrial, gastric, lung, bladder, ovarian, esophageal and renal cell carcinomas, glioblastomas, mesotheliomas, and melanomas. furthermore ido activity during malignant tumor diseases seems to be part of the tumoricidal immune defense strategy, which in the long run is detrimental to the host, when tryptophan deprivation and production of pro - apoptotic tryptophan catabolites counteract t - cell responsiveness.
cor triatriatum is a rare congenital cardiac malformation with an estimated incidence of 0.1% of all congenital heart disease and it usually refers to the left atrium (cor triatriatum sinister). in cor triatriatum sinister (cts) the left atrium is divided by a fibromuscular membrane into two distinct chambers : a posterior - superior chamber receiving the four pulmonary veins and an anterior - inferior chamber (true left atrium) that connects to the left ventricle by means of the mitral valve.1 in cts, the obstructive nature of the membrane leads to creation of a pressure gradient, with an associated rise in pulmonary venous pressures.2 total situs inversus (tsi) is characterized by a heart on the right side of the midline while the liver and the gall bladder are on the left side. here we report an extremely rare case of cor triatriatum sinister which is associated with tsi. physical examination revealed a pulse rate of 145 beats / minute, blood pressure of 94/50 mmhg, with baseline oxygen saturation of 99%. on cardiac examination, the second heart sound was normal and there was no evidence of pulmonary hypertension. auscultation of the right chest revealed a 3/6 systolic murmur at the right parasternal border. laboratory investigation showed a hemoglobin level of 10 g% and a white cell count of 16,000 mm. a gastric air bubble was noted on the right side, and a liver shadow on the left side was present. abdominal ultrasound demonstrated the stomach and spleen on the right side and the liver on the left. transthoracic echocardiography (tte) demonstrated { i, l, i } (i, situs visceroatrialis inversus ; l, l - loop of the ventricles ; i, normally related inverted great arteries). it also showed a fibromuscular membrane across the left atrium, dividing it into two compartments suggestive of cor triatriatum sinister (fig 1. & fig 2). the two chambers communicated through two restrictive orifices (gradient:16mmhg) (fig 3). a small size patent ductus arteriosus (gradient 20/6mmhg) with left to right shunt was present (fig 4). other cardiac anomalies like patent foramen ovale (pfo), atrial septal defect (asd) and anomalous venous connections were ruled out and the diagnosis of cor triatriatum sinister associated with tsi was reconfirmed. apical four - chamber view shows the turbulent flow across the orifice of fibromuscular membrane. cor triatriatum was first described by church in 1868, and the membrane of cor triatriatum appears as a linear echo bisecting the left atrium (cts). the embryologic etiology of cts remains debated, it may result from incomplete incorporation of the common pulmonary vein into the left atrium, abnormal overgrowth of septum primum, entrapment of the common pulmonary vein by the left horn of the sinus venosus preventing its incorporation into the left atrium,1 or persistence of a left - sided superior vena cava which may impinge on the left atrium, resulting in the formation of an abnormal membrane.23 cts was classified in 1949 by loeffler,4 according to the number and size of the orifices in the fibromuscular septum : group 1 is defined as having no opening, group 2 as having one or more small openings and group 3 as having a single, large opening. our case has two small restricted openings present in the fibromuscular membrane (cts) which falls into group 2 classification. cor triatriatum may be associated with major congenital cardiac lesions such as tetralogy of fallot, double outlet right ventricle, coarctation of the aorta, partial anomalous pulmonary venous connection, persistent left superior vena cava with unroofed coronary sinus, ventricular septal defect, atrioventricular septal defect, common atrioventricular canal and rarely asplenia and polysplenia. total situs inversus (tsi), termed as mirror image dextrocardia, is characterized by a heart on the right side of the midline while the liver and the gall bladder are on the left side. the clinical manifestations of cts depend upon the size of the opening in the fibromuscular membrane and the presence of associated congenital cardiac defects. the presentation of cts can mimic those of mitral stenosis, supravalvular mitral ring, left atrial thrombus or pulmonary venous stenosis. the common presenting symptoms are dyspnea, hemoptysis and orthopnea as a result of the obstructive function of the intra - atrial membrane.5 often, cts is misdiagnosed as mitral valve disease, but can be erroneously diagnosed as primary pulmonary hypertension.6 several techniques have been used for diagnosis establishment such as transthoracic echocardiography (tte), transesophageal echocardiography (tee), ct (computerized tomography) scan and magnetic resonance imaging (mri). the typical ctsappears as a membrane attached laterally to the junction of the left upper pulmonic vein and left atrial appendage, dividing the left atrium into 2 chambers. the proximal chamber receives blood from the pulmonary veins and the distal chamber contains the left atrial appendage and mitral valve. three - dimensional reconstruction of echocardiographic images has been used to better define the membrane and its relationship to surrounding structures. both computerized tomography of the heart and cardiac magnetic resonance imaging (mri) have been used for evaluating patients with suspected cor triatriatum. the use of ct scan however includes the hazards of radiation, while tee includes the discomfort of scope intubation. tte is the best method for evaluating the cts.79 surgical resection of the accessory fibromuscular membrane has been successful in symptomatic patients with cor triatriatum even though successful balloon catheter dilatation of the communication between the two chambers has been described.10 to the best of our knowledge, this is only the second report in the literature of a patient with total situs inversus presenting with cts.11	cor triatriatum sinister is a rare congenital cardiac malformation characterized by a membrane in the left atrium which separates the left atrium into the proximal and distal chambers. association of cor triatriatum is extremely rare with situs inversus totalis. here we report a rare case of cor triatriatum sinister with situs inversus totalis in a 5 month old female infant.
massive hemoptysis is a life - threatening medical emergency with mortality rates ranging as high as 75%. transcatheter embolization of bronchial arteries has been regarded as an effective and safe method for the management of massive hemoptysis. chronic pulmonary thromboembolism (pte) is one of these causes, though its exact incidence remains unknown. compensatory hypertrophy of bronchial arteries is known to occur in chronic pte and pulmonary hypertension. however, the exact mechanism of hemoptysis in these patients is unclear. bleeding due to the rupture of smaller vessels or bleeding from hypertrophied bronchial arteries though bronchial artery embolization has been proposed to be effective in the management of hemoptysis, the ideal treatment for hemoptysis in patients with chronic pte remains uncertain. we report one case of hemoptysis in chronic pte with pulmonary arterial hypertension (pah) treated successfully with bronchial artery embolization. a 30-year - old male patient presented to the emergency department of our institute with recurrent bouts of hemoptysis for 1 week, along with shortness of breath., he was found to have tachycardia (pulse rate : 100 bpm) and tachypnea (respiratory rate : 30 breaths / min) with decreased oxygen saturation (85% in room air). the patient underwent computed tomography (ct) and bronchial angiography that showed two bronchial arteries on the right side, which were hypertrophied and tortuous (measuring ~2.6 mm and 2.4 mm, respectively, in maximum caliber) [figure 1a ]. in addition, there was a thrombus in the right pulmonary artery, extending from its origin till the subsegmental branches [figure 1b ]. the right pulmonary artery was reduced in caliber with the dilated main and left pulmonary arteries. two - dimensional echocardiogram (2d echo) was done for the patient that showed severe pah with dilated right atrium and ventricle. on bronchoscopy, active bleeding with clots was seen in the segmental bronchus of the right lower lobe. (a, b) coronal maximum intensity projection (mip) images of ct bronchial angiography showing hypertrophied right bronchial arteries (arrows in a). one of the bronchial arteries was arising from the intercostobronchial trunk from the descending aorta (not shown here). origin of the second right bronchial artery was, however, not clear on ct angiography. a thrombus was seen in the right pulmonary artery (arrow in b) extending till the subsegmental branches the patient was taken up for bronchial angiography. the second bronchial artery was being reconstituted by the internal mammary artery and was hypertrophied [figure 3 ]. both the bronchial arteries were embolized with polyvinyl alcohol (pva) (500 - 700 m) and gelfoam slurry. no other significant systemic collateral was identified on diagnostic runs of the bilateral subclavian arteries. digital subtraction angiogram of the right intercostobronchial trunk (anteroposterior projection) showing hypertrophied and tortuous bronchial artery. postembolization angiogram showed no opacification of the distal bronchial artery (image on the right side) digital subtraction angiogram of the right internal mammary artery showed hypertrophied second right bronchial artery arising from the internal mammary artery. chronic pte is associated with compensatory hypertrophy of the bronchial arteries and bronchopulmonary collaterals. increased incidence of bronchial artery hypertrophy on ct angiography has been reported in chronic pte and pah. though hemoptysis can occur due to hypertrophied bronchial arteries secondary to any cause, its exact incidence in chronic pte is unknown. one systemic review of the literature reported chronic pte as a cause of moderate - to - massive hemoptysis in 0.1% of cases. we report one case in which bronchial artery embolization was successful in managing hemoptysis in a patient with chronic pte with pah. one patient was successfully treated while the other patient continued to have active hemoptysis due to collaterals from the subclavian artery. reembolization was carried out for this patient but the patient died due to right ventricular failure. it was suggested that due to the requirement of anticoagulation for pte, even mild hemoptysis in these patients should be offered immediate intervention. however, another study reported the failure of bronchial artery embolization to prevent hemoptysis in a patient with chronic thromboembolic pah. in chronic pte, there is a propensity for the formation of thromboemboli. at the same time even mild hemoptysis in these patients should be given prompt treatment due to the underlying risk of progression to massive hemoptysis due to the ongoing anticoagulation therapy. however, very limited literature is available on the management of hemoptysis in chronic pte. no study has been carried out to evaluate the long - term effect of bronchial artery embolization in preventing hemoptysis. also, the precise mechanism of hemoptysis in chronic pte is still not clear. thus, further studies are required to establish the role of bronchial artery embolization in chronic pte.	bronchial artery embolization is the treatment of choice for the management of life - threatening massive hemoptysis. chronic pulmonary thromboembolism (pte) is one of the rare causes of hemoptysis. management of hemoptysis in chronic pte is a point of debate. in this article, we have reported one case of hemoptysis in chronic pte managed successfully with bronchial artery embolization.
chronic kidney disease (ckd) is a growing problem due to our aging population and their coexisting comorbidities.1 atrial fibrillation (af) is the most common sustained cardiac arrhythmia in patients with ckd,2 is the most common arrhythmia requiring medical therapy, and its prevalence increases with advancing age.3 new - onset af also occurs with aging as the glomerular filtration rate (gfr) declines and proteinuria worsens.4,5 approximately 15% of patients are found to have ckd when af is diagnosed.6 go have estimated that, in the united states alone, more 5.6 million people will be affected by af by 2050, with more than half those affected aged 80 years or more.7 the framingham study showed that af is an independent risk factor for stroke.8 almost 90% of deaths caused by stroke occur in people over 65 years of age. contemporary therapy for af aims to relieve symptoms and prevent complications such as stroke and heart failure.9 in clinical practice, the chads2 score (congestive heart failure, 1 point ; hypertension, 1 point ; 75 years old, 1 point ; diabetes, 1 point ; prior stroke or transient ischemic attack or thromboembolism, 2 points) is a predictor for estimating the risk of stroke in patients with af10 and is used to determine whether oral anticoagulation, typically with vitamin k antagonists, is required. af in patients with ckd and a high chads2 score (2 points) is associated with a poor outcome and vitamin k antagonist therapy is recommended to reduce mortality and the risk of stroke.1113 randomized controlled trials have shown that prophylactic treatment with warfarin decreases the risk of stroke by 60%70% in patients with af.14 however, although the risk of stroke increases with age, so does the risk of hemorrhage secondary to anticoagulation ; as a result, elderly patients tend to be undertreated with warfarin.15 in addition, warfarin appears to be capable of causing direct renal injury, with warfarin - related nephropathy being reported in patients with and without ckd.16 the primary objective of this study was to assess the impact of warfarin therapy on estimated gfr in elderly patients with ckd and af. our secondary objective was to assess the impact of warfarin therapy on all - cause mortality in these patients. we performed a retrospective cohort study, examining the records of 2023 patients with ckd treated in our tertiary medical center between january 2001 and september 2012. from these records, we selected a cohort of patients aged 60 years or more, in permanent nonvalvular af with a chads2 score greater than 2 points, national kidney foundation kidney disease outcomes quality initiative17 ckd stage 35, and under regular follow - up for more than three months. we excluded patients lacking serial estimated gfr data or lacking regular international normalized ratio (inr) measurements and those with cardiovascular or major hemorrhage events at first hospitalization. to improve the quality of reporting observational studies, the manuscript was organized in a manner compliant with the strobe (the strengthening the reporting of observational studies in epidemiology) statement.18 patient flow is show in figure 1, including the number of patients screened and excluded. the formula used for estimated gfr was a simplified modification of diet in renal disease equation : during the study, despite the small sample, we made an effort to maintain representativeness and to ensure generality. we checked the inr for patients commenced on warfarin every two weeks in the first month, monthly for three months, and then once every three months. the target range for inr was 23 and the usual dose of warfarin was 12.5 mg daily. diagnoses of paroxysmal, persistent, or permanent af were made according to american college of cardiology, american heart association, and european society of cardiology guidelines.19 the 61 patients selected were divided into two groups : those receiving an antiplatelet regimen such as aspirin 100 mg / day or clopidogrel 75 mg / day but not warfarin (group a) and those receiving warfarin treatment (group b). we used the kidney disease outcomes quality initiative guidelines to determine the goals for ideal blood pressure, glucose, and lipid control. the mann - whitney u test was used to compare the median values of continuous variables between the groups. the wilcoxon signed rank test was used to examine within - group changes at different time points. the chi - square test or fisher s exact test was used to compare categorical data. to estimate the effect of warfarin treatment and adjust for the possible inter - correlations of data collected from the same patient and other covariates, we used a generalized estimating equation to fit a linear regression model that yields robust standard errors estimated in the model. survival analysis was evaluated by the kaplan - meier method and the log rank test ; variables that achieved statistical significance (p 3.0 in patients with and without ckd.16 renal biopsy suggests that glomerular hemorrhage and subsequent renal tubular obstruction by red blood cell casts is a potential mechanism.29 in our study, the mean inr was 1.95 1.01 and gross hematuria was not noted. we found that warfarin maintaining a mean inr of 1.95 1.01 significantly reduced all - cause mortality in elderly patients with af and ckd compared with those treated with an antiplatelet regimen over 12 years, and there was no difference in the incidence of bleeding. our results are comparable with those of the randomized controlled bafta (birmingham atrial fibrillation treatment of the aged) trial.30 ali also suggested that antiplatelet agents should not be an alternative means of anticoagulation in older people with af due to lack of efficacy, and that bleeding risk should be assessed on an individual basis.31 our study has some limitations. the study sample size was relatively small, the analysis was retrospective, the demographic studied was narrow, the results can not be generalized, elderly patients with af, ckd, and a high chads2 score also have other comorbidities (all of which have a negative impact on patients survival and renal function) and the study was conducted over 12 years. it might also be worth mentioning the possibility of chronology bias, in that survival may have been influenced by the introduction of lifestyle modification or other more effective drugs, except warfarin. warfarin therapy, as compared with an antiplatelet regimen, slowed the rate of decline in renal function over an 18-month period in elderly patients with af and ckd and improved long - term survival.	backgroundthe purpose of this study was to examine whether long - term use of anticoagulants in elderly patients with atrial fibrillation (af) and chronic kidney disease (ckd) influences renal function.methodsin this retrospective observational study, we reviewed the records of 2023 patients who attended our institution for treatment of ckd between january 2001 and september 2012. inclusion criteria were having been under review for three months or more, age older than 60 years, permanent af, a chads2 score > 2, and national kidney foundation kidney disease outcomes quality initiative ckd stage 35. sixty - one patients fulfilled these criteria, and were divided into those receiving antiplatelet anticoagulation (group a) and those receiving warfarin (group b). the results of laboratory investigations and estimated glomerular filtration rate (gfr) were recorded at months 3, 6, 12, and 18 from treatment initiation. we also recorded the occurrence of serious cardiovascular and neurological events, significant bleeding, and survival beyond 12 years.resultsof the 61 patients enrolled, 35 were in group a and 26 were in group b. the mean international normalized ratio (inr) was 1.95 1.01 (goal < 3.0). after adjustment for potential confounding variables, we found that patients in group b had a higher estimated gfr (6.06 2.36 ml per minute, p = 0.01). over a 12-year observation period, group b patients had significantly (p = 0.013) better survival than group a, with an adjusted hazard ratio for mortality of 0.318 (p = 0.022).conclusionwarfarin therapy may delay deterioration in renal function and improve survival of elderly patients with ckd and af.
maturity - onset diabetes of the young (mody) was distinguished from other types of diabetes mellitus in 1970 (1). it is clinically characterized by nonketotic diabetes mellitus, a primary defect in the function of the beta cells of the pancreas, an onset before the age of 25 yr (usually in childhood or adolescence), and an autosomal dominant mode of inheritance (2). mody seems to be an attractive model for genetic studies because its well - defined mode of autosomal dominant inheritance with high penetrance, and its early onset age that aids the collection of multigenerational pedigrees (3). the molecular genetic basis of mody started in the 1990s (46), showed that mody is a heterogenous group of monogenic disorders. to date, online mendelian inheritance in man (omim) has listed mody1 - 11 based on implicated genes (table 1) (7). genetic classification and clinical phenotypes of the mody subtypes adapted from attiya (41) mody - related genes that have been most commonly studied are the hepatic nuclear factor 4 alpha (hnf4) (mody1), glucokinase (gck) (mody2), the hepatic nuclear factor 1 alpha (hnf1) (mody3), the insulin promoter factor-1 (ipf1) (mody4) and the hepatic nuclear factor 1 beta (hnf1) (mody5) for example, around 32%, 52%, 10% and 6% of cases in the uk were due to gck, hnf1, hnf4, and hnf1, respectively (8). to adding the heterogeneity of mody, diverse mutations were reported in each pathogenic gene. for gck only, more than 600 mutations have been described so far, leading to both hypoglycemia and hyperglycemia (9). furthermore, 1645% of the cases of mody can not be sorted into these 11 subtypes, and be named mody - x. more studied are needed to discover the unknown mody locus or loci (10). population studies revealed that heterogeneity also exists within mody patients of different ethnic groups (11). for example, mody2 (gck) and mody3 (hnf-1a) were found to account for more than 80% of cases in a cohort of u.k. however, in hong kong chinese, these two forms of mody were found to be responsible for a mere 4% and 5%, respectively (13). except for the subtype heterogeneity, the mutations of the same mody subtype that has been reported in different populations are usually different and hard to be confirmed (11). to help the overall understanding of mody - related pathologic mutations, we studied a large chinese mody family. we use whole genome scan and candidate gene sequencing to identify the mody subtype of the family, and to find the related gene mutation. a large han pedigree in 2012 in shandong province, northern china, was identified through a proband with typical mody features (fig. 1). pedigree of the mody family from changqing, shandong, china the pattern of inheritance within the family is consistent with autosomal - dominant inheritance. in total, 9 individuals in this three - generation family met mody diagnostic criteria (14) and showed a broad spectrum of clinical diabetic phenotypes. this study obtained signed informed consent from 9 affected and 17 unaffected family members or their guardians, and 1000 adult voluntary blood donors. this study was approved by the ethics committee of the institute of basic medicine of shandong academy of medical sciences. peripheral venous blood samples were collected from 9 mody patients in the family (2 males and 7 females, age 1554), 17 unaffected family members (8 males and 9 females, age 777) and 1000 apparently healthy blood donors randomly selected from the blood center of shandong province (702 males and 298 females, aged 1755). genomic dna was extracted by a modified phenol - chloroform method as described before (15). the pooled dna samples of (i) mody patients in the family (n=9), (ii) unaffected family members (n=17), and (iii) unrelated population controls (n=1000), were obtained by combining equal amounts of dna from each individual (16). a panel of 400 microsatellite marker loci was genotyped in three pooled dna samples, using abi prism linkage mapping set md-10 (abi). the set has fluorescence - labeled pcr primer pairs for 400 highly polymorphic dinucleotide - repeat microsatellite markers chosen from the geneth on human genetic linkage map on both autosomal and sex chromosomes, with an average spacing of 10 cm (17). polymerase chain reaction (pcr), electrophoresis and genotyping analysis were as described before (15). fifteen-l pcr mixture contained 20 ng of genomic dna, 1.5 mm mgci2, 10x reaction buffer, 0.2 mm of each dntp, 0.3 m of each primer, and 1u of taq polymerase. amplification was performed on a gene amp 9700 thermo cycler (applied bio systems) with the following parameters : 95 c for 12 min initial denaturation, followed by 94 c 15 sec, 55 c 15 sec, 72 c 30 sec, 10 cycles ; then 89 c 15 sec, 55 c 15 sec, 72 c 30 sec, 20 cycles, then 72 c 10 min, and 4 c hold. electrophoresis was carried out on abi prism 3100 avant genetic analyzer, by mixing up to 9 pcr products simultaneously, which had no overlap of products of the same size range labelled with the same dye. the predicted allele frequencies of microsatellites in each dna pool were calculated as allele frequency = fluorescence peak height of each allele / the sum of fluorescence peak height of all allele at the marker. allele frequency was converted into allele counts and the statistical significance was calculated with clump24, a dos executable with c source code based on monte carlo method for assessing significance of case - control association studies with multi - allelic markers (http://www.davecurtis.net/dcurtis/software.html) (18). to reduce false positive error, primers for nine exons of hnf-1 (listed in table 2) were designed using primer premier 5.0 software (http://www.premierbiosoft.com). pcr in a 50 l volume was performed with 5 l genomic dna (20 ng/l), 5 l of each primer (5 m) and 25 l of multiplex pcr mix (takara) was performed on a geneamp9700 thermo cycler (abi) with the following parameters : 94 c for 5 min initial denaturation, followed by 94 c 30 sec, 59 c 30 sec, 72 c 60 sec, 45 cycles ; then 72 c 7 min, and 4 c hold. after spin column purification, the reaction products was sequenced using bigdye terminator v3.1 cycle sequencing kit (abi). the purified labeled dna fragments were sequenced by applied bio systems 3130 genetic analyzer (abi) and analyzed by sequencing analysis software 5.2 (abi). a large han pedigree in 2012 in shandong province, northern china, was identified through a proband with typical mody features (fig. 1). pedigree of the mody family from changqing, shandong, china the pattern of inheritance within the family is consistent with autosomal - dominant inheritance. in total, 9 individuals in this three - generation family met mody diagnostic criteria (14) and showed a broad spectrum of clinical diabetic phenotypes. this study obtained signed informed consent from 9 affected and 17 unaffected family members or their guardians, and 1000 adult voluntary blood donors. this study was approved by the ethics committee of the institute of basic medicine of shandong academy of medical sciences. peripheral venous blood samples were collected from 9 mody patients in the family (2 males and 7 females, age 1554), 17 unaffected family members (8 males and 9 females, age 777) and 1000 apparently healthy blood donors randomly selected from the blood center of shandong province (702 males and 298 females, aged 1755). genomic dna was extracted by a modified phenol - chloroform method as described before (15). the pooled dna samples of (i) mody patients in the family (n=9), (ii) unaffected family members (n=17), and (iii) unrelated population controls (n=1000), were obtained by combining equal amounts of dna from each individual (16). a panel of 400 microsatellite marker loci was genotyped in three pooled dna samples, using abi prism linkage mapping set md-10 (abi). the set has fluorescence - labeled pcr primer pairs for 400 highly polymorphic dinucleotide - repeat microsatellite markers chosen from the geneth on human genetic linkage map on both autosomal and sex chromosomes, with an average spacing of 10 cm (17). polymerase chain reaction (pcr), electrophoresis and genotyping analysis were as described before (15). fifteen-l pcr mixture contained 20 ng of genomic dna, 1.5 mm mgci2, 10x reaction buffer, 0.2 mm of each dntp, 0.3 m of each primer, and 1u of taq polymerase. amplification was performed on a gene amp 9700 thermo cycler (applied bio systems) with the following parameters : 95 c for 12 min initial denaturation, followed by 94 c 15 sec, 55 c 15 sec, 72 c 30 sec, 10 cycles ; then 89 c 15 sec, 55 c 15 sec, 72 c 30 sec, 20 cycles, then 72 c 10 min, and 4 c hold. electrophoresis was carried out on abi prism 3100 avant genetic analyzer, by mixing up to 9 pcr products simultaneously, which had no overlap of products of the same size range labelled with the same dye. the predicted allele frequencies of microsatellites in each dna pool were calculated as allele frequency = fluorescence peak height of each allele / the sum of fluorescence peak height of all allele at the marker. allele frequency was converted into allele counts and the statistical significance was calculated with clump24, a dos executable with c source code based on monte carlo method for assessing significance of case - control association studies with multi - allelic markers (http://www.davecurtis.net/dcurtis/software.html) (18). to reduce false positive error, primers for nine exons of hnf-1 (listed in table 2) were designed using primer premier 5.0 software (http://www.premierbiosoft.com). pcr in a 50 l volume was performed with 5 l genomic dna (20 ng/l), 5 l of each primer (5 m) and 25 l of multiplex pcr mix (takara) was performed on a geneamp9700 thermo cycler (abi) with the following parameters : 94 c for 5 min initial denaturation, followed by 94 c 30 sec, 59 c 30 sec, 72 c 60 sec, 45 cycles ; then 72 c 7 min, and 4 c hold. after spin column purification, the reaction products was sequenced using bigdye terminator v3.1 cycle sequencing kit (abi). the purified labeled dna fragments were sequenced by applied bio systems 3130 genetic analyzer (abi) and analyzed by sequencing analysis software 5.2 (abi). of all the 400 microsatellite marker loci in abi prism linkage mapping set md-10 (abi), d17s798 on chromosome 17q11.2 was related with mody in the family. allele frequencies for d17s798 were found to differ significantly (p<0.001) between the affected and unaffected family members, the affected and the healthy controls, but not between unaffected family members and the healthy controls (p=0.94) (fig. no microsatellite markers on sex chromosomes showed significant differences for frequency between any of the dna pooling samples, indicating an autosomal dominant inheritance that is one of the mody criterions. allele frequency estimates for d17s798 close to d17s798 (17q11.2), there is a known mody - related gene on 17q12, hepatocyte nuclear factor-1 (hnf-1). the differences of allele frequencies for the d17s798 mentioned above implicated that the affected family members can be sorted as the mody5 subtype. a single nucleotide variant (snv) of c77 t in the 5-terminal non - coding region of exon 1 of hnf-1 was related to mody5 in the proband by sequencing and alignment analysis (fig. of all the 400 microsatellite marker loci in abi prism linkage mapping set md-10 (abi), d17s798 on chromosome 17q11.2 was related with mody in the family. allele frequencies for d17s798 were found to differ significantly (p<0.001) between the affected and unaffected family members, the affected and the healthy controls, but not between unaffected family members and the healthy controls (p=0.94) (fig. no microsatellite markers on sex chromosomes showed significant differences for frequency between any of the dna pooling samples, indicating an autosomal dominant inheritance that is one of the mody criterions. close to d17s798 (17q11.2), there is a known mody - related gene on 17q12, hepatocyte nuclear factor-1 (hnf-1). the differences of allele frequencies for the d17s798 mentioned above implicated that the affected family members can be sorted as the mody5 subtype. a single nucleotide variant (snv) of c77 t in the 5-terminal non - coding region of exon 1 of hnf-1 was related to mody5 in the proband by sequencing and alignment analysis (fig. in the current study, allelic frequency of marker d17s798 on chromosome 17q11.2 was found to be related to mody in the chinese family. the known mody - related gene near d17s798 is hnf-1, implicating the patients in the family were mody5 subtype. further sequencing and alignment analysis found that a single nucleotide variant (snv) of c77 t in the 5-terminal non - coding region of exon 1 of hnf-1 was related to mody5 in the proband. mody is an entity of several monogenic disorders, and 11 genes have been associated to different mody subtypes : mody1-hnf4, mody2-gck, mody3-hnf1, mody4-pdx1, mody5-hnf1, mody6-neurod1, mody7-klf11, mody8-cel, mody9-pax4, mody10-ins, mody11-blk (7). another research interest in the mody studies is heterogeneous across populations. the relative prevalence of each sub - types varied (21, 22). in european populations, mody2 (the most prevalent form in french families) (21) and mody3 (the most prevalent form in british families) (22) kindred clinically diagnosed as mody, a relative prevalence of 36% of mody3, 10% of mody2 and 3% of mody1 were reported (23). in spain, relative frequencies in the mody group were 80% mody2, 8.5% mody3 and 1% mody5 (24). the other mody subtypes are rarely described in european studies. however, the studies in other continents reported that mody2 and mody3 are less prevalent. for example, mody2 and mody3 mutations were accounted for 13% and 8.7% in 23 brazilian families only (25). similarly, in asia, mody2 and mody3 do not explain the majority of mody cases (2628). found in 79 mody japanese patients, type 2 and type 3 accounts for about 36.7% (11 plus 18). next most prevalent were mody 5 (6 patients) and mody 1 (3 patients) (26). in a cohort of 27 mody korean patients and 17 patients with early onset type 2 diabetes, mody2 and mody 3 variants were found in only 3 patients (including 1 mody patient) (27). in china particularly, a comprehensive study on 146 hong kong chinese mody families found 13 families had mody3 mutations (9%), 2 had mody2 mutations (1%). the authors concluded that the majority of chinese mody patients are due to yet unknown genes (29). wang. screened in 154 unrelated probands from early onset and multiple affected diabetes chinese pedigrees and found only two patients carried mutation of hnf-1 gene (30). here, we reported a large mody5 family found in the northern china, as a supplement to the above two chinese study which are based in the southern china. hnf-1 gene (gene i d : 6928) is located in chromosome 17:37686432 - 37745247, encoded a protein of 557 amino acids in length (http://asia.ensembl.org/). missense mutations that caused protein sequence changes were reported in different populations, e.g. m160v in australian (31), p239r in romanian (34), l264s in japanese patients (32), p159l in korean patients (35) and s36f in chinese patients (30). a frame - shift mutation, c.c1304del was found in italy patients, which resulted in a truncated protein (36). monoallelic loss of the entire hnf1b gene were reported in merman patients who showed more severe clinical symptoms other than diabetes, such as pancreas dysplasia, exocrine insufficiency, genital defects and mental retardation (37). in the systematic review of hnf-1 anomalies related to mody5 (38), the detection rate of hnf-1 anomalies was 1.4% among mody cases (1.4%) and 41.2% among mody cases with renal structure anomalies. mutations were strikingly located within the dna binding domain and spread among exons of the dna binding domain with exons 2 and 4 were the hottest spots. however, in our mody family an exon 1 mutation was implicated. this novel snv is located in the 5-terminal non - coding region of exon 1. the function of the 5 non - coding region of eukaryotic mrna and its binding proteins has not been extensively studied. generally, the 5 non - coding region plays a crucial role in the protein translation by forming secondary structure and providing binding sites for the ribosome and translation factors (39). therefore, we hypothesize that the change from a methylateable base c to a non - methylateable base t in the 5non - coding region of hnf-1 may change transcription levels by altering the mrna secondary structure and influence the binding sites for ribosome and/or translation factors. the svp of c77 t in the 5non - coding region of hnf-1 was related to mody5 in the chinese family studied. previously detected mutations mainly indicated pathology resulting from the relation between hnf-1 protein structure / function and primary insulin secretory defects. as this novel mutation is in a non - coding region of the gene it suggests that regulation of the gene may be worthy of attention in studying the pathological mechanism of mody or diabetes. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.	background : maturity - onset diabetes of the young (mody) is a heterogeneous entity of monogenic disorders characterized by autosomal dominant inheritance. eleven genes were related, including hnf4, gck, hnf1, ipf1, and hnf-1, and various mutations are being reported.methods:to help the overall understanding of mody - related pathologic mutations, we studied a large mody family found in 2012, in shandong, china, which contained 9 patients over 3 generations. dna was extracted from the periphery blood samples of (i) 9 affected members, (ii) 17 unaffected members, and (iii) 1000 healthy controls. three pooled samples were obtained by mixing equal quantity of dna of each individual within the each group. totally 400 microsatellite markers across the whole genome were genotyped by capillary electrophoresis. the known mody - related gene near the identified marker was sequenced to look for putative risk variants.results:allelic frequency of marker d17s798 on chromosome 17q11.2 were significantly different (p<0.001) between the affected vs. unaffected members and the affected vs. healthy controls, but not between the unaffected members vs. healthy controls. mody5-related gene, hepatocyte nuclear factor-1 (hnf-1) on 17q12 near d17s798 became the candidate gene. a single nucleotide variant (snv) of c77 t in the non - coding area of exon 1 of hnf-1 was found to be related to mody5.conclusion:this novel snv of hnf-1 contributes to the diabetes development in the family through regulating gene expression most likely. the findings help presymptomatic diagnosis, and imply that mutations in the non - coding areas, as well as in the exons, play roles in the etiology of mody.
