article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
the constructs of time and space saturate our discourses, as the two experiential domains are, of course, fundamental to how we interact with and organize our environment. considerable empirical evidence has revealed interactions between time and space in both brain and behavior, from low - level perception to high - level linguistic processes. in this respect, walsh 's prominent theory (well known as a theory of magnitude, atom) has tried to account for these systematic interdomain influences. as posited by this theory, time and space, along with other forms of magnitude, may share a single cross - domain metric system in the brain, in particular within regions of the parietal cortex [1, 2 ]. a distributed and integrated network of other areas, such as the prefrontal cortex, are presumably involved in the magnitude system, even if the cross - domain magnitude representations seem to be specially coded by the parietal regions. thus, temporal events and spatial extents may share a representational and neural format, such that two events are separated by a particular duration in the same way as two locations are separated by a particular distance. in addition to this neural model, at the behavioral level one of the most well - established interactions between space and time is captured by the spatial temporal association of response codes effect (stearc effect) : temporal concepts, such as before versus after, are spatially associated with horizontal locations [37 ]. converging evidence of time - space interactions has therefore supported the proposal that time is represented spatially along a horizontal mental time line (mtl) [8, 9 ]. hence, it has been suggested that humans experience time as flowing along a mental horizontal line, so that smaller magnitudes (intervals) of time are associated with the left part of the line and larger magnitudes (intervals) are associated with the right part of the line. accordingly, the duration of stimuli presented in the left space is underestimated relative to that of stimuli presented in the right space, which tends to be overestimated [10, 11 ]. in line with the finding of a spatial representation of time intervals in ascending order from left to right, a distortion of time perception is observed following leftward or rightward attentional shifts created through prismatic adaptation (pa) procedure. broadly speaking, pa is a well - known sensorimotor technique for investigating cerebral plasticity in neurologically healthy individuals by inducing a relatively transient shift of spatial attention [1216 ]. in addition, leftward- and rightward - deviating prisms affect performance on a variety of temporal tasks. previous research has indeed reported that pa is able to modulate systematically the spatial representation of time in healthy individuals [11, 17, 18 ]. in these studies, participants performed a time (duration) reproduction task and/or a time (duration) bisection task, before and after leftward (lpa) and rightward (rpa) prismatic adaptation. according to the above - recalled left - to - right organization of the spatial representation of time, pa caused an opposite and symmetrical modulation on time processing : lpa produced an overestimation of time durations, whereas rpa produced an underestimation of time durations. these findings have thus demonstrated that manipulating spatial representations can shape biases in the estimation of time durations. somewhat similarly, biasing attention orientation by means of pa alters performance, not only in temporal, but also in visuospatial tasks. so, for instance, in a distinctive visuospatial task, the line bisection, young individuals typically show pseudoneglect : they judge the middle of the horizontal line to the left of the true center [1923 ]. more interestingly, following adaptation to leftward prism (lpa) participants shift their midline judgments to the right, thus reducing or cancelling their leftward bias at baseline [16, 2427 ]. it is worth noting that most studies have demonstrated a significant modulation after lpa, but no effect following rpa on visuospatial processing [16, 2429 ]. in the bine bisection task, however, such a pseudoneglect phenomenon appears to be limited to stimuli presented close to the body, with bias shifting to the right of the true center as viewing distance increases [23, 3034 ]. specifically, individuals show a leftward bias (i.e., pseudoneglect) within near space and a rightward bias in far space, and the point of transition from the left - to - right bias can be manipulated by extending or contracting the participant 's reach [32, 34 ]. this pattern, systematically related to reach capabilities, has been interpreted as evidence of distinct representations of space, which are encoded on the basis of action potentiality [3537 ]. this interpretation is in line with the proposal that pseudoneglect is usually found in the space near the body where individuals can act upon directly by the use of the arm, whereas rightward bias is observed where the line to be bisected is presented in the space far from the body, beyond the space with immediate action potential [3234 ]. indeed, the results of neurophysiological [23, 3841 ], neuropsychological [4244 ], and neuroimaging studies [4548 ] converge suggesting that, on the basis of the potential actions that can be performed, the space close to the body (i.e., near space) and the space that lies just beyond reach (i.e., far space) are represented differently by the brain (for reviews, see [4851 ]). based on the abovementioned evidence indicating tight relationships between attentional mechanisms and representations of space and time, our study was designed to explore, for the first time within the same experimental design, the effect of pa in both near and far space on both spatial and temporal tasks. so far indeed, previous research has investigated the effect of the shift of spatial attention on time processing in the near, but not in the far space. for the purpose of the study, the landmark task, which is a nonmanual, perceptual variant of line bisection, was used to measure the visuospatial bias caused by pa. we chose this paradigm in order to minimize the influence of motor factors on bisection judgments and to slow down the deadaptation process after pa procedure [16, 22, 24, 5254 ]. in this task, participants are required to make forced - choice responses according to whether they perceive a vertical transector to be closer to the left or right end of a horizontally displayed line. the time bisection task was instead used to measure the modulation on the spatial representation of time caused by pa. the paradigm is a well - established task in which participants classify whether a series of stimuli are closer in duration to a long reference duration [5557 ]. in order to compare the temporal and spatial changes induced by pa, we needed similar stimuli to be employed in the two tasks. to this end, in the landmark paradigm stimuli were lines pretransected at one of different locations and were presented for 2000 ms. similarly, in the time bisection paradigm stimuli were lines pretransected at veridical center and had one of different durations. finally, to answer the question of whether pa aftereffects measured by the landmark and time bisection tasks would extend to stimuli presented in the far space, all subjects were submitted to the two tasks at two different distances : 60 cm (within arm 's reach, i.e., in near space) and 120 cm (outside arm 's reach, i.e., in far space). sixty - four healthy volunteers (46 females, mean age = 23.78 ; sd = 2.13 years) participated in the study (mean education = 16.27 ; sd = 1.61 years). the participants had no self - reported history of neurological or psychiatric diseases, had normal or corrected - to - normal vision, and were right - handed according to self - report and as assessed by administration of the edinburgh handedness inventory (mean = 78.29 ; sd = 17.51). they were nave as to the experimental hypotheses being tested and gave informed consent to take part in this study, which was approved by the local ethics committee and conducted in accordance with the ethical standards of the 2008 declaration of helsinki. all data were collected in a noise - attenuated room. the experiment consisted of two blocks : one before and one after a pa session. the preadaptation block included the landmark and the time bisection tasks ; then participants performed a single session of pa. in the postadaptation block they repeated the landmark and the time bisection tasks five minutes after prisms removal within each block, the landmark and time bisection tasks were performed at two viewing distances : near space (60 cm, i.e., monitor screen placed within arm 's reach) and far space (120 cm, i.e., monitor screen placed beyond reaching). participants were asked to keep their eyes closed between the tasks and to rest their hands on their thighs during the whole experiment, except during the pa session. participants were comfortably seated directly in front of the monitor screen, with lights extinguished to reduce external visual cues. stimuli were presented using the e - prime software package (psychology software tools, usa) on a ldc monitor (17 inches, 1280 1024 pixel resolution and 75 hz refresh rate) controlled by a macbook pro laptop. stimuli were white pretransected lines of 100% contrast displayed on a black screen positioned 60 cm (near space) or 120 cm (far space) from the participant 's eyes. the size of horizontal line stimuli was adjusted across viewing distances to ensure the retinal angle subtended remained constant at 19.03 of va (visual angle) in width by 3.23 of va in height. horizontal lines stimuli were centered with respect to both the midsagittal plane of each subject and the computer screen. lines were pretransected at the true center (i.e., 0.00) and at 0.1, 0.2, 0.3, 0.4, and 0.5 of va toward the left and right of the true center. each of the 11 different pretransected lines was presented eight times in a random order, yielding a total of 176 trials, 88 in the near space, and 88 in the far space. trials began with the presentation of a blank (black background) for 750 ms, after which the line stimulus was presented. each pretransected line was displayed for 2000 ms and then replaced by a blank (black background), which remained visible until a response was made. after the response, a black - and - white patterned mask stayed on the screen for a random duration (range 5001500 ms) before the subsequent trial was presented (see figure 1). the task was a two - alternative forced - choice paradigm and consisted of the verbal classification of pretransected lines that appeared centrally displayed on the monitor screen. on each trial, participants were asked to fully inspect each pretransected line and to judge which end of the line the transector was closer to. thus, participants were instructed to verbally classify each prebisected line as left if the transector was perceived as being closer to the left end of the line and as right if they perceived it to be closer to the right end. to ensure that participants understood the task instructions, a practice session was administered before the experimental task. in this practice session participants had to classify five lines pretransected at 0.5 as left and five lines pretransected at + 0.5 as right, all presented in a random order. participants received feedback only in these ten practice trials, which was repeated until they had reached at least 80% of accuracy. then, they were submitted to the experimental task in which all the possible eleven prebisected lines were displayed in random order. participants were required to make a left / right - forced - choice and were told to make their best guess if they were unsure. they were also instructed to respond as accurately and as quickly as possible, without receiving any feedback. the experimenter seated behind participants (at least 1 m) and recorded participants ' verbal responses by pressing one of two keys on a keyboard (q for left and the landmark task took approximately twelve minutes to complete. in order to obtain an objective measure of perceived line midpoint in each condition for each participant, cumulative gaussian functions were fitted to the proportion of right responses (i.e., when subjects judged the transector as being at the right of the true center) given by each participant as a function of the position of the 11 transector positions. the estimate of the point at which the psychometric function cuts the 50% of right responses indicates the point of subjective equality (pse). an increase of right responses after pa, as compared to baseline, induces a decreased pse, reflecting a relative shift toward the left of the perceived midline. on the contrary, an increase of left responses after pa, as compared with performance at baseline, induces an increased pse, reflecting a relative shift to toward the right. so, the pse allows us to detect any rightward (leftward) spatial shifts induced by pa on midpoint judgments in near and far spaces. the experimental procedure of the time bisection task was similar to the landmark paradigm, with the following exceptions. stimuli were lines, presented on the monitor, always pretransected at the true center (i.e., 0.00 of va). lines had different durations that were linearly spaced from 1000 to 3000 ms at 200 ms intervals (i.e., 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, and 3000 ms). the size of the pretransacted lines and the monitor distance were the same of the landmark task in order to keep constant the visual angle at the two viewing distances (60 cm and 120 cm). eight trials for each of the 11 different intervals were randomly presented, yielding a total of 176 trials, 88 in the near space and 88 in the far space. trials began with the presentation of a blank (black background) for 750 ms, after which the line stimuli were presented. one of 11 lines with different durations (range 10003000 ms) was displayed and then replaced by a blank (black background), which remained visible until a response was made. after the response, a black - and - white patterned mask stayed on the screen for a random duration (range 5001500 ms) before the subsequent trial was presented (see figure 1). the time bisection task consisted of the verbal classification of a series of pretransected lines that were displayed for different durations at the center of the computer screen. participants were instructed to verbally judge (forced - choice) whether the duration of each line was short or long with respect to previously acquired pair of reference durations (1000 ms and 3000 ms). before administering the experimental task, the practice session served to familiarize participants with the two reference durations presented in random order. in this session ten practice trials were displayed and participants had to classify five intervals of 1000 ms as short and five intervals of 3000 ms as long. all participants reached at least 80% of accuracy with no more than two practice sessions. after the experimenter had ensured participants were confident with the practice session, all the eleven lines with different durations were presented in random order during the experimental task. participants were required to classify each line duration as short or long and to make their best guess if they were unsure. the experimenter was seated behind the participants (at least 1 m) and recorded participants ' verbal responses by pressing one of two keys on a keyboard (q for short and p for long). the task in the near and in the far space took approximately fourteen minutes to complete. a psychophysical response function was created for each participant by calculating the proportion of long responses for each of the 11 line durations. the data were fit with cumulative gaussian function, whose mean (50% point) indicated the point of subjective equality (pse). the pse is the duration at which a participant is equally likely to classify the stimuli as short or long. for each participant, an increase of long responses after pa, as compared to baseline performance, induces a decreased pse, reflecting a relative shift towards overestimation of temporal midpoint (i.e., durations are perceived being longer with respect to before pa). conversely, an increase of short responses after pa, as compared with performance at baseline, induces an increased pse, reflecting a relative shift towards underestimation of temporal midpoint (i.e., durations are perceived shorter). accordingly, the pse allows us to observe whether pa caused a bias in their temporal judgment towards either an underestimation or an overestimation of durations in near and far spaces. the procedure, stimuli, and material conformed to well - established pa described in frassinetti. ' subjects were submitted to either the rightward prismatic goggles inducing a leftward aftereffect (rpa group, n = 32, 23 females ; mean age = 23.66 ; sd = 1.91) or the leftward prismatic goggles inducing a rightward aftereffect (lpa group, n = 32 ; 23 females ; mean age = 23.91 ; sd = 2.35). during pa subjects were seated at a table in front of a box (height = 30 cm, depth = 34 cm at the center and 18 cm at the periphery, width = 72 cm) that was open on the side facing the participants and on the opposite side, facing the experimenter. the box consisted in a plexiglas panel erected in a vertical and semicircular position and graduated by vertical lines spaced by 1 of va. the experimenter placed a visual target (a pen) at the distal edge of the top surface of the box, in one of three possible positions (randomly determined on each trial) : a central position (0), 21 to the left of the center, and 21 to the right of the center. subjects were asked to keep their right hand at the level of the sternum and to point toward the pen using the index finger of the same hand as quickly and as accurately as possible. participants were also instructed to make a ballistic movement and to correct any errors on the successive movement. participants could not see their hand when it was at the starting position and during the first third of the pointing movement to ensure effective adaptation. the pointing task was performed in three experimental conditions : preadaptation, adaptation, and postadaptation. in the preadaptation condition, the subjects performed two types of trials (total of 60 trials). on half of the trials, their pointing was visible to them (as in the adaptation condition). on the other half, the subjects were required to look at the target and then to point at it with their eyes closed, so that the pointing was not visible at any stage of the movement (i.e., invisible pointing as in the postadaptation condition, open - loop pointing). in the adaptation condition (total of 90 trials), the subjects performed the task while wearing prismatic lenses that induced a 10 shift of the visual field to the left (lpa) or to the right (rpa). participants could see the trajectory of their arm (i.e., visible pointing). in the postadaptation condition, immediately after prisms removal, the subjects were required to look at the target and make their pointing movements with their eyes closed as in the preadaptation condition (i.e., open - loop pointing ; 30 trials). therefore, for each participant the pses in the temporal and spatial tasks were separately calculated for each condition. kolmogorov - smirnov tests separately conducted for each group and experimental condition revealed that data were normally distributed (i.e., the tests of normality gave nonsignificant results). in order to explore pa effects on temporal and spatial judgments in the near and the far space, we ran a multivariate analysis of variance for repeated measures. manova would supposedly reduce the experiment - wise level of type i error compared to several separate analyses and allows for taking into account potential correlations among the dependent variables of different nature (here expressed in milliseconds and degrees of visual angle). the manova was performed on the average pses measured in the landmark and the time bisection tasks, considering as within - subject factors space (near, far) and session (pre - pa, post - pa), and as between - subject factors prisms (lpa, rpa). post hoc paired t - tests with the appropriate bonferroni correction were conducted, where necessary, unless otherwise specified. partial eta squared and cohen 's d are used to report effect size. as preliminary analyses failed to find any significant effect of age, education, or edinburgh scoring, these factors are not considered further here. the multivariate analysis revealed a significant multivariate main effect for space, wilks ' =.823, f(2, 61) = 6.55, p =.003, and p =.18. overall in the landmark task, post hoc analysis showed a negative pse value in the near space, indicating that participants perceived the middle of the line towards the left of the true center (0.026), and a positive pse value in the far space, indicating that participants perceived the middle of the line towards the right (0.016, p.05). more important for the aim of the study, the manova found a significant multivariate interaction effect session by prisms, wilks ' =.667, f(2, 61) = 15.21, p.05). by contrast, both right- and left - deviating prisms biased symmetrically the pses in the time bisection task. indeed, lpa produced an overestimation of time durations as compared to a pre - adaptation baseline (post - lpa = 1860 ms ; pre - lpa = 1946 ms, p =.001, bonferroni corrected p =.006, and d = 0.6), whereas rpa produced an underestimation of time durations (post - rpa = 1964 ms ; pre - rpa = 1866 ms, p.05). finally, a series of pearson 's correlation analyses was performed to assess for possible relationships between the pses at baseline in the landmark and time bisection task for either prisms direction. additionally, a series of correlations was conducted to assess the relationship between the effects of pa on temporal and spatial pses by comparing the measures in the two tasks before and after rpa and lpa session. no significant correlation was found (all ps >.05). taken together these data indicate that, first, spatial judgments were influenced by the space wherein the stimulus to be bisected had been presented (near or far space). more interestingly, the midpoint judgments in the spatial and temporal bisections were affected in a different fashion by pa, regardless of the space where the stimuli had been displayed. namely, only lpa induced a rightward shift in the perceived midpoint of the line, whereas both rpa and lpa biased spatial representation of time toward an underestimation and overestimation, respectively. the absence of any interaction involving the space factor shows that the two different spatial representations (near and far space) did not enforce any differences in the shifts produced by pa, as indexed by the pses measured in the temporal and landmark tasks. that is, the effects of prismatic adaptation procedures on time and spatial processing occurred in both near and far spaces in a similar manner. to make sure that any potential differences in time and space estimation before and after prism session were due to pa, we assessed the presence of both error reduction (i.e., the tendency to compensate for prism - induced error in pointing during pa) and aftereffects (i.e., the subsequent tendency to point in the direction opposite to the visual displacement induced by prisms, after goggles removal). pointing displacement measures (expressed as degrees of visual angle, va) carry a negative sign () when directed to the left and a positive sign (+) when directed to the right with respect to the target actual location. to demonstrate the presence of pointing errors, in the first trials, and of error reduction, in the last trials of pa condition, participant 's pointing performance during preadaptation and adaptation condition if prism adaptation procedures were effective, a difference should be found between the first trials of the adaptation condition and the preadaptation condition, but no difference should be found between the last trials of the adaptation condition and the preadaptation condition (error reduction). in order to verify if participants showed an error reduction as they adapted to the prisms, an anova was performed on the mean pointing measures, with prims (lpa, rpa) as a between - subject factor and condition (preadaptation measures, first three trials of the adaptation measures, and last three trials of the adaptation measures) as a within - subject factor. the anova was followed by post hoc (two - tailed) t - tests for which the appropriate bonferroni correction was applied for each prism group. effect size is indicated as partial eta square or cohen 's d. the anova revealed a significant main effect of the between - subject factor prisms, f(1,62) = 572.92, p.05). this provided a profile of the direct effects of prismatic displacement, which reflects trial - by - trial error reduction. to test for the presence of aftereffect, open - loop pointing measures were compared between the postadaptation and the preadaptation conditions. if pa produced a visuomotor bias opposed to deviation induced by prism, a leftward (rightward) error during open - loop pointing should be found when right (left) prismatic goggles have been removed. we conducted an anova with prisms (lpa, rpa) as the between - subject factor and condition (preadaptation and postadaptation) as the within - subject factor, in order to test this prediction. the main effect of prisms, f(1,62) = 321.81 ; p <.001 ; p = 0.84, and its interaction with condition, f(1,62) = 599.28 ; p <.001 ; p = 0.90, were significant. the open - loop pointing measures in the postadaptation condition differed from the open - loop pointing measures in the preadaptation in rpa (pre - rpa = 0.025, post - rpa = 4.509, p <.001, and bonferroni corrected p <.001) as well as in lpa (pre - lpa = 0.396, post - lpa = 4.517, p <.001, and bonferroni corrected p <.001). since the sign of the sensorimotor aftereffects depends upon the direction of the prisms, we also assessed whether the amount of sensorimotor adaptation was similar for the two groups by submitting the absolute value of the shift to a repeated - measures mixed anova with prisms (lpa, rpa) as a between - subject factor and condition (pre- and post - pa) as a within - subject factor. in this anova only a main effect of condition emerged, f(1,62) = 334.91 ; p <.001 ; p = 0.84 (pre - pa = 0.732, post - pa = 4.513). this analysis revealed no interaction prisms by condition, suggesting that both pa groups were equally adapted and that the amount of sensorimotor adaptation was comparable in the two prism groups. finally, to assess whether there was any correlation between an individual participant 's shift in pse and the amount of sensorimotor aftereffects or error reduction in pointing, we computed separate pearson correlation analyses between the absolute value of aftereffect or error reduction and subject 's performance in the time bisection and the landmark task for each prism direction., data analysis on pa procedure demonstrated that both groups compensated, during prism adaptation, for prism - induced spatial errors in pointing (error reduction) and that, after prisms removal, they pointed in the direction opposite to the visual displacement induced by prism (aftereffect). the main purpose of this investigation was to examine whether the plastic effects on spatial and temporal processing following rightward and leftward prismatic adaptation are generalizable across near and far space. given a considerable body of evidence suggesting, at least, two independent representations of space based on action potentiality, here we went on to ask whether temporal and spatial modulations induced by pa extend beyond the space near the body. the first main finding is that manipulation of pa - induced effects influences temporal and spatial judgments not only in the immediate spatial region within which the adaptation occurs (near space), but also in the sector of the space farther away and beyond arm 's reach (far space). the second one is that lpa induces a significant modulation on spatial and temporal task, whereas rpa only acts on the temporal, but not on the spatial task. this pattern of results suggests that the effects induced by pa on representations of space and time are the same along the sagittal near - far axis, but different along the horizontal left - to - right axis. therefore, we shall first discuss the results of pa modulation found in near and far space and then the asymmetrical effect of orienting spatial attention leftwards and rightward on space and time representations, and we shall finally try to understand the reason of such differences. the finding that the attentional shift after adaptation, which occurred within the near space, may alter spatial - time representations in the two sectors of space in a similar fashion is the novelty of the study. indeed, examining literature on prismatic adaptation, the visuospatial effects of this procedure in far space were investigated by frassinetti and colleagues in neglect patients and by berberovic and mattingley in neurologically healthy individuals. as regards clinical population, the efficacy of rpa in alleviating spatial attentional symptoms in neglect patients who, following a lesion of the right hemisphere, showing a deficit in orienting attention to the contralesional hemispace, has been already demonstrated [6164 ]. frassinetti and coworkers revealed that a training of two weeks with rpa induced a long - lasting amelioration of neglect symptoms both in the near and in the far spaces, as assessed by two different behavioral and ecological tasks. specifically, to explore the presence of neglect in the far space a room description task was used, in which patients were asked to name the items (e.g., window and chair) displayed symmetrically on the left and on the right wall of a room (3.6 2.2 m). as a consequence of the beneficial effects of pa procedure, the number of omissions on the left side was reduced after the two weeks of training with rpa. as far as healthy individuals, berberovic and mattingley found that left - shifting prisms induced a post - pa rightward shift on estimates of visual center for stimuli appearing in far space in the landmark task. relevant to the present study, the same authors also showed a surprising rightward, instead of leftward modulation, as it would have been expected, in the far space only. however, there are several substantial dissimilarities between the study by berberovic and mattingley and our own that could potetially explain such a discordant result. one important difference concerns the experimental procedure and methods adopted. at odds with our study, in berberovic and mattingley 's work both participants and screen were moved between blocks, line stimuli appeared displayed centrally on the screen, or displaced slightly to the left or right, and all the participants used bimanual responses in the landmark task. moreover, half of the sample used the left hand, and half used the right hand in the adaptation session. we can not therefore exclude that these procedural differences might have brought discrepant results. from a statistical point of view, and still contrary to our study, the data obtained from the landmark task in the berberovic and mattingley 's study were analysed separately for the lpa and rpa groups through two one - way repeated - measures anovas. more importantly, our sample is twice as large as that of berberovic and mattingley and this further allowed us to perform an omnibus manova that we believe more powerful and suitable analysis for our study. albeit differences in experimental procedures could have contributed to this different statistical result, we wish to emphasize that in a larger sample we did not replicate this finding. by visual inspection, in our sample there is a tendency towards a rightward shift in the far space, which does not reach significance. furthermore, as in berberovic and mattingley 's study and previous studies [16, 28, 60 ], we found no linear correlation between the sensorimotor and cognitive aftereffects following adaptation. indeed, it has already been established that the two aftereffects were uncorrelated in magnitude (i.e., the amount of sensorimotor aftereffect does not predict the amount of spatial modulation or its magnitude), and this finding is reminiscent of the lack of correlation between pointing errors and line bisection performance in neglect patients following prisms adaptation. the lack of any significant relationship supports the idea that the changes found on the landmark and time bisection tasks are not directly related to the sensorimotor aftereffect. pa might indeed act at both sensorimotor and cognitive levels, but the link between the two different measures might not be a linear association and might imply more complex relationships. nevertheless, the finding that temporal and spatial changes following the procedure of adaptation are similar across representational spaces is in agreement with the hypothesis that pa - induced effects may be mediated by the oculomotor systems [6567 ]. indeed, during prismatic procedure participants perform a series of pointing movements, which relies on a form of visuomotor coordination between the hand and eye. since movements are deviated toward the side of prismatic lenses, to compensate for the visual field displacement participants implicitly deviate their motor programs toward the left or right, thereby implementing a leftward or rightward recalibration into their sensorimotor systems. due to the eye - hand coordination during pointing task, a deviation of eye movements in the direction opposite to the prismatic shift is expected. provided that the areas involved in eye movements (area 8) and in eye movement programming (lip) might contribute to far space representation [68, 69 ], the effects of pa in far space is compatible with a potential shift of the oculomotor system following the procedure of adaptation. since the direction of eye movements can influence spatial representation, shifting oculomotor system can also impact the exploration on the horizontal mental time line, thus resulting in a modulation produced by pa on time representations, too, in near space as well as far space. the second interesting result of the current study is that pa differently affects spatial and time processing, as indexed by comparing the landmark and the time bisection tasks. more in detail, lpa effects were found in landmark as well as in time bisection tasks, whereas rpa effects were limited to time bisection task. indeed, in the spatial domain the effectiveness of pa in modulating spatial cognition has also been proven to be unidirectional in both pathological and neurologically healthy populations. only rpa has been demonstrated to act on neglect symptoms and, by contrast, only lpa has been so far reported to be effective in healthy individuals miming a neglect - like behavior. accordingly, most of the studies investigating pa in healthy subjects did not find any significant plastic effects of rpa on spatial processing. because of the lack of a significant leftward spatial modulation after rightward prism adaptation in nonclinical population, rpa has become the standard procedure for studies examining lpa - induced effects on spatial processing. moving on to a possible explanation of such a null effect, some authors considered the null result regarding the effects of rpa in terms of a simulation of neglect in neurologically healthy individuals. given that neglect syndrome is more likely to occur after right rather than left lesions, inducing a rightward bias of spatial attentional orientation, it has been put forward the hypothesis that the asymmetrical effects of lpa and rpa on spatial processing might reflect an inherent bias of the brain 's structural organization in directing attention to the right. thus, some reports hint that neglect and pseudoneglect may share common cognitive and neural mechanisms, as they appear to be two sides of the same coin. in other words, spatial performances of healthy participants after leftward prismatic adaptation could be considered as correct approximation of a neglect - like behavior, with common main characteristics (e.g., directional bias and directional specificity of pa). moreover, regarding pa effects on time processing, our results are in line with previous findings in healthy subjects. in fact, both pa directions symmetrically alter time processing and the directional bias observed after pa depends on the direction of the prismatic deviation. after rightward optical deviation inducing a leftward aftereffect, participants show a significant underestimation of perceived time, relative to before pa. furthermore, after leftward optical deviation inducing a rightward aftereffect, participants report a significant overestimation of perceived time. thus, results from time bisection task are consistent with the predictions of the anatomofunctional model of pa by pisella and coworkers, but the results from the line bisection task are not. this model hypothesizes that pa may act by hypoactivating the posterior parietal cortex contralateral to the direction of the prismatic deviation and this, in turn, is able to modify the interhemispheric balance involved in orienting spatial attention. the model provides a solid theoretical framework for understanding the functioning of adaptation procedures because it evokes the same mechanism to explain both rpa 's therapeutic effects in neglect (e.g., [59, 61 ]) and the induction of rightward (neglect - like) biases following lpa in healthy individuals (e.g., [16, 24 ]). according to this model, both prism directions are expected to modulate the contralateral posterior parietal cortex, and therefore both lpa and rpa should affect spatial processing in nonclinical population. in line with this account, here we stress the point that, although this symmetrical predicted modulation has not been demonstrated for the space domain yet, the expected effects are here found in the time domain, since we observed that leftward and rightward prism adaptation induced opposite plastic effects on time representations. indeed, the finding that leftward- and rightward - deviating prisms had a different impact on intact spatial cognition was not an unexpected result. as mentioned above, it has been largely demonstrated that pa procedures have an asymmetric action on visuospatial cognition in both patients and healthy individuals. the same studies showing that lpa affects spatial processing in healthy participants have reported no effect of rpa [16, 2427 ], even though the sensorimotor aftereffects (the hallmark of pa) induced by both lpa and rpa have comparable magnitudes and opposite directions. this negative evidence in the literature concerning the absence of rpa effects on intact spatial processing contrasts with the prediction of the anatomofunctional model proposed by pisella and colleagues. here, we concur with the results of the previous studies, in that the model is not supported for the spatial domain. in spite of this, the prediction of the model is confirmed in temporal cognition, which has been shown to be directionally modulated by both pa directions, thus providing partial support to pisella. remarkably, these findings are also in accordance with the proposed pa 's mechanism of action on time processing. 's model, in the absence of manipulation of spatial attention, in healthy individuals real time and perceived time are aligned at the beginning of a temporal duration. the leftward shift of spatial attention via rpa, by shifting the spatial representation of the mental time line leftwards, produces a backward perception of elapsing time. because of this bias, participants underestimate time durations : the passage of time flow of the perceived duration beats more slowly than the real duration. because of the rightward shift of attention following lpa, time seems to speed up and participants overestimated time durations (see figure 3). hence, we wonder why we did not find a similar symmetric modulation caused by the same attention manipulation on two so well - interrelated domains that are space and time. although the exact nature of pa aftereffects is unclear, in order to explain the asymmetrical effects induced by pa procedure, we propose that temporal and spatial representations are not perfectly aligned, and thereby the attentional plastic changes caused by pa could enforce this different alignment between the two representations. a simple approach for testing for the hypothesis of misalignment between spatial and temporal processing is provided by correlation analyses. it does not indeed appear to exist any consistent correlation between the spatial and temporal measures of the landmark and time bisection tasks. note that correlation only looks at linear relationships, as pearson 's correlation is a measure of a linear association between two variables, whereas the nature of this cross - domain association may be much more complicated than a linear one. there may be a need for further and more focused research on this open issue. within this ever - growing interest for the understanding of these phenomenological dimensions, we directly assessed the plastic changes induced by a very well - known spatial attentional manipulation onto representations of time and space. despite the lack of previous evidence in literatures comparing pa modulation in temporal and spatial processes, the reading of research from space - time interactions seems to suggest that, although tightly intertwined, the two domains may also differ in several respects. for instance, while most physical quantities can be represented in an ascending and a descending manner, perceived time always runs in the same direction (the anisotropy of time). along the same lines, whereas time is therefore one - dimensional, space is instead three - dimensional. admittedly, when talking about time, one should take into account that our understanding of this domain could go far beyond simple spatially based concepts of duration according to a specific direction being ascending from left to right. time encompasses many different aspects, including, for example, ordinality (e.g., what comes before versus after) and sequentiality (e.g., first versus second) or historical aspects (e.g., 1960s versus 1980s). some of these proprieties of time might rely on a left - to - right horizontally oriented spatial representation [9, 7779 ], but other aspects might not. some scholars have also found evidence for the cognitive reality of front - back spatial representation of time with the past mapping to the back and the future mapping to the front. furthermore, the iteration of day and night and yearly seasons is not captured by the mental time line, so that some cultures around the world have developed cyclic time models. additionally, we can use complementary, multiple spatial metaphors to understand the elapsed time and temporal relations, considering that time is not a monolith, but rather a mosaic of constructs (for a review). consistent with this view, even though the domains of space and time are closely interconnected and rely on shared neural resources, they also involve distinct structures and circuits. atom does indeed propose a shared neural substrate for representing and manipulating magnitudes but also acknowledges that the representation of all magnitudes may involve additional domain - specific neural substrates. along the same line of reasoning, atom 's supporters proposed that all magnitudes are not created equal. indeed, interactions between space and time may be asymmetrical, such that, for instance, spatial cues may have a larger effect on temporal judgments than temporal cues do on spatial judgments. there is considerable research demonstrating selective influences of the domain of space on the domain of time, but not corresponding influences in the other direction [75, 81, 83, 84 ]. so, although the atom framework does not explicitly predict spatial - temporal asymmetrical interactions, the model is in principle compatible with asymmetries that derive from differences in the domains themselves. for all these reasons, at the moment, it is premature to provide a definitive account of the cross - domain temporal - spatial interactions given the complexity of each phenomenology of space and time. coming back to the purpose of the present study that is to directly compare spatial and temporal alterations after pa in the near and the far space, here we underline the two main findings. the first one is that pa acts in a similar fashion on spatial and temporal processing of stimuli on the sagittal axis (near / far). the second one is that the shift of attention along the horizontal axis (left / right) differently affects space and time. in this respect, it is important to note a difference when we consider sagittal near / far axis and horizontal left / right axis. indeed, near and far are referred to as a physical distance from the body, whereas left and right are referred to as a mental spatial - temporal representation. once prismatic adaptation has acted on this spatial - temporal representation, thus inducing different effects on space and time dimensions according to leftward / rightward attentional shift, the changes due to this manipulation may be extended to all the physical distances. | a large literature has documented interactions between space and time suggesting that the two experiential domains may share a common format in a generalized magnitude system (atom theory). to further explore this hypothesis, here we measured the extent to which time and space are sensitive to the same sensorimotor plasticity processes, as induced by classical prismatic adaptation procedures (pa). we also exanimated whether spatial - attention shifts on time and space processing, produced through pa, extend to stimuli presented beyond the immediate near space. results indicated that pa affected both temporal and spatial representations not only in the near space (i.e., the region within which the adaptation occurred), but also in the far space. in addition, both rightward and leftward pa directions caused opposite and symmetrical modulations on time processing, whereas only leftward pa biased space processing rightward. we discuss these findings within the atom framework and models that account for pa effects on space and time processing. we propose that the differential and asymmetrical effects following pa may suggest that temporal and spatial representations are not perfectly aligned. |
spleen and lymph nodes (lns) are respectively involved in the filtration of blood and lymph flow, and immune responses are induced by the activation of lymphocytes and natural killer (nk) cells, which is dependent on antigen presenting cells (apcs) including dendritic cells and macrophages. lymph nodes are beanlike nodules that are usually < 1 cm in size, but they are spread throughout the entire body, and their total weight corresponds to that of a single organ. lns are also located around the tumor nodule in many kinds of malignant tumors (fig. lymph nodes are composed of an outer cortex and a central medullary part with a space referred to as the ln sinus that is filled with lymphatic fluid in which a number of macrophages are distributed.1, 2 of these ln regions, antigens in the lymphatic fluid first reach the ln sinus, where ln sinus macrophages phagocytize pathogens, foreign substances, and abnormal antigens derived from tumor cells that flow into the lymphatic fluid. these substances are also captured in dcs localized in follicular and paracortex area. the ln sinus large tumor nodules (indicated by black arrowhead) are located in mucosa and muscularis propria, and lymph node (indicated by green arrowhead) is seen in subserosa. (b) serial sections of a human ln were immunostained for cd68 (panmacrophage marker) and cd169. subcapsular sinus macrophages and medullary sinus macrophages are positive for cd68 and cd169 in humans (top). comparison of mouse ln macrophage f4/80 and cd169 staining with human ln cd68 and cd169 macrophage staining is shown at the bottom. cd169 is expressed on both subcapsular sinus macrophages and medullary sinus macrophages in the mouse ; however, the staining pattern of f4/80 (panmacrophage marker) in mouse subcapsular sinus macrophages differs from that of cd68 staining of these macrophages in humans. macrophages are professional phagocytes, and have long been considered to be involved in innate immune responses. it is well established that many macrophages are distributed in lymphoreticular organs including spleen and lns.3, 4 macrophages are detected in the subcapsular sinus, the medullary sinus, and the medullary cord, and, according to animal studies, their functions and phenotypes are somewhat different in each location.5 ln sinus macrophages are known to express the surface antigen cd169. cd169 is a type i lectin with a molecular weight of 185 kda, which specifically recognizes sialic acidcontaining sugar chains.6 while cd169positive macrophages are mainly found in the lns and spleen, cd169positive macrophages are also found in the intestinal tract, liver, and bone marrow, although only in small numbers.7 macrophages detected in the subcapsular sinus and the medullary sinus of lns express cd169 (figs 1b,2a) ; however, macrophages in the medullary cord of both rodent and human lns are negative for cd169. in addition, there tends to be more macrophages in the medullary sinus than in the subcapsular sinus in human lns compared to rodent lns (fig. human sinus macrophages also express programmed cell death 1 ligand 1 (pdl1), cd163, cd204, and fascin, and are negative for cd11c which is a marker for dendritic cells (fig. ln sinus macrophages expressed pdl1, cd163, and cd204 in almost all cases, although the expression of cd169 showed individual variation. since there are no research studies focused on the functions of these antigens expressed on sinus macrophages, the functional mechanisms of these antigens in sinus macrophages have been uncovered. pdl1 is known to be expressed not only on tumor cells but also on macrophages, and pdl2 is also expressed on macrophages.8, 9 blocking pd1pdl1/2 signal might enhance antigen presentation of sinus macrophages to lymphocytes in ln, although further studies are necessary to elucidate the functional significance of pdl1/2 on macrophages in antitumor immune response. (a) serial sections of a human ln were immunostained for cd68, cd169, and pdl1. (b) serial sections of a human ln were immunostained for cd68, cd169, cd204, cd163, fascin, and cd11c. antitumor immunity is observed to a greater or lesser degree in patients with malignant diseases, and the induction of antitumor immune responses is considered to be one of the factors related to the effectiveness of conventional antitumor chemotherapy.10, 11 in the cases of malignant diseases other than hematological malignancies, tumorantigenloaded apcs are considered to induce antigenspecific tcell responses and generate cytotoxic t lymphocytes (ctls) in lns, therefore the lns are thought to be important for the establishment and the maintenance of antitumor immune responses.12, 13 there are many macrophages in the subcapsular sinus of the ln, which, as mentioned above, is located in the first line for incoming lymph. sinus macrophages in the ln engulf antigens via several receptors including scavenger receptors (fig. 2),14, 15 and are considered to present antigenderived peptide to t and blymphocytes. the critical role of ln macrophages in antitumor immunity of lns, is evidenced by recent studies using animal models. it is well known that subcutaneous injection of dead tumor cells induces tumorantigen specific ctls. by exploiting this phenomenon, and by using genetically modified mice in which cd169positive macrophages were specifically depleted by diphtheria toxin, asano.13 demonstrated that cd169positive subcapsular sinus macrophages in lns are preferentially involved in antigenpresentation and the induction of ctls. additionally demonstrated that not only dendritic cells but also cd169positive subcapsular sinus macrophages induced ctl responses. notably, by using an adenoviral particle selectively trapped in marginal zone cd169positive macrophage and cd11cdtr mice, they found that dendritic cells induced ctls that react to strongly binding epitopes whereas macrophages generated ctls that react to a broader range of epitopes.16 the potential role of cd169 in these events was investigated, and cd169 has been considered to contribute to the uptake of sialylated antigen and to be useful as a target of antigen delivery for vaccine.17, 18 however, the result that ctl responses to tumor cells were not different between wild type mice and cd169deficient mice indicated that cd169 function was not of great importance for immune reactions to tumor cells.13 muraoka.19 demonstrated that chp nanogelconjugated tumor antigen was specifically engulfed by medullary sinus macrophages, induced antigenspecific ctls and suppressed tumor development. these findings indicated that medullary sinus macrophages, in addition to subcapsular sinus macrophages and dendritic cells, also functioned in antigen presentation. thus emerging data related to the significance of cd169positive subcapsular and medullary sinus macrophages in the generation of ctls pucci.20 demonstrated that subcapsular sinus macrophages engulfed melanomaderived extracellular vesicles and subsequently suppressed the induction of protumor bcells. they suggested that subcapsular sinus macrophages act as a physical barrier to b cell activation under specific circumstances. with regard to bcell function in tumor development, coussens 's group reported that b lymphocytes and humoral immunity are involved in tumor development through the activation of m2 or protumor myeloid cells,21, 22 and they also showed that a b celldepleting cd20 monoclonal antibody improved response to platinum and taxolbased chemotherapy in squamous cell carcinoma.23 cell interaction between protumor b lymphocytes and ln macrophages ; however, ln macrophagemediated b lymphocyte activation might be a novel target for antitumor immunotherapy. although several studies using murine models have indicated the significance of ln macrophages in antitumor immune responses and tumor progression, there have not been many studies describing correlations between ln macrophages and antitumor immunity or tumor progression. a high number of infiltrating lymphocytes (especially cd8positive cells) into tumor tissues or of circulating lymphocytes in peripheral blood have been reported to be related to favorable clinical prognosis in several malignant tumors.24, 25, 26, 27 recent studies also demonstrated that higher infiltration of cd8positive lymphocytes into the tumor microenvironment is correlated with a higher rate of pathological complete response in breast tumor treated with neoadjuvant chemotherapy.28, 29 these findings indicate that cd8positive cytotoxic lymphocytes (ctls) are the critical mediators related to antitumor immune responses in human tumors ; however, it has not yet been discovered how ctls are generated in tumor patients. based on the above findings, it was suggested that the number and proportion of cd169positive macrophages in ln sinuses reflect the tumor immunocompetence of tumor patients ; however, the association between human cd169 and antitumor immunity has not been analyzed. therefore, in order to verify whether or not an antitumor immune mechanism is linked to cd169positive macrophages in humans, we analyzed the correlation of cd169positive macrophages of regional lns to antitumor immune reactions and clinical prognoses in human colorectal tumors.30 cd169 expression in human ln sinus macrophages was immunohistochemically analyzed ; however, interestingly, it was found that the cd169positive rate in lymph node sinus macrophages differed widely from case to case. in other words, in contrast to mouse cases, cd169 expression in ln sinus macrophages was nearly negative in some human cases. a statistical analysis of the postoperative survival rate and clinicopathological factors of the cd169 high and cd169 low groups, which were based on the cd169 expression level in the lymph nodes (fig. the results showed that an increased density of cd169positive macrophages in the sinus area and higher percentages of cd169positive cells in cd68positive sinus macrophages were significantly correlated with higher t stages, nonln metastasis status, and, notably, high cd8positive lymphocyte infiltration into primary tumor tissues. patients with a higher density or percentage of cd169positive macrophages showed significantly better overall survival. the density of cd68positive macrophages in ln sinus was associated to neither any clinicopathological factors and the density of ctls. these observations suggested that cd169 expression in sinus macrophages was closely involved in the induction of antitumor immune responses and exerted a beneficial effect on the clinical course. (a) scatter diagrams of the number of cd68 and cd169positive macrophages (left) and the ratio of cd169+:cd68 + macrophages (right) in the ln sinus. the value of the cd169+:cd68 + macrophage ratio in the ln sinus indicated the variation of cd169 expression in individuals. (b) cases with high cd169 expression in ln sinus macrophages showed high infiltration of cd8positive ctls and better clinical course, and vice versa. these phenomena were observed when the cases were divided into high or low cd169 expression groups based on median cell numbers or based on the cd169+:cd68 + ratio. however, cases with intermediate cd169 expression are also seen and it might be difficult to strictly classify these cases into either a high or low cd169 expression group. we subsequently carried out similar research using resected samples from patients with melanoma and endometrial tumors.31, 32 similar to the study of colorectal tumors, higher expression of cd169 in ln macrophages was significantly associated with better clinical course in patients with melanoma and endometrial tumors. the density of cd68positive macrophages in ln sinus was associated to neither any clinicopathological factors and infiltration of immune cells in melanoma and endometrial tumors as well as that in colorectal tumors. in endometrial tumors, increased density and percentage of cd169positive ln macrophages correlated well with higher density of infiltrating cd8positive lymphocytes and cd57positive natural killer cells in primary tumor tissues, and with lower clinical stage and nonln metastasis. in melanoma, although there was no significant association between cd169 expression and clinical stages, increased percentage of cd169positive ln macrophages showed a strong link with a higher density of infiltrating cd8positive lymphocytes in primary tumor tissues and nonln metastasis. in our studies in three kinds of tumors, neither gender nor age was associated with either the density or the percentage of cd169positive ln macrophages. at the present time, similar studies are underway to examine the correlations between cd169 expression in sinus macrophages and clinicopatholocal factors including the number of infiltrating effector cells. in our in vitro studies using human monocytederived macrophages, cd169 expression was found to be induced by type 1 interferon (ifn),30 consistent with a previous report.33 however, this observation was inconsistent with data of rodents in which cd169 expression was not affected by ifn.34 therefore, we next examined which cells in lns express type 1 ifn. since an antibody suitable for immunohistochemistry of ifn is commercially available, we immunostained ifn in ln samples. although positive ifn reactions were observed in some of the ln samples, positive signals were detected on cd68positive and cd169negative macrophages that are not morphologically similar to sinus macrophages. it has been suggested that the immunological condition related to ifn production by these cells affects cd169 expression and the capacity of antigen presentation to effector cells. ifn signaling is known to be closely related to antitumor responses, and single nucleotide polymorphisms in type 1 ifn receptor genes were reported to be associated with altered overall survival of patients with glioma.35 therefore, genetic background also potentially influences ifn signaling in lns. a number of methods have been investigated for targeting antigen to ln macrophages as part of the development of future lymphatictargeted vaccines. shiku h. and his colleagues reported that vaccines of a tumor antigen (nyeso1, her2, and magea4) complexed with cholesteryl pullulan (chp) nanogels induced cd8 and cd4positive lymphocytes and antibody production that specifically reacted to antigen in tumor patients, and thereafter vaccination using chp nanogels induced tumor regression in some patients with malignant tumors.36, 37, 38, 39, 40, 41, 42 in these studies, increased antibody reactions to vaccinated antigens were showed to predict the efficacy of antitumor immune responses. in addition, antigen spreading following vaccination was also observed in around half patients treated with chp nanogels.43 as described above, chp nanogels were found to be preferentially engulfed by the medullary sinus macrophages of the ln. thus, these observations indicated the significance of ln sinus macrophages in the development of antitumor immune responses. chen.,17 using newly developed sialic acidconjugated liposomes that successfully deliver antigen to cd169positive macrophages, stimulated the production of antigenspecific t cells. cd169targeting liposomes with lipid antigen induced activation of inkt cells in a cd1d dependent manner.44 reddy.45 demonstrated that nanoparticles that were smaller than 25 nm in size flowed in lymph vessels and reached the ln sinus in which nanoparticles are phagocytosed by cd11cpositive dendritic cells, whereas the targeting efficacy of nanoparticles that were 100 nm in size was very low. although they had never evaluated the macrophages in the article, smallsize nanoparticles seemed to be trapped by sinus macrophages in the picture figure.45 nanoparticles with cyclic dinucleotides (which are an agonist of the stimulator of ifn genes) and peptides were successfully delivered to macrophages and dendritic cells in lns and induced a greater expansion of peptidespecific cd4positive t cells ; moreover, tumor development was significantly reduced by vaccination.46 thus a lymphatictargeted vaccine is considered to be a promising approach to improving vaccine efficacy, and cd169positive macrophages are now of interest as apc to which antigens might be efficiently delivered. since the efficacy of antigen delivery using biomaterials is dependent on the size and the nature of the surface molecules / ligands, it is necessary that methods to deliver antigens and adjuvants to apcs in lns are developed in further studies. tumorassociated macrophages (tams) infiltrating into tumor tissues are well known to promote the proliferation and metastasis of tumor cells, and a high density of tams in primary tumor tissues has been reported as a poor prognostic factor in many tumors.47, 48 unlike tams, ln sinus macrophages have antitumor activity via the induction of antitumor ctls and are important cells for tumor immunotherapy ; thus the phenotype and functions of macrophages in patients with a malignant tumor differ in their distribution (fig. 4). antigen delivery targeting ln macrophages is also considered to be a promising approach for vaccination. immunotherapy using immune checkpoint blockers is of interest for new antitumor therapy ; however, there are few biomarkers for evaluating antitumor immune responses. the evaluation of cd169positive macrophages in lns might be useful for evaluating the status of antitumor immune responses and for predicting the effect of antitumor therapy such as chemotherapy and immunotherapy. (left) tams have protumor functions and a high density of cd163 (a marker of protumor macrophages)positive tams has been reported as one of the predictive factors for worse clinical prognosis in many malignant tumors. (right) cd169positive ln macrophages are considered to crosspresent tumor antigens to effector cells. a high density or percentage of cd169positive ln macrophages has been demonstrated to be one of the predictive factors for better clinical prognosis in colorectal cancer, melanoma, and endometrial cancer. | the lymph node (ln) is an important immune system in which a number of antigenpresenting cells are present that induce rapid immune responses to foreign antigens. while a great number of macrophages exist in lymph nodes, recent studies using animal models have shown that lymph node sinus macrophages are associated with the induction of antitumor immunity, playing a significant role in host immune responses against tumor cells. in colorectal tumor, malignant melanoma, and endometrial tumor, it was shown that a high density of cd169positive macrophages in the ln sinus was a predictive factor for better clinical prognosis. the observations that the density of cd169positive macrophages in the ln sinus was positively associated with the density of infiltrating t or nk cells in tumor tissues, indicates the significance of cd169positive macrophages in antitumor immune reactions of tumor patients. moreover, antigen delivery targeting ln macrophages is also considered to be promising approach for vaccination. in this article, we have summarized the significance of cd169positive ln macrophages in antitumor immunity. |