patients with obsessive compulsive disorder (ocd) have been traditionally described as having a good insight into their symptoms ; they perceive their obsessive - compulsive (oc) symptoms as excessive, unreasonable, and distressing. the dsm iv field trial demonstrated that about a quarter of the patients were uncertain about whether their symptoms were unreasonable or excessive, indicating that a broad range of insight exists among patients with ocd. it is now well - recognized that patients with ocd may present with varying degrees of insight, including poor and complete lack of insight into their oc symptoms.[24 ] pathological beliefs appear to be placed along an symptom component properties, they determine obsessions at one end, where beliefs are recognized as irrational. overvalued ideas lie somewhere in the middle, and delusions where the beliefs are considered rational, lie at the other pole. it can be a phenomenological challenge when the thin line of separation between these becomes difficult to discern. ms. s, a 35-year - old, married lady presented with a one - year history of marked social withdrawal, muttering to herself, and suspiciousness. on clarification with her husband regarding her suspiciousness it was found that she kept enquiring from him whether their acquaintances had visited her or not, subsequently she would report about her belief that she felt her acquaintances were not visiting her often, and hence, they could possibly be cheating her, but would not elaborate further. she firmly held on to these beliefs in spite of her husband telling her otherwise. for the last two weeks there had been a worsening of illness, characterized by crying spells, along with two suicidal attempts of high intentionality and lethality. after hospitalization, she was found to be tearful and withdrawn, reported of being fearful and expressed death wishes. an initial impression of psychosis, with a phenomenological inference of delusion of persecution, was made as per the longitudinal course of the illness from the available information, and she was started on tablet risperidone 2 mg. she continued to express fearfulness and did not show much improvement with risperidone. during the course of hospitalization, she was noticed to be repeatedly asking others to forgive her for a mistake she had committed. on further clarification, she elaborated that she had been getting repeated thoughts that she had done something wrong, which could be the reason for her feeling that her acquaintances were not visiting her often. suspicious behavior. she would get these repetitive, anxiety provoking thoughts so often that she started wondering whether she had actually done something wrong. the level of conviction regarding this thought was quite high and she did not feel that this thought was in anyway irrational. hence, she had started feeling, she would constantly ask reassurance from others, would check with her husband as to why a particular acquaintance had not visited her, and would keep repeatedly muttering to herself about this issue. the thoughts were very repetitive, stereotyped, and distressing, while they remained uncontrollable. as the frequency of these thoughts increased, she started feeling sad throughout the day, along with ideas of hopelessness, guilt, and suicidal ideas. subsequently, her diagnosis was revised to obsessive compulsive disorder (ocd), with obsessions of intrusive thoughts / images and compulsion of reassurance seeking as denoted in the yale brown obsessive compulsive scale (ybocs) symptom checklist. the ybocs obsession score was 16 and compulsion score was 10 (ybocs total score of 26). she was started on fluoxetine 20 mg / day, which was increased to 40 mg per day in a week. after two months follow - up, she had significant improvement in her symptoms with the ybocs total score decreasing to 10. this case demonstrates the importance of eliciting psychopathology in greater detail for specific diagnosis and treatment decisions, especially in the absence of a clear history. the presentation of the case with suspiciousness as the major symptom raised the possibility of psychosis. as there was no morbid illogical reasoning for the belief / thought, delusion was ruled out. additionally, the repetitive nature of the thought, which was stereotyped, causing severe distress, pointed toward a possibility of obsessions. this was supplemented by the compulsive nature of reassurance seeking, which provided some temporary relief to the anxiety caused by the thought. however, the difficulty here was the lack of insight of the patient into this thought phenomenon. even though traditionally viewed as a condition with, egodystonic thoughts recognized as illogical by patients, ocd could present with lack of insight. furthermore, depressive ruminations were usually associated with negative emotions regarding some past event, while in this case the event appeared like an intrusive meaningless thought when it originated. insight in ocd had therapeutic implications such as poorer response to medications and prognostic implications, wherein, schizophrenic spectrum symptoms could lead to worse prognosis. the continuity model between obsessions, overvalued ideas, and delusions seems to be more satisfactory, although it calls for a careful analysis of the phenomenon in clinical settings, for prudent treatment choices.	obsessive compulsive disorder (ocd) is commonly regarded as a disorder with good insight. however, it has now been recognized that insight varies in these patients. pathological beliefs seem to lie on a continuum of insight, with full insight at one end and delusion at the other. this can indeed pose a considerable challenge, especially in a scenario where the phenomenon is difficult to discern. we report a case of ocd, which was initially diagnosed as psychosis.
it is estimated that approximately 400 million people are infected with hepatitis b virus (hbv) globally.1 chb can progress to cirrhosis, decompensated cirrhosis, hepatocellular carcinoma (hcc), and death.2 korea is an hbv endemic area;2 therefore, chb is a major public health problem in korea. several nucleos(t)ide analogues (nas) have been developed over the past decade, and administration of nas has played a crucial role in the treatment of chb. in addition to lamivudine, there are currently four oral nas available for chb treatment, including adefovir dipivoxil, entecavir, telbivudine, and tenofovir, which have shown greater antiviral activity compared with a placebo or lamivudine in patients with chb.3 - 9 telbivudine (-l-2'-deoxythymidine) is a new synthetic nucleoside analogue and is a bioavailable l - nucleoside with specific anti - hbv activity in vitro.10 since telbivudine came on the market in october 2006, a new option has been given to clinicians to treat chb patients, especially based on the results of the globe trial.11 the globe trial showed that telbivudine has more potent antiviral activity and less viral resistance compared with lamivudine.11 in the preclinical toxicological tests, telbivudine had no mutagenic or carcinogenic effects.12 a minority of telbivudine - treated patients experienced creatine kinase (ck) elevation, usually transient, and myopathy occurred rarely.10 however, in our recent clinical practice, we experienced myopathy with serum ck level elevation, which seemed to be associated with telbivudine in two patients who were siblings. myopathy is characterized by muscle pain, weakness and moderately elevated ck levels.13 we report here the two cases of telbivudine - induced myopathy in patients with chb to consider the adverse reaction mechanisms of telbivudine. a 28-year - old man who received telbivudine therapy for chronic hepatitis b presented with progressive weakness of both lower legs and difficulty in ascending stairs over the past 4 months. and also, he was unable to lift up a dumbbell and do pushups due to weakness in both arm. he was diagnosed with chb 3 years ago and started taking 600 mg of telbivudine once daily for 9 months to control hbv activation. since taking telbivudine, the serum viral dna level gradually decreased from 100,000 iu / ml to 222 iu / ml, and the serum alanine aminotransferase (alt) and aspartate aminotransferase (ast) levels were also normalized. although there was no symptoms such as dysphagia, cramps, or sensory abnormality, the patient suffered from progressive and generalized weakness, especially of his legs, and had difficulty climbing stairs. he exhibited motor weakness (grade 4) of the hip flexor, making it difficult for him to stand up from the sitting position, but there was no sign of abnormal deep tendon reflex, muscle atrophy, or hypertrophy on physical examination. he had not taken any other medications that would be regarded as a cause of his symptoms while taking telbivudine. iu / l, alt of 26 iu / l, total bilirubin of 0.9 mg / dl, blood urea nitrogen (bun) of 15.4 mg / dl, and serum creatinine of 0.7 mg / dl. his serum ck level was elevated up to 788 iu / l (44 - 245 electromyography (emg) was performed and showed a few positive sharp waves with polyphasic myopathic motor unit action potentials in the right vastus medialis, tibialis anterior, and biceps brachii muscles, which is consistent with the active stage of generalized myopathy (fig. 1). we planned to perform a muscle biopsy for confirmation, but he refused to have a muscle biopsy. the serum ck level was elevated up to 728 iu / l, 4 months prior to this visit. at that time, he felt general weakness, but he did not stop taking telbivudine. because most of telbivudine - related ck elevations were transient and increased ck levels decreased to normal range without any interruption. thus, he was diagnosed him with telbivudine - induced myopathy based on the clinical clues and emg findings and decided to change the anti - viral agent to 0.5 mg entecavir once daily. he revisited our clinic at one month after telbivudine withdrawal, and his clinical symptoms subsequently improved to the extent that he was able to climb stairs easily. the serum ck level was also decreased to 326 iu / l. a 25-year - old man who received telbivudine therapy for chronic hepatitis b presented with progressive generalized weakness and difficulty exercising. he was diagnosed with chb 4 years ago, and took lamivudine at first, but he changed to combination therapy of 600 mg of telbivudine once daily for 13 months and 10 mg of adefovir once to control hbv activation and lamivudine resistance. at 12 months after starting treatment, the hbv dna level decreased to the undetectable range, and the elevated serum ast and alt levels also decreased along with viral stabilization. however, the patient began to suffer from generalized weakness and difficult exercising since about 2 years after the treatment. he did not have dysphagia, cramps, or sensory symptoms and did not exhibit motor weakness. iu / l, total bilirubin of 0.4 mg / dl, bun of 13.4 mg / dl, and serum creatinine of 1.15 mg / dl, and serum ck was elevated up to 2,992 iu / l. in this case these two patients were siblings and they started taking telbivudine at the same time. also, his symptoms were similar to those of his brother. he visited the department of neurology and was diagnosed with toxic myopathy. for these reasons, we empirically diagnosed this patient with telbivudine - induced myopathy and decided to switch telbivudine to entecavir, so he received combination therapy with 0.5 mg of entecavir and 10 mg of adefovir. two months after telbivudine withdrawal, he revisited our clinic and his laboratory test showed decreased ck level to the normal range of 157 iu / l. a 28-year - old man who received telbivudine therapy for chronic hepatitis b presented with progressive weakness of both lower legs and difficulty in ascending stairs over the past 4 months. and also, he was unable to lift up a dumbbell and do pushups due to weakness in both arm. he was diagnosed with chb 3 years ago and started taking 600 mg of telbivudine once daily for 9 months to control hbv activation. since taking telbivudine, the serum viral dna level gradually decreased from 100,000 iu / ml to 222 iu / ml, and the serum alanine aminotransferase (alt) and aspartate aminotransferase (ast) levels were also normalized. although there was no symptoms such as dysphagia, cramps, or sensory abnormality, the patient suffered from progressive and generalized weakness, especially of his legs, and had difficulty climbing stairs. he exhibited motor weakness (grade 4) of the hip flexor, making it difficult for him to stand up from the sitting position, but there was no sign of abnormal deep tendon reflex, muscle atrophy, or hypertrophy on physical examination. he had not taken any other medications that would be regarded as a cause of his symptoms while taking telbivudine. iu / l, alt of 26 iu / l, total bilirubin of 0.9 mg / dl, blood urea nitrogen (bun) of 15.4 mg / dl, and serum creatinine of 0.7 mg / dl. his serum ck level was elevated up to 788 iu / l (44 - 245 electromyography (emg) was performed and showed a few positive sharp waves with polyphasic myopathic motor unit action potentials in the right vastus medialis, tibialis anterior, and biceps brachii muscles, which is consistent with the active stage of generalized myopathy (fig. 1). we planned to perform a muscle biopsy for confirmation, but he refused to have a muscle biopsy. the serum ck level was elevated up to 728 iu / l, 4 months prior to this visit. at that time, he felt general weakness, but he did not stop taking telbivudine. because most of telbivudine - related ck elevations were transient and increased ck levels decreased to normal range without any interruption. thus, he was diagnosed him with telbivudine - induced myopathy based on the clinical clues and emg findings and decided to change the anti - viral agent to 0.5 mg entecavir once daily. he revisited our clinic at one month after telbivudine withdrawal, and his clinical symptoms subsequently improved to the extent that he was able to climb stairs easily. a 25-year - old man who received telbivudine therapy for chronic hepatitis b presented with progressive generalized weakness and difficulty exercising. he was diagnosed with chb 4 years ago, and took lamivudine at first, but he changed to combination therapy of 600 mg of telbivudine once daily for 13 months and 10 mg of adefovir once to control hbv activation and lamivudine resistance. at 12 months after starting treatment, the hbv dna level decreased to the undetectable range, and the elevated serum ast and alt levels also decreased along with viral stabilization. however, the patient began to suffer from generalized weakness and difficult exercising since about 2 years after the treatment. he did not have dysphagia, cramps, or sensory symptoms and did not exhibit motor weakness. iu / l, total bilirubin of 0.4 mg / dl, bun of 13.4 mg / dl, and serum creatinine of 1.15 mg / dl, and serum ck was elevated up to 2,992 iu / l. in this case these two patients were siblings and they started taking telbivudine at the same time. also, his symptoms were similar to those of his brother. for these reasons, we empirically diagnosed this patient with telbivudine - induced myopathy and decided to switch telbivudine to entecavir, so he received combination therapy with 0.5 mg of entecavir and 10 mg of adefovir. two months after telbivudine withdrawal, he revisited our clinic and his laboratory test showed decreased ck level to the normal range of 157 iu / l. telbivudine, a new synthetic analogue of thymidine, is phoshporylated by host cellular kinases to telbivudine-5'-triphosphate, which has a half - life of 14 hours in vivo.10 telbivudine-5'-triphosphate is then incorporated into hbv dna by hbv polymerase, competing with thymidine-5'-triphosphate, the natural substrate.10 once inserted, telbivudine-5'-triphosphate causes dna chain termination, thereby inhibiting hbv replication.14,15 since telbivudine was approved for the treatment of chb, there have been a few studies11,12,14,16,17 reporting telbivudine - related adverse reactions. in the globe trial, grade 3 or 4 elevation in ck levels was observed in 88 (12.9%) of 680 patients on the telbivudine arm.10,18 myopathy, characterized by muscle pain, weakness, and elevated ck levels, was reported in two patients, which resolved after telbivudine was discontinued.12,17 preliminary data in the globe trial11 found that 9 (1.4%) patients had new onset of grade 3 or 4 ck elevations and 9 (1.4%) had myalgia or myositis between 104 and 156 weeks.11,15,19 the safety profile of telbivudine over three years was similar to that reported at two years in the globe trial ; most adverse effects were mild and transient in nature and no new safety signals were observed.20 the most common treatment - related adverse effects were elevated ck levels (7.5%), headache (3.6%), fatigue (2.9%), nausea (2.9%), diarrhea (2.2%), and nasopharyngitis (1.9%).20 myalgia, myositis and muscular weakness were reported in 22 (5.3%), 2 (0.5%) and 2 (0.5%) patients, respectively.20 xue - song zhang. myalgia accompanied by general weakness, was the most common adverse reaction and the limb skeletal muscles were affected most frequently.17,19 there were four cases with peripheral nervous system involvement, represented by numbness and neuralgia, and one case with cardiac arrhythmia.12,18 while the adverse reactions of the cardiac and nervous systems persisted for a long time after discontinuation of telbivudine, myalgia resolved in a short period of time.12 although several authors have reported regarding telbivudine - related adverse reactions from western and eastern countries,10 - 12,16 there have been no reports in korea, especially regarding telbivudine - related adverse reactions, such as ck elevation or myopathy. to the best of our knowledge, this is the first report in korea regarding telbivudine - related myopathy. in these cases, the two sibling patients had started treatment for chb around the same time and had been taking telbivudine for 9 months and 13 months, respectively. this is the reason that there may be a genetic problem to telbivudine - induced myopathy. when they had myalgia symptoms, both of their ck levels were elevated to 788 iu / l and 2,992 iu / l. according to the data from our institute, 20 (7.7%) of 259 patients who have been prescribed with however, in most of them, serum ck elevation did not accompany with symptoms such as muscle weakness and myopathy. although we were not able to make clear the process of telbivudine - induced myopathy because the patients did not want to have a muscle biopsy and dna study, their elevated ck levels decreased only after telbivudine withdrawal. therefore, we were able to conclude that myopathy in these two patients might be related to telbivudine. in korea, ck elevation and myopathy were reported in many cases of long - term clevudine use.21 - 25 some investigators have reported that these adverse reactions are related to mitochondrial toxicity because most nas including telbivudine as well as clevudine commonly induce mitochondrial damage by inhibiting mitochondrial dna polymerase.18,26 another study has suggested that the mechanism is associated with cell energy metabolism.14,18,19 mitochondria are involved in the production of energy.18 they contain many important proteins, enzymes, and carriers that participate in energy transduction. deficiency in any of these leads to a poor substrate supply for oxidative phosphorylation and eventually to inadequate manufacture of the energy molecule atp, which in turn causes mitochondrial disease.18 as a competitive substrate of natural thymidine, telbivudine is phosphorylated by host mitochondrial thymidine kinases to telbivudine-5'-triphosphate and thymidine kinases are extensively exhausted.18 as a result, the normal energy transduction process is disturbed. moreover, in the process of phosphorylation, high levels of phosphates are captured, which leads directly to exhaustion of atp, resulting in poor energy supply.18 nevertheless, at present, the biological mechanism of telbivudine - related ck elevations and myopathy is not yet clear. in this report, it was highly suspected that there might be a genetic problem related to this cell energy metabolism because the two patients were sibilings. further investigation for the genetic polymorphism associated with drug clearance in these two patients would be helpful to figure out the pharmaco - dynamic relevance. in conclusion, here we report two uncommon cases of telbivudine - induced serum ck elevation accompanied with myopathy in chb patients. even though there have been no cases of telbivudine - induced myopathy in korea, physicians should take into consideration the possibility of the relationship with telbivudine as in the cases of clevudine if they were met with such an adverse reaction in their clinical practice. in addition, further closer monitoring is recommended for the evaluation of ck elevation or myopathy in patients who were treated with telbivudine.	telbivudine is an l - nucleoside analogue with potent antiviral activity against hepatitis b virus (hbv). clinical trials have shown that telbivudine has a more potent and sustained antiviral activity with a lower frequency of viral resistance than lamivudine. although there are several reports concerning the safety profile of telbivudine, most adverse events are described as mild and transient in nature. here we report two cases of telbivudine - induced myopathy in patients with chronic hepatitis b who were siblings.
studies in developed countries reveal that poor lifestyle choices triggering noncommunicable diseases typically co - occur or cluster among children and adolescents.. however, there is insufficient evidence on the clustering of risk behaviors among children in developing countries. meanwhile, developing countries contend with the burden of infectious and chronic diseases less so than risk behaviors for infectious diseases (rbid) among children and adolescents. social variables, such as family socioeconomic status (ses) and family structure, are known to contribute toward risk behaviors ; therefore, they contribute to risk behavior clustering. a low ses, which incorporates a low income and mothers educational levels, is associated with the clustering of risk behaviors. therefore, interventions for risk behaviors must focus on disadvantaged children. rapid development in china is continuing to increase the number of rural - urban migrants. china 's rural - urban migrant population (henceforth, migrant population) is defined as individuals leaving their rural residences for urban cities for a certain period (more than 6 months) without changing household registration. in 2012, the migrant population was approximately 236 million. according to 2010 data, 20.8% of the migrant population were children under 14 years old with living conditions characterized by instability, overcrowded housing, poor sanitation, children attending disadvantaged schools, and social and cultural isolation.. however, the clustering of risk behaviors and their determinants among children in china is under - researched. this study examined the clustering of risk behaviors for infectious and chronic diseases, and the accompanying influence of social determinants among learners in the high grades in primary schools enrolling migrants and residents in beijing. first, we stratified schools into urban districts, inner suburbs, and outer suburbs. beijing comprises 16 districts, including 6 urban districts, 6 inner suburbs, and 4 outer suburbs. second, we randomly selected two medium - scale (8001200) primary schools from each district, which enrolled migrant and resident learners. we selected two grade 4 and 5 classes from each school randomly, with all learners in those classes invited to participate. among the 1021 learners recruited, 41 declined to participate, and the data were collected from february to may 2011 by trained fieldworkers. in this study, migrants were those whose household registration records (hukou) were not in beijing. given their different hukou statuses, learners were divided into two groups : migrants and residents. this study was approved by the institutional review board at peking university (irb00001052 - 11025). the questionnaires were self - completed, and the research assistants were available to clarify arising questions. self - reported risk rbid included six items, namely : do you wash hands before eating ? do you wash hands after defecation ? do you wash fruit before eating ? do you spit in public ? do you drink tap water that is not boiled ? and do you share towels with others ? sometimes or never were risk behaviors for the first three questions, whereas always was a risk behavior for the latter three. related risk behavior interventions for infectious diseases are recommended in health education courses in chinese primary schools, particularly public schools. risk behaviors for chronic diseases (rbcd) and growth included : smoking ; passive smoking (ps) (4 days / week) ; breakfast (3 days / week) ; and consumption of vegetables (3 days / week), fruits (3 days / week), and milk (3 days / week). we defined smoking as having ever smoked or tried and ps as exposure to other people 's tobacco smoke for more than 15 min / day. the frequency method was used to measure risk behaviors, and arbitrary cut - offs were adopted to identify whether behaviors posed health risks. clustering of risk behaviors was demonstrated by number of risk behaviors and clustering patterns of individual risk behaviors as previous studies. descriptive analysis summarized the outcome of demographic characteristics and prevalence of risk behaviors with the percentage for categorical variables and mean for continuous variables. chi - square tests were used to compare prevalence and clustering for the number of risk behaviors among the different groups, with a significance threshold of 0.05. the main effects model would be a priority, assuming that the risk behaviors were mutually independent of one another. if it did not adequately fit, interactions between variables would be considered to establish an appropriate model. the test of parallel lines was used to judge whether the data fit the ordinal logistic regression model (p > 0.05). goodness of fit was tested using 2 log likelihood (2 ll) (p 0.05). first, we stratified schools into urban districts, inner suburbs, and outer suburbs. beijing comprises 16 districts, including 6 urban districts, 6 inner suburbs, and 4 outer suburbs. second, we randomly selected two medium - scale (8001200) primary schools from each district, which enrolled migrant and resident learners. we selected two grade 4 and 5 classes from each school randomly, with all learners in those classes invited to participate. among the 1021 learners recruited, 41 declined to participate, and the data were collected from february to may 2011 by trained fieldworkers. in this study, migrants were those whose household registration records (hukou) were not in beijing. given their different hukou statuses, learners were divided into two groups : migrants and residents. this study was approved by the institutional review board at peking university (irb00001052 - 11025). the questionnaires were self - completed, and the research assistants were available to clarify arising questions. self - reported risk rbid included six items, namely : do you wash hands before eating ? do you wash hands after defecation ? do you wash fruit before eating ? do you spit in public ? do you drink tap water that is not boiled ? and do you share towels with others ? response choices were always, sometimes, and never. sometimes or never were risk behaviors for the first three questions, whereas always was a risk behavior for the latter three. related risk behavior interventions for infectious diseases are recommended in health education courses in chinese primary schools, particularly public schools. risk behaviors for chronic diseases (rbcd) and growth included : smoking ; passive smoking (ps) (4 days / week) ; breakfast (3 days / week) ; and consumption of vegetables (3 days / week), fruits (3 days / week), and milk (3 days / week). we defined smoking as having ever smoked or tried and ps as exposure to other people 's tobacco smoke for more than 15 min / day. the frequency method was used to measure risk behaviors, and arbitrary cut - offs were adopted to identify whether behaviors posed health risks. clustering of risk behaviors was demonstrated by number of risk behaviors and clustering patterns of individual risk behaviors as previous studies. descriptive analysis summarized the outcome of demographic characteristics and prevalence of risk behaviors with the percentage for categorical variables and mean for continuous variables. chi - square tests were used to compare prevalence and clustering for the number of risk behaviors among the different groups, with a significance threshold of 0.05. the main effects model would be a priority, assuming that the risk behaviors were mutually independent of one another. if it did not adequately fit, interactions between variables would be considered to establish an appropriate model. the test of parallel lines was used to judge whether the data fit the ordinal logistic regression model (p > 0.05). goodness of fit was tested using 2 log likelihood (2 ll) (p 0.05). as can be seen in table 1, boys outnumbered girls in all the districts. two - thirds of the learners (age range : 914 years ; mean = 11.25 years) were in public schools ; 70.2% of the subjects were migrants. the education level of guardians in the outer suburbs was the lowest ; only 13.5% had attended high school. the percentage of ownership of 0.05 in the test of parallel lines ; the goodness of fit was also fine with p 0.05 in pearson 's chi - square test [tables 4 and 5 ]. results of r showed the explanatory power was lowest in model 1 and highest in model 4. r in model 2 was greater than it was in model 3, whether in rbid or rbcd, and disclosed the important role of the school. once all variables were included in model 4, more rbid was exhibited by boys, migrants, those living in the outer suburbs, private school learners, learners with less educated guardians, and those from families with fewer household appliances. the three most influential factors were school type (or = 4.47, 95% ci 3.006.66), school located in an inner suburb (or = 0.27, 95% ci 0.180.38), and gender (or = 0.56, 95% ci 0.420.74). regarding rbcd, behavioral clustering was not associated with household registration status and number of appliances, but was significantly associated with school type (or = 5.36, 95% ci 3.727.73), school located in an inner suburb (or = 0.59, 95% ci 0.430.81), and gender (or = 0.61, 95% ci 0.470.78). ordinal logistic regression by number of rbid (reference : no risk behaviors) or : odds ratio ; ci : confidence interval ; rbid : risk behaviors for infectious diseases. ordinal logistic regression by number of rbcd and growth (reference : no risk behaviors) or : odds ratio ; ci : confidence interval ; rbcd : risk behaviors for chronic diseases ; 2 ll : 2 log likelihood. as can be seen in table 1, boys outnumbered girls in all the districts. two - thirds of the learners (age range : 914 years ; mean = 11.25 years) were in public schools ; 70.2% of the subjects were migrants. the education level of guardians in the outer suburbs was the lowest ; only 13.5% had attended high school. the percentage of ownership of 0.05 in the test of parallel lines ; the goodness of fit was also fine with p 0.05 in pearson 's chi - square test [tables 4 and 5 ]. results of r showed the explanatory power was lowest in model 1 and highest in model 4. r in model 2 was greater than it was in model 3, whether in rbid or rbcd, and disclosed the important role of the school. once all variables were included in model 4, more rbid was exhibited by boys, migrants, those living in the outer suburbs, private school learners, learners with less educated guardians, and those from families with fewer household appliances. the three most influential factors were school type (or = 4.47, 95% ci 3.006.66), school located in an inner suburb (or = 0.27, 95% ci 0.180.38), and gender (or = 0.56, 95% ci 0.420.74). regarding rbcd, behavioral clustering was not associated with household registration status and number of appliances, but was significantly associated with school type (or = 5.36, 95% ci 3.727.73), school located in an inner suburb (or = 0.59, 95% ci 0.430.81), and gender (or = 0.61, 95% ci 0.470.78). ordinal logistic regression by number of rbid (reference : no risk behaviors) or : odds ratio ; ci : confidence interval ; rbid : risk behaviors for infectious diseases. ordinal logistic regression by number of rbcd and growth (reference : no risk behaviors) or : odds ratio ; ci : confidence interval ; rbcd : risk behaviors for chronic diseases ; 2 ll : 2 log likelihood. this study assessed the clustering of multiple risk behaviors for infectious and chronic diseases and their social determinants among learners in schools enrolling migrants and residents in beijing, china. the prevalence of none, one, two, and three or more risk factors was 61.2%, 20.0%, 10.8%, and 8.1%, respectively, for infectious diseases, and 46.0%, 30.6%, 15.4%, and 8.0%, respectively, for chronic diseases. regarding some rbid, the participants engaged in more healthy behaviors than those in a nationwide, representative chinese survey conducted in 2005, wherein elementary school learners washed their hands 72.5% (before eating) and 75.4% (after defecation) of the time. the survey showed that, regarding some rbcd, daily breakfast and vegetable consumption was at 84.0% and 67.0%, respectively, among the learners ; this was 79.4% and 81.2% in our study. as most beijing schools provide lunch in recent years, vegetable intake was boosted in students. children who begin smoking earlier are more likely to develop severe nicotine addiction. in a longitudinal canadian study, the prevalence among 1011-year - old children of having ever smoked was 6% from 2000 to 2001, compared to 7.9% in our study. data from the united kingdom showed that 1216-year - old children 's breakfast intake 5 days a week was at 76.7%. however, these studies are not comparable with the current one because of differences in the survey periods, regions, and population. although few studies have focused on behaviors for infectious diseases, there are a number of studies that have examined the clustering of rbcd. our results from the log - linear models showed clear evidence that risk behaviors for infectious and chronic diseases were not independent, but were instead clustered together, such as washing hands before eating and after defecation, sip and dutw, fruit consumption and milk intake, and breakfast and vegetable consumption. although the analytic techniques used to define clustering differed across studies, it was clear that some risk behaviors clustered. multiple behavior interventions (i.e., targeting more than one health behavior simultaneously) would have the potential for a much greater public health impact compared to single behavior interventions. the limited clustering of smoking with the other factors was very different from the other studies. a possible reason for this was that the risk behaviors we investigated were more about diet and nutrition, and less about physical activity and alcohol consumption, which were observed clustering with smoking by other researchers. in addition, the population we studied was primary school students, among whom the smoking rate is comparatively low. however, our results also showed that interventions for smoking and fruit consumption together would be good for primary school students. the literature shows that many factors including gender, ethnicity, grade level, family, schooling, and community contexts influence risk behaviors. in our study, we considered demographic characteristics (i.e., gender and age), school environment (i.e., school type : private or public ; location : urban district or suburb), and family context as determinants of the clustering of risk behaviors. the family context in our study referred to ses, including place of household registration (beijing or other), number of household appliances, and guardians education levels. here, household appliances (i.e., television, washing machine, air conditioner, refrigerator, and personal computer) were considered a measure of wealth because collecting data on income and savings is a sensitive issue in china and learners may not give accurate income - related information. as expected, demographic characteristics, school environment, and family context variables contributed toward the number of risk behaviors, with the school environment variables being the most significant contributor. as learners spend most of their time in school, school conditions, interventions, and teachers and peers support reportedly facilitate the formation of healthy behaviors. in china, urban schools physical conditions and health education capacity are slightly better than those of suburban schools. however, while the conditions in urban schools are generally better, the gaps between urban and suburban schools are not qualitative but quantitative, and more differences exist between public and private schools enrolling migrant children. in public schools, health education courses are regularly offered by qualified teachers, and basic hygiene amenities (sufficient taps, washrooms, and classroom lights), desks and chairs adjusted according to child height, and a balanced diet can be provided. in most public schools, learners annually undergo professional health checks, participate in vaccination programs, and receive counseling ; none of these is provided in most private schools recruiting migrant learners. similarly, in our study, schools characteristics mattered more than the family context as r showed. the family context, reflected by the ses, including household income, parents educational level, and occupation, was another important determinant of risk behaviors. in our study, number of appliances and guardians educational levels (constituting the family context) significantly influenced the number of rbid, possibly because of misinformation regarding these and related prevention measures among learners of a lower ses. regarding rbcd, the guardians education level significantly influenced behavioral clustering but proved less significant than the school environment. according to many studies, teenagers from low ses backgrounds are likely to report inadequate fruit and vegetable consumption. however, comparisons are limited because differences in estimates may be confounded by differences in the risk factors investigated, data - gathering instruments, and analysis. the schools characteristics in our study could be particularly influential because urban public primary schools in beijing provide nutritional lunch comprising fruit, vegetables, and milk to learners. however, demographic and social determinants can directly influence the number of unhealthy behaviors. since clustered risk behaviors may be particularly harmful to children 's health, public health interventions should target three or more risk behaviors according to socioeconomic conditions. it was comprised of a cross - sectional survey, making it impossible to make causal inferences about risk behaviors. moreover, the survey comprised self - reported data by the learners, increasing the possibility of misreporting. further, we did not measure daily vegetable and fruit servings, but assessed the weekly frequency, with arbitrary cut - offs. however, we did maximize the likelihood of honest reporting by ensuring the learners anonymity. thus, despite the limitations, this study is one of the few to focus on social determinants of multiple health behaviors among learners in developing countries, particularly migrant learners.. therefore, improved school conditions and integrated behavioral interventions are particularly important for health promotion.	background : studies in developed countries reveal that poor lifestyle choices triggering diseases typically cluster among children. however, there is insufficient evidence on the clustering of risk behaviors among children in developing countries. this study aimed to determine the clustering of risk behaviors and their social determinants among 4th - and 5th -grade learners in beijing, china.methods:the sample comprised of 967 learners from six primary schools enrolled migrant and resident learners by two - stage stratified cluster sampling. prevalence denoted the risk behaviors and their clustering. a log - linear model was used to explore the clustering patterns. ordinal logistic regression determined the influence of demographic characteristics, school environment, and family context on behavioral clustering.results:the prevalence of none, one, two, and three or more risk factors was 61.2%, 20.0%, 10.8%, and 8.1% for infectious diseases and 46.0%, 30.6%, 15.4%, and 8.0% for chronic diseases, respectively. some behaviors appeared dependent and were more likely to be observed together. the three most influential factors for infectious diseases were school type (odds ratio [or ] = 4.47, 95% confidence interval [ci ] 3.006.66), school located in an inner suburb (or = 0.27, 95% ci 0.180.38), and gender (or = 0.56, 95% ci 0.420.74). regarding risk behaviors for chronic diseases, clustering was not associated with household registration status and number of appliances, but was significantly associated with school type (or = 5.36, 95% ci 3.727.73), school located in an inner suburb (or = 0.59, 95% ci 0.430.81), and gender (or = 0.61, 95% ci 0.470.78). school environment variables were the most significant contributor to the number of risk behaviors.conclusions:the characteristics of schools enrolling migrants and residents influenced the number of risk behaviors. therefore, improved school conditions and integrated behavioral interventions are particularly recommended for health promotion.