chronic inflammatory diseases of the airways such as asthma and copd are no exceptions [1, 2 ]. for better detection of blood vessels, specific stains are needed as haematoxylin and eosin alone are not specific enough. the most commonly used tissue vessel markers in studies of the respiratory tract have been antibodies against collagen iv and factor viii, cd31 (en-4) and cd34. both glycol methacrylate (gma) processing and paraffin embedding are superior to other methods for investigation of vessels in tissue samples. factor viii antigen is produced by endothelial cells and is physiologically involved in platelet aggregation and adhesion [5, 6 ]. a number of studies have reported factor viii antibody as a reliable marker for blood vessel detection. however, it has been reported that factor viii antibody also stains megakaryocytes, mesenchymal tissue, and immune cells in addition to endothelial cells [4, 8 ]. the efficiency of factor viii antibody for detecting blood vessels has also been shown to be related to the size of vessels [9, 10 ]. our group has had substantial experience in using collagen iv antibody as a blood vessel marker in bronchial biopsies (bb) [2, 1114 ]. collagen iv antibody delineates endothelial basement membrane [3, 4 ]. an optimal marker for blood vessels should be specific, independent of pathological changes in tissue (e.g., inflammation, malignancy, hypoxia, ischemia, shearing stress), resistant to the usual methods of tissue fixation and processing, open to detection of a variety of sizes (i.e., large and small) and ages (i.e., old and new) of vessels, and be able to detect different types of vessels, that is, capillary, vein, arteriole, and artery. it has been shown that under both physiological and pathological conditions, endothelial cells modify their antigen presentation, and most available histochemical markers do not fully meet these characteristics, but the pros and cons of different immunohistologic antibody systems have not been worked out in any detail. antibodies to collagen iv and factor viii stain different epitopes and indeed different structures in vessels, and the literature indicates that these markers for immunostaining of vessels do not uniformly detect vessels of different sizes and can vary in efficiency in pathological processes. therefore, we decided to compare the utility of anti - collagen iv and anti - factor viii antibodies as markers for blood vessels in bb from copd versus normal subjects and investigate what the differences are in the vessel profiles that they stain. based on our previous findings [1, 2 ], we would expect any results in this study to apply generally to smokers as well as copd. permeability of mucosal vessels in asthma has been reported to be increased and to correlate with clinical deterioration. vascular endothelial growth factor (vegf) increases vascular permeability to blood water along with proteins. we have reported increased vessel - related vegf in the rbm of copd airways with the changes most marked for current smoking copd patients. therefore, it is also reasonable to study vessel leakiness in the rbm of bronchial wall in current smoking copd subjects. the study was approved by the human research ethics committee (tasmania) network, and all subjects provided written informed consent. lung function tests were performed according to ats / ers guidelines. fiberoptic bronchoscopies and endobronchial biopsies 2 paraffin - embedded sections of 3 m and 50 m apart mounted on apts - coated slides were used. following dewaxing and hydration, sections were subjected to heat retrieval using dako s1700 for 20 minutes (except albumin which did not require epitope retrieval), and then endogenous peroxidase was quenched using 3% hydrogen peroxide for 15 minutes. sections were incubated in primary antibodies for either von willebrand factor (factor viii - related antigen) (dako m06160), type iv collagen (dako m0785) (both at 1 : 150 for 90 minutes) (figure 1), or albumin (abcam ab 2406) 1/6000 for 30 minutes at 20 degrees celsius. for negative controls, matched sequential sections were stained with primary antibody, replaced with a species - appropriate igg1 isotype, at equivalent dilutions and conditions. a horseradish peroxidase (hrp) conjugated dako envision plus (dako k4001) reagent was used for secondary antibody binding and dab plus (dako k3468) for color resolution (brown). sections were dehydrated in ethanol, cleared in xylene, and mounted in permount prior to analysis. measurements were performed using a computer - assisted image analysis tool (image - pro version 5.1, media cybernetics, usa). pictures of all intact and nonoverlapping areas were taken from each slide, and eight separate fields were chosen randomly for measurements to have on average 3 mm of the rbm in our measurements as we did in our previous report. the histologist (as) who performed the measurements was blinded to the diagnoses and order of slides, which had been independently randomly sorted and coded. to be constant, we used the same methods for measurements so as to be able to compare the results of this current study with our previous report. vessels in the reticular basement membrane (rbm) and down to a depth of 150 m of the subepithelial lamina propria (lp) from the antilumenal margin of the rbm were measured separately. only well - formed cylindrical or tubular structures that were stained with immunostaining antibodies were measured as vessels to avoid including nonvascular cells in analyses (figure 1). these data were normalized by dividing by the length of the rbm or dividing by the surface area of the lp examined. mean vascular size (mvs) was calculated as total vascular area / number of vessels. the area of the lp excluded mucous glands and muscle. for vessel permeability, using image - pro 5.1 again, the percentage of compartment tissue area stained for albumin was measured separately in the rbm and lp in current smoking copd and normal controls and the results expressed as a percentage (m of tissue stained/m tissue examined 100). finally, the percentage area of perivascular albumin staining was measured within the 10 m perimeter around vessels (to avoid overlapping of areas) in both the rbm and lp. the data from the two methods of vessel staining were tested for agreement using the method reported by bland and altman. very briefly, by this latter method, the means of the two measurements are plotted against the differences between the two measurements. the 95% limits of agreement (loa = mean of differences 2 standard deviations (sd) of differences) were calculated for every measurement. for comparison of means between two groups or between two methods of staining, student 's t - test was used for variables with normal distribution and the mann - whitney test for nonnormally distributed variables. all continuous data were presented as median (interquartile range), except for the data that are included in agreement between the two methods of vessel staining which were presented as mean 2 standard deviations. pearson 's or spearman tests were used to test correlations for normally and nonnormally distributed variables, respectively. thirty - six subjects participated in the study. table 1 summarizes the demographics. the 28 copd subjects were balanced between 15 current smokers and 13 ex - smokers. the most important characteristics of agreement between the two methods of vessel staining are summarized in table 2. bland and altman plots show that anti - collagen iv antibody detected higher number of vessels and larger mvs in the rbm and lower number of vessels but again larger mvs in the lp compared with anti - factor viii antibody in all study groups (figure 2). this was also the case for the copd group analyzed separately (figure 3). for bland and altman plots, values on the y axis in figures 2 and 3 were calculated as measurements with collagen iv staining minus measurements with factor viii staining. comparing the means of the absolute number, area and mvs of rbm vessels stained by the two immunostaining methods confirmed our results with the bland and altman plots ; there were significantly greater number, area, and mvs of vessels with anti - collagen iv antibody than with anti - factor viii antibody both when all subjects were tested together and when the copd group was tested alone (figure 4). in the lp, comparison of the means showed that the differences between two methods of blood vessel staining were significant for area and mvs but not for the number of vessels (figure 5). when copd subjects were compared to controls, copd had significantly more vessels in the rbm and fewer vessels in the lp with both collagen iv and factor viii antibody staining (figures 6 and 7). significantly, more tissue was stained for albumin in the rbm in current smoker copd than controls (median (interquartile range), m/m presented as percent, 0.37% (1.68) versus 0.00% (0.20), p = 0.02). but perivascular albumin in the rbm or lp and albumin staining in the lp were not significantly different between two groups. number of rbm vessels stained with anti - factor viii antibody correlated negatively with forced vital capacity (fvc) only in ex - smokers with copd (spearman r = 0.8, p = 0.002). we did not find any suggestion of a relationship between either age or pack - years smoking and vascular or permeability changes in the copd group. this study showed that anti - collagen iv antibody tends to stain more vessels in the rbm and bigger vessels overall in both the rbm and lp, while anti - factor viii antibody stains relatively smaller vessels. it has previously been shown that vessel markers can have different sensitivity and specificity in detecting vessels in normal versus abnormal conditions. for example, factors such as genetic diversity in endothelial cells, hypoxemia, age, and shearing stresses have effects on the expression of factor viii protein [10, 20, 21 ]. the sensitivity and specificity of these markers are also related to the size of vessels [9, 22 ]. indeed, our data are consistent with a previous report showing that staining for factor viii can not detect larger - sized vessels as accurately as smaller ones in invasive breast cancer. but this type of differentiation has not previously been attempted with airway wall samples ; although our previous work did show that there was a shift to greater number and smaller vessels in the lp in asthma. anti - collagen iv antibody consistently detected larger vessels in the rbm than factor viii antibody. in the lp, the agreement between the two methods was best when vessels were relatively smaller, so that as the mvs increased, there were increasing differences between the two methods, with anti - collagen iv again demonstrating larger mvs than anti - factor viii (figures 2 and 3). the literature would suggest that smaller vessels are likely to be disproportionately newer vessels, while larger vessels are likely to be older and more mature or even an in vivo study on mice showed that new vessels in airways, formed under angiogenic stimulation by vegf, had detectable pericytes and basement membrane by day 7. when the newly formed vessels were deprived of vegf, firstly the flow of blood stopped, followed by death and then fragmentation of endothelial cells, and finally apoptosis of pericytes. this emphasizes that different markers will demonstrate vessels better or worse depending on their age, maturity, and growth factor environment. we would propose that in conditions where we expect active new vessel formation, such as active asthma or malignancies, anti - factor viii antibody may detect these newer vessels better than anti - collagen iv antibody. this could also be potentially useful in evaluating the effects of treatments on vascular regression, for example, the effects of inhaled corticosteroids on vessels in the airways. in contrast, vessels which are larger and probably older are more effectively detected when stained with anti - collagen iv antibody rather than with anti - factor viii antibody. on this basis, however, we can not explain why the number of rbm vessels is significantly increased with anti - collagen iv compared to anti - factor viii antibody ; we rather expected the data to be the other way round, that is, more new and younger vessels. we suggest that this could be the result of a high number of aged vessels with well - formed endothelial basement membrane where the endothelium has sufficiently matured to lose its factor viii antigens. a novel and especially interesting finding of this study was increased leakiness of the vessels in the rbm in current smoking copd. however, in contrast to our hypothesis, we did not find a correlation between albumin staining in the rbm and vessel - associated vegf (data obtained in our previous study). leak of plasma and its protein material could provide an appropriate environment for angiogenesis by extravasation of fibrinogen and formation of a fibrin gel. therefore, this finding is compatible with the hypervascularity of the rbm we have demonstrated in copd. the consequence of having leaky vessels just below the epithelium in copd is ripe for speculation and further study, but, at the very least, it may contribute to fluid and protein flux into the airway lumen and add to the mucus volume and constituents. this has never previously factored into the concepts of the pathogenesis of smoking - related airway disease pathophysiology. both collagen iv and factor viii immunostaining of bronchial biopsies in this study confirmed our previous findings of hypervascularity of the rbm and hypovascularity of the lp in the copd group compared to the control group. the negative correlation between fvc (likely to reflect predominantly small airway narrowing) and rbm vessels emphasizes the potential functionally detrimental effect of vascular remodeling in the bronchial mucosa in copd. larger and probably more mature vessels were detected better by anti - collagen iv antibody, while smaller and probably newer vessels were detected better by anti - factor viii antibody. increased permeability of vessels in the rbm of current smoking copd subjects could be related to the hypervascularity of this compartment and add to its potential functional significance. both anti - factor viii and anti - collagen iv antibodies confirmed hypervascularity of the rbm and hypovascularity of the lp in the copd bronchial mucosa compared to normal. | background and objective. using collagen iv staining, we have previously reported that the reticular basement membrane (rbm) is hypervascular and the lamina propria (lp) is hypovascular in copd airways. this study compared collagen iv staining with vessels marked with anti - factor viii and examined vessel permeability in bronchial biopsies from copd and normal subjects using albumin staining. results. anti - collagen iv antibody detected more vessels in the rbm (p = 0.002) and larger vessels in both rbm (p < 0.001) and lp (p = 0.003) compared to factor viii. copd airways had more vessels (with greater permeability) in the rbm (p = 0.01) and fewer vessels (with normal permeability) in the lp compared to controls with both collagen iv and factor viii antibodies (p = 0.04 and p = 0.01). conclusion. rbm vessels were increased in number and were hyperpermeable in copd airways. anti - collagen iv and anti - factor viii antibodies did not uniformly detect the same vessel populations ; the first is likely to reflect larger and older vessels with the latter reflecting smaller, younger vessels. |
silk fibroin (sf) is a natural polymer produced by a variety of insects and spiders. the best characterized silks are the dragline silk from the spider nephila clavipes and the cocoon silk from the domesticated silkworm bombyx mori, which has been used in textile production clinical sutures, and more recently as a scaffold for tissue regeneration [13 ]. bombyx mori silk is composed of a filament core protein, silk fibroin, and a glue - like coating consisting of a nonfilamentous protein, sericin. sf is characterized by repetitive hydrophobic and hydrophilic peptide sequences and consists of heavy and light chain polypeptides of ~390 kda and ~26 kda, respectively, linked by a disulfide bond at the c - terminus of the two subunits. the primary structure of bombyx mori sf protein is characterized by the presence of three amino acids in a roughly 3 : 2 : 1 ratio : glycine (45%), alanine (30%), and serine (12%) ; and the sequence is dominated by [gly - ala - gly - ala - gly - ser]n. sf chains also contain amino acids with bulky and polar side chains, in particular tyrosine, valine, and acidic amino acids. the repetitive sequence in hydrophobic residues dominates the -sheet structure, forming crystalline regions in sf fibers and films. hydrophobic regions of silk fibroin in aqueous solution assemble physically by hydrophobic interactions and eventually organize into hydrogels. silk fibroin exhibits impressive mechanical properties as well as biocompatibility making it an attractive biomaterial and scaffold for tissue engineering. the fibroin protein is one kind of biological materials used for artificial skin and other medical applications. as a result of its biodegradability, sf was evaluated for several biomedical applications. in one example, sf - based films with a thickness of 10100 m were developed for acceleration of wound healing and could be peeled off without damaging the newly formed skin. as such, the application of wound protective membranes made from sf was investigated. sf is considered a suitable material for skeletal tissue engineering because of its good oxygen and water - vapor permeability and its minimal inflammatory reaction in vivo [6, 9 ]. as reported previously, fibroin hydrogel scaffolds were prepared from sf aqueous solution with addition of 30% glycerol to promote in situ bone regeneration. also, sf was investigated as the substratum for the culture of animal cells in place of collagen. in another application, the aqueous sf solution was used to prepare a membrane for immobilization of aspergillus niger, glucose - oxidase, and pseudomonas fluorescens lyophilized cells. a novel biocompatible blend was prepared from recombinant human - like collagen (rhlc) and used as a scaffold material for hepatic tissue engineering applications. solution blending was used to incorporate rhlc with sf to enhance the blend films biocompatibility and hydrophilicity, while maintaining elasticity. in yet another demonstration of sf utility, three - dimensional microperiodic scaffolds for tissue engineering were produced from aqueous solutions of regenerated bombyx mori silk. the scaffolds supported human bone - marrow - derived mesenchymal stem cell (hmsc) adhesion and growth. sf was studied as an organic polymer for controlled drug delivery, in which dextrans of different molecular weights, as well as proteins, were physically entrapped into the drug delivery device during processing into films. the release behavior of benfotiamine, a vitamin b1 derivative, from sf gel was investigated. microspheres were fabricated from an aqueous sf solution by laminar jet break - up flow and were investigated as a platform for controlled drug delivery. the assembly process was reported for sf particles loaded with small molecule model drugs, such as alcian blue, rhodamine b, and crystal violet, produced by an all - aqueous salting out process, and it was demonstrated that the release kinetics of crystal violet is dependent on the secondary structure of the sf particles. we attempted to design an oral drug delivery system based on the ability of sf to undergo conformational transition from a random coil to a -sheet form to induce crystallinity and produce an interpenetrating network (ipn). several different approaches to develop a sf - based drug delivery system were used : (1) film and matrix casting with varying composition of sf, gelatin, glycerin and the model drug, and (2) spray drying of sf / model drug solution. multiple factors were evaluated for their effect on sf -sheet formation, including solvents, sf molecular weight, silk source, and so forth. the aim of our study is also to understand the silk fibroin processing and control of structure in connection with design of a controlled release matrix. cocoons of bombyx mori silkworm silk were kindly provided by m. goldsmith (university of rhode island, usa). low mw (~14 kda) sf powder was supplied by lalilab (raleigh, usa). raw silk fiber (grade 5a, bombyx mori silk) was purchased from ria international llc (east hanover, nj, usa), and fibro - silk powder (mw ~ 100 kda) was purchased from arch chemicals, inc (atlanta, ga, usa). both sephadex g-25 (medium grade) and sodium carbonate were purchased from j. t. baker (austin, tx, usa). naproxen sodium was supplied by rochem international, inc (ronkonkoma, ny, usa). sodium dodecyl sulfate and calcium chloride dihydrate were purchased from spectrum chemical (new brunswick, nj, usa). lithium bromide, calcium nitrate, and potassium bromide were purchased from sigma - aldrich (st. louis, mo, usa). gelatin (type b, 150 bloom limed bone, nf) was obtained from rousselot (france). glycerin (usp, kosher, vegetable - based) was obtained from proctor and gamble (cincinnati, oh, usa). all other chemicals were of analytical or pharmaceutical grade, were purchased from sigma - aldrich, and were used without any additional purification. silk fibroin aqueous stock solutions were prepared as described previously with some modifications [16, 18 ]. briefly, cocoons, silk powder, or grade 5a raw silk were boiled several times for 1 hour in aqueous solutions of 0.02 m na2co3, or 0.25% naco3/0.25% naso4 mixture, rinsed thoroughly with distilled water to remove the glue - like sericin proteins and dried. dry degummed silk fibers were then dissolved in one of the following neutral solutions of libr, ca(no3)2 or cacl2, and then the resulting solution was dialyzed against distilled water using a slide - a - lyzer dialysis cassette (mwco 3500, pierce) or cellulose membrane tube (mwco 60008000, sigma - aldrich) at room temperature to remove the salt. the final concentration of sf aqueous solution was determined by weighing the residual solid of a known volume of solution after drying at 60c for 2 days. based on this determination, the concentration of the silk protein was approximately in the range of 3 to 4% (w / v). to prepare films, sf solution was transferred to a polystyrene weighing boat and allowed to dry for several days at room temperature in a desiccator. sf / gelatin films were prepared by mixing the sf solution with gelatin blends, consisting of gelatin, plasticizer, and water, and dried in a polystyrene weighing boat at room temperature in a desiccator for several days. separation of salts and sf protein was performed using a sephadex g-25 media column as described in the literature with some modifications. sf powder was dissolved in a triad solvent of cacl2 : etoh : h2o with a mole ratio of 1 : 2 : 8, at a concentration of 14.4% (w / w), at 6080c, and stirred for 46 hrs until fully dissolved and the stock sf solution was diluted in deionized water to reduce sample viscosity. to a 7.3 g of sephadex g-25 (medium grade) 42.6 g water was added allowing the sephadex to swell for at least 3 hours then the slurry was packed by gravity flow of deionized water (2 - 3 bed volumes) in a 50 ml glass burette. conductivity of eluent flow was measured until 3 consecutive fractions (10 ml each) tested 98% salt removal in < 2 hrs.) shown herein for sephadex column chromatography provide a promising alternative to conventional sf purification by dialysis. purification of sf solutions by sephadex g-25 column chromatography could be an effective and industrially scalable chemical process. however, further optimization and analysis need to be performed for utilizing sf in pharmaceutical development. in addition, sephadex media can be flushed and reused, thereby reducing development costs associated with purification of sf solutions. sf is dominated in composition by the amino acids glycine, alanine and serine which tend to form antiparallel -sheets or crystals through hydrogen bonding and hydrophobic interactions. upon gelation many factors such as temperature, sf concentration, shear force, metallic ions, ca, ph, treatment with low dielectric constant solvents and poly(ethylene oxide) [21, 26 ] are thought to affect the conformation transition. with increase in sf it is well known and reported in the literature that the addition of methanol to sf induces aggregation (dehydration), which drives the structural transition from random coil to -sheet. it was demonstrated [28, 29 ] that upon methanol - induced crystallization, the sf -sheet network stabilizes sf / gelatin hydrogels at elevated temperatures. the transition of regenerated sf films from random coil to -sheet has been reported after treatment with methanol, ethanol, and 2-propanol. it was also demonstrated that the rate of gelation of sf was dependent upon glycerol content and/or sf content and addition of glycerol to the sf solution accelerated this rate. in our research, we investigated the effect of dehydrating solvents (methanol, ethanol, isopropyl alcohol, and glycerin) on formation of -sheets in sf / gelatin blends and demonstrated that the treatment with glycerin is also effective for the transformation of silk i to ii which is in agreement with the literature data. the presence of glycerin in the matrix can trigger -sheet induction as seen from table 3 at the ratio of sf / gelatin ~1 : 1. since the -sheet formation did not occur in experiments with sf - to - gelatin ratio of 1 : 3, it is suggested that the ratio of sf to gelatin is also critical for the -sheet formation. in the presence of glycerin, for the sf / gelatin 1 : 1 blend, untreated films exhibit the absorption bands characteristic of the -sheet structure. in this case the ftir spectra possess strong absorption bands at 1625.9 cm1621.8 cm and 1536 cm1531.9 cm, corresponding to the amide i and amide ii peaks, respectively. the induced crystallization of sf - containing films had an impact on the release profile of the model drug naproxen sodium as evidenced by dissolution studies performed on naproxen - sodium - loaded films. it was shown that no burst effect was observed for matrix containing sf : gelatin : glycerin in the ratio of 1 : 3 : 3 compared to films containing gelatin alone or silk : gelatin (1 : 1.5) only which released almost 80% of the drug within the first 15 minutes (figure 2). the influence of glycerin - induced sf / gelatin crystallization on structure and properties was ascertained by dissolution studies of sf containing controlled release matrixes (figure 2). the -sheet content in the sf matrixes was assessed by ftir and illustrated in figure 8. two maxima on spectra reflect the characteristic bands of noncrystallized biopolymer (gelatin) in the matrix and crystallized sf. the amide i peak, which reflects the stretching of c = o group along the sf backbone, is shifted from 1655 to 1630 cm, while the gelatin exhibit, the absorption band at 1654 cm (amide i). release behavior of the model drug at different loading from spray - dried microparticles was studied using 3-stage dissolution testing conditions. in our study it was observed that the release profile was not dependant on the naproxen - to - sf ratios in the range of 3 : 1 to 1 : 1 or treatment with dehydrating solvent (ethanol) demonstrating that spray - drying method accelerated the transition from random coil to the -sheet structure of microparticles, which is in agreement with the literature data. our data obtained from naproxen - loaded, spray - dried microparticles, matrices, and films demonstrated a promising approach for creating a new platform for controlled drug delivery. it has been demonstrated that the conformational transition of sf from random coil to -sheet in blends with gelatin obtained by spray - drying or induced by solvents could be used to generate a porous matrix. the development of sf - containing blends in which sf is crystallized yields drug delivery system allowing for controlled release of the drug. further studies will be performed on sf - containing matrixes and microparticles to explore feasibility for delivering different classes of drugs, in particular macromolecular drugs for site - specific delivery. | the objective of this proof - of - concept study was to develop a platform for controlled drug delivery based on silk fibroin (sf) and to explore the feasibility of using sf in oral drug delivery. the sf - containing matrixes were prepared via spray - drying and film casting, and the release profile of the model drug naproxen sodium was evaluated. attenuated total reflectance fourier transform infrared spectroscopy (ftir) has been used to observe conformational changes in sf- and drug - containing compositions. sf - based films, spray - dried microparticles, and matrixes loaded with naproxen were prepared. both ftir spectra and in vitro dissolution data demonstrated that sf -sheet conformation regulates the release profile of naproxen. the controlled release characteristics of the sf - containing compositions were evaluated as a function of sf concentration, temperature, and exposure to dehydrating solvents. the results suggest that sf may be an attractive polymer for use in controlled drug delivery systems. |
as a unique family of g protein - coupled receptors, newfound protease - activated receptors (pars) are widely expressed on the cells in central nervous system (cns), including neurons and glial cells, regulating cell responses to extracellular serine proteases as cell surface sensors and contributing extensively to the regulation of homeostasis as well as to the dysfunctional responses of these cells required for progression of cerebral diseases. among the four pars identified to date, par-2 is a unique one activated by trypsin and mast cell tryptase while others (par-1, -3, and -4) activated by thrombin. the role of par-2, which is distributed extensively throughout the nervous system (including cns and peripheral nervous system), has been principally investigated in peripheral nervous system, where it is known to play major roles in injury, inflammation, neuronal signaling, and nociception [4, 5 ]. and the physiological role of par-2 in cns remains unclear but its activation has been shown to increase intracellular ca levels in both neurons and astrocytes [6, 7 ] as well as trigger the release of gliotransmitters such as gro / cinc-1 [810 ] and nitric oxide. recent group of evidence have revealed that par-2 contributes to neuroprotection and/or neurodegeneration in the brain under pathological conditions [1215 ]. therefore, par-2 has been suggested to be a novel therapeutic target for the treatment of brain disorders. tryptase, the major secretory protein of mast cells, is the natural agonist of par-2 and can stimulate peripheral mononuclear cells to secrete tumor necrosis factor - alpha (tnf-) and interleukin-6 (il-6) to induce widespread inflammation. although mast cells typically reside at barrier sites of the body such as the intestinal mucosa and blood brain barrier (bbb), silverman. found that mast cells can rapidly penetrate brain blood vessels and migrate into the neural parenchyma, implying an interaction between mast cells and nerve tissue cells. as the most abundant cells in brain parenchyma, astrocytes play pivotal roles in bbb integrity and cns function such as synapse formation, communication, cerebrovascular tone, adult neurogenesis, as well as neuroimmune. since par-2 is widely expressed in astrocytes and is recognized for the modulatory properties of neuroinflammation and neurodegeneration such as multiple sclerosis, its contribution to astrocytic functions remains to be elucidated. in the present study, we investigated the consequence of tryptase stimulation on (1) the astrocytic survival and proliferation ; (2) the production of il-6, tnf-, and reactive oxygen species (ros) ; (3) the involvement of mapks and pi3k / akt pathways in par-2 activation ; (4) the levels of potent neural cytokines transforming growth factor- (tgf-) and ciliary neurotrophic factor (cntf) generated by astrocytes. dulbecco 's modified eagle 's medium (dmem) and fetal bovine serum (fbs) were purchased from gibco - brl (grand island, ny, usa). poly - d - lysine, tryptase, sb203580, pd98059, sp600125, and ly294002 were purchased from sigma - aldrich (st. louis, mo, usa). dojindo cell counting kit-8 was purchased from sigma - aldrich (st. louis, mo, usa). rat il-6 immunoassay kit and rat tnf- immunoassay kit were obtained from r&d systems, inc. live green reactive oxygen species detection kit was purchased from molecular probes invitrogen (carlsbad, ca, usa). specific glial fibrillary acid protein (gfap) antibody (a marker for astrocytes) was purchased from sigma - aldrich (st. louis, mo, usa). specific monoclonal antibodies against p38, phospho - p38, sapk / jnk (c - jun n - terminal kinase), phospho - sapk / jnk, p44/42 mapk (extracellular regulated protein kinases, erk), phospho - p44/42 mapk (phospho - erk) and akt, and phospho - akt were obtained from cell signaling (beverly, ma, usa). specific polyclonal antibodies against tgf- and cntf were purchased from abcam (cambridge, ma, uk). confluent primary astrocyte cultures were prepared from sprague - dawley rats as previously described with slight modification. all animal procedures were performed according to the nih guide for animal care and approved by the institutional animal care and use committee. briefly, postnatal (p1-p2) rats were killed by rapid decapitation, cerebral cortices were triturated and cells were plated on poly - d - lysine precoated culture flasks in dmem, containing 10% fbs, 100 u / ml penicillin, and 100 mg / ml streptomycin. culture medium was replaced 24 h later and then changed every 2 - 3 days. after reaching a confluent monolayer of cells (1014 days), microglia were eliminated from astrocytes by shaking off for 5 h at 100 r.p.m. and astrocytes were replated in poly - d - lysine coated culture dishes, 96-well or 6-well plates. cell viability was measured by conversion of dojindo 's highly water - soluble tetrazolium salt wst-8 to a yellow - colored water - soluble formazan (cck8 assay). the amount of formazan dye generated by the activity of mitochondrial dehydrogenases in cells is directly proportional to the number of living cells. cells were collected and seeded in 96-well plates at a density of 10 cells / cm. after incubation for 48 h, cells were exposed to fresh medium containing various concentrations of tryptase (0.001, 0.01, 0.1, 1, and 10 g / ml) at 37c for further 24 h. then, 20 l of cck8 solution in pbs was added to each well and the plates were incubated for an additional 2 h. the optical density of each well was measured using a microculture plate reader at a 450 nm wavelength. the 2,7-dichlorodihydrofluorescein diacetate (dcfh - da) reagent passively enters cell where it is deacetylated by esterase to nonfluorescent dcfh. inside the cell, dcfh reacts with ros to form 2,7-dichlorofluorescein (dcf), the fluorescent product. for this assay, 10 mm of dcfh - da was dissolved in dmso and was diluted 500-fold in hbss to give 20 m of dcfh - da. enriched - astrocyte cultures seeded (5 10) in 96-well plates were then exposed to dcfh - da for 1 h at 37c in dark, followed by treatment with hbss containing various concentrations of tryptase for 2 h. after being rinsed twice with pbs, green fluorescence from dcf in cells was measured in the fl1 log channel through a 525-nm band - pass filter on the coulter epics xl / x1-mcl (beckman coulter company, miami, fl, usa). the amount of il-6 and tnf- in the culture medium was measured with commercial elisa kits from r&d systems, respectively. after incubation for 20 min on ice, cell lysate was centrifuged at 12,000 g at 4c for 10 min and protein concentration in the extracts was determined by the bradford assay. proteins in cell extracts were denatured with sodium dodecyl sulfate (sds) sample buffer and separated by 10% sds - polyacrylamide gel at 80 v for 2 h. then proteins were electrotransferred to nitrocellulose membranes at 300 ma for various time points by using a bio - rad miniprotein - iii wet transfer unit. the membranes were blocked with 5% bsa dissolved in tris - buffered saline with tween 20 (tbst) (ph 7.5, 10 mm tris - hcl, 150 mm nacl and 0.1% tween 20) at room temperature for 1 h. this was followed by incubating the membranes with different antibodies (anti - p38, -phospho - p38 ; -jnk, -phospho - jnk ; -erk, -phospho - erk ; -akt, -phospho - akt ; -tgf- at 1 : 800 dilution and -cntf at 1 : 1500 dilution) overnight at 4c, and finally incubated with a horseradish peroxidase - conjugated anti - rabbit igg for 1 h at room temperature. the significance of the difference between control and samples treated with various drugs was determined by one - way anova followed by the post - hoc least significant difference test. cell survival measured by cck8 analysis revealed that incubation with different dose of tryptase (0.001, 0.01, 0.1, 1, and 10 g / ml) for 24 h had no significant effect on astrocytic viability and proliferation. no impact was either observed in specific par-2 inhibitor fs (200 or 400 m), p38 inhibitor sb203580 (20 m), jnk inhibitor sp600125 (20 m), erk1/2 inhibitor pd98059 (20 m) and pi3k / akt inhibitor ly294002 (20 m) (figure 1). the results of the dcf assay indicated that incubation with tryptase at low concentrations (0.001 and 0.01 g / ml) for 2 h modestly inhibited the intracellular levels of ros, which was abolished by fs (400 m) (figure 2). the fluorescence of dcf in cells decreased to 83% (0.001 g / ml group) and 86% (0.01 g / ml group) of that in the control, and specific par-2 inhibitor fs diminished the effects of tryptase (0.001 g / ml) on ros generation in astrocytes, implying that activation of par-2 at low concentrations of tryptase is responsible for the inhibition of ros production. as shown in figure 3, incubation with tryptase at the dose of 0.001, 0.01, 0.1, 1, and 10 g / ml for 24 h produced a concentration dependent increase in il-6 secretion from primary cultured astrocytes with a minimum effective dose of 0.1 g / ml (figure 3(a)). meanwhile, tryptase (1 and 10 g / ml) also increased tnf- secretion at a minimum effective dose of 1 g / ml (figure 3(b)), but modestly inhibited tnf- secretion at the dose of 0.001 g / ml. par-2 inhibitor fs (200 and 400 m) was able to diminish tryptase (1 g / ml) induced il-6 and tnf- increase but itself alone (200 and 400 m) failed to affect il-6 and tnf- secretion from astrocytes (figures 3(a) and 3(b)), suggesting that tryptase is able to modulate the secretion of il-6 and tnf- from astrocytes via par-2. to investigate the involvement of mapks and pi3k / akt signaling pathways in the il-6 and tnf- secretion, we used pharmacological inhibitors of mapks and pi3k / akt. sb203580 is a pyridinyl imidazole compound which acts as a competitive inhibitor of atp binding on the p38 kinase and thus serves as a specific inhibitor of p38 mapks. pd98059 is a potent, selective, and cell - permeable inhibitor of mek1, which results in inhibition of the phosphorylation and activation of erk1/2. sp600126 is a potent, selective, reversible, and cell - permeable inhibitor of jnk, a ser / thr kinase that phosphorylates c - jun. ly294002 is a potent, selective, cell permeable, and specific inhibitor of pi3k / akt. as shown in figure 4, sb203580 (20 m), pd98059 (20 m), sp600125 (20 m), and ly294002 (20 m) alone did not have impacts on the secretion of il-6 and tnf- from astrocytes. tryptase (1 g / ml) induced il-6 increase was reversed by ly294002, but not by inhibitors of mapks (sb203580, pd98059, sp600125) (figure 4(a)). however, tryptase (1 g / ml) induced tnf- increase was reversed by sb203580, pd98059, sp600125, and partially by ly294002 (figure 4(b)), indicating that pi3k / akt signaling pathway contributes to the secretion of tnf- and il-6 induced by tryptase, respectively, whereas mapks signaling pathway is involved in the tryptase induced secretion of tnf-, but not il-6. in order to further understand the actions of tryptase on astrocytes tryptase at 1 g / ml activated p38 mapk, jnk, erk (p44/42), and akt, which was confirmed by increased phosphorylation of tyrosine residues of these kinases as determined by western blot analysis. the time course experiments showed that treatment with tryptase (1 g / ml) led to a rapid and transient phosphorylation of mapks and akt with the peak levels of phospho - p38, phospho - jnk, and phosphor - erk (p44/42) occurring at 30 min, and phospho - akt at 60 min, respectively (figure 5(a)). astrocytes were pretreated with par-2 antagonist fs (200 and 400 m) for 30 min and then exposed to tryptase (1 g / ml) for another 30 min or 60 min for detecting the phosphorylation of mapks and akt, respectively. par-2 antagonist fs alleviated tryptase - induced mapks activation but itself alone had no effect on the phosphorylation of mapks and akt in astrocytes (figure 5(b)), indicating that activation of par-2 by tryptase might be responsible for the activation of mapks and pi3k / akt. the time course study (incubation with 1 g / ml tryptase for 0, 30, 60, 120, 240 min) showed that tryptase significantly promoted tgf- expression in astrocytes, which began at 2 h and lasted at least until 4 h. however, an increase of cntf expression induced by tryptase (1 g / ml) initiated rapidly at 1 h following incubation and lasted at least until 4 h (figure 6). the enhancement in tgf- and cntf levels indicates that tryptase can induce endogenous production of tgf- and cntf, which probably contributes to neuroprotection. astrocytes, microglia, and endothelial cells are involved in the intracerebral immune response where they act, in part, by secreting cytokines, chemokines, neurotrophic or neurotoxic factors. among them, astrocytes play an essential role in neuronal life - support and contribute to the bbb. so in the present work, we put our focus on astrocytes with an emphasis on its potential role in the cytokine production involved in neuroimmune processes. in this study, we first found that tryptase is able to regulate cytokines release from astrocytes without affecting astrocytic viability and proliferation via par-2-mapks or par-2-pi3k / akt signaling pathway, revealing a novel profile of par-2 as a new target in the regulation of astrocytic function. tryptase, a major secretory protein of human mast cells, is an endogenous peptide which specifically activates par-2. incubation with tryptase at low concentrations (0.001 and 0.01 g / ml) modestly inhibited the intracellular levels of ros in astrocytes, indicating this protease is a potent factor to modulate astrocytes - derived ros. the specific antagonist peptide of par-2 fs diminished the effect of tryptase on ros generation, implying that the inhibition of the intracellular ros by tryptase might at least partially be responsible for the activation of par-2. in the brain, ros exerts a key role in normal physiological functions and neuroimmune responses [26, 29 ], and astrocytes are the important sources of ros. imbalance in the level of ros has been shown to be a causative factor in numerous pathologies such as ischemia / reperfusion injury and degenerative diseases [29, 30 ]. considerable amount of evidence suggests oxidative stress induced by astrocytes - derived ros is a crucial contributor to neurodegeneration [31, 32 ]. our current observation implicates that moderate stimulation of par-2 existed in astrocytes might regulate astrocytes - derived ros and supplies a new option for the management of cns functions. il-6 is a pleiotropic cytokine involved in the regulation of inflammatory and immunological responses, acute phase protein production, and hematopoiesis. there is increasing evidence supporting a role for the il-6 receptor family in cns development, as well as during neurodegeneration and regeneration. like many cytokines, il-6 may have distinct physiological effects at different concentrations and in different biological contexts. like il-6, tnf- now appears also to play an important role in neural plasticity and neurorepair [3638 ] in addition to its well established function as a proinflammatory cytokine. here we presented data investigating the consequence of par-2 activation by various concentrations of tryptase on il-6 and tnf- secretion from astrocytes. we found that tryptase administration produced a concentration dependent increase in il-6 and tnf- secretion with a minimum effective dose of 0.1 g / ml and 1 g / ml, respectively, suggesting that the stimulation of il-6 generation by tryptase is more sensitive than that of tnf- in astrocytes, which is distinct from the data obtained from microglia. since neuroinflammation could generate an environment detrimental for repair, alternatively it could also create an environment permissive for neurorepair, our findings implicate that mast cell tryptase is able to regulate the activity of astrocytes and the levels of neuroinflammatory proteins released from astrocytes such as il-6 and tnf- so as to modulate the balance between neuroinflammation and neurorepair. moreover, tryptase - induced il-6 and tnf- release from astrocytes appeared to rely on the activation of par-2 as a specific antagonist peptide of par-2 fs was able to block the action of tryptase on astrocytes. par-2 was identified to be expressed abundantly on astrocytes, par-2 activation in astrocytes has been demonstrated to play a key modulatory role in diverse pathological conditions [15, 41, 42 ], but the underlying mechanisms remain to be clarified. the intracellular downstream mapks have been demonstrated to be involved in the regulation of astrocytic function including the production of neuroinflammatory factors in astrocytes. indeed, our results showed that the intracellular signaling mechanisms that mediate tryptase - induced tnf- release rather than il-6 release from astrocytes are p38, jnk, and erk dependent, as sb203580, pd98059, and sp600125 all significantly eliminated tnf- release. as well, tryptase - induced tnf- increase was partly due to pi3k / akt signaling. similarly, pi3k / akt signaling is also responsible for the enhanced production of il-6, which is consistent with the finding previously reported. thus, our data provide new evidence that pi3k / akt signaling pathway contributes to the secretion of tnf- and il-6 induced by tryptase, whereas mapks signaling pathway is involved in the tryptase induced secretion of tnf-, but not il-6. in addition, since tgf- and cntf are potent neural cytokines with very low expression predominantly by astrocytes and both cytokines play very important roles in the modulation of cns function including neuroinflammation and neurorepair, the levels of tgf- and cntf expressed in astrocytes were determined in our study. we found that tryptase administration significantly upregulated tgf- and cntf expression in astrocytes initiated at 2 h and 1 h, respectively, implying that tryptase is as well potent to increase endogenous levels of tgf- and cntf which probably contribute to neuroprotection. cntf is almost exclusively produced in the nervous system and can rescue various types of adult cns neurons in disease models [4547 ]. our results not only reveal tryptase as a potent factor to regulate tgf- and cntf production in astrocytes but may also provide a novel therapeutic option to neurological disorders. obviously, more detailed work is required to address the issue further. in conclusion, to our knowledge, this is the first study to demonstrate the ability of mast cell tryptase in modulation of astrocytic activation and astrocytes - derived cytokine production via par-2. the implicated signaling mechanisms that mediate the actions of tryptase might be par-2-mapks or par-2-pi3k / akt pathways, providing a novel profile of par-2 as a new target in the regulation of astrocytic function. | protease - activated receptor 2 (par-2), which is abundantly expressed in astrocytes, is known to play major roles in brain inflammation. however, the influence of the natural agonist of par-2, tryptase, on proinflammatory mediator releasedfrom astrocytes remains uninvestigated. in the present study, we found that tryptase at lower concentrations modestly reduced intracellular ros production but significantly increased il-6 and tnf- secretion at higher concentrations without affecting astrocytic viability and proliferation. the actions of tryptase were alleviated by specific par-2 antagonist fsllry - nh2 (fs), indicating that the actions of tryptase were via par-2. pi3k / akt inhibitor ly294002 reversed the effect of tryptase on il-6 production, whereas inhibitors specific for p38, jnk, and erk1/2 abolished the effect of tryptase on tnf- production, suggesting that different signaling pathways are involved. moreover, tryptase - induced activation of mapks and akt was eliminated by fs, implicating that par-2 is responsible for transmitting tryptase biosignals to mapks and akt. tryptase provoked also expression of tgf- and cntf in astrocytes. the present findings suggest for the first time that tryptase can regulate the release of cytokines from astrocytes via par-2-mapks or par-2-pi3k / akt signaling pathways, which reveals par-2 as a new target actively participating in the regulation of astrocytic functions. |
fiber optic endoscopic evaluation of swallowing (fees) revealed severe oropharyngeal dysphagia with poor oral bolus control, premature spillage leading to predeglutitive aspiration, a severely delayed swallowing reflex, and residues in the epiglottic valleculae and in the piriform sinus, with solid and half - solid consistencies tested, leading to postdeglutitive penetration and aspiration (figure, c). (a) t1 gadolinium - enhanced axial mri shows no evidence of underlying brainstem or cranial nerve pathology. (b) no intrathecal immunoglobulin synthesis was observed in csf analysis using the reiber scheme. (c) fiber optic endoscopic evaluation of swallowing reveals postdeglutitive residue in the valleculae epiglotticae (3), on top of the epiglottis (2), and in the piriform sinuses (1). videofluoroscopic swallowing study showed poor oral bolus control and, as subsequently confirmed by high - resolution manometry, inadequate opening of the upper esophageal sphincter and ineffective esophageal peristalsis due to disharmonic and partially retrograde contractions. cerebral mri (figure, a) including contrast - enhanced high - resolution imaging of brainstem and cranial nerves was unremarkable. emg including repetitive nerve stimulation was normal without indication of a myasthenic reaction or myopathy. serum acetylcholine receptor antibodies, muscle - specific tyrosine kinase antibodies, and titin antibodies were negative (euroimmun ; lbeck, germany). screening for antiganglioside antibodies was negative. ct examination of the chest and abdomen with contrast agent showed no evidence of malignancy. screening for systemic autoimmune diseases and hematologic malignancy was negative. except for a probably irrelevant decrease in the serum / csf glucose quotient (0.4, reference value 0.60.9), no intrathecal immunoglobulin (ig) synthesis (figure, b) or isolated oligoclonal igg bands were observed and accordingly no antibody - producing plasma cells were found in the csf as revealed by flow cytometry. autoantibody screening was positive for iglon5 igg (+ + +, 1:1,000) serum levels but no other known neural autoantibody. csf was not analyzed for the presence of neural autoantibodies. however, as measured by the total igg ratio between csf and serum (0.003), relevant csf titers of iglon5 igg can be expected even by passive diffusion. sixteen days after admission, right - sided ptosis and peripheral facial palsy occurred, followed by respiratory deterioration necessitating orotracheal intubation and subsequent tracheotomy. subsequent fees revealed bilateral vocal cord palsy with complete glottis closure. ambulatory polysomnography (psg) (somnoscreen ; somnomedics gmbh, randersacker, germany) without videography and audiography was conducted in the intensive care unit (icu). it was applied according to american academy of sleep medicine (aasm) standard criteria (aasm scoring manual 2.0) including eeg (f4, c4, c3, o2, m1, and m2 electrodes), electro - oculography, emg (mental, both anterior tibialis muscles), cardiorespiratory recording (single - channel ecg, thoracic and abdominal respiratory movements [piezo ], transcutaneous oxygen saturation), and body position. sleep stages and associated events were scored according to suggested definition by sabater. at the time of psg, undifferentiated non - rem (nrem) sleep with frequent movement artifacts occurred during the first and second third of the night associated with recurring arousals with and without association with partly highly frequent periodic limb movements (92.2/h). normal slow wave sleep, predominantly occurring in the last third of the night, was associated with frequent spindles. rem sleep was reduced (1.5%) and showed bursts of muscle activity in mentalis and tibial anterior muscles, compatible with rem sleep without atonia. respiratory parameters were normal (apnea hypopnea index 0.9/h, oxygen desaturation index 0.2/h, mean oxygen saturation 98%, minimal oxygen saturation 91%, breathing frequency 17/min). due to the absence of video recordings, rem sleep behavior disorder or purposeful behaviors were not assessable but recurrent motoric artifacts especially during undifferentiated nrem might be suspicious for possible behavior during rem and nrem sleep. due to the detection of iglon5 igg, an immune - mediated neuropathy of the cranial nerves or brainstem pathology was suspected and a total of 5 cycles of plasmapheresis (treatment of 1.5 plasma volumes every other day) combined with iv methylprednisolone pulse therapy (1 g / d for 5 consecutive days) was initiated. this treatment led to mild improvement of vocal cord paresis and marked remission of ptosis and facial nerve palsy. after the patient was weaned from the respirator, fees revealed that although vocal cord paresis showed further improvement, severe pharyngeal dysphagia persisted. the patient was transferred to a rehabilitation unit with a tracheal cannula in place without any oral intake. nutrition was given via percutaneous endoscopic gastrostomy tube. at a follow - up visit 6 weeks later, dysphonia had substantially improved. speaking was loud and clear when the cuff was deflated and the cannula was manually closed. fees revealed that vocal cord paralysis had resolved and the patient was able to swallow her saliva without any problems. when given small amounts of liquids, the swallowing reflex was triggered ; however, the whiteout was shortened and weak, corresponding to a reduced laryngeal elevation and weak pharyngeal contraction. swallowing training started with small amounts of pudding textures, while nutrition was supplied by tube feeding. no relapses of ptosis, facial nerve palsy, or other focal neurologic deficit were observed. we present a case of a 77-year - old woman with slowly progressive neurogenic dysphagia as initial sign of anti - iglon5 syndrome. during the hospital stay, multiple cranial nerves, either peripheral or central portions, were affected, leading to ptosis and facial nerve palsy on the right side. instrumental dysphagia assessment revealed a complex pathophysiology involving the oral, pharyngeal, and esophageal phase of swallowing. the first case series of 8 patients with anti - iglon5 syndrome was published in 2014. since then, 4 additional cases have been published (table), all of which developed sleep abnormalities initially or during the course of the disease. none of the patients presented initially with bulbar symptoms, whereas 10 of 12 patients developed neurogenic dysphagia during the course of the disease. a patient with cranial nerve pathology evidenced by a bilateral ptosis was first reported in 2015. an overview of the clinical characteristics is provided in the table including published cases of anti - iglon5 syndrome until the present day. clinical features, treatment, and outcome in contrast to all other published cases, the patient presented here did not show any of the previously reported symptoms, such as gait instability or chorea. psg conducted in the icu revealed reduced sleep efficiency and the abnormal sleep architecture in nrem and rem sleep typically described in the anti - iglon5 syndrome. video recording was not available to assess abnormal behaviors during nrem or rem sleep. with regards to treatment options, iv immunoglobulins were applied in 4/13 patients, iv steroids in 9/13 patients, and rituximab in 3/13 patients. presented here, antibody depletion via plasmapheresis combined with immunosuppressive glucocorticoid therapy led to complete remission of ptosis, vocal cord paresis, and facial palsy, as well as partial remission of neurogenic dysphagia, making removal of the tracheal cannula possible during a follow - up visit. taken together, the exact role of iglon5 igg in the pathogenesis of the clinical presentations remains unclear. iglon5 is a neuronal cell adhesion molecule predominantly expressed in the adult and developing cns but expression by peripheral nerve or skeletal or smooth muscle has not been reported so far. the patients described so far have a broad variety of neurologic deficits as well as a heterogeneous disease course. treatment with immunosuppressants did not lead to sustained improvement in the majority of the published cases. a suboptimal psg, lack of confirmatory antibody testing, and the absence of hla studies are limitations of this study. the patient may have died before the syndrome had developed fully. in the patient described, the course of the disease and, in particular, the complete remission of most of the symptoms following antibody - depleting treatment may support the hypothesis of antibody - mediated effects as part of the underlying pathophysiology. anti - iglon5 syndrome constitutes another rare differential diagnosis in patients presenting with isolated slowly progressive neurogenic dysphagia. dr. schrder : study concept and design, acquisition of data, analysis and interpretation. dr. melzer : analysis and interpretation, acquisition of data, critical revision of the manuscript for important intellectual content. muhle : acquisition of data, critical revision of the manuscript for important intellectual content. warnecke : analysis and interpretation, critical revision of the manuscript for important intellectual content. dziewas : study concept and design, analysis and interpretation, critical revision of the manuscript for important intellectual content, study supervision. n. melzer received travel funding and/or speaker honoraria from biogen idec, glaxosmithkline, teva, and fresenius medical care ; spends 5% of his time performing immunoadsorption ; and received research support from fresenius medical care and diamed. t. ruck received travel funding and/or speaker honoraria from genzyme, novartis, biogen, and teva ; and received research support from genzyme and novartis. a. heidbreder received travel funding and/or speaker honoraria from air liquide, vital air, heinen+loewenstein, and ucb. i. kleffner received travel funding and/or speaker honoraria from csl behring and received research support from imf. t. warnecke received speaker honoraria from abbvie, teva, bayer, zamboon, and ucb ; and consulted for abbvie and ucb. r. dziewas served on the scientific advisory board for boehringer ingelheim, pfizer, bms, bayer healthcare, daiichi sankyo, nestle health science, nutricia, fresenius, and infectopharm ; received travel funding and/or speaker honoraria from boehringer ingelheim, pfizer, bms, bayer healthcare, daiichi sankyo, nestle health science, nutricia, fresenius, and infectopharm ; and received research support from the german research foundation. | objective : to report on dysphagia as initial sign in a case of anti - iglon5 syndrome and provide an overview of the current literature.methods:the diagnostic workup included cerebral mri, fiber optic endoscopic evaluation of swallowing (fees) with the fees tensilon test, a videofluoroscopic swallowing study, evoked potentials and peripheral nerve conduction studies, polysomnography, lumbar puncture, and screening for neural autoantibodies. a systematic review of all published cases of iglon5 syndrome is provided.results:we report a case of anti - iglon5 syndrome presenting with slowly progressive neurogenic dysphagia. fees revealed severe neurogenic dysphagia and bilateral palsy of the vocal cords. autoantibody screening was positive for iglon5 igg (+ + +, 1:1,000) serum levels but no other known neural autoantibody. polysomnography was highly suggestive of non - rem parasomnia. symptoms were partially responsive to immunotherapy.conclusions:slowly progressive neurogenic dysphagia may occur as initial sign of anti - iglon5 syndrome highlighting another clinical presentation of this rare disease. |
gitelman syndrome (gs) is a rare autosomal - recessive inherited disorder with 99% penetrance caused by inactivating mutations in the slc12a3 gene, localized on the 16q13 chromosome. this genetic defect impairs the function of the thiazide - sensitive sodium - chloride cotransporter in the distal convoluted renal tubule. gs is the hypocalciuric, hypomagnesemic variant of bartter syndrome, which was first described in 1966., we describe the management and pregnancy course of a 27-year - old patient with gs. we report the course of a pregnancy in a 27-year - old woman previously diagnosed with gs. her pregnancy was uneventful and she remained asymptomatic despite persistent hypokalemia. potassium levels were followed at a regular basis and ranged between 2.3 and 3.1 mmol / l (2.3 and 3.1 meq / l). she was electively admitted to hospital at 39 weeks of gestational age for full - term induction of labor. the patient received 240 meq of intravenous potassium chloride and 180 meq per oral, as well as 4 g of intravenous magnesium sulfate and 1200 meq of oral magnesium oxide. she was continued on 150 mg daily of eplerenone. despite aggressive electrolyte replacement, her potassium and magnesium levels ranged between 2.0 and 3.0 meq / l) and 1.1 and 2.6 mmol / l (1.1 and 2.6 meq / l), respectively. the baby was born healthy with 2863 g, and apgar measurements were 8 and 9 at 1 and 5 min, respectively. first described in 1966 by gitelman., gs is a rare autosomal - recessive condition characterized by hypokalemia, metabolic alkalosis and hypomagnesemia. it has since been shown to result from a mutation in the slc12a3 gene on chromosome 16 leading to a loss of function mutation in the sodium - chloride cotransporter in the distal convoluted tubule. this leads to potassium and magnesium wasting into the cortical collecting duct as the increase in delivered sodium is reabsorbed through the epithelial sodium channel. despite being normotensive aldosterone axis. to date, 24 pregnancies in 18 women with gs have been described in the literature [315 ]. twenty of the pregnancies had no reported fetal complication (table 1), six pregnancies were complicated by oligohydramnios [5, 8, 9, 12, 13 ] and one was complicated by intrauterine growth retardation. kaliuresis does not typically ensue presumably due to the antimineralocorticoid effects of progesterone demonstrated by ehrlich and lindheimer in 1972. de haan. have suggested that this protective mechanism may be impaired in gs patients thus resulting in an exacerbation of potassium and magnesium losses. the increase in the requirement for oral potassium during pregnancy has been documented by several authors including talaulikar. in 2005 who reported a 6-fold increase in potassium and magnesium requirements in their patient. mmol / l (3.64.0 meq / l) range [10, 14 ]. it has been suggested that normalization of potassium and magnesium levels is not required for a good obstetric and neonatal outcome. worsening of the symptoms of gs such as fatigue, cramping, tetany and dizziness has been described in the gs pregnancies [7, 12, 13 ]. the symptoms may be exacerbated by hyperemesis and fetal demand for potassium [9, 12 ]. worsening of symptoms is cited as a reason for the modification of therapy [3, 4, 611, 13 ]. our patient did not exhibit symptoms during her pregnancy, and we felt that intravenous potassium loading would be inefficient and unnecessary in the absence of symptoms. beyond the use of supplemental cations, the management of patients with gs has included the use of potassium - sparing diuretics. the us food and drug administration has deemed spironolactone a category c drug in pregnancy. this is consistent with the findings of mascetti. who describe a series of spironolactone - exposed children born to a group of mothers with bartter syndrome, another potassium - wasting nephropathy. the use of amiloride and eplerenone, both class b drugs in pregnancy, has been previously documented in gs [4, 9, 14, 15 ]. in contrast to bartter syndrome, the use of non - steroidal anti - inflammatory drugs (nsaids) to inhibit prostaglandin synthase is theoretically of no benefit as gs is not a hyperprostaglandinemic state. angiotensin - converting enzyme inhibitors are contraindicated in pregnancy due to teratogenic effects as well as impaired fetal growth. there has been a concern over the potential for a ventricular tachyarrhythmia during pregnancy and childbirth due to hypokalemia. fortunately, no such complication has been observed in any of the documented gs pregnancies. the extensive work of calo. in this area suggests however that the upregulation of the nitric oxide system and vasodilation seen in gs may limit the physiologic response to increased myocardial demand [19, 20 ]. it is also suggested in subsequent work that increased angiotensin 17 levels seen in gs may be antiarrhythmic at low levels and proarrhythmic at very high levels. the small number of documented gs pregnancies precludes any rigorously studied recommendations for management in the peripartum period. the anesthesia literature describes a risk of complications in gs patients in the perioperative setting. these include electrocardiographic changes as well as vasodilation, electrolyte imbalance and alkalemia complicating the ventilatory management of the patient. given the expected physiologic demands of labor and delivery, it appears that an elective, multidisciplinary approach to the delivery of the child is most prudent. baseline electrocardiography should be obtained as up to 50% of patients with gs have qt interval prolongation. frequent monitoring of electrolytes is advisable as is blood pressure monitoring given the propensity of gs patients have vasodilation. the postpartum period is associated with natriuresis ; however, this would not explain a drop in potassium during active labor. it may be, however, that the drop in serum potassium observed here is related to a shift in potassium from the extracellular to intracellular space as could be seen in any patient and is not unique to gs. in our patient pretreatment with a thiazide diuretic was associated with a more significant drop in serum potassium during epinephrine loading than that seen in the control group receiving epinephrine alone. as gs mimics the effects of thiazide diuretics, one could assume a similar effect in these patients. table 1.summary with the cases of gitelman syndrome during pregnancyauthorage at diagnosis (years)diagnosismaternal age (years)number of patientsnumber of pregnanciessymptomsjones jm. 17before pregnancy1) 24131st- asymptomatic except for tiredness in 3rd trimester2) 252nd- asymptomatic3) 273rd- asymptomatictalaulikar gs. 20before pregnancy1) 22121) increasing tiredness, muscle cramps. required 3 hospitalizationskwan. 2) n / abefore pregnancy1) 24211st- symptomatic, not specified2) 272nd- muscle weakness, fatiguede arriba g. 201st trimester (10 weeks)2011tiredness, muscle weakness, decreased muscle strength and tenderness bilaterally in lower extremitiesmccarthy fp. n / an / a1) 27561, 2, 3, 4) uneventful 5) tiredness and tetanic seizures2) 323) 284) 335) 33/35calo la. meq / l1.3 meq / lk and mg supplementationoligohydramniosinduced vaginal deliveryhealthy female infant, 2410 g36 weeksn / an / ak and mg supplementation1, 2 and 3) none1st- spontaneous labor1st- healthy male infant. 2620 g1st-35 weeks1st- k range = 2.32.8 mmol / l1st- mg range = 0.530.58 mmol / l1st- k and mg supplementation2nd- spontaneous labor2nd- healthy female infant, 2910 g2nd- 38 weeks2nd- maximum level = 3.1 mmol / l2nd- maximum level = 0.56 mmol / l2nd- k and mg supplementation3rd - spontaneous labor3- healthy female infant. n / a3rd- n / a3rd - n / a1) nonenormal deliveryhealthy infant1) n / ak range = 2.33.4 mmol / l1 and 2)n / a1 and 2) k and mg supplementation2) gestational diabeteselective c - sectionn / a2) 39 weeksn / anoneuncomplicated vaginal delivery, induced for post - term pregnancyhealthy female infant, 3250 g41 weeks and 4 daysn / an / ak and mg supplementation1st - oligohydramnios, partial placenta previa, intrauterine growth restriction.1st- primary c - section, healthy infanthealthy female infant, 3970 g1 and 2) 38 weeksn / an / ak and mg supplementation. healthy infanthealthy male infant, 3845 goligohydramniosprogrammed c - section, w / o complicationshealthy infant, 3000 gn / a2.42.8 meq / ln / ak and mg supplementation, spironolactone.oligohydramnioselective c - section (breech presentation)healthy female baby, 3350 g273maximum level = 3.0 mmol / lmaximum level = 0.68 mmol / lk and mg supplementationoligohydramniosinduced c - section (failure to progress in the first stage)healthy female baby, 2940 g266k range = 2.63.3 mmol / lmg range = 0.470.66 mmol / lk and mg supplementation, amiloride. supplementation of k and mgfetal macrosomia (patient had gestational diabetes)induced c - sectionhealthy male baby, 3080 gn / an / an / ak and mg supplementation, amiloride (1st trimester). supplementation of k and mg.nonevaginal deliveryhealthy female baby, 3630 g2732.62.9 mmol / ln / aepleronone1, 2, 3, 4 and 5) nonen / ahealthy male baby. 4080 g40 weeksn / an / ak and mg homeopathy k, amiloride k, mg none (1st pregnancy) / k (2nd pregnacy)healthy female baby, 3380 g38 weekshealthy female baby, 2420 g37 weekshealthy male baby. 2810 g41 weekshealthy male baby, 2830 g / healthy male baby, 2640 g38 weeks/36 weeks1 and 2) nonen / ahealthy female baby 2900 gat termn / an / a1 and 2) k and mg supplementationhealthy female baby 3125 g / healthy female baby 3400 gat term / at term summary with the cases of gitelman syndrome during pregnancy in conclusion, the experience of clinicians treating pregnant women with gs is limited but is also being described with more frequency. there is no evidence of significant risk to the fetus but maternal symptoms may worsen during the pregnancy. the management of gs should be focused on the replacement of potassium and magnesium though routine intravenous supplementation and should be reserved for cases of worsened symptoms. cautious use of adjunctive treatment with potassium - sparing agents should be considered as the potassium requirement may increase significantly during pregnancy. in addition to gs - related potassium and magnesium loss, hypokalemia can be exacerbated by cellular shift as well as extrarenal losses of cations which can affect any patient. no consensus recommendations exist for the perinatal management of the pregnant gs patient but an elective delivery in a setting with appropriate cardiac monitoring and central venous access is prudent as potassium and magnesium aberrations during active labor may be seen. | gitelman syndrome (gs) is an autosomal - recessive condition characterized by hypokalemia, hypomagnesemia and hypocalciuria. very little information is available in the literature to guide the management of pregnant patients with gs. we report a case of a 27-year - old woman with gs who became pregnant and despite persistent hypokalemia and hypomagnesemia during pregnancy and labor, had a successful maternal and fetal outcome. |
kimura 's disease (kd) is a rare benign disorder of unknown etiology, and is observed primarily in young asian men. kd may the result of an allergic or chronic inflammatory response, preferentially occurring in the head and neck. the clinical symptoms are usually manifest either as painless unilateral lymphadenopathy, predominantly in the head or neck region, or elevated serum immunoglobulin (ig) e and eosinophilia1,2). kd lesions usually precede or coincide with the development of renal disease2,8). early diagnosis and recognition of kd may spare both patient and doctor from the need for unnecessary invasive diagnostic procedures. in the present case, the patient exhibited an unusual case of kd, occurring during hemodialysis, involving the thoracic and abdominal lymph nodes, which resolved itself spontaneously, and nearly completely, after two months. a 45-year - old man was admitted for evaluation of a series of painless, firm, movable neck masses. he had received maintenance hemodialysis for 3 years, for end - stage renal disease resulting from chronic glomerulonephritis. hemodialysis was performed 3 times weekly for 4 hours per session, using polysulfone dialysis columns. in the preceding 4 months the patient had no history of fever, cold sweating, or weight loss. during the physical examination, firm and movable masses, measuring up to 332 cm (the largest one) were found. these masses were palpable with no tenderness, and were located primarily in the right anterior triangle of the neck. although there were also several palpable masses in both the axillary and inguinal areas, no hepatosplenomegaly was detected. laboratory findings included a hemoglobin level of 7.3 g / dl, platelet count of 20010/l, and a white blood cell (wbc) count of 6.2 10/l : the differential wbc count revealed 68.9% segmented neutrophils, 10.2% lymphocytes, 8.4% monocytes, 12.1% eosinophils, and 0.4% basophils. serum total ige level was 261.0 iu / ml. the blood urea nitrogen and serum creatinine level were 56 mg / dl and 4.8 mg / dl. fine needle aspiration cytology of the neck mass revealed findings of nonspecific reactive lymphadenitis. a computed tomography (ct) scan of the neck and chest revealed masses adjacent to both sternocleidomastoid muscles, numerous lymph nodes of varying size in both axillary areas, and over lymph nodes of over 1 cm in size in the paratracheal, subcarinal, and intrapulmonary areas (figure 1a). a ct scan of the abdomen and pelvis displayed multiple lymph nodes of varying size, which were enhanced in the hepatic hilum, peripancreatic area, celiac axis, and paraaortic area (the largest was 4.5 cm) (figure 1b). a tumor scan using gallium-67 demonstrated more noticeable increased uptake lesions in the left lower cervical, left axillary, paraaortic, right iliac, and both inguinal lymph nodes (figure 2). the findings from fine needle aspiration cytology were inconclusive with regard to diagnosis, thus an open biopsy was recommended. results of histopathological examinations of the neck mass and lymph nodes revealed dense infiltration of eosinophils, lymphocytes, and histiocytes, along with many small vessels, mild fibrosis, and results consistent with kd, with no evidence of malignant lymphoma (figure 3). thereafter, the patient has received no specific treatment, as his symptoms, with the exception of the mass, were clinically unremarkable. after two months, physical examination revealed no neck masses, and a follow - up abdominal ct scan showed that the numerous lymph nodes of varying size had subsided spontaneously (figure 4). although its etiology remains unknown, it has been tentatively suggested that kd is the result of an aberrant allergic or chronic inflammatory response to viral, bacterial or parasitic infection3 - 5). kd usually manifests as a tumor - like lesion, showing a predilection for head and neck sites. systemic manifestations of kd are characterized by elevated serum ige, eosinophilia, and renal diseases, including focal segmental glomerulosclerosis, iga nephropathy, minimal change disease, membranous nephropathy, and igm nephropathy6 - 8). clinical symptoms of kd normally precede or coincide with the development of renal disease2,8). neck masses that were incidentally detected in end - stage renal disease patients were first considered in terms of differential diagnoses, possibly as neoplastic disease or infection, such as tuberculosis, in asian patients. clinically, kd may often be confused with malignant lymphoma or other metastatic cancers9). consequently, a patient with kd is often unnecessarily evaluated for symptoms of far more serious diseases10). it is difficult to diagnose kd without a tissue biopsy, and fine needle aspiration cytology has only limited value in such cases. in the present case,, we were also unable to differentiate these lesions from malignant lymphoma or metastasis. unlike most cases, our patient exhibited multiple lymphadenopathy, including thoracic, abdominal, neck, axillary, and inguinal lymph nodes. histopathological analyses of the neck mass and lymph nodes revealed no signs of malignant lymphoma. in contrast, alhe occurs in all racial groups, showing a slight predominance in females11). regional lymphadenopathy, serum eosinophilia, and elevated ige levels are rare in cases of alhe. kd typically manifests several histologic features, such as predominant eosinophilic infiltration with follicular hyperplasia, fibrocollagenous change, and vascular proliferation. however, vascular proliferation is more significant in alhe. in alhe, vessels are aggregated and lined by plump cuboidal, or occasional hobnail, endothelial cells, with frequent cytologic atypia and vacuolization. however, these angiomatoid features are never observed in cases of kd12). in our case, we observed no vessels lined by plump cuboidal endothelial cells suggesting alhe, and there were characteristic and distinctive clinical features suggesting kd. we have no evidence that would explain this relationship between kd and end - stage renal disease in our patient. the treatment of kd involves one of three major approaches : surgical excision, irradiation, or steroid therapy. our patient had no complaints or symptoms, with the exception of the aforementioned palpable masses. thus, the patient has received conservative treatment while undergoing regular checkups. in conclusion, a high index of suspicion regarding kd the early diagnosis and recognition of kd may spare both patient and doctor from the need for unnecessary invasive diagnostic procedures. to our knowledge, this is the first case of kd occurring during hemodialysis, involving thoracic and abdominal lymph nodes, which resolved itself both spontaneously, and nearly completely, after two months. | we report the first observed case of kimura 's disease occurring during hemodialysis, involving the thoracic and abdominal lymph nodes, which spontaneously resolved nearly completely after two months. early diagnosis and recognition of kimura 's disease may spare both the patient and doctor from the need for unnecessary invasive diagnostic procedures. therefore, we emphasize that we need to have a high index of suspicion regarding kimura 's disease. |
over the past two decades, there have been numerous calls worldwide to reform and innovate healthcare delivery to meet objectives, such as the provision of collaborative, safe, patient centered care. heath information technology (hit) will play a key role in facilitating healthcare delivery to meet these objectives. studies have described positive outcomes from hit, including support for the management of chronic diseases, facilitation of communication as part of care transitions, and improvements in patient safety by providing necessary information to all providers. there is also a wide body of research that describes numerous challenges to implementing hit in organizations, including workflow, communication and cognitive issues, and medical errors that are mitigated by the use of hit. further, studies have reported that hit adoption has had minimal impact on the quality of care, measured by patient mortality, adverse drug events, and readmission rates. yet, despite the implementation issues, governments continue to spend large amounts of money on the adoption of hit. organizational and social issues (osis) contribute to hit implementation issues. while some studies have explicitly studied or discussed osis in hit, much of the research on osis has been imbedded in studies of post - implementation issues, such as unintended consequences and adverse events. one essential point that needs to be made is that even if the hit in question adequately automates the task it was designed for (e.g., order entry), unintended consequences may still occur due to conflicts between the hit and the context of how and where the system is used. overall, there is a need for better understanding of the organizational issues surrounding hit implementation. one of the biggest challenges in studying osis is what can be referred to as ' bounding '. such a wide range of studies have reported on osis that it becomes challenging to identify what elements should be studied and how studies should be conducted. healthcare systems continue to focus on goals such as patient safety, collaborative care delivery, and patient centered care, yet an often overlooked fact is that these goals are bound within the organizational and social web that exists in healthcare settings. there is a need for a paper that reviews the wide body of literature on osis in hit to provide some bounding for how to think about and study these issues. this paper addresses that need by reviewing the literature on osis in hit to identify themes that can be used to provide bounding for future research. the papers reviewed included explicit studies about osis in hit (e.g., review articles) as well as papers that referred to osis in hit in the context of other studies (e.g., unintended consequences, medical errors, collaborative care delivery). in reviewing the papers, five overarching themes around osis in hit were identified : scope and frameworks for defining osis in hit, context matters, process immaturity and complexity, trade - offs will happen and need to be openly discussed, and means of studying osis in hit. to provide some framing for the discussion, each theme is discussed from the perspective of micro and macro aspects of osis. macro aspects include organizational structure, leadership, incentives, training, and organizational structure (e.g., facility size, it spending). micro aspects include front - line care delivery issues, such as communication, collaboration or training for hit usage. as stated in the introduction, a significant challenge in studying osis in hit is defining them, given the range of studies that have reported on osis. on one hand, osis have been studied using broad approaches or frameworks, such as those from classic studies of information technology in organizations. an interpretive review by cresswell and sheikh points out the range of models used to study osis in hit, such as the technology adoption model (tam), the diffusion of innovation model, and organizational psychology models. other models from the information systems literature that have been used to evaluate hit include the delone and mclean information system success model. a literature review by lluch identified and classified organizational barriers and hit under five main headings : structure of healthcare organizations, tasks, people policies, incentives, and information and decision processes. it was proposed that the five categories be used as a starting point for policy interventions. while the above reviews and models are good at identifying the broader structural or macro aspects of hit in osis, they do not provide as much insight into the behavioral or micro aspects of osis, yet behavioral issues are a major cause of hit issues and often span across individual, group, and organizational levels. a significant amount of research has looked at micro - level intricacies between hit and the organizations where they are used. while studies may not be explicitly labeled as studies on osis in hit, many of their findings refer to aspects of osis. a seminal work by ash the plethora of studies on the unintended consequences of hit implementation emphasizes that even a well - designed system can be influenced by organizational culture and issues, such as power struggles. research drawing upon socio - technical theory has been used to study hit for some time and has provided valuable insight on hit in osis. a sociotechnical framework was developed by sittig and singh that articulates eight dimensions for studying the safety and effectiveness of hit, including organizational policies and procedures. others have suggested that while organizational structure and leadership are important for hit success, it is equally important that culture, workflow, and productivity be studied. developed the ' triangle evaluation model ', which incorporates the organizational structure, processes pertaining to organizational implementation of technology, and organizational policies affecting providers. macro - level solutions are impacted by the micro - level context where they are implemented. a systematic review of hit implementation identified better reporting of context as the biggest need in hit evaluation. provide a good perspective on the importance of context by differentiating the ideal or abstract description (the ostensive dimension) of how hit should be used and how it is actually used in real clinical settings (the performance dimension). the performance dimension is defined by context, and failure to account for the ostensive - performance gap can lead to unintended consequences, such as communication, coordination, and patient safety issues. a key part of understanding the performance dimension is understanding the intersection of organizational routines and technology. while evaluation approaches, such as usability testing, can identify individual variations or contexts, it is equally important to understand organizational contexts, such as leadership, culture, and workflow, as they can impact hit usage one context is the type of organization, as hit implementation can vary according to the size and type of organization where hit is being implemented. while training on the specific features of the hit being used is obviously important, it is equally important that organizations invest in training on technical skill sets (e.g., information management skills, such as data entry and retrieval) that are necessary for effective interaction with hit. a shortcoming of many of the it adoption frameworks described in the previous section, such as tam, is that they focus on behavior related to the technology and not the organizational or clinical context where the technology is used. to address this shortcoming, models of hit implementation have been developed that attempt to incorporate the macro (organizational) and micro (clinical) context. one such model is the contextual implementation model (cim), which looks at hit usage from organizational, clinical unit, and individual contexts. hit implementation is often compared to other industries, such as finance, aviation, or manufacturing. while it has been able to improve supply chain efficiency in companies like wal - mart, and it has enabled courier companies to develop online customer package tracking systems, a key difference between these domains and healthcare is that supply chain management and parcel delivery are mature processes ; therefore, the technology was used to automate well - defined processes. a major challenge is that many of the healthcare organizational processes we are trying to automate lack maturity. for example, while numerous interventions have been proposed to improve team - based care delivery, including training and the use of technologies such as electronic health records, these macro - level interventions have not resulted in improved outcomes. it has been stated that if a care team lacks team characteristics (e.g., shared objectives and processes) than they exist as teamwork in name only. poorly defined teams provide less than ideal team - based care delivery, leading to adverse events, such as communication issues and medical errors. while there have been mixed reports about the ability of hit to support teamwork, hit on its own will not enhance team - based care delivery ; rather, we need a better definition of the rules of engagement and the relationship between teamwork and individual provider work routines. handovers are another example of processes that can be classified as evolving. a lack of standardized handover processes has been cited as a reason for errors and other quality issues related to handovers. essential elements for handoffs, such as common ground amongst providers, are still a work in progress. poorly defined handover processes and measures make it challenging to develop hit to support handovers. while hit may be designed to automate a specific task, it will impact and be impacted by other organizational and clinical tasks. a well acknowledged shortcoming in how we design hit is a focus on " tidy use cases of predictable orderliness " which fail to describe the complex interrelated manner in which hit is used. rather than considering hit as isolated events or activities, we need to draw upon systems theory and consider hit and the processes it supports as complex entities. hit is more likely to introduce unintended consequences if it designed to support specific tasks while ignoring other tasks or routines that interact with it. tenets of complexity theory, such as emergence, non - linearity, and self - organization can help us understand the inter - relatedness between hit and the processes, policies, and other system components that interact with a hit. hit implementation often necessitates trade - offs between how people currently work and how their work routines change because of hit. however, providers may be unwilling to make trade - offs, or they may find trade - offs problematic to their work practices, and as a result develop workarounds to mitigate hit - mediated changes. a significant trade - off is the individual - collaborative interchange. while systems may be designed to support individual or organizational tasks, designing for groups is a different challenge. macro - level objectives, such as collaborative care delivery, necessitate trade - offs at the individual - collaborative interchange and across clinical units, change individual roles in the context of working in a team, and may require the development of awareness or rules of engagement for social or group dynamics. while standardization of data and processes is required for interoperability to support inter- and intra - organizational care delivery standardized data may lead to increased charting for providers, which can require a workflow trade - off with respect to patient care delivery. tasks such as communication, information retrieval, or decision - making may become more challenging because of hit. at times, it may not be possible to perform tasks in the same manner with hit, and providers may be forced to learn new variations on tasks. in addition to the need to understand hit mediated trade - offs, there is the need to effectively manage them. some of the changes may be flexible and can be negotiated as part of hit design, whereas others (e.g., data standards or organizational policy) are more permanent. failure to discuss hit - induced changes can result in adverse events and other unintended consequences because of individual variations on processes. the nature of trade - offs and/or losses to work practices from hit need to be discussed and, if applicable, negotiated with providers. kaplan has advocated for methodological pluralism, emphasizing the need for broad approaches to hit evaluation that study social, cultural, organizational, cognitive, and other contextual concerns. both qualitative and such studies have included the use of markov models, simulation, and multi - agent models. quantitative studies can also be used to define structural aspects of work processes, such as communication flows or patterns, to model how things should work. while quantitative studies are helpful for providing bounding or structure regarding osis in hit, a shortcoming of quantitative approaches is that they decontextualize situations and thus may not sufficiently explain why things happen. as described above, a lack of rules of engagement for team - based care delivery may cause a seemingly ideal collaboration structure to work in unintended ways. qualitative approaches, such as non - participant observations, interviews, and focus groups, have been valuable for studying and providing explanations about the organizational context of osis in hit. an advantage of qualitative studies is their ability to provide rich descriptions of situation, particularly the micro aspects regarding why things happen. although there has been a wide variety of approaches to studying hit that have come directly from the medical informatics community, we need to remember that the broader discipline of information systems also offers many approaches and frameworks that can be used in studying osis in hit. furthermore, fields peripheral to medical informatics, such as computer - supported cooperative work (cscw), have also made significant contributions to our understanding of the relationship between osis in hit. regardless of the type of approach used, an iterative approach that engages users will increase the chance of understanding osis as a precursor to successful hit design and implementation. methods such as design science and participatory design provide ways to engage users in the understanding of problems and the design of hit solutions to these problems. as stated in the introduction, a significant challenge in studying osis in hit is defining them, given the range of studies that have reported on osis. on one hand, osis have been studied using broad approaches or frameworks, such as those from classic studies of information technology in organizations. an interpretive review by cresswell and sheikh points out the range of models used to study osis in hit, such as the technology adoption model (tam), the diffusion of innovation model, and organizational psychology models. other models from the information systems literature that have been used to evaluate hit include the delone and mclean information system success model. a literature review by lluch identified and classified organizational barriers and hit under five main headings : structure of healthcare organizations, tasks, people policies, incentives, and information and decision processes. it was proposed that the five categories be used as a starting point for policy interventions. while the above reviews and models are good at identifying the broader structural or macro aspects of hit in osis, they do not provide as much insight into the behavioral or micro aspects of osis, yet behavioral issues are a major cause of hit issues and often span across individual, group, and organizational levels. a significant amount of research has looked at micro - level intricacies between hit and the organizations where they are used. while studies may not be explicitly labeled as studies on osis in hit, many of their findings refer to aspects of osis. a seminal work by ash the plethora of studies on the unintended consequences of hit implementation emphasizes that even a well - designed system can be influenced by organizational culture and issues, such as power struggles. research drawing upon socio - technical theory has been used to study hit for some time and has provided valuable insight on hit in osis. a sociotechnical framework was developed by sittig and singh that articulates eight dimensions for studying the safety and effectiveness of hit, including organizational policies and procedures. others have suggested that while organizational structure and leadership are important for hit success, it is equally important that culture, workflow, and productivity be studied. developed the ' triangle evaluation model ', which incorporates the organizational structure, processes pertaining to organizational implementation of technology, and organizational policies affecting providers. macro - level solutions are impacted by the micro - level context where they are implemented. a systematic review of hit implementation identified better reporting of context as the biggest need in hit evaluation. provide a good perspective on the importance of context by differentiating the ideal or abstract description (the ostensive dimension) of how hit should be used and how it is actually used in real clinical settings (the performance dimension). the performance dimension is defined by context, and failure to account for the ostensive - performance gap can lead to unintended consequences, such as communication, coordination, and patient safety issues. a key part of understanding the performance dimension is understanding the intersection of organizational routines and technology. while evaluation approaches, such as usability testing, can identify individual variations or contexts, it is equally important to understand organizational contexts, such as leadership, culture, and workflow, as they can impact hit usage one context is the type of organization, as hit implementation can vary according to the size and type of organization where hit is being implemented. while training on the specific features of the hit being used is obviously important, it is equally important that organizations invest in training on technical skill sets (e.g., information management skills, such as data entry and retrieval) that are necessary for effective interaction with hit. a shortcoming of many of the it adoption frameworks described in the previous section, such as tam, is that they focus on behavior related to the technology and not the organizational or clinical context where the technology is used. to address this shortcoming, models of hit implementation have been developed that attempt to incorporate the macro (organizational) and micro (clinical) context. one such model is the contextual implementation model (cim), which looks at hit usage from organizational, clinical unit, and individual contexts. hit implementation is often compared to other industries, such as finance, aviation, or manufacturing. while it has been able to improve supply chain efficiency in companies like wal - mart, and it has enabled courier companies to develop online customer package tracking systems, a key difference between these domains and healthcare is that supply chain management and parcel delivery are mature processes ; therefore, the technology was used to automate well - defined processes. a major challenge is that many of the healthcare organizational processes we are trying to automate lack maturity. for example, while numerous interventions have been proposed to improve team - based care delivery, including training and the use of technologies such as electronic health records, these macro - level interventions have not resulted in improved outcomes. it has been stated that if a care team lacks team characteristics (e.g., shared objectives and processes) than they exist as teamwork in name only. poorly defined teams provide less than ideal team - based care delivery, leading to adverse events, such as communication issues and medical errors. while there have been mixed reports about the ability of hit to support teamwork, hit on its own will not enhance team - based care delivery ; rather, we need a better definition of the rules of engagement and the relationship between teamwork and individual provider work routines. handovers are another example of processes that can be classified as evolving. a lack of standardized handover processes has been cited as a reason for errors and other quality issues related to handovers. essential elements for handoffs, such as common ground amongst providers, are still a work in progress. poorly defined handover processes and measures make it challenging to develop hit to support handovers. while hit may be designed to automate a specific task, it will impact and be impacted by other organizational and clinical tasks. a well acknowledged shortcoming in how we design hit is a focus on " tidy use cases of predictable orderliness " which fail to describe the complex interrelated manner in which hit is used. rather than considering hit as isolated events or activities, we need to draw upon systems theory and consider hit and the processes it supports as complex entities. hit is more likely to introduce unintended consequences if it designed to support specific tasks while ignoring other tasks or routines that interact with it. tenets of complexity theory, such as emergence, non - linearity, and self - organization can help us understand the inter - relatedness between hit and the processes, policies, and other system components that interact with a hit. hit implementation often necessitates trade - offs between how people currently work and how their work routines change because of hit. however, providers may be unwilling to make trade - offs, or they may find trade - offs problematic to their work practices, and as a result develop workarounds to mitigate hit - mediated changes. a significant trade - off is the individual - collaborative interchange. while systems may be designed to support individual or organizational tasks, designing for groups is a different challenge. macro - level objectives, such as collaborative care delivery, necessitate trade - offs at the individual - collaborative interchange and across clinical units, change individual roles in the context of working in a team, and may require the development of awareness or rules of engagement for social or group dynamics. while standardization of data and processes is required for interoperability to support inter- and intra - organizational care delivery standardized data may lead to increased charting for providers, which can require a workflow trade - off with respect to patient care delivery. tasks such as communication, information retrieval, or decision - making may become more challenging because of hit. at times, it may not be possible to perform tasks in the same manner with hit, and providers may be forced to learn new variations on tasks. in addition to the need to understand hit mediated trade - offs, there is the need to effectively manage them. some of the changes may be flexible and can be negotiated as part of hit design, whereas others (e.g., data standards or organizational policy) are more permanent. failure to discuss hit - induced changes can result in adverse events and other unintended consequences because of individual variations on processes. the nature of trade - offs and/or losses to work practices from hit need to be discussed and, if applicable, negotiated with providers. kaplan has advocated for methodological pluralism, emphasizing the need for broad approaches to hit evaluation that study social, cultural, organizational, cognitive, and other contextual concerns. such studies have included the use of markov models, simulation, and multi - agent models. quantitative studies can also be used to define structural aspects of work processes, such as communication flows or patterns, to model how things should work. while quantitative studies are helpful for providing bounding or structure regarding osis in hit, a shortcoming of quantitative approaches is that they decontextualize situations and thus may not sufficiently explain why things happen. as described above, a lack of rules of engagement for team - based care delivery may cause a seemingly ideal collaboration structure to work in unintended ways. qualitative approaches, such as non - participant observations, interviews, and focus groups, have been valuable for studying and providing explanations about the organizational context of osis in hit. an advantage of qualitative studies is their ability to provide rich descriptions of situation, particularly the micro aspects regarding why things happen. although there has been a wide variety of approaches to studying hit that have come directly from the medical informatics community, we need to remember that the broader discipline of information systems also offers many approaches and frameworks that can be used in studying osis in hit. furthermore, fields peripheral to medical informatics, such as computer - supported cooperative work (cscw), have also made significant contributions to our understanding of the relationship between osis in hit. regardless of the type of approach used, an iterative approach that engages users will increase the chance of understanding osis as a precursor to successful hit design and implementation. methods such as design science and participatory design provide ways to engage users in the understanding of problems and the design of hit solutions to these problems. although hit continues to play a vital role in healthcare delivery, successful implementation of hit remains a challenge. this paper reviewed osis in hit and identified five themes to help us better understand and study osis in hit. one overall finding is that, while organizations frequently have strategies for macro - level objectives, such as patient safety, systems integration, collaborative care delivery, and chronic disease management, these efforts need to be studied and integrated with the underlying micro processes that operationalize the objectives. one of the key issues identified in this paper is the need to account for immature or evolving processes. while hit introduces a sudden and often substantial change to how work is done, the processes being automated by hit may not evolve as quickly. as a result, unintended consequences occur because of the gap between the level of automation and the people and processes using the automation. defining rules of engagement for tasks such as collaborative care delivery, or handovers, needs to be done prior to automation of these tasks. while we need to continue research on macro - level osis, such as leadership, funding, and organizational structure, these studies need to be complemented by research on osis at the micro level. organizational strategy and policy may define the framework of healthcare delivery, but it is the social and behavioral aspects at the micro level that will define the activities within the framework. we also need to move away from studies that look broadly at osis ; rather, we need to focus our research efforts on specific contexts of osis. for example, dorr. pointed out that hit is often not designed to explicitly support collaboration. therefore, there is a specific research need to define the collaborative behaviors and rules of engagement that hit needs to support. another context is the organizational setting or type. as more healthcare delivery, and subsequently more hit, occurs outside traditional healthcare settings (e.g., in patient homes, long - term care centers) we need better evidence on how to design and evaluate hit to support care delivery in these contexts. it shows how osis need to be studied from micro and macro perspectives, both upstream and downstream, as part of hit implementation. macro considerations include the funding, incentives, leadership, organizational structure, and process or care delivery objectives. micro considerations include the context and complexity of hit usage, rules of engagement, and training and trade - offs. ' upstream ' refers to hit design and development prior to the actual implementation of hit. ' downstream ' refers to the operations and maintenance that take place after hit is implemented. it is essential that both micro and macro perspectives are studied upstream (i.e., pre - implementation) as well as downstream (i.e., post - implementation) because of the dynamic and evolving nature of healthcare processes. further, hit users need to be involved as much as possible to enable to them to understand the nature of hit - induced changes and how it will impact their work routines. one of the other conclusions from this work is that osis can not be studied from the perspective of linear modeling of ideal scenarios ; rather, they must be studied from the perspective of the messy and complex reality in which hit is situated. in that context in addition to the frameworks and methods from medical informatics, insights may be gained through a wide array of approaches from the information systems discipline, such as peter checkland 's soft systems methodology and the technological frames approach of orlikowski and gash, and approaches from the social sciences, such as activity theory and actor network theory. as hit is more widely implemented in healthcare settings, it is essential that we ensure hit is a fit in the organizational setting where it will be used. this paper reviewed osis in hit and identified five themes to provide guidance and bounding for future research. echoing other studies, the findings from this paper suggest that there is a key need for more explicit and theoretical studies of osis in hit. more research on integrating micro and macro perspectives of hit use in organizations is also a priority need. | objectivesthis paper reviews organizational and social issues (osis) in health information technology (hit).methodsa review and synthesis of the literature on osis in hit was conducted.resultsfive overarching themes with respect to osis in hit were identified and discussed : scope and frameworks for defining osis in hit, context matters, process immaturity and complexity, trade - offs will happen and need to be discussed openly, and means of studying osis in hit.conclusionsthere is a wide body of literature that provides insight into osis in hit, even if many of the studies are not explicitly labelled as such. the two biggest research needs are more explicit and theoretical studies of osi in hits and more research on integrating micro and macro perspectives of hit use in organizations. |
chronic myocardial inflammation can be identified as a specific pathogenic mechanism in a significant proportion of dilated cardiomyopathy (dcm) patients, either with viral persistence (e.g., coxsackievirus, adenovirus, parvovirus b19/b19v) or in terms of a post - viral anti - cardiac immunity maintained even after viral elimination. immunohistologically detected intramyocardial inflammation has been identified as a feature of myocarditis with prognostic and therapeutic relevance [35 ]. the t - cell receptor (tcr) is a transmembrane heterodimer that recognizes peptides presented by hla molecules. adaptive immunity depends on genetic recombination, which produces diverse functional tcr gene rearrangements from a pool of discontinuous segments. the human tcr- locus consists of 65 v (variable), 2 d (diversity), and 13 j (joining) segments. as a result, 10 different tcr- chain rearrangements are available in the human nave t - cell repertoire.. chronic activation of the immune system targeting specific antigenic epitopes can also evoke clonal tcr- expansions in the inflamed tissues. a further mechanism that may contribute to the development of clonal tcr- rearrangements is superantigens (from bacteria or viruses) by cross - linking the lateral side of the mhc class ii molecule with the v portion of the tcr, thereby stimulating proliferation of specifically reactive t - cells. experimental data from both autoimmune and coxsackievirus myocarditis have shown restricted tcr- rearrangements involving v - b 8.2 and 10 by cdr3 (complementary determining region 3) spectratyping in rodents. depletion of the respective clonotypes by antibodies or dna vaccines resulted in significant protection from disease development. in light of these findings from experimental myocarditis models, we sought to investigate whether clonal tcr- restrictions are detectable also in human dcm. we furthermore investigated the distribution pattern of clonal tcr- rearrangements by analyzing multiple samples (3 each) obtained from 3 cardiac regions (9 samples total) from explanted dcm hearts (rv : right ventricle, s : septum, lv : left ventricle). we hypothesized that if clonal tcr- rearrangements target particular, but multiple, epitopes, various clonal tcr- rearrangements with a multifocal pattern might be present in dcm hearts. normal tonsillar tissues obtained at autopsy were used as polyclonal controls of the trc - b pcr method, whereas the t - cell line molt4 served as control for tcr- clonality. from 17 explanted dcm hearts (1 female ; age : 48.913.1 years ; lvef : 19.74.9%), each 3 myocardial samples (ca. 50 mg tissue) were obtained from random locations of the right ventricle (rv ; rv 13), the septum (s), and the left ventricle (lv) at explantation (9 total myocardial samples per case). coronary artery disease was excluded in all these patients by the lack of significant coronary stenosis in coronary angiography, and further possible secondary causes (e.g., valvular, hypertensive or systemic diseases) were excluded. patients subjected to immunomodulatory treatment such as immunosuppression or antiviral interferon treatment were excluded from this study. single lv myocardial samples from 6 explanted hearts with non - dcm cardiomyopathy entities (1 female ; age : 5310 years ; lvef : 194% ; ischemic cardiomyopathy : n=3 ; hypertrophic non - obstructive cardiomyopathy : n=1 ; transposition of the great vessels and ventricular septum defect : n=2) served as controls. universittsmedizin berlin in the framework of the sonderforschungsbereich tr19 in compliance with the helsinki declaration. the pcr for the detection of tcr- rearrangements was performed as described by assaf.. in brief, dna was extracted from snap - frozen myocardial tissues using the qiagen dna extraction kit (qiagen, hilden, germany) according the manufacturer s instructions. two hundred ng of genomic dna from each sample was subjected to a semi - nested pcr with 2 separate reactions involving the same v consensus primer (v pan : 5-ctcgaattct(t / g)t(a / t) (c / t)tggta(c / t)c (g / a)(t / a)ca-3 ; 200 ng) and 2 j different primer sets (200 ng each set) consisting of 6 (j1 family ; jfs1a) and 7 (j2 family ; jfs2a) j family - specific primers, respectively, employing high - quality high - performance liquid chromatographic purified oligonucleotides. thirty cycles were carried out with a primer annealing temperature of 60c (40 sec) for the initial 5 cycles and 57c (40 sec) for the remaining 25 cycles. for re - amplification, an aliquot (1%) of the first 2 reactions was used as a template in 2 additional separate pcrs, comprising 40 cycles each with the same annealing temperature profile as described above. the same v primer (200 ng) was used in combination with 2 nested family - specific j primer mixes (jfs1 and jfs2 ; 200 ng each set). the conditions for denaturation (96c, 15 sec) and primer extension (72c, 40 sec) remained constant through all cycles of the first and second pcr, whereas the concentration of mgcl2 was 2.5 mmol / l in the first and 1.5 mmol / l in the second amplification. all reactions were carried out in a final volume of 100 l with 0.8 mmol / l of dntps (200 mol / l each) and 2.5 units taq polymerase (perkin elmer, weiterstadt, germany) in a thermal cycler (tc9600, perkin elmer, weiterstadt, germany). high - resolution genescan analysis of the pcr products was performed with 5-carboxyflourescein - labeled v primers. aliquots (2 l) of pcr products were mixed with loading buffer (2 l formamide, 0.5 l edta), and 0.5 l of the internal size standard (genescan-500) were included for precise determination of the length of the amplificates. after denaturation for 2 min at 90c, the products were separated on a sequencing gel and analyzed by automatic fluorescence quantification and size determination, using the computer program genescan 672 (abi 373a, applied biosystems, darmstadt, germany). in cases with clonal tcr- rearrangements, the re - amplification was repeated with unlabeled v primers to generate unlabeled pcr products, which, after purification, can be used for direct fluorescence dye terminator cycle sequencing. the sequencing reactions were analyzed on a 377a dna sequencer (applied biosystems, darmstadt, germany) after removal of the unincorporated fluorescence dye. each sequencing reaction was carried out in both directions using the primers vpan and jfs1 or jfs2, respectively. the sequences were identified by comparison to published sequences in the international immunogenetics database (imgt ; website : http://www.imgt.org/). statistical analysis was performed using jmp statistical discovery software 4.02 (sas institute, inc., normal tonsillar tissues obtained at autopsy were used as polyclonal controls of the trc - b pcr method, whereas the t - cell line molt4 served as control for tcr- clonality. from 17 explanted dcm hearts (1 female ; age : 48.913.1 years ; lvef : 19.74.9%), each 3 myocardial samples (ca. 50 mg tissue) were obtained from random locations of the right ventricle (rv ; rv 13), the septum (s), and the left ventricle (lv) at explantation (9 total myocardial samples per case). coronary artery disease was excluded in all these patients by the lack of significant coronary stenosis in coronary angiography, and further possible secondary causes (e.g., valvular, hypertensive or systemic diseases) were excluded. patients subjected to immunomodulatory treatment such as immunosuppression or antiviral interferon treatment were excluded from this study. single lv myocardial samples from 6 explanted hearts with non - dcm cardiomyopathy entities (1 female ; age : 5310 years ; lvef : 194% ; ischemic cardiomyopathy : n=3 ; hypertrophic non - obstructive cardiomyopathy : n=1 ; transposition of the great vessels and ventricular septum defect : n=2) served as controls. universittsmedizin berlin in the framework of the sonderforschungsbereich tr19 in compliance with the helsinki declaration. the pcr for the detection of tcr- rearrangements was performed as described by assaf.. in brief, dna was extracted from snap - frozen myocardial tissues using the qiagen dna extraction kit (qiagen, hilden, germany) according the manufacturer s instructions. two hundred ng of genomic dna from each sample was subjected to a semi - nested pcr with 2 separate reactions involving the same v consensus primer (v pan : 5-ctcgaattct(t / g)t(a / t) (c / t)tggta(c / t)c (g / a)(t / a)ca-3 ; 200 ng) and 2 j different primer sets (200 ng each set) consisting of 6 (j1 family ; jfs1a) and 7 (j2 family ; jfs2a) j family - specific primers, respectively, employing high - quality high - performance liquid chromatographic purified oligonucleotides. thirty cycles were carried out with a primer annealing temperature of 60c (40 sec) for the initial 5 cycles and 57c (40 sec) for the remaining 25 cycles. for re - amplification, an aliquot (1%) of the first 2 reactions was used as a template in 2 additional separate pcrs, comprising 40 cycles each with the same annealing temperature profile as described above. the same v primer (200 ng) was used in combination with 2 nested family - specific j primer mixes (jfs1 and jfs2 ; 200 ng each set). the conditions for denaturation (96c, 15 sec) and primer extension (72c, 40 sec) remained constant through all cycles of the first and second pcr, whereas the concentration of mgcl2 was 2.5 mmol / l in the first and 1.5 mmol / l in the second amplification. all reactions were carried out in a final volume of 100 l with 0.8 mmol / l of dntps (200 mol / l each) and 2.5 units taq polymerase (perkin elmer, weiterstadt, germany) in a thermal cycler (tc9600, perkin elmer, weiterstadt, germany). high - resolution genescan analysis of the pcr products was performed with 5-carboxyflourescein - labeled v primers. aliquots (2 l) of pcr products were mixed with loading buffer (2 l formamide, 0.5 l edta), and 0.5 l of the internal size standard (genescan-500) were included for precise determination of the length of the amplificates. after denaturation for 2 min at 90c, the products were separated on a sequencing gel and analyzed by automatic fluorescence quantification and size determination, using the computer program genescan 672 (abi 373a, applied biosystems, darmstadt, germany). in cases with clonal tcr- rearrangements, the re - amplification was repeated with unlabeled v primers to generate unlabeled pcr products, which, after purification, can be used for direct fluorescence dye terminator cycle sequencing. the sequencing reactions were analyzed on a 377a dna sequencer (applied biosystems, darmstadt, germany) after removal of the unincorporated fluorescence dye. each sequencing reaction was carried out in both directions using the primers vpan and jfs1 or jfs2, respectively. the sequences were identified by comparison to published sequences in the international immunogenetics database (imgt ; website : http://www.imgt.org/). statistical analysis was performed using jmp statistical discovery software 4.02 (sas institute, inc., cary, nc, usa). the analysis of dna extracted from tonsils gave rise to polyclonal tcr- rearrangements (gaussian - like distribution of the pcr amplificates), with a size range from 234 to 261 bp as revealed by high - resolution genescan analysis (figure 1a). in contrast, tcr- pcr employing dna extracted from a t - cell line (molt-4) resulted in a single pcr product, characteristic for the presence of a single tcr- rearrangement (figure 1b). in control myocardial tissues (non - dcm hearts), the genescan analysis of the tcr- pcr products revealed a gaussian - like size distribution consistent with the presence of polyclonal t - cell populations (figure 1c). in contrast, clonal tcr- rearrangements were detectable in at least 1 myocardial sample in 9 out of 17 dcm cases (3 each from rv, lv, and s) of the dcm hearts (figure 1d). the demographic data of this subset of dcm patients were not statistically different compared to the remaining dcm patients without detectable clonal tcr- rearrangements (female : 0 ; age : 51.811.3 years ; lvef : 18.95.2%). a total of 20 of the 81 specimens displayed single dominant tcr- pcr products consistent with the presence of clonal t - cell populations. there was a non - significant tendency for a higher detection rate of t - cell clonality in the samples from the lv compared with the remaining regions of the dcm hearts (rv : n=4, s : n=4, lv : n=6). interestingly, the sizes of the dominant pcr products were not identical within the same case or among the respective cases. the sequence analysis of the clonal tcr- pcr - products (n=20) from the 9 explanted dcm hearts showed an involvement of v19.01 segments in 14 of the dominant amplificates (70%). further tcr - v segments involved in clonal tcr- rearrangements of dcm hearts were v6 - 1.01 (n=1), v6 - 3.01 (n=2), v6 - 5.01 (n=1), v10 - 3.02 (n=1), and v19.03 (n=1). clonal tcr- rearrangements were present in only 1 of the 9 samples from the different cardiac regions in 3 dcm hearts (patient code 05 : v6 - 3.01, 07 : v10 - 3.02, and 20 : v6 - 1.01), and the remaining 6/9 dcm cases demonstrated clonally rearranged tcr- genes in at least 2 of the 9 different samples investigated from each individual. an involvement of the same vb - segment was detected in multiple (at least 2) samples in 5/6 (83%) of the dcm patients with v19.01 tcr - v rearrangement (patients 02, 13, 14, 16 and 17), and different v segments were found in the remaining identified clones. only 1 out of 6 cases with a clonal v19.01 rearrangement (code no. 21) the results of sequence analysis of clonal tcr- pcr - products identified by genescan analysis in these explanted dcm hearts are summarized in table 1. one important finding of our investigation is that the presence of clonal tcr- rearrangements is a disease - associated phenomenon in 9 out of 17 dcm patients, but not in other non - dcm cardiomyopathies. these first data on the application of this analysis system of clonal tcr- rearrangements are limited by the fact that only single myocardial samples of the control hearts were investigated, but multiple samples (3 each) were analyzed from 3 cardiac regions (9 samples total) from explanted dcm hearts (rv : right ventricle, s : septum, lv : left ventricle). however, the presence of disease - specific tcr- dominances was also confirmed by different methodological approaches in further investigations. one major goal of this study was to determine the applicability of the methodology published by assaf., followed by high - resolution genescan and direct sequencing. secondly, we sought to determine the distribution of detectable clonal tcr- rearrangements in dcm hearts. analysis of 9 different tissue samples (3 each from the rv, s, and lv) revealed that these clonal t - cell populations were not identically distributed within the respective dcm hearts, albeit with a clear predominance of v 19.01 segments. the clear predominance of the v19.01 segment suggests that a common antigen may evoke and maintain such a selective clonal tcr- expansion in the majority of dcm cases. clonal tcr- rearrangements with further tcr- segments (v6 - 1.01, v6 - 3.01, v6 - 5.01, v10 - 3.02 and v19.03) were identified less frequently. however, we were not able to confirm findings by luppi on the restricted usage of v 3, 7, and 13.1 families. firstly, this discrepancy may result from different patient cohorts. whereas luppi analyzed 3 children with fulminant myocarditis, we analyzed adult dcm patients with a chronic history of symptoms at end - stage heart failure. furthermore, methodological differences are also important to consider. the cdr3 spectratyping used by luppi strongly depends on the pcr results from 24 different tcr- pcrs obtained from healthy controls (ie, peripheral blood lymphocytes), and restricted tcr - v usage is interpreted as the relative increase of distinct pcr products in impaired tissues. in contrast, a determination of clonal tcr- rearrangements is possible by use of the tcr- pcr system. this family - specific pcr with multiple primers, however, may be hampered by pseudoclonality issues. nonetheless, this tcr- pcr approach can discriminate between polyclonal and oligoclonal tcr- compositions without the need of interpretations based on a control population. interestingly, whereas the same vb - segment was involved in multiple (at least 2) samples in 5/6 (83%) of the dcm patients with v19.01 tcr - v rearrangements, different v segments were found with respect to the remaining identified clones (v6 - 1.01, v6 - 3.01, v6 - 5.01, v10 - 3.02, v19.03). these data are consistent with clonal expansion of t - cells at multiple intramyocardial foci, and rather incompatible with a diffuse infiltration of the whole dcm heart with a single t - cell population. our data may be furthermore compatible with the typically non - homogeneously distributed t - lymphocytic clusters suggestive of focal expansion and myocytolysis in dcm. different tcr - v skewing in different cardiac regions were also confirmed by cdr3 spectratyping in 2 out of 3 pediatric patients with acute myocarditis. the clear predominance of the v19.01 segment suggests that a common antigen may evoke and maintain such a selective clonal tcr- expansion in the majority of dcm cases. clonal tcr- rearrangements with further tcr- segments (v6 - 1.01, v6 - 3.01, v6 - 5.01, v10 - 3.02 and v19.03) were identified less frequently. the multifocal presence of different t - cell clones might be a decisively important issue for the design of tcr - based immunotherapies in dcm, since such approaches would need to target not just one, but several, different clonal t - cell populations simultaneously. in line with these considerations, matsumoto reported that only the combined deletion of both tcr - v 8.2 and tcr - v 10 clones proved efficacious in experimental autoimmune myocarditis, while the approach of a single tcr - v deletion did not improve disease severity. these insights indicate that multiple antigens may be responsible for clonal expansion of reactive t - cells, and warrant further investigations on the respective epitopes. clonal expansion of t - lymphocytes in dcm may occur in response to specific stimulation by particular epitopes. potential candidates may be either viral proteins in the framework of antiviral immunity, or myocardial antigens such as in molecular mimicry. given the insights from both viral and autoimmune myocarditis, both options may also hold true for the appearance of clonal t - cell populations in human dcm. the focal nature of viral infection and cell - to - cell viral spreading might be a further factor contributing to the observed multifocal clonal tcr- rearrangements in dcm. regarding autoimmunity, it is important to consider that deletion of self - reactive t - cells in the thymus is not complete, and a minority of self - reactive t - cells may also surpass peripheral selection mechanisms. these potentially self - reactive t - cells can be activated when encountering autoantigens, which are usually not accessible to or are ignored by circulating t - cells. with the ensuing tissue destruction in viral myocarditis, cryptic myocardial antigens can be presented to the immune system, which may evoke local recruitment and clonal expansion of self - reactive t - cells targeting these epitopes. an association of findings of skewed cdr3 spectratyping with enteroviral protein (vp-1) expression has been reported in myocarditis patients. these conclusions were drawn by associations to vp-1 (enteroviral protein-1) immunoreactivity, which was reported in all cardiac samples (100%). however, pcr failed to confirm enteroviral genomes in these tissues. the presence of enteroviral genomes assessed by pcr, however, is reported in about 1020% of myocarditis and dcm patients. sensitivity and, especially, specificity of vp-1 immunostaining may be an important issue to solve this discrepancy. further cardiotropic viruses such as adenovirus and parvovirus b19 (b19v) have been identified even more frequently in myocarditis and dcm patients in recent investigations. these viral genomes were not investigated in the aforementioned study by luppi.. on the other hand, the debate on the pathogenic and prognostic significance of the presence of b19v genomes in myocardial tissues is controversial. it may be deduced that the antigen - specific t - cells reactive to these proteins might be different from the t - cell clones targeting enteroviral vp-1, with relevance also for dcm patients with multiple viral infections. viral infection and anti - cardiac immunity are involved in the pathogenesis and prognosis of dilated cardiomyopathy (dcm). the disease - associated presence of clonal tcr- rearrangements, as investigated by semi - nested pcr, genescan, and direct sequencing, indicates a pathogenic relevance of this finding in dcm, since it was not detected in non - dcm cardiomyopathies. the predominance of v 19.01 segments suggests that the immune response in dcm patients targets particular epitopes. this finding is consistent with immunity targeting particular antigens involved in dcm, which leads to intramyocardial expansion of reactive t - cell clones. however, the partly heterogenic tcr- populations in various myocardial samples from the respective cases support the notion that t - cell immunity may target multiple epitopes in human dcm. further analyses are warranted to investigate the prognostic relevance of clonal tcr- rearrangements, and the impact of immunomodulatory treatment strategies in dcm patients. these insights might also be interesting for the analysis of t - cell - mediated cardiac allograft rejection. | backgroundviral infection and anti - cardiac immunity are involved in the pathogenesis of dilated cardiomyopathy (dcm). immunity targeting particular antigens may evoke expansion of reactive t - cell clones.material/methodsmyocardial tissues from explanted hearts were investigated for clonal t - cell - receptor- (tcr-) rearrangements by an established semi - nested polymerase chain reaction (pcr), followed by high - resolution genescan analysis and direct sequencing. from 17 explanted dcm hearts, 3 myocardial samples each were obtained from the right ventricle, the septum, and the left ventricle (total : 9 myocardial samples per case). six explanted hearts with non - dcm cardiomyopathy entities served as controls.resultsgenescan analysis revealed polyclonal tcr- rearrangements in all controls. in contrast, at least 1 myocardial sample in 9 out of 17 dcm hearts (total : 20 of the 81 dcm specimens) displayed single dominant tcr- pcr products consistent with the presence of clonal t - cell populations. direct sequencing of the clonal tcr- pcr - products disclosed an involvement of vb 19.01 segments in 14 of the dominant amplificates (70%). further tcr - v segments involved in clonal tcr- rearrangements of dcm hearts were v 6 - 1.01 (n=1), v 6 - 3.01 (n=2), v 6 - 5.01 (n=1), v 10 - 3.02 (n=1), and v 19.03 (n=1).conclusionsthe detectability of clonal tcr- rearrangements indicates a pathogenic relevance of this finding in dcm. the predominance of v 19.01 segments suggests that the immune response in dcm patients targets particular epitopes. however, the partly heterogenic tcr- populations in various myocardial samples from the respective cases support the notion that t - cell immunity may target multiple epitopes in human dcm. |
activator protein-1 (ap1) is a transcription factor that consists of either homo- or heterodimers of the jun and fos family proteins. it regulates gene expression in response to a variety of stimuli, including environmental stresses, uv radiation, cytokines, and growth factors. ap1 in turn controls a number of cellular processes including proliferation, transformation, inflammation, and innate immune response. the jun and fos proteins share similar amino acid sequences that comprise the basic dna - binding sequence and the adjacent leucine zipper region by which these proteins dimerize [24 ]. the ap1 transcription factor binds specifically to 12-o - tetradecanoylphorbol-13-acetate (tpa) responsive element 5-tgag / ctca-3 which is commonly referred to as the ap1 site [5, 6 ]. c - fos and c - jun genes are autoregulated ; the transcription of c - jun is stimulated by its own product, and in contrast c - fos is negatively autoregulated [79 ]. ap1 has been found constitutively active in many cancers including breast, ovarian, cervical, and lung. numerous studies have shown that inhibition of ap1 has a profound effect on the behavior of cancer cells and tumors suggesting that ap1 could be a promising target for cancer therapy. curcumin, a dietary spice derived from the plant turmeric (curcuma longa), is used as a traditional medicine for inflammatory conditions. further, curcumin has been reported to have anti - inflammatory, anti - oxidant, and anticancer effects [1215 ]. in vivo administration of curcumin was found to reduce the incidence and size of tumors in mice [1619 ]. moreover, curcumin was reported to inhibit proliferation and cell cycle progression in cancer cells. curcumin suppresses constitutive ap1 activity in hl-60, raji, and prostate cancer cell lines (lncap, pc-3, and du145) [2125 ]. curcumin was also reported to suppress lps - induced cyclooxygenase-2 gene expression by inhibiting ap1 dna binding in bv2 microglial cells. it was confirmed that curcumin directly interacts with jun - fos dimer and inhibits its binding to dna (ap1 site). some synthetic curcumin derivatives have been discovered as inhibitors of jun - fos - dna complex formation [2830 ]. however, no information on the site of interaction is reported yet. in the present study we investigate the interaction of curcumin derivatives with jun - fos complex by molecular docking studies. to investigate the interaction with jun - fos complex, curcumin natural derivatives (figure 1), synthetic curcumin - based inhibitors (table 1), and other known inhibitors of jun - fos - dna complex formation (figure 2) were drawn and 3d optimized using marvinsketch (free academic license) and saved in protein data bank (pdb) file format. these molecules were prepared for molecular docking by merging nonpolar hydrogens, assigning gastegier charges, and saving them in pdbqt file format using autodock tools (adt) 1.5.6. x - ray crystal structure of jun - fos - dna complex (pdb i d : fos1) was obtained from the protein data bank (http://www.rcsb.org/pdb). for molecular docking dna and other heteroatoms (water, ions, etc.) gasteiger charges were assigned, and jun - fos complex was saved in pdbqt file format using adt. grid and docking parameter files were prepared using adt, and molecular docking was performed with autodock 4.2.1 (scripps research institute, usa) considering all the rotatable bonds of curcumin derivatives as rotatable and jun - fos complex as rigid. grid box size of 90 90 90 with 0.375 spacing was selected that include the whole basic dna - binding sequence and the adjacent leucine zipper region of jun - fos complex. empirical - free energy function and lamarckian genetic algorithm, with an initial population of 150 randomly placed individuals, a maximum number of 2,500,000 energy evaluations, a mutation rate of 0.02, and a crossover rate of 0.80, were used to perform molecular docking. curcumin derivative - jun - fos complex for lowest free energy of binding (g) confirmation from the largest cluster was written in pdbqt format and converted to pdb file format using ucsf chimera 1.6.1. further, these complexes were analyzed using pymol 0.99 for possible polar and hydrophobic interactions. all the docking studies were performed at intel(r) xeon(r) cpu (3.2 ghz) with linux - based operating system fedora 15. x - ray crystal structure of jun - fos - dna complex shows that arg140, asn147, lys153, ser154, arg155, arg158, arg268, asn271, arg272, and ser278 are the key residues by which jun - fos complex binds to dna through hydrogen bonding (figure 3). to predict the interaction of curcumin derivatives with jun - fos complex, natural curcumin derivatives and other known inhibitors of jun - fos - dna complex formation were docked over dna - binding region (dbr) of jun - fos complex, and results were summarized in table 2. amongst all the natural curcumin derivatives docked to jun - fos complex curcumin sulphate bound with g of 8.20 kcal / mol and predicted ki of 976.64 nm followed by cyclocurcumin and demethoxycurcumin which bound with g of 5.75 and 5.72 kcal / mol and predicted ki of 61.42 and 63.86 m, respectively (figure 4(a)). the binding mode of curcumin sulphate depicted that sulphate and nearby methoxy group present at one aromatic ring of the molecule were in polar contact range with lys282 ; however methoxy group present at the other side formed polar contact with side chain of lys280 (figure 4(b)). keto group present in the linker region was in polar contact range with side chain of arg158. the binding mode of cyclocurcumin showed that hydroxyl group present at one aromatic ring of the molecule formed polar contact with side chain of arg155 ; however at the other side it formed polar contacts with arg158 (figure 4(c)). when demethoxycurcumin docked to jun - fos complex, hydroxyl and neighboring methoxy group present at one aromatic ring formed polar contact with side chains of arg155 and arg279, respectively, while hydroxyl group present at other side of the molecule formed polar contact with side chain of ser276 (figure 4(d)). in the linker region of the molecule keto and hydroxyl groups were in polar contact range with arg158 and arg279, respectively. amongst the synthetic curcumin - based inhibitors chc011 bound to jun - fos complex with g of 9.59 kcal / mol and predicted ki of 93.25 nm followed by chc009 and chc007 which docked with g of 9.52 and 9.15 kcal / mol and predicted ki of 104.26 nm and 196.96 nm, respectively (figure 5(a)). similar results were observed in the in vitro studies by hahm. in 2002. the binding mode studies depicted that no2 group present at one aromatic ring of the chc011 molecule formed polar contact with side chain of arg272 while at the other side of the molecule it interacted with lys282 (figure 5(b)). when chc009 docked to jun - fos complex, keto group present in the linker region of the molecule formed polar contact with side chain of arg158 (figure 5(c)). hydroxyl and no2 group present at one aromatic ring of the chc007 molecule formed polar contacts with backbone of arg155 and side chain of lys282, respectively, while the hydroxyl group present in the linker region of the molecule showed polar contact with side chain of arg158 (figure 5(d)). amongst the other known inhibitors t5224 [3-(5-(4-(cyclopentyloxy)-2-hydroxybenzoyl)-2-((3-hydroxybenzo [d]isoxazol-6-yl)methoxy)phenyl)propanoic acid ] bound to jun - fos complex with g of 9.96 kcal / mol and predicted ki of 49.64 nm followed by dihydroguaiaretic acid and resveratrol which docked with g of 4.43 and 4.20 kcal / mol and predicted ki of 569.58 and 829.30 m, respectively (figure 6(a)). the binding mode studies of t5224 depicted that oxygen atom of cyclopentyloxy group formed polar contact with side chain of arg158 ; however nearby hydroxyl group formed polar contact with arg279. hydroxyl group of 3-hydroxybenzo [d]isoxazol-6-yl)methoxy group formed polar contact with asn271 ; however oxygen atom of its methoxy group formed polar contact with ser278. acid group of the t5224 molecule was in polar contact range with lys282 (figure 6(b)). when docked to jun - fos complex neighboring hydroxyl and methoxy groups present at one side of the dihydroguaiaretic acid molecule formed polar contacts with ser278 and arg279 respectively, whereas the hydroxyl group present at the other side of the molecule formed polar contact with backbone of arg279 (figure 6(c)). when docked to jun - fos complex neighboring hydroxyl groups attached to one of the aromatic ring of resveratrol molecule formed polar contacts with ser 154 and side chain of lys282, respectively (figure 6(d)). we observed that curcumin derivatives form polar contacts preferentially with residues like arg155, arg158, lys276, arg279, lys280, and lys282 when docked to dbr of jun - fos complex amongst which arg155 and arg158 are the key residues by which jun - fos complex binds to dna. the results suggested that interaction of curcumin derivatives with residues like arg155 and arg158 could be the possible mechanism by which curcumin derivatives inhibit jun - fos - dna complex formation. ala151, ala275, leu283, and ile286 were the hydrophobic residues present at binding site contributing to hydrophobic contacts with inhibitor molecules. the present molecular docking study provides insights into the inhibition of jun - fos - dna complex formation by curcumin derivatives. the involvement of residues like arg155, arg158, lys276, lys280, and lys282 seems to play a key role in binding of curcumin derivatives to jun - fos complex through polar contacts which prevents its binding to dna (ap1 site). ala151, ala275, leu283 and ile286 were the important hydrophobic residues present at binding site. most of the curcumin derivatives were predicted to be more potent than inhibitors like resveratrol and dihydroguaiaretic acid. curcumin sulphate was predicted to be the most potent inhibitor amongst all the natural curcumin derivatives docked. | activator protein-1 (ap1) is a transcription factor that consists of the jun and fos family proteins. it regulates gene expression in response to a variety of stimuli and controls cellular processes including proliferation, transformation, inflammation, and innate immune responses. ap1 binds specifically to 12-o - tetradecanoylphorbol-13-acetate (tpa) responsive element 5-tgag / ctca-3 (ap1 site). it has been found constitutively active in breast, ovarian, cervical, and lung cancers. numerous studies have shown that inhibition of ap1 could be a promising strategy for cancer therapeutic applications. the present in silico study provides insights into the inhibition of jun - fos - dna complex formation by curcumin derivatives. these derivatives interact with the amino acid residues like arg155 and arg158 which play a key role in binding of jun - fos complex to dna (ap1 site). ala151, ala275, leu283, and ile286 were the residues present at binding site which could contribute to hydrophobic contacts with inhibitor molecules. curcumin sulphate was predicted to be the most potent inhibitor amongst all the natural curcumin derivatives docked. |
experimental details, xray crystal structure of culoaded f33y cubmb, malditof mass spectra, epr simulation, and extra uv / vis, epr spectra are provided in the supporting information. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors. | abstractrational protein design has been proven to be a powerful tool for creating functional artificial proteins. although many artificial metalloproteins with a single active site have been successfully created, those with dual active sites in a single protein scaffold are still relatively rare. in this study, we rationally designed dual active sites in a single heme protein scaffold, myoglobin (mb), by retaining the native heme site and creating a copperbinding site remotely through a single mutation of arg118 to his or met. isothermal titration calorimetry (itc) and electron paramagnetic resonance (epr) studies confirmed that a copperbinding site of [3his ] or [2his1met ] motif was successfully created in the single mutant of r118h mb and r118 m mb, respectively. uv / vis kinetic spectroscopy and epr studies further revealed that both the heme site and the designed copper site exhibited nitrite reductase activity. this study presents a new example for rational protein design with multiple active sites in a single protein scaffold, which also lays the groundwork for further investigation of the structure and function relationship of heme / nonheme proteins. |