the inclusion and exclusion criteria were established based on the standards of diagnostic research published by the cochrane methods group for screening and diagnostic testing (http://www.cochrane.org/docs/sadtdocl.htm). this systematic review includes only prospective observational studies in which the results of the diagnostic test of interest were compared with that of a reference standard - histological biopsy, radical prostatectomy, or surgery. the objective of this study is to evaluate the value of mrs in diagnosing prostate cancer. all scans were read by radiology medicine doctors which were " blinded " to the patients ' history, clinical presentation, and physical examination. the studies which were " blindly read " were not mentioned to be in the exclusion criteria. moreover, the subjects had not previously undergone hormone or radiotherapy before they underwent an mri and mrs. the relevant publications were identified in the database by querying the medline (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi ?), elsevier, springer, ovid, cnki (china national knowledge infrastructure), and embase databases by computer from 1994 to 2006. next, a manual research of the reference lists cited in the original articles of the relevant journals had also been done. all medical subject headings with diagnosis were combined with words : (carcinoma of prostate or prostate cancer or prostate carcinoma or prostate tumor) and diagnosis and (mrs or mr spectroscopic imaging or magnetic resonance spectroscopic imaging or mr spectroscopy or magnetic resonance spectroscopy) and sensitivity and specificity. the publication languages were restricted to english and chinese and the research subjects were human. all articles were checked by two independent reviewers and any disagreement was resolved employing the arbitration of a third reviewer. according to a hierarchy of evidence in the diagnostic test studies from the cochrane methods group (7, 8), only studies in grade a (an independent, blind comparison with reference standard among an appropriate population of consecutive patients) and grade b (an independent, blind comparison with reference standard among an appropriate population of non - consecutive patients or confined to a narrow population of study patients) were included in this review. the common information including the articles ' grade, author, published time, number of subjects, mean age, lesions, and level of psa. were extracted. other data such as true positive value (tp), true negative value (tn), false positive value (fp), false negative value (fn), sensitivity (sen), specificity (spe), accuracy (acc), positive likelihood ratio, negative likelihood ratio were also extracted. the meta - test software (version 0.9 joseph lau, md - new england medical center, boston, ma) was used for the data analysis and synthesis. group differences between two diagnosis criteria were considered significant at a p value of < 0.05 by fisher 's exact test. i) homogeneity test : diagnostic meta - analysis achieved by pooling the results of individual studies. the results produce a common effect size. as a result, before the data were pooled and calculated, a test of the homogeneity of results between the different studies was necessary using the q statistic of the chi - square value test. 2) statistical model : the statistical model used in the meta - analysis included a fixed effects model which was chosen following the determination of the absence of heterogeneity. alternatively, if the heterogeneity test failed, a random effects model was selected to analyze the data (9). 3) meta - analysis : the appropriate statistical model was selected to calculate pooled weighted values of sensitivity and specificity with the corresponding 95% ci (95% confidence interval). according to moses. (10), we established a linear regression equation between d and s as follows : d = logit (tpr) - logit (fpr) ; s = logit (tpr) + logit (fpr) (tpr - true positive rate, fpr - false positive rate). the model is d = a + bs (a is the regression intercept and b is the regression coefficient)., the model can be transformed back to the conventional axes of tpr against fpr, which facilitates the determination of a sroc curve to calculate the area under the sroc. if the curve is closer to top - left corner, the area under curve (auc) is larger, which means that the diagnosis is more accurate. the inclusion and exclusion criteria were established based on the standards of diagnostic research published by the cochrane methods group for screening and diagnostic testing (http://www.cochrane.org/docs/sadtdocl.htm). this systematic review includes only prospective observational studies in which the results of the diagnostic test of interest were compared with that of a reference standard - histological biopsy, radical prostatectomy, or surgery. the objective of this study is to evaluate the value of mrs in diagnosing prostate cancer. all scans were read by radiology medicine doctors which were " blinded " to the patients ' history, clinical presentation, and physical examination. the studies which were " blindly read " were not mentioned to be in the exclusion criteria. moreover, the subjects had not previously undergone hormone or radiotherapy before they underwent an mri and mrs. the relevant publications were identified in the database by querying the medline (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi ?), elsevier, springer, ovid, cnki (china national knowledge infrastructure), and embase databases by computer from 1994 to 2006. next, a manual research of the reference lists cited in the original articles of the relevant journals had also been done. all medical subject headings with diagnosis were combined with words : (carcinoma of prostate or prostate cancer or prostate carcinoma or prostate tumor) and diagnosis and (mrs or mr spectroscopic imaging or magnetic resonance spectroscopic imaging or mr spectroscopy or magnetic resonance spectroscopy) and sensitivity and specificity. the publication languages were restricted to english and chinese and the research subjects were human. all articles were checked by two independent reviewers and any disagreement was resolved employing the arbitration of a third reviewer. according to a hierarchy of evidence in the diagnostic test studies from the cochrane methods group (7, 8), only studies in grade a (an independent, blind comparison with reference standard among an appropriate population of consecutive patients) and grade b (an independent, blind comparison with reference standard among an appropriate population of non - consecutive patients or confined to a narrow population of study patients) were included in this review. the common information including the articles ' grade, author, published time, number of subjects, mean age, lesions, and level of psa. were extracted. other data such as true positive value (tp), true negative value (tn), false positive value (fp), false negative value (fn), sensitivity (sen), specificity (spe), accuracy (acc), positive likelihood ratio, negative likelihood ratio were also extracted. the meta - test software (version 0.9 joseph lau, md - new england medical center, boston, ma) was used for the data analysis and synthesis. group differences between two diagnosis criteria were considered significant at a p value of < 0.05 by fisher 's exact test. i) homogeneity test : diagnostic meta - analysis achieved by pooling the results of individual studies. the results produce a common effect size. as a result, before the data were pooled and calculated, a test of the homogeneity of results between the different studies was necessary using the q statistic of the chi - square value test. 2) statistical model : the statistical model used in the meta - analysis included a fixed effects model which was chosen following the determination of the absence of heterogeneity. alternatively, if the heterogeneity test failed, a random effects model was selected to analyze the data (9). 3) meta - analysis : the appropriate statistical model was selected to calculate pooled weighted values of sensitivity and specificity with the corresponding 95% ci (95% confidence interval). according to moses. (10), we established a linear regression equation between d and s as follows : d = logit (tpr) - logit (fpr) ; s = logit (tpr) + logit (fpr) (tpr - true positive rate, fpr - false positive rate). the model is d = a + bs (a is the regression intercept and b is the regression coefficient)., the model can be transformed back to the conventional axes of tpr against fpr, which facilitates the determination of a sroc curve to calculate the area under the sroc. if the curve is closer to top - left corner, the area under curve (auc) is larger, which means that the diagnosis is more accurate. according to criteria set in the index words, a total of 140 papers were screened from the above - mentioned databases. however, only 7 studies remained after taking into account the inclusion and exclusion criteria. among these articles, two were of grade a, whereas the other five were of grade b (table 1). in clinical practice, the classification system described by kurhanewicz. (6) was often used : normal - a voxel of signal intensity ratios of (choline + creatine) / citrate lower than 0.75 ; suspicious - between 0.75 and 0.86 ; definitive tumor - above this threshold. to calculate the sensitivity and specificity, descriptive statistical data (tp, tn, fp, and fn) were determined by using two dichotomized rating systems : one with a voxel ratio of less than 0.75 which was not determined to be cancer, as opposed to a voxel ratio greater than 0.75 which represented a finding of cancer. while another cut - off value was 0.86. five studies used a diagnostic value of 0.75 as a cut - off criteria (table 2), as opposed to five studies, which used a diagnostic cut - off value of 0.86 (table 3). the homogeneity test showed : q1 = 37.20, p1 < 0.01, q2 = 23.17, p2 < 0.01. therefore, in these two groups, the random effects models was used for the meta - analysis. forest plots for two groups were constructed and the pooled weighted sensitivity, specificity, and corresponding 95% ci were calculated (fig. 1, table 4). because sroc can inflect a non - linear relationship between the sensitivity and specificity simultaneously, it was better used (18) to assess the accuracy of the diagnostic tests. here we drew and analyzed sroc and calculated auc for these two groups (figs. 2, 3). the pooled weighted sensitivity of the first criterion was higher 0.82 (0.73, 0.89) than the second 0.64 (0.55, 0.72), in which the p - value was < 0.0001, chi - square value = 57.13 however, its specificity is lower [0.68 (0.58, 0.76) vs. 0.86 (0.79, 0.91) ] than, a p - value < 0.0001, chi - square value = 118.30. however, the difference between the two aucs was not significant, 83.40 versus 82.70 (if the difference between two aucs was greater than 5%, the diagnostic performance between two objects had statistics significance, which suggested that the accuracy would be same) (table 4). according to criteria set in the index words, a total of 140 papers were screened from the above - mentioned databases. however, only 7 studies remained after taking into account the inclusion and exclusion criteria. among these articles, two were of grade a, whereas the other five were of grade b (table 1). in clinical practice, the classification system described by kurhanewicz. (6) was often used : normal - a voxel of signal intensity ratios of (choline + creatine) / citrate lower than 0.75 ; suspicious - between 0.75 and 0.86 ; definitive tumor - above this threshold. to calculate the sensitivity and specificity, descriptive statistical data (tp, tn, fp, and fn) were determined by using two dichotomized rating systems : one with a voxel ratio of less than 0.75 which was not determined to be cancer, as opposed to a voxel ratio greater than 0.75 which represented a finding of cancer. while another cut - off value was 0.86. five studies used a diagnostic value of 0.75 as a cut - off criteria (table 2), as opposed to five studies, which used a diagnostic cut - off value of 0.86 (table 3). the homogeneity test showed : q1 = 37.20, p1 < 0.01, q2 = 23.17, p2 < 0.01. therefore, in these two groups, the random effects models was used for the meta - analysis. forest plots for two groups were constructed and the pooled weighted sensitivity, specificity, and corresponding 95% ci were calculated (fig. 1, table 4). because sroc can inflect a non - linear relationship between the sensitivity and specificity simultaneously, it was better used (18) to assess the accuracy of the diagnostic tests. here we drew and analyzed sroc and calculated auc for these two groups (figs. 2, 3). the pooled weighted sensitivity of the first criterion was higher 0.82 (0.73, 0.89) than the second 0.64 (0.55, 0.72), in which the p - value was < 0.0001, chi - square value = 57.13 however, its specificity is lower [0.68 (0.58, 0.76) vs. 0.86 (0.79, 0.91) ] than, a p - value < 0.0001, chi - square value = 118.30. however, the difference between the two aucs was not significant, 83.40 versus 82.70 (if the difference between two aucs was greater than 5%, the diagnostic performance between two objects had statistics significance, which suggested that the accuracy would be same) (table 4). further, cancers detected by dre are in an advanced stage in up to 50% of cases. using a psa cut - off value of 4 ng / ml as an indication of carcinoma of the prostate, up to 25% of men with cancer in addition, the positive predictive value of the test is only 30% in asymptomatic men (4). an mri performed using an endorectal coil is unsuitable as a primary diagnostic tool for detecting prostate cancer due to its low specificity and low positive predictive value (19) ; although, the accuracy of mri staging for stages b and c is 77% and there is a high sensitivity of detection for extraprostatic tumor extension and seminal vesicle infiltration (20, 21). to date, the histopathologic examinations of biopsy tissue remain the gold standard for diagnosis of prostate cancer. however, this method only results in a sensitivity of 50% and specificity of 82%. in these cases, malignancies are easily overlooked because of their multi - focal and heterogeneous nature, which happens in as many as 85% of patients (22, 23). it has been reported that after a radical prostatectomy, the biopsy - determined result increased in as many as 54% of patients (24). therefore, an accurate and noninvasive way of determining prostate cancer is needed to improve the ability to define subsets of patients in which a cure is possible and necessary. the mrs can detect a resonance spectrum from different chemical compounds in tissues, which in turn, reveals structural information about the chemical compound as well as the metabolic information of the tissues. in normal prostate tissue, however, in the case of prostate cancer, citrate levels diminish or are undetectable because of a conversion from citrate - producing to citrate - oxidating metabolism. moreover, the choline level is elevated due to a high phospholipids cell membrane turnover rate in the proliferating malignant tissue. hence, the method for depicting tumors is based on an increased (choline + creatine) / citrate ratio (22). a meta - analysis is a statistical analysis that combines or integrates the results of several independent studies considered to be combinable. the reliability of the results depends on the quality of the included studies and whether the result of the analysis is reliable. according to cochrane 's methods of screening and diagnosis (table 5), the suggested quality in the five levels of diagnostic procedures were (grade a and grade b) for analysis by two reviewers ' independent evaluation, which may lead to a selection bias with more information. all the studies we used for this study are prospective observational (independent), blind comparisons with a reference standard, in which radiologists scan and diagnose the patients after the scientific experiment design. according to our selection criteria this meta - analysis included only 7 studies out of the many reviewed articles. one reason for this low number is that mrs has been used in diagnosing prostate cancer for only a few years and related studies are scarce. another factor is that the quality of these studies on the basis of inclusion in meta - analyses are not high. case in point, only two studies qualified as grade a, whereas the other five studies included subjects that all had prostate cancer, which represented a selection bias of the subjects, though the mrs tests the peak of choline, citrate, and creatine in the different voxels of whole prostates. moreover, the two radiologists are unaware of which patient has prostate cancer. according to table 1, our intentions were to analyze the homogeneity of the basic information of all studies including psas, gleason grades which may affect the assessment of the results (6). however, it is impossible to achieve this because data is not integral. in some studies detected voxels, a biopsy is inaccurate because prostate cancer is multi - focal and heterogeneous in nature, and it is limited in examining all cancers, sites, and grades (24). hence, their (15, 16) positive results are much smaller than the negative results and the sensitivity is not so reliable. according to kristen. (25) who measured the mr spectroscopic imaging, and the ratio of prostate tumor for (cho + cr) / cit ratio. his data indicated that in the diagnosis, cancer with a gleason score of 3 + 3, the mr spectroscopic imaging tumor detection sensitivity was 44.4%, and the sensitivity increased to 89.5% in cancers with a gleason score of more than 8. thus, a large proportion of tumors with a gleason score of 6 and under 6 did not generate abnormal voxel metabolite ratios. one possible explanation for this finding is that these tumors tended to be smaller, thereby permitting a volume averaging with noncancerous tissue. another is that low - grade tumors (below 6) may be missed, due to slight alterations in citrate and choline levels. in all studies except that of prando 17) we have not talked about tumor or volume, so we did n't further analyze it. the advantage of sroc curves is that the curves may be tested for symmetry and therefore can be determined if a subgroup analysis is appropriate. a disadvantage of sroc curves is that if a large variability is present between subgroups, the goodness of fit using sroc curves will be limited (26). in this meta - analysis, we have only compared the value of two criteria. the two aucs are similar ; however, their sensitivity and specificity possess noticeable differences. hence, the combination of the two criteria may improve the accuracy in clinical use. in china, however, their study results were compared to biopsy and non - pathologic results, which yielded a different set of outcomes. at the present time, we still need large samples and multi - center studies to increase the confidence in the results. in conclusion, we could not analyze the literature with a more reasonable option than we have now, due to poor reporting in the primary studies and small quantity of studies. here, we supply just the primary assessment of the value for mrs in clinic.	objectivewe aimed to do a meta - analysis of the existing literature to assess the accuracy of prostate cancer studies which use magnetic resonance spectroscopy (mrs) as a diagnostic tool.materials and methodsprospectively, independent, blind studies were selected from the cochrane library, pubmed, and other network databases. the criteria for inclusion and exclusion in this study referenced the criteria of diagnostic research published by the cochrane center. the statistical analysis was adopted by using meta - test version 6.0. using the homogeneity test, a statistical effect model was chosen to calculate different pooled weighted values of sensitivity, specificity, and the corresponding 95% confidence intervals (95% ci). the summary receiver operating characteristic (sroc) curves method was used to assess the results.resultswe chose two cut - off values (0.75 and 0.86) as the diagnostic criteria for discriminating between benign and malignant. in the first diagnostic criterion, the pooled weighted sensitivity, specificity, and corresponding 95% ci (expressed as area under curve [auc ]) were 0.82 (0.73, 0.89), 0.68 (0.58, 0.76), and 83.4% (74.97, 91.83). in the second criterion, the pooled weighted sensitivity, specificity, and corresponding 95% ci were 0.64 (0.55, 0.72), 0.86 (0.79, 0.91) and 82.7% (68.73, 96.68).conclusionas a new method in the diagnostic of prostate cancer, mrs has a better applied value compared to other common modalities. ultimately, large scale rct randomized controlled trial studies are necessary to assess its clinical value.
despite the lack of randomized, controlled trials proving its long - term safety and efficacy, intravitreal corticosteroid injections have emerged in the past decade as an increasingly used treatment for patients with macular edema secondary to diabetes mellitus, retinal vein occlusion, exudative macular degeneration, chronic uveitis and pseudophakic cystoid macular edema.1 potential complications of intravitreal corticosteroid treatment are divided into steroid - related and injection - related adverse effects. steroid - related side effects most commonly include cataract formation and an elevation in intraocular pressure (iop). injection - related side effects include retinal tear, choroidal and retinal detachment, vitreous hemorrhage, bacterial endophthalmitis, non - infectious endophthalmitis, pseudo - endophthalmitis, and activation of latent infections (such as acute syphilitic posterior placoid chorioretinitis or cytomegalovirus retinitis).211 we describe a rare case of triamcinolone acetonide entrapment in the berger 's space between the posterior lens capsule and the anterior hyaloid face after intravitreal triamcinolone acetonide (ivta) injection. the patient underwent neodymium : yttrium - aluminum - garnet (nd : yag) laser anterior hyaloidotomy, allowing the trapped fluid to flow into the vitreous cavity. a 65-year - old male with a 15-year history of type 2 diabetes mellitus presented with a complaint of blurred vision in the left eye over a 2-month period. best corrected visual acuity was 20/30 and 20/80 in the right and left eyes, respectively. fundus examination showed a bilateral moderate non - proliferative background diabetic retinopathy and a clinically significant macular edema (csme) in the left eye. time - domain optical coherence tomography (stratus oct3, carl zeiss meditec inc., dublin, ca, usa) showed a diffuse thickening in the macula with a foveal thickness of 630 m. there was no evidence of significant vitreomacular traction. the left eye underwent injection into the vitreous cavity of 0.1 ml (4.0 mg) of a commercially available suspension of triamcinolone acetonide (trigon depot ; 40 mg / ml, bristol - myers squibb sl, new york, ny, usa) under aseptic conditions in the operating room. the 26-g needle was inserted perpendicular through sclera in the inferotemporal quadrant, 4 mm from the limbus, with the tip aimed toward the center of the globe (to avoid any contact with the posterior lens). as a part of the routine protocol, the next day, the patient returned to our emergency department complaining of sudden decrease of vision in the left eye. visual acuity in this eye dropped to hand movements. slit - lamp examination showed the drug between the posterior capsule of the lens and the displaced anterior hyaloid membrane, within the berger 's space [figure 1 ]. there was no view of the fundus, but an ultrasound b scan exam revealed a clear vitreous. during 2 weeks of follow - up, there was no change in the appearance of the milky fluid, and the blurred vision persisted unchanged. with the patient 's consent, an nd : the anterior face of the hyaloids was nicely outlined by the triamcinolone, allowing easily its identification. it was approximately 1 mm far from the posterior capsule. a peyman contact lens (opyg-12/12, ocular instruments, inc., bellevue, wa, usa) was applied to the eye. after a single pulse application at 2.0 mj for 1.0 ms duration aiming at the displaced anterior face of the hyaloid, the trapped triamcinolone acetonide leaked into the vitreous cavity. one week later, slit - lamp examination revealed the complete disappearance of the milky fluid [figure 2 ]. the patient did not receive other treatments, macular thickness decreased significantly to 302 m, and no posterior subcapsular cataract was observed. slit - lamp examination showing the triamcinolone acetonide between the posterior capsule of the lens and the anterior hyaloid membrane (berger 's space) following intravitreal triamcinolone acetonide injection one week after performing neodymium : yttrium - aluminum - garnet laser anterior hyaloidotomy, slit - lamp examination revealed the complete disappearance of the milky fluid anterior segment problems after ivta injection are rare and include vitreous prolapse into anterior chamber with or without intraocular lens (iol) and decentration and opaque coating over the iol.1213 salman.14 reported the only case of entrapment of intravitreal triamcinolone behind the crystalline lens. in that case, the head movement at the time of injection caused the drug to be delivered into the berger 's space between the posterior lens capsule and the anterior hyaloid face. the pathogenesis of this complication is unclear. probably, the injected triamcinolone was misdirected alongside the anterior vitreous surface. a closed chamber might have formed behind the posterior lens capsule by a central detachment of the anterior hyaloid membrane still adherent to the posterior lens capsule by a fibrosed ring. the lens is usually attached to the anterior vitreous surface along a circular zone called the hyaloideocapsular ligament or ligamentum pectinatum, of approximately 12 mm in width and 89 mm in diameter.15 this circular attachment is firm in youth and weakens with age. the potential space of berger lies within the hyaloideocapsular ligament, where the vitreous is attached to the posterior aspect of the lens. this case highlights the importance of proper technique of intravitreal injections because triamcinolone acetonide may become entrapped behind the crystalline lens if the needle is not properly positioned. although both conservative approach to avoid damage to the lens and surgical removal via the pars plana were valid options, we preferred nd : yag laser anterior hyaloidotomy. it was successfully performed resulting in a dramatic increase in visual acuity and the lens remaining clear. in conclusion, nd : yag laser anterior hyaloidotomy is an effective, simple, useful and minimally invasive outpatient procedure in cases with persistent entrapment of triamcinolone acetonide behind the crystalline lens. this technique offers patient rapid recovery of visual acuity and the avoidance of more invasive surgical procedures, allowing the drug to clear without trauma to the crystalline lens. nd : yag laser posterior hyaloidotomy has been indicated for subhyaloid hemorrhages16 and premacular vitreous floaters.17 likewise, nd : yag laser anterior hyaloidotomy has been indicated for malignant glaucoma following cataract surgery.18 to the best of our knowledge, this is the first case report to document the use of nd : yag laser anterior hyaloidotomy for allowing the persistent depot of triamcinolone acetonide to flow into the vitreous cavity. a limitation of this paper is the short follow - up period of only 7 days. although no complications were observed during this time, late complications such as the progression of diabetic macular edema due to rupture of the anterior hyaloid membrane or the development of a posterior subcapsular cataract might be expected.	a 65-year - old male underwent intravitreal triamcinolone acetonide (ivta) injection for treating a clinically significant macular edema (csme) due to background diabetic retinopathy in his left eye. on the first postoperative day, visual acuity dropped from 20/80 to hand movements. slit - lamp examination showed the drug between the posterior capsule of the lens and the anterior hyaloid face. two weeks later, visual acuity and the milky fluid seemed unchanged. neodymium : yttrium - aluminum - garnet (nd : yag) laser anterior hyaloidotomy was performed. one week later, slit - lamp examination of the retrolental space revealed the complete disappearance of triamcinolone and intraocular pressure remained stable. after a follow - up period of 2 months, visual acuity increased to 20/50 with the lens remaining clear. nd : yag laser anterior hyaloidotomy is an effective, simple, useful and minimally invasive outpatient procedure in patients with persistent entrapment of triamcinolone behind the crystalline lens, allowing the drug to clear without trauma to the lens.
i look at the power of belief to produce profound changes in people s experience. one of the earliest reports on the power of placebo was the seminal work of stewart wolf, who demonstrated the ability of placebos to block the effect of potent drugs (5). a pioneer in the investigation of placebo effects, wolf reported three successful experimental attempts at reversing the effects of active medications that typically induce abdominal discomfort. in each case, the reversal was brought about by misinforming the subject about the nature of the drug being administered, and in each case the subjective changes were verified by physiological assessment. one of wolf 's subjects was a 28-year - old pregnant woman who was suffering from nausea and vomiting. wolf gave her ipecac, a drug that interrupts normal gastric contractions, thereby inducing vomiting and nausea. although ipecac is commonly used to induce vomiting when toxic substances have been swallowed, wolf misinformed his patient that it was a medicine which would alleviate her nausea. prior to taking ipecac, the patient displayed an absence of gastric contractions. within 20 minutes of ingesting the drug, normal gastric contractions resumed and the nausea ended. the most impressive of these reports involves the suggestion - related production and inhibition of contact dermatitis (6). contact dermatitis is a skin condition produced by chemical substances to which people have become sensitized. in the study reported by ikemi and nakagawa, 13 students were touched on one arm with leaves from a harmless tree, but were told that the leaves were from a lacquer or wax tree (japanese trees that produce effects similar to poison ivy and to which the boys had reported being hypersensitive). on the other arm, the subjects were touched with poisonous leaves, which they were led to believe were from a harmless tree. all 13 subjects displayed a skin reaction to the harmless leaves (the placebo), but only two reacted to the poisonous leaves. although a meta - analysis published in the new england journal of medicine concluded that the placebo effect is not very powerful (7), wampold and his colleagues have reanalyzed those data and calculated the number needed to treat (nnt) for placebo compared to no treatment at all (8). nnt is the number of patients that need to be treated to achieve one success by means of a particular treatment. although this is not a large effect, it is instructive to compare it to the nnt for various accepted medical treatments, as published in a growing database of published studies provided online (http://www.cebm.utoronto.ca/glossary/nntsprint.htm) by the university of toronto s centre for evidence - based medicine. the nnt for radiotherapy for breast cancer, for example, is shown on that database to be 8, that for beta - blockers for chronic heart failure is 24, the flu vaccine has an nnt of 12, and aspirin as a prophylactic for myocardial infarction has an nnt of 208. the nnt of 7 for placebo treatment was calculated across studies of many different clinical conditions. but there is good reason to believe that the placebo effect should be even greater on depression. this is because hopelessness is a core feature of depression, and one of the presumed effects of a placebo is to instill hope (9). if you ask depressed patients what the worst thing in their life is, many will tell you that it is their depression. they feel stuck in an intolerable condition and they are hopeless about the possibility of getting better (10). so it stands to reason that a treatment promising relief would bring some relief, merely on the basis of hope - instilling promise. indeed, a meta - analysis of the published antidepressant literature indicates that the placebo effect (placebo no - treatment) is twice as large as the drug effect (drug placebo) (11). clinical experience shows that antidepressant drugs work, in the sense that patients get better when given medication. the clinical trials showed substantial and clinically significant improvement, as did those given placebo. hence they have no way of comparing the effects of the drugs they prescribe to placebos. when they prescribe a treatment and it works, quite naturally they ascribe the cure to the treatment. but the history of medicine is replete with cures that were known to work by doctors and their patients. these apparently effective treatments, that we now consider to have been placebos, include dolphin s genitalia, lizard s blood, crocodile dung, pig 's teeth, putrid meat, frog s sperm, powdered stone, human sweat, worms, and spiders. that is why placebo - controlled trials are required in order to demonstrate drug efficacy. when the administration of a drug is followed by improvement, the improvement might not be due to the drug s chemical composition. placebo - controlled trials are used to separate the drug effect from such factors as the placebo effect, spontaneous remission, and regression towards the mean. this is absolutely true. in fact, our data show a small advantage for drug over placebo that is statistically significant, but not clinically significant. we proven that antidepressants do nt work, but we also havent proven that their effect is below the threshold of clinical significance. what we have shown is that the data upon which drug approval was based does not show clinical significance. but it is always possible that future studies, perhaps with better experimental methods or measures of depression, will show a greater effect.. the onus should not be on critics to demonstrate that a treatment is ineffective, but rather for proponents to demonstrate that it is. if all that is needed is an absence of proof that a treatment does not work, then perhaps we ought to resume using treatments crocodile dung and dolphin genitalia until well - enough designed clinical trials prove conclusively that they are not more effective than placebo. this is indeed possible. in fact, we found evidence of greater drug effectiveness in a small subset of studies involving patients with exceptionally high levels of initial depression, although it seemed that they were less responsive to the placebo, rather than more responsive to the drug. we also found that the drug - placebo difference was zero for people who were moderately depressed. for this rather large group of sufferers, anti - depressants seemed to have no drug effect at all. it is feasible that there are other subgroups of patients for which antidepressants are more effective, but simply asserting this possibility is not enough. one must identify those subgroups and demonstrate the clinically - significant benefit they obtain from active medication over placebo. for example, gender is most certainly identified in the data sets of most, if not all, clinical trials. it would be a simple matter, for example, to reanalyze these data to test whether women are in fact more responsive to ssris and men to tricylic medication, as has been suggested (12). note that if there are some groups of patients that respond better than the overall mean, then there must also be some that respond worse. given how small the advantage is over placebo overall, this should be of considerable concern. if some are responding substantially better, then others must not be responding at all or even being made worse by the active medication, compared to how they would have fared on placebo. if this is the case, it would be important to know it so that antidepressant medication could be prescribed more selectively. understandably, pharmaceutical companies might be reluctant to carry out analyses of this sort, as they have the potential to cut into sales substantially. one way around this is to require that raw data for all approved medications be available for researchers to reanalyze. this could easily be done with full protection of the anonymity of those who participated as subjects. greater transparency and availability of the data would be in the best interests of patients, doctors, third - party payers, health researchers, and government agencies. defenders of antidepressants have noted a number of flaws in the clinical trials used to evaluate them. in fact, using the american psychiatric association classification scheme, the mean baseline severity was in the very severe range for all but one of the trials we analyzed. the one exception was a clinical trial involving moderately depressed patients, in which the response to drug was virtually identical to the response to placebo. one possibility is that clinical trial researchers distort the data. according to a spokesperson for the fda, patients may be rated as more severely depressed than they actually are so that they will qualify for the trial (4). now if this is true, then the response of treatment is even less than the clinical trials indicate, unless of course the researchers also inflate scores at the end of the trial. equally troubling if the data have been distorted, then perhaps the drugs should not have been approved in the first place. whereas some critics have complained that the patients in the clinical trials we assessed were not depressed enough, an editorial in nature reviews drug discovery, for example, complained that all but one trial analyzed involved groups with mean initial depression scores in the very severe range, limiting the strength of extrapolations (13). the drug companies did not conduct any trials on patients between the very severely depressed and moderately depressed categories. but here too, the evidence should be on the compani s to demonstrate efficacy for the severely but not very severely depressed patients. there may be many flaws in clinical trials, including relatively short durations, unrepresentativeness of the sample, and the breaking of blind by patients and doctors on the basis of side effects (14). but these trials are the data on the basis of which the drugs were approved. if they are flawed, then we have no evidence of drug effectiveness, and the drugs should not have been approved in the first place. finally, some have argued that even if the drugs do nt work, it was wrong of my colleagues and me to publish our studies. we should nt tell patients that the drugs do nt work because it will undermine their faith in treatment., patients and physicians can not make informed treatment decisions, researchers will be asking the wrong questions, and policymakers will be implementing misinformed policies. if the antidepressant effect is largely a placebo effect, it is important that we know this. it means that improvement can be obtained without reliance on addictive drugs with potentially serious side effects (15, 16).	this article explores the reaction when an article challenging received wisdom is published and covered extensively by the media (1). the article in question was a meta - analysis of antidepressant clinical trials indicating that for most patients, difference between drug and placebo was not clinically significant. reactions ranged from denial that the effects of antidepressants are so small to criticisms of the clinical trials that were analyzed. each of these reactions is explored and countered.
eosinophilic gastroenteritis (eg) usually involves the stomach and small bowel, and esophageal involvement is rare. eg is characterized by gastrointestinal symptoms, peripheral eosinophilia and eosinophil infiltration of the gastrointestinal tissues. although all layers of the stomach and bowel may be involved, symptoms usually reflect the layer which is most severely affected. mucosal disease may be associated with malabsorption and protein deficiency, muscle disease with obstructive symptoms and serosal disease with eosinophilic ascites. in addition, up to 50% of patients have other manifestations of allergy and there is usually a strong family history of allergy [1, 2 ]. esophageal eosinophilia is a pathological condition defined as eosinophil infiltration within the esophageal mucosa, where eosinophils are not normally found. this condition can have various causes, and primary or idiopathic esophageal eosinophilia is referred to as eosinophilic esophagitis (eoe). it has been reported that eoe is closely associated with allergic conditions, especially in the pediatric population. eoe has more recently been increasingly recognized in adults and is one of the most common causes of intermittent solid food dysphagia or food impaction in western countries, but is rare in asian countries [5, 6 ]. squamous cell carcinoma (scc) of the esophagus is one of the most common gastrointestinal malignancies in japan and other asian countries, and it is known to be an aggressive tumor. recent studies have indicated that eosinophil infiltration at the invasion front of esophageal scc may correlate with a less aggressive tumor [7, 8 ]. this type of eosinophil infiltration is termed tumor - associated tissue eosinophilia (tate). however, the biological significance of tate as a host response to carcinoma is not necessarily consistent. the resected esophageal wall showed eosinophil infiltration in areas not surrounding the scc, which did not appear to be pathologically consistent with eoe or tate. a 77-year - old japanese man was admitted to our hospital for investigation and treatment of a superficial esophageal cancer, detected on upper gastrointestinal endoscopy in january 2011. the patient had a 4-week history of decreased appetite. endoscopic examination showed the esophageal cancer as a slightly elevated lesion, 3234 cm from the incisor teeth (fig. iodine staining left the tumor unstained, but showed the margin more clearly (fig. a biopsy of the lesion showed poorly differentiated scc without eosinophil infiltration. computed tomography revealed a normal esophagus, but found lymphadenopathy of the right cardiac nodes. we performed an ivor lewis esophagectomy, consisting of a right thoracotomy and laparotomy with anastomosis in the chest, with two - field thoracoabdominal lymph node dissection. the fluid collection around the anastomosis gradually drained through a drainage tube. the leakage improved over the 40 days following surgery, and the patient the surgical specimens consisted of a 9 cm segment of esophagus with a 5 cm cuff of stomach and lymph nodes from the thoracic and upper abdominal groups. gross examination confirmed a superficial esophageal cancer measuring 2.5 2.5 cm (fig. there was also marked eosinophil infiltration of the full length of the esophageal wall except around the scc (more than 100 eosinophils per high - power field) (fig. eosinophil infiltration was seen in the submucosa, muscle and adventitia, but not in the mucosa (fig. eg is an uncommon disease characterized by peripheral eosinophilia and eosinophil infiltration of the gastrointestinal tract. the most common sites affected are the stomach and small bowel, and esophageal involvement is rare. the clinical presentation depends on the site of gastrointestinal tract involvement as well as the layer of the bowel wall that has been infiltrated. eg has been classified into three types according to the predominant location of eosinophil infiltration : mucosal, muscular and subserosal. eosinophil infiltration at the invasion front of scc is termed tate and correlates with tumor progression [7, 8 ]. in our case, eosinophil infiltration was seen in the submucosa, muscle and adventitia of the entire esophageal wall except around the scc, and there was no peripheral eosinophilia. pathologically, the eosinophil infiltration in this case appeared to be more similar to predominantly muscular or subserosal eg than to eoe or tate. the patient did not, however, have stenosis or obstruction as typically associated with muscular disease, or pleural effusion as typically associated with subserosal disease. his only symptom was loss of appetite, but it is unknown whether that was related to the eosinophil infiltration or to the esophageal scc. have previously reported a case of achalasia with esophageal eosinophilia that underwent esophageal myotomy revealing eosinophil infiltration of the muscle layer. some reports have described that eosinophil infiltration of the muscle layers of the esophagus appeared to be related to esophageal narrowing, although no pathological diagnosis was recognized. steroid therapy was required for severe cases of esophageal narrowing [11, 12, 13, 14, 15 ]. as there was no eosinophil infiltration in the mucosa or around the scc, it would have been difficult to diagnose this by preoperative biopsy. gross examination of the surgical specimen did not show the eosinophil infiltration, which was revealed only by microscopic examination. if the eosinophil infiltration promoted inflammation of the esophagus, this may have been a risk factor for the leakage. however, the significance of eosinophil infiltration in the esophageal wall remains unclear. to the best of our knowledge, the diagnosis was made only after esophagectomy, but eosinophil infiltration such as in this case is pathologically significant. eosinophil infiltration of the esophagus may represent a variant of eg and may predispose to postoperative complications [1, 10 ].	we report a case of esophageal squamous cell carcinoma (scc) with marked eosinophil infiltration which was identified postoperatively in the esophageal wall in areas not surrounding the scc. the eosinophil infiltration was seen in the submucosa, muscle and adventitia, but not in the mucosa. eosinophilic esophagitis (eoe) is a pathological condition defined as eosinophil infiltration within the esophageal mucosa. eosinophil infiltration at the invasion front of esophageal scc is termed tumor - associated tissue eosinophilia (tate). however, the eosinophil infiltration in this case may be pathologically different from both eoe and tate. to our knowledge, this is the first report of esophageal scc with eosinophil infiltration.
fear of hypoglycaemia and gain in body weight are barriers for initiation of insulin therapy. modern insulin analogues are a convenient new approach or tool to glycaemic control, associated with low number of hypoglycaemia and favourable weight change. a1chieve, a multinational, 24-week, non - interventional study, assessed the safety and effectiveness of insulin analogues in people with t2 dm (n = 66,726) in routine clinical care. this short communication presents the results for patients enrolled in biphasic insulin aspart sub group from libya. please refer to editorial titled : the a1chieve study : mapping the ibn battuta trail. the study was started with an aim to collect data on all the insulin analogue viz insulin detemir, biphasic insulin aspart and insulin aspart. however, due to ongoing revolution, the complete data could not be collected. here the majority of patients (189) were started on or were switched to biphasic insulin aspart. other groups were insulin detemir (n = 58), basal + insulin aspart (n = 44) and other insulin combinations (n = 25). being the biggest treatment group, this communication describes the results for patients treated with insulin therapy before and then switched to biphasic insulin aspart. overall demographic data 179 patients started on biphasic insulin aspart ogld, and all the patients were on insulin therapy prior to the study. after 24 weeks of switching to biphasic insulin aspart, hypoglycaemic events reduced from 7.2 events / patient - year to 3.7 events / patient - year [tables 2 and 3 ]. all parameters of glycaemic control improved from baseline to study end [table 4 ]. overall efficacy data 179 patients started on biphasic insulin aspart ogld, and all the patients were on insulin therapy prior to the study. after 24 weeks of switching to biphasic insulin aspart, hypoglycaemic events reduced from 7.2 events / patient - year to 3.7 events / patient - year [tables 2 and 3 ]. all parameters of glycaemic control improved from baseline to study end [table 4 ]. our study reports improved glycaemic control following 24 weeks of treatment with biphasic insulin aspart with or without ogld. hypoglycemic events decreased from baseline and sadrs did not occur in any of the study patients. though the findings are limited by number of patients, still the trend indicates that biphasic insulin aspart can be considered effective and possess a safe profile for treating type 2 diabetes in libya.	background : the a1chieve, a multicentric (28 countries), 24-week, non - interventional study evaluated the safety and effectiveness of insulin detemir, biphasic insulin aspart and insulin aspart in people with t2 dm (n = 66,726) in routine clinical care across four continents.materials and methods : data was collected at baseline, at 12 weeks and at 24 weeks. this short communication presents the results for patients enrolled in biphasic insulin aspart sub group from libya.results:a total of 179 patients were enrolled in the biphasic insulin aspart subgroup. all the patients were prior insulin users. at baseline glycaemic control was poor (mean hba1c : 9.3%). after 24 weeks of treatment there was an improvement in hba1c (0.9%). hypoglycaemic events reduced from 7.2 events / patient - year to 3.7 events / patient - year in 24 weeks. sadrs did not occur in any of the study patients.conclusion:starting or switching to biphasic insulin aspart was associated with improvement in glycaemic control with a low rate of hypoglycaemia.
in geriatric psychiatric disorders, vigilance for potentially reversible causes of morbidity and mortality is especially important. recently, some authors have suggested the importance of screening for vd sufficiency, as well. serum concentration of 25-ohd, or calcidiol, is the best indicator of vd status. estimating the exact prevalence of vd deficiency has been difficult due to lack of consensus regarding both optimal and frankly deficient vd levels among experts in the field. nmol / l is desirable as the lower end of the normal range. a recent review by schwalfenberg. found that up to 97% of the general canadian population showed inadequate vd levels (low end of adequate vd level was defined as about 80 this finding led them to declare the current state of vd status to be a public health crisis. however, based on the 2007 to 2009 canadian health measures survey, statistics canada indicated that only about 5% of males and 3% of females aged 6 to 79 were considered vd deficient (with a cutoff level defined as 25-ohd 80 nmol / l is associated with normal mineral metabolism, the optimal suggested level for breast cancer prevention should be 100 nmol / l. furthermore, a combined analysis of multiple studies found that taking modest levels of vd supplements was associated with a statistically significant 7% reduction in mortality from any cause. most organs and tissues in the body have vd receptors including skeletal muscles. while the causal link between vd deficiency, bone disease, and subsequent falls by associated decreased muscle strength is overwhelming, low vd was also found to be an independent risk factor for falls among the elderly. additionally, vd insufficiency is an established risk factor for osteoporosis ; this medical history was present in two - thirds of our participants. interestingly, vd deficiency was also shown to play an increased role in major psychiatric disorders. an association between vd deficiency and seasonal depression, geriatric depression, anxiety disorders, schizophrenia, and alcoholism, was reported. in individuals with secondary hyperparathyroidism, low serum 25-ohd was associated with higher depression scores and, in those with fibromyalgia, there was an association with both depression and anxiety. remarkably, considerable psychiatric improvement coincided with vd treatment in some of the patients whose deficiency was treated. the benefits of vd beyond bone and muscle are currently based on epidemiological reports, but the vital study intends to answer these questions. despite the high rate of vd deficiency found in this sample, none of the patients were on vd supplement at admission, including multivitamins, and calcium / cholecalciferol tablets. higher demand for testing vd in recent years has led to governmental agencies trying to restrict the number of vd tests ordered by physicians. therefore, routine testing of vd status has been discouraged because of cost and the safety of routine supplements. simple oral supplementation with vd (in the absence of clinical malabsorption) is sufficient. however, polypharmacy is a common problem encountered in the elderly, and clinicians may be reluctant to empirically start vd treatment. as there is no consensus on optimal vd levels, clinicians may have to rely on considering factors that may influence the vd status such as age, latitude, skin pigmentation, and adequate sun exposure. thus, little evidence guides clinicians on when to screen for vd deficiency, and if deficiency is found, an appropriate starting vd dosage. the authors certainly acknowledge that there are clear limitations to any interpretations deriving from such small sample size, with dementia being the most prevalent diagnosis (88.8%), and consisting of only psychiatric inpatients, as well as not being able to account for dietary intakes prior to commencement of the study. despite previous reports of higher rates of low vd in those institutionalized, vd insufficiency is so widespread that the authors advocate routine supplementation of vd is warranted in elderly patients with late - onset psychiatric disorders, regardless of their living arrangements. the high rate of co - morbidity suggests that monitoring vd levels may have additional value in improving the general health in this population. future larger studies are required to determine if 25-ohd can be used as a biomarker in the clinical determination and management of psychiatric disorders.	backgroundhypovitaminosis d is unrecognized and remarkably common in geriatric patients, with various clinical manifestations. the purpose of this study was to prospectively assess the vitamin d (vd) status in newly admitted psychogeriatric patients, and to study the correlation of vd status with indicators of calcium metabolism.methodsa valid vd sample, as measured by serum 25-hydroxyvitamin d (25-ohd), was obtained from nine consecutive psycogeriatric inpatients (66% women), during a one - month period in 2011. the research ethics boards at st. joseph s healthcare hamilton approved this project.resultsall participants showed vd inadequacy (defined as 25-ohd 75 nmol / l) with a mean level of serum 25-ohd of 45.5 14.6 (range 28.573.4) nmol / l. none of the patients in the sample met criteria for vd deficiency (currently defined by expert consensus as 25-ohd < 25 nmol / l). mean serum vd levels were lower in females (38.8 9.8 nmol / l) than in males (59.0 14.3 nmol / l), p =.03. magnesium and pth were both higher in females (p =.03 and.02, respectively). univariate linear regression analysis showed that vd levels were strongly negatively associated with magnesium (p =.001) and pth (p =.02).conclusionsince research links vd deficiency to psychiatric conditions, high rates of insufficiency in this population is very common and routine supplements are strongly suggested, regardless of patients living environment.
invasive fungal infections (ifis) are among the major infectious complications in critically ill or immunocompromised pediatric patients with prolonged neutropenia or various types of organ transplant. pediatric patients with hematologic disorders are predisposed to ifis, mainly due to the use of aggressive chemotherapy regimen or receiving immunosuppressive agents. based on prior studies, it is estimated that ifi occurs in 8% - 17% of pediatric patients with hematologic malignancies (1 - 3). the most common fungi causing invasive infections are candida and aspergillus species with respective mortality rates of 30% and 80% in allogeneic hematopoietic stem cell transplantation (4, 5). conventional diagnostic methods such as blood culture, considered as the gold standard, are insensitive and time consuming (6, 7). different studies show how delay in starting antimycotic therapy increases the risk of mortality from 15% to 40%, when blood culture is used to isolate fungi (8 - 10). other diagnostic procedures including histological examination and culture of deep tissues require an aggressive approach. given these limitations, non - culture - based diagnostic methods used to detect circulating serum biomarkers, cell wall components or fungal antigens in the blood specimens should be considered to confirm fungal infections. galactomannan (gm), one of the major components of fungal cell walls, and circulating antigen in the blood during aspergillus infections is widely used to diagnose invasive aspergillosis (ia), with an overall sensitivity of 90% and specificity of 92% in daily clinical practices (11). -d - glucan (bdg), as a pan - fungal marker, is a useful antigen to diagnose candida and aspergillus species with 80% sensitivity and 82% specificity (12, 13). detection of fungal dna by polymerase chain reaction (pcr) is evaluated in several studies as an attractive alternative test for faster detection of fungal dna in the blood and other clinical specimens with overall sensitivity and specificity of 86.6% and 82%, respectively (14 - 17). the current study aimed to investigate the incidence of ifis and evaluate the diagnostic performance of three non - invasive laboratory tests ; bdg, galactomannan and nested - pcr in pediatric patients with hematologic disorders. this cross - sectional study was conducted in a university medical center, namazee hospital in shiraz, south - west of iran, from october 2014 to january 2015. ninety pediatric patients with hematologic disorders who experienced febrile neutropenia (< 0.5 10 neutrophils/l) and no response to broad - spectrum antibiotics more than 72 - 96 hours were eligible for inclusion in the current study and due to death or discharge from the hospital, 62 patients remained throughout the study. these patients did not receive any antifungal prophylaxis and were examined for fungal infection signs and symptoms twice weekly. after blood collection, presumptive antifungal therapy was started for the patients with suspected fungal infections. eighteen healthy pediatrics with no evidence of fungal infections were considered as the control group and all tests were done on their bloods to determine sensitivity and specificity of tests. all the patients were classified according to diagnostic criteria of the european organization for research and therapy of cancer and mycoses study group (eortc / msg) consensus revised definitions draft (18). in the current study, all the suspected patients had host factors. proven ifis was defined as positive histopathological evidence of ifis or a positive culture of specimen obtained by a sterile procedure from a normally sterile site with clinical sign and symptoms of infection. probable ifis patients are those with host factor with clinical signs and symptoms of infections (one major or two minors) and positive mycological culture of specimens obtained from none sterile sites. possible ifis are those with host factors criteria with mycological evidence or clinical (one major or two minors) criteria (18). the ethics committee of professor alborzi clinical microbiology research center, shiraz university of medical sciences, approved the current study, which was conducted in accordance with the 1975 declaration of helsinki, as revised in 1983. written informed consents were obtained from all parents of pediatric patients and controls prior to the study. clinical samples such as cerebrospinal fluid, pleural and abdominal taps, tissue, bronco - alveolar lavage and sputum from patients with signs of fungal infections were cultured on sabouraud dextrose agar with chloramphenicol (merck, germany) and evaluated by direct microscopic examination. at least two blood cultures were obtained aseptically by inoculating the samples into bactec medium (becton - dickinson, spark, md, usa). yeasts isolated from positive cultures were identified using api 20c aux (biomerieux, hazelwood, mo), according to the manufacturer s instructions. blood samples were collected from all patients and controls and separated serums were kept frozen at -20c until further examination. galactomannan, -d - glucan (bdg) and nested - pcr testing were checked at least twice per week for each patient. bdg was determined using the glucan detection kit, glucatell (associates of capecod, falmouth, ma, usa). a cut - off value of 60 pg / ml was considered as positive (19). detection of the gm antigen was performed by the platelia aspergillus enzyme immunoassay (eia) (bio - rad laboratories, hercules, usa), according to the manufacturer s instructions. a result was considered positive if the level of gm was 0.5 ng / ml in duplicate tests. dna extraction from the sera was performed using the qiaamp dna kit (qiagen, hilden, germany), in accordance with the manufacturers instructions. (15) were used for the nested - pcr, with two sets of universal primers (its1, its4) for all the aspergillus species and species - specific forward and reverse primers applied for candida spp. as described by lindsley. the amplification of the rrna gene resulted in an approximately 600-bp - long amplicon for all tested fungi. the diagnostic performances of the gm, bdg and nested - pcr were evaluated in terms of sensitivity, specificity, positive predictive value (ppv) and negative predictive value (npv) of each test. this cross - sectional study was conducted in a university medical center, namazee hospital in shiraz, south - west of iran, from october 2014 to january 2015. ninety pediatric patients with hematologic disorders who experienced febrile neutropenia (< 0.5 10 neutrophils/l) and no response to broad - spectrum antibiotics more than 72 - 96 hours were eligible for inclusion in the current study and due to death or discharge from the hospital, 62 patients remained throughout the study. these patients did not receive any antifungal prophylaxis and were examined for fungal infection signs and symptoms twice weekly. after blood collection, presumptive antifungal therapy was started for the patients with suspected fungal infections. eighteen healthy pediatrics with no evidence of fungal infections were considered as the control group and all tests were done on their bloods to determine sensitivity and specificity of tests. all the patients were classified according to diagnostic criteria of the european organization for research and therapy of cancer and mycoses study group (eortc / msg) consensus revised definitions draft (18). in the current study, all the suspected patients had host factors. proven ifis was defined as positive histopathological evidence of ifis or a positive culture of specimen obtained by a sterile procedure from a normally sterile site with clinical sign and symptoms of infection. probable ifis patients are those with host factor with clinical signs and symptoms of infections (one major or two minors) and positive mycological culture of specimens obtained from none sterile sites. possible ifis are those with host factors criteria with mycological evidence or clinical (one major or two minors) criteria (18). the ethics committee of professor alborzi clinical microbiology research center, shiraz university of medical sciences, approved the current study, which was conducted in accordance with the 1975 declaration of helsinki, as revised in 1983. written informed consents were obtained from all parents of pediatric patients and controls prior to the study. clinical samples such as cerebrospinal fluid, pleural and abdominal taps, tissue, bronco - alveolar lavage and sputum from patients with signs of fungal infections were cultured on sabouraud dextrose agar with chloramphenicol (merck, germany) and evaluated by direct microscopic examination. at least two blood cultures were obtained aseptically by inoculating the samples into bactec medium (becton - dickinson, spark, md, usa). yeasts isolated from positive cultures were identified using api 20c aux (biomerieux, hazelwood, mo), according to the manufacturer s instructions. blood samples were collected from all patients and controls and separated serums were kept frozen at -20c until further examination. galactomannan, -d - glucan (bdg) and nested - pcr testing were checked at least twice per week for each patient. bdg was determined using the glucan detection kit, glucatell (associates of capecod, falmouth, ma, usa). a cut - off value of 60 pg / ml was considered as positive (19). detection of the gm antigen was performed by the platelia aspergillus enzyme immunoassay (eia) (bio - rad laboratories, hercules, usa), according to the manufacturer s instructions. a result was considered positive if the level of gm was 0.5 ng / ml in duplicate tests. dna extraction from the sera was performed using the qiaamp dna kit (qiagen, hilden, germany), in accordance with the manufacturers instructions. (15) were used for the nested - pcr, with two sets of universal primers (its1, its4) for all the aspergillus species and species - specific forward and reverse primers applied for candida spp. as described by lindsley. the amplification of the rrna gene resulted in an approximately 600-bp - long amplicon for all tested fungi. data were transferred into spss ver. 16 (ibm spss, chicago, usa). the diagnostic performances of the gm, bdg and nested - pcr were evaluated in terms of sensitivity, specificity, positive predictive value (ppv) and negative predictive value (npv) of each test. a total of 62 pediatric patients with hematologic disorders were included in the study. among the patients, 64.5% (n = 40) were male and 35.5% (n = 22) were female, with the mean age of 9.3 years (ranged from 1 to 16 years). the underlying diseases were hematologic disorders including acute lymphocytic leukemia (n = 29, 46.8%), acute myeloblastic leukemia (n = 12, 19.4%), aplastic anemia (n = 3, 4.8%), pancytopenia (n = 6, 9.7%), chronic granulomatous disease (n = 2, 3.2%) and other disorders (n = 10, 16.1%) such as solid tumor or myelodysplastic syndrome. culture, bdg, gm and nested - pcr were done on all of the 321 blood specimens (average five samples for each patient). on the whole, samples of 134 patients including seventy - two bronco - alveolar lavages, ten sinus tissues, thirty - nine sputum, seven cerebrospinal fluids, three abdominal and three pleural fluids were examined by routine culture and microscopic examinations. on the basis of positive culture results of clinical samples along with suggestive host factor, clinical and radiological criteria, patients were categorized into the proven, probable or possible groups (18). according to eortc / msg criteria, 26 patients were considered as proven and probable ifis with the overall incidence of 42%, including 3 (5%) proven and 23 (37%) probable cases. the etiologic agents were six cases of c. albicans, two cases of c. tropicalis, four cases of a. flavus and six cases of a. fumigatus (table 1). of the three proven patients, the blood culture was positive for c. albicans and one for c. tropicalis species. the third one had positive sinus histopathology result (invasion) and tissue culture for a. flavus species. according to eortc / msg (18), 23 patients were considered as probable including 15 patients with positive culture (candida and aspergillus species) of their non - sterile clinical samples (bronco - alveolar lavage, lung / bronchial washing, sinus / sinus washing) (table 1) and eight patients with positive gm test of their blood samples (table 2). among the 18 cases of control group, four patients had bdg level 60 pg / ml and two had positive pcr results. for 26 patients with proven and probable criteria (documented cases), the sensitivity, specificity, negative and positive predictive values of bdg test were reported 92.3%, 77.7%, 85% and 87.5%, respectively. of the patients with suspected ifis according to culture and positive gm results, based on eortc / msg criteria, 18 were classified as proven and probable invasive aspergillosis (ia) and eight as systemic candidiasis (tables 1 and 2). in 17 out of 18 patients with ia, gm serum levels were 0.5 ng / ml in at least two blood samples. the sensitivity, specificity, negative and positive predictive values of gm test in the collected serum samples from patients with proven and probable ia were 94.4%, 100%, 100% and 94.7%, respectively. twenty - two out of 26 patients with proven and probable criteria were pcr positive for aspergillus and candida species (tables 1 and 2). the sensitivity, specificity, positive and negative predictive values of the nested - pcr in this group of patients were 84.6%, 88.8%, 91.7%, and 80%, respectively. abbreviations : bal, bronco - alveolar lavage ; eortc / msg, european organization for research and therapy of cancer and mycoses study group ; fuo, fever of unknown origin ; pcr, polymerase chain reaction. abbreviations : eortc / msg, european organization for research and therapy of cancer and mycoses study group ; pcr, polymerase chain reaction. in patients with suspected fungal infections, rapid and accurate diagnosis of ifis is hampered by non - specific clinical manifestations and difficulties in obtaining appropriate biological samples. traditional diagnostic methods were insensitive and the gold standard diagnostic tests (histopathologic evidence and cultures from deep tissues) needed invasive procedures in high risk patients, due to their critical conditions and concomitant severe thrombocytopenia (20). in that case, accurate diagnosis was made by clinical and radiological data (computed tomography (ct) scan) and laboratory tests including culture, gm in serum or bronco - alveolar lavages, bdg and pcr on clinical samples of patients. available data show a remarkable increase in the incidence of candida and aspergillus species, the most common agents responsible for ifis, among patients during the past decades (1). the overall incidence of ifis in children with malignancy or severe hematological diseases is different. the present study reported the incidence rate of ifis in pediatric patients with onco - hematological diseases (42%), including (n = 3, 5%) proven and (n = 23, 37%) probable cases. eighteen (29%) patients were considered as possible cases. in the study by mor., 75 out of 1047 (7.2%) children hospitalized in the hematology / oncology department were diagnosed as ifis including proven (n = 16, 21.3%), probable (n = 18, 24%) and possible (n = 41, 54.7%) cases (2). in a recent report on the frequency of ifis in a pediatric cohort by watanabe., who retrospectively reviewed the records of 743 neutropenic episodes from 1997 to 2008, the overall frequency was 0.8% (n = 6) and frequencies of proven, probable and possible fungal infections were 0.3% (n = 2), 0.4% (n = 3) and 0.1% (n = 1), respectively (21). the difference between the current observations and the above mentioned results may be attributed to substantial impacts of different characteristics of the study population, diagnostic methods or health care systems. development of reliable methods for the early diagnosis of ifis is the most important goal in the management of the patients. recent studies demonstrated the importance of bdg to diagnose fungal infections (19, 22, 23). according to the current study, the sensitivity, specificity, npv and ppv of bdg test were 92.3%, 77.7%, 85% and 87.5%, respectively. karageorgopoulos. reported an overall sensitivity of 77% and a specificity of about 85%, npv of 95% and ppv ranging from 59% to 96% in pediatric patients with hematologic disorders through a meta - analysis study (24). variable ranges of sensitivity and specificity of bdg among patients are largely due to the use of different cut - off values, as ostrosky - zeichner. reported that when the glucatell assay was performed in 22 out of 163 patients with cut - off of 60 pg / ml, the sensitivity of the test was 69.9% and specificity 87.1%, but increasing the cut - off to 80 pg / ml provided a sensitivity of 64% and specificity of 92.4% (25). moreover, false positive results may occur during the treatment, due to the use of some immunoglobulins or contaminated albumin with fungal elements or concomitant -lactam therapies and bacterial co - infections (26, 27). the diagnostic potential of circulating gm ag to predict the development of ia is increasingly considered in patients with hematologic disorders and several studies confirmed the value of gm detection in this group (28 - 30). as indicated in the current study, gm test demonstrated high sensitivity and specificity (94.4% and 100%, respectively) with npv and ppv of 100% and 94.7%, respectively. evaluated the diagnostic potential of the gm test and reported the overall sensitivity, specificity, npv and ppv of 80%, 98%, 89% and 95%, respectively, among pediatric hematologic patients with proven and probable ifis (30). in contrast, a recent study evaluating the aspergillus antigen test reported a sensitivity of 79%, specificity of 61%, npv and ppv of 54% and 83%, respectively (31). the discrepancy in the results may be attributed to the possibility of concomitant use of antifungal therapy or probability of obtaining a false - negative result based on the optical density cutoff value used (optimal value was 0.5 ng / ml). false - positive results might be originated from factors such as concurrent use of some antibacterial treatments (piperacillin / tazobactam even up to five days after the cessation of treatment), concomitant administration of amoxicillin with or without clavulanate and use of various brands of milk formula and liquid nutrient supplements containing soybean protein (32). the other test for the sensitive detection of ifis and fungal dna of most fungi is pcr. depending on the type of pcr assay, differences in dna extraction and product detection method, the reported sensitivity and specificity in the diagnosis of ifis could vary. based on the current study data, the overall sensitivity and specificity of nested - pcr in proven and probable cases were 84.6% and 88.8%, respectively. for panfungal pcr and nested - pcr assays, these rates were reported 75%, and 92% (31), and 80% and 81%, respectively (33). some studies focused on pediatric patients with hematological malignancy demonstrated a complete lack of sensitivity of pcr (28) ; whilst in others sensitivities were similar to those of the current population (8). however, given the fact that until recently there was no standardized protocol for pcr test, diversity of the designs of different studies did not allow the easy comparison of study results. although high sensitivity and specificity were reported for pcr in the current assay, it was a technique that should be validated in further prospective studies. based on the current study data, the rate of ifis in pediatric patients was high. non - invasive methods such as bdg, gm, and nested - pcr tests can serve as efficient diagnostic tools in pediatric hematologic patients with suspected ifis, especially in cases without any positive culture results. the results should be interpreted with caution and only in combination with clinical, radiological, and microbiological findings. based on the current study data, the rate of ifis in pediatric patients was high. non - invasive methods such as bdg, gm, and nested - pcr tests can serve as efficient diagnostic tools in pediatric hematologic patients with suspected ifis, especially in cases without any positive culture results. the results should be interpreted with caution and only in combination with clinical, radiological, and microbiological findings.	backgroundinvasive fungal infection (ifis) is a major infectious complication in immunocompromised patients. early diagnosis and initiation of antifungal therapy is important to achieve the best outcome.objectivesthe current study aimed to investigate the incidence of ifis and evaluate the diagnostic performance of non - invasive laboratory tests : serologic (-d - glucan, galactomannan) and molecular (nested polymerase chain reaction) tests to diagnose fungal infections in hematologic pediatric patients.patients and methodsin a cross - sectional study from october 2014 to january 2015, 321 blood samples of 62 pediatric patients with hematologic disorders and at high risk for fungal infections were analyzed. non - invasive tests including the platelia aspergillus enzyme immunoassay (eia) to detect galactomannan antigen, glucatell for d glucan and nested pcr to detect candida and aspergillus species - specific dna were used in a weekly screening strategy.resultstwenty six patients (42%) were considered as proven and probable ifis, including 3 (5%) proven and 23 (37%) probable cases. eighteen patients (29%) were considered as possible cases. the sensitivity, specificity, positive and negative predictive values for galactomannan test in 26 patients with proven and probable fungal infections were 94.4%, 100%, 100% and 94.7% ; for -d - glucan test 92.3%, 77.7%, 85%, 87.5% and for nested - pcr were 84.6%, 88.8%, 91.7% and 80%, respectively.conclusionsthe rate of ifis in pediatric patients with hematologic disorders is high, and sample collection from the sterile sites can not be performed in immunocompromised patients. detection of circulating fungal cell wall components and dna in the blood using non - invasive methods can offer diagnostic help in patients with suspected ifis. their results should be interpreted in combination with clinical, radiological and microbiological findings.