the world health organization (who) defines it as a locally invasive polymorphic neoplasia that often has a follicular or plexiform pattern in a fibrous stroma. clinicians emphasize that ameloblastoma is a benign tumor but is locally aggressive. in 20% of cases, it is localized in the maxilla where it can be particularly dangerous because of the close proximity to vital structures and the great difficulty to obtain clean surgical margins. however, 80% of ameloblastomas are placed in the mandible and, among these, 70% are detected in the ascendant ramus or molar region while 20% in the premolar area, and only 10% in the anterior region. they are usually discovered around the fourth and the fifth decades of life, with the exception of the unicystic variant, which is most common between 20 and 30 year old. the symptoms of this tumor are few, and swelling represents the most frequent. from a radiological point of view ameloblastoma the most common form is the multilocular with various cysts which are in groups or separated by osseous septa giving a soap bubble appearance. the unilocular form is the third in frequency. from a histological point of view, literature reports different entities, some of which have prognostic relevance. however, others rare varieties of this tumor such as peripheral ameloblastoma have been described. multicystic ameloblastoma is the most frequent subtype and it generally brings about marked facial deformities and serious debilitation. moreover, as it tends to infiltrate cancellous bone trabeculae, despite accurate curettage, the incidence of recurrence rates is up to 90%.. histologically, solid multicystic ameloblastoma is characterized by the occurrence of islands, strands and irregular configurations of tumor epithelium, consisting of a central mass of poliedral cells resembling stellate reticulum surrounded by a layer of cuboidal or columnar cells, similar to pre - ameloblasts. when degeneration of centrally placed cells occurs in several tumor islands, the term multicystic is often used. the two tumors show similar epidemiological features with a male - female ratio of 1:1.3. impacted teeth, especially third molars, are associated with multicystic ameloblastoma, although several reports underline that also unicystic ameloblastoma can be caused by impacted third molar teeth. solid multilocular ameloblastoma often have a soap bubble appearance, whereas there is a unilocular configuration in 2447% of multicystic ameloblastoma. the unicystic subtype is considered as a less aggressive tumor with a variable recurrence rate according to different authors. unicystic ameloblastoma is a monocystic lesion and it usually shows quite a large cystic cavity with a lining composed of ameloblastic cells. it may also present one or more nodules arising from the cyst and projecting into the lumen of the cyst cavity comprising odontogenic epithelium with a plexiform pattern which may mimic a plexiform ameloblastoma. finally, a few unicystic ameloblastomas may have one more mural nodules or local thickenings of the cyst wall. a variant without particular clinical relevance is the desmoplastic ameloblastoma characterized by a uniformly dense collagenous stroma with small nests and strands of compressed odontogenic epithelium. in the scientific literature, other uncommon variants have been described, such as the kerato ameloblastoma and its papilliferous variant, as well as ameloblastoma associated with calcifying odontogenic cysts or diffuse mineralized dental tissue deposits similar to odonto - ameloblastoma. in addition, some focal microscopic differentiations with no particular clinical relevance have been described in the literature. they include mucous cell differentiation, adenomatoid changes, and hpv 18-positive verrucous lesion in a cystic cavity of ameloblastoma.[1416 ] it should be emphasized that although the concepts of unicystic and multicystic ameloblastoma, as described above, were introduced more than 30 years ago by robinson and martinez, confusion still exists when clinicians and pathologists discuss this lesion. such confusion particularly involves the terminology of ua. the term unicystic comes from the macro and microscopic appearance since this lesion is a well - defined single cystic sac lined by odontogenic epithelium. the term unilocular is used in a radiological sense in order to describe only one loculus of radiolucency. the confusion derives from the fact that unicystic ameloblastoma can be observed as either unilocular or multilocular bone defect. therefore, this article has the aim of reviewing the recent literature about unicystic ameloblastoma using our unusual clinical case as a starting point to illustrate this discussion. multicystic ameloblastoma is the most frequent subtype and it generally brings about marked facial deformities and serious debilitation. moreover, as it tends to infiltrate cancellous bone trabeculae, despite accurate curettage, the incidence of recurrence rates is up to 90%.. histologically, solid multicystic ameloblastoma is characterized by the occurrence of islands, strands and irregular configurations of tumor epithelium, consisting of a central mass of poliedral cells resembling stellate reticulum surrounded by a layer of cuboidal or columnar cells, similar to pre - ameloblasts. when degeneration of centrally placed cells occurs in several tumor islands, the two tumors show similar epidemiological features with a male - female ratio of 1:1.3. impacted teeth, especially third molars, are associated with multicystic ameloblastoma, although several reports underline that also unicystic ameloblastoma can be caused by impacted third molar teeth. solid multilocular ameloblastoma often have a soap bubble appearance, whereas there is a unilocular configuration in 2447% of multicystic ameloblastoma. the unicystic subtype is considered as a less aggressive tumor with a variable recurrence rate according to different authors. unicystic ameloblastoma is a monocystic lesion and it usually shows quite a large cystic cavity with a lining composed of ameloblastic cells. it may also present one or more nodules arising from the cyst and projecting into the lumen of the cyst cavity comprising odontogenic epithelium with a plexiform pattern which may mimic a plexiform ameloblastoma. finally, a few unicystic ameloblastomas may have one more mural nodules or local thickenings of the cyst wall. a variant without particular clinical relevance is the desmoplastic ameloblastoma characterized by a uniformly dense collagenous stroma with small nests and strands of compressed odontogenic epithelium. in the scientific literature, other uncommon variants have been described, such as the kerato ameloblastoma and its papilliferous variant, as well as ameloblastoma associated with calcifying odontogenic cysts or diffuse mineralized dental tissue deposits similar to odonto - ameloblastoma. in addition, some focal microscopic differentiations with no particular clinical relevance have been described in the literature. they include mucous cell differentiation, adenomatoid changes, and hpv 18-positive verrucous lesion in a cystic cavity of ameloblastoma.[1416 ] it should be emphasized that although the concepts of unicystic and multicystic ameloblastoma, as described above, were introduced more than 30 years ago by robinson and martinez, confusion still exists when clinicians and pathologists discuss this lesion. such confusion particularly involves the terminology of ua. the term unicystic comes from the macro and microscopic appearance since this lesion is a well - defined single cystic sac lined by odontogenic epithelium. the term unilocular is used in a radiological sense in order to describe only one loculus of radiolucency. the confusion derives from the fact that unicystic ameloblastoma can be observed as either unilocular or multilocular bone defect. therefore, this article has the aim of reviewing the recent literature about unicystic ameloblastoma using our unusual clinical case as a starting point to illustrate this discussion. a 30-year - old man who had been complaining of slight pain in the premolar and molar area of the left side of mandible for few weeks, had a check up at the department of dentistry at versilia hospital. extraoral examination revealed a slight swelling measuring 1 2 cm in the left area of mandible. intraoral examination revealed a swelling area in the premolar and molar zone, where the patient has been complaining of mild pain. it should be observed that the oral mucosa which covered the area was normal x - rays revealed a well - defined unilocular radiotrasparency with radiopaque margins extending from the central incisor to the molar area but no signs of displacement of the roots were observed. x - rays indicated a well - defined unilocular radiotrasparency with radiopaque margins extending from the central incisor to the molar area. no signs of displacement of the roots were observed a provisional diagnosis of radicular cyst was considered and the lesion was removed by osteoctomy and curettage [figures 3 and 4 ]. the larger one measured 4 4 cm while the smaller 2 1 cm [figures 5 and 6 ]. it should be noted that the cortical plate has been partially destroyed and the cyst is in direct contact with soft tissues the surgical intervention has been carried out so as to remove integrally the cyst. therefore a trap door has been created and, using a spoon, the surgeon has carefully removed the lesion. this fact allows a macroscopic evaluation of the cyst by a pathologist this image shows the larger specimen from a large grey irregular cyst with corrugate margins. it measured 4 4 cm this image shows the smaller specimen from the cyst. the histological diagnosis indicated that the wall of the cyst was made up of pluristratified pavimentous epithelium surrounded by fibrous tissue. an interesting finding was that inside the wall, islands of ameloblastic epithelium reactive to calretinin and cytocheratin 8 and 18 were detected. the ameloblastic epithelial islands were observed in lassus connective tissue and in some areas they presented the typical fenced epithelium. at the time of writing, the patient has had a 6-month follow up check without any evidence of recurrence. literature considers two different types of intraosseously located ameloblastomas, the solid or multicistic variant and the unicystic form. as described above, the multicystic variety appears as a solid tumor or multicystic as a result of degeneration of central islands of the tumor while, the unicystic form is a single well - defined lesion made up of odontogenic epithelium with amelobastic appearance and stratified squamous epithelium in remaining areas. several attempts to classify unycistic ameloblastoma have been made but there is still some confusion. the first attempt to classify unicystic ameloblastoma was that of robinson and martinez who divided into three different subtypes. they considered ameloblastoma only if one ore more of the following criteria were present : -in the lining epithelium the basal cells were clearly columnar with hypercromathic nuclei and the overlying cells were only loosely textured with the absence of cohesiveness downgrowth of ameloblastic epithelium into the connective tissue portion of the cyst wallpresence in the connective tissue portion of the cyst wall of islands composed of a periphery of columnar epithelial cells and a centre identical to stellate reticulumintralumenal nodules composed of anastomosing cords and islands of epithelium downgrowth of ameloblastic epithelium into the connective tissue portion of the cyst wall presence in the connective tissue portion of the cyst wall of islands composed of a periphery of columnar epithelial cells and a centre identical to stellate reticulum intralumenal nodules composed of anastomosing cords and islands of epithelium several years later, ackermann. first divided these entities into the following three histologic groups : luminal ua : tumor confined to the luminal surface of the cystintraluminal/ plexiform ua : nodular proliferation into the lumen without infiltration of tumour cells into the connective tissue wallmural ua invasive islands of ameloblastic epithelium in the connective tissue wall not involving the entire epithelium luminal ua : tumor confined to the luminal surface of the cyst intraluminal/ plexiform ua : nodular proliferation into the lumen without infiltration of tumour cells into the connective tissue wall mural ua invasive islands of ameloblastic epithelium in the connective tissue wall not involving the entire epithelium more recently the classification of ackermann. has been modified by philipsen and reichart, considering : subgroup 1 : luminal uasubgroup 1.2 : luminal and intraluminalsubgroup 1.2.3 : luminal, intraluminal and intramuralsubgroup 1.3 : luminal and intramural subgroup 1 : luminal ua subgroup 1.2 : luminal and intraluminal subgroup 1.2.3 : luminal, intraluminal and intramural subgroup 1.3 : luminal and intramural these authors indicate that it is well known that unicystic ameloblastomas show a combination of various histological features so their classification might be more appropriate. moreover, they underline that it can be useful in order to plan the treatment. thus, they indicate that a tumor in subgroup 1 and 1.2 can be treated conservatively, while a more invasive approach should be followed in the other two categories. literature reports several cases of ameloblastomas apparently arising from what was wrongly considered an odontogenic cyst. although more than 90 publications have described one or more cases of ameloblastomas at least, most of these publications are difficult to find or lack adequate radiographical images and microscopic analysis. in addition, confusion in ameloblastoma nomenclature makes any comparison impossible. unycistic ameloblastoma cases in the scientific literature the mean age at the time of diagnosis of ua is strongly related to the possible association between an impacted tooth and the tumor. divided their review into cases with an initial presentation of dentigeours cyst, where the mean age was 16.5 years old and non - dentigeurous cysts with a mean age of 35.2 year old. li. described their 15 years experience in treating ameloblastomas, considering 33 unicystic ameloblastomas, and the mean age was 25.3 year old although peaks were observed in the second and third decades. reported an ameloblastoma in a 10-year - old girl which was masquerading a cancer lesion. more recently two cases in a 17-year - old male and in a 14-year - old female with a gardner syndrome were reported. on these bases, it is confirmed that association of an impacted tooth with the ameloblastoma is crucial in determining the age of diagnosis. with regard to the location of the tumor philipsen. in their review indicated a ratio of 3 to 13 in favor of mandible. evaluated a strange association between an osteoblastoma at the apex of a molar associated with a posterior maxillary ameloblastoma. navarro. showed a unicystic ameloblastoma in the anterior maxillary area underlining the importance of a differential diagnosis when it occurs in that area. recently, paikkatt. observed an ameloblastoma in the area of premaxilla in a young teenager. a provisional diagnosis of radicular cyst was made. oliveira. presented a unicystic ameloblastoma involving an unerupetd inferior second premolar in a girl under orthodontic treatment, while both quereshi. and sivapathasundharam. all authors agree about the fact that posterior mandible including ascending ramus are the most affected areas. concerning histology, it is impossible to compare data due to the fact that histological classifications were made in few publications. philipsen. in their review showed that two thirds of unicystic ameloblastomas showed invasive ameloblastic tissue in the wall of the cyst. they underlined that this histological pattern occurred more frequently in the no impaction category., leider., and wang a large number of the tumors presented intramural nodules. the article of ng. reveals an interesting aspect to evaluate, which is the possible correlation between tooth impaction and infiltrative potential. this should represent a future topic of the research. a case of unusual histological presentation was described by sivapathasundharam., who observed an unicystic ameloblastoma with luminal and intramural plexiform epithelial proliferation with typical dentin in the connective capsule. reported two cases where the histological analysis was crucial to determine the true nature of unicystic ameloblastomas. in our case report, the lesion looked like an odontogenic cyst, but a careful histological analysis revealed an unusual type of mural ameloblastoma, with ameloblastic cells only in few areas. these cells were surrounded by a thick layer of fibrous connective tissue [figures 7 and 8 ]. this could be due to mesenchymal induction mediated by neoplastic ameloblasts [figure 9 ]. typical islands of ameloblastic epithelium surrounded by connective tissue this is a histological image of islands of ameloblastic epithelium presenting the typical peripheral fenced epithelium radiological evaluation after 6 months indicates no evidence of recurrence of the lesion although philipsen. recommended performing an enucleation after a biopsy failed to show mural invasion, literature lacks general agreement about a surgical approach. the article of ngwenya. emphasized that macroscopic examination of serial sections of ameloblastomas provide information that an examination of randomized biopsies can not give. evans. also described an interesting case report where microscopic changes similar to an adenomatoid odontogenic tumor on a small incision biopsy confused the correct diagnosis of amelobastoma. on these bases, it should be kept in mind that the first hystopatologic analysis of our specimen revealed a harmless odontogenic cyst although further investigations discovered that it was an unusual presentation of ameloblastoma. in the light of our case report, we believe that a careful histological analysis using different biopsies by the same specimen is crucial to determine true nature of the lesion. gardner. reported that the recurrence rate for conservative surgical treatment is less than 25%, whereas other authors have described a recurrence rate of 1020%. however, it should be noted that few case reports evaluated the follow - up period. in their review, underline that there seem to be differences in recurrence rates between the intralumenal subtype and the intramural subtypes although sufficient data to support this hypothesis are not available yet. unicystic ameloblastoma has a better prognosis with a lower recurrence than multicystic ameloblastoma, although it should be remembered that the tumor epithelium may break the periphery of the capsule infiltrating the surrounding cancellous bone. all in all, this literature review supports the idea that unicystic ameloblastomas may appear in different hystologic subtypes, and further studies need to clarify what the behavior of each different tumor is. we think that our case report provides new insights in general knowledge of unicystic ameloblastomas. it is unusual to find an unicystic lesion with few islands of tumor epithelium in the thick of a cyst, and this fact should induce surgeons and pathologists to consider carefully each lesion. a preoperative biopsy can only be representative for the entire lesion in extremely few instances and will probably result in incorrect classification and diagnosis. thus, the true nature of the lesion can be evident when the entire specimen is available for microscopy. pathologists should make multiple or serial sectioning to search cell and tissue configurations in cyst wall nodules. thus, if tumor islands are found intramurally, a more aggressive surgical approach should be carried out, considering removal of adjacent bone and a follow up period of at least 10 years. however, further studies are necessary to clarify both what approach the surgeon in relationship with the specific ameloblastoma subtype must consider and the exact period of follow up of each subtype of tumor. the first attempt to classify unicystic ameloblastoma was that of robinson and martinez who divided into three different subtypes. they considered ameloblastoma only if one ore more of the following criteria were present : -in the lining epithelium the basal cells were clearly columnar with hypercromathic nuclei and the overlying cells were only loosely textured with the absence of cohesiveness downgrowth of ameloblastic epithelium into the connective tissue portion of the cyst wallpresence in the connective tissue portion of the cyst wall of islands composed of a periphery of columnar epithelial cells and a centre identical to stellate reticulumintralumenal nodules composed of anastomosing cords and islands of epithelium downgrowth of ameloblastic epithelium into the connective tissue portion of the cyst wall presence in the connective tissue portion of the cyst wall of islands composed of a periphery of columnar epithelial cells and a centre identical to stellate reticulum intralumenal nodules composed of anastomosing cords and islands of epithelium several years later, ackermann. first divided these entities into the following three histologic groups : luminal ua : tumor confined to the luminal surface of the cystintraluminal/ plexiform ua : nodular proliferation into the lumen without infiltration of tumour cells into the connective tissue wallmural ua invasive islands of ameloblastic epithelium in the connective tissue wall not involving the entire epithelium luminal ua : tumor confined to the luminal surface of the cyst intraluminal/ plexiform ua : nodular proliferation into the lumen without infiltration of tumour cells into the connective tissue wall mural ua invasive islands of ameloblastic epithelium in the connective tissue wall not involving the entire epithelium more recently the classification of ackermann. has been modified by philipsen and reichart, considering : subgroup 1 : luminal uasubgroup 1.2 : luminal and intraluminalsubgroup 1.2.3 : luminal, intraluminal and intramuralsubgroup 1.3 : luminal and intramural subgroup 1 : luminal ua subgroup 1.2 : luminal and intraluminal subgroup 1.2.3 : luminal, intraluminal and intramural subgroup 1.3 : luminal and intramural these authors indicate that it is well known that unicystic ameloblastomas show a combination of various histological features so their classification might be more appropriate. moreover, they underline that it can be useful in order to plan the treatment. thus, they indicate that a tumor in subgroup 1 and 1.2 can be treated conservatively, while a more invasive approach should be followed in the other two categories. literature reports several cases of ameloblastomas apparently arising from what was wrongly considered an odontogenic cyst. although more than 90 publications have described one or more cases of ameloblastomas at least, most of these publications are difficult to find or lack adequate radiographical images and microscopic analysis. in addition, confusion in ameloblastoma nomenclature makes any comparison impossible. unycistic ameloblastoma cases in the scientific literature the mean age at the time of diagnosis of ua is strongly related to the possible association between an impacted tooth and the tumor. divided their review into cases with an initial presentation of dentigeours cyst, where the mean age was 16.5 years old and non - dentigeurous cysts with a mean age of 35.2 year old. li. described their 15 years experience in treating ameloblastomas, considering 33 unicystic ameloblastomas, and the mean age was 25.3 year old although peaks were observed in the second and third decades. reported an ameloblastoma in a 10-year - old girl which was masquerading a cancer lesion. moreover, both oliveira - neto. and paikkatt. described two cases in 11-year - old children. more recently two cases in a 17-year - old male and in a 14-year - old female with a gardner syndrome were reported. on these bases, it is confirmed that association of an impacted tooth with the ameloblastoma is crucial in determining the age of diagnosis. with regard to the location of the tumor philipsen. in their review indicated a ratio of 3 to 13 in favor of mandible. evaluated a strange association between an osteoblastoma at the apex of a molar associated with a posterior maxillary ameloblastoma. navarro. showed a unicystic ameloblastoma in the anterior maxillary area underlining the importance of a differential diagnosis when it occurs in that area. recently, paikkatt. observed an ameloblastoma in the area of premaxilla in a young teenager. a provisional diagnosis of radicular cyst was made. oliveira. presented a unicystic ameloblastoma involving an unerupetd inferior second premolar in a girl under orthodontic treatment, while both quereshi. and sivapathasundharam. all authors agree about the fact that posterior mandible including ascending ramus are the most affected areas. concerning histology, it is impossible to compare data due to the fact that histological classifications were made in few publications. showed that two thirds of unicystic ameloblastomas showed invasive ameloblastic tissue in the wall of the cyst. they underlined that this histological pattern occurred more frequently in the no impaction category., leider., and wang a large number of the tumors presented intramural nodules. the article of ng. reveals an interesting aspect to evaluate, which is the possible correlation between tooth impaction and infiltrative potential. this should represent a future topic of the research. a case of unusual histological presentation was described by sivapathasundharam., who observed an unicystic ameloblastoma with luminal and intramural plexiform epithelial proliferation with typical dentin in the connective capsule. reported two cases where the histological analysis was crucial to determine the true nature of unicystic ameloblastomas. in our case report, the lesion looked like an odontogenic cyst, but a careful histological analysis revealed an unusual type of mural ameloblastoma, with ameloblastic cells only in few areas. these cells were surrounded by a thick layer of fibrous connective tissue [figures 7 and 8 ]. this could be due to mesenchymal induction mediated by neoplastic ameloblasts [figure 9 ]. typical islands of ameloblastic epithelium surrounded by connective tissue this is a histological image of islands of ameloblastic epithelium presenting the typical peripheral fenced epithelium radiological evaluation after 6 months indicates no evidence of recurrence of the lesion although philipsen. recommended performing an enucleation after a biopsy failed to show mural invasion, literature lacks general agreement about a surgical approach. the article of ngwenya. emphasized that macroscopic examination of serial sections of ameloblastomas provide information that an examination of randomized biopsies can not give. evans. also described an interesting case report where microscopic changes similar to an adenomatoid odontogenic tumor on a small incision biopsy confused the correct diagnosis of amelobastoma. on these bases, it should be kept in mind that the first hystopatologic analysis of our specimen revealed a harmless odontogenic cyst although further investigations discovered that it was an unusual presentation of ameloblastoma. in the light of our case report, we believe that a careful histological analysis using different biopsies by the same specimen is crucial to determine true nature of the lesion. gardner. reported that the recurrence rate for conservative surgical treatment is less than 25%, whereas other authors have described a recurrence rate of 1020%. however, it should be noted that few case reports evaluated the follow - up period. in their review, underline that there seem to be differences in recurrence rates between the intralumenal subtype and the intramural subtypes although sufficient data to support this hypothesis are not available yet. unicystic ameloblastoma has a better prognosis with a lower recurrence than multicystic ameloblastoma, although it should be remembered that the tumor epithelium may break the periphery of the capsule infiltrating the surrounding cancellous bone. all in all, this literature review supports the idea that unicystic ameloblastomas may appear in different hystologic subtypes, and further studies need to clarify what the behavior of each different tumor is. we think that our case report provides new insights in general knowledge of unicystic ameloblastomas. it is unusual to find an unicystic lesion with few islands of tumor epithelium in the thick of a cyst, and this fact should induce surgeons and pathologists to consider carefully each lesion. a preoperative biopsy can only be representative for the entire lesion in extremely few instances and will probably result in incorrect classification and diagnosis. thus, the true nature of the lesion can be evident when the entire specimen is available for microscopy. pathologists should make multiple or serial sectioning to search cell and tissue configurations in cyst wall nodules. thus, if tumor islands are found intramurally, a more aggressive surgical approach should be carried out, considering removal of adjacent bone and a follow up period of at least 10 years. however, further studies are necessary to clarify both what approach the surgeon in relationship with the specific ameloblastoma subtype must consider and the exact period of follow up of each subtype of tumor. | ameloblastoma is the most common tumor of odontogenic origin. there are various types of this tumor and confusion still exists among the clinicians about the correct classification. multicystic ameloblastoma is the most frequent subtype while unicystic ameloblastoma can be considered as a variant of the solid or multycistic. this subtype is considered as a less aggressive tumor with a variable recurrence rate. however, its frequency is often underestimated. the aim of this article is reviewing the recent literature about unicystic ameloblastoma using our unusual clinical case as a starting point to illustrate this discussion. a 30-year - old man who had been complaining of slight pain in the premolar and molar area of the left side of mandible had a check up at our department. x - rays revealed a unilocular radiotrasparency with radiopaque margins. the first histological diagnosis was an odontogenic cyst. successive histological evaluations revealed that ameloblastic epithelial islands were present in lassus connective tissue. we think that our case report provides new insights into the approach to the ameloblastoma diagnosis. we agree with authors who have pointed out that a single small biopsy may often be inadequate for the correct diagnosis of amelobastoma. moreover, in the light of our experience, it should be kept in mind that ameloblastomas may have sometimes unusual presentations and this fact should induce surgeons and pathologists to consider carefully each lesion. |
vegetable oils are an important component of human diet because they provide nutritional properties, flavor, and consistency. recently intensive research on the pressure changes of physical properties of vegetable oils has been done in several laboratories. during food manufacture, for example, olive and seed oils are subjected to a pressure of 700 mpa. phase transformations are accompanied by drastic changes in the physicochemical and mechanical properties of oils. in the case of oils such as castor oil, rapeseed oil, soy oil etc., first order phase transitions have been observed [35 ]. since the common component of those materials is triacylglycerols of fatty acids (mostly of oleic acid), some comparative studies on pure triacylglycerols (laboratory synthetic) such as triolein have been conducted [6, 7 ]. they have shown the occurrence of the same type of phase transition as that in natural oils. further studies indicated a crystallization process during the phase transition and also observation of molecular crystal forms has been reported. although the literature on oil crystallization under the influence of temperature at atmospheric pressure is very extensive, see, e.g.,, publications concerning the phase transition occurring in the oils under pressure are not yet numerous e.g., [2, 11 ]. olive oil has been a subject of intensive research, also with regard to the effect of pressure because of its importance to the food industry. several physical properties such as : thermal conductivity and density, ultrasonic attenuation coefficient, ultrasonic velocity, pvt characteristic up to 150 mpa, volumetric properties and thermal diffusivity have been presented by various authors, but none of them have reported pressure - induced phase transition. some suggestions appeared in the work, but the results obtained were ambiguous. having earlier experience in sound velocity measurements under high pressure and using the method developed by the authors in [19, 20 ], we decided to investigate the olive oil by the ultrasonic method. olive oil is one of the most popular edible oils and is produced in several countries. because of various brands of the product available on the market, for our experiments we selected olive oil produced in spain with a high content of oleic acid triacylglycerols. olive oil sample was analyzed by means of the gas chromatography method using a hewlett - packard hp6890 device with a flame ionization detector and a high - polar column bpx 70. the composition of the esters of fatty acids in the sample obtained from gas chromatography, are presented in table 1. there are five major fatty acids : the dominant c18:1 cis - oleic acid, c16:0 palmitic acid, c18:2 cis cis - linoleic acid, c18:0 stearic acid and c16:1 palmitoleic acid. the positions of particular chains in the triacylglycerol molecules were determined for frequently occurring fatty acids. those results are presented in table 2, where the sn-1,3 means the external position, and sn-2 internal position in the triacylglycerol molecule.table 1composition of investigated olive oilfatty acidc14:0c16:0c16:1c17:0c17:1c18:0c18:1cc18:2 ct / tc% in olive < 0.111.021.010.10.13.476.8 < 0.1c18:2 ccc18:3 cccc20:0c20:1c20:2c22:0c24:0c24:15.90.70.40.3<0.10.1<0.1<0.1table 2position of fatty acids in olive oil moleculesfatty acidsn-2 tagsn-1,3 tagc 16:05.095.0c 16:18.691.4c 18:021.079.0c 18:186.113.9c 18:249.750.3c 18:358.541.5 composition of investigated olive oil position of fatty acids in olive oil molecules this information could be important when trying to compare the values obtained with results from other experiments. high - pressure measurements were performed using a setup designed and constructed by our team, see fig. 1. all detectors were located along with the tested olive sample inside the 22-cm capacity pressure chamber. the pressure inside the chamber was measured by a manganin sensor, calibrated using a dead weight piston gauge with a relative accuracy of 0.05 %. the standard deviation of the measurement series of resistance computed for 50 values of resistance was smaller than 1 m. change in manganin sensor resistance in the range of pressures used in our measurements was approximately 1400 m. volume changes were measured by observation of piston displacement within the chamber. corrections related to the expansion of the chamber were evaluated from the lamee equations and considered during data analysis. therefore, the main source of errors in determining the volume was the error in measurement of piston displacement which was measured using a digital caliper with an accuracy of 0.01 mm. this gives a measurement error of the volume of the order of 0.1 %. a constant temperature of 293 k was maintained by a thermostatic water bath.fig. 1experimental setup for measuring longitudinal ultrasonic wave velocity in liquids at high pressure experimental setup for measuring longitudinal ultrasonic wave velocity in liquids at high pressure initial density and specific volume of the sample were determined by weighing on an electronic weighing machine (1 mg) the known volume of olive oil. since the mass of the sample did not change during the experiment, the changes in volume could be used to determine changes in these parameters versus pressure. the sound velocity was measured using the setup developed by the authors and presented in detail in and. the measurement was based on the evaluation of the time of flight between two piezoelectric transducers., usa) were used as both the transmitter and the receiver (frequency f = 5 mhz). the ultrasonic transducers mounting has been designed to provide a low level of parasitic ultrasonic signals. the signal to the transmitter was supplied with a tb-1000 pulser - receiver computer card (matec, usa). after passing through the sample of olive the signal was detected by the receiver and was processed by the pda-1000 digitizer card (signatec, usa). to increase the signal to noise ratio the distance between the transducers and pulse transition time between them were used to calculate the speed of sound in the medium. instead, it is possible to use methods based on digital signal processing such as the cross - correlation function. the cross - correlation function h(t), between two functions f(t) and g(t), 11\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ h\left (t \right) = \int\limits _ { - \infty } ^{\infty } { f\left (\tau \right) } \,g\left ({ t + \tau } \right)d\tau $ $ \end{document } the first signal received (the function f(t)) corresponds to the ultrasound pulse that travels across the distance l between the transmitting and receiving transducers. part of the ultrasonic energy of the first signal is reflected at the receiving transducer back to the transmitting transducer, which in turn reflects part of the incident energy back to the receiving transducer. as a result, the next impulse detected by the receiving transducer (function g(t)) the correlation analysis yields a measure of the similarity between the two considered pulses f(t) and g(t) shifted in time. because those two pulses have a similar shape but a different amplitude and delay, the cross - correlation function reaches a maximum for t equal to the evaluated time difference corresponding to the distance 2l. the relative uncertainty for the ultrasonic velocity in liquid equals 0.3 % at a 95 % confidence level. each pressure increase was followed by a time interval which allowed the olive oil to reach thermodynamic equilibrium. approaching a pressure of 450 mpa we noticed a tendency of the pressure to decrease at a fixed position of the piston. therefore, at a pressure of 450 mpa the compression was stopped and the piston in the high - pressure chamber was locked into position to allow the phase transformation to occur undisturbed. subsequently, pressure was still raised to 600 mpa, and later it was gradually reduced. during the experiment, the measurements of the volume dependence on pressure and sound velocity dependence on pressure were performed simultaneously. as one can see at a pressure of about 450 mpa, the above - mentioned dependence has a discontinuity characteristic for the first order phase transition. for the pressure values below the phase transition, the data are in good agreement with those presented by guignon. above the phase transition, the observed dependence of volume on pressure is very similar to that observed in triolein and described in detail in.fig. 2relative volume changes in olive oil versus pressure, t = 293 k. arrows indicate the direction of pressure changes. 1 low - pressure phase, 2 phase transition, 3 high - pressure phase, 4 decompression relative volume changes in olive oil versus pressure, t = 293 k. arrows indicate the direction of pressure changes. 1 low - pressure phase, 2 phase transition, 3 high - pressure phase, 4 decompression the changes in sound velocity caused by the elevation of pressure are presented in fig. 3. at a pressure relevant to the phase transition, the discontinuous increase in the speed of sound was noticed, despite the drop in pressure. the phase transition is defined as the transition of the first order if it is accompanied by an abrupt change in physical parameters, such as density. the ultrasonic wave velocity depends among other things on the density, and therefore a change in density must produce a similar change in wave velocity. observation of the measured wave velocity discontinuity as a method for detecting the phase transition has already been used in the work in. such phase transitions at similar pressures were present in all previously studied triglycerides. at a pressure of 600 mpa, values of about 3000 m / s are typical for solid - like media, which confirms the crystallization of triglycerides observed in model triglycerides such as triolein and trilaurin, reported by ferstl. in.fig. 3speed of sound in olive oil as a function of pressure, t = 293 k, f = 5 mhz. arrows indicate the direction of pressure changes. 1 low - pressure phase, 2 phase transition, 3 high - pressure phase, 4 decompression speed of sound in olive oil as a function of pressure, t = 293 k, f = 5 mhz. arrows indicate the direction of pressure changes. 1 low - pressure phase, 2 phase transition, 3 high - pressure phase, 4 decompression during the decompression, hysteresis of the sound velocity and volume changes were clearly visible. the process was reversible and, under atmospheric pressure, all parameters returned to their initial value. the pressure dependence of the relative sound attenuation in olive oil is presented in fig. as can be seen in fig. 4, at a pressure of 450 mpa, attenuation shows discontinuity. t = 293 k, f = 5 mhz. arrows indicate the direction of pressure changes. 1 low - pressure phase, 2 phase transition pressure dependence of the relative sound attenuation in olive oil. t = 293 k, f = 5 mhz. arrows indicate the direction of pressure changes. 1 low - pressure phase, 2 phase transition on the basis of the above measurements the density, the specific volume, and adiabatic compressibility (from the sound velocity) were evaluated. dependence of adiabatic compressibility on pressure is presented in fig. 5. as one can notice the compressibility after the phase transition is much smaller and less dependent on pressure than below the phase transition.fig. 5adiabatic compressibility of olive oil versus pressure, t = 293 k. the direction of the pressure changes is similar to that in fig. 1. 1 low - pressure phase, 3 high - pressure phase adiabatic compressibility of olive oil versus pressure, t = 293 k. the direction of the pressure changes is similar to that in fig. 1. 1 low - pressure phase, 3 high - pressure phase the kinetics of the phase transition is presented in fig. 6. the phase transition in triolein which is the main component of vegetable oils takes a short time (about 40 min). therefore the phase transition in other types of vegetable oils (e.g. castor oil) takes a much longer time (e.g., even a few days). therefore, the discovery of phase transitions in these oils has only been made relatively recently. 6kinetics of phase transition in olive oil (t = 293 k) kinetics of phase transition in olive oil (t = 293 k) the following conclusions arise from the conducted investigations : dependencies of sound velocity, ultrasonic wave attenuation, volume, and adiabatic compressibility on pressure show discontinuities. this proves the existence of a first order phase transition in olive oil (liquid to solid - like phase transition).the biggest relative changes were observed for the dependence of ultrasonic wave attenuation on pressure. rapid and large changes in attenuation at a fixed position of the piston testify to the phase transition occurring in olive oil.values of the pressure during the phase transition are very similar to that of triolein since in both cases, triacylglycerols of oleic acid are the main constituents of triolein and olive oil.the induction time of the phase transition in olive oil is greater than that in the case of triolein because of the different chemical composition of these oils.the phase transition in the examined olive oil at 20 c occurred at a pressure of 450 mpa. in our present and previous [6, 19, 29 ] investigations, it was shown that in triacylglycerol at 20 c, the phase transition occurred in the same pressure range, in diacylglycerol - at about 210 mpa. the transformation time for olive oil was about 6 h, for triacylglycerols, it was about 40 min., and for diacylglycerol it was approximately 20 min. dependencies of sound velocity, ultrasonic wave attenuation, volume, and adiabatic compressibility on pressure show discontinuities. this proves the existence of a first order phase transition in olive oil (liquid to solid - like phase transition). the biggest relative changes were observed for the dependence of ultrasonic wave attenuation on pressure. rapid and large changes in attenuation at a fixed position of the piston testify to the phase transition occurring in olive oil. values of the pressure during the phase transition are very similar to that of triolein since in both cases, triacylglycerols of oleic acid are the main constituents of triolein and olive oil. the induction time of the phase transition in olive oil is greater than that in the case of triolein because of the different chemical composition of these oils. the phase transition in the examined olive oil at 20 c occurred at a pressure of 450 mpa. in our present and previous [6, 19, 29 ] investigations, it was shown that in triacylglycerol at 20 c, the phase transition occurred in the same pressure range, in diacylglycerol - at about 210 mpa. the transformation time for olive oil was about 6 h, for triacylglycerols, it was about 40 min., and for diacylglycerol it was approximately 20 min. the investigation of phase transitions is very important in high - pressure food processing and conservation. phase transformations can modify the molecular structure significantly and consequently, affect the texture and sensory characteristics of food products. therefore measuring the speed of sound in the liquid at high pressure enables one to control the quality of food products subjected to high - pressure technological processes, and to understand the nature of the physicochemical behavior of oils. the only article on high - pressure phase transitions in olive oil known to the authors was an article. however, in the article, the composition of the investigated oil is not given. in contrast to, the authors of the present paper did not observe the presence of the phase transition at a pressure value of 124 mpa. in our experiments, the phase transition in olive oil (for a temperature of 20 c) started at higher pressure values, i.e., at about 450 mpa. although the authors of the work investigated pressures as high as 1,167 mpa, they only included points up to 356 mpa in their analysis. in this range of pressure, also in the work, the phase transition was not observed in the olive oil in a pressure range from atmospheric pressure up to 150 mpa. in this work the relationship of viscosity with pressure for olive oil up to 150 mpa was studied. the authors of could not measure the viscosity at higher pressures due to inherent limitations of the applied measuring method. the discrepancy with the results of may be due to a different composition of the oil used in the study by the authors of and the authors of the present work. olive oils may differ in composition (content of fatty acids, triacylglycerols, etc.), and thus in their properties. this will allow the comparison of our results with those obtained for oils of similar composition. | this paper presents measurements of sound velocity and attenuation in olive oil, with known chemical composition, as a function of pressure, within the range of pressure up to 0.7 gpa. dependencies of sound velocity, relative ultrasonic wave attenuation, volume, and adiabatic compressibility on pressure show discontinuities. this proves the existence of the first order phase transition in olive oil (liquid to solid - like phase transition). rapid and large changes in relative attenuation testify to the existence of a phase transition in olive oil. moreover, the kinetics of phase transition was also investigated. measurement of acoustic wave velocity and relative attenuation in olive oil during the phase transition and in the high - pressure phase is a novelty. the results obtained can be useful in the development of new methods in food (edible oils) control, processing, and preservation. |
all known compounds were characterized by h and c nmr and melting point determination (for solids) and compared with literature values. all new compounds were characterized by h, c, f nmr spectra, high - resolution mass spectrometry (hrms), and melting point determination (for solids). h, c, and f nmr spectra were recorded at 500.4, 125.8, and 470.8 mhz, respectively. hrms (ci) data were obtained in positive mode, using ethane as the ionizing gas. reactions were performed using sealed biotage microwave vials purged with argon several times before use. reactions were monitored by thin - layer chromatography carried out on silica plates using uv light for visualization. chromatography was performed on a combiflash rf 200 using hexanes and ethyl acetate as eluent. to 5-bromothienyl-2-sulfonamide (242.1 mg, 1.00 mmol) was added aryl / heteroaryltrifluoroborate (1.1 mmol), k3po4 (636 mg, 3.0 mmol), and pd(pph3)4 (58 mg, 0.05 mmol) in a vial, which was sealed and purged with argon three times. then, 1,4-dioxane (5 ml) was added, followed by the addition of h2o (1.25 ml). the solution was stirred at 100 c, and the reaction was monitored by gcms / tlc. after the reaction was complete, it was cooled to rt. extraction was performed with etoac (30 ml 3) to obtain the organic layer, which was filtered and dried (na2so4). the residue obtained was purified by combiflash column chromatography using etoac and hexanes to obtain the desired product. mp 200201 c ; h nmr (500 mhz, acetone - d6) 7.747.69 (m, 2h), 7.647.53 (m, 1h), 7.517.38 (m, 4h), 6.94 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 150.7, 145.9, 134.6, 133.0, 131.0, 130.6, 127.7, 127.6, 124.9, 124.9 ; hrms (tof ms es) m / z calcd. for c10h8no2s2 [m h ], 237.9994 ; found, 237.9996. mp 185186 c ; h nmr (500 mhz, acetone - d6) 7.58 (dd, j = 4.0, 1.0 hz, 1h), 7.44 (dd, j = 4.0, 1.0 hz, 1h), 7.40 (br s, 2h), 7.20 (br s, 1h), 6.87 (br s, 2h), 3.022.88 (m, 2h), 1.29 (d, j = 7.0 hz, 12h) ; c nmr (125.8 mhz, acetone - d6) 150.9, 150.7, 144.6, 133.8, 132.1, 126.3, 123.8, 122.6, 34.8, 24.2 ; hrms (tof ms es+) m / z calcd. for c16h22no2s2 [m + h ], 324.1092 ; found, 324.1088. obtained as a yellow solid (232 mg, 88%). mp 168170 c ; h nmr (500 mhz, dmso - d6) 8.27 (s, 1h), 8.04 (d, j = 8.0 hz, 1h), 7.86 (d, j = 8.0 hz, 1h), 7.82 (br s, 2h), 7.00 (d, j = 3.5 hz, 1h), 7.67 (t, j = 8.0 hz, 1h), 7.59 (d, j = 4.0 hz, 1h) ; c nmr (125.8 mhz, dmso - d6) 145.6, 145.1, 133.6, 132.2, 131.0, 130.6, 130.5, 129.2, 125.4, 118.3, 112.5 ; hrms (tof ms es+) m / z calcd. for c11h7n2o2s2 mp 170172 c ; h nmr (500 mhz, acetone - d6) 7.647.58 (m, 2h), 7.407.37 (m, 1h), 7.26 (dd, j = 9.0, 2.0 hz, 1h), 7.006.96 (m, 1h), 6.85 (br s, 2h), 3.97 (s, 3h), 3.86 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 154.7, 150.7, 145.4, 144.5, 130.3, 125.1, 122.9, 115.8, 114.2, 113.5, 56.5, 55.9 ; hrms (tof ms es+) m / z calcd. for c12h14no4s2 mp 176178 c ; h nmr (500 mhz, acetone - d6) 7.56 (dd, j = 3.5, 1.5 hz, 1h), 7.38 (dd, j = 4.0, 1.5 hz, 1h), 7.317.24 (m, 2h), 7.207.14 (m, 3h), 6.89 (d, j = 8.0 hz, 1h) ; c nmr (125.8 mhz, acetone - d6) 158.6, 149.7, 144.6, 134.8, 132.0, 131.0, 123.7, 118.0, 116.7, 113.3 ; hrms (tof ms es+) m / z calcd. for c10h8no3s2 [m h ], 253.9946 ; found, 253.9943. obtained as a yellow solid (248 mg, 92%). mp 180181 c ; h nmr (500 mhz, acetone - d6) 7.857.75 (m, 1h), 7.657.50 (m, 2h), 7.407.30 (m, 1h), 7.207.10 (m, 1h), 7.107.00 (m, 1h), 6.85 (br s, 2h), 3.98 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 156.0, 144.8, 144.5, 130.4, 130.1, 128.2, 124.6, 121.8, 121.5, 112.5, 55.7 ; hrms (tof ms es+) m / z calcd. for c11h12no3s2 [m + h ], 270.0259 ; found, 270.0254. obtained as a yellow solid (246 mg, 92%). mp 177178 c ; h nmr (500 mhz, acetone - d6) 10.18 (s, 1h), 7.99 (d, j = 7.5 hz, 1h), 7.797.74 (m, 1h), 7.687.62 (m, 3h), 7.26 (dd, j = 7.8, 3.8 hz, 1h), 7.01 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 191.3, 147.7, 144.5, 136.7, 135.2, 134.7, 132.3, 131.4, 130.3, 130.2, 128.9 ; hrms (tof ms es+) m / z calcd. for c11h9no3s2na [m + na ], 289.9922 ; found, 289.9924. obtained as a yellow solid (262 mg, 88%). mp 192193 c ; h nmr (500 mhz, acetone - d6) 10.5010.45 (m, 1h), 8.017.95 (m, 2h), 7.607.56 (m, 1h), 7.507.42 (m, 1h), 7.377.30 (m, 1h), 6.92 (br s, 2h), 4.104.04 (m, 3h) ; c nmr (125.8 mhz, acetone - d6) 189.1, 163.2, 148.6, 144.9, 134.3, 132.4, 126.7, 126.0, 125.8, 124.0, 114.4, 56.8 ; hrms (tof ms es+) m / z calcd. for c12h12no4s2 [m + h ], 298.0208 ; found, 298.0213. mp 210212 c ; h nmr (500 mhz, acetone - d6) 9.94 (s, 1h), 7.63 (dd, j = 4.0, 1.5 hz, 1h), 7.36 (s, 1h), 7.63 (dd, j = 4.0, 1.5 hz, 1h), 7.07 (s, 1h), 6.99 (br s, 2h), 6.24 (s, 2h) ; c nmr (125.8 mhz, acetone - d6) 189.4, 153.4, 150.2, 147.8, 144.3, 133.9, 131.4, 130.8, 130.4, 111.6, 106.9, 104.1 ; hrms (tof ms es+) m / z calcd. for c12h9no5s2na mp 180181 c ; h nmr (500 mhz, acetone - d6) 7.69 (s, 1h), 7.587.56 (m, 2h), 7.447.37 (m, 3h), 6.88 (br s, 2h), 4.69 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 150.2, 145.1, 144.8, 133.8, 132.3, 130.1, 128.1, 125.4, 125.0, 124.1, 64.3 ; hrms (tof ms es+) m / z calcd. for c11h10no3s2 [m h ], 268.0103 ; found, 268.0104. mp 170171 c ; h nmr (500 mhz, acetone - d6) 7.60 (dd, j = 8.5, 4.5 hz, 1h), 7.47 (dd, j = 8.0, 4.0 hz, 1h), 7.427.36 (m, 1h), 7.307.22 (m, 2h), 7.01 (dd, j = 8.0, 2.5 hz, 1h), 6.92 (br s, 2h), 3.89 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 161.2, 149.7, 145.1, 135.0, 132.1, 131.2, 124.2, 119.2, 115.4, 112.2, 55.7 ; hrms (tof ms es+) m / z calcd. for c11h12no3s2 [m + h ], 270.0259 ; found, 270.0272. mp 243244 c ; h nmr (500 mhz, acetone - d6) 8.178.15 (m, 1h), 8.04 (d, j = 7.0 hz, 2h), 7.01 (d, j = 4.0 hz, 1h), 7.65 (d, j = 7.0 hz, 1h), 7.627.58 (m, 3h), 7.327.30 (m, 1h), 7.04 (br s, 1h) ; c nmr (125.8 mhz, acetone - d6) 147.5, 146.3, 134.9, 132.2, 131.5, 131.5, 130.4, 129.5, 129.3, 128.4, 128.0, 127.3, 126.3, 125.7 ; hrms (tof ms es+) m / z calcd. for c14h10no2s2 mp 254255 c ; h nmr (500 mhz, acetone - d6) 10.13 (s, 1h), 7.64 (d, j = 4.0 hz, 1h), 7.607.50 (m, 4h), 7.457.32 (m, 4h), 7.17 (d, j = 3.5 hz, 1h), 6.98 (br s, 2h), 5.28 (s, 2h) ; c nmr (125.8 mhz, acetone - d6) 191.0, 160.5, 147.3, 144.7, 137.7, 136.4, 133.9, 131.5, 129.9, 129.6, 129.5, 129.0, 128.6, 122.1, 113.4, 71.0 ; hrms (tof ms es+) m / z calcd. for c18h15no4s2na [m + na ], 396.0340 ; found, 396.0337. mp 235236 c ; h nmr (500 mhz, acetone - d6) 8.25 (s, 1h), 8.01 (dd, j = 8.0, 1.0 hz, 1h), 7.95 (d, j = 7.5 hz, 1h), 7.627.57 (m, 2h), 7.53 (dd, j = 4.0, 1.5 hz, 1h), 6.95 (br s, 2h), 3.92 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 166.6, 148.4, 145.8, 134.2, 132.3, 132.2, 131.1, 130.5, 130.2, 127.3, 124.9, 52.6 ; hrms (tof ms es+) m / z calcd. for c12h10no4s2 mp 191192 c ; h nmr (500 mhz, acetone - d6) 7.707.65 (m, 2h), 7.58 (d, j = 3.5 hz, 1h), 7.467.39 (m, 3h), 6.89 (br s, 2h), 4.47 (s, 2h), 3.36 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 149.8, 145.0, 140.8, 133.1, 132.3, 129.2, 126.8, 124.0, 74.4, 58.3 ; hrms (tof ms es+) m / z calc. for c12h12no3s2 mp 171172 c ; h nmr (500 mhz, acetone - d6) 7.70 (d, j = 7.0 hz, 1h), 7.557.45 (m, 2h), 7.39 (dd, j = 8.0, 2.0 hz, 1h), 7.267.22 (m, 1h), 7.01 (br s, 2h), 2.51 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 147.1, 145.8, 139.0, 134.7, 132.3, 132.0, 131.3, 131.2, 127.7, 126.9, 20.7 ; hrms (tof ms es+) m / z calcd. for c11h11clno2s2 [m + h ], 287.9913 ; found, 287.9912. obtained as a yellow solid (265 mg, 88%). mp 211212 c ; h nmr (500 mhz, acetone - d6) 10.4 (s, 1h), 7.93 (d, j = 8.0 hz, 1h), 7.88 (s, 1h), 7.81 (d, j = 8.0 hz, 1h), 7.70 (d, j = 4.0 hz, 1h), 7.64 (d, j = 3.5 hz, 1h), 7.03 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 189.1, 147.6, 146.0, 140.1, 138.6, 132.7, 132.2, 130.9, 128.1, 126.9, 125.7 ; hrms (tof ms es+) m / z calcd. for c11h7clno3s2 [m h ], 299.9556 ; found, 299.9566. mp 209210 c ; h nmr (500 mhz, acetone - d6) 9.29 (s, 1h), 8.15 (s, 1h), 7.637.58 (m, 2h), 7.447.38 (m, 3h), 6.92 (br s, 2h), 2.13 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 169.3, 149.9, 145.1, 141.4, 134.3, 132.2, 130.5, 124.0, 121.5, 120.2, 117.3, 24.4 ; hrms (tof ms es+) m / z calcd. for c12h13n2o3s2 [m + h ], 297.0374 ; found, 297.0376. mp 214215 c ; h nmr (500 mhz, acetone - d6) 8.27 (br s, 1h), 7.607.50 (m, 3h), 7.18 (d, j = 7.0 hz, 1h), 6.956.90 (m, 1h), 6.79 (br s, 2h), 2.36 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 152.0, 145.7, 144.7, 131.6, 130.3, 126.4, 126.1, 124.7, 121.3, 121.1, 16.5 ; hrms (tof ms es+) m / z calcd. for c11h10no3s2 mp 256258 c ; h nmr (500 mhz, acetone - d6) 8.05 (d, j = 9.5 hz, 1h), 7.91 (d, j = 8.0 hz, 1h), 7.74 (d, j = 3.5 hz, 1h), 7.69 (d, j = 9.0 hz, 1h), 7.53 (d, j = 9.5 hz, 1h), 7.497.44 (m, 1h), 7.437.38 (m, 1h), 7.09 (d, j = 4 hz, 1h), 6.97 (br s, 2h), 3.93 (br s, 3h) ; c nmr (125.8 mhz, acetone - d6) 155.5, 145.7, 142.5, 134.0, 131.6, 130.5, 129.1, 129.1, 128.5, 127.5, 124.3, 124.1, 115.1, 113.6, 56.4 ; hrms (tof ms es+) m / z calcd. for c15h12no3s2 [m h ], 318.0259 ; found, 318.0258. obtained as a yellow solid (122 mg, 46%). mp 148150 c ; h nmr (500 mhz, acetone - d6) 7.737.67 (m, 2h), 7.607.53 (m, 3h), 7.507.44 (m, 1h), 6.92 (br s, 2h), 6.856.75 (m, 1h), 5.91 (dd, j = 17.5, 4.5 hz, 1h), 5.32 (dd, j = 11.0, 4.5 hz, 1h) ; c nmr (125.8 mhz, acetone - d6) 149.6, 145.2, 139.2, 137.1, 133.3, 132.3, 128.0, 127.1, 124.1, 115.3 ; hrms (tof ms es+) m / z calcd. for c12h10no2s2 [m h ], 264.0153 ; found, 264.0163. mp 188190 c ; h nmr (500 mhz, acetone - d6) 7.687.50 (m, 5h), 7.42 (d, j = 4 hz, 1h), 6.90 (br s, 2h), 1.36 (s, 9h) ; c nmr (125.8 mhz, acetone - d6) 152.8, 149.9, 144.4, 132.1, 130.9, 126.9, 126.5, 123.4, 35.1, 31.7, 31.3 ; hrms (tof ms es+) m / z calcd. for c14h16no2s2 [m h ], 294.0622 ; found, 294.0624. mp 196198 c ; h nmr (500 mhz, acetone - d6) 8.47 (s, 1h), 8.27 (s, 1h), 8.23 (s, 1h), 7.74 (d, j = 4.0 hz, 1h), 7.66 (d, j = 4.0 hz, 1h), 7.02 (br s, 2h), 3.99 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 165.4, 147.1, 146.2, 135.6, 133.3, 132.5, 132.2, 130.8, 127.3, 126.4, 126.3, 53.1 ; hrms (tof ms es+) m / z calc. for c12h10n2o2s2 mp 155156 c ; h nmr (500 mhz, acetone - d6) 7.63 (dd, j = 7.0, 2.0 hz, 2h), 7.54 (d, j = 4.0 hz, 1h), 7.31 (d, j = 4.0 hz, 1h), 7.01 (dd, j = 7.0, 2.0 hz, 2h), 6.85 (br s, 2h), 4.154.06 (m, 2h), 1.421.35 (m, 3h) ; c nmr (125.8 mhz, acetone - d6) 160.7, 150.2, 143.7, 132.3, 128.2, 126.2, 122.7, 115.9, 64.3, 15.0 ; hrms (tof ms es+) m / z calcd. for c12h12no3s2 mp 262264 c ; h nmr (500 mhz, acetone - d6) 7.89 (dd, j = 7.5, 1.5 hz, 1h), 7.687.60 (m, 4h), 7.517.46 (m, 2h), 7.457.39 (m, 2h), 7.32 (d, j = 6.5 hz, 1h), 7.177.11 (m, 1h), 6.90 (br s, 2h), 5.45 (s, 2h) ; c nmr (125.8 mhz, acetone - d6) 155.4, 145.3, 144.9, 137.6, 130.6, 129.3, 129.1, 128.8, 128.4, 125.4, 122.7, 122.1, 114.3, 71.1 ; hrms (tof ms es+) m / z calcd. for c17h15no3s2na [m + na ], 368.0391 ; mp 144145 c ; h nmr (500 mhz, acetone - d6) 7.61 (d, j = 3.5 hz, 1h), 7.41 (d, j = 7.5 hz, 1h), 7.34 (d, j = 4.5 hz, 2h), 7.307.26 (m, 1h), 7.14 (d, j = 4.0 hz, 1h), 6.91 (br s, 2h), 2.41 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 148.8, 145.7, 136.9, 133.4, 131.9, 131.3, 131.0, 129.8, 127.5, 127.2, 21.1 ; hrms (tof ms es+) m / z calcd. for c11h12no2s2 mp 256258 c ; h nmr (500 mhz, acetone - d6) 7.697.65 (m, 2h), 7.60 (dd, j = 7.5, 1.5 hz, 1h), 7.53 (dd, j = 7.5, 1.5 hz, 2h), 7.44 (t, j = 7.5 hz, 1h), 7.39 (td, j = 7.5, 1.5 hz, 1h), 7.35 (dd, j = 7.5, 1.5 hz, 1h), 7.33 (d, j = 3.5 hz, 1h) ; c nmr (125.8 mhz, acetone - d6) 147.0, 146.0, 137.1, 136.6, 136.1, 135.7, 134.1, 131.1, 130.9, 130.4, 129.7, 129.4, 129.3, 129.0, 128.7 ; hrms (tof ms es+) m / z calcd. for c16h10no2s4 [m h ], 375.9594 ; found, 375.9606. obtained as a yellow solid (268 mg, 90%). mp 208209 c ; h nmr (500 mhz, acetone - d6) 10.06 (s, 1h), 8.01 (d, j = 9.0 hz, 1h), 7.68 (d, j = 3.5 hz, 1h), 7.29 (d, j = 4.0 hz, 1h), 7.23 (dd, j = 9.0, 2.5 hz, 1h), 7.13 (d, j = 2.0 hz, 1h), 7.03 (br s, 2h), 4.02 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 189.7, 164.7, 147.8, 144.5, 139.2, 131.4, 130.2, 130.2, 128.7, 116.9, 116.4, 59.5 ; hrms (tof ms es+) m / z calcd. for c12h11no4s2na [m + na ] mp 144146 c ; h nmr (500 mhz, acetone - d6) 7.47 (d, j = 3.5 hz, 1h), 7.02 (d, j = 3.5 hz, 1h), 6.80 (br s, 2h), 6.33 (m, 1h), 2.432.41 (m, 2h), 2.242.08 (m, 2h), 1.821.75 (m, 2h), 1.701.62 (m, 2h) ; c nmr (125.8 mhz, acetone - d6) 152.4, 142.6, 131.4, 131.4, 127.3, 121.8, 27.7, 26.1, 23.1, 22.4 ; hrms (tof ms es+) m / z calcd. for c10h13no2s2 na [m + na ], 266.0285 ; found, 266.0287. mp 155156 c ; h nmr (500 mhz, acetone - d6) 7.427.37 (m, 1h), 6.856.81 (m, 1h), 6.73 (br s, 2h), 2.86 (d, j = 7.5 hz, 1h), 1.161.108 (m, 2h), 0.840.74 (m, 2h) ; c nmr (125.8 mhz, acetone - d6) 155.8, 142.2, 131.4, 123.4, 12.1, 11.1 ; hrms (tof ms es+) m / z calcd. for c7h8no2s2 [m + h ], 204.0153 ; mp 212214 c ; h nmr (500 mhz, acetone - d6) 10.36 (s, 1h), 7.907.71 (m, 4h), 7.11 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 186.4, 154.6, 152.5, 149.3, 149.2, 147.3, 147.2, 139.6, 131.7, 129.5, 129.5, 124.8, 124.4 ; hrms (tof ms es+) m / z calcd. for c11h6f2no3s2 [m h ], 301.9757 ; found, 301.9757. obtained as a yellow solid (273 mg, 94%). mp 236237 c ; h nmr (500 mhz, acetone - d6) 9.40 (s, 1h), 8.618.59 (m, 1h), 8.24 (d, j = 8.0 hz, 1h), 8.00 (d, j = 5.5 hz, 1h), 7.92 (dd, j = 7.5, 1.5 hz, 1h), 7.807.73 (m, 2h), 7.417.39 (m, 1h), 7.06 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 154.0, 147.0, 145.7, 145.3, 134.5, 133.2, 131.7, 130.6, 130.1, 129.9, 128.8, 127.9, 118.2 ; hrms (tof ms es+) m / z calcd. for c13h11n2o2s2 [m + h ], 291.0262 ; found, 291.0260. mp 194195 c ; h nmr (500 mhz, acetone - d6) 8.478.45 (m, 1h), 8.148.11 (m, 1h), 7.657.63 (m, 1h), 7.567.52 (m, 1h), 7.527.49 (m, 1h), 7.04 (br s, 1h) ; c nmr (125.8 mhz, acetone - d6) 150.2, 149.0, 147.7, 143.2, 140.7, 130.9, 129.4, 129.3, 124.1 ; hrms (tof ms es+) m / z calcd. for c9h8cln2o2s2 [m + h ], 274.9714 ; found, 274.9709. obtained as a yellow solid (223 mg, 78%). mp 202203 c ; h nmr (500 mhz, acetone - d6) 9.02 (d, j = 1.5 hz, 1h), 8.608.53 (m, 1h), 8.458.36 (m, 1h), 7.84 (d, j = 6.5 hz, 1h), 7.71 (d, j = 6.5 hz, 1h), 7.12 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 157.1, 148.7, 146.5, 143.1, 137.8, 135.3, 132.4, 128.1, 119.5 ; hrms (tof ms es+) m / z calcd. for c9h8n3o4s2 [m + h ], 285.9956 ; found, 285.9955. obtained as a yellow solid (213 mg, 78%). mp 166167 c ; h nmr (500 mhz, acetone - d6) 10.06 (s, 1h), 8.59 (d, j = 5.0 hz, 1h), 7.85 (d, j = 5.0 hz, 1h), 7.61 (dd, j = 8.5, 3.8 hz, 1h), 7.41 (dd, j = 8.5, 4.0 hz, 1h), 6.96 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 185.6, 146.0, 141.5, 140.3, 139.9, 133.7, 131.3, 128.9, 128.2 ; hrms (tof ms es+) m / z calcd. for c9h7no3s3na [m + na ], 295.9486 ; found, 295.9491. mp 214215 c ; h nmr (500 mhz, acetone - d6) 7.64 (d, j = 3.5 hz, 1h), 7.20 (d, j = 4.0 hz, 1h), 6.96 (br s, 2h), 2.55 (s, 3h), 2.35 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 167.3, 158.4, 145.3, 137.1, 131.3, 126.9, 109.9, 11.8, 10.8 ; hrms (tof ms es+) m / z calcd. for c9h10n2o3s2na [m + na ], 281.0031 ; found, 281.0027. mp 188189 c ; h nmr (500 mhz, dmso - d6) 7.74 (br s, 2h), 7.64 (d, j = 5.5 hz, 1h), 7.48 (d, j = 2.1 hz, 1h), 7.46 (dd, j = 3.5, 1.0 hz, 1h), 7.31 (d, j = 4.0 hz, 1h), 7.15 (t, j = 4.0 hz, 1h) ; c nmr (125.8 mhz, dmso - d6) 143.4, 140.9, 134.7, 131.0, 128.7, 127.3, 125.9, 123.7 ; hrms (tof ms es+) m / z calcd. for c8h8no2s3 [m + h ], 245.9717 ; found, 245.9712. mp 181182 c ; h nmr (500 mhz, acetone - d6) 7.817.79 (m, 1h), 7.62 (dd, j = 5.0, 3.0 hz, 1h), 5.54 (d, j = 4.0 hz, 1h), 7.46 (dd, j = 5.0, 1.0 hz, 1h) ; c nmr (125.8 mhz, acetone - d6) 144.8, 144.0, 135.1, 132.1, 128.4, 126.7, 124.0, 122.7 ; hrms (tof ms es+) m / z calcd. for c8h6no2s3 [m h ], 243.9561 ; found, 243.9572. obtained as a white solid (190 mg, 79%). mp 200201 c ; h nmr (500 mhz, acetone - d6) 8.94 (d, j = 2.0 hz, 1h), 8.60 (d, j = 3.0 hz, 1h), 8.108.05 (m, 1h), 7.63 (d, j = 3.5 hz, 1h), 7.57 (d, j = 4.0 hz, 1h), 7.507.46 (m, 1h), 6.99 (br s, 2h) ; c nmr (125.8 mhz, acetone - d6) 150.8, 147.8, 146.5, 146.1, 134.1, 132.3, 130.0, 125.5, 125.0 ; hrms (tof ms es+) m / z calcd. for c9h9n2o2s2 [m + h ], 241.0105 ; found, 241.0107. obtained as a yellow solid (326 mg, 78%). mp 246248 c ; h nmr (500 mhz, acetone - d6) 8.20 (s, 1h), 8.13 (d, j = 7.0 hz, 1h), 7.92 (d, j = 7.5 hz, 1h), 7.70 (t, j = 6.5 hz, 1h), 7.65 (d, j = 4.0 hz, 1h), 7.637.59 (m, 2h), 7.53 (d, j = 4.0 hz, 1h), 7.48 (t, j = 8.0 hz, 1h), 7.437.39 (m, 1h) ; c nmr (125.8 mhz, acetone - d6) 144.7, 140.3, 138.4, 136.1, 135.4, 131.8, 130.5, 128.7, 127.9, 126.5, 125.6, 125.1, 121.1, 116.8, 114.6 ; hrms (tof ms es+) m / z calcd. for c18h13n2o4s3 [m h ], 417.0037 ; found, 417.0036. obtained as a yellow solid (159 mg, 58%). mp 196197 c ; h nmr (500 mhz, dmso - d6) 8.81 (d, j = 2.5 hz, 1h), 8.20 (dd, j = 8.5, 2.5 hz, 1h), 7.82 (br s, 2h), 7.69 (d, j = 3.5 hz, 1h), 7.63 (dd, j = 8.0, 4.5 hz, 1h), 7.59 (d, j = 4.0 hz, 1h) ; c nmr (125.8 mhz, dmso - d6) 150.0, 146.7, 145.8, 142.4, 136.8, 131.0, 128.1, 125.7, 124.7 ; hrms (tof ms es+) m / z calcd. for c9h8cln2o2s2 mp 188189 c ; h nmr (500 mhz, acetone - d6) 9.92 (s, 1h), 7.85 (s, 1h), 7.64 (d, j = 7.0 hz, 1h), 7.43 (d, j = 4.0 hz, 1h), 7.02 (br s, 2h), 2.80 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 183.9, 147.5, 142.5, 141.7, 140.6, 139.1, 137.9, 131.9, 128.1, 15.8 ; hrms (tof ms es+) m / z calcd. for c10h10no3s3 [m + h ], 285.9666 ; found, 285.9673. mp 248250 c ; h nmr (500 mhz, dmso - d6) 8.48 (dd, j = 8.0, 1.0 hz, 1h), 8.478.44 (m, 1h), 8.138.10 (m, 1h), 7.86 (s, 2h), 7.85 (d, j = 7.5 hz, 1h), 7.727.69 (m, 2h), 7.67 (t, j = 7.5 hz, 1h), 7.627.57 (m, 2h) ; c nmr (125.8 mhz, dsmo - d6) 145.4, 145.2, 138.1, 136.5, 136.4, 134.9, 130.7, 127.7, 127.6, 126.9, 126.1, 125.8, 125.3, 123.0, 122.6, 122.4 ; hrms (tof ms es+) m / z calcd. for c16h12no2s3 [m + h ], 346.0030 ; found, 346.0036. mp 156158 c ; h nmr (500 mhz, dmso - d6) 9.93 (s, 1h), 8.04 (d, j = 4.0 hz, 1h), 7.86 (br s, 2h), 7.68 (d, j = 4.0 hz, 1h), 7.59 (d, j = 3.5 hz, 1h), 7.56 (d, j = 4.0 hz, 1h) ; c nmr (125.8 mhz, dmso - d6) 184.2, 146.1, 143.3, 142.7, 139.1, 139.0, 131.1, 127.0, 126.6 ; hrms (tof ms es) m / z calcd. for c9h5no3s3 [m h ], 271.9510 ; found, 271.9512. mp 209210 c ; h nmr (500 mhz, dmso - d6) 7.90 (br s, 1h), 7.68 (br s, 2h), 7.537.49 (m, 1h), 7.487.46 (m, 1h), 7.447.38 (m, 3h), 6.51 (s, 1h) ; c nmr (125.8 mhz, dmso - d6) 150.5, 142.1, 136.2, 131.1, 128.1, 126.9, 123.6, 121.6, 119.5, 117.7, 112.3, 101.8 ; hrms (tof ms es+) m / z calcd. for c12h9n2 [m o2s2 ], 277.0112 ; found, 277.0117. obtained as a blackish brown solid (188 mg, 82%). mp 165167 c ; h nmr (500 mhz, acetone - d6) 7.687.66 (m, 1h), 7.54 (d, j = 3.5 hz, 1h), 7.32 (d, j = 4.0 hz, 1h), 6.94 (br s, 2h), 6.88 (d, j = 3.5 hz, 1h), 6.616.59 (m, 1h) ; c nmr (125.8 mhz, acetone - d6) 148.5, 144.1, 138.7, 131.9, 127.8, 122.8, 113.1, 108.3 ; hrms (tof ms es+) m / z calcd. for c8h8no3s2 [m + h ], 229.9946 ; mp 186187 c ; h nmr (500 mhz, acetone - d6) 8.048.01 (m, 1h), 7.677.63 (m, 1h), 7.537.49 (m, 1h), 7.237.19 (m, 1h), 6.87 (br s, 2h), 6.80 (s, 1h) ; c nmr (125.8 mhz, acetone - d6) 145.2, 143.5, 140.4, 131.7, 129.3, 124.0, 120.2, 109.6 ; hrms (tof ms es+) m / z calcd. for c8h6no3s2 [m h ], 227.9789 ; found, 227.9781. mp 192193 c ; h nmr (500 mhz, acetone - d6) 7.52 (d, j = 4.0 hz, 1h), 7.21 (d, j = 4.0 hz, 1h), 6.88 (br s, 2h), 6.71 (d, j = 3.5 hz, 1h), 6.196.17 (m, 1h), 2.33 (s, 3h) ; c nmr (125.8 mhz, acetone - d6) 153.6, 146.6, 142.8, 139.0, 131.7, 121.5, 109.1, 109.0, 13.1 ; hrms (tof ms es) m / z calcd. | a mild, practical protocol has been developed for the suzuki cross - coupling of unprotected thienylsulfonamides from air- and bench - stable organotrifluoroborates in the absence of a protecting group on the sulfonamide nitrogen. the developed synthetic method can be applied to the preparation of various arylated and heteroarylated thienylsulfonamides under conditions that are tolerant of a broad range of functional groups. |
we investigated a tbe outbreak, comprising 6 cases, in a mountain region in western austria in july 2008. the index case occurred in a 43-year - old shepherd who had stayed for 24 days at his alpine pasture (1,564 m above sea level) before he was hospitalized for nonbacterial urethritis and nonspecific influenza - like symptoms (including pain in the lower abdomen and legs), followed by clinical signs of meningitis. tbev infection was confirmed serologically by elisa demonstration of specific immunoglobulin (ig) m and igg in serum and cerebrospinal fluid. the patient did not remember a tick bite but had eaten self - made cheese prepared from a mixture of nonpasteurized goat milk and cow milk 811 days before illness onset ; further investigation found 6 additional persons who had eaten the same cheese (figure). for 5 of them, recent tbev infection was serologically proven (table). for 3 of these persons (2 men, 44 and 65 years of age ; and 1 woman, 60 years of age), similar to the index patient, a typical biphasic course and symptoms of tbe (nonspecific flu - like symptoms followed by fever, cephalea, meningism, and ataxia after 410 days) developed and they were hospitalized. the 2 other persons who had eaten the cheese (female, 37 and 7 years of age) were clinically asymptomatic. the noninfected person had vomited shortly after eating the cheese because of a gastric banding. time course and series of events of a tick - borne encephalitis (tbe) outbreak from cheese made with goat milk. week 0, transport of goat to high altitude ;, onset of disease ; o i, hospitalization period ; tbev, tick - borne encephalitis virus ; me, meningoencephalitis. tbev, tick - borne encephalitis virus ; nt, neutralization test ; csf, cerebrospinal fluid ; ig, immunoglobulin ; me, meningioencephalitis ; pos, positive ; bor, borderline ; na, not applicable ; neg, negative. the cheese was prepared from a mixture of fresh milk from 1 goat and 3 cows and was eaten shortly after production. detection of tbev - specific hemagglutination inhibiting (hi) and neutralizing antibodies in the goat s serum proved infection in the goat ; the 3 cows were seronegative for tbev. at the time of this investigation (1 month after cheese production), tbev was already undetectable by pcr in serum and milk of the goat. cheese from the 3 batches produced after the contaminated batch was tbev negative by pcr. the 4 domestic pigs kept at the alpine pasture and fed with the whey and goat milk, however, were seropositive (tbev hi- and neutralizing antibodies detected), which indicated tbev infection, but no clinical signs were observed. serum samples from 105 goats from pastures in the neighborhood also were investigated for tbev - specific antibodies ; all goats were seronegative. our analyses showed that the 6 humans and the 4 pigs were infected through the milk of 1 goat, which had been transported by car from a tbe nonendemic valley to the alp 12 days before production of the tbev - contaminated cheese. experiments have demonstrated that infected domestic animals (i.e., goats, sheep, and cows) can excrete tbev into milk for 37 days, beginning as early as the second or third day postinfection (69). in addition, although cheese was produced once or twice each week, only this 1-kg batch of cheese transmitted tbev. therefore, all the evidence indicates that the goat was infected at the alpine pasture at an altitude of 1,564 m. indeed, some ticks were collected from cows that had stayed at this altitude during the entire summer. analyses of these ticks for tbev by pcr, however, yielded only negative results. our findings provide further evidence for the expansion of tbev - endemic regions to higher altitudes in central europe. for example, longitudinal studies in the czech republic, a country with similar climatic and ecologic conditions to those of austria, showed a shift in ixodes ricinus ticks and tbev, from 700 m in 19811983 to 1,100 m altitude in 20012005 (10,11). likewise, zeman and benes demonstrated that the maximum altitude at which tbev is found in the czech republic gradually moved upward during 19702000, corresponding to the rise in temperature during the same period (12). in scandinavia, a northward extension of the geographic range of i. ricinus ticks and tbev since the mid-1980s has also been recognized (1,1315). climatic changes most likely are the major driving forces for the geographic changes in the distribution of tbev and its main vector, i. ricinus, in europe. this report also emphasizes the efficiency of oral transmission of tbev to humans and to pigs. six of the 7 persons who ate the cheese and all 4 pigs fed residual milk or whey from the same cheese became infected. given the excellent effectiveness of the tbe vaccine (2), vaccination probably could have prevented all 6 human cases. | we report transmission of tick - borne encephalitis virus (tbev) in july 2008 through nonpasteurized goat milk to 6 humans and 4 domestic pigs in an alpine pasture 1,500 m above sea level. this outbreak indicates the emergence of ticks and tbev at increasing altitudes in central europe and the efficiency of oral transmission of tbev. |