the previous issue of critical care includes a report of a multicenter study in which cardiac index and gastric mucosal ph targets were compared during resuscitation of patients with septic shock. similar to all other hemodynamic variables with the exception of central venous oxygen saturation, the value of a cardiac index target in the resuscitation of patients in septic shock has not been established. in contrast, achievement of other goals in the treatment of septic patients (for instance, early and adequate antibiotic treatment) has been associated with improved outcomes. because ' normal ' systemic hemodynamics do not necessarily guarantee adequate tissue oxygen supply, monitoring organ perfusion or function it has been shown that persistent microcirculatory alterations are associated with organ failure and mortality in patients with septic shock. gastric mucosal ph (phi) is an interesting parameter that has been shown to predict outcome in many patient groups. phi is a composite variable that reflects not just adequacy of local perfusion but also systemic metabolic acid - base homeostasis and ventilation. the interaction of the components of phi and their response to treatment may confound the interpretation and prognostic relevance of gastric mucosal acidosis. in the study conducted by palizas and coworkers, resuscitation to a phi goal conceptually, there are four interpretations of these findings : the tested variables (cardiac index and phi) are not relevant to survival ; the defined targets were not adequate ; the targets were relevant but only in combination with the achievement of other goals ; and finally, the efforts to achieve the goals were not adequate, and the goal therefore was not achieved. cardiac output determines tissue oxygen delivery and is certainly an important variable with respect to the resolution of septic shock. however, other variables contribute to tissue oxygen transport, and the demands may also vary. in that sense, as the authors state themselves, a goal representing a presumed adequate relationship between oxygen delivery and consumption (for example, mixed venous oxygen saturation) would have been preferable. its strong association with mortality makes phi an ideal target variable for improving outcomes. in the study reported by palizas and coworkers, the target cardiac index was achieved at baseline in nearly 90% of patients. because the mortality was 30%, it is clear that the target should have been higher, if increasing cardiac index is believed to be beneficial. it is a relatively common practice to increase minute ventilation in order to normalize arterial ph when bicarbonate is low. whether a (normal) phi of 7.32 can be achieved at all during the early phase of septic shock is questionable. the use of vasoconstrictors can decrease mesenteric perfusion, and metabolic effects of adrenaline (epinephrine) may increase pco2 further. there is no information on how other aspects of septic shock treatment were addressed (antibiotics, source control, ventilator settings, and so on) the authors indicate that crystalloids and colloids were given, but in their protocol only saline is listed. although colloids can be harmful in sepsis, normal saline (or colloids in saline) can cause hyperchloremic metabolic acidosis and thereby decrease mucosal phi. adrenaline (epinephrine), noradrena - line (norepinephrine), dopamine, and dobutamine were used to improve blood pressure and flow. although adrenaline can impair splanchnic perfusion in septic shock, dobutamine appears to be able to reverse these changes, at least in part. phi was measured every 6 hours, and no data are given on the frequency of cardiac index assessments. four daily assessments of the treatment 's influence on the target variable may be too few, especially in view of the fact that splanchnic blood flow is highly variable in septic patients. it would have been interesting to see how the individual therapeutic interventions influenced the target variables. without this information, nevertheless, the work by palizas and coworkers reminds us that mucosal acidosis persists in the majority of patients who ultimately will die after resuscitation from septic shock. monitoring and treating cardiac output determines tissue oxygen delivery and is certainly an important variable with respect to the resolution of septic shock. however, other variables contribute to tissue oxygen transport, and the demands may also vary. in that sense, as the authors state themselves, a goal representing a presumed adequate relationship between oxygen delivery and consumption (for example, mixed venous oxygen saturation) would have been preferable. in the study reported by palizas and coworkers, the target cardiac index was achieved at baseline in nearly 90% of patients. because the mortality was 30%, it is clear that the target should have been higher, if increasing cardiac index is believed to be beneficial. in contrast, the incidence of low phi was high. however, the variable is influenced by arterial carbon dioxide tension (pco2). it is a relatively common practice to increase minute ventilation in order to normalize arterial ph when bicarbonate is low. thus, the mucosalarterial pco2 gradient would have been a better choice. whether a (normal) phi of 7.32 can be achieved at all during the use of vasoconstrictors can decrease mesenteric perfusion, and metabolic effects of adrenaline (epinephrine) may increase pco2 further. there is no information on how other aspects of septic shock treatment were addressed (antibiotics, source control, ventilator settings, and so on) the authors indicate that crystalloids and colloids were given, but in their protocol only saline is listed. although colloids can be harmful in sepsis, normal saline (or colloids in saline) can cause hyperchloremic metabolic acidosis and thereby decrease mucosal phi. adrenaline (epinephrine), noradrena - line (norepinephrine), dopamine, and dobutamine were used to improve blood pressure and flow. although adrenaline can impair splanchnic perfusion in septic shock, dobutamine appears to be able to reverse these changes, at least in part. phi was measured every 6 hours, and no data are given on the frequency of cardiac index assessments. four daily assessments of the treatment 's influence on the target variable may be too few, especially in view of the fact that splanchnic blood flow is highly variable in septic patients. it would have been interesting to see how the individual therapeutic interventions influenced the target variables. without this information, nevertheless, the work by palizas and coworkers reminds us that mucosal acidosis persists in the majority of patients who ultimately will die after resuscitation from septic shock. monitoring and treating the department of intensive care medicine at inselspital has or has had research contracts and/or collaboration contracts with edwards lifescience, ge healthcare, pulsion, orion pharma, berna biotech and b. braun medical.	the need to achieve adequate tissue oxygen delivery early in patients with septic shock is well established. however, it is less well recognized that tissue hypoperfusion can exist despite normalization of systemic hemodynamics. efforts to resuscitate septic patients until adequate tissue perfusion has been achieved can potentially improve outcome. in a multicenter study, 130 patients with septic shock were resuscitated within 12 hours of diagnosis using a protocol including goals for mean arterial and pulmonary artery occluded pressures, urinary output, arterial ph, and hemoglobin goals. they were then randomly assigned to further resuscitation with either a cardiac index (3 l / minute per m2) or a gastric mucosal ph (7.32) target. the intensive care unit length of stay and 28-day mortality did not differ between groups, but more patients in the cardiac index group were in the target range, both at baseline and after resuscitation, as compared with the gastric mucosal ph group. in contrast to cardiac index, gastric mucosal ph at baseline and at 24 and 48 hours predicted mortality. whether other targets for the chosen variables, or different and in particular earlier resuscitation efforts would have favored one group can not be concluded from the data provided.
hypertension and dyslipidemia, two powerful risk factors for cardiovascular disease, often coexist, and their combined effect is much greater than the sum of their individual effects. moreover, a growing body of evidence supports that dyslipidemia may predate the onset of hypertension, while a genetic link between dyslipidemia and hypertension can not be excluded [2, 3 ]. statins, the mainstay of lipid - lowering therapy, result in a significant clinical benefit both in primary and secondary cardiovascular prevention. in addition to their hypolipidemic capacity, other properties may contribute to statin - induced benefits, including a reduction of blood pressure (bp) [59 ]. in this context, rosuvastatin has been associated with reductions in bp and bp variability in animal studies [6, 10 ]. nicotinic acid (na) comprises the oldest hypolipidemic drug in use since 1955, and it has been associated with bp decrease in a number of studies [11, 12 ]. recently, the european medicine agency approved a fixed combination of extended release (er) na with laropiprant (a prostaglandin d2 receptor antagonist) which reduces na - induced flushing without altering the beneficial effects of na on lipid profile or bp [1315 ]. we aimed to compare the possible bp effects of switching to high - dose rosuvastatin with add - on - current statin er - na / laropiprant in normotensive and hypertensive patients with primary dyslipidemia who were currently treated with a conventional statin regimen but had not achieved the treatment goals. to our best of knowledge, consecutive subjects with primary hypercholesterolemia (n = 70) attending the outpatient lipid and obesity clinic of the university hospital of ioannina, ioannina, greece were recruited. eligible patients were those treated for at least 3 months with a conventional statin dose (1040 mg simvastatin or 1020 mg atorvastatin or 520 mg rosuvastatin) and their low - density lipoprotein cholesterol (ldl - c) or non - high - density lipoprotein cholesterol (non - hdl - c) levels were above those recommended by the national cholesterol education program adult treatment panel iii (ncep - atp) iii based on each patient risk factors. subjects with triglycerides (tg) > 500 mg / dl (5.65 mmol / l), renal disease (serum creatinine levels > 1.6 mg / dl, 141 mol / l), hypothyroidism (thyroid stimulating hormone (tsh) > 5 iu / ml), and liver disease (alanine aminotransferase (alt) and/or aspartate aminotransferase (ast) levels > 3-fold upper limit of normal in 2 consecutive measurements) were excluded from the study. patients with hypertension and/or diabetes were considered eligible if they were on stable medication for at least 3 months and their bp and/or glycemic profile were adequately controlled (no change in their treatment was allowed during study period). patients were randomly allocated (without a washout phase) to open - label high - dose rosuvastatin (40 mg / day) or to add - on current statin treatment with er - na / laropiprant (1000/20 mg / day for the first 4 weeks, followed by 2000/40 mg / day for the next 8 weeks) for a total of 3 months. all study participants gave their written informed consent prior to enrolment, and the ethics committee of the university hospital of ioannina approved the study protocol. visits took place at baseline and 12 weeks after the start of treatment. at each visit, bp was measured in triplicate in the right arm after patients had rested for 10 minutes in a sitting position. measurements were performed by trained clinicians using an electronic sphygmomanometer (watchbp office, microlife watchbp ag, widnau, switzerland). levels of total cholesterol (tc), hdl - c, and triglycerides (tg) were determined enzymatically in the laboratory of the university hospital of ioannina using an olympus au 600 analyzer (olympus diagnostica gmbh, hamburg, germany). ldl - c was calculated using the friedewald equation (provided that tgs were 3-fold upper normal limit. no changes in body weight, dietary habits (including salt intake), or antihypertensive or antidiabetic medications were reported during the followup. in the switch - to - rosuvastatin 40 mg / day group, in contrast, the addition of er - na / laropiprant to current statin treatment resulted in a significant 7% reduction of systolic bp (p <.001 versus baseline and p =.01 versus rosuvastatin 40 mg) and a significant 5% reduction of diastolic bp (p =.009 versus baeline and p =.01 versus rosuvastatin 40 mg) (table 2). in the subgroup of hypertensive subjects (n = 18) the add - on - current - statin er - na / laropiprant was associated with a 7% and 6% significant reduction of systolic and diastolic bp, respectively, compared with baseline (systolic bp from 133 6 to 124 11 mmhg, p =.009 and diastolic bp from 80 9 to 75 6 mmhg, p =.03). in normotensive subjects (n = 12) the add - on - current - statin er - na / laropiprant resulted in similar though not significant bp alterations (6% (from 131 5 to 125 6 mmhg) and -5% (from 83 5 to 79 6 mmhg), respectively, p = ns versus baseline and p = ns versus hypertensive subgroup). in the switch - to - rosuvastatin 40 mg group, both hypertensive and normotensive subjects demonstrated no significant bp alterations (data not shown). both the switch to rosuvastatin 40 mg and add - on - statin er - na / laropiprant significantly decreased tc, ldl - c, tgs and non - hdl - c compared with baseline (all p <.001) (table 2). the change in ldl - c was more pronounced in the switch - to - rosuvastatin 40 mg compared with add - on - current - statin er - na / laropiprant group. in contrast, tgs and hdl - c levels were improved more with add - on - statin er - na / laropiprant compared with switch - to - rosuvastatin 40 mg (table 2). the observed bp reductions were not significantly correlated with hdl - c increase or other lipid changes in the add - on - statin er - na group (data not shown). this is the first study to directly compare the antihypertensive potential of switching to high - dose statin with add - on - current statin er - na / laropiprant. we demonstrated that add - on - current - statin er - na / laropiprant but not the switch to rosuvastatin 40 mg is associated with significant reductions of both systolic and diastolic bp in patients with primary dyslipidemia, especially in the subgroup of hypertensives. a growing body of evidence suggests that statins may reduce bp [5, 8, 9, 17, 18 ]. the effects of rosuvastatin on systemic and regional hemodynamics were evaluated in 2 hypertensive rat models (one genetically determined and one hypertensive - induced via inhibition of nitric oxide (no) synthesis). regional hemodynamics improved with rosuvastatin in both hypertensive models, as evidenced by increased blood flow and decreased vascular resistance. in addition, rosuvastatin has been associated with improved bp variability in genetically dyslipidemic mice (apolipoprotein e /) and reduced systolic bp in obese rats with chronic kidney injury [6, 19 ]. moreover, in obese and dyslipidemic (leptin- and ldl - receptor - deficient) mice rosuvastatin reduced systolic bp to the same levels compared with age - matched wild type control mice despite incomplete correction of insulin resistance and regardless of dose. the mechanisms by which statin may reduce bp remain unknown. it is possible that statin effects on bp are mediated by endothelial function improvement. of note, among the pleiotropic actions of rosuvastatin are the reduction of proinflammatory cytokines and endogenous no synthase inhibitor levels, the promotion of no function and peroxisome proliferator - activated receptor gamma (ppar) expression, and the increase of superoxide dismutase 1 which represent major antioxidants in the vasculature [6, 7, 10 ]. moreover, in a placebo - controlled study, rosuvastatin (10 mg / day) decreased p - selectin in 60 patients with pulmonary arterial hypertension (pah). p - selectin is a crucial player in inflammation and thrombosis, and its reduction by rosuvastatin is relevant to the pathophysiological scenario of pah and potentially to arterial bp. indeed, a growing body of evidence suggests that vitamin d may decrease bp [22, 23 ]. in our study, the switch to rosuvastatin 40 mg / day was not associated with significant bp reductions. a possible explanation could be that all patients were already receiving baseline statin treatment. as the bp - lowering effect of rosuvastatin has been demonstrated to be independent of dose and changes in lipids, at least in animal models, it is possible that the switch to high - dose rosuvastatin does not result in any further reduction in bp compared with preexisting statin treatment [6, 7, 9, 10 ]. despite the use of na for approximately 50 years, there are only few reports on the effects of na on bp [11, 24, 25 ]. in one study na was intravenously infused to 11 normotensive and 10 hypertensive subjects. in the normotensives, systolic, diastolic, and in contrast, the hypertensive subjects experienced a decrease in mean bp from 105 2 mmhg to 100 3 mmhg (p <.01) accompanied by significant decreases in systolic, diastolic, and pulse pressures. another study reached similar results, supporting that na (500 mg / day for 7 days and then 1 g / day for further 7 days) does not have an acute effect on bp in normotensive subjects. a post - hoc analysis of the coronary drug project (cdp) demonstrated that 1-year therapy with na in patients with metabolic syndrome was associated with a 2.2 mmhg reduction of systolic bp compared with a rise of 0.8 mmhg in the placebo group (p <.0001). additionally, diastolic bp declined by 2.9 mmhg compared with 0.9 mmhg decrease in the placebo group (p <.0001). in a post - hoc analysis of a 24-weeks, phase 3 trial, 1613 dyslipidemic patients were randomized in er - na alone or er - na / laropiprant combination or placebo. bp decreased with er - na, while laropiprant did not attenuate or abolish this effect. specifically, the placebo - adjusted mean changes from baseline in systolic bp were 2.2 and 3.1 mmhg in the er - na and er - na / laropiprant groups (p <.05 and p <.001, resp.), while similar changes were reported for diastolic bp (2.7 and 2.5 mmhg in the er - na and er - na / laropiprant groups, respectively, both p <.001). of note, the reduction of systolic bp in the er - na and er - na / laropiprant groups was more pronounced in patients not receiving antihypertensive treatment compared with those on such treatment. on the contrary, diastolic bp decreased similarly in all patients receiving er - na or er - na / laropiprant regardless of concomitant antihypertensive therapy. there were also a few cases reported of hypotension (in 0.3%, 0.0%, and 0.7% of patients receiving er - na, er - na / laropiprant and placebo, resp.) and orthostatic hypotension (in 0.1%, 0.2% and 0.0% of patients receiving er - na, er - na / laropiprant and placebo, resp.). in contrast, in a smaller (n = 412) and shorter study (8 weeks), the combination of er - na (1 - 2 g / day) with laropiprant did not significantly alter bp levels. the mechanisms by which na can reduce bp remain unknown. studies with na and laropiprant suggest that the latter does not affect bp [15, 30 ]. thus, it is unlikely that these changes are mediated by prostaglandin d2 or cutaneous vasodilatation. another possible mechanism may be the improvement in endothelial function, as hdl promotes no endothelial generation. thus, the na - induced elevation of hdl may result in a no - mediated decrease of bp. in our study, add - on - statin er - na / laropiprant was associated with significant bp reductions, mainly in hypertensive subjects. the observed bp reductions were not significantly correlated with hdl - c increase or other lipid changes. thus, the er - na / laropiprant - induced bp lowering may be independent of lipid changes and may be associated with the pleiotropic effects of this agent. na apart from raising hdl improves several pleiotropic properties of hdl including improved capacity of hdl to stimulate endothelial no, to reduce superoxide production, and to promote endothelial progenitor cell - mediated endothelial repair which may be beneficial for endothelial function. moreover, na has been directly associated with the reduction of asymmetric dimethylarginine (adma), a methylated amino acid that causes endothelial dysfunction by competitive inhibition of the no synthase [33, 34 ]. of note, although er - na / laropiprant - associated bp reduction was numerically similar between normotensives and hypertensives, it was significant only in hypertensive subjects. however, the small number of patients in the normotensive subgroup does not allow firm conclusions. we noticed more pronounced reduction in ldl - c in the switch - to - rosuvastatin 40 mg group compared with the add - on - statin er - na / laropiprant group. as expected, tgs and hdl - c were improved more with the add - on - statin er - na / laropiprant compared with the switch - to - rosuvastatin 40 mg. a major limitation of our study is its open - label design. on the other hand, it was an adequately powered randomized study that used a validated method for the assessment of bp. this study design is relevant to every day clinical practice when the treating physician is in dilemma over what to do in a patient who has failed to achieve lipid targets while on conventional statin treatment. the bp - lowering effect of na may be more pronounced in inadequately controlled hypertensives, but further research in this field is needed. the addition of er - na / laropiprant to a conventional statin regimen, but not the switch to high - dose rosuvastatin, is associated with significant reductions of both systolic and diastolic bp in dyslipidemic patients, especially in those with hypertension. addition of er - na / laropiprant to a conventional statin regimen may further improve both bp and lipid profile in hypertensives who have not achieved lipid targets.	introduction. nicotinic acid (na) and statins have been associated with reductions in blood pressure (bp). patients and methods. we recruited 68 normotensive and hypertensive dyslipidemic patients who were treated with a conventional statin dose and had not achieved lipid targets. patients were randomized to switch to high - dose rosuvastatin (40 mg / day) or to add - on current statin treatment with extended release (er) na / laropiprant (1000/20 mg / day for the first 4 weeks followed by 2000/40 mg / day for the next 8 weeks) for 3 months. results. switching to rosuvastatin 40 mg / day was not associated with significant bp alterations. in contrast, the addition of er - na / laropiprant to current statin treatment resulted in a 7% reduction of systolic bp (from 134 12 to 125 10 mmhg, p <.001 versus baseline and p =.01 versus rosuvastatin group) and a 5% reduction of diastolic bp (from 81 9 to 77 6 mmhg, p =.009 versus baseline and p =.01 versus rosuvastatin group). these reductions were significant only in the subgroup of hypertensives and were independent of the hypolipidemic effects of er - na / laropiprant. conclusions. contrary to the switch to high - dose rosuvastatin, the addition of er - na / laropiprant to statin treatment was associated with significant reductions in both systolic and diastolic bp.
nosocomial infections are one of the most frequent causes of mortality and morbidity in children requiring intensive care including mechanical ventilation. in pediatric intensive care units (picu), bloodstream and they are almost always associated with prolonged use of invasive methods in the treatment of critically ill patients such as methods of catheterization and mechanical ventilation. according to the criteria of centers for disease control and prevention (cdc criteria), one is the gram staining technique, which groups both micro - organisms and infections into gram - negative and gram - positive categories, and the other is incubation time, which distinguishes community from nosocomial infections. classifying infections is crucial in any infection surveillance program, in particular in the intensive care units (icu). from the practical point of view, time cut - offs, generally 48 h, have been accepted to distinguish community and hospital - acquired infections from infections due to micro - organisms acquired during the patient s stay in the icu (i.e., icu - acquired infections). however, many clinicians have appreciated that an infection developing after 48 h of icu stay, due to a micro - organism carried by the patient on admission to the icu, can not be considered as true icu acquired. obviously, this infection is nosocomial, i.e. the infection occurs in the icu because the patient required intensive care treatment for her / his underlying disease associated with the immuno - paralysis. however, the causative micro - organism does not belong to the icu microbial ecology, as the patient imported the micro - organism in her / his admission flora. a new classification of icu infections, based on the knowledge of patient s carrier state, has been proposed. this approach allows the distinction between imported, or primary, and secondary carriage of potentially pathogenic micro - organisms (ppms), in addition to endogenous and exogenous infections. the objectives of this study were to evaluate the incidence of infections and infection complications in children admitted to the picu, university childrens hospital, brno, czech republic during years 20042005, to differentiate between primary endogenous (pe), secondary endogenous (se) and exogenous (ex) infections, and to compare this classification with traditional classification of infections and identify the most common pathogens causing nosocomial infections at picu. this prospective observational study included all the patients hospitalized for more than 3 days (72 hours) at picu from jan 1, 2004 to dec 31, 2005. patients who had had the infection before the admission and those who did not develop an infection during the hospitalization were excluded from the study. surveillance samples of oropharyngeal and rectal swabs were obtained on admission to the picu, and twice weekly (e.g. on mondays and thursdays) thereafter. diagnostic or clinical samples were obtained in the case of suspicion of infection based on the clinical condition and laboratory findings [tracheal aspiration (ta), bronchoalveolar lavage (bal), blood, urine, smear, etc. ]. the microorganisms causing the infections were classified based on their pathogenicity as potentially pathogenic microorganisms (ppm) such as streptococcus pneumoniae, haemophilus influenzae, moraxella catarhalis, staphylococcus aureus, escherichia coli, candida albicans, or pathogenic microorganisms (pm) such as klebsiella species, proteus species, morganella species, enterobacter species, citrobacter species, serratia species, acinetobacter species, pseudomonas species, stenotrophomonas species. all the infections were classified based on the traditional classification of infections (cdc criteria) such as the cut - off interval (infections appearing before or after 48 hours of hospitalization), and based on the carrier state. knowledge of the carrier state, together with diagnostic cultures, allows the distinction between the three types of infection occurring in the icu. primary endogenous infections (pe) were defined as an infection caused by ppm or pm brought into the unit with the patient who carried the ppm in throat and/or gut on admission. secondary endogenous infections (se) was an infection caused by a ppm or pm not carried by the patient on admission, but acquired in the unit followed by oropharyngeal and/or gastrointestinal carriage and subsequent infection. exogenous infections (ex) were infections caused by ppm or pm that was never present in throat and/or gut of the patient. bacteria are transferred directly into an internal organ without previous carriage. according to this criterion, only secondary endogenous and exogenous infections are labeled icu - acquired infections, whilst primary endogenous infections are considered to be imported infections. the patients were classified as having either infection at the time of admission or without infection. the patients without infection at the time of admission were split into groups of those with complications caused by an infection and those without them. the study recorded following data for all the patients : age, weight, sex, pediatric risk of mortality (prism) score at admission, the basic cause of the illness, multiorgan failure score (mofs), the length of the hospitalization, classification of the infections based on traditional classification of infections and carrier state criteria, the incidence of specific microorganisms, and the type of infection caused by them later on. swabs of throat, nose and stool (surveillance samples) were qualitatively and semi - quantitatively processed in order to determine the carrier state type. identification, typing and sensitivity of all the microorganisms were done using standard microbiological methods. descriptive statistics and basic statistical methods (fisher exact test, pearson s chi - square test and mann - whitney u test) were used for analysis of the findings depending on data type. out of 617 patients admitted in the years 2004 and 2005, 264 (42.7%) patients were hospitalized for more than 72 hours. of the hospitalized patients, 86 (32.6%) the study dealt with 178 (67.4%) patients, who were without infection at the time of admission. they included 22 boys and 22 girls with an average age of 88.1 months, average weight of 26.9 kg, and average length of stay 3.9 days. table 1 compares the patients with an infection during hospitalization and the patients without one. both groups had similar demographic data including age, weight, sex and the cause of the basic illness, the severity of illness on admission (prism, mofs), or mortality. there was however, statistically significant difference in the length of stay (13.9 days for patients with an infection vs. 8.9 days for patients without an infection, p=0.0001). the distribution of the bacterial and yeast infections according to two classification schemes, namely 48 hour cut - off interval was based on traditional classification of infections (cdc criterion) and carrier state criterion. the comparison of characteristics of the patients with and without nosocomial infection during hospitalization fisher exact test ; pearson s chi - kvadrat test ; mann - whitney u test ; prism : pediatric risk of mortality ; mofs : multiorgan failure score based on the cdc criteria 70.5% of all the infections were classified as nosocomial and 29.5% of them as community infections. using the carrier state criteria, 27 (61.3%) infections were classified as pe, 10 (22.7%) infections as se and 7 (15.9%) as ex. in all three categories (pe, se, ex), the most common one (95% [42 out of 44 infections ]) was the lower airways infection (table 2). primary endogenous and se in most cases were caused by ppm that can be carried by healthy people as well (community bacteria). primary endogenous infection in most cases (8 out of 24 ; 29.6%) was caused by e. coli, and se was mostly (8 out of 10, 80%) caused by c. albicans. the most common ex were klebsiella species and pseudomonas aeruginosa, which are the typical nosocomial pathogenous microorganisms. the distribution of pathogens based on carrier state criterion pe : primary endogenous infections ; se : secondary endogenous infections ; ex : exogenous infections the terms exogenous and endogenous, derived from the greek word genous, which mean depend or develop, and tell us whether the infections originated in the patient s inner or his outer environment. there is no evidence that infections occurring on, or at a specific time after icu admission, are attributable solely to micro - organisms transmitted via the hands of care givers and, hence, acquired during the icu stay. it also still remains uncertain from the literature whether the given time cut - off refers to the number of days on the icu or the number of days following intubation. the failure of the cdc guidelines to specify a time cut - off has led to the introduction of arbitrary and different time cut - offs, and to the use of the type of micro - organism causing the infections to distinguish between community-, hospital-, and icu - acquired infections. clinicians, in extending the time cut - off, appreciated that infections developing in the first days after icu admission have nothing to do with the icu microbial ecology, and hence acknowledged that incubation time represents an inaccurate criterion for classifying infections in the critically ill patients. according to the pathogenesis of icu - acquired infections, acquisition of a ppm is followed by carriage and overgrowth of that micro - organism before colonization and infection of an internal organ may occur. undoubtedly, this process takes more than 2, 3, or 4 days to develop. therefore, a low respiratory tract infection due to a ppm already carried in the throat and/or gut on admission and developing in a ventilated trauma patient after 3, 4, or even 10 days of icu admission, can not be considered as icu acquired. knowledge of the carrier state at the time of admission and throughout the icu stay is indispensable in distinguishing infections due to imported ppms (i.e., primary endogenous) from infections due to bacteria acquired on the unit (i.e., secondary endogenous and exogenous). icu - acquired infections, as the origin of the causative bacteria is outside the icu patient, the icu environment. in the case of the secondary endogenous infections, the micro - organism acquired in the unit goes through a digestive tract phase, but this does not apply to the exogenous infections. we consider the classification of infections developed in the hospital, and especially at icu, a key for the definition of nosocomial infections, because nosocomial infections lead to a higher mortality, prolong the hospitalization time, and increase the treatment costs. also, the percentage of occurrence of nosocomial infections is often a mark of quality of the critically ill patients treatment. in our set of patients, the infection developed during hospitalization prolonged the hospitalization time at the icu (13,9 vs. 8.9 day, p=0.0001), and did not affect mortality (2 vs 10 patients, not significant). since both patient groups namely, those with and those without an infection during hospitalization, are similar in terms of the demographic content and the severity of illness (see table 1), the prolongation of the hospitalization time must be caused by the infections. in our set of patients the infections acquired during hospitalization were divided into two groups of nosocomial (70.5%) and community ones (29.5%) based on cdc criteria. the use of the carrier state criterion, however, led to significant differences in this classification resulting in the rate of 61.3%, for pe, 22.7% for se, and 15.9% for ex. based on the carrier state, the se and ex infections are considered nosocomial, resulting in the total rate of nosocomial infections of 38.6%. the evaluation of treatment quality of the critically ill children based on the percentage of nosocomial infections would be very different too. another important aspect of this is the possibility to prevent the infections acquired during hospitalization. the main message of the traditionalists, who use a time cut - off of 48 h for classifying infection, is that the icu - acquired infectious problem is a huge early phenomenon involving about two - thirds (up to 85%) of all icu infections. their approach implies that most infections occurring in the icus are nosocomial, due to micro - organisms transmitted via the hands of care givers, except those established in the first two days. the 48 h time cut - off is also responsible for blaming staffs for almost all infections occurring in the icus and for initiating expensive transmission investigations. therefore, hand washing is highly recommended by influential authorities, as the most important measure to control the exaggerated nosocomial problem due to an overestimated level of transmission. our results show that more than 60% of all picu infections are primary endogenous, i.e., due to micro - organisms not related to the icu ecology, and develop during the first week of icu stay. hand washing can not be expected to control primary endogenous infections because it fails to clear oropharyngeal and gastrointestinal carriage of ppms present on arrival. being inherently active solely on transmission, hand hygiene can not reduce the major infection problem of primary endogenous infection, as transmission is not involved in this type of infection. strictly identifying and evaluating the primary endogenous, and the nosocomial problem of secondary endogenous and exogenous infections, the surveillance of both infection and carriage allows the intensivist to start with the appropriate prevention measures, protective isolation or the selective decontamination of the digestive tract. based on the cdc definition of nosocomial infection, 70.5% (31 out of 44 patients) had nosocmial infection, and based on the carrier state criterion 38.6% (17 out of 44 patients) had the infection. given that the incidence of nosocomial infections is one of the factors affecting the quality of care for critically ill patients, the precise classification of the infection is crucial. we believe that icu patients may benefit from an infection control program that includes surveillance of both carriage and infection	background : the rate of nosocomial infection appears to depend on whether it is calculated using the center for disease control (cdc) or carrier state criteria. the objective of this study was to differentiate between primary endogenous (pe), secondary endogenous (se) and exogenous (ex) infections, and to compare this classification with cdc criteria for nosocomial infections. methods : children hospitalized for more than 72 h at pediatric intensive care unit during 20042005 were enrolled. children, who had the infection before the admission, and or did not develop an infection within the hospitalization were excluded. surveillance samples were sampled on admission, and then twice a week. diagnostic samples were obtained when infection was suspected based on the clinical condition and laboratory findings. infections were evaluated as pe, se and ex, and their incidences were compared with cdc criteria for nosocomial infections. results : one hundred seventy eight patients were enrolled in the study. forty - four patients (24.7%) develop infection. twenty - seven patients (61.3%) had pe, 10 patients (22.7%) had se, and 7 patients (15.9%) had ex infection. secondary endogenous and ex infections are considered as nosocomial, thus 17 patients (38.6%) had a nosocomial infection. thirty - one patients (70.5%) met cdc criteria for nosocomial infections. seventeen patients (55%) were classified as pe, and 14 patients (45%) as se or ex infections. conclusion : seventy percent of infections (31 out of 44 patients) met the cdc criteria for nosocomial infections, but only 39% of infections (17 out of 44 patients) were classified as nosocomial based on carrier state classification.