the oral rehabilitation of patients with implants requires the placement of stable prostheses enabling security, comfort and longevity to treatment. the beginning of the construction of prosthetic treatment requires the faithful reproduction of the working cast of the situation found in mouth, to reduce the errors inherent to this stage. numerous studies have tried to find the " perfect " fit between prosthetic components and the implant. however, the variables found in the steps of the clinical and laboratory procedures involved in the fabrication prostheses become an obstacle in the search for a perfect fit, leading to errors that make it impossible to obtain a dental implant with a perfect framework fit. during the production stages of a cast, some processes may influence the correct analogue position of the working cast, increasing the chances of distortion and misfit of the final prosthesis. the casting material used, the casting technique and the casting impression conditions are factors that can influence the accurate reproduction of the clinical situation. another important aspect to be considered is the step of sending the molds to the laboratory. a study by christensen (1997) demonstrated that most jobs ready to be poured with gypsum were deficient in some aspect. the literature, although large and concerned with the techniques and impression materials, is scarce when dealing with the variables of everyday practice. a small number of studies focused on the influence of factors such as casting of the plaster cast or the technique for casting on dimensional changes of the casts. in an attempt to minimize distortions in the procedures for obtaining a working cast, improve the accuracy of implant prostheses and assist dentists, we developed a small, silent and portable vibrator. we hypothesized that this device would be able to reduce the vibration generated by conventional devices, thus leading to fewer changes in the working cast, better adaptation between the cylinders of implant - supported dentures and their respective analogues. this would result in a more faithful copy of the situation in the mouth, with minimal bubbles and dimensional change in the working cast. the purposes of this study were to test the technique of casting plaster using this portable vibrator device, comparing it with conventional methods, and to evaluate the influence of this device on the position of implant analogue working casts. a master acrylic resin template (palaton - dencril, pirassununga, sp, brazil) of a class iv edentulous maxillary arch, with two external hexagonal implants 3.75x11 mm (master screw ; conexo sistemas de prteses, so paulo, sp, brazil) positioned in the region of the maxillary right lateral incisor (a) and maxillary left lateral incisor (b) was manufactured for the study design (figure 1). two abutments (micro - unit ; conexo sistemas de prteses, aruj, sp, brazil) were installed by manual ratchet key until a torque of 20 n.cm was produced according to the manufacturer 's directions and 30 transfer moldings were made with open trays. this cast was then randomly divided into three groups, depending on the plaster casting technique : step - by - step fabrication of the portable device designed to casting plaster (a) : electric toothbrush ; (b) : bristles of the brush removed ; (c) : hole on tip of the toothbrush in place of the bristles ; (d) : installation of the tip of a brush on the opposite side of the bristles and (e) : portable vibrator ready group i (gi):pouring performed at an outsourced dental laboratory with conventional plaster vibrator (10 casts) ; group ii (gii):pouring performed at ufsc laboratory with conventional plaster vibrator (10 casts) ; group iii (giii) : pouring performed with the portable vibrator fabricated for this study (10 casts). to make the impressions, standard size (no. 3) perforated plastic trays were used (jg, jon, so paulo, sp, brazil), with an opening at the top of two holes designed for the removal of screws for transferring squares. the material of choice for the impression was polyvinyl siloxane (pvs) (express xt silicone addition, 3 m espe, usa) and manipulation was done by the single step double impression technique. the transfer copings were screwed in their abutments in the master cast and splinted together with a metal rod and acrylic pattern resin (trim plus red - acrylic pattern ; harry j. bosworth company, skokie, il, usa), reducing the distortion of polymerization. after 10 min of union with transferring acrylic resin, heavy - body pvs was handled according to the manufacturer 's instructions and the tray was loaded with the material, while light - body pvs was injected into the region of the implants and their components. to standardize the molding, heavy - body pvs was measured in a plastic syringe injector for elastomer (jon) filled with slurry by cast. setting of the dummy tray was held constant with manual pressure until it clicked into a reference point located on the mannequin, then held in position for 10 min to complete polymerization of the material. all impressions were made in the same temperature - controlled air conditioning between 18c and 22c. after the mold was ready, the transfer copings were loosened to remove the impression and screwed to the respective analogues of the abutments (conexo sistemas de prteses). for all transfer copings a torque of 10 n.cm was applied manually with a keyed ratchet (conexo sistemas de prteses), but the placement of analogues was performed with a digital grip, because the torque applied by a 10 n.cm ratchet could cause rotation of the transferor pvs. adaptation of impressions prior to the tightening grip and digital analogue was again verified by the transferor with explorer no. when the impressions were ready, with the union of the analogues, they were randomly assigned to groups according to the technique of casting plaster. the 30 plaster casts used microgranulated special type iv plaster (durone, dentisply, petrpolis, rj, brazil), and pouring was conducted in an area for at least 60 min and at most 3 days after the order was ready. for casting plaster of group iii, we developed a portable vibrator made from an electric toothbrush (360 sonic power, colgate palmolive ind. the bristles of the brush were removed using a carborundum disk - type cutter and maxi - cut, and a hole in the place of the bristles was made for installation of the tip of a brush on the opposite side (round marta brush tropical 006, tigre, so paulo, sp, brazil), maintaining a slight inclination toward the end to facilitate placement of the plaster inside the impression (figure 1). ten impressions were sent to the outsourced laboratory, in a routine procedure for work on prosthetic implants. along with the impressions, an order tab was included with the request for plaster casting of special type iv, for a minimum standardization with the other groups. the casts of groups ii and iii were poured with 100 g of powder type iv gypsum, proportioned to 22 ml of water and hand - mixed for 60 s. insertion of the plaster cast was performed according to the technique assigned to each group, with group ii using the leaked vibrator with conventional casting and group iii with the portable vibrator. after a period of at least 1 h of setting time for the plaster, the working casts were removed from the mold. all casts were stored at room temperature for at least 92 h before assessment of misfit. to standardize the samples, all steps of molding, tooling, and casting of plaster were made by the researcher in charge, while handling the pvs was done by an assistant operator. verification of the accuracy of the position of analogues and comparison between groups was performed to develop an infrastructure (ie) from two metal cylinders of titanium abutment micro - unit, bolted to the abutment of the master cast (mc) and joined together by a titanium bar and laser welding. to calculate the misfit of the casts and make comparisons between groups, we measured the vertical misfit of ie in the mc to verify the reliability of the adaptation and the value of the initial ie misfit. then, the evaluations also were carried out in testing casts (tc) of groups i, ii, and iii, with ie placed on them, whose respective averages were subtracted from the initial value obtained for mc in order to obtain the real misfit value. the implants of mc and related analogues of the tested casts were recorded as a and b, from left to right, as with the cylinders of ie. evaluation of misfit was based on the protocol of tightening the screw only to test the passivity of the implant structures, which had the grip of a retainer and evaluation of the contrary retainer (figure 2). infrastructure placed on the master cast (mc) (a) and the test cast (tc) (b) to test the single screw the misfit was measured at 120x magnification in a measuring microscope accurate to 1.0 m (uhl mm-100-bt, uk), equipped with a digital camera (kc-512nt ; kodo br electronics ltd., so paulo, sp, brazil) and analyzer unit (qc 220-hh quadra - check 200 ; metronics inc., bedford, nh, usa). the casts were placed randomly under the microscope so that the blind evaluator did not know to which group they belonged. all casts were evaluated at identical points and cylinders a and b of ie were marked with a carborundum disk 75x0.2 mm on the handpiece. the readings were performed by an examiner on two calibrated points on the buccal (1 and 2) and two in the lingual face (3 and 4), ordered from left to right. the sequence of assessment was followed by the tightening of the screw in the implant b with 10 n.cm and measuring the distance in micrometers (m) of 1 - 4 points on the interface of the cylinder to the abutment / analogue interface, identifying the considered misfit (figure 3). the same procedure was then performed for b. each point was measured three times and the average value used for the analysis. microscopic image of the misfit generated at the interface of one point means and standard deviations for each plaster casting technique were calculated and analyzed by one - way anova to determine whether there were significant differences between groups, at =0.05. after anova, data were subjected to holm - sidak multiple comparison test, which identified the p values. the software used was sigmastat 3.5 (systat software, inc., chicago, il, usa). for casting plaster of group iii, we developed a portable vibrator made from an electric toothbrush (360 sonic power, colgate palmolive ind. the bristles of the brush were removed using a carborundum disk - type cutter and maxi - cut, and a hole in the place of the bristles was made for installation of the tip of a brush on the opposite side (round marta brush tropical 006, tigre, so paulo, sp, brazil), maintaining a slight inclination toward the end to facilitate placement of the plaster inside the impression (figure 1). ten impressions were sent to the outsourced laboratory, in a routine procedure for work on prosthetic implants. along with the impressions, an order tab was included with the request for plaster casting of special type iv, for a minimum standardization with the other groups. the casts of groups ii and iii were poured with 100 g of powder type iv gypsum, proportioned to 22 ml of water and hand - mixed for 60 s. insertion of the plaster cast was performed according to the technique assigned to each group, with group ii using the leaked vibrator with conventional casting and group iii with the portable vibrator. after a period of at least 1 h of setting time for the plaster, the working casts were removed from the mold. all casts were stored at room temperature for at least 92 h before assessment of misfit. to standardize the samples, all steps of molding, tooling, and casting of plaster were made by the researcher in charge, while handling the pvs was done by an assistant operator. verification of the accuracy of the position of analogues and comparison between groups was performed to develop an infrastructure (ie) from two metal cylinders of titanium abutment micro - unit, bolted to the abutment of the master cast (mc) and joined together by a titanium bar and laser welding. to calculate the misfit of the casts and make comparisons between groups, we measured the vertical misfit of ie in the mc to verify the reliability of the adaptation and the value of the initial ie misfit. then, the evaluations also were carried out in testing casts (tc) of groups i, ii, and iii, with ie placed on them, whose respective averages were subtracted from the initial value obtained for mc in order to obtain the real misfit value. the implants of mc and related analogues of the tested casts were recorded as a and b, from left to right, as with the cylinders of ie. evaluation of misfit was based on the protocol of tightening the screw only to test the passivity of the implant structures, which had the grip of a retainer and evaluation of the contrary retainer (figure 2). infrastructure placed on the master cast (mc) (a) and the test cast (tc) (b) to test the single screw the misfit was measured at 120x magnification in a measuring microscope accurate to 1.0 m (uhl mm-100-bt, uk), equipped with a digital camera (kc-512nt ; kodo br electronics ltd., so paulo, sp, brazil) and analyzer unit (qc 220-hh quadra - check 200 ; metronics inc., bedford, nh, usa). the casts were placed randomly under the microscope so that the blind evaluator did not know to which group they belonged. all casts were evaluated at identical points and cylinders a and b of ie were marked with a carborundum disk 75x0.2 mm on the handpiece. the readings were performed by an examiner on two calibrated points on the buccal (1 and 2) and two in the lingual face (3 and 4), ordered from left to right. the sequence of assessment was followed by the tightening of the screw in the implant b with 10 n.cm and measuring the distance in micrometers (m) of 1 - 4 points on the interface of the cylinder to the abutment / analogue interface, identifying the considered misfit (figure 3). the same procedure was then performed for b. each point was measured three times and the average value used for the analysis. means and standard deviations for each plaster casting technique were calculated and analyzed by one - way anova to determine whether there were significant differences between groups, at =0.05. after anova, data were subjected to holm - sidak multiple comparison test, which identified the p values. the software used was sigmastat 3.5 (systat software, inc., chicago, il, usa). data analysis revealed a statistically significant difference between group iii as compared to groups i and ii (p<0.001) (figure 4). this means that the technique of casting the plaster with a portable vibrator produces a smaller misfit between cylinders of implant - supported dentures and their respective analogues in comparison with the conventional techniques for casting plaster. means and standard deviations(sd) of the misfit (m) for the three groups. for the construction of a fixed partial denture on implants, several steps must be followed to reduce errors and obtain a clinically acceptable product. according to dental knowledge, the larger the number of pontics and retainers in prosthesis, the greater the chances of mismatch. since the installation of the abutment to the working model also, the fact that the analogues are screwed to the implant makes them susceptible to displacement, especially during vibration of plaster during pouring. this work aimed to check the effectiveness of a new portable vibrator on the plaster pouring of implant - supported dentures, also to verify if this device reduces the possibility of misfit between cylinders of implant - supported dentures and their respective analogues. the results of the present work showed that the portable vibrator led to lower misfit values between cylinders of implant - supported dentures and their respective analogues when compared to conventional vibrator. a minimum misfit was found when using the new vibrator, but the " perfect " adaptation is almost impossible to reach. extrapolating to clinical results of acceptable misfit of an implant - supported prosthesis, the literature is unable to show an ideal value of adjustment that will not jeopardize the entire system for prosthetic reconstruction. according to tossi (2010) values of marginal fit between frameworks to multiple - units are clinically acceptable within 150 m range. carr (1996) in an in vivo study on primates verified that there is no statistically significant difference in bone response around the implants supporting frameworks with 38 m and 345 m misfits. according to literature the marginal misfit can be influenced by the technique and by the material used to fabricate the frameworks. however, this research suggests that the vibration is also an important factor at this point, reminding that it refers to just one of many steps that are required to get a prosthetic piece. during the other steps required to complete prosthesis fabrication, such as firing porcelain several times and finishing done by a laboratory technician, misfit values will be further enhanced, thus emphasizing the importance of using laboratory techniques and devices that decrease the possibility of distortion in the final piece. the new portable vibrator not only contributes to decrease the misfit, but also has the advantage of being a small, soundless and low - cost device. the casting technique using the portable vibrator allowed a smaller misfit between the cylinders of implant - supported dentures and their respective analogues than the conventional plaster vibrator. mauru antnio arruda nbilo, professors of dentistry at the university of campinas, sp, brazil for his contribution and support to this work. | objectivethe aim of this study was to test a new portable vibrator for plaster pouring (developed for this purpose), comparing the effect of its use on the accuracy of working cast of implant - supported restorations to the conventional vibrator. material and methodsfrom a master cast with 2 implants, 30 transfer moldings were made randomly and divided into three groups : group i (gi) : pouring performed in an outsourced dental laboratory with conventional plaster vibrator (10 casts), group ii (gii) : pouring performed in the laboratory of the federal university of santa catarina (ufsc) with conventional plaster vibrator (10 casts) and group iii (giii) : pouring performed with the portable vibrator fabricated for this study (10 casts). the position of the analogue and marginal adaptation of the infrastructure were verified by testing the single screw on the master model and on the working model. the measurement of misfit was blindly performed with a precision microscope and analyzing unit, quadra - check 200. the data were statistically analyzed by analysis of variance (anova) and the holm - sidak test (=0.05).resultsmeansstandard deviations were as follows : gi : 19.194.73 m ; gii : 21.725.41 m ; giii : 13.52.39 m (p<0.05), with giii significantly lower as compared to the other groups. conclusionwithin the limitations of this study, it was concluded that a greater accuracy of working cast was achieved when a portable vibrator was used for casting molds. |
non - straight steps that change the direction of movement account for 3550% of all steps when walking indoors1. patients with stroke fall not only during walking but also during standing turn or transfer between bed and wheelchair2, 3. therefore, the ability to take multidirectional steps is important for patients with stroke. there are many clinical tests that evaluate the temporal aspects of stepping4,5,6,7, but there are few that evaluate the spatial aspects. the maximum step length (msl) test is a clinical test of stepping distance in which participants step to the front, side, and back as far as possible with one leg, before returning to the starting position8, 9. msl values correlate significantly with clinical measures of balance in community - dwelling older adults8. in addition, community - dwelling older adults showed no significant differences in step distance between the front, side, and back directions8. however, differences in step distance in the three directions have not been investigated in patients with stroke. in addition, the reliability of the msl test has been investigated only in the front direction and has not been investigated in the side and back directions10. stroke causes motor dysfunction, loss of coordination, and weakness of the muscles, which affect standing balance and walking11. these features would also affect step distance, and step distance would be expected to vary between limbs (paretic vs. non - paretic) and the direction of stepping (front, side, and back). step training in various directions improves balance and gait12,13,14, and it is important for the step training to evaluate the characteristics of stepping according to step direction and stepping limb. the purposes of this study were to determine the reliability of the msl test for the side and back directions, the effect of the stepping limb and step direction on step distance, and the associations of step distance and stepping laterality in step distance with walking ability and motor dysfunction. we hypothesized that step distance would vary across step directions and stepping limbs, and that the stepping laterality in step distance would be associated with motor dysfunction and walking ability. thirty - nine patients with chronic hemiparesis as a result of stroke sustained at least 6 months previously were recruited from an outpatient rehabilitation center to participate in this study. inclusion criteria were the ability to walk at least 10 m with or without a walking aid or ankle - foot orthosis and the ability to follow commands. individuals were excluded if they had disturbed consciousness, dementia, or musculoskeletal conditions that affect the performance of walking. the institutional review board of the geriatrics research institute and hospital approved this study and all the subjects provided their written informed consent to participation. step distances were measured for the paretic and the non - paretic limbs using the msl test8, 9. the subjects stepped out maximally with one leg, maintaining the stance leg in the initial position, and then returned to their initial stance position in one step. participants were instructed to step out with the paretic leg and the non - paretic leg in each direction, and therefore performed six stepping actions : to the front with the paretic limb, to the side with the paretic limb, to the back with the paretic limb, to the front with the non - paretic limb, to the side with the non - paretic limb, and to the back with the non - paretic limb. the subjects were allowed to use their usual ankle - foot orthosis during the msl test. physical impairments that might affect walking ability were evaluated using the stroke impairment assessment set15,16,17. the motor functions were assessed through hip flexion, knee extension, and foot pat (rapid foot tapping). motor function was evaluated in stages from 0 to 5, with higher scores indicating better function. this treatment - oriented measure includes two static sitting balance items and eight dynamic sitting balance items. the static sitting balance items assess the ability to maintain the sitting position with and without upper limb support. the dynamic sitting balance items assess the ability to : reach with an upper limb, lift the pelvis from a table, move the buttocks in the frontal plane, move the buttocks in the sagittal plane, flex the hips individually, flex the hips together, rotate the upper trunk, and flex the shoulder of the non - paretic upper limb. the maximum score is 20, with higher scores indicating better trunk function. walking ability in the home was evaluated using the functional ambulation category (fac), which includes walking on uneven terrain and walking up and down stairs19. walking ability was rated on the following six - point scale : (0) unable to walk or requires the help of two persons to walk ; (1) ambulatory with firm continuous contact with one person ; (2) ambulatory with the intermittent or continuous support of one person ; (3) ambulatory on level surfaces with verbal supervision or stand - by help from one person without physical contact ; (4) independent ambulation only on level surfaces ; and (5) independent ambulation anywhere, including stairs. walking ability was also evaluated using gait speed in the 10-m walk test and the timed up and go (tug) time20,21,22. for the 10-m walk test, participants walked in a straight line at a comfortable speed for 16 m, including 3-m runways at the start and end of a 10-m test walkway. gait speed was calculated from the time required to walk across the 10-m walkway. the tug time was the amount of time required to stand from a seated position, walk forward 3 m, turn around, walk back to the chair, and sit down. the participants completed these tasks at a comfortable speed and used their usual walking aid and ankle - foot orthosis. the test - retest reliability of the two administrations of the msl test was evaluated using the intraclass correlation coefficient, model 1,1 [icc(1,1)]23. step distance was compared across limbs and step directions using two - way repeated - measures analysis of variance (anova) and the bonferroni post hoc test. for each step direction, the difference in the step distance of the paretic and non - paretic limb was calculated (paretic limb minus non - paretic limb). this stepping laterality was compared across the three directions using one - way repeated - measures anova. pearson correlation coefficients were calculated for all pairwise combinations of step distance in the front, side, and back directions of the two limbs. a conservative estimate of the minimal detectable change at the 95% confidence level (mdc95) is 8.128 cm (3.2 inches)10. therefore, subjects were classified into three groups according to the stepping laterality in step distance to the front : a paretic step distance > 8.128 cm and longer than the non - paretic step distance (longer paretic step group), stepping laterality between 8.128 cm and 8.128 cm (symmetric group), or a paretic step distance > 8.128 cm and shorter than the non - paretic step distance (longer non - paretic step group). one - way anova and tukey s post hoc tests were used to compare walking ability across the three groups. the kruskal - wallis and mann - whitney u tests with bonferroni adjustments were used to compare motor impairment across the three groups. receiver operating characteristic curves were generated to compare the diagnostic validity of step distance to the front to distinguish fac 5 from fac 4. optimal cut - off points were determined by sensitivity, specificity, positive predictive value, and negative predictive value. table 1table 1.characteristics of the subjectsmean sdmedian [first third quartile]age (years)69.99.8gender : male / female (n)23/16duration since stroke onset (days)1562.41182.0paretic side : right / left (n)27/12siaship - flexion4 [24]knee - extension3 [24]foot - pat3 [14]fact10 [614]gait speed (m / sec)0.50.3tug (s)36.124.0fac4 [35]fac : functional ambulation category ; fact : functional assessment for control of trunk ; tug : timed up and go test ; sias : stroke impairment assessment set shows the characteristics of the 39 subjects. their mean (sd) age was 69.9 (9.8) years, and the duration since stroke onset was 1,562.4 (1,182.0) days. the mean gait speed in the 10-m walk test was 0.5 (0.3) m / s, and the tug time was 36.1 (24.0) s. the msl test had excellent test - retest reliability (icc(1,1) = 0.9390.957 ; table 2table 2.reliability and step distance in each directionicc (1,1)95% cistep distance (cm)step limbstep directionlimb directionpareticfront0.9430.895, 0.97026.120.4n.sn.sside0.9390.888, 0.96820.716.9back0.9570.919, 0.97719.117.0non - pareticfront0.9510.909, 0.97425.124.1side0.9540.915, 0.97620.821.3back0.9460.899, 0.97119.119.0icc : intraclass correlation coefficients. values are mean sd. significantly different according to anova (p 0.900). step distance did nt differ significantly between the paretic and non - paretic limb. this indicates that patients with stroke adapt to motor impairment24, and can perform similar length steps with the paretic and non - paretic limb. on the other hand, step distances significantly differed between the front, side and back directions. it is possible that poor coordination of limb segments, poor posture in stepping, the effect of visual information, and insufficient experience of stepping to the side and back caused the differences in step distances across directions. we classified participants into three groups according to the stepping laterality in step distance to the front, with reference to a previous study10. the longer non - paretic step group had better walking ability than the symmetric group and the longer paretic step group. moreover, weight - bearing by the paretic limb improves gait and balance ability26. the step distance of the non - paretic limb indicates the weight shift ability of the paretic lower limb, and good weight shift ability in the paretic limb is necessary for large step distances by the non - paretic limb. therefore, the longer paretic step group had limited weight - bearing ability for the paretic limb and the longer non - paretic step group had adequate weight - bearing ability for the paretic limb, indicating that step distance of the non - paretic limb is important for walking ability. on the other hand, most measures of motor function of the paretic limb did nt differ among the three groups. functional mobility was nt strongly correlated with impairments of motor function in the paretic - lower limb27. therefore, it is possible that motor function of the paretic - lower limb does not affect the stepping laterality in step distance between the paretic and non - paretic limbs. however, the number of participants was small, and this limits the generalizability of our results. correlations between step distances in the different directions were high. therefore, we calculated cut - off scores for the paretic front step distance and non - paretic front step distance to distinguish fac 5 from fac 4. the cut - off score was 33 cm for the paretic front step distance and non - paretic front step distance. fac can discriminate independent walkers, and thus step distance to the front is useful because it can rapidly be evaluated in small spaces. a limitation of this study is that participants had chronic hemiparesis, and most had low walking ability. therefore, our results might not be reflected by stroke patients with good walking ability. in addition, it is possible that the classification of the subjects into three groups using the mdc95 of the msl test may not have been appropriate. the mdc95 of a previous study was too large to usefully classify the participants in our study into three groups10. subjects of the previous study had high gait ability, a mean gait speed of 0.8 m / seconds10, which is equivalent to that of community walkers21. to conclude, we investigated the reliability of the msl test and the differences in step distance across stepping limbs and step directions. the test - retest reliability coefficients were excellent for all step directions (icc = 0.9390.957). in addition, paretic step distance shorter than non - paretic step distance indicated good walking ability. paretic front step distance and non - paretic front step distance may be useful for discriminating independent walkers. | [purpose ] the purpose of this study was to determine the effect of stepping limb and step direction on step distance and the association of step distance and stepping laterality in step difference with walking ability and motor dysfunction. [subjects and methods ] the subjects were thirty - nine patients with chronic hemiparesis as a result of stroke, who performed the msl (maximum step length) test along with tests of motor impairment, gait speed and functional ambulation category. the msl test is a clinical test of stepping distance in which participants step to the front, side, and back. the subjects were classified into three groups according to the stepping laterality in front step distance. [results ] step distance did not differ across stepping limbs but did differ across step directions. front step distance was significantly longer than side and back step distance. participants with forward paretic step length shorter than forward non - paretic step length had significantly higher walking ability than participants with symmetric forward step length or forward paretic step length longer than forward non - paretic step length [conclusion ] patients with stroke have characteristic step distances in each direction. adequate weight shift toward the paretic limb when stepping with the non - paretic limb is associated with walking ability. |
the major current use of genomic technology by the military is collecting dna from present and former members of the military in order to facilitate the identification of remains. the collection, called a biobank or biorepository, is the armed services repository of specimen samples for the identification of remains (afrssir), which was established in 1993. every member of the military is required to submit a blood sample to the repository upon enlistment, and as of 2012, over 6.5 million blood samples have been collected and stored on bloodstain cards similar to those used for newborn screening. under current policy, afrssir can retain the samples for up to 50 years. aside from being used to identify remains, dna collected by the military can be decoded or sequenced, and the results linked to medical and personnel information obtained from service members or extracted from existing records. phenobank, which enables genetic and genomic variations to be correlated with medical, physical, and other characteristics and was one of the recommendations in the jason report. several military geno phenobanks are under construction. in 2009, in collaboration with the national institute of mental health, the u.s. army began a $ 65 million, 6-year army study to assess risk and resilience in servicemembers (starrs) to identify risk factors for military suicides. one component of the research, the new soldier study which started in february, 2011, asks new enlistees to volunteer to complete surveys and to undergo neurological and dna testing to identify genetic and other risk factors. as of november, 2012 air force office of the surgeon general established the patient - centered precision care research (pc2-z) program, which collects and sequences dna from saliva samples provided by volunteers from the air force medical service and matches the results with their medical information and family history. the purpose of the project is to create a personalized medicine profile that identifies genomic risks for clinically actionable, common complex diseases that are traditionally treated in the primary care setting, and to determine the impact of this information on the health of the volunteers. finally, in 2011, the us department of veterans affairs (va) established the million veteran program, a geno phenobank that collects dna and health information from veterans and combines it with their va medical records for research purposes. the military may want to use the afrssir dna samples for research purposes rather than just for the identification of remains. the results of dna sequencing could be combined with medical and personnel records for present and former members of the military to form a very large geno, such an effort may be limited by the degree to which past records have been converted to an electronic format, which would be necessary in order to facilitate the research project. as noted earlier, the jason report calls for dod to create geno phenobanks to determine which phenotypes that might reasonably be expected to have a genetic component have special relevance to military performance and medical cost containment. once these genetic and genomic components are identified, genetic tests can be developed to identify which individuals possess genotypes that contain these components. currently, the u.s. military tests enlistees for sickle cell anemia and glucose 6-phosphate dehydrogenase deficiency. as the field of personalized genomic medicine expands, military physicians can be expected to use newly developed genomic tests in the same ways as their civilian medical colleagues, namely, to identify individual genomic characteristics associated with the prevention, diagnosis, and treatment of disease. for example, genetic testing can identify individuals with genetic disorders that will not become symptomatic until some point in the future, such as alzheimer 's or huntington 's disease. in some cases, there may be steps that can be taken to prevent or mitigate the symptoms. genomic testing also may be able to make or to help confirm a clinical diagnosis ; the air force, for example, is reported to be developing a genetic test for colorblindness that improves upon existing detection methods. as the jason report recognized, military physicians also increasingly will practice pharmacogenomics, in which genomic tests help determine the appropriate drugs to prescribe for specific patients based on their genomic profiles. like their civilian counterparts, moreover, military physicians might use genomic testing to identify individuals who were at risk for genetic disorders such as breast and colorectal cancers that can be prevented or mitigated by early detection and intervention. military interest in genomic testing will extend beyond the prevention, diagnosis, and treatment of disease. the jason report anticipates that tests will identify individuals who have genetic profiles that are of special relevance to military performance and medical cost containment. depending on whether test results revealed that individuals possessed desirable or undesirable genomes, the military could consider the results in deciding whether to incentivize or block enlistment, or to advance or curtail military careers, and the test results also could be useful in making duty, specialization, and geographic assignments. the national cancer institute, for instance, describes a young woman found to carry a mutation in a gene that increases the risk of breast cancer who may not be considered eligible for deployment for a 12- to 15-month period because access to recommended health care, such as mri screening, may not be easily accessible. in 2010, a former military physician described an officer with a family history of huntington 's disease who was tested to see if he had inherited the disease gene before being promoted to flag rank, and a female pilot who was grounded after she developed a deep vein thrombosis and genetic testing revealed that she had a genetic mutation called factor v leiden polymorphism that increases the risk of such life - threatening blood clots. the military will be interested in identifying individuals with genomic variations of general medical interest, but also mutations that affect physical attributes that are of particular significance in military operations. the jason report, for example, mentions the value of genetic testing for susceptibility to traumatic bone fracture, prolonged bleeding, or slow wound healing. in 2009, a group of researchers published an updated human gene map for performance and health - related fitness phenotypes containing over 214 entries that may be of interest to the military. the jason report also describes future genetic testing that would provide information about the ability to tolerate conditions of sleep deprivation, dehydration, or prolonged exposure to heat, cold, or high altitude. researchers already have developed and marketed a genetic test that identifies one variant of the actn3 gene in humans, called r577x, which codes for a protein called -actinin-3. individuals with this genetic variation tend to have an abundance of slow - twitch muscles, which are associated with activities such as long - distance running that require endurance, while individuals who do not have this variant of the actn3 gene have more fast - twitch muscles, which are associated with activities requiring shorter bursts of energy such as sprinting and weightlifting. recruiters and training and assigning officers might be interested in knowing which of these variations their potential enlistees or trainees possessed. genomic testing for mental as well as physical traits will attract the military 's attention. a considerable amount of research on genetic variants associated with mental illness already is underway. for example, geneticists are searching for mutations that predispose warfighters to or protect them from post - traumatic stress disorder (ptsd) and have identified several genes, such as fkbp5, pacap, tll1, rs263232 in adcy8, and rs71534169 in dpp6, as susceptibility genes for ptsd. researchers also are seeking genomic mutations that are associated with superior mental abilities, and although claims of success are often met with skepticism, many geneticists are confident that genomic tests for superior mental capabilities eventually will be developed. scientists at the university of pennsylvania, for example, have created a strain of smart mice that produce more of a protein called nr2b, giving them superior memory and learning abilities. studies in humans have identified a gene called dysbindin on chromosome 6 and another called snap-25 on chromosome 20 that are associated with cognitive ability. genetic researchers have demonstrated in mice that a genetic mutation of the eif2 gene and genetic manipulation of the lynx1 gene could achieve enhancements in synaptic plasticity, learning, and memory. studies funded by the nih found that people with a certain variant of the gene catecholamine - o - methyltransferase can improve both memory and problem solving by taking a drug called tolcapone, which is prescribed for patients with parkinson 's disease, and exogenous medication may overcome a type of genotype - associated trait under which genetic variation can be associated with reduced dopamine neurotransmission to impair learning and cognitive performance. finally, a chinese research institute located in hong kong has purchased more than $ 90 million worth of advanced genetic sequencing machines and is using them, among other things, to sequence the dna of 2000 chinese school children to search for genes that correlate with educational testing scores. again, recruiters and trainers can be expected to want to use tests such as these in recruitment, training, and assignment. like their civilian colleagues, military physicians will develop and employ genomic technology not only to diagnose and predict but to prevent and treat both genomic and non - genomic diseases. a detailed description of the prospects for gene - based preventive measures and treatments is beyond the scope of this paper, but they include (1) the use of techniques such as recombinant dna to manufacture drugs ; (2) gene therapy, or the introduction or modification of endogenous or exogenous human dna to provide an increased ability to combat injury or illness (for example, jonathan moreno cites the interest of the defense advanced research projects agency in using genetic manipulation to improve the immune system) or to correct or compensate for genomic abnormalities ; and (3) altering the composition or characteristics of the microbiome, the non - human organisms found in the human digestive system and elsewhere that play a significant role in metabolism and human health. an especially controversial subject is germ line therapy, which entails making therapeutic alterations in an individual 's dna at such an early stage of development that the changes will be incorporated into eggs or sperm and therefore can be inherited by the individual 's descendants. the military may be interested in germ line therapy, for example, in order to reduce the frequency and costs of care for heritable genomic disorders in military families. the military will be intensely interested in exploiting the association between genomics and human capabilities and performance. in 2001, the committee on opportunities in biotechnology for future army applications of the board on army science and technology at the national research council called on the army to lead the way in laying ground - work for the open, disciplined use of genomic data to enhance soldiers ' health and improve their performance on the battlefield. a 2002 report by dod information assurance and analysis center observed that because genomics [sic ] information offers clues to improving human performance it could provide the army with means of increasing combat effectiveness. the jason report notes that both offensive and defensive military operations may be impacted by the applications of personal genomics technologies through enhancement of the readiness, and performance of military personnel. one way that genomic science can improve military effectiveness has been mentioned earlier : using genomic testing to sort individuals based on how they were expected to function in various military environments. in addition, the same genomic modification techniques described in the previous section on gene - based therapeutics could be used to actively improve warfighting ability. for example, until recently, one company, 23andme, offered direct - to - consumer genetic testing for a number of non - disease traits including avoidance of errors, eating behavior, food preference, measures of intelligence, memory, muscle performance, and pain sensitivity. the company acknowledged that the ability of the tests to actually measure these traits has not been established, but if the genomic variations could in fact be identified, it might be possible to manipulate them directly or by administering drugs that affected the proteins for which they coded. conceivably, then, warfighters could be made smarter and less error - prone, given better memories and muscles, or have their metabolisms altered to enable them to function with fewer calories or on unusual diets. air force office of scientific research reported that sleep deprivation disrupted the functioning of over 700 genes. in the future, these genes might be able to be reprogrammed so that they were not as affected by sleeplessness, enabling warfighters to carry out missions despite lack of sleep. a 2008 jason report predicted that, in contrast to elite sports, small improvements in warfighter performance would not have a dramatic effect on the outcome of military engagements ; a major breakthrough in the need for sleep, however, could seriously alter the balance of engagement. the uses of genomic technology by the military described in the previous section raise a host of elsi issues. how should the military, for example, conduct genomic research ? what types of genomic testing are appropriate in the military and how should the results be used ? what rules should govern how the military provides genomic therapeutics and enhancement technologies to its personnel ? similar questions arise in the civilian sector, and the elsi program at the nih has attempted to articulate solutions. however, the suitability of these civilian solutions in the military is limited by differences in core values. in his landmark work moral issues in military decision making, anthony hartle articulates freedom, equality, individualism, and democracy as the core american values. for the military on the other hand, hartle identifies country. in contrast to the civilian notion that the welfare of the individual is paramount, in the military it is subservient to the unit, mission, and country. in contrast to the civilian values of freedom, equality, and democracy, members of the military are obliged to obey lawful orders. the military also emphasizes taking responsibility for one 's decisions and actions, and an obligation to promote the welfare of subordinates to the extent consistent with the welfare of the unit, the accomplishment of the mission, and the safeguarding of the state. in a separate paper, i argue that these differences in core values require a different set of principles to govern bioethics in the military. the focus on the welfare of the individual patient in the clinical application of the civilian principle of beneficence, which stands in sharp contrast to the military value of selflessness, should be replaced in the military by the principle of proportionality. according to the principle of proportionality, a biomedical risk can be imposed on a warfighter only when there is no less risky alternative to accomplish a legitimate military objective, and the nature and degree of the risk are outweighed by the military advantage sought to be gained. in view of the lack of individual autonomy in the military, it also makes sense to downplay the civilian emphasis on voluntary choice reflected in the principle of respect for persons by substituting instead the principle of paternalism. combining the principles of paternalism and proportionality, military commanders have a duty to ensure that the biomedical risks that they impose on their subordinates are proportionate. these twin principles also guide privacy and confidentiality : commanders have a duty to protect their subordinates privacy and confidentiality unless and to the extent that it is outweighed by military necessity. commanders likewise have a duty to protect warfighters dignity by avoiding exposing them to biomedical risks that humiliate or demean them. finally, the principle of fairness should replace the civilian principle of justice and require members of the military to give their consent when commanders impose a biomedical risk only on a subgroup of subordinates or when the risk is especially great. fairness also precludes using biomedical risks as a punishment for bad behavior or imposing the risks in a discriminatory manner or on warfighters who are less able to bear them than others, such as physically weaker members of a unit. not only do basic principles of bioethics differ in civilian and military life, but several laws that play an important role in civilian genomics do not apply to service members, including the genetic information nondiscrimination act (gina) and, according to the so - called feres doctrine, the common law doctrine that provides damages for victims of medical malpractice. these legal differences must be taken into account in analyzing the elsi issues that arise in military genomics. the sections that follow identify the elsi challenges raised by military genomics explain how similar issues have been addressed by the civilian elsi program, and consider whether the civilian approaches are appropriate in the military due to their different bioethical and legal frameworks, and, if not, how these approaches should be adjusted to meet the needs of the military in an ethically, legally, and socially appropriate manner. a related set of issues involve the military operation of dna biobanks and geno phenobanks and the commercialization of research discoveries. a third series of issues relates to clinical and enhancement uses of genomic technologies by the military. the second is extramural research, where the military sponsors research that is conducted in civilian institutions such as hospitals and universities. the third setting is research conducted by the va on veterans who are receiving medical care from the va. each of these settings raises different eslp issues and therefore will be discussed separately. as discussed earlier, the military may wish to conduct genomic research to obtain general information relating to human health or to obtain information of particular relevance to the military. there are two types of genomic research involving human subjects : clinical research, in which experiments are conducted on live humans, and non - clinical research, which is conducted on human biological material such as dna samples. (dod calls clinical research research involving a human being as an experimental subject to distinguish it from research involving human subjects, which includes both clinical and non - clinical research.) the following discussion concerns clinical genomic research ; a discussion of non - clinical genomic research appears in balancing risks and benefits below. it might be thought that, under the principles of proportionality and paternalism, clinical research can take place without the informed consent of military subjects when the research is important enough to the unit, mission, or nation. an argument can be made that one major philosophical justification for informed consent, immanuel kant 's deontological categorical imperative that individuals should be treated as ends rather than as means, has little application in the military. military bioethicist michael gross asserts that, at least in wartime, human life is of but instrumental value, and observes that, there is very little compunction about using persons as means. no doubt based in part on this reasoning, the military gave soldiers lysergic acid diethylamide and other hallucinogens without telling them that they were being given the drugs but instead that they were participating in a study on the effectiveness of protective clothing and equipment against chemical warfare agents. similarly, voluntary consent was not always obtained from military personnel involved in radiation experiments that were conducted as part of atomic bomb testing. despite doubts about the applicability of a kantian perspective to the military, at least since the trials of nazi war criminals and the promulgation of the nuremberg code, which makes no distinction between civilian and military subjects, it is generally accepted that competent adults must give their informed consent to serve as subjects in biomedical research, and this consensus has long been reflected in official military policy. moreover, if the risks to subjects are more than minimal, it is required under the military bioethical principle of fairness since only a subset of the force is likely to be enrolled as participants. informed consent also has practical value in military research ; failure to obtain informed consent could discourage individuals from serving as research subjects, thereby reducing the amount of beneficial research that can be conducted, and even could discourage individuals from serving in the military in the first place. a 2000 congressional report on the dod 's mandatory anthrax vaccine program, for example, was especially concerned about the effect of the program on retention in reserve units, and noted that half of the air crew in one air national guard unit had resigned as a result. there is no reason to waive or weaken the requirement of informed consent for biomedical research employing military personnel as subjects when the research involves genomic science. informed consent is a central focus in the government 's efforts to protect human subjects in genetic and genomic research. indeed, it has been argued that genomic research requires even stronger protections for subjects than many other types of human experimentation because of the sensitive nature of personal genomic information that a study may uncover, such as predictive data about future illnesses for which the subject or the subject 's family members are at risk or misattributed paternity and maternity, that is, the discovery that a person 's presumed father or mother is not in fact biologically related. one reason to conduct genomic research on military personnel without informed consent might be to help preserve secrecy so that adversaries were not alerted to the production of information that might help them construct genomic weapons or defenses. for example, the military may feel the need to conceal the fact that it is obtaining genomic information about members of the same genomically differentiated subpopulation as enemy combatants. national security arguments have been put forth on behalf of military experiments conducted without consent in the past, such as atomic radiation experiments during the manhattan project and the cold war. although critics of those experiments argue that a measure of voluntary consent could have been sought from subjects, for example, by using the term dangerous radioactive substance in place of the classified word plutonium, it may not always be possible to use obfuscating terminology and still provide sufficient information to subjects to enable them to give informed consent. the solution would seem to be to enroll only those subjects who held security clearances high enough to permit them to be given the classified information. a requirement that members of the military give their informed consent to serve as subjects in genomic research does not mean that they actually can do so, however. in order for individuals to give informed consent, they first must have adequate information about the nature, potential benefits, and risks of the experiment, and they must be able to understand the information to a reasonable degree. serious doubts have been expressed about prospective subjects ability to comprehend and absorb the information they are given. there is little reason to expect members of the military to do better than other subjects ; on average, for example, they are less well educated than the general public. indeed, a strong argument can be made that warfighters should be regarded as a vulnerable study population, despite not being formally listed as vulnerable in the common rule. it was not until 1981 that army regulations were changed to prohibit penalties under the uniform code of military justice from being imposed on warfighters who refused to volunteer or withdrew from participating in military research. even without the prospect of formal punishment, warfighters may feel that they have no choice but to acquiesce when they are invited to serve as subjects. as victor sidel and barry levy explain in the textbook of military medicine, because they can not simply quit their jobs file a grievance with a union, government agency, or professional organization, military personnel may not believe that they can truly refuse to participate in these experiments. they may feel more like a captive audience than like volunteers. moreover, as the house committee on government reform pointed out in its critique of dod 's mandatory anthrax vaccination program, in a culture based on a chain of command and the power to compel, attempts at persuasion and education often devolve into intimidation. superiors may make subordinates willingness to serve as subjects a condition for allowing them to undertake certain attractive missions, for example, missions to test exciting new technologies such as genomic enhancements. unit cohesion and comradeship may lead warfighters to agree to be subjects if other members of their unit already have. warfighters may also feel that it is their patriotic duty to participate in research, a notion that some commentators are pushing in the civilian sector. dod is well aware of the risk that warfighters asked to give their informed consent to serve as research subjects will feel that they have no choice but to accede. dod rules prohibit superiors from influencing the decisions of their subordinates regarding participation as subjects and specifically forbid superiors from being present when informed consent is being sought. moreover, except for a payment of $ 50 in return for having blood withdrawn, military personnel on duty may not be compensated for serving as subjects. warfighter 's limited autonomy requires a shift in emphasis in military clinical research away from the reliance on informed consent as a primary protection for subjects in the civilian model and toward a reliance on paternalism. civilian research ethics contain a strong element of paternalism ; subjects are only asked to give their consent to participate in research after experts, in the form of institutional review boards, sponsors, government regulators, and the investigators themselves, are satisfied that the potential benefits of a study outweigh the risks. given the limits on warfighter autonomy, the need for paternalism in the military is more pronounced, however, and ensuring proportionality must be viewed as the primary responsibility of research directors, institutional review boards, and subjects commanders rather than the subjects themselves. to that end, dod rules require the appointment of an ombudsman and a research monitor (who may be the same person) to oversee the informed consent process when the research presents more than minimal risk (and, in the case of an ombudsman, when the recruitment of subjects takes place in a group setting). individual services have added additional oversight in certain cases in the form of a requirement for a second level of protocol review in addition to review by an institutional review board (irb). one approach that the military has taken to promote voluntary participation in research is to establish special units from which to draw subjects, beginning with operation whitecoat, in which 2300 seventh - day adventist church conscientious objectors between 1954 and 1973 participated in 137 protocols to develop vaccines and treatments for q fever, tuleremia, various viral encephalitides, rift valley fever virus, sand fly fever and plague, and continuing with the medical research volunteer subjects program using the us army medical research institute of infectious diseases (usamriid) troops recruited from although concerns have been voiced in connection with operation whitecoat that seventh - day adventist church officials endorsed the program, with one subject later pointing out that we grew up to trust the church, the head of usamriid emphasizes that participation in research among members of these units is voluntary, with only about 80 per cent of the troops consenting to serve as subjects in any one year. this has led some commentators to suggest that similar units should be the primary if not the exclusive source of military research subjects. but it is still unclear if the members of these units would feel sufficiently free to decline to participate in research, and specialized groups of subjects may not be representative of the troops who actually would be exposed to the instrumentalities being tested. an axiom of research ethics is that a study may proceed only if the risks are outweighed by the potential benefits. in balancing research risks and benefits, civilian and military principles of bioethics the risks to the subjects can be outweighed either by the benefits to the subjects themselves or by the benefits, in the form of the knowledge gained, to others. civilian research thus employs an approach similar to the military principle of proportionality in which the welfare of the individual can be subordinated to a greater good in appropriate circumstances. civilian research also embraces the military principle of paternalism ; as mentioned earlier, the balancing of risks and benefits is entrusted first to institutional review boards, study sponsors, government regulators, and the investigators themselves, and only after they have satisfied themselves that the benefits outweigh the risks are subjects asked to make their own assessment in giving their informed consent to participate. warfighters may be subjected to grave personal risks in order to achieve a military objective ; as bill rhodes, president of the international society for military ethics, states, a military member is expected to serve the state unto maiming, capture, or death. accordingly, a research risk that would be deemed excessive for civilian subjects, such as a significant likelihood of serious harm in a study intended to produce knowledge to benefit others but with no direct benefit to the subjects, might be deemed acceptable for military subjects, under the principle of proportionality if the military objectives were sufficiently important. in other words, while the risks might be greater than for civilians, so might be the corresponding benefits to the unit, mission, or country. along this line, military subjects ought to be allowed to participate in studies intended to produce information of special relevance to the military, such as tests of genomic interventions to treat ptsd, that posed greater risks than studies aimed at developing genomic interventions of no special value to the military. another question is how to weigh the risks and benefits of research on genomic enhancements, such as interventions to increase the ability to tolerate conditions of sleep deprivation, dehydration, or prolonged exposure to heat, cold, or high altitude mentioned in the jason report. although as discussed later, the distinction between enhancements and other types of biomedical interventions is not always easy to make, some commentators believe that enhancement benefits are less worthwhile than medical benefits and therefore that a risk that might be acceptable in a medical trial would be unethical in an enhancement experiment. one bioethicist states, for example, that : [t]he cost / benefit analysis is different for enhancement. while those who are experimenting with treatments for serious diseases may only succeed in substituting one kind of misery for another, those experimenting on human enhancement are likely to substitute a miserable life for a happy one. [t]he cost / benefit analysis is different for enhancement. while those who are experimenting with treatments for serious diseases may only succeed in substituting one kind of misery for another, those experimenting on human enhancement are likely to substitute a miserable life for a happy one. as my colleague jessica berg and i have argued, however, the value of a benefit clearly depends on the nature of the benefit ; an enhancement that potentially increased cognitive function substantially, for example, might be deemed more valuable than a treatment, say, for nail fungus. in both health - oriented and enhancement research, therefore, the potential benefit necessary to justify a set of risks will depend on the specifics of the study in question. moreover, it is difficult to distinguish between enhancement and other types of biomedical research in the military ; a study of a genomic intervention to provide combat troops with better - than - normal vision, hearing, or cognition, or a greater - than - normal ability to tolerate conditions of sleep deprivation, dehydration, or prolonged exposure to heat, cold, or high altitude, for example, could be regarded as the study of how to prevent injury as well as an enhancement study. in short, there is no reason to treat an enhancement experiment differently than a treatment study when it comes to balancing risks and benefits. a particularly controversial topic in genomic research is whether researchers have a duty to provide study findings to the subjects if the information could provide health benefits to the subjects. the issue arises especially when researchers are examining large amounts of genomic information on large numbers of subjects, such as searching a collection of dna samples for variations associated with particular disease risks or traits. as noted earlier, for example, military researchers are hunting for genomic variations that predispose warfighters to ptsd. the answer might seem to be of course, since individuals generally have a right to receive their personal biomedical information. but some geneticists worry that, since genomic information is often difficult to understand, subjects may misinterpret it and be harmed. genomic findings often are probabilistic, and the average person has difficulty understanding probabilities. the effect of a genomic variation may be small ; the genetic variation apoe4, for example, is found in 40 per cent of persons with late - 's disease but also in 2530 per cent of the general population. penetrance, so that individuals may never show symptoms or may only experience a mild form of the illness. since physicians may be uncertain about how to interpret genomic test results, one suggestion is to rely on specially trained experts called genetic counselors to convey results to subjects, but this requires more time and adds to the cost. another complication is that some diseases such as alzheimer 's can not now be prevented or treated, and some commentators question the value of informing subjects about risks for those kinds of disorders. furthermore, the clinical laboratories improvement act (clia) requires laboratories that test dna to be clia - certified if the results are reported to diagnose, prevent, or treat disease or to assess health, and obtaining and maintaining clia certification is burdensome and expensive. finally, commentators argue that researchers do not have the same obligations to subjects that physicians have to their patients, in particular, a duty to look after the subjects health needs. some of these objections do not apply in the military as much as they do in civilian research. the military is responsible for service members health, so military researchers, like other superiors, have an obligation to look out for the well - being of their subordinates under the principle of paternalism. moreover, military laboratories are not driven by the same profit motive as private civilian laboratories, and therefore may be less burdened by having to comply with clia requirements. but military researchers still need to carefully consider the pros and cons of returning results to subject. they should have the same compunctions about how well subjects understand study results as their civilian brethren, especially since they are held accountable for the welfare of subjects under the principle of paternalism. furthermore, there may be special considerations that justify withholding genomic information from military subjects. for example, if the military eventually discovers genomic variations closely associated with certain desirable or undesirable traits, it may decide to test prospective enlistees and use the results in making service assignments, but may not want to disclose the results to warfighters because of military exigencies. warfighters told that they were at increased risk for certain types of battlefield injuries, for example, they might lose effectiveness if military necessity required them to participate in combat missions. the need for security to keep sensitive genomic information out of the hands of adversaries also might justify withholding test results from warfighters in certain circumstances. another question is whether researchers who disclose results to patients to improve their health should also disclose the results to family members who may also be at risk for the same genomic conditions, and if so, should they do so only with the subjects permission. the question has been addressed mainly in the context of the relationship between patients and physicians rather than subjects and researchers, and there is a split of opinion. many prominent groups say that doctors may override the patient 's wishes if the physician has made a reasonable effort to obtain the patient 's consent, there is a high probability that imminent, serious harm will occur if the information is not disclosed, and only information necessary for the diagnosis or treatment of disease is disclosed. (the institute of medicine goes further and says that the information must be disclosed.) however, some physician groups maintain that notifying family members is the patient 's responsibility rather than the physician 's, and point out that laws in illinois, massachusetts, and new york prohibit any disclosure of genetic information without the patient 's consent. whatever the eventual consensus, the only reason for the rules governing disclosure of research to family members to differ between military and civilian life would be if the disclosure would pose a significant threat to national security or the successful completion of a military mission. a topic that is closely related to the return of research results is how researchers should handle information about subjects that is outside of the scope of the study, called (a similar issue arises when a physician examining a patient 's genome for certain clinically relevant information discovers other medically relevant findings.) researchers searching for genomic mutations that made subjects susceptible to ptsd, for example, inadvertently might discover mutations that placed certain subjects at risk for other diseases. again, the answer might seem clear that they should, since doing so could alert subjects to the need for future vigilance and beneficial medical care. is the medical risk reflected by the incidental information sufficiently important to outweigh the chance that subjects will misunderstand it ? how clear is it that the individual will show symptoms of the genomic disease or will experience a serious form of the illness ? what if little or nothing can be done to reduce or eliminate the health risk ? one particularly troublesome type of unintended finding, which can occur when both parents and offspring are studied in pedigree research, is that a parent is not biologically related to a child ; how should researchers handle this result, which can be extremely disruptive to the family unit ? for these reasons, some commentators maintain that researchers have no obligation to inform subjects about incidental findings. a growing consensus seems to be emerging, however, that researchers should disclose incidental findings that are sufficiently important for the subjects health, or at least that subjects should be asked during the informed consent process if they wish to receive this information. there is no reason to assume that military researchers have a lesser obligation regarding disclosure of incidental findings than civilian researchers. in fact, an argument can be made that military researchers have a greater obligation than their civilian counterparts to consider returning incidental findings to subjects because military personnel have less ability than civilians to obtain genomic testing outside of the military. another research controversy concerns whether researchers have a duty to contact subjects after a study is over to ascertain whether they are suffering any long - term or latent adverse effects, and to alert them to new information bearing on their health, such as the discovery of genomic risks that were not known at the time of the study or the availability of new treatments or preventive measures. the military has been criticized, for example, for not adequately following up with subjects in the man - break experiments on mustard gas during world war ii. civilian researchers object that they should not have a long - term obligation to follow up with subjects because of the difficulties of keeping track of their whereabouts, but military researchers should be better able to keep track of military subjects, who may still be in the military or receiving care from the va. in addition, the army maintains a volunteer registry for all subjects in more - than - minimal - risk studies, one of the purposes of which is to enable the military to exercise its obligation to ensure research volunteers are adequately warned of new risks and to provide new information as it becomes available, and the us army medical research and materiel command (usamrmc) stores the information for a minimum of 75 years. in sum, the military should endeavor to contact subjects about future developments of significance to their health bioethicists are concerned that offering people substantial amounts of money or other items of economic value in return for serving as research subjects could compromise the voluntariness of informed consent, but this is less of a concern in the military because dod rules forbid paying research subjects on active duty except for drawing a blood sample, for which they may receive $ 50. (off - duty personnel may receive compensation comparable to civilian subjects, which under health and human services (hhs) rules must be approved by an irb and be a reasonable amount in accordance with prevailing local rates.) military irbs must be on guard however against offering troops non - monetary benefits for enrolling in research studies, such as desirable assignments or commendations. dod rules prohibit superiors from influencing the decisions of their subordinates regarding participation as subjects, but the rules could be more specific by defining what counts as influence. moreover, the prohibition against paying military subjects emphasizes the need to protect them from being exploited by being pressured to participate in disproportionately risky research. another financial issue that arises in civilian biomedical research is whether subjects are entitled to a portion of the financial benefits that accrue to sponsors of studies that lead to the commercialization of a lucrative new medical product. although withholding compensation has been criticized as unfair, there is a general consensus that sponsors can avoid compensating subjects if they disclose their policy to subjects during the informed consent process. the argument for rewarding military subjects is weakened by their obligation to serve the national interest, but the issue is complicated by the fact that a substantial amount of the fruits of military research often redounds to the benefit of private enterprises that commercialize the resulting discoveries, including prostheses and thermal imaging devices. a solution might be for dod to ensure that genomic discoveries with important medical value derived from research on military subjects were available to current and former members of the military through military medical services and the va. the common rule governing human subjects research does not require researchers to compensate civilian subjects for injuries sustained as a result of their participation, but subjects who have been injured by negligent investigators may recover monetary damages in a tort action. for example, the father of an 18-year - old subject who died in a university of pennsylvania experiment aimed at developing a gene therapy for a genetic disease called ornithine transcarbamylase sued the investigators for negligently enrolling his son without proper safety testing. no such remedy is available to military subjects, however, as a result of the so - called feres doctrine. dod rules require researchers to establish procedures to protect human subjects from medical expenses (not otherwise reimbursed) that directly result from participation in more - than - minimal - risk military research, whereas civilian subjects may receive compensation for losses such as pain and suffering and reduced future earnings. it also runs counter to the principle of paternalism insofar as it shields the military from having to fully redress superiors mistakes. but congress has not seen fit to modify the doctrine to permit injured subjects to receive compensation, the courts have consistently given the doctrine a broad interpretation on the premise that immunity from suit is essential to maintain military discipline, and even some of the critics only want soldiers to be able to sue for intentional rather than merely negligent research misconduct. protecting the privacy and the confidentiality of subjects personal health information has long been a priority in civilian research, and its importance has been reinforced by the adoption of the privacy and security provisions of the health insurance portability and accountability act (hipaa) and its accompanying regulations. one of the requirements of informed consent under the common rule, for example, is giving potential subjects a statement describing the extent, if any, to which confidentiality of records identifying the subject will be maintained, and the government recently has proposed strengthening data security and information protection requirements for federally sponsored research. in addition, the gina specifies that genetic information is protected under hipaa. as noted earlier, dod has adopted the common rule / it also has subjected itself to hipaa. however, the privacy and confidentiality of members of the military is subordinate to military necessity. michael gross observes, for example, that among one 's own soldiers, the scope of the private sphere decreases and that of the public expands as collective welfare takes precedence over an individual 's private good. dod rules accordingly permit commanders to obtain health information to assure the proper execution of the military mission, and while service members have the right to an accounting of disclosures, there is no such right for disclosures for national security or intelligence purposes. one of the chief reasons for protecting privacy and confidentiality in regard to genomic information is to prevent stigma and discrimination. the legal protections against workplace discrimination for civilian federal employees in the rehabilitation act of 1973 and gina do not apply to uniformed members of the military. once warfighters leave the military, however, they come under gina 's protections against employment discrimination on the basis of genomic information. furthermore, dod policies implementing the national defense authorization act of 2008 changed a previous policy that had denied health and disability benefits to service members who experienced injuries or illnesses during their time of service if the condition was congenital or hereditary. now, service members are entitled to compensation and benefits so long as they do not have a disability that was noted at the time of enlistment, unless there is compelling evidence or medical judgment that the disability existed prior to enlistment. however, united states army special operations command (usasoc) found that the two strongest fears among service members with respect to behavioral health treatment, including ptsd, were confidentiality, fear of being labeled, and negative impact on career. as shown in part i.b., the most recent research has shown a genetic contribution to ptsd and some scholars have raised concerns regarding the display of pertinent genetic information may also generate stigma and affect individual career outcomes. how should the status of subjects as members of the military affect the privacy and confidentiality of identifiable genomic information obtained in the course of military human subjects research ? one approach might be that, given the reduced privacy and confidentiality within the military, the military should be able to use identifiable genomic information obtained in the course of conducting human subjects research on military subjects without the subjects informed consent, so long as the information is used for a legitimate military purpose. but this approach conflicts with the spirit of the military 's policy of requiring military subjects to give their informed consent to serve as research subjects. another approach would be for irbs to give the potential loss of privacy and confidentiality less weight when balancing risks and benefits in research on military subjects than in research on civilians. but the federal government is contemplating removing privacy and confidentiality concerns altogether as matters for irb review and instead imposing mandatory data security rules on all human subjects research. the best approach therefore is to rely on the principles of proportionality and paternalism described earlier and place the responsibility on commanders, including those overseeing research programs and the researchers themselves, to protect subordinates against inappropriate disclosures of identifiable genomic information. in summary, using members of the military as subjects raises many of the same ethical issues as employing civilian subjects, but there are several notable differences. due to limitations on warfighter autonomy, members of the military need special protection from coercion and undue influence during the informed consent process, and the principles of proportionality and paternalism require commanders to assure themselves that the potential benefits of the study outweigh the risks rather than relying on individual subjects to make this judgement for themselves in uncertain cases. at the same time, risks that would be excessive for civilian subjects might be acceptable in the military if the military 's need for the research were sufficiently compelling. finally, the fact that the military is responsible for the health of its members and the relative ease with which it can keep track of warfighters, including after they are discharged, argue in favor of imposing a clearer obligation on military researchers than on civilian researchers to follow up with subjects and to return results and incidental and unintended findings to them in appropriate cases. dod spends approximately 75 per cent of its outlay for research and development on extramural research, that is, research conducted at civilian institutions. the allocation of such a large portion of the defense r&d budget to civilian researchers results from the need to fund industrial contractors that develop weapon systems and the desire to nourish a broad science base at u.s. academic institutions. some of this dod - sponsored research there are no published estimates of how much involves the use of live human subjects. some of these studies may involve genomic science, and the amount of genomic human subjects research can be expected to increase if dod follows the recommendations in the jason report described earlier. extramural studies of human subjects must be approved by irbs at the civilian institutions conducting the research as well as by internal military irbs. the army requires an additional layer of protocol review by the usamrmc commanding general 's human subjects research review board for studies involving gene transfer. although commentators have noted the potential for conflict between internal military and external civilian irbs, there is no information on how they interact, for example, how they resolve disagreements. nor is there an understanding of how the members of civilian irbs decide whether to approve protocols for military sponsored research. they may not be clear on how to weigh risks to subjects against military necessity and national security. on the one hand, they may feel that it is inappropriate for them to reject military studies that pose risks to subjects that would be unacceptable in purely civilian research. on the other hand, some irb members may be critical of military research for various reasons, leading them to block or unreasonably delay studies that should go forward. in addition, both dod and hhs regulations forbid irbs from considering possible long - range effects of applying knowledge gained in the research (for example, the possible effects of the research on public policy) as among those research risks that fall within the purview of its responsibility, and irbs may not know how this restriction should affect their consideration of the long - range effects of military research. bioethicist jonathan moreno notes the difficulties raised by conducting classified military research outside of the military, including requiring irb members and potential subjects to have security clearances. (dod rules, for example, require irbs to determine if potential subjects need access to classified information to make a valid, informed consent decision.) the advisory committee on human radiation experiments evaluated human subjects protections in classified government research and identified a number of shortcomings in written informed consent forms. academics describe resistance among academics and universities to conducting classified government research due to concerns about infringement of academic freedoms, including the freedom to publish research results. nineteen of 39 universities she studied had policies prohibiting either classified or non - publishable research. (eisenberg notes, however, that in some cases faculty researchers at these institutions may be affiliated with off - campus laboratories that do not have similar restrictions.) in addition, eisenberg reports that a number of other universities do not consider classified research for purposes of promotion, tenure, or academic credit. dod has adopted special protections for subjects in classified experiments regardless of whether the subjects are military personnel or civilians : the protocol must be approved by the secretary of defense ; the fact that the study is sponsored by dod and that the research is classified must be disclosed as part of the informed consent process, unless the secretary of defense makes an exception because providing this information could compromise intelligence sources or methods; irbs must do a full rather than expedited review ; and an irb member who disagrees with a majority decision approving the study may appeal to the secretary. the foregoing concerns about extramural military research raise the question of whether and in what circumstances it should take place at all. an argument can be made that all military human subjects research, including genomic research, should take place intramurally using members of the military as subjects. by being in the military, they have agreed to subordinate their interests to those of the military, and therefore seem more appropriate to bear research risks than civilians, especially in experiments that offer no prospect of direct benefit to subjects. furthermore, military subjects are protected by the principle of paternalism and therefore, at least in theory, commanders who expose them to disproportionate experimental risks are accountable and subject to punishment. in civilian bioethics, on the other hand, there is a dispute over how much of a duty civilian researchers owe to protect the interests of their subjects, with some commentators asserting that the investigators duty to subjects is superseded by their duty to the study sponsor. on the other hand, certain types of genomic studies for example, genome - wide association studies may need to use large civilian dna repositories in order to have the power to discover variations that account in small ways for phenotypes of military interest. science argues in favor of continuing to use military research funding to support civilian research institutions. finally, requiring military research to be conducted on military personnel could lead to public perceptions that they were being used as human guinea pigs, especially if the research was not on a topic primarily of military interest. the va has already staked a claim to genomic research by launching its million veteran program in may, 2011, which collects voluntary donations of dna from veterans along with permission to correlate their genetic data with information in their medical and personnel records in order to establish a geno phenobank. (the program is described further below in the section on biobanks.) in addition, the va conducts genomic research on amyotrophic lateral sclerosis, bipolar disorder and schizophrenia, and ptsd. in 2006, it established a genomic medicine program advisory committee to guide the start of a new genomic medicine program, and it also conducts pharmacogenomic research. the va, like dod, has adopted the common rule to govern live human subjects research. however, va patients asked to participate as subjects, like other civilian patients, may fear that they will be denied health care if they refuse. va researchers are required to make every reasonable effort to provide patients with an informational brochure called volunteering in research here are some things you need to know which states that they have a right to say no and that refusing to participate will not affect your va health care or benefits. beyond that, the agency has no special human subjects protections. for example, it does not recognize veterans as a vulnerable research population. while it is true that they are not among the groups formally designated as vulnerable subjects, they resemble those groups in their dependence on government - provided health care, and the fact that they served in the military may make them feel that they have a duty to participate in research whenever they are asked. these considerations require the va to employ a heightened degree of paternalism to protect veterans against disproportionate research risks. while the foregoing sections discuss the ethical, legal, and policy issues raised by clinical genomic research using human subjects, this section discusses another type of genomic research that uses dna samples rather than living human subjects. as noted earlier, the military currently possesses millions of dna samples from current and former service members, and the army, air force, and va are collecting additional samples for research purposes. the resulting biorepositories can be linked to the medical and personnel records of the individuals who contribute the dna to create geno phenobanks, enabling researchers to discover links between dna variants and physical and mental conditions and characteristics. phenobank research raises many of the same types of ethical, legal, and policy concerns as clinical research, including the need to obtain consent from dna contributors to use their dna for research, return of results and incidental findings, shared benefit, and maintaining the privacy and confidentiality of research results. in regard to consent, some commentators have suggested that, based on traditional research ethics, individuals whose dna is proposed to be used for research should be re - contacted and asked to give consent for each new research project. other commentators propose that, at the time that their dna is obtained, individuals should give multi - layered consent which would enable them to specify their wishes on a detailed form, such as giving consent to future research on specific diseases or being re - contacted and asked to consent to any future research. however, under increasing recognition that re - contacting participants to obtain their specific informed consent for every future research project may be impractical, expensive, and possibly impede socially valuable research, there has been a growing movement away from the model of specific informed consent. alternatives that have been put forward include (1) permitting human research ethics committees to waive individual consent under circumstances where obtaining consent is impracticable and there is a strong public interest in the research ; (2) broad consent that allows samples to be used for one or more general purposes, such as biomedical research in general, or research on one or more specific diseases ; and (3) to understand the issues involving consent, it is important to distinguish between research on existing dna samples and research on newly acquired samples. suppose dod wanted to combine existing dna samples in the afrssir with digitalized medical and personnel records of service members in order to conduct biomedical research. would dod have to obtain the consent of the dna contributors, and if so, what kind of consent ? on the one hand, it might be argued that consent is unnecessary. the dod policy that requires informed consent from military research subjects only applies to research involving a human being as an experimental subject, which dod defines as involving an intervention or interaction with a living individual, and moreover, providing dna to the afrssir is mandatory ; warfighters have been court - martialed for refusing, and their courts - martial have been upheld by the courts. furthermore, having to obtain consent could be burdensome in the case of individuals who are no longer in the service, who might be difficult to locate. the argument for proceeding without consent is especially strong in regard to research with distinct military applications, for example, on gene variants associated with coolness under fire, or genomic therapies that speed trauma recovery. on the other hand, the consensus in the civilian sector is that research on dna samples requires the consent of the contributors if their identity is revealed or can be determined from the data, which, as mentioned earlier, would be the case with a military geno phenobank. furthermore, the mandatory nature of the afrrssir program has been criticized, and in any event, dod currently permits afrrssir samples to be used for purposes other than identification of remains only with the consent of the donor or the surviving primary next - of - kin. finally, the whereabouts of personnel who have left the service may not be that difficult to determine since they may be obtaining health care from the veterans administration. if the consent of warfighters to use existing dna samples is necessary, what kind of consent must be obtained ? specifically, can warfighters be asked to consent to any research use of their dna (referred to as broad or general consent), or must they give specific consent for each particular research project, including for different projects undertaken in the future ? this is the subject of controversy in the civilian sector, but there appears to be a growing consensus, reinforced by changes in consent rules proposed by dhhs, that broad consent is acceptable, and the reasoning supporting the consensus suggests that broad consent also should be sufficient for military research. if the military must obtain consent for research using existing dna, all the more reason that it should obtain consent for research on newly acquired specimens, since this can be done easily when the specimen is obtained. the common rule that governs civilian research does not apply to deceased persons, who are not deemed to be human subjects. however, some commentators have argued that researchers should honor preferences that a deceased person made known while alive, and that consent should be obtained from the next - of - kin. in the case of the military, when they submit samples to afrssir, enlistees could be asked to give their consent to posthumous research using their dna. as noted earlier, the va operates the million veteran program, a geno phenobank that collects dna and health information from veterans and combines it with their va medical records for research purposes. veterans at participating va medical centers are sent a letter asking if they would like to participate. if they opt in, they fill out a brief health survey and make an appointment at the medical center to accompany their next medical visit. during this visit, they are counseled about the program, given the opportunity to consent to be placed in the database and to make their medical records available for research, and asked to give a blood sample. the consent is broad, as the veteran is asked to consent to a general program of genetic research, and the sample is kept indefinitely. as of october, 2012, as noted earlier, the va does not return any results to the donors, claiming that it is barred from doing so because the dna is not analyzed at a clia - certified laboratory. given the public nature of va funding and the relative ease in locating participating veterans, an argument can be made that the cost concerns raised by requiring samples to be analyzed at clia - certified laboratories are outweighed by the potential health benefits of returning results that are medically significant. testing in aid of medical diagnosis or treatment raises ethical and legal concerns. whether physicians can order hiv tests and drug screens without patient consent has been especially contentious, but objections also have been made to the widespread physician practice of ordering other routine medical tests without informing patients of the nature of the tests and obtaining their consent. when the testing in question is genomic, special concerns arise because the testing laboratory obtains access to the patient 's dna, which contains the patient 's entire genetic code rather than just information about the targeted illness. one issue that has been discussed earlier, for example, is whether the physician has a duty to inform the patient about when addressing ethical and legal concerns of genomic testing, it is common to distinguish between predictive genomic testing, which aims to ascertain if a person is at risk for a genomic illness in the future, and non - predictive testing, that is, testing to diagnose or aid in treating a manifested illness. as discussed earlier, military physicians can be expected to employ genomic testing for non - predictive purposes in the same manner as their civilian colleagues, that is, to help diagnose and treat illness in their military patients. non - predictive genomic testing generally has been less controversial, since it tends to be viewed as analogous to other types of medical testing. for example, a provision in massachusetts state law prohibiting genetic testing without informed consent excludes any test for the purpose of diagnosing or detecting an existing disease, illness, impairment or disorder from its definition of genetic test. but even when it is performed for non - predictive purposes, genomic testing can yield information about the patient 's risks for future illnesses, which can lead to social stigma if it becomes known to others and discrimination if it gets into the hands of employers or health insurers. from an ethical and legal standpoint, then, there is no meaningful difference between predictive and non - predictive genomic testing, and in the civilian sector, there is a clear consensus that no genomic testing should be performed without an individual 's informed consent. as discussed previously, however, the bioethical principles that govern military life are different from those that apply to civilians. the health status of warfighters not only affects their well - being, but the well - being of the unit, the success of the mission, and the security of the state. unlike civilians, therefore, warfighters are not free to refuse necessary medical care, including medical testing. should the fact that a test is genomic change this rule, that is, should warfighters be able to refuse a genomic test, and should the answer be the same when the genomic test is predictive rather than in aid of diagnosis or treatment ? finally, should warfighters be able to refuse genomic testing that pertains to non - disease characteristics, such as physical and mental abilities ? despite the special concerns raised by genomic testing, a strong argument can be made that it should be subject to the same rules as other types of military medical testing, meaning that warfighters can not refuse to submit to genomic testing, including when it is predictive rather than in aid of treatment and diagnosis. as noted earlier, providing a blood sample for dna testing under afrrssir is mandatory, and its mandatory nature has been upheld by the courts. furthermore, the military rules of evidence governing proceedings under the uniform military code of justice provide that, while communications between a patient and psychotherapist arguably the most sensitive type of medical information are privileged, the privilege does not apply when the information is necessary to ensure the safety and security of military personnel or the accomplishment of a military mission. moreover, although the military in a sense is an employer of its personnel, it is not subject to the prohibition in gina against requiring employees to undergo genomic testing. in any event, there is some sentiment that gina should be amended to allow employers to use genomic testing that could identify job applicants who might pose a threat to the safety of others as a result of their genomic endowment. at the same time, however, military genomic testing is subject to the principles of proportionality and paternalism that govern military bioethics generally, so it may only be undertaken if accountable superiors determine that the risks, including loss of privacy and potential breaches of confidentiality, are outweighed by military necessity. this is especially important in the case of genomic testing for non - disease characteristics. the military has a legitimate interest in obtaining information about warfighters physical and mental abilities, including genomic information, but only if the genomic test is a valid indicator of what it purports to show and the information is necessary in order to carry out the mission. furthermore, as noted earlier, the military has adopted the privacy rules of hipaa, including the limitation on disclosure of protected health information to the minimum necessary to accomplish the purpose of the disclosure, and the requirement that the information must be kept secure. finally, the military must be mindful of relying too heavily on the results of genomic tests that have not been adequately validated. the popular press is quick to tout purported links between genomic factors and traits or conditions that often turn out to be false or overstated. although military exigencies may create a compelling need for genomic data, the data must be viewed with caution until they are adequately confirmed. this raises the question of under what circumstances the military is entitled to rely on genomic technologies that have not yet been fully tested, discussed in the following section. as described earlier, the military has an interest in giving troops gene - based technologies that could help protect them, treat injury and illness, and improve their performance. earlier, this article discussed ethical and legal issues surrounding the testing of these interventions in military and civilian subjects. but the military might not want to pass up the opportunity to provide a promising genomic intervention to warfighters, especially those in harm 's way, even though the intervention had not undergone complete testing for safety and efficacy. a similar situation, although not involving genomic technologies, arose with the distribution of pyridostigmine bromide (pb) and botulinum toxoid (bt) vaccine to troops during the gulf war, and with the dod 's anthrax vaccine immunization program (avip), which began in 1998. these modalities were given to troops to protect against chemical and biological weapons rather than solely to determine whether or not they actually worked. in other words, they were deployment uses rather than formal research studies. at the time, the food and drug administration (fda) had approved pb for treatment of myasthenia gravis, but not for protection against nerve agents, while at the start of the avip program, the anthrax vaccine was approved by the fda to protect against cutaneous exposure but not against the airborne exposure that dod expected. (the fda approved anthrax vaccine for all routes of exposure in 2004.) therefore, these were off - label or unapproved uses, a common medical practice. the fda had not approved bt vaccine for any use at the time of the gulf war, but the vaccine had an odd history ; it was the only vaccine available against botulinum toxin, had been used by doctors to protect people against it for years, and was manufactured for that purpose by the centers for disease control and prevention under an investigational new drug exemption, the fda 's mechanism for allowing unapproved products to travel legally across state lines. these deployment uses generated controversy over whether they should be voluntary, that is, whether troops should be allowed to refuse to take the drug and the vaccines. one concern was that making deployment use mandatory would encourage the military to use it to circumvent the informed consent requirements of formal research. ultimately, congress decided that drugs could be given to troops off - label only if a waiver of informed consent was issued by the president or under an emergency use authorization (eua) granted by the fda during a national emergency, and then not to all members of the armed forces but only to troops in a particular military operation. the same legal restrictions currently would apply to the deployment use of unapproved or off - label genomic technologies. in addition, the military should only seek a presidential waiver or an eua when the use of these genomic technologies would be ethical, that is, when it would comply with the principles of proportionality, paternalism, and fairness. commanders should carefully consider the available evidence concerning the risks and benefits of the technology in question and determine that there is no less risky alternative, so that imposing the risks on troops would be necessary in order to accomplish the mission. with the possible exception of deployment uses, warfighter access to genomic technologies will be through a physician intermediary, whether as a researcher, clinician, or operator of a genomic testing program. some commentators claim that physicians in the military should behave no differently than physicians in the civilian world and that the same ethical norms and legal rules should apply. the world medical association, for example, states that medical ethics in times of armed conflict is identical to medical ethics in times of peace, bioethicist peter clark asserts that the failure of medical professionals to recognize that military and civic duty can never trump medical ethical principles is clearly an injustice, and sidel and levy go so far as to claim that it is morally unacceptable for a physician to serve as both a physician and a soldier in the united states military forces, leaving open the question of who is going to provide medical services in the military. as noted earlier, the civilian bioethical principle that the welfare of the individual patient is the paramount is in conflict with the military principle that the welfare of the individual is subordinate to the welfare of the unit, the success of the mission, and the security of the state. as edmund howe emphasizes, the military physician, at least implicitly, promises to support the mission or greater good when and if this is necessary, even if this requires subordinating the medical well - being of the individual soldier. if military doctors acted according to civilian principles of bioethics when they provided services to their own troops, they might find themselves having to violate the fundamental principle of military bioethics. consequently, the rules governing military physicians can not be the same as those that govern civilians. military physicians are still medical professionals, however, and while this status can not relieve them of their obligations as members of the military, it imposes on them a special obligation to look out for the interests of warfighters for whom they are responsible. due to their medical expertise, they should be in a better position than non - physicians to assess biomedical risks and benefits, and therefore they have a duty to apply their medical expertise to determine if a genomic risk that commanders seek to impose on their subordinates is disproportionate. if physicians disagree with the commanders judgement, they must take the matter up the chain of command until they are satisfied that their professional concerns have received due consideration. as canadian brigadier general and former director of canadian military health services hilary jaeger states, the military physician must act as a counterweight, by being the voice of caution, and should not hesitate to challenge when they are not satisfied. a prime example of the special protective role of military physicians in fact involves a genomic technology, a recombinant - dna - manufactured clotting agent called factor vii. the army introduced the product into clinical practice in iraq in 2004 before full - scale testing, which later revealed both safety problems, such as an increased risk of blot clots that could cause strokes and a lack of efficacy. army physicians in baghdad became concerned in 2006 about the safety and efficacy of the clotting agent and urged their superiors in the medical chain of command to curtail its use. ethical and legal issues raised by military human subjects research on genomic enhancements were discussed earlier in balancing risks and benefits. this section addresses the issues raised by giving genomic enhancements to troops outside of research, such as during training or deployment. genomic enhancement technologies raise some of the same ethical and legal concerns that have been discussed in connection with other genomic technologies, for example, whether warfighters must be asked for informed consent. the question here is whether the fact that the genomic technology is an enhancement rather than medically related calls for different treatment. generally speaking the fact that a genomic test seeks information about a warfighter 's physical or mental abilities rather than their risk for genomic disease, for example, does not alter the ground rules for military genomic testing described in genomic testing, which mandate that any risks from the testing be proportionate to the military 's need for the information and that superiors protect the warfighter 's welfare to the greatest extent possible. the same is true for a genomic intervention such as a recombinant - dna - manufactured drug, an example of which would be erythropoietin, which provides greater endurance by increasing the oxygen supply to tissues, or even a direct genomic manipulation that aims to improve warfighter performance. in all these cases, the same considerations of safety, efficacy, proportionality, paternalism, and fairness obtain. one reason for not making special rules for genomic enhancement is that the distinction between an enhancement and other sorts of genomic technologies is difficult to make. consider a recombinant drug that improves mental ability or endurance. is this an enhancement or a preventive medical measure that helps prevent warfighters from becoming ill or injured ? some commentators argue that an enhancement is something that enables an individual to exceed population norms for the characteristic or ability. thus, a drug to improve cognitive function in persons with below - normal cognitive ability would not be considered an enhancement., it refers to the frequency with which a trait or capability occurs within a population. in regard to height, the convention is to regard individuals who are more than two standard deviations below the mean height of the population as being of short stature. in other circumstances, what is considered normal may have no relationship to the distribution of a trait. for example, normal eyesight is deemed to be 20/20, but only about 35 per cent of adults have 20/20 vision without some form of correction. standards of normality also may vary from place to place and time to time, and can be expected to change as the use of enhancements increases. body shapes that were considered healthy a 100 years ago, for instance, are now considered obese. furthermore, the concepts of disease and disorder themselves may be hard to pin down. before 1973, the american psychiatric association regarded homosexuality as a mental disorder. moreover, there is a tendency to regard more and more health states as diseases and more and more interventions as treatments. instead of attempting to make a bright - line distinction between enhancements and other techniques, the emphasis should be on the effect of the intervention on the well - being of the warfighters who receive the intervention, the welfare of their units, and the completion of the mission. are there certain types of biomedical enhancements that should be out of bounds in the military ? arguably enhancements should not compromise warfighter dignity by producing socially stigmatizing or disfiguring physical characteristics. in the debate about the ethics and legality of human genomic engineering, one technology that causes particular concern, for example, critics object that even using this technology to combat disease, for enhancement purposes, should be prohibited due to the risk of creating monsters and blurring the line between humans and other animals. on the other hand, an argument can be made that the benefits from giving warfighters an eagle 's daytime vision, an owl 's night vision, a dog 's sense of smell, a gorilla 's strength, or a cheetah 's speed might be so great that they should not be ruled out of the question. from a technical standpoint, however, it may well be necessary to produce such changes at a sufficiently early stage of embryonic development that the alterations showed up in all of the resulting individual 's cells, including their reproductive cells, and therefore would be passed on to their descendants. in short, germ line genomic engineering. this is another genomic approach that meets with strong objections, including that it could cause inadvertent harm to future generations. the question then would be whether the military ought to be allowed to produce modifications that made the offspring of their personnel especially valuable as warfighters if the same types of changes were forbidden in the general population. this scenario is sufficiently far in the future that it does n't have to be resolved at this time, but one conclusion that seems certain even now is that such modifications would be unethical without the warfighter 's informed consent. another ethical issue is what effect genomic enhancement use should have on promotions, commendations, and other rewards within the military. if warfighters are required to take the enhancements, then it does not seem justified to deprive them of resulting service benefits so long as access to the enhancements is fairly distributed. on the other hand, if warfighters use enhancements voluntarily, the situation might be thought to resemble enhancements in sport, where it is argued that abilities or accomplishments attributable in substantial part to enhancements do not deserve reward. as in the case of sports, however, one must inquire why from an ethical standpoint biomedical enhancements should be treated differently than permissible performance - improving practices such as dietary modification and extreme training. moreover, unlike in sport, where the use of enhancements may confer benefits on individual athletes and teams but produce little or no broader societal benefit, enhancements in the military could help protect warfighters and their comrades from harm, and aid them in accomplishing missions deemed to be in the national interest. in terms of the impact on military rewards, then, the willingness of warfighters to incur health risks from enhancements in order to benefit others as well as themselves might be deemed to be praiseworthy. an additional concern is the potential for genomic enhancement technology to migrate from the military to the civilian sector. the successful development of enhancements for the military is likely to become publicly known and create pressure to make them available to civilians, including from entities that have a proprietary interest in the technologies. warfighters also might illegally distribute enhancements that they were given for military use to family members and other civilians. just as the military legitimately prohibits public access to properly classified information and dangerous weaponry, it would be appropriate to prevent the public from gaining access to military enhancements that were overly dangerous or that were so effective that it would threaten national security if they became available to adversaries. a final question is whether warfighters should be allowed to benefit from being enhanced after they are discharged from the military or retire. the ability to do so, for example, might be used as a recruiting incentive, similar to being taught technical skills. a fairness issue would arise, however, if former warfighters continued to enjoy advantages from enhancements that were not readily available to civilians because they were illegal or too expensive. on the one hand, continued advantage might seem unfair to civilians who were not eligible for military service. on the other hand, enhancement advantages could be viewed as a legitimate part of warfighters compensation package, especially if they were in combat or had been given other especially risky assignments. similar considerations arise in connection with other veterans benefits such as government - subsidized college education, job preferences, and access to va care ; in all cases, the public must decide whether the benefits are justified based on factors such as the need for military volunteers and the value of the benefit compared to what is available to civilians. in the case of genomic enhancements, an additional issue is how difficult or dangerous it would be to remove or cancel the effect of the warfighter 's enhancement. although genomic technologies could produce significant benefits for the military and its individual members, they must be subject to appropriate ethical and legal constraints. the bioethical principles that underlie these constraints differ between military and civilian contexts, and therefore the rules that govern the military use of genomic technologies also must be different. given the exigencies of military operations and national security, the military in many respects deserves to have greater freedom to conduct research using military subjects, obtain genomic information from military personnel, create and establish military geno phenobanks, and provide genomic therapies and enhancements to warfighters than would be ethically acceptable in civilian biomedical contexts. nevertheless, warfighters deserve to be respected and to have their welfare maximized as much as possible under the circumstances. the essence of military bioethics is the duty of superiors to protect their subordinate 's welfare and impose risks on them only to the extent that the risk is appropriate in light of the military benefits to be gained. given the scientific uncertainty surrounding many aspects of genomics, public sensitivity to genomic misconduct, and the importance of maintaining an effective voluntary military force, adherence to these principles in the realm of genomics is especially critical. | advances in genomic science are attracting the interest of the u.s. military for their potential to improve medical care for members of the military and to aid in military recruitment, training, specialization, and mission accomplishment. while researchers have explored the ethical, legal, and social issues raised by the use of genomic science in a wide variety of contexts, there has been virtually no examination of these issues in connection with the use of genomics by the military. this article identifies potential uses of genomic science by the military, proposes an applicable ethical and legal framework, and applies the framework to provide ethical and legal guidance for military decision - makers. |
as recent improvements in ultrasound techniques have increased diagnostic accuracy, ultrasonography is being used as an initial screening procedure in acute and chronic biliary tract disease, especially in gallbladder disease. since present real - time ultrasonography shows high - quality imaging, the absence of a gallbladder image in a fasting patient must be considered pathological. the possible causes for gallbladder nonvisualization by ultrasonography include : (1) congenital absence of gallbladder ; (2) previous cholecystectomy ; (3) physiologic contraction because the patient was not truly fasting, or a longer fast was necessay ; (4) diseased gallbladder with lumen obliteration ; (5) small volume gallbladder or one with an unusual shape or location ; (6) obstruction of the biliary tree proximal to the cystic duct ; (7) obscured gallbladder by gasfilled intestinal loops ; (8) and technical error. however, in most cases, the apparently absent gallbladder is, in fact, a small, chronically infected, contracted gallbladder. we reviewed the follow - up data on 31 cases in which the gallbladder could not be identified despite adequate fasting, to define the significance of gallbladder nonvisualization by ultrasonograpy. ultrasonography was performed on 7,582 patients at severance hospital of yonsei university college of medicine from may 1980 to july 1985. all ultrasonic examinations were done with a commercially available b - mode grayscale unit at a frequency of 2.5 or 3.5 mhz and linear - array real - time transducer at a frequency of 3.5 mhz (searle pho / sonic - sm alpha). preparation for examination involved fasting for at least 8 hours prior to the examination. with the patient held in maximal inspiration, multiple serial scans of the right upper quadrant at closely spaced intervals (0.5 cm) the patients were examined in the supine, decubitus, oblique intercostal, and erect positions to optimize visulaization of the gallbladder. a review of the results of 7,582 ultrasonic examinations revealed that in 78 (1.02%) cases the gallbladder lumen was not imaged. excluded from this group were 35 cases in which the patient had undergone cholecystectomy prior to examination, and 12 cases which were not further evaluated. the medical records and radiographic findings on oral cholecystography, intravenous (iv) cholangiography, and endoscopic retrograde cholangiopancreatography (ercp) of the 31 cases were analyzed. nineteen of the 31 cases underwent surgical exploration ; surgical findings and pathological results were also analyzed. of the 31 cases of gallbladder nonvisualization, 18 were male and 13 were female. the peak was in the sixth decade, and most of the cases were in the range of 40 to 69 years (table 1). of the 31 cases of gallbladder nonvisualization, surgery was performed in 2 with no further evaluation beyond ultrasonography. of the remaining 29 cases, oral cholecystography was performed in 12 cases, ercp in 11 cases, oral cholecystography and ercp in 2 cases, oral cholecystography and iv cholangiography in 2 cases, and iv cholangiography and ercp in 2 cases (table 2). oral cholecystography was performed in 16 cases and its findings were nonvisualization of the gallbladder in 9 cases, stone in 5 cases, faint visualization of the gallbladder in one case and normal - appearing gallbladder in one case (table 3). of the 4 cases which underwent iv cholangiography, the gallbladders were nonvisualized in all. the biliary ducts were nonvisualized in 2 cases, filled with air in one case, and normal in one case (table 4). of the 15 cases which underwent ercp, gallbladders were nonvisualized in 7 cases, stones were present in 4 cases, gallbladders were contracted in 2 cases and normal in 2 cases. among the 7 cases of nonvisualized gallbladder, the findings of the common bile ducts included stones in 2 cases, cancer in one case, and normal findings in 4 cases. of the 4 cases of gallstones, the findings of the common bile ducts included stones in two cases and normal in two cases. in the two cases presenting a contracted gallbladder, stones were found in the common bile duct, and in two cases showing a normal gallbladder, the common bile ducts were normal (table 5). the diagnoses for gallbladder nonvisualization, confirmed at the time of surgery in 19 cases, were contracted gallbladder due to chronic cholecystitis in 17 cases with cholelithiasis (13 cases), choledocholithiasis (2 cases) and cancer (2 cases), obliteration of the lumen due to cancer of the gallbladder in one case and technical error in one case due to an unusual location of the gallbladder in a case proven as having cancer of the bile duct at the level of the cystic duct (table 6) the gallbladder diseases in 31 cases of gallbladder nonvisualization included chronic cholecystitis in 15 (48.4%) cases (among these 15, cholelithiasis was present in 13 cases, and choledocholithiasis in 2 cases), cholelithiasis in 4 (12.9%) cases in which surgery was not performed, and cancer in 3 (9.7%) cases. there were 4 (12.9%) cases which showed a normal gallbladder and 5 (16.1%) cases in which the etiology was indeterminent. in 5 cases, the gallbladders were non - visualized by oral cholecystography in 3 cases and ercp in one case, and was faintly visualized by oral cholecystography in one case (table 7). there were 4 cases of diagnostic error in which gallbladder nonvisualization occurred despite a demonstrable lumen : normal - appearing gallbladders were found by oral cholecystography in one case, ercp in 2 cases, and at the time of surgery in one case. since present real - time ultrasonography shows high - quality imaging, the absence of a gallbladder image in a fasting patient must be considered pathological. reported that ultrasonic visualization of the gallbladder can be achieved with relative ease and reliability, with a 98% success rate using b - scan echography. in our study, the gallbladder was nonvisualized in 78 (1.02%) of 7582 cases. among the 78 cases, 35 cases the apparently absent gallbladder is, in fact, a small, chronically infected, contracted gallbladder. leopold. found six patients with gallbladder nonvisualization, all of whom proved to have gallstones (100% positive accuracy). harbin. reported that 22 of 25 cases (88% positive accuracy) were found to have diseased gallbladders. anderson and harned noted that 10 of 13 cases with gallbladder nonvisualization were found to have cholelithiasis (77% positive accuracy). in our study, if 5 of the 31 cases in whom the etiology of gallbladder nonvisualization were not confirmed are excluded, 22 of 26 cases (84.6% positive accuracy) were found to have diseased gallbladders (table 7). detwiler and associates reviewed the records of all patients cholecystectomized in their hospital from january 1977 to december 1979, a total of 374 patients. the oral cholecystography accurately diagnosed gallbladder disease in 71 of these 76 patients, with 93.4 per cent accuracy, false positive in one patient, and false negative in 4 patients. ultrasonography correctly predicted gallbladder disease in 66 of the 75 patients, with 86.8% accuracy, false positive in one patient, and false negatives in 9 patients. these authors recommended that ultrasound scanning should be employed as the initial screening study for all gallbladder disease, and that oral cholecystography should then follow in patients in whom ultrasonography fails to identify gallbladder calculi. vas and salem also recommended cholecystosonography as the initial study in the investigation of gallbladder disease by making a comparative retrospective study of 140 patients. ultrasound was found to be 95% accurate for gallbladder disease, with a 5% false negative rate. some investigators have recommended the use of single - dose oral cholecystography as the routine first examination when gallbladder disease is suspected. if the gallbladder is not satisfactorily visualized on first examination, ultrasonic cholecystography can be done immediately. in an emergency, or for patients who might be pregnant harbin. studied follow - up data on 25 patients whose gallbladders were nonvisualized by oral cholecystography and reported that of the 24 patients proven by surgery (22 patients) or autopsy (2 patients), the positive accuracy for 11 patients with both an abnormal cholecystogram and nonvisualization by cholecystography was 100%. in our study, of the 16 cases which underwent oral cholecystography, abnormalities were found in 15 cases such as stone in 5 cases, nonvisualization in 9 cases, and faint visualization in one case (table 3). of the 9 cases whose gallbladders were nonvisualized on oral cholecystography, stone were found in 4 cases, cancer in one case, a normal - appearing gallbladder by ercp in one case, and for 3 cases no additional radiological evaluation was done. a case whose gallbladder was faintly visualized received no additional evaluation in general, intravenous cholangiography is indicated in diseases of the extrahepatic duct, but it should be applied when oral examination is impractical, such as, in emergencies due to time limitations, in cases of gastrointestinal irritation, withholding of oral sustenance, or the presence of nasogastric tubes. there is some disagreement concerning the utilization of intravenous cholangiography when there has been failure of the gallbladder to opacify after a second - day cholecystogram. in a series of 5,000 cases, majahed and associates showed such failure of opacification to represent gallbladder disease in all instances. on the other hand, wise has claimed that 10% of patients with gallbladder nonvisualization on oral cholecystography may have a normal intravenous cholangiogram and possibly not suffer from gallbladder disease. in our study, intravenous cholangiography was done in 4 cases, which were confirmed by surgery to be cases of gallstone with chronic cholecystitis in 2 cases, choledocholithiasis with chronic cholecystitis in one case, and cancer of the gallbladder in one case. intravenous cholangiography showed that the gallbladder was nonvisualized in all 4 cases, and that the biliary duct was not visualized in 2 cases, was filled with air in one case, and was normal in one case. in two (cancer and cholelithiasis with chronic cholecystitis) of the 4 cases, a cholecystogram was performed before intravenous cholangiography showed a nonvisualized gallbladder, and two (cholelithiasis with chronic cholecystitis and choledocholithiasis with chronic cholecystitis) underwent ercp after intravenous cholangiography showed choledocholithiasis with a contracted gallbladder, and cholelithiasis with air in the biliary duct. therefore, intravenous cholangiography did not aid in the determination of the etiology of gallbladder nonvisualization in any of the 4 cases endoscopic retrograde cholangiography is valuable in gallbladder disease when jaundice is present, particularly when there is a question of a possible co - existing disease in the biliary duct. in our study, of the 15 cases which underwent ercp, there were 7 cases of nonvisualized gallbladder, 4 cases of cholelithiasis, 2 cases of contracted gallbladder, and 2 cases of a normal appearing gallbladder. the associated findings of the biliary duct included stone in 6 cases, cancer in one case, and normal in 8 cases. in one case, surgical findings in 6 of the 7 cases which showed gallbladder nonvisualization by ercp, were cholelithiasis in 4 cases, cancer of the gallbladder in one case, and cancer of the bile duct at the level of the cystic duct with a normal sized gallbladder in one case. in the remaining case, thus ercp helped to determine the etiology of gallbladder nonvisualization by ultrasonography in 14 (93.3%) of the 15 cases. nonvisualization of the cystic duct and gallbladder by ercp represents cystic duct obstruction when adequate filling of the biliary tree is obtained. however, unless the biliary tree is filled to the second or third order of branches, no comment can be made on nonvisualization of the gallbladder. sixty - three cases, whose gallbladders and cystic ducts were nonvisualized by ercp although the rest of the biliary system was well visualized, were analyzed by rohrmann and coworkers, and three groups of patients with abnormal conditions were noted : (1) those with obstructing lesions of the distal common bile duct, 35 patients, (2) those with primary lesions of the cystic duct or gallbladder, 19 patients, and (3) those with obstructing lesions about the common hepatic / cystic duct junction, 8 patients. in the second group, 19 patients had actual obstructing lesions of the cystic duct or gallbladder, such as calculi in 14 patients, empyema of gallbladder or chronic obliterative cholecystitis in 3 patients, and carcinoma of the gallbladder in 2 patients. harbin. reported that 22 of 25 cases in whom the gallbladder could not be identified by cholecystosonography despite adequate fasting had diseased gallbladders with obliteration of the lume (cholelithiasis with chronic cholecystitis in 20 cases and carcinoma in 2 cases). in our study, the 5 cases in which the etiology of gallbladder nonvisualization was not confirmed were excluded from the 31 cases, 22 of the 26 cases were found to have diseased gallbladders such as chronic cholecystitis in 15 cases (among these 15, cholelithiasis was present in 13 cases, choledocholithiasis in 2 cases), cholelithiasis in 4 cases which were nonsurgerized, and cancer in 3 cases (among these chronic cholecystitis was present in 2 cases and the lumen was obliterated in one case). of the 19 cases confirmed at the time of surgery, the reasons for gallbladder nonvisualization by ultrasonography were contracted gallbladder due to chronic cholecystitis in 17 cases due to cholelithiasis (13 cases), choledocholithiasis (2 cases) and cancer (2 cases), obliteration of the lumen due to cancer of the gallbladder in one case, and technical error due to an unusal location of the gallbladder in one case proven as having cancer of the bile duct at the level of the cystic duct. the mechanisms accounting for gallbladder nonvisualization in our 4 cases of diagnostic error seemed to be technical error due to an unusual location of the gallbladder in three cases and obscuration of the gallbladder by intestinal gas in one case. according to doust and mahlad, the causes accounting for gallbladder nonvisualization, using bistable b - mode scanning were small volume gallbladders or those with unusual shapes or locations. harbin. reported that the mechanism accounting for gallbladder non - visualization in 3 cases (12%) of diagnostic error is obscure, but that the possible causes are physiologic contraction of the gallbladder because the patients are not truly fasting and obscuration of the gallbladder by adjacent gas pockets in the colon or small bowel. in conclusion, we feel that careful examination should be done to detect an gallbladder unusually located or one obscured by intertinal gas in order to decrease the diagnostic error rate when the gallbladder is not visualized by ultrasonography. | to define the significance of nonvisualization of the gallbladder by ultrasonography, we studied follow - up data on 31 cases in which the gallbladder could not be identified despite adequate fasting. thirty one cases of gallbladder disease included 15 cases of chronic cholecystitis due to cholelithiasis (13 cases) and choledocholithiasis (2 cases), 4 cases of cholelithiasis which were not surgerized, and 3 cases of cancer. there were 4 cases of diagnostic error in which gallbladder nonvisualization occurred despite a demonstrable lumen. the etiology of disease was not determined in the 5 remaining cases. therefore 22 of 26 cases were found to have diseased gallbladders.the resasons for nonvisualization of the gallbladder by ultrasonography in the 19 cases which underwent surgicl exploration were : 17 cases due to chronic cholecystitis with cholelithiasis (13 cases), choledocholithiasis (2 cases) and cancer (2 cases), obliteration of the lumen due to cancer of the gallbladder in one cases, and technical error due to an unusual location of the gallbladder in one case. the mechanisms of diagnostic error in 4 cases seemed technical error due to an unusual location of the gallbladder in 3 cases and the obscured gallbladder by intestinal gas in one case.in conclusion, we feel that careful examination should be done to detect a gallbladder located unusually or obscured by intestinal gas in order to decrease the rate of diagnostic error when the gallbladder is not visualized by ultrasonography. also, we recommend an oral cholecystography or ercp for ultrasonic nonvisualized gallbladder. |