vertebral hemangiomas are common benign lesions of the spinal column usually asymptomatic and are discovered incidentally or found during evaluation of neck or back pain.13 they comprise 12% of the benign tumors affecting the general population.47 they are congenital vascular malformations and not true neoplasms. they consist of remnants of embryonic capillaries and veins, but unlike congenital vascular malformations, arteriovenous shunting does not occur in these hemangiomas. rarely they may enlarge and cause pain and neurological deficit because of spinal cord compression, vertebral body or arch expansion, or pathological fracture. plain spine films often suggest the diagnosis of vertebral hemangiomas by the presence of coarse vertical striations ; however, one - third of the vertebral body must be involved for these findings to be evident. computed tomography (ct) scan helps in determining the extent of vertebral involvement and magnetic resonance imaging (mri) provides information regarding the aggressiveness of the disease. treatment options for symptomatic vertebral hemangiomas include transarterial embolization, surgical excision, radiotherapy, and percutaneous injection of alcohol or methyl methacrylate. embolization alone is not quite effective in the treatment of symptomatic hemangiomas causing compression of the neuraxis. nowadays, preoperative embolization followed by surgical excision is the preferred treatment modality in many centers. radiotherapy may be successful in obliterating the hemangiomas, but the effect may be too delayed for patients with cord compression.89 we have analyzed seven cases of vertebral hemangiomas causing significant cord compression and features of myelopathy. the problems of differential diagnosis in such cases, their surgery and postoperative management are discussed in this article. we retrospectively collected the data of patients of symptomatic vertebral hemangiomas with neuraxial compression that were managed from 2006 to 2009 and have a followup at our institute. patients were evaluated for clinical features such as backache, radiculopathy, myelopathy, sensory deficits, and bowel/ bladder involvement. the patient who opted for other treatment modalities such as embolization or percutaneous ablation a total of seven patients were analyzed preoperatively according to frankel grading system [table 1 ] and compared with the postoperative status. frankel grading system postoperatively, x - ray was done in all cases to assess the adequacy of decompression and instrumentation. all patients were assessed in the wards postoperatively and long term followup was obtained in the outpatient departments or on regular correspondence. followup was done regularly at 3 months, 6 months, 12 months, and then yearly. the clinical signs developed insidiously in two patients and rapidly in five patients (35 months). grossly the motor power was mrc grade 0 in three patients and grade 34/5 in the remaining four patients. bowel and bladder involvement in the form of urinary retention and constipation was present in three cases. the paralysis was graded by frankle grade c. all patients were evaluated radiologically with x - rays and mri. the thoracic vertebrae were involved in five and lumbar vertebrae in two of the patients. radiology revealed complete destruction of the vertebral body in all seven cases with destruction of posterior elements in one of them. t1-weighted images revealed isointense changes in the destroyed vertebral bodies in three patients and hyperintense changes in four patients. all were associated with epidural soft tissue changes with extension and compression onto the thecal sac. clinical profile of patients all these cases were treated surgically and we used a retroperitoneal approach in two lumbar lesion and transthoracic approach in five of the cases. excision of the vertebral bodies was done in the seven cases and all had brisk bleeding during surgery. the blood loss ranged from 1.5 to 3 l. the loss was adequately and immediately replaced with blood and fresh frozen plasma. after excision of the vertebral bodies, the dura was seen thoroughly superiorly, inferiorly, and laterally, indicating adequate decompression. these patients underwent instrumentation in the form of caging and stabilization with screws in the vertebral bodies and rod construct. two patients had abnormal bleeding parameters postoperatively, but were corrected with fresh frozen plasma and vitamin k. at average followup of 24 months, their comparison showed significant improvement in their neurological status [table 3 ]. pre and postoperative frankel grading it was found that of the three patients who had a grade a preoperatively, two improved to grade c and one to grade b postoperatively. one patient who had grade b preoperatively improved to grade d. three patients who had grade c preoperatively improved to grade e in two patients and grade d in one patient. four patients had features of intercostal neuralgia, but it gradually resolved over a week following surgery. postoperative radiology taken on the third and twelfth month after surgery showed the stability of implants and grafts and no spinal deformation was noticed. there was no mortality, and in all cases, the biopsy showed features suggestive of hemangioma. vertebral (intraosseous) hemangiomas account for 2.3% of spinal tumours and are benign vascular tumors composed of proliferation of blood vessels. they are classified histologically by the predominant type of vascular channel as capillary, cavernous, arteriovenous, or venous type. they usually have an indolent course, but may cause pathological fractures, hemorrhage, extraosseous extension into the paravertebral space, and rarely, epidural extension. spinal cord or cauda the thoracic region is the most common site for vertebral hemangiomas presenting with features of spinal cord compression.1012 causes of neural compression include : (1) expansion of the involved vertebrae, (2) extension of the tumor into the extradural space, (3) compression fracture, and (4) hemorrhage resulting in extradural hematoma.13 of these, the first two are the most common mechanisms. however, in our series, the mechanism was compression fracture of the vertebrae and extension of the tumor into the epidural space leading to spinal cord compression. since all patients presented with features of vertebral collapse, they underwent investigations to rule out metastatic, tubercular, or osteoporotic etiology, but all were inconclusive. though vertebral hemangiomas have typical x - ray and mri findings, these were lacking in our cases probably because of the soft tissue component predominating in advanced stages of the disease. it is important to realize that by the time compressive collapse occurs, the classical radiology of vertebral hemangioma is quiet difficult to be demonstrated. hence, the differential diagnosis of other epidural compressive lesions such as pott 's spine, metastases, and bony neoplasms must also be borne in mind. they tend to erode the horizontal trabeculae of the vertebral bodies, thus leading to the appearance of accentuated, thickened vertical trabeculae, giving rise to corduroy or jailhouse striation appearance in lateral x - ray or sagittal ct scan.14 in axial ct scans, they give the appearance of a polka - dot or spike of bone pattern because the vertical trabeculae are imaged in cross section.15 mri may provide additional information regarding the aggressiveness of the hemangioma. increased fatty signals with mottled appearance on both t1- and t2-weighted images are suggestive of non - evolving intraosseous lesions [figure 1a, b ]. conversely, osseous or extraosseous hemangiomas that are isointense on t1-weighted images are commonly found with symptomatic lesions. laredo concluded that fat - intensity lesions are generally inactive, while hemangiomas demonstrating low or isointense signal on t1-weighted images indicate a hypervascular lesion with the potential to compress the spinal cord.16 this was true in five of our cases where t1-weighted images were isointense [figure 2a, b ]. another interesting feature noted was that all patients who had t1 isointense changes had a short duration of symptoms. this indicates that t1 isointensity to a certain extent helps in predicting the aggressive potential of the lesion. (a) sagittal t2wi showing l1 collapse with hyperintensity changes within the vertebral body and compression on the thecal sac. (b) sagittal t2wi showing hyperintensity changes with extradural soft tissue component causing thecal sac compression at l1 level (a and b) sagittal images with t1 isointensity and t2 hyperintensity changes within the l1 vertebral body with significant extradural soft tissue component. this patient had a short duration of symptoms treatment options for symptomatic vertebral hemangiomas include surgery, transarterial embolization, direct ethanol injection, and vertebroplasty ; each with varying degrees of success.1719 surgery is indicated when there is significant or progressive neurological deficit. surgical options include corpectomy or vertebrectomy if there is significant vertebral body involvement with epidural extension causing spinal cord compression. patients undergoing corpectomy are subjected to instrumentation to provide spinal stability.6720 in our series, patients underwent caging and pedicle screw instrumentation in six patients and only pedicle screw fixation in one of them [figure 3a, b ]. surgery was encountered with significant bleeding ranging from 1.5 to 2.5 l in all these patients. but with timely replacement of the lost blood volume, surgery could be continued and adequate excision achieved. all patients were replaced adequately and timely with fresh frozen plasma, blood, and colloids. patients were regularly followed up for a period of 2 years with periodic radiological investigations. postoperative radiology revealed the screws well in place with adequate canal decompression [figure 4a, b ]. anteroposterior and lateral postoperative x - rays (a and b) showing adequate excision of the vertebral bodies and instrumentation intraoperative images showing (a) the gutter created after adequate excision of the vertebral bodies. (b) cage filled with autograft placed in the gutter created after excision of the vertebral hemangioma endovascular embolization has also been used by some as a sole therapy for vertebral hemangiomas.21 hekser. were the first to report reversal of spinal cord compression following percutaneous embolization of feeding vessels.22 however, this may not be helpful in the setting of acute spinal cord compression and neurological deterioration. embolization followed by surgery is another option that is highly propagated in the present era. however, there are reports where preoperative embolization failed to reduce the intraoperative blood loss. this is due to the fact that though transarterial embolization may occlude the feeding vessels, it may fail to destroy the hemangioma due to an intervening capillary bed that separates the hemangioma from the arterial feeders. reflux of the embolization material into the lumbar and intercostal arteries may occur and this may lead to spinal cord infarction with severe pain and paresis.23 in case of recurrent or residual disease, a second attempt is not possible because feeding arteries have already been occluded. at our institute, we attempted preoperative embolization in two patients, but could not succeed because the vertebral bodies were collapsed and converted into a solid mass. considering the impact of neuraxial compression, we felt it unwise to subject the patient to multiple treatment modalities, and hence direct surgery was adopted in all our patients. radiation therapy is also an effective mode of treatment, especially in lesions associated with pain. vertebral hemangiomas are radiosensitive tumors and reports have shown symptomatic improvement following radiotherapy.24 however, the effects of radiotherapy are delayed and radionecrosis of the spinal cord and vertebral bodies still remains a risk. percutaneous ablation with ethanol or methyl methacrylate constitutes some of the newer options in the treatment of vertebral hemangiomas. this leads to devascularization of the hemangioma, and thereby reduces its size alleviating the cord compression. however, for its success, it is necessary that the ethanol is injected into the vascular spaces of the hemangioma. this is critical in elderly patients as bone is quiet fibrotic and the vascular component of the hemangioma may be small. moreover, the technique seems to be cumbersome as the needle has to be localized with the help of prior and intraoperative angiography. goyal. in their study of 14 patients suffering from symptomatic vertebral hemangiomas reported neurological deterioration in three patients.25 one developed infection due to extravasation of contrast material into paraspinal tissues, another a recurrence at 1 month followup, and the third patient developed vertebral fracture 5 months following the procedure. niemeyer. have reported a case of brown sequard syndrome following alcohol ablation.26 alcohol ablation deals with the vertebral hemangioma per se, but does not restore the strength of the vertebral body that has been fractured. injection of methyl methacrylate is usually performed under fluoroscopic guidance and is indicated for stabilizing vertebral bodies at risk for collapse or to reduce pain. however, when a patient is paraparetic, methyl methacrylate may extend into the spinal canal and exacerbate spinal cord compression that is already present. in such cases, however, surgery with adequate blood replacement can be done in some cases. in others, though the treatment modalities are many and have their own pros and cons, to use them singly or in combination is a difficult decision to be taken by the treating surgeons.	background : hemangiomas are benign vascular tumors associated with proliferation of blood vessels in bone or soft tissue and they are usually incidental findings in vertebrae. when symptomatic, they present with features of radiculopathy, myelopathy, or vertebral fractures. treatment options are varied, include sole embolization, embolization combined with surgical excision, surgical excision alone, percutaneous ablation, and radiotherapy. we hereby describe a series of seven cases of symptomatic vertebral hemangiomas operated from 2006 to 2009.materials and methods : their clinical and radiological profile and outcome have been described. all patients were subjected to surgical excision followed by instrumentation. outcome was assessed at a followup of 2 years following surgery with frankel grading system.results:seven patients (five females and two males) were included in the study. the mean age was 33.85 years with the mean duration of symptoms of 12 months. all seven cases were symptomatic vertebral hemangiomas with cord compression and underwent surgical excision. preoperatively, patients with poor frankel grade such as a and b improved postoperatively to c, d, or e.conclusion:surgical excision of these lesions is difficult due to the tremendous amount of intraoperative bleeding. during surgery, brisk bleeding is usually encountered, but can be brought under control with adequate preoperative preparation and expertize. preoperative embolization may help to reduce the bleeding, but at times it may be difficult to do if vertebrae are replaced by a solid hard mass. in spite of the risks associated with surgery, it still is the treatment of choice as a single intervention, especially in aggressive vertebral hemangiomas.
atherosclerosis is the primary cause of cerebrovascular and coronary artery disease through slowly progressive lesion formation and luminal narrowing of arteries. this vascular remodeling leads to thrombotic complications including acute coronary syndrome, myocardial infarction, and stroke. atherosclerosis is well known to be an inflammatory disease, and the underlying pathology is characterized by a persistent inflammatory process of the arterial wall. with increasing prevalence of risk factors such as hypertension, diabetes, and obesity, it is critical to control vascular inflammation in order to decrease mortality and improve public health. to solve this problem, peroxisome proliferator - activated receptor (ppar- belongs to the nuclear receptor family of ligand - activated transcription factors, which also include the steroid and thyroid hormone receptors. ppar- forms heterodimers with the retinoid x receptor (rxr) and activates transcription by binding to a specific dna element known as the ppar response element (ppre). in the absence of ligand, ppar - rxr heterodimers bind a number of corepressors, including nuclear receptor corepressor and the silencing mediator of the retinoid and thyroid hormone receptors, to suppress the target genes. in the presence of selective ligands, ppar- undergoes a conformational change facilitating the dissociation of corepressors and the recruitment of co - activators, leading to transcriptional activation of the target genes [5, 6 ]. to date, a variety of endogenous and synthetic ligands in addition to its co - activators have been detected (table 1). ppar- is known to have four splice isoforms : ppar-1, 2, 3, and 4. ppar-1 and 2 have been identified in mouse, whereas in humans and other species, at least two other isoforms, ppar-3 and 4, have also been detected. ppar-3 and 4 encode the same protein as ppar-1, which is expressed in endothelial cells (ecs), vascular smooth muscle cells (vsmcs), macrophages, and cardiomyocytes. on the other hand, the thiazolidinedione (tzd) class of synthetic ppar- ligands reduces peripheral insulin resistance and has been widely used to treat type 2 diabetes mellitus. for instance, several reports using high - fat diet - induced obese mice demonstrated that ppar- agonists had beneficial effects on improving insulin resistance and inflammation [1013 ]. in addition, recent large clinical studies have demonstrated that a ppar- agonist had beneficial effects not only on glycemic control but also in preventing atherosclerotic disease [1417 ]. the lines of evidence derived from study of ec specific ppar- null mice [1820 ] and from virus - mediated constitutive expression of ppar- in human ecs have also shown important roles of ppar- on atherogenesis. increasing evidence has demonstrated that ppar- plays important roles in the immune system, since ppar- is expressed in inflammatory cells such as macrophages, t cells, b cells, and dendritic cells. these results suggest that ppar- activation is an important regulator in vascular inflammation and is expected to be a therapeutic target in the treatment of atherosclerotic complications (figure 1). the present paper focuses on the role of ppar- in vascular inflammation beyond its beneficial effects on glycemic control and discusses the potential therapeutic roles of regulating ppar- activation. ppar- has been detected in rodent macrophages, and human macrophages in atherosclerotic lesions. differentiated macrophages show two acquired phenotypic characteristics, the classically activated (m1) phenotype and the alternatively activated (m2) phenotype. m1 activation is triggered by stimulation such as by bacterial lipopolysaccharide (lps) and is associated with the production of proinflammatory cytokines including interferon- (ifn-) and interleukin-12 (il-12), which are linked to t helper 1 (th1) immune responses. in contrast to m1, m2 activation is triggered by il-4 and il-13, which are linked to th2 responses. m1 macrophages produce a number of proinflammatory cytokines and express a high level of reactive oxygen species (ros), having antimicrobial activity. on the other hand, m2 macrophages generate anti - inflammatory products and are involved in pathogen sequestration, wound healing, and phagocytosis of apoptotic cells [28, 29 ]. the balance between these two subsets is thought to be important in regulating vascular inflammation. in vitro studies have demonstrated that ppar- agonists attenuated the gene expression and secretion of proinflammatory cytokines associated with m1 macrophages in human monocytes, such as tumor necrosis factor- (tnf-), il-1, and il-6, and reduced the activity of macrophages including the transrepression of nuclear factor kappa b (nf-b). in addition, troglitazone and rosiglitazone, ppar- agonists, inhibited monocyte chemotactic protein 1 (mcp-1)-directed monocyte migration through modulation of matrix metalloproteinase-9 (mmp-9) and tissue inhibitor of matrix metalloproteinase-1 (timp-1) production. these results suggest that ppar- activation may be involved in vascular inflammation through regulating macrophage activation. ppar- has been also reported to be an invaluable transcriptional regulator of monocyte phenotypic differentiation. crosstalk between ppar- and il-4 signaling is thought to be important for m2 macrophage polarization [32, 33 ]. in macrophages, il-4-mediated signaling activates the transcription factor, signal transducers, and activators of transcription 6 (stat6), resulting in upregulation of the expression of ppar-, ppar- coactivator-1 (pcg-1), and arg1. increased pcg-1 enhances stat6 action on these genes and other genes relating to mitochondrial biogenesis, oxidative metabolism, and m2 differentiation. additionally, other recent studies have demonstrated that ppar--deficient macrophages were resistant to m2 polarization and promoted insulin resistance [29, 34 ]. have demonstrated that ppar- ligands induced the differentiation of human monocytes into macrophages and enhanced the transcription of a scavenger receptor for oxidized low - density lipoprotein (oxldl), cd36. in addition, oxidized lipids inside the oxldl particle, including 9-hydroxyoctadecadienoic acid (9-hode) and 13-hode, enhance ppar- activation. thus, ppar- activation in the presence of oxidized lipids could lead to a positive feedback loop to promote foam cell formation [37, 38 ]. on the other hand, in vivo studies revealed that tzd treatment could increase macrophage cd36 expression, but did not enhance foam cell formation, suggesting that ppar- could activate other pathways that enhance cholesterol efflux and reduce intracellular cholesterol level. the enhancement of cholesterol efflux was mediated by the cholesterol - phospholipid transporter abca1, which is an indirect target gene of ppar- via liver x receptor [39, 40 ]. these results suggest that ppar- activation couples oxldl uptake to cholesterol efflux, thus enhancing the removal of oxldl from the vessel wall. ppar- is expressed in t cells, and its expression is increased in activated t cells. it is reported that ppar- activation modulates the expression of proinflammatory th1 cytokines in cd4-positive lymphocytes. for instance, 15-deoxy--prostaglandin j2 (15d - pgj2), an endogenous ppar- ligand, and tzds reduced il-2 secretion from murine t cell clones and inhibited il-2 production and phytohemagglutinin - inducible proliferation in human t cells in a dose - dependent manner. in addition, ppar- activators inhibited the expression of proinflammatory cytokines such as interferon- (ifn-), tnf-, and il-2, leading to attenuation of human monocyte cd64 expression and human endothelial cell major histocompatibility complex class ii induction. in a well - established mouse colitis model, it is reported that tzds attenuated intestinal inflammation, at least in part, due to immune deviation away from th1 and towards th2 cytokine production. th17 cells and a proinflammatory cytokine, il-17, secreted by them have been reported to be involved in the pathogenesis of atherosclerotic disease. recently, klotz. have indicated that ppar- activation can regulate the differentiation and function of th17 cells, a newly identified t cell subset. ppar- activators could suppress the differentiation of th17 cells by inhibiting the upregulation of retinoic acid receptor - related orphan receptor t (rort), the key transcriptional factor of th17 differentiation, in response to th17 cell - promoting cytokines, such as tgf- and il-6. therefore, ppar- activation selectively suppressed th17 cell differentiation, but not the differentiation of th1, th2, or regulatory t cells (treg). pharmacologic activation of ppar- prevented removal of the silencing mediator for retinoid and thyroid hormone receptors corepressor from the rort promoter in t cells, thus interfering with rort transcription. both t cell - specific ppar- knockout and endogenous ligand activation revealed the physiological role of ppar- in continuous t cell intrinsic control of th17 differentiation. cd4+cd25 + tregs also play an important role in the pathogenesis of atherosclerosis and are expected to be a novel therapeutic target to attenuate atherosclerosis and stabilize vulnerable plaques. the ppar- ligand, ciglitazone, enhanced the conversion of effector t cells to tregs in vitro and had an enhancing effect on both natural and inducible tregs. moreover, lei. have demonstrated that ppar- activation with endogenous and synthetic ligands together with transforming growth factor- (tgf-) elicited foxp3 deoxyribonucleic acid (dna) methylation through potent downregulation of dna methyltransferases (dnmts) such as dnmt1, 3a, and 3b, and induced potent and stable foxp3, resulting in the generation of functional inducible tregs. b cells play an important role in atherosclerosis and are thought to have atherogenic and antiatherogenic effects according to their subtype. mature b cells are categorized into three subtypes according to their surface antigens : conventional b2 b cells, b1 b cells, and marginal zone b cells. the conventional b2 b cell plays an important role in adaptive immunity by producing specific antibodies to cognate antigens. the b1 b cell, which is found primarily in serosal cavities such as the peritoneal and pleural cavities, is important in innate immunity and responsible for production of natural igm antibodies. the marginal zone b cell in splenic tissue plays a role in first - line defense against circulating blood - borne antigens. b1 b cells are thought to have a protective effect against atherogenicity [52, 53 ]. on the other hand, it seems that b2 b cells are involved in atherosclerosis, since native conventional b2 b cells can differentiate into two effector b cells, so - called be1 and be2 b cells. be1 b cells produce th1 cytokines including inf-, il-2 and il-12, whereas be2 b cells secrete il-4, il-6 and il-10, which are th2 cytokines. it is reported that these cytokines secreted by be cells enhance immunomodulation during chronic inflammation. however, the detailed role of be1 and be2 b cells in atherosclerosis remains to be elucidated. recently, regulatory b cells that produce il-10 have been recognized as an important component of the immune system [5559 ]. regulatory b cells secrete il-10, and this may lead to suppression of both th1 and th2 polarization and inhibition of proinflammatory cytokine production from macrophages and dc. the role of regulatory b cells in atherosclerosis also remains to be elucidated, but they may attenuate the progression of atherosclerosis. most studies of the effect of ppar- activation on b cells focus on the apoptotic effect of endogenous and synthetic ligands on normal or b lymphoma cells. recent reports demonstrated that detailed roles of ppar- and rxr agonists in ppar- agonist - induced apoptosis of b cells were activation of mitogen - activated protein kinases (mapks), inhibition of nuclear factor - kappa b (nf-b), and cd40 activation [6266 ]. on the other hand, a recent paper by garcia - bates. they demonstrated that activated b cells have upregulated expression of ppar-. in addition, nanomolar levels of ppar- ligands, such as 15d - pgj2 and rosiglitazone, enhanced b cell proliferation and significantly stimulated plasma cell differentiation and antibody production. the simultaneous addition of nanomolar concentrations of the rxr ligand, 9-cis - retinoic acid, and ppar- ligands to cpg - activated b cells resulted in additive effects on b cell proliferation, plasma cell differentiation, and antibody production. this result suggests that ppar- activation may also regulate the function and differentiation of b cells. however, the link between ppar- activation and b cell function in atherosclerosis is still unclear. dc contributes to chronic vascular inflammation, leading to atherosclerosis and its complications [6870 ]. in fact, a number of dc has been observed in atherosclerotic lesions of mouse models [7173 ] and in human advanced plaques [7476 ]. in normal conditions, dc is professional antigen - presenting cell that presents many kinds of endogenous and exogenous antigens to t cells, providing an important link between innate and adaptive immune responses. additionally, many lines of evidence have demonstrated that dc contributes to the pathogenesis and progression of atherosclerosis [6870 ]. dc accumulates in the intima of atherosclerotic lesions through vascular cell adhesion molecule-1 (vcam-1) and cx3c chemokine receptor 1 (cx3cr1) during low - grade chronic inflammation [72, 78 ]. dc may differentiate from ly6 monocytes that cx3cr1-dependently patrol arterial vessels, but can also differentiate from ly6 monocytes, which seem to be preferentially recruited. in intimal proliferation of dc, granulocyte macrophage colony - stimulating factor (gm - csf) is thought to be important [79, 80 ]. excess lipoproteins deposited in the arterial wall accumulate within lipid - loaded cd11c dc, contributing to early - stage plaque formation. dc also regulates t cell activation in the vessel wall and influence helper t cell responses, with lipoprotein being able to contribute to dc maturation and activation. for instance, conventional dc (cdc) can participate in interaction with t and natural killer t cells, which results in increased production of ifn-, il-17, and tnf- from t cells. activation of cd36 and toll - like receptors (tlrs) in cd11b+cd11c+ dc and cdc by lipids results in increased secretion of various dc - derived cytokines, such as il-6, il-12, and tnf-. plasmacytoid dc (pdc) has been shown to produce amounts of type i ifns (ifn- and), which play a proatherogenic role. ppar- is expressed in murine and human dc, and ppar- activation has been shown to be involved in dc function [8390 ]. ppar- ligands inhibited the production of il-12 and several cytokines such as chemokine (c - x - c motif) ligand 1 (cxcl1) and chemokine (c - c motif) ligand 5 (ccl5) [85, 86 ]. moreover, ppar- inhibited the maturation of dc and attenuated the expression of cd1a, cd40, cd80, cd83, and chemokine (c - c motif) receptor 7 (ccr7) [85, 88, 90 ]. these results indicate that ppar- activation by synthetic ligands reduced the ability of dc to stimulate lymphocyte proliferation and to prime antigen - specific t cell responses. neutrophils, as well as macrophages, lymphocytes, and dc, also play crucial roles in atherogenesis [91, 92 ]. neutrophils and their mediators have been detected in mouse and human atherosclerotic lesions [9395 ]. an increased number of circulating neutrophils are also observed in pathological conditions such as hyperlipidemia. neutrophils are recruited into atherosclerotic lesions via specific chemokine receptors, including ccr1, 2, 5, and cxcr2. oxldl may induce the transmigration of neutrophils and release of ros and granule proteins from neutrophils, which trigger monocyte recruitment and extravasation directly or indirectly through upregulation of adhesion molecules on endothelial cells. in addition, apoptotic neutrophils sustain monocyte recruitment via various find - me and eat - me signals. several lines of evidence have demonstrated the presence of ppar- in neutrophils, and have shown a suppressive effect of ppar- activation by endogenous and synthetic ligands on neutrophil infiltration in various animal models of inflammation [98103 ]. a recent study by napimoga. reported that administration of 15d - pgj2, an endogenous ppar- ligand, decreased leukocyte rolling and adhesion to inflamed mesenteric tissue by a mechanism dependent on no. specifically, pharmacological inhibitors of no synthase (nos) abrogated the 15d - pgj2-mediated suppression of neutrophil migration to the inflammatory site. moreover, inducible nos mice were not susceptible to 15d - pgj2-mediated suppression of neutrophil migration to inflammatory sites compared with their wild type. in addition, 15d - pgj2-mediated suppression of neutrophil migration appeared to be independent of the production of cytokines and chemokines, since their production was not significantly affected in the carrageenan - injected peritoneal cavity. these findings demonstrated that 15d - pgj2 suppresses inflammation - initiated neutrophil migration in a mechanism dependent on no production in mesenteric tissue. however, the detailed role of neutrophil regulation by ppar- ligands in atherosclerosis remains to be elucidated and further studies are needed. as described above, ppar- activation is expected as a therapeutic target for improving cardiovascular risk factors. however, its safety is controversial in clinical use, since several reports pointed out an increase in risk of ischemic cardiovascular events with ppar- agonists. meta - analysis of randomized controlled trials has suggested that rosiglitazone, one of tzd, increased risk of ischemic cardiovascular events [105, 106 ]. in contrast, meta - analysis of clinical trials of another tzd, pioglitazone has also reported the possibility of an ischemic cardiovascular benefit by pioglitazone ; however, both tzds are reported to increase the risk of congestive heart failure. recently, meta - analysis of observational studies that directly compared the risk of cardiovascular outcomes for rosiglitazone and pioglitazone among patients with t2 dm has demonstrated that the use of rosiglitazone was associated with significantly higher odds of congestive heart failure, myocardial infarction, and death compared with that of pioglitazone. however, whether any meaningful difference exists in the magnitude of risk between two tzds is still unclear. the european medicines agency has recommended the suspension of marketing authorization for rosiglitazone, whereas the us food and drug administration has allowed the continued marketing of rosiglitazone with additional restrictions. further studies are required to understand these contradictory effects of ppar- agonists in the future. vascular inflammation - induced atherosclerosis is one of the most worrying common problems throughout the world. as described above, ppar- has a wide range of roles in the pathogenesis and progression of atherosclerosis via regulation of inflammatory cells, including monocytes / macrophages, lymphocytes, dendritic cells, and neutrophils. although regulation of ppar- activity may not alter the underlying cause of the disease, it may regulate pathological conditions, resulting in clinical benefit. several recent experimental and clinical findings have supported the potential utility of regulating ppar- activity as a therapeutic approach for atherosclerosis. further accumulation of experimental and clinical evidence on the relationship between ppar- and vascular inflammation may contribute to solving this problem.	vascular inflammation plays a crucial role in atherosclerosis, and its regulation is important to prevent cerebrovascular and coronary artery disease. the inflammatory process in atherogenesis involves a variety of immune cells including monocytes / macrophages, lymphocytes, dendritic cells, and neutrophils, which all express peroxisome proliferator - activated receptor- (ppar-). ppar- is a nuclear receptor and transcription factor in the steroid superfamily and is known to be a key regulator of adipocyte differentiation. increasing evidence from mainly experimental studies has demonstrated that ppar- activation by endogenous and synthetic ligands is involved in lipid metabolism and anti - inflammatory activity. in addition, recent clinical studies have shown a beneficial effect of thiazolidinediones, synthetic ppar- ligands, on cardiovascular disease beyond glycemic control. these results suggest that ppar- activation is an important regulator in vascular inflammation and is expected to be a therapeutic target in the treatment of atherosclerotic complications. this paper reviews the recent findings of ppar- involvement in vascular inflammation and the therapeutic potential of regulating the immune system in atherosclerosis.