the benzo [c ] furan system, trivially called isobenzofuran, has come to light from 1960s. there are records for the reactivity of substituted isobenzofurans as dienes in the diels - alder reaction [1, 2 ]. citalopram (figure 1), a well - known compound, affects serotonin metabolism in the brain and thus acts as an antidepressant drug. citalopram is prescribed for treating major depression, social anxiety [5, 6 ], panic disorder [79 ], diabetic neuropathy, premature ejaculation [11, 12 ], and poststroke pathological crying [13, 14 ]. the pharmacological profiles of 3-mercapto-1,2,4-triazoles are tested meticulously for their antimicrobial [18, 19 ], anticonvulsant, and antidepressant activities. an attempt to prepare 2-amino-5-substituted-1,3,4-thiadiazoles from substituted acyl thiosemicarbazides 11 has failed to furnish the corresponding products. the decomposition of the starting material is indicated by h nmr and c nmr spectra. this reaction in acidic medium is dependent on both ph of the medium and substituents of acylthiosemicarbazides. the probable reason for the failure may be the steric hindrance posed by bulky isobenzofuran component for cyclization pathway. this paper portrays the synthetic tactic for the preparation of 3-mercapto-1,2,4-triazole derivatives bearing isobenzofuran moiety and an assessment of their antimicrobial action. the ir (kbr) spectra are recorded on shimadzu 8300 fourier transform infrared spectrometer. h nmr is recorded on bruker am 400 mhz spectrometer and c nmr is recorded on bruker am 100 mhz spectrometer using dmso as solvent and tms as an internal standard (chemical shift in ppm). mass spectral (ms) analysis is carried out on agilent 6520 esiqtof ms with ionization source esiqtof and acetonitrile as solvent (110 volts). thin layer chromatography is conducted on 0.25 mm silica gel plates (60f254, merck). reagents are obtained commercially and used as received. to a cooled solution of sncl2 (1.0 g, 5.27 mmol) in conc. hcl (20 ml) add 4-nitrophthalimide 1 (5.0 g, 0.026 mol) slowly under stirring. after complete addition, the reaction mass is stirred for 3 h at r.t. the reaction mass is cooled and the solid formed is filtered and washed with chilled water. the wet solid 2 (4 g, 0.024 mol) is dissolved in 30% aq. zn dust (2 g, 0.030 mol) is added to the mixture and refluxed for 4 h. the residue is filtered and the filtrate is acidified with conc. this mass is refluxed again for 2 h. thereafter, the reaction mass is cooled and the ph is adjusted to neutral using liq. nh3. the solid formed is filtered and recrystallised from boiling methanol to afford 5-amino-3h - isobenzofuran-1-one 3 as off white solid, yielding 3.0 g (83%), m.p. 186188c ; ir (kbr pellet, cm) : 3133 (nh), 3085 (aromatic ch), 1644 (c = o), 1620, 1471 (aromatic c = c), 1044 (coc), 1022 (cn) ; h nmr (dmso, 400 mhz) : 7.55 (d, j = 8.0 hz, 1h, arh), 6.626.69 (m, 2h, arh), 5.32 (s, 2h, ch2), 5.13 (bs, 2h, nh2) ; c nmr (dmso, 400 mhz) : 169.0, 141.7, 137.6, 133.0, 131.9, 128.9, 124.4, 70.5 ; anal. calcd. for c8h7no2 : c, 64.42 ; h, 4.73 ; n, 9.39. found : c, 64.49 ; h, 4.69 ; n, 9.34. dissolve 5-amino-3h - isobenzofuran-1-one 3 (2.00 g, 0.013 mol) in conc. dilute with water (30 ml) and stir to make a homogeneous solution. cool in ice and add nano2 (1.10 g, 0.016 mol) solution in water (2.5 ml) under stirring. to this cool diazonium salt solution add cucn (1.42 g, 0.015 mol) slowly in small quantities with warming on a water bath at 60c. reflux for 30 min and then cool the reaction mass to get the title compound 4 which is recrystallised from ethyl acetate, yielding 1.68 g (84%), m.p. 202204c ; ir (kbr pellet, cm) : 3043 (aromatic ch), 2251 (cn), 1685 (c = o), 1670, 1444 (c = c), 1037 (coc) ; h nmr (dmso, 400 mhz) : 8.01 (d, j = 7.5 hz, 1h, arh), 7.65 (d, j = 7.5 hz, 1h, arh), 7.62 (s, 1h, arh), 5.38 (s, 2h, ch2) ; c nmr (dmso, 400 mhz) : 171.1, 140.6, 137.8, 132.5, 131.7, 128.4, 125.7, 119.6, 69.4 ; anal. calcd. for c8h4no2 : c, 67.92 ; h, 3.17 ; n, 8.80. found : c, 67.91 ; h, 3.19 ; n, 8.88. under nitrogen atmosphere p - fluoro phenyl magnesium bromide (7.5 g, 37.73 mmol) is added dropwise to a stirred solution of 1-oxo-1,3-dihydro - isobenzofuran-5-carbonitrile 4 (5 g, 31.44 mmol) in thf (50 ml) at 05c. put in some more thf and wash with water. remove off thf and pour residue 5 into methanol (10 ml). nabh4 (0.58 g, 15.72 mmol) is added slowly for 30 min to the reaction mass and stirred for 2 h at r.t. solvents are removed to get diol 6 which is refluxed with 2n hcl (50 ml) for 2 h. the reaction mass is cooled and diluted with water. the product is extracted into methylene chloride, washed with water, and dried (anhy. the solvent is removed and the residue is crystallized in ipa to provide 1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile 7 as pale yellow solid yielding 5.9 g (79%), m.p. 97 - 98c ; ir (kbr pellet, cm) : 3013(aromatic ch), 2246 (cn), 1699, 1479 (c = c), 1038 (coc) ; h nmr (dmso, 400 mhz) : 7.65 (s, 1h, arh), 7.58 (d, j = 8.5 hz, 1h, arh), 7.31 (dd, j = 14.0 hz, 2.6 hz, 2h, arh), 7.15 (d, j = 8.5 hz, 1h, arh), 7.09 (t, j = 7.6 hz, 2h, arh), 6.11 (s, 1h, ch), 5.29 (d, j = 2.0 hz, 1h, ch), 5.18 (d, j = 2.0 hz, 1h, ch) ; c nmr (dmso, 400 mhz) : 144.8, 140.5, 137.2, 133.3, 132.9, 131.3, 128.9, 128.4, 125.7, 119.6, 116.0, 84.2, 71.8 ; anal. calcd. for c15h10fno : c, 81.08 ; h, 4.58 ; n, 6.36. 1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile 7 (5 g, 20.92 mmol) is added to methanol (50 ml) and 1n naoh (20 ml). completion of reaction is marked by tlc with mobile phase toluene : ethyl acetate = 7.5 : 2.5. after completion of reaction, the mass is cooled and acidified with 1n hcl. the solid formed is filtered, washed with water, and recrystalized from ethanol to give 8 as crystalline white solid with a yield of 4.7 g (87%), m.p. 188190c ; ir (kbr pellet, cm) : 3012 (acid ch), 2912 (acid oh), 1707 (c = o), 1682, 1492 (c = c), 1039 (coc) ; h nmr (dmso, 400 mhz) : 12.35 (bs, 1h, cooh), 7.80 (s, 1h, arh), 7.72 (d, j = 8.5 hz, 1h, arh), 7.26 (dd, j = 14.0 hz, 2.5 hz, 2h, arh), 7.13 (d, j = 8.5 hz, 1h, arh), 7.01 (t, j = 8.0 hz, 2h, arh), 6.14 (s, 1h, ch), 5.34 (d, j = 2.0 hz, 1h, ch), 5.21 (d, j = 2.0 hz, 1h, ch) ; c nmr (dmso, 400 mhz) : 178.2, 144.8, 140.8, 138.1, 133.2, 132.0, 131.7, 128.9, 127.9, 125.4, 115.6, 84.7, 71.2 ; anal. found : c, 69.70 ; h, 4.24. 1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carboxylic acid 8 (5 g, 0.019 mol) the mixture is refluxed for 5 h. the progress of the reaction is monitored by tlc (toluene : ethyl acetate = 7.5 : 2.5). to stop the back reaction, excess of alcohol ether layer is washed with 5% sodium bicarbonate solution and thereafter evaporated to yield corresponding aromatic ester 9. compound 9 (4 g, 0.013 mol) is directly refluxed with 98% hydrazine hydrate (4 ml) in ethanol (4 ml) for 3 h. the progress of the reaction is monitored by tlc (toluene : ethyl acetate : diethylamine = 7.5 : 2.5 : 1). reaction mixture is cooled and the solid formed is filtered and washed with ethanol to get 1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbohydrazide 10 as white solid with a yield of 3.6 g (94%), m.p. 238240c ; ir (kbr pellet, cm) : 3185 (nh), 1695 (c = n), 1083 (coc) ; h nmr (dmso, 400 mhz) : 11.91 (s, 1h, nh), 11.76 (s, 2h, nh2), 8.48 (s, 1h, arh), 7.93 (d, j = 8.5 hz, 1h, arh), 7.74 (dd, j = 14.0 hz, 2.5 hz, 2h, arh), 7.42 (d, j = 8.5 hz, 1h, arh), 7.21 (t, j = 8.0 hz, 2h, arh), 6.27 (s, 1h, ch), 5.34 (d, j = 2.0 hz, 1h, ch), 5.21 (d, j = 2.0 hz, 1h, ch) ; c nmr (dmso, 400 mhz) : 161.0, 147.8, 139.7, 133.8, 129.5, 129.1, 127.5, 127.1, 122.6, 121.3, 125.0, 115.9, 84.5, 72.8 ; anal. calcd. for c15h13 fn2o2 : c, 66.17 ; h, 4.81 ; n, 10.29. found : c, 66.19 ; h, 4.77 ; n, 10.22. reflux an equimolar mixture of compound 10 and 4-substituted phenyl isothiocyanate (a h) in methanol (10 vol.) for 3 h. after cooling, the resulting solid is filtered and recrystallized from methanol to afford pure acyl thiosemicarbazides 11(a h). thiosemicarbazide 11(a h) (1.0 mmol) is added portionwise to 5% naoh solution (30 ml) and the reaction mixture is refluxed for 4 h. cool and acidify with 6 n hcl to ph 2 - 3. the precipitated solid 12(a h) is filtered, washed with water, and recrystallized from ethanol. (0.50 g, 1.23 mmol) we synthesized a white solid 12a (0.436 g, 91%) with m.p. 208210c ; ir (kbr pellet, cm) : 3402 (nh), 3085 (aromatic ch), 1604 (c = n), 1404 (c = c), 1234 (c = s), 1157 (coc), 1033 (cf) ; h nmr (dmso, 400 mhz) : 14.14 (s, 1h, nh), 7.50 (s, 1h, arh), 7.48 (d, j = 8.5 hz, 1h, arh), 7.37 (dd, j = 14.0 hz, 2.6 hz, 2h, arh), 7.34 (t, j = 8.0 hz, 2h, arh), 7.33 (d, j = 8.5 hz, 1h, arh), 7.187.0 (m, 5h, arh), 6.15 (s, 1h, ch), 5.23 (d, j = 2.0 hz, 1h, ch), 5.17 (d, j = 2.0 hz, 1h, ch) ; c nmr (dmso, 400 mhz) : 169.0, 150.9, 144.4, 139.7, 134.9, 129.9, 129.8, 129.1, 128.9, 128.8, 128.2, 125.8, 122.6, 121.9, 115.8, 115.6, 84.3, 72.7 ; ei - ms (110 v) m / z (%) : 390 (m, 100), 360 (6.7), 267 (28), 165 (2.5), 123 (4.3) ; anal. calcd. for c22h16 (0.50 g, 1.19 mmol) we synthesized a white solid 12b (0.432 g, 90%) with m.p. 194196c ; ir (kbr pellet, cm) : 3448 (nh), 3085 (aromatic ch), 2923 (ch), 1654 (c = c), 1280 (c = s), 1033 (cf) ; h nmr (dmso, 400 mhz) : 14.11 (s, 1h, nh), 7.53 (s, 1h, arh), 7.37 (d, j = 8.5 hz, 1h, arh), 7.34 (dd, j = 14.0 hz, 2.5 hz, 2h, arh), 7.24 (t, j = 8.0 hz, 2h, arh), 7.19 (d, j = 8.5 hz, 1h, arh), 7.07.11 (m, 5h, arh), 6.21 (s, 1h, ch), 5.28 (d, j = 2.0 hz, 1h, ch), 5.44 (d, j = 2.0 hz, 1h, ch), 2.5 (s, 2h, ch2) ; c nmr (dmso, 400 mhz) : 168.5, 151.7, 144.8, 140.0, 138.8, 136.2, 129.9, 129.1, 129.0, 128.4, 127.9, 126.0, 123.0, 122.1, 115.9, 115.6, 85.4, 72.7, 47.1 ; anal. calcd. for c23h18 fn3os : c, 68.47 ; h, 4.50 ; n, 10.41. found : c, 68.42 ; h, 4.57 ; n, 10.43. (0.50 g, 1.15 mmol) we synthesized a white solid 12c (0.413 g, 86%) with m.p. 212214c ; ir (kbr pellet, cm) : 3271 (nh), 3155 (aromatic ch), 1666 (c = n), 1542 (c = c), 1234 (c = s), 1164 (coc), 1018 (cf) ; h nmr (dmso, 400 mhz) : 14.13 (s, 1h, nh), 7.50 (s, 1h, arh), 7.36 (d, j = 8.5 hz, 1h, arh), 7.32 (dd, j = 14.0 hz, 2.5 hz, 2h, arh), 7.29 (t, j = 8.0 hz, 2h, arh), 7.15 (d, j = 8.5 hz, 1h, arh), 7.07.08 (m, 5h, arh), 6.20 (s, 1h, ch), 5.24 (d, j = 2.0 hz, 1h, ch), 5.47 (d, j = 2.0 hz, 1h, ch), 3.6 (t, j = 7.0 hz, 2h, ch2), 2.51 (t, j = 7.0 hz, 2h, ch2) ; c nmr (dmso, 400 mhz) : 169.1, 150.6, 144.2, 140.6, 135.1, 129.5, 129.1, 128.8, 128.2, 127.9, 126.3, 125.4, 122.9, 121.1, 115.6, 115.1, 85.0, 72.7, 48.4, 33.2 ; anal. calcd. for c24h20 fn3os : c, 69.04 ; h, 4.83 ; n, 10.06. found : c, 69.06 ; h, 4.88 ; n, 10.04. (0.50 g, 1.13 mmol) we synthesized a white solid 12d (0.387 g, 79%) with m.p. 180182c ; ir (kbr pellet, cm) : 3440 (nh), 3093 (aromatic ch), 1612 (c = n), 1488 (c = c), 1226 (c = s), 1103 (coc), 1033 (cf), 825 (ccl) ; h nmr (dmso, 400 mhz) : 14.07 (s, 1h, nh), 7.92 (s, 1h, arh), 7.88 (d, j = 8.5 hz, 1h, arh), 7.70 (d, j = 7.0 hz, 2h, arh), 7.64 (d, j = 7.0 hz, 2h, arh), 7.45 (dd, j = 14.0 hz, 2.5 hz, 2h, arh), 7.31 (t, j = 8.0 hz, 2h, arh), 7.25 (d, j = 8.5 hz, 1h, arh), 6.21 (s, 1h, ch), 5.16 (d, j = 2.0 hz, 1h, ch), 5.10 (d, j = 2.0 hz, 1h, ch) ; c nmr (dmso, 400 mhz) : 169.0, 152.6, 147.5, 144.5, 139.8, 138.7, 134.5, 131.1, 129.8, 128.9, 128.8, 128.3, 125.7, 122.7, 115.8, 155.6, 84.3, 72.7 ; anal. calcd. for c22h15 clfn3os : c, 62.34 ; h, 3.57 ; n, 9.91. found : c, 69.32 ; h, 3.54 ; n, 9.96. (0.50 g, 1.14 mmol) we synthesized a white solid 12e (0.416 g, 83%) with m.p. 174176c ; ir (kbr pellet, cm) : 3224 (nh), 3091 (aromatic ch), 1612 (c = n), 1481 (c = c), 1315 (no2), 1244 (c = s), 1103 (coc) ; h nmr (dmso, 400 mhz) : 14.19 (s, 1h, nh), 8.20 (d, j = 8.0 hz, 2h, arh), 7.94 (s, 1h, arh), 7.83 (d, j = 8.5 hz, 1h, arh), 7.42 (d, j = 8.0 hz, 2h, arh), 7.37 (dd, j = 14.0 hz, 2.5 hz, 2h, arh), 7.30 (t, j = 8.0 hz, 2h, arh), 7.24 (d, j = 8.5 hz, 1h, arh), 6.87 (s, 1h, ch), 5.21 (d, j = 2.0 hz, 1h, ch), 5.18 (d, j = 2.0 hz, 1h, ch) ; c nmr (dmso, 400 mhz) : 168.8, 153.6, 150.6, 143.8, 137.9, 134.5, 129.9, 129.5, 129.1, 128.6, 127.3, 125.8, 124.4, 122.5, 117.0, 115.2, 84.2, 72.1 ; anal. calcd. for c22h15 fn4o3s : c, 60.82 ; h, 3.48 ; n, 12.90. found : c, 60.87 ; h, 3.43 ; n, 12.96. (6) synthesis of 4-(4-methylphenyl)-5-[1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-yl]-2h-1,2,4-triazole-3-thione 12f. from 11f (0.50 g, 1.19 mmol) we synthesized a white solid 12f (0.422 g, 88%) with m.p. 152154c ; ir (kbr pellet, cm) : 3162 (nh), 3044 (aromatic ch), 2948 (ch), 1612 (c = n), 1472 (c = c), 1226 (c = s), 1146 (coc), 1012 (cf) ; h nmr (dmso, 400 mhz) : 14.07 (s, 1h, nh), 7.92 (s, 1h, arh), 7.88 (d, j = 8.5 hz, 1h, arh), 7.64 (d, j = 7.0 hz, 2h, arh), 7.58 (d, j = 7.0 hz, 2h, arh), 7.40 (dd, j = 14.0 hz, 2.6 hz, 2h, arh), 7.33 (t, j = 8.0 hz, 2h, arh), 7.26 (d, j = 8.5 hz, 1h, arh), 6.12 (s, 1h, ch), 5.20 (d, j = 2.0 hz, 1h, ch), 5.17 (d, j = 2.0 hz, 1h, ch), 2.33 (s, 3h, ch3) ; c nmr (dmso, 400 mhz) : 169.0, 150.5, 144.7, 143.6, 133.0, 130.3, 129.8, 129.7, 129.1, 128.9, 128.3, 126.8, 125.7, 122.6, 119.5, 115.8, 83.7, 72.5, 21.4 ; anal. calcd. for c23h18 fn3os : c, 68.47 ; h, 4.50 ; n, 10.41. found : c, 68.42 ; h, 4.56 ; n, 10.47. (7) synthesis of 4-(4-methoxyphenyl)-5-[1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-yl]-2h-1,2,4-triazole-3-thione 12 g. from 11 g (0.50 g, 1.14 mmol) we synthesized a white solid 12 g (0.403 g, 84%) with m.p. 174176c ; ir (kbr pellet, cm) : 3210 (nh), 3093 (aromatic ch), 1646 (c = n), 1428 (c = c), 1305 (co), 1278 (c = s), 1140 (coc), 1005 (cf) ; h nmr (dmso, 400 mhz) : 14.10 (s, 1h, nh), 7.99 (s, 1h, arh), 7.85 (d, j = 8.5 hz, 1h, arh), 7.44 (dd, j = 14.0 hz, 2.6 hz, 2h, arh), 7.32 (t, j = 8.0 hz, 2h, arh), 7.24 (d, j = 8.5 hz, 1h, arh), 7.11 (d, j = 7.5 hz, 2h, arh), 6.79 (d, j = 7.5 hz, 2h, arh), 6.44 (s, 1h, ch), 5.29 (d, j = 2.0 hz, 1h, ch), 5.01 (d, j = 2.0 hz, 1h, ch), 3.11 (s, 3h, och3) ; c nmr (dmso, 400 mhz) : 168.4, 150.4, 150.1, 144.7, 140.0, 134.1, 131.1, 129.5, 129.1, 128.9, 128.2, 124.3, 122.0, 117.1, 117.4, 115.4, 84.1, 72.8, 53.6 ; anal. calcd. for c23h18 fn3o2s : c, 65.86 ; h, 4.33 ; n, 10.02. found : c, 65.82 ; h, 4.39 ; n, 10.07. (0.50 g, 1.05 mmol) we synthesized a white solid 12h (0.398 g, 81%) with m.p. 206208c ; ir (kbr pellet, cm) : 3241 (nh), 3077 (aromatic ch), 1672 (c = n), 1488 (c = c), 1237 (c = s), 1142 (coc), 1075 (cf), 524 (cbr) ; h nmr (dmso, 400 mhz) : 14.03 (s, 1h, nh), 7.90 (s, 1h, arh), 7.85 (d, j = 8.5 hz, 1h, arh), 7.66 (d, j = 7.0 hz, 2h, arh), 7.52 (d, j = 7.0 hz, 2h, arh), 7.44 (dd, j = 14.0 hz, 2.5 hz, 2h, arh), 7.32 (t, j = 8.0 hz, 2h, arh), 7.24 (d, j = 8.5 hz, 1h, arh), 6.19 (s, 1h, ch), 5.18 (d, j = 2.0 hz, 1h, ch), 5.12 (d, j = 2.0 hz, 1h, ch) ; c nmr (dmso, 400 mhz) : 168.1, 150.6, 146.2, 145.1, 134.6, 133.2, 129.9, 129.5, 129.0, 128.8, 127.1, 125.7, 122.4, 118.4, 115.2, 113.6, 84.3, 72.6 ; anal. calcd. for c22h15 br fn3os : c, 56.42 ; h, 3.23 ; n, 8.97. found : c, 56.44 ; h, 3.26 ; n, 8.91. as per nccls document m62-a7 protocols, the preliminary antimicrobial activity is performed using the disc diffusion method. they are bacillus subtilis (ncim 2063), staphylococcus aureus (ncim 2079), escherichia coli (ncim 2574), pseudomonas aeruginosa (ncim 2036), candida albicans (ncim 3471), saccharomyces cerevisiae (ncim 3559), aspergillus flavus (ncim 1316), and aspergillus niger (ncim 545). the bacterial strains are maintained on muller - hinton (mh) agar medium and fungi are sustained on sabouraud dextrose (sd) agar medium. the bacterial inoculum is prepared by suspending in 9 ml of sterile water for colonies from 24 h culture on mh agar medium. for the fungi, the inoculum is prepared with spores derived from 48 h96 h culture on sd agar medium. to standardize the inoculum density for a susceptibility test the turbidity of the actively growing microbial culture is adjusted with sterile saline to attain turbidity optically comparable to that of the 0.5 mcfarland standards. within 15 minutes after adjusting the turbidity of the inoculum suspension, the petri plates are inoculated with a standardized suspension of the tested microorganisms. the predetermined series of antimicrobial discs is allotted onto the surface of the inoculated agar plate. whatman filter paper number 1 is used to prepare discs approximately 6 mm in diameter, which are sterilized in a hot air oven before placing in petri plates. these paper discs are placed in a circular pattern in each inoculated plate and then injected with the specific amount of tested compound using micropipettes. all the newly synthesized mercaptotriazoles are dissolved in dimethyl sulfoxide (dmso) to prepare chemicals of stock solution of 10 mg/1 ml for antibacterial study and 25 mg/1 ml for antifungal study. the plates are incubated and the inhibitory activity is measured (in mm) as the diameter of the observed inhibition zones. the tests are repeated to confirm the findings and the average of the readings is taken into account. following m62-a7 protocols, broth dilution test by doubling dilution of the antibiotics is carried out to examine the minimum inhibitory concentration of the most promising compound 12d against the tested microbes. the antibacterial and antifungal assays are performed in mueller - hinton broth and sabouraud dextrose broth, respectively. mic for microbes is to be observed between 250 g/1 ml and 7.81 g/1 ml. gentamicin (1 mg/2 ml) and fluconazole (1 mg/2 ml) are used as standard antibacterial and antifungal drugs, respectively. 4-nitrophthalimide 1 is reduced to 4-aminophthalimide 2 using sncl2/hcl which is converted to 5-amino-3h - isobenzofuran-1-one 3 by employing zn / naoh. compound 4, commonly called 5-cyanophthalide, is subjected to grignard reaction with 4-fluorophenyl magnesium bromide in tetrahydrofuran and the resulting product is treated with sodium borohydride to obtain the diol 6, which is cyclized with 2n hcl to afford 1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile 7. the synthesized acid hydrazide is treated with different substituted phenyl isothiocyanates (a h) to yield 1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-acyl thiosemicarbazides 11(a h). cyclodehydration of the thiosemicarbazides 11(a h) in basic medium (5% naoh) leads to the formation of 4-substituted phenyl-5-[1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-yl]-2h-1,2,4-triazole-3-thiones 12(a h) (scheme 1). the ir spectra of the mercaptotriazoles 12(a h) mark the absence of carbonyl absorption around 1750 cm. the existence of triazoles in thione form is indicated by the absence of sh stretching in the characteristic region of 2540 cm. the h nmr spectrum of every compound unveils the deshielding of nh of the triazole ring as anticipated in the range 14.0014.50. the signal for nh appearing downfield than 12.0 authenticates the existence of the ring in thione form. the characteristic fluorocoupling is observed for the aromatic protons of the phenyl ring attached to the 1st position of isobenzofuran moiety. in the c nmr spectra of triazol-3-thiones, values close to 168 and 150 are the characteristic signals for c-3 and c-5 carbons, respectively. disappearance of signal around 161163 for carbonyl carbons indicates the formation of target compounds 12(a h). the molecular ion peak in the mass spectrum of c22h16fn3os (12a) is found to be at m / z 390.09. many research articles on heterocycles have explicated the synthesis of 2-amino-5-substituted-1,3,4-thiadiazole derivatives from substituted acyl thiosemicarbazides. this reaction runs parallel to the preparation of 3-mercapto-1,2,4-triazoles from the same starting material. here moreover, the use of novel reagents like saccharin and p - toluene sulfonic acid has also failed to afford the required products. similarly, spectral characterization reveals that 2-substituted acyl thiosemicarbazides have failed to form the required mercaptotriazoles. greater steric hindrance of the bulky isobenzofuran substituents may be the rationalization for both failures. the results of the preliminary testing of the antimicrobial activity of the novel compounds are tabulated in tables 1 and 2. varying grades of inhibition against the growth of the tested microbes by the synthesized compounds can be noticed. broadly, the inhibitory activity against the gram - positive bacteria is higher than against the gram - negative bacteria. compound 12d shows significant inhibition against all the tested microorganisms owing to the presence of chloro group on the benzene ring attached to the 4th position of triazole ring. the better activity of 12e, 12 g, and 12h can be attributed to the presence of nitro, methoxy, and bromo groups, respectively, at para positions of benzene ring. compound 12a, which has unsubstituted benzene at 4th position of triazole ring, also shows better activity than the triazoles with benzyl and phenylethyl groups. the fluoro substituent attached to the para position of benzene ring, which is connected to the 1st position of the isobenzofuran core, appears to be the reason behind the antimicrobial activities displayed by the target compounds. minimum inhibitory concentration (mic) is inspected for 12d by broth dilution approach. for gram - positive bacteria, the values are less than 62.5, but for gram - negative bacteria the results are 125 mic > 62.5. structural confirmation is done with analytical techniques and antimicrobial action is performed by disc diffusion method. based on structural activity relationship study, compounds 12a, 12d, | the paper describes a convenient method for the preparation of 4-substituted phenyl-5-[1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-yl]-2h-1,2,4-triazole-3-thiones. the structures of the synthesized compounds are established by the results of lcms, 1h nmr, 13c nmr, and ir and elemental analyses. the mercaptotriazoles are indicated to be in thione form by 1h nmr spectra. all the synthesized compounds have been screened for antibacterial and antifungal activities. compounds 12d and 12h exhibit encouraging results, while the remaining compounds show moderate activities. on the basis of spectral studies, formation of 2-amino-1,3,4-thiadiazoles from the isobenzofuran acyl thiosemicarbazides 11(a h) is ruled out. |
entamoeba histolytica is an enteric anaerobic protozoan parasite with about 50 million infections and over 100,000 deaths worldwide annually (14). developing countries have the highest prevalence of amoebiasis because of human faeces have not been properly separated from food and water supplies. however, socio - economic factors, including poor education, poverty, overcrowding, and un - sanitary conditions are also involved in fecal - oral transmission (5). the travellers to endemic areas with low standards of hygiene and sanitation are at risk (6). the swimming pools are a potential source, although it has not been proved (7). the cysts of e. histolytica are very resistant and can survive for several months in water with temperature of 0 c, 3 days at 30 c, 30 minutes at 45 c, 5 minutes at 50 c, and are extremely resistant to chlorination (8). the genus entamoeba contains six species (e. histolytica, e. dispar, e. moshkovskii, e. poleki, e. coli, and e. hartmanni) in the human intestinal lumen (913). e. moshkovskii is a free - living amoeba found in anoxic sediments (10) and e. dispar is considered as a commensal of the human gut. although e. histolytica is proved a pathogen, we still can not definitely determine that other two species do not cause diseases (11, 12). e. histolytica, e. dispar, and e. moshkovskii are morphologically similar, but have differences in genetic and biochemistry characteristics (913). since these three species can not be differentiated by microscopy that is the most frequently used diagnostic method predominantly in tropical countries where resources are limited and can only be differentiated by the use of molecular methods such as the polymerase chain reaction based methodologies (1, 9, 14). there are few studies on surface water contamination with entamoeba and the most studies have been done on fecal samples in epidemiological surveillance. in turkey two out of six water samples (32%) collected from the ankara river were positive for e. histolytca by pcr (15). based on a study in thailand, gram staining on water samples in mazandaran showed the contamination rate of e. histolytica and e. coli were 2.3%. and 0.7%, respectively (17) and mahmoudi., detected acanthamoeba species in 14 out of 27 samples by pcr method in surface water of rasht, guilan, iran (18). considering the high level of ground water in the northern parts of iran, the lack of adequate sanitation in rural areas, integration of surface water with domestic and industrial wastewater, especially in the rainy season, and also the fact that contaminated water is one of the transmission ways for e. histolytica, this study was conducted with the aim of determining surface water contamination with cysts of e. histolytica using pcr method in rasht city in this cross - sectional study, 49 water samples were randomly taken from 18 rivers and 6 wetlands from different regions near rasht city in autumn of 2012. rasht city, in the southern of the caspian sea and capital of guilan province, is one of the wettest regions in iran, which can also be very humid. it is seven meters below sea level and 15 km inland from the anzali lagoon. the samples were collected from 30 cm depth in one - liter bulk and transferred to the laboratory in sterile containers. after centrifugation and filtration using 0.22 m nitrate cellulose membrane filters, the samples were examined and analysed using microscope in direct method. genomic dna of e. histolytica (hm-1 : imss) was kindly provided by dr. haghighi, department of parasitology, shahid beheshti university of medical sciences, tehran, iran. freeze - thaw method was used for lysing cysts wall before dna extraction. in the first phase, cysts were subjected to five freeze - and - thaw cycles to facilitate the breakage of cyst wall, followed by 2025 minutes of sonication (30-second pulse followed by 30-second rest) electrical shock (seven shocks every 15 s) was given to cysts by sonificator system (hielscher, germany). then, dna was extracted using a dna isolation kit (dnp kit, cina gene, iran) and phenol- chloroform extraction method. pcr primers were designed based on small - subunit rrna (ribosomal rna) of e. histolytica using invitrogen site. primers sequences were as follows : forward primer 5cccgagaatagaaaactctt3 and reverse primer 5tcaagtatagtgcaccatct 3. pcr amplifications were performed in a final volume of 25 l containing one - time pcr buffer 2.5 l, 1.5 mm mgcl2 0.8 l, 200 m of each dntp, 2 u taq dna polymerase (takapoo zist, iran), 1 l of each primer (10 mm, takapoo zist) and dna template 2.5 l(100200 ng). reactions were carried out in a thermocycler (eppendorf, germany) pcr system and set as follows : 35 cycles contain denaturation at 94 c, annealing at 43.5 c, extension at 72c, every stage for 30 s and finally the pcr products were analyzed on 1.8% agarose gel after electrophoresis. the sequencing was used on pcr product (by pishgam co., iran) for controlling of the specificity of the result for e. histolytica. in microscopic examination, four samples of the 49 samples were positive for cysts of entamoeba (histolytica / dispar / muschkovskii). these three species can not be differentiated by microscopy and can only be differentiated by the use of molecular methods. by using pcr method, one sample was positive for e. histolytica. just as we expected, in one sample in addition to positive control that was genomic dna of e. histolytica (hm-1 : imss), had a band with 220 bp weight (fig. 1). pcr amplification of samples dna with the entamoeba histolytica specific primers lane m : molecular marker (100 bp) ladders, c+ : positive control (e. histolytica dna), c : negative control (h2o), lane 1 : amplified product (220 bp) indicating positive sample, lanes 24 : positive samples in microscopic examination that were not amplified by pcr. in molecular analysis and sequencing (by pishgam co., iran) as shown in table 1., the gene sequence had 94%, 94% and 93% homology with 18s ribosomal rna(rrna), 5.8s rrna (in plasmid) and small - subunit 1 gene e. histolytica, respectively. the differentiation between the amoeba species is not possible using light microscopic methods and who has put emphasis on the need to develop improved techniques for the species - specific diagnosis of e. histolytica infection (3). many epidemiological surveys on the prevalence of intestinal amoeba based on microscopic methods were performed in iran and almost all of them show a high prevalence of infection in different parts of iran. it is essential to note that the majority of them have not used molecular methods (1923). the recently recognized distinction among the e. histolytica, e. dispar, and e. moshkovskii has led to some confusion in epidemiological studies of amoebiasis (24). a study in stool samples by direct and formalin - ether concentration methods in iran proved the prevalence of infection with e. histolytica/ e. dispar was 0.78%, 3.9% and 4.6% for the central, northern and southern part of iran, respectively (21). a molecular method for differential diagnosis of e. histolytica and e. dispar (pcr - rflp method) showed that in different regions of iran, 92.1% of the isolates were e. dispar and 7.9% were e. histolytica or mixed infections. in the northern areas, 5.9% and 94.1% of isolates were e. histolytica and e. dispar, respectively (20). many studies using molecular methods confirm that e. histolytica is a rare species in iran and e. dispar is the predominant species (12, 20, 21, 2430). the only molecular study on amoeba in iran suggesting that e. histolytica as more prevalent than e. dispar, was conducted by pcr, where 10 of 11 positive samples in microscopic examination were e. histolytica and only one of them was e. dispar (31) water is a possible source for transmission of entamoeba to human host. cysts can survive for prolonged periods in the environment, because of the protection by their cell wall (32, 33). indicated that two out of six water samples (32%) collected from the ankara river in turkey were positive for e. histolytca by pcr (15). phuc., suggested in northern of vietnam where livestock and domestic sewage are used in agriculture, infection with e. histolytica depends on hygiene - related behaviors and socio - economic factors (34). in mazandaran (iran) by direct method and gram staining, 197(19.9%) out of 989 samples were contaminated with parasites. from 197 parasitic contaminated samples, 53 cases (26.9%) overall, 100 cases (50.8%) were nonpathogenic and the contamination rate of e. coli was 0.7% (17). furthermore, mahmoudi., detected acanthamoeba species in 14 out of 27 samples by pcr method in surface water of rasht, guilan, iran (18). in this study, by microscopic examination, four samples of surface water of rasht were positive for entamoeba, but we had not any suggestion about the species. by pcr method in these four samples, one sample was positive for e. histolytica. we had a positive control for e. histolytica, but had not any positive controls for e. dispar and e. moshkovskii, therefore could not identify the species of other three samples. for confirmation the result of pcr, we used sequencing on the pcr production. in sequencing, the gene sequence had 94%, 94% and 93% homology with 18s rrna, 5.8s rrna (in plasmid) and small - subunit 1 gene e. histolytica, respectively that is a confirmation for pcr examination. contamination by e. histolytica was proved in the surface water of rasht city and this is the first report of detection of e. histolytica in surface water in iran by molecular method. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. the authors would like to express their special thanks to b. rezavand, school of medicine, baqiyatallah university, tehran, iran, dr. n. ranji, islamic azad university, rasht branch, rasht, iran and t. taheri, tehran kharazmi university, tehran, iran for support, helpful comments and editing on this manuscript. | background : this study was conducted with the aim of determining surface water contamination with cysts of entamoeba histolytica using pcr in rasht city, northern iran.methods : in this cross - sectional study, 49 water samples including 18 rivers and 6 wetlands were collected from different regions near the city of rasht in autumn of 2012. after filtration using 0.22 m nitrate cellulose membrane filters, the samples were examined using microscope and pcr method.results : in microscopic examination, four samples of the 49 samples were positive for cysts of e. (histolytica / dispar / muschkovskii). by using pcr method and molecular analysis, one sample was positive for e. histolytica.conclusion:in the molecular analysis, contamination by e. histolytica was proved in the waters of rasht city. further investigations including more samples and necessary preparations must be applied to prevent contamination. |
the emergence of non - invasive forms of prenatal genetic testing has the potential to expand the availability of highly sensitive and specific prenatal testing. in particular, new tests that target and analyze cell - free fetal dna (cffdna) in the maternal bloodstream as early as nine weeks into pregnancy (1) the growing interest in these technologies stems from cffdna testing s distinguishing features : the absence of procedure - related risks of miscarriage and the potential to obtain results earlier in gestation than currently available prenatal diagnostic tests (3,4). over the past decade, several biotechnology companies - including sequenom, verinata health, natera and ariosa diagnostics - and academic laboratories have validated cffdna techniques for the detection of fetal rhd blood type, sex, and most recently, trisomy 13, 18, and 21 (down syndrome), monosomy x, and other sex chromosome aneuploidies (1,5,6). tests using these techniques are now entering an expanding $ 1.3 billion prenatal testing market in the united states (us) (7,8). industry expects non - invasive prenatal testing methods using cffdna (cffdna testing) to supplement, and potentially replace, existing first - trimester combined screening and significantly reduce the number of invasive procedures performed (9) because cffdna testing offers increased sensitivity and specificity (between 98.0 and 99.0% sensitivity and 99.5% and 99.8% specificity) over existing screening measures together with early usage and without the procedure - related miscarriage associated with diagnostic testing (1). professional societies have begun to release preliminary guidelines supporting the use of cffdna testing as second - tier screening in high - risk pregnancies (10,11). this study explores the interest of individuals of reproductive age in cffdna testing in relation to other prenatal testing mechanisms. past studies on american attitudes towards prenatal testing were largely conducted before non - invasive testing methods became clinically available (12). one of few studies addressing non - invasive testing, by tischler., found that 71.9% of a small sample of pregnant women were interested in cffdna testing as a replacement for amniocentesis because of the decreased risk to the fetus (13). similarly found that women undergoing invasive diagnostic testing in four united states metropolitan clinics responded positively to the potential of non - invasive prenatal testing using whole fetal cells (14). in the united kingdom, lewis. found positive attitudes towards non - invasive testing for fetal sex among women at risk for transmitting sex - linked genetic disorders (15). although professional stakeholders, such as healthcare providers, have been assessed regarding the potential usage of cffdna testing (16), studies conducted on views of non - invasive testing among end users in the us have been limited to small, specific populations of pregnant women (13). there has yet to be a comprehensive national study on the target users of this technology individuals of reproductive age - and their view of cffdna testing as a possible supplement to or replacement for other methods of testing, including invasive measures such as amniocentesis. we designed a 25 question online survey for distribution to a representative selection of the general public in the us regarding their choices among cffdna testing, conventional screening, and diagnostic procedures such as amniocentesis. here, we present data on the responses of individuals of reproductive age, as defined by age self - reported between 18 and 44 years. participants were randomized between one of two versions of the survey - focusing on testing for either trisomy 13 and 18 or trisomy 21 - in order to asses whether the severity of the condition being tested affected uptake rates. participants were randomized in order to avoid any cognitive bias associated with the order in which conditions were presented (17). we were interested in testing whether allowing individuals to consider higher morbidity versus lower morbidity conditions independently would impact testing decisions. at the beginning of the survey, short descriptions of either trisomy 13 and 18 or trisomy 21 were provided to the viewer (see appendix a) in conjunction with a table highlighting the features of different testing options and their costs. the tests presented were designed to mirror the current abilities of first - trimester combined screening and cffdna testing. cffdna testing was described as more expensive than screening in accordance with the current state of the us prenatal testing market (7). participants were asked to state a preference as to which test should be used in the event of a pregnancy in themselves or a loved one. survey questions were derived from previous empirical data on prenatal testing as well as pertinent concepts in the prenatal medicine literature (18,19). a broader team of bioethics scholars reviewed the survey s text for readability and content. the survey consisted of 10 questions on the topic of prenatal testing choices, some of which used a five - point likert scale to determine the importance the participant assigned to the features of different tests. participants were then asked to consider invasive follow - up and whether they would consider termination of an affected pregnancy. the research team contracted a web - based survey provider to electronically distribute both versions of the study to individuals aged 18 to 44 years throughout the united states. the online survey company provides a quality - assured sample of survey respondents by validating prospective panelists to ensure that they are providing accurate data and de - duplicating survey responses by using digital fingerprinting. responses were downloaded to a spreadsheet via a secure webpage by the research team, and statistical analysis was performed using the spss statistics standard program version 20.0 in consultation with the stanford university biostatistics consultation service. we designed a 25 question online survey for distribution to a representative selection of the general public in the us regarding their choices among cffdna testing, conventional screening, and diagnostic procedures such as amniocentesis. here, we present data on the responses of individuals of reproductive age, as defined by age self - reported between 18 and 44 years. participants were randomized between one of two versions of the survey - focusing on testing for either trisomy 13 and 18 or trisomy 21 - in order to asses whether the severity of the condition being tested affected uptake rates. participants were randomized in order to avoid any cognitive bias associated with the order in which conditions were presented (17). we were interested in testing whether allowing individuals to consider higher morbidity versus lower morbidity conditions independently would impact testing decisions. at the beginning of the survey, short descriptions of either trisomy 13 and 18 or trisomy 21 were provided to the viewer (see appendix a) in conjunction with a table highlighting the features of different testing options and their costs. the tests presented were designed to mirror the current abilities of first - trimester combined screening and cffdna testing. cffdna testing was described as more expensive than screening in accordance with the current state of the us prenatal testing market (7). participants were asked to state a preference as to which test should be used in the event of a pregnancy in themselves or a loved one. survey questions were derived from previous empirical data on prenatal testing as well as pertinent concepts in the prenatal medicine literature (18,19). a broader team of bioethics scholars reviewed the survey s text for readability and content. the survey consisted of 10 questions on the topic of prenatal testing choices, some of which used a five - point likert scale to determine the importance the participant assigned to the features of different tests. participants were then asked to consider invasive follow - up and whether they would consider termination of an affected pregnancy. the research team contracted a web - based survey provider to electronically distribute both versions of the study to individuals aged 18 to 44 years throughout the united states. the online survey company provides a quality - assured sample of survey respondents by validating prospective panelists to ensure that they are providing accurate data and de - duplicating survey responses by using digital fingerprinting. responses were downloaded to a spreadsheet via a secure webpage by the research team, and statistical analysis was performed using the spss statistics standard program version 20.0 in consultation with the stanford university biostatistics consultation service. a pilot version of the study was sent to approximately 200 users (100 individuals for each version of the survey) to ensure the participants could understand and complete the survey. minor revisions were made to enhance the clarity of the questions, and the final survey was sent to members of the company s panel, representative of the primary demographic features of the united states general public. including the pilot sample, 1861 individuals of reproductive age completed the survey. because the commercial survey provider measures participation in terms of completed surveys rather than invitations sent, the total response rate is unknown. both income and education were evenly distributed and most (90%+) participants had a high school degree or higher. age and gender in the sample were well distributed, with slightly more women than men responding (52.6% female to 47.3% male for trisomy 13 and 18 and 55.8% female to 44.1% male for trisomy 21). a majority, over 80% of the sample, identified as white ; over 80% also identified as non - hispanic or latino. a majority of the sample identified as somewhat or very religious, with strong catholic representation (21.6% for trisomy 13 and 18, 24.5% for trisomy 21). demographic features of the sample are included in table 1. in order to establish representativeness, we compared demographic measures to the 2010 us census data (for gender, age, ethnicity, race, educational attainment, household income, and health insurance status) using chi - square goodness - of - fit tests with =0.05. the survey sample under - represented males ((1, n=1861)=14.8, p<0.001), individuals who identify as hispanic or latino ((1, n=1738)=90.7, p<0.001) and black or african - american ((1, n=1861)=7.7, p<0.001). additionally, the distributions of respondent age ((5, n=1861)=8.3, p<0.001) and educational attainment ((4, n=1861)=490.4, p<0.001) were statistically different from those of the national population. no statistically significant differences were found in the demographics between the t13/18 and t21 samples. as figure 1 (ci = 95%) demonstrates, when asked to choose between testing modalities, respondents reported a substantive projected uptake of cffdna testing (trisomy 13/18 37.7%, trisomy 21 38.9%) over traditional screening mechanisms (trisomy 13/18 22.1%, trisomy 21 25.2%) with a small minority (trisomy 13/18 8.7%, trisomy 21 6.5%) expressing an interest in using both tests. there was no statistically significant difference between the two cohorts in those who chose cffdna over screening. however there was a statistically significant difference (p=0.001) in those that wished to undergo both tests, with a higher percentage electing to undergo both tests for trisomy 13 and 18. a significant segment of the respondents (trisomy 13/18 31.4%, trisomy 21 29.2%) declined either form of testing. participants were asked to rank the features of testing that they considered most important to decision making (see figure 2). the lowered rate of false negatives and false positives and the ability to use the test earlier in the pregnancy were the most highly rated benefits of cffdna testing. two other strongly rated factors were the cost of cffdna testing and the recommendation of a health care provider. finally, the beliefs of family and friends were consistently ranked lowest among the factors provided. participants were asked whether they would elect for invasive confirmatory testing after receiving a prenatal diagnosis of trisomy 13 or 18 or trisomy 21. desire for invasive confirmation was higher after receiving a positive result from both screening and cffdna testing with approximately half of participants electing to receive confirmatory testing after a positive screening result (trisomy 13/18 53.3%, trisomy 21 50.7%) or after a positive cffdna testing result (trisomy 13/18 46.4%, trisomy 21 46.5%). uptake rates were lower following a negative testing result from screening (trisomy 13/18 43.8%, trisomy 21 40.8%) and cffdna testing (trisomy 13/18 33.7%, trisomy 21 32.1%). there were no significant differences between rates for trisomy 13 and 18 and rates for trisomy 21. the accuracy of invasive testing was the highest rated factor when respondents were asked which factors were most influential in deciding whether or not to undergo invasive testing. the discomfort of invasive procedures and the recommendation of a medical provider were also ranked as considerations for both conditions. timing was also ranked fairly low, and cost was ranked considerably lower as a decision - making factor when considering invasive versus non - invasive testing. finally, the belief of family and friends was once again ranked lowest in considering testing. finally, participants were asked whether they would consider termination following a diagnosis of trisomy. (when trisomy 13 or 18 is detected in a fetus, most parents choose not to continue the pregnancy. do you think this is a decision you would consider ?) as shown in figure 5, a statistically significant (p=0.001) percentage (trisomy 13/18 49.8%, trisomy 21 41.3%) were more likely to consider termination for trisomy 13/18 than for trisomy 21. approximately half (trisomy 13/18 50.1%, trisomy 21 58.6%), however, reported that they would not consider termination after a diagnosis of trisomy 13 and 18 or 21. both income and education were evenly distributed and most (90%+) participants had a high school degree or higher. age and gender in the sample were well distributed, with slightly more women than men responding (52.6% female to 47.3% male for trisomy 13 and 18 and 55.8% female to 44.1% male for trisomy 21). a majority, over 80% of the sample, identified as white ; over 80% also identified as non - hispanic or latino. a majority of the sample identified as somewhat or very religious, with strong catholic representation (21.6% for trisomy 13 and 18, 24.5% for trisomy 21). demographic features of the sample are included in table 1. in order to establish representativeness, we compared demographic measures to the 2010 us census data (for gender, age, ethnicity, race, educational attainment, household income, and health insurance status) using chi - square goodness - of - fit tests with =0.05. the survey sample under - represented males ((1, n=1861)=14.8, p<0.001), individuals who identify as hispanic or latino ((1, n=1738)=90.7, p<0.001) and black or african - american ((1, n=1861)=7.7, p<0.001). additionally, the distributions of respondent age ((5, n=1861)=8.3, p<0.001) and educational attainment ((4, n=1861)=490.4, p<0.001) were statistically different from those of the national population. no statistically significant differences were found in the demographics between the t13/18 and t21 samples. as figure 1 (ci = 95%) demonstrates, when asked to choose between testing modalities, respondents reported a substantive projected uptake of cffdna testing (trisomy 13/18 37.7%, trisomy 21 38.9%) over traditional screening mechanisms (trisomy 13/18 22.1%, trisomy 21 25.2%) with a small minority (trisomy 13/18 8.7%, trisomy 21 6.5%) expressing an interest in using both tests. there was no statistically significant difference between the two cohorts in those who chose cffdna over screening. however there was a statistically significant difference (p=0.001) in those that wished to undergo both tests, with a higher percentage electing to undergo both tests for trisomy 13 and 18. a significant segment of the respondents (trisomy 13/18 31.4%, trisomy 21 29.2%) declined either form of testing. participants were asked to rank the features of testing that they considered most important to decision making (see figure 2). the lowered rate of false negatives and false positives and the ability to use the test earlier in the pregnancy were the most highly rated benefits of cffdna testing. two other strongly rated factors were the cost of cffdna testing and the recommendation of a health care provider. finally, the beliefs of family and friends were consistently ranked lowest among the factors provided. participants were asked whether they would elect for invasive confirmatory testing after receiving a prenatal diagnosis of trisomy 13 or 18 or trisomy 21. desire for invasive confirmation was higher after receiving a positive result from both screening and cffdna testing with approximately half of participants electing to receive confirmatory testing after a positive screening result (trisomy 13/18 53.3%, trisomy 21 50.7%) or after a positive cffdna testing result (trisomy 13/18 46.4%, trisomy 21 46.5%). uptake rates were lower following a negative testing result from screening (trisomy 13/18 43.8%, trisomy 21 40.8%) and cffdna testing (trisomy 13/18 33.7%, trisomy 21 32.1%). there were no significant differences between rates for trisomy 13 and 18 and rates for trisomy 21. the accuracy of invasive testing was the highest rated factor when respondents were asked which factors were most influential in deciding whether or not to undergo invasive testing. the discomfort of invasive procedures and the recommendation of a medical provider were also ranked as considerations for both conditions. timing was also ranked fairly low, and cost was ranked considerably lower as a decision - making factor when considering invasive versus non - invasive testing. finally, the belief of family and friends was once again ranked lowest in considering testing. finally, participants were asked whether they would consider termination following a diagnosis of trisomy. (when trisomy 13 or 18 is detected in a fetus, most parents choose not to continue the pregnancy. do you think this is a decision you would consider ?) as shown in figure 5, a statistically significant (p=0.001) percentage (trisomy 13/18 49.8%, trisomy 21 41.3%) were more likely to consider termination for trisomy 13/18 than for trisomy 21. approximately half (trisomy 13/18 50.1%, trisomy 21 58.6%), however, reported that they would not consider termination after a diagnosis of trisomy 13 and 18 or 21. overall, these data show support among us adults of reproductive age for the uptake of non - invasive prenatal testing for aneuploidy over current first - trimester combined screening methods. recent studies have suggested that cffdna testing is more cost effective as a follow - up to a positive first - trimester screen (20). however, our results suggest that patients would not necessarily support such an approach, as only 8.7%, for trisomy 13/18, or 6.5%, for trisomy 21, indicated that they would opt for both screening and cffdna testing. furthermore, unlike previous testing estimates that the availability of cffdna testing would decrease the uptake of invasive testing for 66% (9), 46% of our participant population indicated that they would request confirmatory testing, even after a negative result from cffdna. this result suggests that, in the hypothetical, participants devalue the risk of invasive procedures in favor of a desire for more conclusive information. given the decline in uptake of invasive procedures in general (21), it is probable that this number is significantly higher than actual clinical uptake of invasive procedures. it does, however, emphasize the importance potential parents place on certainty in prenatal results. however, a pilot study of providers also indicated that many felt unprepared to have a knowledgeable conversation about cffdna testing, suggesting that broader clinician education about the capabilities and limitations of non - invasive testing will be necessary (16). furthermore, genetic counselors have expressed concerns that other medical professionals do not offer adequate pre - test counseling to ensure informed consent for cffdna testing (3,2224), while physicians have reported a preference for professional genetic counseling services to be administered after a positive test result, indicating a discomfort with physicians attempting to offer effective genetic counseling. plans to expand the offer of cffdna testing into wider clinical use for average risk pregnancies will exacerbate the lack of adequate counseling services available to women considering prenatal testing options. on a broader level, the input of pertinent regulatory agencies may become increasingly important as non - invasive prenatal testing expands. given that the accuracy of testing is the most highly valued feature in prenatal testing, additional measures will be necessary to ensure that novel tests are rigorously validated and monitored. approximately a third of participants indicated that they would continue to decline all testing, including cffdna testing, despite the potential to receive more accurate results non - invasively. these results are supported by tischler (2011) and are consistent with limited clinical reports from academic medical centers (25). however, other studies involving individuals who decline invasive prenatal testing have emphasized that risk to the fetus is a significant motivation for declining testing (26). one explanation for this may be that the risk to the fetus may serve as a form of proxy anxiety for cultural and religious beliefs surrounding the permissibility of termination ; because patients may be uncomfortable considering elective termination as a valid option, risk is used as an alternative explanation for why testing is unacceptable. previous studies have supported the idea that personal and ethical beliefs can significantly mediate patient choices regarding prenatal testing (27). despite the modest importance assigned to personal beliefs in the current sample, it is probable that those who do express strong cultural or religious values contribute significantly to the proportion of individuals in the sample who said they would decline testing. the number of individuals who continue to express a desire to avoid all prenatal testing is potentially worrisome because of the potential for cffdna testing to compress the informed consent process leading up to near - diagnostic results. cffdna testing can be carried out at a time in the pregnancy when women generally undergo blood draws for a variety of reasons and observers have frequently expressed concern that pregnant women will have difficulty distinguishing aneuploidy testing from other routine maternal tests (2830). indeed, recent data show that even women who remember formulating a plan, with regard to whether or not to receive quad screen testing, end up inadvertently acting against their intentions due to a lack of awareness of what kind of testing to which they are agreeing (31). furthermore, due to the lack of physical risk in cffdna testing, there is concern that medical professionals may be inclined to view non - invasive testing as information with no downside (32,33), an attitude that may erode the informed consent process (34). for instance, van den heuvel. found that service providers recommended less stringent informed consent procedures when hypothetically referring for non - invasive versus invasive testing (35). we echo the concerns of other observers who note that it is important to maintain the integrity of the informed consent process, even when testing is conducted early and non - invasively (3538). finally, it is clear that cost remains a factor in prenatal decision - making, highlighting the significant challenges of integrating cffdna testing into the us health care system. while a few states have subsidized prenatal screening programs using first - trimester combined screening, it is unclear how quickly, if at all, cffdna testing will be taken up by public payors, including both medicaid and state screening programs. for third - party payors who might otherwise cover these costs, cffdna testing will have to prove that it significantly improves detection rates of targeted conditions or substantively reduces the number of invasive procedures before it will be widely reimbursable. reimbursement for non - invasive tests using cffdna among private insurers has thus far been inconsistent among us providers (3, 22) ; to date, california is the only state that includes nipt in its universally available prenatal screening regime (39). furthermore, if patients are unwilling to rely on cffdna testing in making decisions about a pregnancy and decide to undergo amniocentesis regardless of their results, then the timing advantages of cffdna testing may be reduced (3). reported uptake of testing of any kind did not significantly differ across trisomies, despite the fact that trisomies 13/18 were presented as most often fatal whereas trisomy 21 was presented as a condition with which affected individuals may lead long, relatively healthy lives (see appendix a). the only significant difference came in the small proportion of people who indicated that they would choose to undergo both screening and cffdna testing suggesting that the additional reassurance was considered important when considering a fatal condition. on the one hand, as we report elsewhere, the inherent value of information is frequently cited as a motivation for undergoing testing, even when participants report that they intend to carry the pregnancy to term regardless of testing results. this finding may suggest that respondents who said they would choose testing value prenatal information in and of itself, regardless of the condition being detected. further, participants were informed that current standard of care is the integrated screen and that doctors are thus likely to suggest this option to patients as a first tier test. indeed, the recommendation of a health care provider was listed higher than personal or family beliefs in testing decision - making factors. the recommendation of a health care provider may therefore be a significant contributor to the decision to undergo integrated screening rather than cffdna testing. similarly, those who said they would refuse testing may regard the information as unnecessary, regardless of the condition. significant difference was shown in the consideration of termination between trisomy 13/18 and trisomy 21. a higher percentage of respondents indicated that they would be more likely to consider terminating a pregnancy affected by trisomy 13/18 than a pregnancy affected by trisomy 21, which most likely indicates consideration of the increased severity of trisomy 13/18. however, the reported willingness to consider termination seen here are considerably lower than actual statistics for termination post trisomy 21 diagnosis, which range from 67 to 85% in the us (40). the high reported willingness to consider termination for trisomy 21 is also at odds with previous studies of individuals and families with trisomy 21, which report high levels of satisfaction and quality of life, although there is some selection bias in these findings (41,42). patient advocates have long suggested that this dichotomy reflects a lack of education and nuanced understanding of the reality of living with genetic conditions which can be overcome with better educational approaches to prenatal counseling (43). finally, as noted in the results section, there are statistically significant differences between the study sample and the national census on several demographic factors. in particular, as reported elsewhere, educational achievement and income may affect the reported willingness to undergo testing. by the same token the underrepresentation of certain minority populations may give the impression of greater enthusiasm for testing among the population as a whole ; past studies have shown that minority populations have lower uptake rates of prenatal testing than caucasian populations (44). on the other hand, these demographics may be a more accurate portrayal of those populations that are most likely to be offered non - invasive prenatal testing methods. given high price points and uncertain insurance coverage, it is likely that this testing will be accessed, at least initially, by more socio - economically advantaged populations. another limitation concerns the fact that participants received relatively little information on the complex nature of risk calculations and phenotypic expression of trisomies. this is counter to the recommendation of many disability advocates, who frequently campaign for more nuanced information in the genetic counseling process (45,46). however, it may not be dissimilar to actual clinical testing presentations, especially in resource - limited settings (47). a third limitation is suggested by the disparity between anticipated invasive testing and termination rates and the experience of clinical practitioners. this disparity suggests that individuals can not always accurately predict their future actions, which may restrict the generalizability of the data gathered here. there is a well - known expectation bias among participants in social science research, particularly that which deals with morally controversial subjects. especially among populations with strong cultural or religious stigma surrounding abortion, individuals are less likely to publically confess a willingness to undergo pregnancy termination. the way in which these attitudes change when confronted with the reality of a positive diagnosis may account in part for the discrepancy in reported versus actual terminations. overall, these data show support among us adults of reproductive age for the uptake of non - invasive prenatal testing for aneuploidy over current first - trimester combined screening methods. recent studies have suggested that cffdna testing is more cost effective as a follow - up to a positive first - trimester screen (20). however, our results suggest that patients would not necessarily support such an approach, as only 8.7%, for trisomy 13/18, or 6.5%, for trisomy 21, indicated that they would opt for both screening and cffdna testing. furthermore, unlike previous testing estimates that the availability of cffdna testing would decrease the uptake of invasive testing for 66% (9), 46% of our participant population indicated that they would request confirmatory testing, even after a negative result from cffdna. this result suggests that, in the hypothetical, participants devalue the risk of invasive procedures in favor of a desire for more conclusive information. given the decline in uptake of invasive procedures in general (21), it is probable that this number is significantly higher than actual clinical uptake of invasive procedures. it does, however, emphasize the importance potential parents place on certainty in prenatal results. however, a pilot study of providers also indicated that many felt unprepared to have a knowledgeable conversation about cffdna testing, suggesting that broader clinician education about the capabilities and limitations of non - invasive testing will be necessary (16). furthermore, genetic counselors have expressed concerns that other medical professionals do not offer adequate pre - test counseling to ensure informed consent for cffdna testing (3,2224), while physicians have reported a preference for professional genetic counseling services to be administered after a positive test result, indicating a discomfort with physicians attempting to offer effective genetic counseling. plans to expand the offer of cffdna testing into wider clinical use for average risk pregnancies will exacerbate the lack of adequate counseling services available to women considering prenatal testing options. on a broader level, the input of pertinent regulatory agencies may become increasingly important as non - invasive prenatal testing expands. given that the accuracy of testing is the most highly valued feature in prenatal testing, additional measures will be necessary to ensure that novel tests are rigorously validated and monitored. approximately a third of participants indicated that they would continue to decline all testing, including cffdna testing, despite the potential to receive more accurate results non - invasively. these results are supported by tischler (2011) and are consistent with limited clinical reports from academic medical centers (25). however, other studies involving individuals who decline invasive prenatal testing have emphasized that risk to the fetus is a significant motivation for declining testing (26). one explanation for this may be that the risk to the fetus may serve as a form of proxy anxiety for cultural and religious beliefs surrounding the permissibility of termination ; because patients may be uncomfortable considering elective termination as a valid option, risk is used as an alternative explanation for why testing is unacceptable. previous studies have supported the idea that personal and ethical beliefs can significantly mediate patient choices regarding prenatal testing (27). despite the modest importance assigned to personal beliefs in the current sample, it is probable that those who do express strong cultural or religious values contribute significantly to the proportion of individuals in the sample who said they would decline testing. the number of individuals who continue to express a desire to avoid all prenatal testing is potentially worrisome because of the potential for cffdna testing to compress the informed consent process leading up to near - diagnostic results. cffdna testing can be carried out at a time in the pregnancy when women generally undergo blood draws for a variety of reasons and observers have frequently expressed concern that pregnant women will have difficulty distinguishing aneuploidy testing from other routine maternal tests (2830). indeed, recent data show that even women who remember formulating a plan, with regard to whether or not to receive quad screen testing, end up inadvertently acting against their intentions due to a lack of awareness of what kind of testing to which they are agreeing (31). furthermore, due to the lack of physical risk in cffdna testing, there is concern that medical professionals may be inclined to view non - invasive testing as information with no downside (32,33), an attitude that may erode the informed consent process (34). for instance, van den heuvel. found that service providers recommended less stringent informed consent procedures when hypothetically referring for non - invasive versus invasive testing (35). we echo the concerns of other observers who note that it is important to maintain the integrity of the informed consent process, even when testing is conducted early and non - invasively (3538). finally, it is clear that cost remains a factor in prenatal decision - making, highlighting the significant challenges of integrating cffdna testing into the us health care system. while a few states have subsidized prenatal screening programs using first - trimester combined screening, it is unclear how quickly, if at all, cffdna testing will be taken up by public payors, including both medicaid and state screening programs. for third - party payors who might otherwise cover these costs, cffdna testing will have to prove that it significantly improves detection rates of targeted conditions or substantively reduces the number of invasive procedures before it will be widely reimbursable. reimbursement for non - invasive tests using cffdna among private insurers has thus far been inconsistent among us providers (3, 22) ; to date, california is the only state that includes nipt in its universally available prenatal screening regime (39). furthermore, if patients are unwilling to rely on cffdna testing in making decisions about a pregnancy and decide to undergo amniocentesis regardless of their results, then the timing advantages of cffdna testing may be reduced (3). reported uptake of testing of any kind did not significantly differ across trisomies, despite the fact that trisomies 13/18 were presented as most often fatal whereas trisomy 21 was presented as a condition with which affected individuals may lead long, relatively healthy lives (see appendix a). the only significant difference came in the small proportion of people who indicated that they would choose to undergo both screening and cffdna testing suggesting that the additional reassurance was considered important when considering a fatal condition. on the one hand, as we report elsewhere, the inherent value of information is frequently cited as a motivation for undergoing testing, even when participants report that they intend to carry the pregnancy to term regardless of testing results. this finding may suggest that respondents who said they would choose testing value prenatal information in and of itself, regardless of the condition being detected. further, participants were informed that current standard of care is the integrated screen and that doctors are thus likely to suggest this option to patients as a first tier test. indeed, the recommendation of a health care provider was listed higher than personal or family beliefs in testing decision - making factors. the recommendation of a health care provider may therefore be a significant contributor to the decision to undergo integrated screening rather than cffdna testing. similarly, those who said they would refuse testing may regard the information as unnecessary, regardless of the condition.. a higher percentage of respondents indicated that they would be more likely to consider terminating a pregnancy affected by trisomy 13/18 than a pregnancy affected by trisomy 21, which most likely indicates consideration of the increased severity of trisomy 13/18. however, the reported willingness to consider termination seen here are considerably lower than actual statistics for termination post trisomy 21 diagnosis, which range from 67 to 85% in the us (40). the high reported willingness to consider termination for trisomy 21 is also at odds with previous studies of individuals and families with trisomy 21, which report high levels of satisfaction and quality of life, although there is some selection bias in these findings (41,42). patient advocates have long suggested that this dichotomy reflects a lack of education and nuanced understanding of the reality of living with genetic conditions which can be overcome with better educational approaches to prenatal counseling (43). finally, as noted in the results section, there are statistically significant differences between the study sample and the national census on several demographic factors. in particular, as reported elsewhere, educational achievement and income may affect the reported willingness to undergo testing. by the same token the underrepresentation of certain minority populations may give the impression of greater enthusiasm for testing among the population as a whole ; past studies have shown that minority populations have lower uptake rates of prenatal testing than caucasian populations (44). on the other hand, these demographics may be a more accurate portrayal of those populations that are most likely to be offered non - invasive prenatal testing methods. given high price points and uncertain insurance coverage, it is likely that this testing will be accessed, at least initially, by more socio - economically advantaged populations. another limitation concerns the fact that participants received relatively little information on the complex nature of risk calculations and phenotypic expression of trisomies. this is counter to the recommendation of many disability advocates, who frequently campaign for more nuanced information in the genetic counseling process (45,46). however, it may not be dissimilar to actual clinical testing presentations, especially in resource - limited settings (47). a third limitation is suggested by the disparity between anticipated invasive testing and termination rates and the experience of clinical practitioners. this disparity suggests that individuals can not always accurately predict their future actions, which may restrict the generalizability of the data gathered here. there is a well - known expectation bias among participants in social science research, particularly that which deals with morally controversial subjects. especially among populations with strong cultural or religious stigma surrounding abortion, individuals are less likely to publically confess a willingness to undergo pregnancy termination. the way in which these attitudes change when confronted with the reality of a positive diagnosis may account in part for the discrepancy in reported versus actual terminations. overall, these results suggest moderate support for the use of cffdna testing in high - risk pregnancies for the detection of trisomy. despite differences in mortality and morbidity between trisomy 13 and 18 and trisomy 21, there were no statistical differences between uptake of testing for the two sets of conditions, with the exception of a slight increase in those who indicated that they would prefer to have both screening and cffdna testing for trisomy 13 & 18. there was also greater support for consideration of termination when considering a positive result for trisomy 13 and 18 as opposed to trisomy 21. while these numbers seem to suggest a measured consideration of the probable quality of life impact of these respective conditions, reported willingness to consider termination remained significantly lower than the rates of actual termination reported clinically. while the potential to test for aneuploidy earlier in the pregnancy does offer benefits in terms of the possibility of earlier reassurance or decisions surrounding termination when medical, rather than surgical, abortions are still possible, it also condenses the informed consent process and may discourage healthcare providers and patients from having comprehensive conversations about the realities of living with a genetic condition (32,37). it is of some concern to note that respondents consistently valued the recommendation of a physician when making prenatal testing decisions despite the fact that most obstetric clinicians do not have training in genetics and may be unprepared to have knowledgeable conversations about the implications of expanded prenatal genetic testing. in addition, a small but significant portion of the sample indicated that they would continue to support the refusal of any form of prenatal testing, even when offered a non - invasive testing option and despite differences in the severity of the condition being tested. this is contrary to previous prediction, which suggested that the limiting factor for many women who decline testing is the risk of miscarriage (26). we suggest that stakeholders should direct proactive attention to reforming and strengthening the informed consent process in order to effect the most ethical implementation of cffdna testing. | objective(s)to determine how adults in the united states (us) view non - invasive prenatal testing using cell - free fetal dna (cffdna testing) in order to help estimate uptake.study designa national sample of 1,861 us - based adults was surveyed using a validated online survey instrument. the survey was administered by a commercial survey research company. respondents were randomized to receive a survey about prenatal testing for trisomy 13 and 18 or trisomy 21. participants were asked to select among testing modalities, including cffdna testing, and rank the features of testing that they considered most important to decision making.resultsthere was substantive interest in the use of cffdna testing rather than traditional screening mechanisms with a minority of respondents reporting that they would support the use of both methods in combination. the lower rates of false negative and false positive test results and the ability to use the test earlier in the pregnancy were the most highly rated benefits of cffdna testing. participants expressed strong support for diagnostic confirmation via invasive testing after a positive result from either screening or cffdna testing. however, almost one - third of participants reported that they would not endorse the use of either invasive or non - invasive prenatal testing.conclusion(s)there appears to be support for uptake of non - invasive prenatal tests. clinical guidelines should therefor go forward in providing guidance on how to integrate non - invasive methods into current standard of care. however, our findings indicate that even when accuracy, which is rated by patients as the most important aspect of prenatal testing, is significantly improved over existing screening methods and testing is offered non - invasively, the number of individuals who reported that they would decline any testing remained the same. attention should therefor be directed at ensuring that the right of informed refusal of prenatal testing is not impacted by new, non - invasive methods. |