first described by codman in 1931, chondroblastoma is a rare benign tumor that accounts for 1% of all primary bone neoplasms.1 2 3 these lesions typically originate from chondroblasts within the epiphyses of long bones, and are most common in the proximal humerus, distal femur, or proximal tibia.4 chondroblastoma usually presents in the second decade of life, with a 2:1 male predominance, and causes localized swelling and pain that is managed with surgical resection and reconstruction.5 6 chondroblastoma of the craniofacial skeleton is particularly rare, most frequently occurring within the squamous portion of the temporal bone.5 7 8 to date, only 20 extratemporal chondroblastoma of the craniofacial skeleton have been reported, typically presenting in the third decade of life with local mass effect and possible cranial neuropathy. we report the first case of chondroblastoma of the clivus causing diplopia that was resected via an endoscopic endonasal approach. a 27-year - old woman with an 18-month history of headache and intermittent diplopia presented to the hospital with a 48-hour history of severe headache, persistent diplopia, and left facial dysesthesias. physical examination revealed hypesthesia in the left maxillary nerve dermatome, and complete left abducens nerve palsy with esotropia. a computed tomography (ct) scan of the head demonstrated an expansile intraosseous mass of the upper clivus, measuring 28 20 19 mm (fig. 1a). the mass was relatively well circumscribed, contained multiple scattered foci of punctate calcifications, and resulted in erosion of the posterior cortex of the clivus and of the medial cortex of the carotid canal. it caused effacement of the prepontine cistern and mild narrowing of the internal carotid artery (ica) as demonstrated by ct angiogram (fig. preoperative cta demonstrating calcified expansile lesion of the upper clivus and posterior sella turcica, with compression of the left cavernous sinus (panel a) and erosion of the carotid canal along its vertical clival segment (panel b). preoperative coronal (panel c) and sagittal (panel d) gadolinium - enhanced mri demonstrating a homogenously enhancing expansile lesion of the middle and upper clivus with anteriosuperior deviation of the pituitary gland and compression of the left cavernous sinus. immediate postoperative mri scans demonstrates gross - total resection of tumor (panel e), with decompression of the pituitary gland and stalk (panel f). cta, computed tomography angiography ; mri, magnetic resonance imaging. on magnetic resonance imaging (mri), the mass was isointense to gray matter on t1-weighted sequences, markedly hypointense on t2-weighted sequences, and diffusely but mildly enhancing after gadolinium administration (fig. the mass extended laterally to the medial wall of the left cavernous sinus resulting in mild mass effect on the cavernous segment of the left ica. it also eroded the floor of the sella turcica and extended into the sella and suprasellar cistern causing superoanterior deviation of the pituitary gland but no mass effect on the optic chiasm. there was mild effacement of the prepontine cistern, with encroachment on the basilar artery and with no clear involvement of the dorello canal. a direct endoscopic endonasal approach was used to perform a right middle turbinectomy, nasoseptal flap elevation, posterior septectomy, posterior ethmoidectomy, and wide sphenoidotomy. intraoperative doppler ultrasound and surgical navigation were also used to identify the location of the paraclival / vertical segment of each ica before beginning the resection. a high - speed drill and rongeurs were used to remove the anterior face and floor of the sella turcica, as well as the anterior clivus overlying the lesion. tumor tissue was encountered within the clivus bone, which was resected in a piecemeal fashion. tumor was found to extend through the posterior margin of the clivus, abutting but not transgressing the dura, which appeared grossly normal (fig. lateral extension of the tumor behind the left paraclival ica was removed using suction and angled ring curettes. inferior extension into the clivus was drilled out, and superior extension through the floor of the sella turcica and behind the pituitary fossa dura was resected using suction and angled ring curettes. along the posterior floor of the sella, at the junction with the prepontine dura at the clival recess, there was a small dural defect overlying the gland where tumor had invaded some of the dura but had not extended into the pituitary gland this was completely resected without complication and no visible cerebrospinal fluid (csf) leak was present. endoscopic view of the sphenoid sinus after resection of the clivus mass (panel a). the tumor occupied the middle and upper clivus, with anterior extension to, but not into, the prepontine dura (panel b). after completing the tumor resection, we elected to place the nasoseptal flap over the repair given the wide area of mucosal resection required for tumor access and to mitigate the risk of delayed csf leak from the small dural defect noted above. the patient was extubated in the operating room and transferred to the intensive care unit for postoperative care. the patient 's immediate postoperative course was uncomplicated, with mild improvement in her left lateral gaze palsy. immediate postoperative mri scan confirmed complete removal of the tumor, with preservation of the pituitary gland and prepontine dura (fig. after 3 weeks of surgery, the patient continued to experience moderate sixth nerve palsy that was managed with prism lenses in her eyeglasses. adjuvant therapy was not employed since a complete excision was achieved. grossly, the lesion was red - tan with areas of granular calcifications. microscopically, the tumor was composed of uniform round to polygonal cells with well - defined cytoplasmic borders, round to ovoid nuclei, predominantly growing in cellular sheets (fig. (panel a) chondroblastoma composed of sheets of mostly uniform appearing chondroblasts and scattered osteoclast - type giant cells, h&e, 200 magnification ; (panel b) h&e, 400 magnification ; (panel c) pericellular chicken wire calcifications, h&e, 400 magnification ; (panel d) proliferative ki-67 activity, 400 magnification. tumor cells were focally positive for s-100 and proliferative activity was estimated to be 5 to 10% (fig. a 27-year - old woman with an 18-month history of headache and intermittent diplopia presented to the hospital with a 48-hour history of severe headache, persistent diplopia, and left facial dysesthesias. physical examination revealed hypesthesia in the left maxillary nerve dermatome, and complete left abducens nerve palsy with esotropia. a computed tomography (ct) scan of the head demonstrated an expansile intraosseous mass of the upper clivus, measuring 28 20 19 mm (fig. 1a). the mass was relatively well circumscribed, contained multiple scattered foci of punctate calcifications, and resulted in erosion of the posterior cortex of the clivus and of the medial cortex of the carotid canal. it caused effacement of the prepontine cistern and mild narrowing of the internal carotid artery (ica) as demonstrated by ct angiogram (fig. preoperative cta demonstrating calcified expansile lesion of the upper clivus and posterior sella turcica, with compression of the left cavernous sinus (panel a) and erosion of the carotid canal along its vertical clival segment (panel b). preoperative coronal (panel c) and sagittal (panel d) gadolinium - enhanced mri demonstrating a homogenously enhancing expansile lesion of the middle and upper clivus with anteriosuperior deviation of the pituitary gland and compression of the left cavernous sinus. immediate postoperative mri scans demonstrates gross - total resection of tumor (panel e), with decompression of the pituitary gland and stalk (panel f). cta, computed tomography angiography ; mri, magnetic resonance imaging. on magnetic resonance imaging (mri), the mass was isointense to gray matter on t1-weighted sequences, markedly hypointense on t2-weighted sequences, and diffusely but mildly enhancing after gadolinium administration (fig. the mass extended laterally to the medial wall of the left cavernous sinus resulting in mild mass effect on the cavernous segment of the left ica. it also eroded the floor of the sella turcica and extended into the sella and suprasellar cistern causing superoanterior deviation of the pituitary gland but no mass effect on the optic chiasm. there was mild effacement of the prepontine cistern, with encroachment on the basilar artery and with no clear involvement of the dorello canal. a direct endoscopic endonasal approach was used to perform a right middle turbinectomy, nasoseptal flap elevation, posterior septectomy, posterior ethmoidectomy, and wide sphenoidotomy. intraoperative doppler ultrasound and surgical navigation were also used to identify the location of the paraclival / vertical segment of each ica before beginning the resection. a high - speed drill and rongeurs were used to remove the anterior face and floor of the sella turcica, as well as the anterior clivus overlying the lesion. tumor tissue was encountered within the clivus bone, which was resected in a piecemeal fashion. tumor was found to extend through the posterior margin of the clivus, abutting but not transgressing the dura, which appeared grossly normal (fig. lateral extension of the tumor behind the left paraclival ica was removed using suction and angled ring curettes. inferior extension into the clivus was drilled out, and superior extension through the floor of the sella turcica and behind the pituitary fossa dura was resected using suction and angled ring curettes. along the posterior floor of the sella, at the junction with the prepontine dura at the clival recess, there was a small dural defect overlying the gland where tumor had invaded some of the dura but had not extended into the pituitary gland this was completely resected without complication and no visible cerebrospinal fluid (csf) leak was present. endoscopic view of the sphenoid sinus after resection of the clivus mass (panel a). the tumor occupied the middle and upper clivus, with anterior extension to, but not into, the prepontine dura (panel b). after completing the tumor resection, we elected to place the nasoseptal flap over the repair given the wide area of mucosal resection required for tumor access and to mitigate the risk of delayed csf leak from the small dural defect noted above. the patient was extubated in the operating room and transferred to the intensive care unit for postoperative care. the patient 's immediate postoperative course was uncomplicated, with mild improvement in her left lateral gaze palsy. immediate postoperative mri scan confirmed complete removal of the tumor, with preservation of the pituitary gland and prepontine dura (fig. after 3 weeks of surgery, the patient continued to experience moderate sixth nerve palsy that was managed with prism lenses in her eyeglasses. microscopically, the tumor was composed of uniform round to polygonal cells with well - defined cytoplasmic borders, round to ovoid nuclei, predominantly growing in cellular sheets (fig. (panel a) chondroblastoma composed of sheets of mostly uniform appearing chondroblasts and scattered osteoclast - type giant cells, h&e, 200 magnification ; (panel b) h&e, 400 magnification ; (panel c) pericellular chicken wire calcifications, h&e, 400 magnification ; (panel d) proliferative ki-67 activity, 400 magnification. tumor cells were focally positive for s-100 and proliferative activity was estimated to be 5 to 10% (fig. chondroblastoma occurring outside of the epiphyses of long bones is rare, with lesions of the craniofacial skeleton accounting for 6.6 to 7.1% of all cases.1 2 9 the mean age of presentation is 39.4 years, significantly older than patients with long bone disease.5 10 11 signs and symptoms of craniofacial chondroblastoma vary based on anatomic location, often resulting from mass effect on adjacent structures. for example, lesions of the temporal bone often present with hearing loss (49%), cranial neuropathy (43.3%), facial swelling (22.2%), and/or otalgia (19.8%).8 12 13 14 15 16 17 18 since the abducens nerve is particularly prone to compression at the clivus where it enters the dorello canal,19 chondroblastoma in this region can result in diplopia with lateral rectus palsy and headache. the squamous portion of temporal bone is the most common site of craniofacial chondroblastoma, likely due to its cartilaginous origin.10 17 18 reid identified 81 total reported temporal bone cases since 1950.12 only 24 extratemporal craniofacial lesions have been reported previously, including chondroblastoma in the region of the temporomandibular joint (n = 13), the nasal cavity and paranasal sinuses (n = 5), skull base (n = 1), skull vault (n = 4), and nasion (n = 1, see table 1).1 6 9 20 21 22 23 24 25 26 27 28 29 30 31 32 abbreviations : ica, internal carotid artery ; ned, no evidence of disease ; nr, not reported ; tmj, temporomandibular joint. in 1978, harner postulated that chondroblastoma results from a transition incident during cartilaginous or endochondral bone formation.33 in 1992, varvares further theorized that chondroblastomas arise from normal chondrocytes that transform in response to an alteration in the local environment.34 for example, such an initiating event can occur when normal mesenchymal or cartilaginous tissue is trapped within the petrosquamous suture line during temporal bone development.35 36 the petrosquamous suture delineates the embryologically distinct squamous and petrous portions of the temporal bone, making this theory plausible.35 expanding on the above theory, it is possible that chondroblastoma of the clivus originates from the cartilaginous union of the sphenoid body and basilar part of the occipital bone, or from cells trapped within the sphenooccipital synchondrosis.37 the three hallmark histopathological features of chondroblastoma are mononuclear cells (chondroblasts), osteoclastic - like giant cells, and a chondromyxoid stroma surrounding neoplastic cells.12 38 39 in general, chondroblastomas display low proliferative activity.18 40 high mitotic activity, however, has been described by ishikawa in an aggressively growing temporal bone chondroblastoma with a high mib-1 index.40 chondroblastoma must be differentiated from other giant cell tumors. the osteoclastic - like giant cells seen in chondroblastomas can have striking histological similarities to giant cell reparative granulomas, aneurysmal bone cysts, giant cell tumors, and chondromyxoid fibromas. positive staining for s-100 is most commonly used to help differentiate from other giant cell tumors, since this protein is expressed on human chondrocytes and related to chondroid tissue formation.22 41 radiographically, chondroblastoma of the long bone presents as a well - demarcated, round - to - ovoid lytic lesion, occasionally containing calcific foci (range, 3050%).2 22 42 in the temporal bone, these lesions can be solid or cystic, with an osteolytic appearance and areas of punctate calcifications (as was present in the case we present).5 8 10 11 13 16 43 mri findings are more variable lesions are often low - to - intermediate intensity on t1-weighted sequences and low - to - high intensity on t2-weighted mri5 10 and demonstrate contrast enhancement, which can be peripheral, homogeneous, or heterogeneous.10 40 44 the clival lesion we present appeared intermediate intensity on t1-weighted and low intensity on t2-weighted sequences, consistent with endochondral bone formation and cartilaginous tumor matrix rather than chronic blood products.5 the differential diagnosis for an expansile clival mass, such as in our patient, includes chondrosarcoma, chordoma, plasmacytoma, and much less likely chondromyxoid fibroma. chondrosarcoma, the most frequent clival chondroid mass, can not be reliably differentiated by imaging from chondroblastoma and chondromyxoid fibroma. since chondroblastoma is a benign locally aggressive tumor, complete excision is the mainstay of treatment.12 41 45 46 simple curettage is not adequate, as it has been associated with a recurrence rate of 55%.2 47 kurokawa and moon found no evidence of recurrence 5 and 9 years after following complete en bloc resection of temporal bone chondroblastoma.46 47 however, some authors have reported recurrence rates approaching 20%, even after complete tumor removal.4 10 17 therefore, surveillance imaging following surgical resection is prudent for early diagnosis of tumor recurrence. malignant degeneration to chondrosarcoma is likely rare but has been previously reported,11 and some authors have suggested that lesions with an intratumoral aneurysmal bone cyst may behave more aggressively.8 radiation therapy is a treatment option for poor surgical candidates, or patients with recurrent or unresectable disease.11 41 radiation is not recommended after complete excision, due to the possibility of radiation - induced chondrosarcoma.41 metastatic workup is not recommended since metastatic craniofacial chondroblastoma has never been reported (in contrast, pelvic chondroblastoma may spread to the abdomen and lung).12 48 at present, there is no role for chemotherapy in the management of chondroblastomas.11 since chondroblastoma is a benign locally aggressive tumor, complete excision is the mainstay of treatment.12 41 45 46 simple curettage is not adequate, as it has been associated with a recurrence rate of 55%.2 47 kurokawa and moon found no evidence of recurrence 5 and 9 years after following complete en bloc resection of temporal bone chondroblastoma.46 47 however, some authors have reported recurrence rates approaching 20%, even after complete tumor removal.4 10 17 therefore, surveillance imaging following surgical resection is prudent for early diagnosis of tumor recurrence. malignant degeneration to chondrosarcoma is likely rare but has been previously reported,11 and some authors have suggested that lesions with an intratumoral aneurysmal bone cyst may behave more aggressively.8 radiation therapy is a treatment option for poor surgical candidates, or patients with recurrent or unresectable disease.11 41 radiation is not recommended after complete excision, due to the possibility of radiation - induced chondrosarcoma.41 metastatic workup is not recommended since metastatic craniofacial chondroblastoma has never been reported (in contrast, pelvic chondroblastoma may spread to the abdomen and lung).12 48 at present, there is no role for chemotherapy in the management of chondroblastomas.11	background and importance chondroblastoma is a benign primary bone tumor that typically develops in the epiphyses of long bones. chondroblastoma of the craniofacial skeleton is extremely rare, with most cases occurring in the squamosal portion of the temporal bone. in this report, we describe the first case of chondroblastoma of the clivus presenting with cranial neuropathy that was treated with endoscopic endonasal resection. we review the literature on craniofacial chondroblastomas with particular emphasis on extratemporal lesions. case presentation a 27-year - old woman presented with severe headache, left facial dysesthesias, and diplopia. physical examination revealed hypesthesia in the left maxillary nerve dermatome, and complete left abducens nerve palsy. imaging demonstrated an expansile intraosseous mass originating in the upper clivus with extension superiorly into the sella turcica and laterally to involve the medial wall of the left cavernous sinus. the tumor was completely resected via an endoscopic endonasal approach, with postoperative improvement in lateral gaze palsy. histopathology was consistent with chondroblastoma. conclusion chondroblastoma is a rare tumor of the craniofacial skeleton that should be included in the differential diagnosis of an osteolytic lesion of the clivus. complete surgical resection remains the mainstay of treatment.
infrequently clostridial species may be the cause of intrahepatic air, and this is seen most commonly in diabetic patients. even rarer, however, is the finding of gas within the hepatic veins (non - portal) due to rupture of hepatic abscesses. the clostridial species, specifically c. perfringens, is responsible for many of the various histotoxic syndromes seen in patients with sepsis and infection. fulminant infections such as gas gangrene, food poisoning, and enteritis necroticans are caused by the production and release of volatile fatty acids, hydrogen, and nitrogen gas from the clostridium organism. in addition to c. perfringens, c. septicum is the organism responsible for non - traumatic, spontaneous gas gangrene which is most often found in the colon. the clostridial species has been implicated in studies involving hepatic venous air. additionally, non - portal, hepatic venous air has been reported in patients with bowel ischemia, emphysematous pyelonephritis, manipulation of tunneled femoral catheters, and liver lacerations secondary to blunt abdominal trauma. a 69-year - old man with gastroesophageal reflux disease and diverticulosis presented to our emergency department hemodynamically stable with a two - day history of generalized weakness, chills, epigastric pain, and a fever of 103.3f (39.6c), one week after undergoing a routine colonoscopy. on physical examination, a moderately distended abdomen with mildly tender hepatomegaly was noted. relevant laboratory investigation revealed a leukocytosis (16,400/l) with 21% bands, elevated liver function tests [total bilirubin 2.2 mg / dl (0.1 - 1.2 mg / dl), aspartate transaminase 124 iu / l) and serum lipase 283 u / l (7 - 60 u / l) ]. an ultrasound of the abdomen showed areas of increased echogenicity with lobular contours (3.4 cm in diameter) in the posterior sector of the right lobe of the liver. a contrast - enhanced computed tomography (ct) revealed multiple hepatic abscesses as well as air within the hepatic venous system (fig. 1) and the right ventricle (fig. the patient became hemodynamically unstable and did not respond to aggressive resuscitative efforts, including high - flow oxygen therapy. thereafter, his general condition rapidly worsened, and despite all measures, the patient expired. blood cultures subsequently grew c. perfringens within 24 h. an autopsy was denied by the family. gas within the hepatic venous system was initially reported on an ultrasound examination in 1989. the case involved a patient with a diagnosis of emphysematous pyelonephritis. since then, rare anecdotal cases have been published and each of these reports has postulated theories relating to the mechanism by which gas enters the hepatic venous system. the first such theory was described by james. and involved a patient suffering from emphysematous pyelonephritis. the authors contend that hepatic venous air was a transient phenomenon in which gas entered the inferior vena cava via the renal vein and subsequently entered the hepatic vein. chen. described a patient with a similar condition and proposed that hepatic venous gas developed from fermentation of glucose. the authors reasoned that the formation and diffusion of gas into the vasculature required four major factors, which included : (1) the presence of gas - forming bacteria, (2) a high tissue glucose level, (3) impaired tissue perfusion, and (4) a defective immune response. as a result of anaerobic glucose metabolism, hydrogen and carbon dioxide gases are produced as byproducts and can enter the hepatic venous circulation. poor tissue perfusion contributes to the accumulation of these gases within the tissue with eventual diffusion into the bloodstream. brown. reported a case of hepatic venous gas in a patient suffering from blunt abdominal trauma. they postulated that the sudden increase in intraabdominal pressure, caused by the impact, forced intraabdominal air into the bowel wall. the gas was then absorbed into the portal circulation and passed into the hepatic veins via sinusoids. finally, marin. described a case of direct entry of air from the inferior vena cava via the femoral vein that occurred during manipulation of a tunneled femoral catheter. other potential explanations for gas entry into the hepatic veins include the dilatation and engorgement of the vasculature seen in right - sided heart failure or a portal vein - to - hepatic vein fistula. in our patient, we believe that gas - producing anaerobic bacteria most likely gained access to the liver from a colonic diverticular microperforation via the portal circulation. following seeding of the liver, production of toxins by the clostridial species resulted in the formation of intrahepatic abscesses with rupture into an adjacent hepatic vein and ultimately a right ventricular pneumocardia. unfortunately, the highly aggressive nature of the offending microorganism caused overwhelming bacteremia and the patient developed septic shock. following these developments, as discussed above, gas within the non - portal hepatic venous system may arise due to several etiologies. although in most cases the condition has been reported as an incidental radiological finding, it is usually an indication of a serious underlying condition that is its cause. hence, immediate identification of the underlying etiology is essential and the treatment should be directed towards it [1, 6 ]. a ct scan of the abdomen and pelvis as well as a thorough workup did not reveal a mechanical cause for this case and thus it is not possible to identify the origin of the organisms causing the hepatic abscesses. a focused assessment along with immediate administration of empiric antibiotics following presentation to the emergency department may avert progression of this condition as the presence of gas in the hepatic vein is of paramount importance should it be related directly to an infectious etiology, and as delay in treatment may permit further bacterial dissemination.	gas - filled abscesses and gas gangrenes are extremely rare causes of intrahepatic gas. even rarer, however, is the occurrence of gas within the non - portal hepatic veins. most often seen in diabetic patients, dissemination and hepatic seeding of bacteria has been linked to procedures such as femoral catheters as well as liver lacerations and pyelonephritis. we report the case of a 69-year - old relatively healthy male who presented to our emergency department with abdominal pain and a fever of 103.3f (39.6c). a contrast - enhanced computed tomography scan of the abdomen revealed multiple hepatic abscesses and gas within the hepatic venous system as well as pneumocardia. in conclusion, gas within the non - portal hepatic veins is usually an indication of a serious underlying condition and its immediate identification is essential for treatment as hematogenous dissemination has already begun.
vascular dementia (vd) is the third most common cause of dementia (8 to 10%), following alzheimer 's disease (ad) (60 to 70%) and dementia with lewy bodies (dlb) (10 to 25%), but these numbers vary considerably according to the different criteria used for vad 1,2. subcortical ischemic vascular dementia (sivd) is an important subtype of them caused by the cerebral vessels factors (ischemia, hypoxia, etc.) which lead to brain tissue damage. it is characterized by lacunar infarcts and deep white matter changes and affects the inner parts of the brain consisting of deep white matter made up of nerve cell fibers. the term the syndromes consist of loss of memory, judgment, reasoning, and changes in mood, behavior and communication abilities 3. the proportion of vascular dementia (vad) attributed to sivd ranges from 36 to 50%, with higher rates in african americans and asian americans 4 than whites 5,6. for ad patients, brain 's anatomical structures have been analyzed using the vbm (voxel - based morphometry) technique recently, demonstrating that the gray matter volume of the hippocampus, parahippocampal gyrus, insula, superior / middle temporal gyrus, thalamus, cingulate gyrus, and superior / inferior parietal lobule is decreased. volumetric analysis of the entorhinal cortex can even distinguish subjects who were destined to develop dementia from normal controls with high accuracy 7. recently it has been found subcortical vascular dementia (sivd) patients has notable cortical thickness and volume alterations in frontal and tempral cortices, and the conversion from mci associated with small - vessel disease (svmci) to sivd is associated with cortical atrophy in dorsolateral prefrontal and temporal cortices 8 - 9. until now alterations of cortical gray matter density in subjects with cognitive impairment have not been reported. the aim of the present study was to prove the possibility of gray matter density detection using fsl - vbm (http://www.fmrib.ox.ac.uk/fsl/fslvbm) 10 - 11, to characterize the cerebral morphology and atrophy patterns of the cortex, and to provide a new method and biomarker for the diagnosis of sivd. nine sivd patients were recruited by physician referral from the department of neurology in southwest hospital, chongqing, china (table 1). the clinical diagnosis of sivd was made by a senior neurologist according to the criteria suggested by erkinjuntti 12 and dsm - iv (diagnostic and statistical manual of mental disorders, iv). ad patients with subcortical ischemia or mixed dementia who can also meet dsm - iv vad criteria and the patients with large territorial infarction involving cortex or single strategic infarction such as anterior nucleus of thalamus were excluded. all patients have visible white matter hyperintensities (wmh) (grade 3 or more by a reported rating scale 13) addressed with t2/flair imaging data in mri scanning. cognitive performance was evaluated through neuropsychological tasks that included : mini mental state examination (mmse), clinical dementia rating (cdr), neuropsychiatric inventory (npi), activities of daily living scale (adl), hachinski and hamilton test. nine age- and sex - matched old people with normal - cognition were recruited from surrounding regions by advertisement. they underwent a comprehensive brain examination to ensure that they had normal brain structure and no neurological lesions. exclusion criteria included patients with aphasia or who otherwise could not complete psychological testing because of a language disorder ; diagnosed chronic or degenerative disease affecting the central nervous system ; active substance abuse disorders ; intracranial hemorrhage ; difficult to control epilepsy that could present with cognitive impairment ; or temporal lobe epilepsy. all of those subjects who with brain trauma, brain tumor, psychiatric disorders, systemic disease or other mri contraindication such as claustrophobia were excluded from this study. present or past use of medication to treat cognition and infarction was not an exclusion criterion. all subjects provided informed consents and the ethics committee at the third military medical university approved the study protocols. the mri brain scanning was performed on a siemens avanto 1.5 tesla scanner with head matrix coil at the department of radiology in southwest hospital, chongqing, china. during the examination, scanner noise was attenuated with earplugs and head motion was restricted with foam padding (provided by the manufacturer) around the head and the necessity of head immobility was emphasized to each subject. anatomical image datasets were acquired with a standard t1-weighted high - resolution anatomic scan of magnetization - prepared rapid gradient echo (mprage) sequence : tr=1900ms, te=3.37ms, ti=1100ms, flip angle=15, fov=256mm192 mm, nex=1, matrix=256192, 1.001.00 mm in - plane resolution, horizontal slices with slice thickness of 1.3 mm and no gap. the mprage acquisition of each study was ensured the same slice orientation (paralleled to the anterior commissure (ac) and commissural posterior (pc) line). subsequently, t2-weighted (t2wi) images with 36 axial slices, 3 mm thick and 1 mm gap, oriented to ac - pc line were obtained. before further analysis of the 3d brain images the 3d data were copied from the mri scanner and imported to a personal computer running a linux operating system, on which off - line analysis was carried out by anatomical structure image analysis software fsl - vbm. first, by using mri_convert command, dicom files were completely converted to nii.gz format and then these structural images were brain - extracted using bet 14 in order to remove skin and skull. next, tissue - type segmentation was carried out using fast4 15 package, after that gray matter, white matter and csf were produced. the resulting gray - matter partial volume images were then aligned to mni152 standard space using the affine registration tool flirt 16,17, followed optionally by nonlinear registration using fnirt, which uses a b - spline representation of the registration warp field 18. the resulting images were averaged to create a study - specific template in order to reduce the effect of inter - subject brain variability during the registration procedure, to which the native gray matter images were then non - linearly re - registered. the registered partial volume images were modulated (to correct for local expansion or contraction) by dividing using the jacobian of the warp field. the modulated segmented images were then smoothed with an isotropic gaussian kernel with a sigma of 3 mm for the tfce - based analysis 19. finally, differences in cerebral gray matter density between the patient group and control group were assessed by voxelwise glm applied using permutation - based non - parametric testing (5000 permutations) 20. cluster - size shareholding at p - values<0.05, fully correcting for multiple comparisons across space, was used. nine sivd patients were recruited by physician referral from the department of neurology in southwest hospital, chongqing, china (table 1). the clinical diagnosis of sivd was made by a senior neurologist according to the criteria suggested by erkinjuntti 12 and dsm - iv (diagnostic and statistical manual of mental disorders, iv). ad patients with subcortical ischemia or mixed dementia who can also meet dsm - iv vad criteria and the patients with large territorial infarction involving cortex or single strategic infarction such as anterior nucleus of thalamus were excluded. all patients have visible white matter hyperintensities (wmh) (grade 3 or more by a reported rating scale 13) addressed with t2/flair imaging data in mri scanning. cognitive performance was evaluated through neuropsychological tasks that included : mini mental state examination (mmse), clinical dementia rating (cdr), neuropsychiatric inventory (npi), activities of daily living scale (adl), hachinski and hamilton test. nine age- and sex - matched old people with normal - cognition were recruited from surrounding regions by advertisement. they underwent a comprehensive brain examination to ensure that they had normal brain structure and no neurological lesions. exclusion criteria included patients with aphasia or who otherwise could not complete psychological testing because of a language disorder ; diagnosed chronic or degenerative disease affecting the central nervous system ; active substance abuse disorders ; intracranial hemorrhage ; difficult to control epilepsy that could present with cognitive impairment ; or temporal lobe epilepsy. all of those subjects who with brain trauma, brain tumor, psychiatric disorders, systemic disease or other mri contraindication such as claustrophobia were excluded from this study. present or past use of medication to treat cognition and infarction was not an exclusion criterion. all subjects provided informed consents and the ethics committee at the third military medical university approved the study protocols. the mri brain scanning was performed on a siemens avanto 1.5 tesla scanner with head matrix coil at the department of radiology in southwest hospital, chongqing, china. during the examination, scanner noise was attenuated with earplugs and head motion was restricted with foam padding (provided by the manufacturer) around the head and the necessity of head immobility was emphasized to each subject. anatomical image datasets were acquired with a standard t1-weighted high - resolution anatomic scan of magnetization - prepared rapid gradient echo (mprage) sequence : tr=1900ms, te=3.37ms, ti=1100ms, flip angle=15, fov=256mm192 mm, nex=1, matrix=256192, 1.001.00 mm in - plane resolution, horizontal slices with slice thickness of 1.3 mm and no gap. the mprage acquisition of each study was ensured the same slice orientation (paralleled to the anterior commissure (ac) and commissural posterior (pc) line). subsequently, t2-weighted (t2wi) images with 36 axial slices, 3 mm thick and 1 mm gap, oriented to ac - pc line were obtained. before further analysis of the 3d brain images, we confirmed that all images were uncontaminated with major head motion. the 3d data were copied from the mri scanner and imported to a personal computer running a linux operating system, on which off - line analysis was carried out by anatomical structure image analysis software fsl - vbm. first, by using mri_convert command, dicom files were completely converted to nii.gz format and then these structural images were brain - extracted using bet 14 in order to remove skin and skull. next, tissue - type segmentation was carried out using fast4 15 package, after that gray matter, white matter and csf were produced. the resulting gray - matter partial volume images were then aligned to mni152 standard space using the affine registration tool flirt 16,17, followed optionally by nonlinear registration using fnirt, which uses a b - spline representation of the registration warp field 18. the resulting images were averaged to create a study - specific template in order to reduce the effect of inter - subject brain variability during the registration procedure, to which the native gray matter images were then non - linearly re - registered. the registered partial volume images were modulated (to correct for local expansion or contraction) by dividing using the jacobian of the warp field. the modulated segmented images were then smoothed with an isotropic gaussian kernel with a sigma of 3 mm for the tfce - based analysis 19. finally, differences in cerebral gray matter density between the patient group and control group were assessed by voxelwise glm applied using permutation - based non - parametric testing (5000 permutations) 20. cluster - size shareholding at p - values<0.05, fully correcting for multiple comparisons across space, was used. the two groups did not differ significantly in age, sex ratio, or education. the scores include mmse, npi, cdr and adl, as well as those key excluded measuring scales such as hachinski score and hamilton score were summarized in table 1. the cerebral gray matter density in sivd patients were found significant decreasing than that of the normal controls in brain regions of thalamus, parietal lobe, frontal lobe and temporal lobe (p<0.05). to date, limited studies of cortical gray matter density have been performed due to the lack of efficient methods. before the methods for automatic calculation of cortical thickness were established, measurement of cortical thickness was performed primarily on the basis of manual contouring, which inevitably incurred significant inter - operator variability. manual measurement also has the drawback of inability to achieve sub - millimeter precision ; therefore the accuracy of the measurements is quite questionable. fsl - vbm is more accurate than spm - vbm and can found more significant cluster 10, because this method depends on the degrees of freedom of the non - rigid registration 21 and non - linear registration the alteration in cortical thickness have been well studied in several neurological diseases, such as multiple sclerosis 11, schizophrenia 10 and so on, by using the fsl - vbm analysis. svmci patients have been reported cortical thinning in inferior frontal and orbitofrontal gyri, anterior cingulate, insula, superior temporal gyrus, and lingual gyrus, while cortical thinning in sivd patients involved all these areas plus dorsolateral prefrontal and temporal cortices 22. to our best knowledge, the present study represents the first attempt to adapt this method to analyze the cerebral gray matter density of vascular cognitive impairment. in this study, the mri technique and anaphase analysis method provide a new way to study the structure of the brain. gray matter density in brain regions of thalamus, parietal lobe, frontal lobe and temporal lobe were found decreasing greatly, which mri can detect. these findings suggest that these brain regions may be the most affected in sivd, that the alterations in gray matter density are a possible characteristic of this type of dementia, and that the measurement of gray matter density in the above regions might help its detection. temporal lobe has been found closed correlation with memory and emotion. based on experimental evidence from both monkeys as well as humans, the prefrontal cortex has been proved to be important not only for attention, emotion and execution processing, but also for inhibition of " prepotent " habitual 23. some human diseases, such as schizophrenia, involving prefrontal abnormalities result in impairments in attention conflict paradigms 24. for example, the region of the left inferior parietal has been reported to become active when processing words compared to letter strings. the lateral left inferior region has been reported to be more active when viewing or naming words compared to pictures 25. thalamus lesion was found associate with memory damage in animal 26 and other human studies 27. previously, by using tc - hmpao spect method, regional cerebral blood flow in thalamus was found decreased significant in vascular dementia when compared with that in the controls 28. there is no cure for vascular dementia until now and the focus is currently on early diagnosis and preventing further brain damage. diagnostic research criteria for sivd are based on magnetic resonance imaging (mri) findings including substantial white matter lesions (wml), multiple lacunar infarcts, and neuropsychological tests. efforts to relate mri - measured lacunes and white matter changes to cognitive impairment have not been straightforward 26,30. in this study we found a new biological marker of sivd patients, which can be detected conveniently by fsl -vbm. as a new atraumatic technology, we believe fsl -vbm has much potential value and could promote the diagnosis of sivd in future.	background and purpose : the present study was designed to detect the abnormalities of the cerebral grey - matter density in subcortical ischemic vascular dementia patients by fsl - vbm method to promote the early diagnosis of it.methods : nine subcortical ischemic vascular dementia patients and nine age - matched normal controls underwent mri brain structure scanning that was performed on a siemens avanto 1.5 tesla scanner and standard t1-weighted high - resolution anatomic scans of mprage sequence were obtained. the 3-demensional mprage images were processed with fsl - vbm package and the cerebral gray matter density was compared between the subcortical ischemic vascular dementia patients and normal controls.results : compared with the normal control group, the cerebral gray matter density of subcortical ischemic vascular dementia patients was found significantly decreasing, including brain regions of thalamus, parietal lobe, frontal lobe and temporal lobe (p<0.05).conclusions : the cerebral gray matter density alterations have closed correlation with cognitive dysfunction in subcortical ischemic vascular dementia patient and can be detected by mri. mri has some potential value in the diagnosis of them.
the 25-gauge curved vitrectomy probe was a prototype manufactured by bausch and lomb (rochester, ny). the length of the probe is 25 mm with a uniform 25-g diameter (0.5 mm). construction of the illuminated vitrectomy probe is similar to that described previously with a 20-g vitrectomy probe.5 a seamless strong polyester (polyethylene terephthalate) heat shrunk tubing (advanced polymers, inc. salem, nh) is used to secure a fiberoptic endoilluminator with a curved 25-g vitrector ([fig. 1a, b, and 2a ] : vitrector and em).6 the tubing has an internal diameter of 0.05 inches and thickness of 0.0005 inches. the resultant illuminated vitrector has a diameter of 1.0 mm (0.5 mm fiberoptic light source + 0.5 mm 25-g vitrector) [fig. the assembly is sterilized with gamma radiation, ethylene oxide or cold gas sterilization. standard surgical technique with microvitreoretinal blade is used to create the sclerotomies.7 the posterior ppv is completed using a 20-g vitrector. at the end of the procedure the 20-g cutter is replaced with the 25-g illuminated curved vitrector [fig. 3 ]. the illumination of the probe facilitates visualization of the vitreous on the opposite vitreous base (180 away), while the curved design of the probe avoids crystalline lens touch [figs. 4, 5 ]. this allows the surgeon to use the other hand to depress the opposite sclera, which enables viewing of the internal sclerotomy with its surrounding vitreous through the wide - angle lens system [fig. position of the endoilluminator tip from the vitrector port can be varied by a gentle sliding maneuver during the surgery to optimize the illumination of the incarcerated vitreous. the vitreous incarcerated in the internal sclerotomy opening is shaved completely under direct visualization. excision of the peripheral vitreous in a phakic eye with a clear lens is one of the most challenging tasks in vitreoretinal surgery. with the advent of the wide - angle viewing systems, visualization of the peripheral vitreous base the potential of iatrogenic trauma to the posterior lens surface by the straight vitrectomy probe restricts access to the peripheral vitreous near the sclerotomy site.8 a curved instrument allows access to the internal sclerotomy site without damaging the posterior lens surface [fig. 5].9,10 while using the curved or conventional vitrector, the surgeon holds the endoilluminator while the assistant depresses the sclera for view of the anterior vitreous. this makes the surgery assistant - dependent, time - consuming, and limits the dynamic viewing of the vitreous base with the endoilluminator. the 20-g curved illuminated vitrector addresses the problems of illumination of the peripheral vitreous and safety of the crystalline lens.11 however, it requires a larger sclerotomy (18-g) than conventionally used, thereby increasing the risk of sclerotomy - related leakage and vitreous incarceration. due to the smaller diameter of the shaft, the 25-g curved illuminated vitrector allows removal of the vitreous from the internal sclerotomy site through a conventional sclerotomy (20-g) while preserving the safety of the posterior lens surface. clinical examination as well as ultrasonographic examination confirmed this in both pseudophakic and phakic patients [fig- 6a, b ]. an illuminated sleeve (synergetics, inc. charles, mo) that wraps around a straight 25-g vitrector provides the benefit of illuminated 25-g vitrector in a pseudophakic eye. however, the illuminated sleeve does not conform to the curved 25-g vitrector and can not be used in phakic eyes without risk of lens touch. effective and complete removal of vitreous from the internal sclerotomy prevents postoperative complications associated with wound healing. sabti., studied 22 eyes with ultrasound biomicroscopy (ubm) of which 11 underwent ppv with complete shaving of the vitreous from the internal sclerotomy site by indentation with a straight conventional vitrector, while 11 eyes in the control group underwent conventional ppv only. complete vitreous shaving around the sclerotomy site significantly reduced vitreous incarceration.4 removal of vitreous from the internal sclerotomy assumes added importance during implantation of intra - vitreal drug delivery systems where large sclerotomies are necessary to accommodate the size of the implant (2 to 4 mm). in a prospective study utilizing ubm to study the internal sclerotomy site in diabetic patients undergoing vitrectomy, bhende., noted that eyes with postoperative vitreous incarceration developed fibrovascular proliferation six months after surgery.3 this is a known high - risk factor for recurrent vitreous hemorrhage after ppv in diabetics we have successfully employed this instrument in 100 complicated vitreoretinal procedures, of which 41 were phakic eyes. no lens - related complications occurred, though novice surgeons may experience a learning curve with the new device. in summary, the 25-g curved illuminated cutter combines the advantage of a self - illuminated vitrectomy probe and custom curved design that avoids crystalline lens touch. in addition, its usage through a standard 20-g sclerotomy in facilitating complete removal of vitreous from the internal sclerotomy prevents sclerotomy - related complications.	incarceration of vitreous in sclerotomy sites during pars plana vitrectomy can lead to wound - related complications similar to vitreous incarceration in cataract surgery. we describe an illuminated curved 25-gauge vitrectomy probe for removing vitreous from sclerotomy sites. polyester tubing is used to secure a fiber optic endoilluminator (0.5 mm) with the curved 25-gauge vitrector (0.5 mm). the resultant illuminated curved vitrector (20 g) has a diameter of 1.0 mm. it facilitates complete removal of vitreous around the internal sclerotomies under direct visualization in both phakic and pseudophakic eyes. the same was confirmed with ultrasound biomicroscopy of the sclerotomy sites. curved vitrector reduces postoperative complications related to incarcerated vitreous in phakic and pseudophakic eyes and other sclerotomy - related wound complications.
to ensure faithful organelle inheritance, the segregation of each cellular component must be tightly coupled to the act of cell division. for chromosomes, this coupling relies on the exchange of signals between the elongating anaphase spindle and the overlying cell cortex, which helps to position the site at which the actomyosin - based ring is formed that cuts the cell into two. although the mechanisms are less well worked out, organelles may also rely on crosstalk between the microtubule - based spindle and the actin cortex for their partitioning [68 ]. to identify new actin - based regulators of cell division, we screened a human actinome small interfering rna (sirna) library for sirnas that induce division errors, targeting genes associated with the actin cytoskeleton, genes with predicted actin - binding domains, myosin motors, rho family gtpases, gtpase activating proteins (gaps), and guanine nucleotide exchange factors for sirnas that induce division errors. while previous screens had used fixed endpoint assays to identify cytoskeletal regulators whose silencing led to cytokinesis failure (e.g.,), here we aimed to combine fixed data with live imaging to identify sirnas that caused more subtle division errors. briefly, for the live - imaging analysis, a library targeting the human actinome, four sirnas per gene, was mixed with a transfection reagent and arrayed in spots onto glass chamber slides. hela-13 cells expressing lifeact - egfp to label filamentous actin and histone-2b - mcherry to label dna were then plated onto these arrays in triplicate experiments. approximately 2 days after solid - phase reverse transfection, these marked islands of sirna - treated cells were then filmed, using automated microscopy, to take a frame every 33 min over a 20 hr period. we focused our manual screen analysis on hits (n = 67) that exhibited a multinucleated rnai phenotype in the fixed screen carried out using the same library. movies were visually inspected to identify sirnas inducing cell division defects. for the 18/67 hits with the most reproducible oligo - specific rnai phenotypes, division outcome was scored for 100 cells in each film and was compared with the outcomes from sicontrol spots on the same slide. using this approach, nine candidate genes were identified that exhibited a cell division defect with more than one independent sirna (figure 1a ; for details of these sirnas and their individual phenotypes, see table s1 and see figure s1a, available online, for a graphical depiction of the workflow). the strongest hits corresponded to genes known to be crucial for faithful cell division, including anillin, citron kinase, and ect2. the centralspindlin subunit rac gtpase activating protein 1 (racgap1, mgcracgap) was also identified as a moderately strong hit, together with two members of the beta - spectrin family, which bind actin and are major constituents of the cell cortex, and an unconventional myosin, myosin - xix (myo19). finally, bcr, which contains a c - terminal gap domain specific for rac, and tpm4 (tropomyosin 4) were recovered as relatively weak hits. given its potential novelty, we chose to focus our further analysis on the role of the unconventional myosin myo19. briefly, myo19 is a myosin found in most animals that appears to have been lost from lineages leading to insects and roundworms. the 970 amino acid protein consists of a motor domain that has features distinguishing it from other myosin classes [2224 ], a lever arm region containing three light - chain - binding iq - motifs, and a tail domain. interestingly, the tail domain of myo19, which is unique in the myosin family, was recently shown to target the protein to mitochondria. this myo19-specific mitochondria outer membrane association (mymoma) domain consists of approximately 150 amino acids (140 in mouse), bearing little easily identifiable sequence or structural homology to other known domains. previous biochemical studies of purified myo19 confirmed that the protein is a plus - end - directed, actin - activated atpase capable of translocating actin filaments in vitro. these studies also suggested that myo19 may spend a large fraction of its chemomechanical cycle in an actin - bound state a property common to transport motors such as myo5. moreover, the ectopic expression of full - length myo19 was reported to increase the motility of mitochondria in interphase and to alter mitochondrial network organization in an actin - dependent fashion. given this, it was important to first confirm a role for myo19 in division, before going on to test whether myo19 might influence the outcome of cell division through its interaction with mitochondria. using a myo19 sirna (myo19 - 03), we were able to confirm the increased rate of division failure following myo19 silencing using live imaging (figure 1b) and to show that in the majority of cases (37/41), division first failed soon after furrow formation, while only a small number of cells failed later (figure 1c). to validate this myo19 rnai phenotype, we silenced the gene using nonoverlapping sirnas. after fixation and staining, we observed a significant increase in the percentage of myo19 rnai cells with more than one nucleus compared with the nontargeting sicontrol (figure 1d). specifically, after 2 days of treatment with myo19 - 02 sirna, 14% of cells were multinucleated, whereas myo19 - 03 sirna caused 30% of the cells to contain multiple nuclei, compared to 2% of sicontrol - treated cells (figure 1e). a similar phenotype was obtained using two additional sirna sets targeting the same gene (data not shown). to further validate the specificity of the myo19 depletion phenotype, we performed a rescue experiment in a hela cell line stably expressing an n - terminally tagged gfp - bacterial artificial chromosome (bac) version of murine myo19, whose species - specific nucleotide sequence differences would make it resistant to knockdown by human myo19 sirna. in these cells, the entire visible pool of gfp - myo19 was localized to mitochondria, as confirmed by colabeling with mitotracker (data not shown) and by fixing and staining cells with an antibody against cytochrome c (figure 1f). moreover, in cells with robust mitochondrial gfp - myo19 expression (figure 1 g, with representative images in figure 1h), we observed a statistically significant reduction in the percentage of multinucleated cells following treatment with myo19 - 03 sirna, implying a direct or indirect role for this mitochondrially localized pool of myo19 in cell division. as additional validation, we observed a significant increase in the percentage of multinucleation in a different cell type, namely, murine cells expressing a stable, lentiviral - induced myo19 small hairpin rna (63% of silenced cells, compared with 34% in the control ; figure s1b), in which the myo19 knockdown (of 80%) could be verified by western blot analysis using an antibody generated against the mouse protein (figure s1c). we also used quantitative pcr to validate the knockdown following treatment with myo19 - 02 and myo-19 - 03 sirnas in hela cells, revealing an 88% reduction with myo19 - 02 and a 73% reduction with myo19 - 03 oligo relative to the sicontrol reagent (figure s1d). from this point on, we used myo19 - 03 as the representative sirna for our experiments, as it had the most penetrant phenotype. given that myo19 is localized to mitochondria, where it has been implicated in mitochondrial movement, it was important to test whether defects in the distribution or activity of mitochondria might be responsible for the observed myo19 sirna - induced disruption in cell division. mitochondria are known to go through phases of fission and fusion during passage through the cell division cycle, which are thought to affect their activity and segregation [27, 28 ]. more specifically, mitochondrial fusion is thought to be accelerated at the g1-s transition, whereas fission is induced during mitosis. although we were unable to identify defects in cell division following drug - induced inhibition of oxidative phosphorylation (data not shown), we could phenocopy the multinucleation phenotype observed in myo19 rnai cells by treating hela cells with mitochondrial division inhibitor 1 (mdivi), a drug that shifts the balance toward mitochondrial fusion through the inhibition of the fission machinery protein drp1 (figure 2a, representative images in figure 2b). this result implies that division failure could ultimately result from the simple obstruction of the actomyosin ring during cytokinesis by misplaced or excessively fused mitochondria in myo19 rnai cells. in support of this idea, both the mdivi1 and the myo19 depletion phenotypes were rescued in cells treated with sirnas targeting mitofusin-2 (mfn2), whose depletion shifts the balance toward mitochondrial fission (figures 2c and 2e, with a representative image in figures 2d and 2f ; see figure s2a for evidence of mfn2 protein reduction). a similar mitochondrial fragmentation was seen in mfn2 myo19 rnai cells (data not shown). to determine the longer - term consequences of simyo19-induced mitochondrial asymmetry, we followed dividing cell progeny to see how they coped with a subsequent cell cycle. hela cells stably expressing mitochondria - targeted yellow fluorescent protein (yfp) were treated with myo19 sirna or sicontrol and live imaged after 24 hr. as quantified in figure s2b, myo19 cells that failed division in the first round could produce daughter cells that succeeded in the second, and vice versa. therefore, division failure appeared to be stochastic as expected if it was due to physical obstruction. to examine whether myo19 is required for actomyosin ring formation or closure, we examined mitotic cells after depletion with simyo19 or sicontrol sirna and could see no obvious morphological differences in the contractile ring, as assessed by staining with an antibody specific for anillin (figure s2c). moreover, using live imaging, we compared the time it took for cells to travel from the onset of anaphase to the onset of cytokinesis and observed no significant difference between control and myo19 rnai cells, whether or not the cell ultimately failed division (figures s2d and s2e). to determine whether the cell division failure following myo19 depletion might be due to improperly segregated chromosomes, we live imaged hela cells expressing histone-2b - mcherry after knockdown with simyo19. although we did observe lagging chromosomes in some control and myo19 rnai cells, there was no correlation between the presence of dna bridges and division failure (figure s2f). however, cells with more severe mitochondrial segregation defects tended to fail division at a higher rate (figure s2f). taken together with the mitochondrial fusion findings mentioned above, these results argue that myo19 is not an integral part of the cell division machinery or of the actomyosin ring. during the course of these experiments, we noted an additional phenotype specific to myo19 rnai cells : mitochondria appeared asymmetrically localized in mitotic simyo19 cells. strikingly, while we observed relatively subtle changes in the structure and organization of mitochondria in interphase (figure 3a, left panels), mitochondria appeared clumped and asymmetrically distributed in both metaphase and anaphase myo19 rnai cells (figure 3a, montages ; quantified in figure 3b). as a result, pairs of daughter cells frequently inherited different proportions of the total mass of mitochondria (figure s3a ; this effect is quantified for anaphase in figure s3b and quantified for telophase in figure s3c ; see also movies s1, s2 and s3 for representative examples of an sicontrol cell, a myo19 cell that succeeded in division, and a myo19 cell that failed, respectively). this phenotype was statistically significant in experiments using a number of different myo19-specific sirnas (data not shown), was rescued by the expression of the rnai - resistant bac mouse gfp - fusion protein (figure s3b, right side). to determine whether the asymmetric segregation observed might be a simple consequence of defects in mitochondrial fission, we cosilenced myo19 and mfn2. while mfn2 sirna rescued the multinucleation phenotype seen in the myo19 knockdown (figure 2c), this increase in fission had no impact on the myo19-rnai - induced asymmetry in mitochondrial inheritance (figure s3c, right side, with representative images as insets). first, it strongly suggests that myo19 does not exert its effects on mitochondrial segregation simply by altering the mitochondrial fusion status. second, it enabled us to separate the effects of myo19 on cell division, which appear to be due to a stochastic process in which misplaced mitochondria physical obstruct the process, from the robust defects in the symmetry of mitochondria at division. these distinct functions could be observed in movies of different dividing myo19 rnai hela cells stained with mitotracker green. as shown in figure s3d, mitochondrial positioning was still visibly perturbed regardless whether division succeeds (middle row shows a representative cell) or fails (bottom row). similar results were observed when live imaging was performed with a mitochondria - targeted yfp tag (hela - mito - yfp) instead of mitotracker (data not shown). to determine whether myo19 functions in mitosis to aid the proper distribution and segregation of mitochondria, we synchronized simyo19 or sicontrol hela cells transiently expressing -tubulin mcherry in prometaphase with the eg5-inhibitor s - trityl - l - cysteine (stlc) for 14 hr and then used mitotracker green to visualize mitochondria in the 30 min required for cells to exit mitosis following drug washout (figure 4a ; n = 15 for control and n = 15 for myo19 rnai). while control cells manifested occasional mild mitochondrial asymmetries at metaphase (e.g., second row for figure 4a), they were able to restore symmetry during anaphase. in contrast, while the distribution of mitochondria appeared similar in the majority of control and simyo19 cells arrested in prometaphase, following release from the arrest many myo19 rnai cells entering metaphase with a relatively normal mitochondrial distribution exhibited profound defects in mitochondrial segregation. these first arose as mitochondria moved to cell poles just prior to the onset of anaphase chromosomal movements (figure 4a, bottom row) and led to defective mitochondrial segregation at division (figure 4a, third row). in addition, it was noted that myo19 cells tended to take longer on average to complete mitosis (data not shown). these data provide evidence that myo19 functions to regulate mitochondrial movement and segregation as cells exit mitosis. the correct partitioning of mitochondria into daughter cells during cell division requires precise orchestration, since defects in this process are likely to have serious consequences for daughter cells. aside from their best - known role as producers of atp, mitochondria regulate lipid and amino acid metabolism, redox regulation, calcium buffering, the production of heme, and apoptosis. given the fundamental and diverse nature of mitochondrial housekeeping functions, it is no surprise that their disruption is associated with numerous human diseases and that checkpoints have been found in yeast that prevent division if problems in mitochondrial partitioning have occurred. for example, in budding yeast, actin cables are employed to transport mitochondria from the mother cell to the bud cell, whereas in fission yeast, microtubules move the organelles to opposite poles. ral - induced fission of mitochondria in mitosis has very recently been proposed to contribute to their partitioning at cell division. although a recent paper reported that mitochondria were recruited to the cleavage furrow during cytokinesis in hela and other cell types, a process its authors concluded was dependent on microtubules but not actin, we never observed this in our experiments (see, for example, figures 3 and 4a ; figures s3a and s3d ; movie s1). given that myo19 is an actin - binding protein, we wanted to test whether actin is required for the movement of mitochondria during early cell division. to this end, we synchronized hela cells transiently expressing -tubulin mcherry in prometaphase with stlc for 14 hr and then stained with mitotracker green for the last 30 min. after drug washout, we imaged cells to inspect the behavior of mitochondria before and then 4 min after the addition of latrunculin b to disrupt f - actin assembly, or dmso as a control (representative images in figure 4b, with the quantification in figure 4c). the disassembly of actin was found to trigger the rapid movement of mitochondria to the two opposing spindle poles of anaphase cells. strikingly, this mirrored the premature movement of mitochondria to the spindle poles in myo19 rnai cells passing through mitosis (figure 3a) and following the recovery from a prometaphase arrest (figure 4a). this finding supports the idea that actin helps to control the movement of mitochondria during mitosis, but suggests that the actin cytoskeleton may constrain rather than promote mitochondrial movement in anaphase, which may be driven by microtubules. our data therefore support a mechanism whereby the mitochondrially associated myosin motor myo19 functions together with f - actin in ensuring the regulated segregation of mitochondria during anaphase. it may also help to keep mitochondria out of the way of the cleavage plane to allow easy division of the cell body. in many other systems, general high - speed and longer - range transport of organelles on microtubules is refined by local anchorage to the actin cytoskeleton. for example, in the vertebrate axon, inhibition studies in vivo showed that mitochondrial transport can occur via either microtubules or actin microfilaments, but both are required for normal speed and net transport properties. in this system, actin provides fine - tuning in response to signaling events ; for example, nerve growth factor can induce the accumulation of the organelles in particular parts of the axon by recruiting mitochondria from the general microtubule - trafficked pool via filamentous actin tethers. similarly, melanosomes undergo kinesin - mediated radial transport from the center of the cell to its periphery. once at the periphery, these organelles switch to myo5-mediated transport and localization on actin filaments. track - switching also occurs in the myo5-mediated endoplasmic reticulum transport into dendrites underlying neuronal synaptic plasticity. our analysis supports a model whereby mitochondria move to the poles of the microtubule - based spindle at anaphase in a way that is independent of actin filaments, in line with the large body of literature showing that mitochondria are carried along microtubules in animal cells. in this context, myo19, through its association with mitochondria, may function to tether mitochondria to actin filaments during metaphase and anaphase, helping to regulate or limit their association with and poleward movement along microtubules, which provides the driving force for their segregation [27, 37 ]. this function would be similar to the role proposed for many other unconventional myosins as tethers. further experiments will be required to understand exactly how myo19 regulates mitochondrial movement, and to ascertain whether its activity is coupled to mitotic progression for example, to determine whether there is regulated disengagement of mitochondria from actin at anaphase. taken together, however, our analysis shows that interactions between myo19 and the actin cytoskeleton likely help to control the intracellular distribution of mitochondria and to ensure their precise and timely symmetrical segregation to spindle poles during animal cell division. because mitochondria are unique among organelles in carrying their own genome, their missegregation, in common with errors in dna segregation, would be expected to have profound effects on the future growth and viability of daughter cells. j.l.r. contributed to the scientific strategy, performed experiments, helped analyze data, and wrote the manuscript. o.a.q. performed the murine cell experiments, helped advise on the analysis of data, helped with the manuscript, and contributed to scientific strategy. j.e. advised and helped to oversee the rnai screening. b.b. oversaw the scientific strategy and helped to design experiments, performed experiments, analyzed data, and cowrote the manuscript	summaryduring animal cell division, an actin - based ring cleaves the cell into two. problems with this process can cause chromosome missegregation and defects in cytoplasmic inheritance and the partitioning of organelles, which in turn are associated with human diseases [13 ]. although much is known about how chromosome segregation is coupled to cell division, the way organelles coordinate their inheritance during partitioning to daughter cells is less well understood. here, using a high - content live - imaging small interfering rna screen, we identify myosin - xix (myo19) as a novel regulator of cell division. previously, this actin - based motor was shown to control the interphase movement of mitochondria [4 ]. our analysis shows that myo19 is indeed localized to mitochondria and that its silencing leads to defects in the distribution of mitochondria within cells and in mitochondrial partitioning at division. furthermore, many myo19 rnai cells undergo stochastic division failure a phenotype that can be mimicked using a treatment that blocks mitochondrial fission and rescued by decreasing mitochondrial fusion, implying that mitochondria can physically interfere with cytokinesis. strikingly, using live imaging we also observe the inappropriate movement of mitochondria to the poles of spindles in cells depleted for myo19 as they enter anaphase. since this phenocopies the results of an acute loss of actin filaments in anaphase, these data support a model whereby the myo19 actin - based motor helps to control mitochondrial movement to ensure their faithful segregation during division. the presence of dna within mitochondria makes their inheritance an especially important aspect of symmetrical cell division.
	inoculation of tumorigenic prostatic stroma and nontumorigenic prostatic epithelia into the subcutaneous space of syngeneic rats induced the development of carcinosarcoma. the induced tumors, which were composed of a mixture of adenocarcinoma and fibrosarcoma, were androgen responsive. this model offers a novel mechanism for prostatic carcinogenesis in which prostatic fibroblasts determine epithelial growth, androgen responsiveness, and tumorigenicity. our results emphasize the potential importance of an epigenetic pathway in prostatic carcinogenesis.imagesfigure 1. afigure 1. bfigure 4. afigure 4. bfigure 4. c
right ventricular based pacing (rvp) has been standard therapy for children with advanced second - degree and complete atrioventricular (av) block during the last several decades. nevertheless, congestive heart failure (chf) and dilated cardiomyopathy (dcm) may rarely occur in children undergoing chronic rvp systems (1, 2). there are numerous clinical trials on crt that show the effectiveness of it when dealing with or treating adult patients with refractory chf and dcm (3, 4). however, most reports on crt and its effectiveness have paid attention to adult patients rather than child patients. not many studies on crt with young children have been conducted. some researches on the issue that were carried out only dealt with heterogeneous populations that are not capable of being generalized (5 - 7). we present a case of progressive left ventricular (lv) dysfunction following chronic right ventricular (rv) epicardial pacemaker for congenital complete av block whose lv dysfunction was improved after crt. a 9-yr - old boy was transferred to our hospital because of progressive lv dysfunction on march 14, 2007. he was delivered by caesarean section at 39 weeks of gestation and his birth weight was 3.2 kg. after birth, bradycardia due to congenital heart block was noted. at the age of 3 days, a permanent vvi pacemaker was implanted due to a resting heart rate of 50 - 60 beats / min, which was accompanied by lv dilatation and low - lv ejection fraction (ef) of 41%. after vvi pacing, lv dilatation and dysfunction had been improved. at the age of 9 yr, the new york heart association (nyha) class was ii or i, occasionally. electrocardiogram showed vvi paced wide qrs complex of 164 msec with left bundle branch block (lbbb) pattern of qrs morphology and superior axis at frontal plane. test weaning of ventricular pacing revealed intrinsic rhythm of complete heart block with wide qrs escape beats (fig. there was significant intraventricular dyssynchrony as follows : septal to lateral delay was 136 msec and all segment delay measured by tissue synchrony image (tsi) was 219 msec. chest radiography showed a cardiomegaly, of which cardiothoracic (ct) ratio was 0.61 (fig. the level of plasma b - type natriuretic peptide (bnp) was 111 pg / ml. screening for fluorescent antinuclear antibodies (fana) and anti double - stranded deoxyribonucleic acid (ds - dna) antibodies was negative. both anti - ssa / ro and anti - ssb / la antibodies were also negative. when we have examined his mother, the results were as follows : fana 1:40, anti ds - dna antibodies 6.0 and anti - ssa / ro and ssb / la antibodies (+). because lv ef remained below 30% on echocardiography in spite of medical treatment for 1 yr, we decided to use crt in an attempt to improve cardiac function and acquire the reversed remodeling. he received an epicardial biventricular pacing system with bipolar leads (insync iii model 8042, medtronic inc., the epicardial bipolar atrial lead and the bipolar ventricular lead were placed on the right atrial (ra) appendage and the rv apex, respectively. the left lead was placed on the lv posteriolateral wall, between the posterior descending artery and the branches of left circumflex artery. in choosing pacing sites, in order for optimal synchronization in lv walls, we considered tsi by intraoperative transesophageal echocardiography and arterial pressure monitoring that brought about minimal dyssynchrony and maximal arterial pressure. the pacing thresholds of ra and lv were 1.0 v and 1.5 v respectively with 0.4 msec pacing width. minimum intraventricular dyssynchrony was achieved with the setting of lv earlier by vv delay 4 msec. twelve months after implantation, electrocardiogram showed atrial - sensing and ventricular - pacing qrs complex of 148 msec (fig. now, 18 months later from the implantation, he shows the improved exercise tolerance. he has been followed up at the outpatient department and observed on a regular basis. prolonged ventricular dyssynchrony induced by long - term rvp is associated with deleterious lv remodeling, which are lv dilatation and lv asymmetrical hypertrophy (2, 8, 9). a recent small series study documented that crt was effective in improving lv function in young patients with rvp induced cardiomyopathy (10, 11). very few children with idiopathic dcm meet the published criteria found predictive of a positive response in adult subjects (lbbb, lv dysfunction [ef 125 msec ]) (3, 4, 7). rvp induced cardiomyopathy seems to be one consistent subset of children and adolescent patients that seems eligible for crt. in this case with congenital heart block, rv paced qrs duration was prolonged (164 msec) and lv dysfunction was obvious (lv ef=25.1%). although the heart failure was not severe, the lv dysfunction in this patient was considered to be caused by chronic rv pacing and intraventricular dyssynchrony. the underlying disease and life expectancy in children are different from those in adult, current indication for crt in adult patients may not be strictly applicable to children. (5) described the use of biventricular pacing in one infant with congenital complete av block and dcm that had been previously paced for complete av block. (6) reported an improved clinical status and lv ef following crt in four of five patients previously paced for surgical complete av block. in some study of resynchronization therapy in pediatric patients (7, 12), the authors reported the patients with av block who exhibited an average improvement in lv ef. our patient showed an improving lv ef and septal to lv lateral delay on tsi. similar to the improvement in lv function, our patient exhibited reduction in the plasma bnp level. the change of bnp has rarely been described in pediatric patients with dilated cardiomyopathy undergoing crt (13). in adult patients, bnp levels are deemed as a useful index to reflect different degrees of lv reverse remodeling (14). meanwhile, (15) reported anti ssa / ro and anti ssb / la antibodies were one of the risk factors for development of dcm in patients with congenital complete av block. even though our patient 's anti ssa / ro and anti ssb / la antibodies were negative, his maternal anti ssa / ro and anti ssb / la antibodies were positive. maternal antibody may result in not only the damage of the conduction tissue but also contracting myocardium of the fetal heart. direct association between rvp and development of severe dcm and overt heart failure in the young has not yet been demonstrated in korea. this case is expected to play a significant role in rvp induced electromechanical dyssynchrony in the development of lv dysfunction irrespective of av block etiology. long term follow - up studies are also needed to determine not only beneficial effects and but also crt - related late adverse effects in young children. in summary, despite early institution of cardiac pacing, some patients with congenital av block develop lv cardiomyopathy. patients with congenital av block have to be closely monitored not only their heart rate and rhythm but also ventricular function even after pacemaker implantation. upgrading to crt by biventricular pacing should be considered in the patient who has progressive lv dysfunction after rvp.	cardiac resynchronization therapy (crt) has been proven its value in adult patients with congestive heart failure of low ejection fraction and wide qrs duration. contrast to adult patients, crt has been rarely applied for young patients. we report on a 9-yr - old boy with progressive left ventricular (lv) dilatation and dysfunction following chronic vvi pacemaker therapy for congenital complete atrioventricular block associated with maternal anti - ssa / ro and ssb / la antibody. his lv dysfunction was improved after epicardially established crt.

Subsets and Splits