neurofibroma is a benign peripheral nerve sheath tumor arising from the schwann cells and perineural fibroblasts. oral involvement is noted in 3.4 - 92% of adults and 40% of children with nf1. a 28-year - old male patient reported [figure 1 ] with the chief complaint of a painless swelling in the right upper back tooth region since 3 years. history revealed swelling was of insidious in onset, which increased to attain the present size. family history revealed the patient 's father [figure 3 ] also had multiple swellings all over the body and face. on general examination, multiple swellings all over the trunk region and arms were observed [figure 2 ]. solitary well - defined oval shaped swelling [firm in consistency and nontender on palpation figure 4 ] approximately 4 cm 3 cm was present in the right maxillary posterior region extending from distal aspect of maxillary first premolar to mesial aspect of third molar.. however, multiple, discrete, sessile cutaneous masses which had started appearing since childhood were observed. histopathological examination of incisional biopsy of the oral lesion showed spindle cells with elongated wavy nuclei. the lesional area was separated from the overlying epithelium by mature fibrous connective tissue [figure 5 ]. cutaneous neurofibroma over the trunk patient 's father with cutaneous neurofibroma gingival neurofibroma h and e stained section of the lesion under, 40 neurofibromatosis type 1 is due to alteration of nf1 gene, which is a tumor suppressor gene located in the long arm of chromosome 17. the clinical criterion for the diagnosis of nf1 encompasses presence of six or more cafau lait spots (> 5 mm in children or > 15 mm in adults), two or more cutaneous or subcutaneous neurofibromas or one plexiform neurofibroma, freckles in the axilla or groin optic glioma, two or more lisch nodules (pigmented hamartomas of the iris), bony lesion with sphenoid wing dysplasia or bowing of the long bones with or without pseudoarthrosis, and/or first degree relative with nf1. other features that have been described to occur variably in individuals with nf1 include short stature, large head size, failure to gain weight, precocious puberty, vascular disease including childhood hypertension, neural problems secondary to the spinal cord involvement, headaches, cognitive problems, stroke, brain tumors, and rarely tumors such as pheochromocytoma, and juvenile chronic myeloid leukemia. common sites of the oral solitary neurofibromas include tongue (26%), buccal mucosa (8%), alveolar ridge (2%), labial mucosa (8%), palate (8%), gingiva (2%), nasopharynx, paranasal sinuses, larynx, floor of the mouth and salivary gland. this patient reported with gingival localization of neurofibroma, which is extremely rare and unique. gingival neurofibromas can cause periodontal disease, as tissue growth is an obstacle in carrying out routine oral hygiene measures. oral radiographic findings unique to nf include lengthening, narrowing and rarefaction of coronoid and articular process, deepening of sigmoid notch, an enlarged mandibular canal, mandibular foramen and mental foramen. other findings are shortening of the ramus, notching of the inferior border of the mandible. in the case usually, the prognosis for solitary neurofibroma is extremely good, with only rare instances of recurrence. the present case was kept under observation and was recalled every 3 months for a period of 1 year and showed no signs of recurrence. malignant transformation of neurofibromas with nf1 into neurogenic sarcomas bears a very bad prognosis with a 5 years survival rate of just 15%. long - term review of patients and genetic counseling is recommended owing to the likelihood (50%) of vertical transmission. it is imperative for the general physicians and dermatologists to be aware of the oral manifestations of nf1 considering the risk of malignant transformation and the poor prognosis. | neurofibroma is a benign peripheral nerve sheath tumor and is the most frequent tumor of neural origin. its presence is one of the clinical criteria for the diagnosis of neurofibromatosis type 1 (nf1 ; a common hereditary disease occurring in one out of every 3000 births). the diagnosis can sometimes be made at birth, while in others the diagnosis is made later in life after the appearance of additional clinical criteria. majority of the solitary neurofibromas are sporadic, while a few are associated with nf1 syndrome. oral hard and soft tissue are affected by the tumor ; however, the tongue is the most affected site. gingival neurofibroma is an uncommon oral manifestation of nf. here, we report a rare case of gingival neurofibroma in nf1 patient. one of the most feared complications of nf1 is its transformation into neurofibrosarcoma, which bears a very poor prognosis. treatment of neurofibroma is surgical resection. |
elevated intraocular pressure (iop) is a frequent complication of intraocular inflammation, affecting 5 to 19% of uveitis patients. elevated iop can be acute or chronic and both presentations can lead to optic nerve damage and visual field defect in glaucoma secondary to hypertensive uveitis. iop elevation may have different origins : trabeculitis, obstruction of the trabecular meshwork, pupillary block due to posterior synechiae, or steroid induced. the treatment begins classically with the use of topical hypotensive drugs like beta - blockers, alpha - agonist, and carbonic anhydrase inhibitors. although it has been reported in the past that prostaglandins analogs could induce uveitis, more recent studies have found their relative safety in nonviral uveitis, and they are thus now also used for the management of intraocular hypertension in some uveitis patients [24 ]. when treatment with topical drops fails to normalize intraocular pressure, oral acetazolamide can also be added but is often not well tolerated for long term treatment. when medical treatment is no longer sufficient or requires chronic oral acetazolamide, a surgical approach is usually proposed [35 ]. elevated iop and glaucoma have been described more frequently in certain uveitis entities, such as juvenile rheumatoid arthritis, sarcoidosis, vogt - koyanagi - harada syndrome, sympathetic ophthalmia, syphilis, or toxoplasmosis. viral uveitis, including rubella virus (rv) infection associated with clinical diagnosis of fuchs uveitis and anterior uveitis due to herpes virus infection (herpes simplex virus (hsv), herpes zoster virus (vzv), and cytomegalovirus (cmv)), is another uveitis group also frequently associated with elevated iop and glaucoma [59 ]. few studies have compared viral and nonviral hypertensive uveitis in terms of iop characteristics or evolution towards glaucoma [1, 7, 10, 11 ]. therefore we retrospectively reviewed the clinical outcome of our series of uveitis patients with elevated iop and analyzed their outcome and compared patients with viral and nonviral uveitis. we retrospectively retrieved the medical records of consecutive patients with uveitis and iop higher than 25 mmhg at the department of ophthalmology in the chu saint - pierre, brussels, belgium, who presented to our department since the first episode of uveitis between 2003 and june 2012. this study was accepted by the ethic committee of the hospital. in order to obtain a complete and long enough follow - up of patients since the first episode of hypertensive uveitis, all patients already treated for uveitis before their referral to our department or who did not have a minimum of 1-year follow - up were excluded from the study. clinical data were collected including results from systemic work - up, etiology, first iop at presentation of uveitis, first elevated iop, time before elevation of intraocular pressure, maximal iop, iop at 3 months, at 1 year, and at last visit, need for surgery, and occurrence of glaucoma as defined by casson.. the diagnosis of glaucoma was based on visual field defects measured by the automated visual field humphrey (test 24 - 2) and optic disc analysis of pathologic cupping of the optic nerve head (inferior thinning of nerve fiber layers during quiescent periods of uveitis) analyzed by oct zeiss spectralis in patients with elevated iop based on the diagnostic tools for glaucoma detection and management reported by sharma.. a suspected glaucoma was defined as glaucomatous defects on visual field or optic nerve head detected by oct but not both tests together in patients with elevated iop. elevated iop with no glaucoma corresponded to a lack of glaucomatous defects on visual field and optic disc oct in these patients. all patients included had an appropriated work - up depending on the type of uveitis with at least syphilis serology, chest x - ray, and mantoux test for granulomatous uveitis and hla b27 test for nongranulomatous uveitis. diagnoses of specific uveitis entities, such as birdshot, vogt - koyanagi - harada (vkh), and sarcoidosis, were based on sun criteria and specific criteria [1416 ]. diagnosis of viral uveitis was based on clinical characteristic and/or positive polymerase chain reaction (pcr) for a virus. for the diagnosis of cmv anterior uveitis, selection of patients was based on the association of anterior uveitis with a few large precipitates surrounded by endothelial inflammation (coin shaped) and positive pcr for cmv in all the cases. a positive pcr for hsv1, hsv2, or vzv was used in most cases to support the diagnosis. diagnosis of fuchs heterochromic uveitis was based on pathognomonic spindle shape keratic precipitates scattered all over the cornea with diffuse iris changes including heterochromia, depigmentation, and velvet aspect of the iris surface [6, 18 ]. rubella virus has been mostly implicated but cmv might also be implicated in fuchs heterochromic uveitis [69 ]. therefore, pcr for cmv and rubella have also been performed in some of these patients. for the diagnosis of herpetic anterior uveitis, the diagnosis was based on clinical characteristics including typical sectorial iris atrophy pathognomonic for herpetic anterior uveitis and associated scars of stromal keratitis and endotheliitis or previous zoster ophthalmicus in the frontal and nasal area [19, 20 ]. in order to perform a statistical analysis, when both eyes had hypertensive uveitis, only the worse eye was selected for the study based on the worse evolution of the hypertony iop most uncontrolled or most topically and/or orally (acetazolamide) treated to control iop. the appropriate tests used for statistical analysis are detailed in the tables for each statistical analysis. ten patients had a bilateral hypertensive uveitis but for statistical analysis we only included in the study 61 eyes with the most severe hiop. we found 25 patients with viral uveitis including 18 patients with positive pcr for a virus (5 : fuchs (2 pcr+), 14 : herpes (10 pcr+), and 6 : cmv (6 pcr+)) and 36 nonviral uveitis including 6 : toxoplasmosis, 3 : behet, 3 : vogt - koyanagi - harada (vkh), 7 : sarcoidosis (1 defined, 2 presumed, and 4 probable as defined by the international criteria for the diagnosis of ocular sarcoidosis : results of the first international workshop on ocular sarcoidosis), 1 : juvenile idiopathic arthritis (jia), 2 : ankylosing spondylitis (spa), and 14 : idiopathic (table 1). the number of patients analyzed in the viral group did not differ statistically from nonviral group (25 and 36, p = 0.159). patients were significantly older in viral group than in the nonviral group (50.6 and 35.7 years, p = 0.014). no difference was found in the m / f ratio in both viral and nonviral groups (13/12 and 19/17, p = 1.0). the mean follow - up duration was 67.8 months (range 6205 months, sd : 37.8) in the whole series of patients with no significant difference between viral and nonviral groups (65.9 and 69.1 months, p = 0.743) (table 2). all patients from the viral group had unilateral uveitis while bilateral hypertensive uveitis was observed in 10 patients (16.4%) of the nonviral group. mean time before first episode of elevated iop was 9.3 months (range 0141, sd : 23.0). there was no significant difference in time to first episode of elevated iop (p = 0.080) between viral and nonviral group of uveitis and table 3. the mean value of the first elevated iop in the whole series of patients was 32.9 mmhg (range 2558, sd : 9.0) which was significantly higher in the viral group (36.0 mmhg) than in the nonviral group (27.5 mmhg) (p = 0.008) (table 3). the mean highest value of iop for the whole group of patients was 36.6 mmhg (range 2558, sd : 9.9). the mean highest value of iop was significantly higher (40.3 mmhg, range 2656, sd : 10.6) in the viral group than in the nonviral group (34.1 mmhg, range 2558, sd : 8.7) (p = 0.015) (table 3). thirty patients (49.20%) (15 in the viral group and 15 in the nonviral group) had elevated iop before applying corticosteroid drops. among these 30 patients there was no significant difference in first or maximal elevated iop in viral and nonviral group (p = 0.260 and 0.160). at 3 months after the first episode, the mean iop values dropped to 19.54 mmhg (range 856, sd : 9.16) in the whole group with iop of 23.0 mmhg (range 1056, sd : 11.4) in the viral group and 17.5 mmhg (range 848, sd : 6.3) in the nonviral group (p = 0.057) (figure 2). at the end of the follow - up we found a mean iop of 15.5 mmhg in the whole series of patients (range 647, sd : 6.24) with a mean iop of 17.7 mmhg (range 1047, sd : 8.3) in the viral group and 13.94 mmhg (range 625, sd : 3.64) in the nonviral group (p = 0.043). at the end of the follow - up we had still 25 patients (41%) who needed topical treatment to control the elevated iop. a glaucoma demonstrated by oct and visual fields occurred in 15 patients (24.59%) (2 : fuchs, 1 : vkh, 1 : sarcoidosis, 4 : cmv, 3 : herpes, and 4 : idiopathic). there were 8 cases of glaucoma found in the viral group (34.78%) and 7 cases of glaucoma found in the nonviral group (23.33%) (p = 0.774) (table 3). suspected but uncertain glaucoma was found in 11 patients (18.03%) (3 in the viral group and 8 in the nonviral group) (p = 0.401). no glaucoma was found in 31 patients of the whole group 14 viral and 21 nonviral (p = 0.774). iop could be successfully lowered under 25 mmhg in most patients (90.16%). no differences were found between groups (97.2% and 84% p = 0.149) (figure 2). fifteen patients (25%) underwent surgery for uncontrolled iop, 9 patients (25%) in the nonviral group and 6 patients (24%) in the viral group (p = 1.0). the etiologies of those patients were 1 : fuchs, 2 : vkh, 1 : sarcoidosis, 3 : herpes, 2 : cmv, 4 : idiopathic, 1 : behet, and 1 : ankylosing spondylitis. elevated iop in uveitis does not always lead to glaucomatous damage ; however glaucoma is one of the most severe complications of uveitis. the aim of this work was to evaluate the characteristics of uveitis with elevated iop and the evolution toward glaucoma and to compare viral and nonviral hypertensive uveitis. in order to study the evolution patients with elevated iop since the beginning of the disease it was important to include only patients who had a complete follow - up since first attack and exclude patients that were already treated for uveitis before the referral in our department. most patients with jia were addressed to our referral center from another clinic ; consequently only one patient with jia from our group of patients with jia and elevated iop could be included in the study. however when we analyze our complete cohort of patients with jia referred later in the evolution of their uveitis to our clinic, 55% of them presented with a hypertony and 35% of them had a glaucoma (unpublished results). these results are more in accordance with other reports where a frequency from 14 to 42% of glaucoma was found in jia [2027 ]. this is slightly less than other reports where 28 to 45% of elevated iop was found [28, 29 ]. another limit of our study is that only 18/25 patients of the viral group had a pcr performed and a positive result for a virus. however the 7 patients without pcr had pathognomonic signs of herpetic anterior uveitis or fuchs heterochromic anterior uveitis. only 2 patients with a clinical diagnosis of fuchs heterochromic uveitis had a positive pcr and none had a goldman witmer test performed for rubella virus. found a positive goldman witmer ratio for rubella virus in 100% of patients with a clinical diagnosis of fuchs while only 12% of these patients had a positive pcr for rubella virus. to our knowledge, our study is the first one to evaluate the etiologies of uveitis among a group of hypertensive uveitis and to compare viral and nonviral uveitis, while most previous studies investigated elevated iop among groups of patients with a specific etiology of uveitis [6, 10, 20, 21, 27, 28 ]. the patients of the viral group were older than the patients in the nonviral group. indeed, the mean age for viral uveitis was 50.6 years while it was 34.7 years for nonviral causes., who compared rv with hsv and vzv and found that rv appeared in younger patients compared to hsv and vzv while miserocchi. also reported that the age was similar for hsv and vzv. a major issue of hypertensive uveitis is to evaluate the relative role or inflammation and corticosteroid - response in the elevation of iop. in this series, 30 patients (49.2%) had elevated iop before the use of topical steroids drops. this means that, at least, half of the uveitis with elevated iop were not related to the use of topical corticosteroid. among these patients, there was no significant difference in iop between viral and nonviral group. when all the 61 patients were evaluated, the mean value of the first elevated iop and the mean highest value of iop appeared to be significantly higher in the group of patients with a viral uveitis as compared with the patients with nonviral uveitis. however these values were not significant anymore when limited to the measurements of the 30 patients with elevated iop before the use of topical corticosteroids. this might indicate that patients with viral and nonviral uveitis have comparable iop or that the series limited to 30 patients was too little to show significant differences. to our knowledge very few authors previously reported intraocular pressure values ; most of them defined a limit beyond which the uveitis is defined as hypertensive but did not analyze iop values. values of high iop have been reported recently in cmv uveitis ; park. reported an average maximal iop of 33.9 in cmv uveitis which is similar to our values before corticosteroids (32.75) while the average maximal iop was 47.3 mmhg among all our group of patients of cmv uveitis. our results in fuchs uveitis with an average iop of 36.32 mmhg at baseline and 40.28 mmhg as average maximal iop with one patient who had a filtering surgery (16.67%) support the study of bouchenaki and herbort who reported a lower rate of filtering surgery in fuchs uveitis compared with the other etiologies of uveitis. unfortunately we can not compare our values with their iop values because we only analyzed the hypertensive uveitis and not the hypertensive uveitis among all uveitis cases [28, 30 ]. iop could be successfully lowered under 25 mmhg in most patients in both groups (97.2% and 84%) and 24.6% of the patients underwent a glaucoma surgery (9 in the nonviral group and 6 in the viral group). the glaucoma surgery rate varies among studies : sungur. found only 2.6% (2 patients) of surgeries among viral hypertensive uveitis cases but this study was evaluating all patients with and without hypertensive uveitis, and their patients had herpetic keratouveitis rather than anterior uveitis without active keratitis. and if we report their 2 patients among their hypertensive cases, the rate of surgeries becomes 5.56%. sallam. found 14.5% of surgeries among elevated iop uveitis cases. a clear glaucoma occurred in 24.6% of our patients with hypertensive uveitis without significant differences between viral and nonviral uveitis. found 18 to 30% of glaucoma in viral uveitis with a lower rate of glaucoma in rv with clinical signs of fuchs uveitis compared to in herpetic uveitis. found 13.1% of glaucoma in viral uveitis, but again this was a group of keratouveitis. our percentage is slightly higher but this can be explained by the design of our study evaluating only hypertensive uveitis which increased the risk to develop glaucoma compared with a group of uveitis including nonhypertensive as well as hypertensive uveitis. detection of glaucoma may be influenced by uveitic changes, uveitis may affect the visual field and inflammatory optic disc swelling may also obscure the assessment of glaucomatous optic disc. therefore, as recently suggested by din., oct of the optic nerve had been preferentially evaluated for glaucomatous retinal rnfl changes in our patients with uveitis during quiescent periods to reduce the masking effect of rnfl thickening associated with active uveitis. although the two groups were comparable concerning the gender, the length of follow - up, and the number of patients, the two groups were not totally comparable since the age of patients was significantly different with 35.7 years for the nonviral group and 50.6 years in the viral group (p = 0.014) but this appears to be a characteristic of viral uveitis. on the other side, some authors found younger patient in fuchs uveitis and also in cmv uveitis while lymphoma and sarcoidosis are especially known to occur in older patients [6, 8, 32, 33 ]. this retrospective study evaluates the evolution of iop in hypertensive uveitis and provides in addition a comparative approach of viral and nonviral hypertensive uveitis. we found an older age and a higher number of unilateral cases in viral hypertensive uveitis compared with nonviral cases. half of the patients had the first episode of hiop before the use of corticosteroids. a higher initial and maximal elevated iop value in viral hypertensive uveitis compared with nonviral cases might also be possible. the risk to develop glaucoma in hypertensive uveitis is important and comparable in both groups. | purpose. to review the clinical outcome of patients with hypertensive uveitis. methods. retrospective review of uveitis patients with elevated intraocular pressure (iop) > 25 mmhg and > 1-year follow - up. data are uveitis type, etiology, viral (vu) and nonviral uveitis (nvu), iop, and medical and/or surgical treatment. results. in 61 patients, iop values are first 32.9 mmhg (sd : 9.0), highest 36.6 mmhg (sd : 9.9), 3 months after the first episode 19.54 mmhg (sd : 9.16), and end of follow - up 15.5 mmhg (sd : 6.24). patients with vu (n = 25) were older (50.6 y/35.7 y, p = 0.014) and had more unilateral disease (100%/72.22% p = 0.004) than those with nvu (n = 36). thirty patients (49.2%) had an elevated iop before topical corticosteroid treatment. patients with viral uveitis might have higher first elevated iop (36.0/27.5 mmhg, p = 0,008) and maximal iop (40.28/34.06 mmhg, p = 0.0148) but this was not significant when limited to the measurements before the use of topical corticosteroids (p = 0.260 and 0.160). glaucoma occurred in 15 patients (24.59%) and was suspected in 11 (18.03%) without difference in viral and nonviral groups (p = 0.774). conclusion. patients with vu were older and had more unilateral hypertensive uveitis. glaucoma frequently complicates hypertensive uveitis. half of the patients had an elevated iop before topical corticosteroid treatment. |
chorea may be the manifestation of a wide variety of degenerative, vascular, metabolic, or toxic disorders involving the central nervous system, in which dysfunction of the basal ganglia, particularly of the striatum, is generally assumed to be responsible. we report an index case of generalized chorea secondary to the ingestion of propiconazole toxin (fungicide) in a young female. in this case, the patient was a 35-year - old lady who was a known case of primary juvenile myoclonic epilepsy, on treatment with valproate (800 mg / day) for 7 years. she was found in unconscious state at home by the family, who then took her to the emergency department of another facility. in view of prior history of epilepsy, three days later, due to persistent unresponsive neurological condition, she was referred to our tertiary care hospital for further management. at admission, her glasgow coma scale was e2m5v1, with bilateral small - sized pupils (2 mm, reacting), heart rate of 64/min, blood pressure 90/60 mmhg on inotropic support with norepinephrine 2 g / kg / min and dopamine 8 g / kg / min. blood biochemistry and metabolic profile were normal with total leukocyte count-12,000/mm, rbs-85 mg / dl, blood and urine culture were sterile. electroencephalogram was done to rule out status epilepticus while the patient was on valproate (blood level-80) and no sedatives. magnetic resonance imaging (mri) brain with contrast, and cytological and biochemical analysis of cerebrospinal fluid were normal. on day 3 of her illness when inotropes had been tapered, her heart rate was in the range of 5058/min. bradycardia (even with inotropic support) along with small - sized pupils raised the suspicion of intoxication. furthermore, relatives were redirected to look for any evidence of suspicious compound at home. cholinesterase levels were very low (134) along with an empty bottle of propiconazole toxin (fungicide) found at home, confirming the diagnosis of intoxication. however, on the 9 day of her illness, she developed irregular random flowing movements from one part of the body to another, suggesting generalized chorea [video 1 ]. a detailed family history was not positive for any chorea / choreiform movements suggestive of inherited degenerative disorders. the patient was extensively evaluated for other acquired cause of chorea, but her hematological investigations including peripheral blood film, biochemical, thyroid function, serum valproate levels, and vasculitic workup were negative and repeat mri brain and computed tomography ct abdomen were also normal. she was treated with clonazepam (2 mg), tetrabenazine (75 mg), and risperidone (2 mg) with partial improvement in chorea. our case depicts initial diagnostic dilemma, which is frequent problem in intoxication as history is often concealed. hence, insecticide poisonings are relatively a common occurrence with wide spectrum of neurological presentations which may affect the function of the central and peripheral nervous system. clinical manifestations vary greatly, and include movement disorders such as secondary parkinsonism and a wide range of hyperkinetic disorders and even delayed neuropathy. propiconazole is the triazole class of fungicide and is available as an emulsifiable concentrate ready - to - use liquid [figure 1 ]. it is also known as dmi or demethylation - inhibiting fungicide, due to its binding with and inhibition of 14-alpha - demethylase enzyme. to the best of our knowledge, this is the index case of generalized chorea following intoxication with propiconazole (fungicide). the probable mechanism may be excessive acetylcholine activity in the nigrostriatal system due to inactivation of acetylcholinesterase by propiconazole. within the nigrostriatal network, caudate nucleus and globus pallidus are particularly rich in cholinergic neurons causing less inhibition of pallidothalamic fibers and generalized choreiform movements. chemical structure of propiconazole (c15h17cl2n3o2) the neurological manifestation with propiconazole intoxication is not reported in literature. only few cases of extrapyramidal manifestations following cholinergic intoxication secondary to organophosphate poisoning (opc) have been described. in the three cases described by joubert., the extrapyramidal manifestations were limited to choreiform movements. although exact mechanism of action of propiconazole is not clear, but circumstantial evidence, low cholinesterase levels, and response to anticholinergic treatment sufficiently support our diagnosis. with delayed development of generalized chorea as neurological sequelae, propiconazole may be added as another compound in the causal list of toxic chorea widening the spectrum of acquired toxic causes of chorea still further. in a country like ours, where poisonings are frequent exposure to toxic agents | chorea is a rare manifestation of poisoning. we report an index case of a young woman who developed generalized chorea following propiconazole toxin ingestion. as large series on neurological complications of toxic compounds are difficult to be compiled, it is of interest to report our experience. this report adds one more compound to the increasing list of toxic chorea. |
the metabolic syndrome (mets) was first described by kylin, a swedish physician, in 1923 as a clinical association between hypertension and gout. he described it as syndrome x which is a constellation of insulin resistance, hyperglycemia, hypertension, low high - density lipoprotein cholesterol (hdl - c), and increased very - low - density lipoprotein (vldl) and triglyceride (tg) levels. it is considered the main threat for public health in the 21 century with its associated risk of cardiovascular disease. several definitions for mets have been put forward by different expert bodies such as world health organization (who), european group for study of insulin resistance (egir), national cholesterol education program (ncep), american association of clinical endocrinologist (aace), national heart, lung, and blood institute / american heart association, and international diabetes federation (idf). in 2005 idf the main emphasis is on central obesity defined by waist circumference : waist circumference (wc) in europids 94 cm and in asians > 90 cm. and there should be two or more of the following four factors : elevated tg 1.7 mmol / l (150 mg / dl), reduced hdl - c < 1.03 mmol / l (< 40 mg / dl), elevated blood pressure (bp) systolic 130 mmhg, diastolic 85 mmhg (or treatment), and dysglycemia (raised fasting plasma glucose, fbg 5.6 mmol / l (100 mg / dl) (or type 2 diabetes mellitus, dm). a new joint statement from a number of professional organizations such as idf, the national heart, lung, and blood institute (nhlbi), who, the international atherosclerosis society, and the american heart association (aha) has identified specific criteria for the clinical diagnosis of the metabolic syndrome. patients with three of the five criteria (elevated wc, elevated tgs, reduced hdl - c levels, elevated bp and elevated fbg levels) are considered to have ms. prevalence of mets : it is estimated that around 20 - 25% of the world 's adult population have the metabolic syndrome. in the united states the prevalence of mets is 34.5% based on the ncep definition and 39.0% based on idf definition. even in children and adolescents it has been reported in up to 9%. in north india the prevalence of mets was reported to range from 31.6% to 49.2% of the urban population using ncep atp iii / modified ncep atp iii guidelines.[1518 ] two studies from urban north india reported the prevalence of mets ranging from 35.8% to 38.5% by ncep atp iii criteria, 45.3% by modified ncep atp iii criteria and 39.5% to 47.4% by idf criteria. in south india the prevalence has been reported in the range of 18.3 - 41% using ncep atp iii guidelines. in an urban population of south india the prevalence of mets ranges from 18.3% by ncep atp iii criteria, 23.2% by who criteria and 25.8% by idf criteria. another two studies showed a prevalence of 29.7 - 41.3% using idf guidelines. using who criteria a higher prevalence of 46.4% the prevalence is reported in the range of 19.5 - 35.2% using different criteria. in a rural population of central india it is seen in around 9% by modified atp iii criteria. in sub - himalayan region of eastern india, abdominal obesity has been associated with low t in both cross - sectional and longitudinal studies, and low t concentration correlates with greater visceral fat accumulation. testosterone normally inhibit adipocyte development but in states of low t there is greater fat mass. visceral obesity causes increased inflow of free fatty acids into the liver and perturbs metabolism. obesity is associated with increased inflammatory cytokine production, as well as increased aromatization of t to estradiol in peripheral fat tissue. both of these factors then decrease the pituitary production of gonadotropins, which, in turn, decreases testicular production of t. the increased level of leptin in obese individuals may interfere with luteinizing hormone / human chorionic gonadotropin stimulation of androgen production, thereby decreasing t levels. testosterone deficiency leads to increased fat deposition resulting in insulin resistance. in states of low t muscle biopsy as up to 70% of the body 's insulin sensitivity is accounted by muscle, low t leads to insulin resistance. hyperinsulinemia, as encountered in insulin resistance, might impair t secretion by the leydig cell may be directly since there are insulin receptors on the leydig cell. it has also been found in obese men that there is an attenuated pulse amplitude of luteinizing hormone (lh) while the lh pulse frequency is unaffected, thus producing a less strong stimulation of testicular t production. although there are a number of publications showing the association of t and mets in females,[4556 ] in this review we will restrict to the association in males. the frequency of mets is increased with declining tertiles of total t (tt). and an inverse relationship for circulating t, bioavailable t, sex - hormone binding globulin (shbg), and dehydroepiandrosterone sulphate (dhea - s) is also seen with mets. the quebec family study found higher levels of t reduced the risk of metabolic syndrome and increased insulin sensitivity. in a finnish study of 1896 nondiabetic middle - aged men, free t and shbg were 11% and 18% lower in men with mets. men with metabolic syndrome at baseline are at an increased risk of developing hypogonadism based on an 11-year follow - up. in another finish study of 702 middle - aged men who had neither diabetes nor the metabolic syndrome, after 11 years of follow - up after adjustment for age men with total t, calculated ft, and shbg levels in the lower fourth had a severalfold increased risk of developing the metabolic syndrome and diabetes. in a population - based sample of 462 older italian men with mean age of 75 years, after adjusting for multiple confounders, including age, smoking, alcohol intake, and physical activity, tt was found to be negatively associated with mets. the massachusetts male aging study has demonstrated that low t levels in a nonobese population were found to predict the later onset of the metabolic syndrome particularly among men with a bmi < 25 kg / m. in the baltimore longitudinal study of aging of 618 healthy caucasian adult men with a mean age of 63 years alone total t and shbg were inversely related to the development of mets over a mean follow - up period of 5.8 years. a cross - sectional study from australia involving 2502 community dwelling men aged 50 - 70 years without known diabetes reported that men with hypogonadotrophic hypogonadism have a high prevalence of metabolic syndrome. the risk of metabolic syndrome increased for total t<20 nmol / l, shbg<50 nmol / l, and free t<300 pmol / l. in study of health in pomerania (ship), which is a population - based prospective cohort of adults aged 20 - 79 years without baseline mets, after a median follow - up time of 5.0 years 47.8% developed mets. with increasing number of mets components t levels decreased. testosterone in the lowest quartile predicted mets particularly among men aged 20 - 39 years. data from the third national health and nutrition examination survey showed that after adjustment for age, race / ethnicity, smoking status, alcohol intake, physical activity level, ldl -c, crp, and insulin resistance, men with lower total testosterone were more likely to have metabolic syndrome than men with higher t (p<0.001 for linear trend). similarly, men with lower shbg were more likely to have metabolic syndrome than men with higher shbg (p=0.02 for linear trend). in a study of 63 males with mets total and calculated ft and shbg were significantly lower in cases with mets than controls. hypogonadism was seen in 30% cases with mets compared to 3.1% in controls [table 1 ]. the various studies which reported the difference in the serum testosterone level in normal subjects and those with mets in a meta - analysis of 20 studies, patients with mets showed significantly lower comparison of data using ncep atp iii criteria and other mets classifications reveals the same. lower baseline t was demonstrated among patients with incident mets compared to controls in longitudinal studies. in another meta - analysis of 52 observational studies comprising 22,043 men and 7839 women, endogenous tt and ft levels were lower in men with mets and higher in women with mets. similarly, men with higher tt levels had a lower mets risk whereas higher tt levels increased the risk of mets in women. in both sexes, higher shbg levels were associated with a reduced risk. although various studies have shown that lower t levels may be associated with mets and type 2 dm, both conditions associated with cardiovascular disease, reverse causation has to be considered, as systemic illness may result in reduced t levels. thus, the strength of these associations and the likely direction of causation need to be carefully considered. in the telecom study, there appeared to be an association of t and cardiovascular risk factors in healthy, nondiseased adult men. serum tg, tc, ldl - c, apolipoprotein b, fasting, and 2-hour plasma insulin were higher and serum hdl - c was lower in men with lower serum t levels. total and ft and shbg were inversely associated with concentrations of insulin, glucose, tg, c - reactive protein (crp), and crp - adjusted ferritin and positively associated with hdl - c. low tt and ft levels were associated with high levels of insulin, glucose, and tg and low levels of hdl - c. in the tromso study, t levels were inversely associated with anthropometrical measurements with the lowest levels of total and free t found in men with the most pronounced central obesity. total t was inversely associated with systolic blood pressure, and also men with hypertension had lower levels of both total and free t. furthermore, men with dm had lower t levels compared to men without a history of dm, and an inverse association between t levels and hba1c was found. a strong association of mets with sex hormones was observed for tg higher than 150 mg / dl and wc more than 102 cm and a modest with hypertension. increased odds of low hdl - c < 40 mg / dl were observed with lower tt levels and shbg but not with ft. further adjusting for bmi, observed associations of sex hormones and mets were attenuated but remained statistically significant with the exception of the associations observed with hypertension. total t was positively associated with hdl - c but not with other components of mets. log shbg is positively associated with hdl - c, negatively associated with tg and wc, but not associated either way with bp or bg levels. bioavailable t was significantly associated with abdominal obesity and marginally associated with high blood pressure. tt was also shown to be associated with all except hypertension, and free t was associated only with wc and tg. in a study of middle - aged japanese men, t was significantly related to the mets parameters of obesity (wc and bmi), hypertension, dyslipidemia, insulin resistance, and adiponectin. there are studies from special groups of patients where hypogonadism is a feature due to pharmacotherapy, which strengthens opinion that t deficiency is a risk factor for the development of mets and type 2 dm, and is an independent cardiovascular risk factor. a small study showed that initiation of gnrh agonist or antiandrogen therapy in 22 men with prostate cancer led to increases in serum insulin, arterial stiffness, and fat mass over the subsequent 3-month period. braga - basaria. evaluated 58 men, including 20 with prostate carcinoma undergoing androgen deprivation therapy for at least 12 months. the prevalence of mets was higher in the androgen deprivation group compared with the nonandrogen deprivation group and control groups. men in the androgen deprivation group had a higher prevalence of abdominal obesity and hyperglycemia. androgen - deprived men also had elevated tg compared with controls but the prevalence of hypertension and low hdl levels were similar. a longitudinal study followed a large population of 73,196 men with loco - regional prostate cancer followed for a median of 4.55 years. those treated with androgen suppression therapy were more likely to develop diabetes, ischemic heart disease, myocardial infarction, and sudden death from cardiovascular disease compared with those patients untreated or treated with other modalities. similarly, a study of 396 men with prostate cancer undergoing androgen - deprivation therapy showed worsening glycemic control with an increase in hba1c and an increased incidence of new onset of diabetes. another study has shown increased risk of mets with chemotherapy compared with radiotherapy for testicular cancer. metabolic syndrome was positively associated with cumulative cisplatin, bleomycin, and etoposide doses but not with cumulative vinblastine dose. logistic regression using a backward stepwise model with all four chemotherapy agents and age included, revealed cumulative cisplatin dose as significant variables. one of the earliest studies reporting the effect of trt on obesity was by rebuffescrive. in 1991 in a small group of 11 men where it was found that waist - hip ratio decreased in 9 out of 11 men after 6 weeks of testosterone replacement. recently, there have been a number of studies published investigating the effect of trt in men primarily with type 2 dm and mets. marin and colleagues were the first to report a significant reduction in diastolic blood pressure after trt in obese middle - aged men, along with a reduction in visceral fat, fbg, tg, and total cholesterol. in a study of 122 men receiving treatment with parenteral t undecanoate over 15 months, both systolic and diastolic blood pressure decreased. a single - blind randomized study of t administration to men with mets and recent onset of dm established also beneficial effects of testosterone on blood pressure over and above the effects of diet and exercise. in men with osteoporosis intramuscular t for 6 months showed significant reduction in diastolic blood pressure along with total cholesterol, tgs, and hdl - c. reported a study of 48 type 2 diabetic men with symptoms of androgen deficiency in an open - label, randomized treatment undertaken over 3 months. testosterone treatment resulted in significant reductions in weight, whr, and percentage body fat compared with no treatment. fasting blood glucose and postprandial blood glucose levels were also reduced significantly, and hba1c fell by 1.8% (p<0.05). this study provides the first evidence that testosterone treatment may offer clinical benefit to men with type 2 diabetes. in the first double - blind placebo - controlled study by kapoor. with 24 patients of type 2 dm and clinical diagnosis of hypogonadism, t treatment resulted in a significant improvement in the homa - ir index in those patients not on insulin therapy and resulted in insulin dose reduction by an average of 7 units per day in those patients recieving insulin. statistically significant reductions in both fbg (28.4mg / dl) and fasting insulin were observed, with hba1c falling by 0.4% (p=0.03). testosterone treatment also resulted in statistically significant improvement in wc, whr, and total cholesterol although there was no significant effect on hdl - c, ldl - c, tgs, or blood pressure. heufelder. investigated the effects of trt in 32 hypogonadal men with newly diagnosed, treatment - naive type 2 dm with mets in a 52-week single - blind, randomized but not placebo - controlled study, with either diet and exercise advice alone, or diet and exercise advice in conjunction with 50 mg t gel once daily. compared with diet and exercise alone, t treatment resulted in a statistically significant improvement in hba1c of 0.8% (p<0.001), with all patients attaining an hba1c of < 7.0% and 87.5% of patients attaining an hba1c < 6.5%. there was also a statistically significant reduction in the homa - ir index, although the observed treatment - mediated reduction in fpg (5.4 mg / dl) narrowly failed to achieve statistical significance (p=0.06). testosterone treatment was associated with a statistically significant reduction in serum tg and a statistically significant increase in serum hdl - c. in another study, there were declines in plasma total cholesterol, ldl - c, and tg, whereas plasma hdl - c showed an increase. a large multicenter, randomized, double - blind, placebo - controlled study undertaken in eight european countries, the times2 (testosterone replacement in men with metabolic syndrome or type 2 diabetes), recruited 220 hypogonadal men diagnosed with either type 2 dm and/or mets (defined according to the idf criteria) with no trt within the previous 6 months. insulin resistance (homa - ir) improved after 6 and 12 months of therapy. testosterone therapy was also associated with reductions in the percentage of body fat, tc, and ldl - c and lipoprotein (a) after 6 months but there was no significant effect on hdl - c or tg. one of the earliest studies reporting the effect of trt on obesity was by rebuffescrive. in 1991 in a small group of 11 men where it was found that waist - hip ratio decreased in 9 out of 11 men after 6 weeks of testosterone replacement. recently, there have been a number of studies published investigating the effect of trt in men primarily with type 2 dm and mets. marin and colleagues were the first to report a significant reduction in diastolic blood pressure after trt in obese middle - aged men, along with a reduction in visceral fat, fbg, tg, and total cholesterol. in a study of 122 men receiving treatment with parenteral t undecanoate over 15 months, a single - blind randomized study of t administration to men with mets and recent onset of dm established also beneficial effects of testosterone on blood pressure over and above the effects of diet and exercise. in men with osteoporosis intramuscular t for 6 months showed significant reduction in diastolic blood pressure along with total cholesterol, tgs, and hdl - c. reported a study of 48 type 2 diabetic men with symptoms of androgen deficiency in an open - label, randomized treatment undertaken over 3 months. testosterone treatment resulted in significant reductions in weight, whr, and percentage body fat compared with no treatment. fasting blood glucose and postprandial blood glucose levels were also reduced significantly, and hba1c fell by 1.8% (p<0.05). this study provides the first evidence that testosterone treatment may offer clinical benefit to men with type 2 diabetes. in the first double - blind placebo - controlled study by kapoor. with 24 patients of type 2 dm and clinical diagnosis of hypogonadism, t treatment resulted in a significant improvement in the homa - ir index in those patients not on insulin therapy and resulted in insulin dose reduction by an average of 7 units per day in those patients recieving insulin. statistically significant reductions in both fbg (28.4mg / dl) and fasting insulin were observed, with hba1c falling by 0.4% (p=0.03). testosterone treatment also resulted in statistically significant improvement in wc, whr, and total cholesterol although there was no significant effect on hdl - c, ldl - c, tgs, or blood pressure. investigated the effects of trt in 32 hypogonadal men with newly diagnosed, treatment - naive type 2 dm with mets in a 52-week single - blind, randomized but not placebo - controlled study, with either diet and exercise advice alone, or diet and exercise advice in conjunction with 50 mg t gel once daily. compared with diet and exercise alone, t treatment resulted in a statistically significant improvement in hba1c of 0.8% (p<0.001), with all patients attaining an hba1c of < 7.0% and 87.5% of patients attaining an hba1c < 6.5%. there was also a statistically significant reduction in the homa - ir index, although the observed treatment - mediated reduction in fpg (5.4 mg / dl) narrowly failed to achieve statistical significance (p=0.06). testosterone treatment was associated with a statistically significant reduction in serum tg and a statistically significant increase in serum hdl - c. in another study, there were declines in plasma total cholesterol, ldl - c, and tg, whereas plasma hdl - c showed an increase. a large multicenter, randomized, double - blind, placebo - controlled study undertaken in eight european countries, the times2 (testosterone replacement in men with metabolic syndrome or type 2 diabetes), recruited 220 hypogonadal men diagnosed with either type 2 dm and/or mets (defined according to the idf criteria) with no trt within the previous 6 months. insulin resistance (homa - ir) improved after 6 and 12 months of therapy. testosterone therapy was also associated with reductions in the percentage of body fat, tc, and ldl - c and lipoprotein (a) after 6 months but there was no significant effect on hdl - c or tg. there is a strong evidence of a high prevalence of mets in patients with a low t level. there are reports of high prevalence of t deficiency in patients with type 2 dm. early interventional studies have shown that trt in hypogonadal men with mets has beneficial effects on central adiposity, insulin resistance, and glycemic control. there are consistent data regarding beneficial effect on blood pressure, tg, or hdl - c. furthermore testosterone replacement in several studies has been shown to have a small but significant effect in reducing cholesterol and ldl - c, also important cardiovascular risk factors. whether low t is just a biomarker of the degree of illness or a contributory factor to the progression of atherosclerosis is unclear. accumulating evidence now suggests that t deficiency is a risk factor for cardiovascular disease and intervention may ameliorate the process. there is a need for long - term interventional study to examine the effect of t on cardiovascular disease in men with mets and/or type 2 dm. | metabolic syndrome (mets) or syndrome x which is a constellation of insulin resistance, hyperglycemia, hypertension, low high - density lipoprotein cholesterol (hdl - c), and increased very - low - density lipoprotein (vldl) and triglyceride (tg) levels. it is one of the main threats for public health in the 21st century with its associated risk of cardiovascular disease. this condition affects a major chunk of mankind. international diabetes federation (idf) estimated that around 20 - 25% of the adult population of the world has mets. several definitions have been put forward by different expert bodies leading to confusion. to overcome this, joint new statement of many expert group have been issued. serum testosterone (t) has been shown to be associated with mets. several studies have shown a higher prevalence of mets in subjects with low testosterone. there are also several studies showing a significant difference in serum t between those with mets and those without. serum t has also been shown to be associated with components of mets and testosterone replacement therapy (trt) improves various metabolic and anthropometric parameters in mets. patients with androgen deprivation for treatment of various cancers have also been reported to have higher prevalence of mets. but the evidence of association is not sufficient evidence for the causation of mets by low testosterone and long - term studies are needed to confirm whether t deficiency is the cause or is a feature of mets. |
surgical management of displaced subcapital fractures of the femoral neck continues to be challenging. internal fixation, hemiarthroplasty, and total hip replacement could be considered as appropriate solutions. for internal fixation, most orthopaedic surgeons choose either a dynamic hip screw (dhs) or multiple cannulated screws (mcs). osteosynthesis with mcs fixation is a less invasive technique and reduces blood loss and soft tissue stripping [13 ]. with the use of dhs published a biomechanical comparison of internal fixation techniques for the treatment of unstable basicervical femoral neck fractures. its disadvantages are large skin incisions, more extensive soft tissue dissection, a greater need for blood transfusion, and a longer stay in hospital. in a cross - sectional survey using a regressive analysis, bhandari. suggested that surgeons in europe were more likely to indicate a dhs device over mcs than north american surgeons. defended the use of only two cannulated screws in nondisplaced femoral neck fractures but suggested dhs, as a more stable implant, for garden iii - iv fractures., after reviewing 90 fractures, concluded that dhs showed a trend for an increased rate of overall success in elderly patients with nondisplaced femoral neck fracture compared with mcs. there are few published reports focusing on dhs in the treatment of femoral intracapsular displaced neck fractures. they reviewed 25 randomized trials and concluded that most studies have had an insufficient number of subjects to permit a valid comparison.. found overall failure in 15.9% of cases using mcs and in 2.5% of cases using dhs. chen., using dhs in extracapsular basicervical neck fractures, achieved union in 97.5% of their patients, with no cases of avascular necrosis and 1.7% of nonunion. osteosynthesis not only has the potential to offer normal hip function after fracture consolidation but also has a relatively high rate of failure and complications in the form of nonunion, avascular necrosis, redisplacement, and so forth. the purpose of the present study was to correlate the incidence of avascular necrosis following treatment with the dhs with patient demographics, time elapsed from the fracture to surgery, quality of reduction, garden 's classification, and the position of the screw in the head. the present study prospectively evaluated 96 patients who had subcapital fractures of the femoral neck and were assigned to close reduction and internal fixation with dhs. the inclusion criterion was subcapital fractures of the femoral neck and not tumoral ones, whereas exclusion criteria were bad quality x - rays pre- or postoperatively, more than a week since fracture, comminuted fractures, dislocated fractures classified as garden iii and iv in patients older than 75 years, rheumatoid arthritis and metabolic diseases (including osteoporosis singh stage iii or less), and incomplete records. we prospectively followed 128 patients, but 32 cases were excluded from the final analysis according to the exclusion criteria. four patients died but were still included, because they died 3 years, 4 years and 6 months, 8 years, and 7 years, respectively, after the onset of fracture. all surgeries were performed by closed reduction, on a standard fracture table assisted by fluoroscopy. if the fracture was incompletely reduced, small incremental increases in both traction and internal rotation were subsequently performed, checking the position after each adjustment. a standard internal fixation with a 135 dhs was used, varying the number of screws and length of the plate as required. reduction was judged on both the anterior - posterior (ap) and lateral views. the junction of the convex femoral head and neck should produce an s - shaped curve in all planes. a valgus reduction is inherently more stable, whereas a varus reduction is associated with a much higher risk of fixation failure. what constitutes an acceptable reduction is debatable, and arnold recommended that there should be less than 20 degrees of posterior angulation to minimize the risk of fixation failure. garden described an alignment index to measure the quality of reduction, which was used in the present work. demographics, age at the onset of fracture, trauma mechanism, garden 's classification, associated fractures, time elapsed to surgery, american society of anaesthesiologists ' (asa) criteria, baumgaertner index, and hospital discharge were evaluated. the tip - apex distance (tad) of all lag screws was measured, as described by baumgaertner., and the position of the screw in the head was classified in the anterior - posterior projection as high, middle, or low. the same was done in the lateral projection, classifying the position as anterior, central, or posterior. the accepted definition of union was the development of a well - established trabecular pattern across the fracture site within 6 months following the date of injury. avascular necrosis of the femoral head was diagnosed based on progressive pain with the classic mottled appearance, increasing radiodensity, segmental collapse, and degenerative changes. the fisher method of statistical analysis was used to correlate all possible positions of the screw in the head with avascular necrosis. table 1 presents the characteristics of the 96 patients. there were 56 (58%) males and 40 (42%) females with an overall mean age at the onset of fracture of 53 years (14), ranging from 18 to 70 years. sixteen (16%) had fallen from height and three (3%) were victims of automobile traffic trauma. with respect to garden 's classification for femoral neck fractures, 58 (60%) were identified as garden iv, 25 (26%) were garden iii, and 13 (14%) were garden ii. fifty patients (52%) had fractures of the right hip and 46 (48%) of the left one. eleven patients had associated fractures : three distal radius fractures, three rib fractures, two ankle fractures, two proximal humeral fractures, and one tibial shaft fracture. only one (1%) patient was operated on in the first 24 hours. fifty - five (57%) patients were operated on between 24 to 72 hours after fracture. when considering clinical conditions, 68 (71%) were considered asa i (normal healthy) and 28 (29%) were asa ii (mild systemic disease). the dhs plate was fixed with two screws in five patients (5%), while three screws were used in 61 patients (64%), and four screws in 30 patients (31%). good reduction was obtained in 94 (98%) of the patients, which means normal or slightly valgus reduction. the average hospital discharge was 9 days. the greatest penetration into the femoral head for the lag screw of the dhs was 66 mm, whereas the least penetration was 31 mm, with an average of 42.3 mm. the mean tad was 16 mm (ranging from 11 to 24 mm). a satisfactory union was achieved in 80 patients, with a failure rate of about 20%. three patients failed to show union after 6 months (3%) and presented criteria justifying surgical reintervention. in these cases, the radiographs showed no radiological signs of consolidation, with resorption of the fracture, pain, and synthesis failure. all of these nonunions were treated with a valgus intertrochanteric osteotomy, all of them achieving successful healing. sixteen cases of avascular necrosis were observed (16%), ten of which were classified as ficat 3 and six as ficat 4. most of our patients (58% ; 56/96) were operated on in the first 72 hours. however, a substantial number was operated on after 72 hours (42% ; 40/96). the percentage of osteonecrosis in the latter group was 23% (9/40), being almost double that of the former (13% ; 7/56). four fractures healed with shortening of the femoral neck of less than 15 mm. we also analysed the screw position based on all nine possibilities presented in figure 1 for the ap and lateral projections (see also table 2) and correlated them with osteonecrosis. the most frequent position was middle (ap) and central (lateral view), as observed in 47 patients (49%), with four cases of osteonecrosis (9% ; 4/47). the combination high (ap) and anterior (lateral) was observed in eight fractures (8%) and five of these patients developed osteonecrosis (63% ; 5/8). this was the only statistically significant association between screw placement and osteonecrosis (p = 0.0029, using fisher 's correction). regarding the d ' aubign and postel score, sixty patients (63%) scored 18 points, 18 (19%) scored 17 points, and 18 (19%) scored less than 17 points. we correlated age, gender, side, time elapsed until surgery, garden 's classification, and quality of reduction with avascular necrosis and no statistical differences were found, but when we analysed the position of the screw in the femoral head we found a significant correlation between necrosis and the high, anterior position (p = 0.003). the treatment of displaced femoral neck fractures has been debated for many years. the main question during decision making is whether to fix or replace the femoral neck. many recently published papers have shown that a primary total hip replacement is superior to internal fixation for the treatment of displaced femoral neck fractures when performed in a relatively healthy and mentally competent elderly patient [5, 7, 1820 ]. however, the optimal treatment for a young or adult patient under 70 years old is controversial, as the younger the patient is, the more the orthopaedic surgeon is obliged to pursue internal fixation. there are many factors that could influence the decision : the preinjury functional status regarding gait, mental ability, and habitat, but the most important consideration is probably the difference between chronological and biological age. criticisms against internal fixation are due to its association with high rates of failure due to loss of fixation, osteonecrosis, and nonunion. nevertheless, when a femoral head heals over the neck, the patient has the chance of regaining his physiologically normal hip. lu - yao. published a meta - analysis of 106 published reports and concluded that the rate of loss of fixation or reduction after open reduction and internal fixation (orif) is about 16% (927%), which is significantly higher than the risk of dislocation after hemiarthroplasty (2%) or total hip replacement. tronzo identified more than 100 different available implants for orif of femoral neck fractures. however, if a surgeon chooses orif, he basically must decide between two consecrated techniques : multiple cannulated screws (mcs) or a dynamic hip screw (dhs). several studies have attempted to identify predictive factors of failure in femoral neck fracture treatment. there is little agreement among these studies regarding which fractures are more likely to fail because they analysed both displaced and nondisplaced fractures, different clinical and radiological factors, different implants for internal fixation, different weight - bearing times, and so forth. the results of osteosynthesis in young patients are debatable by presenting a considerable complication rate. however, there is little doubt that the main complication is the occurrence of osteonecrosis. many variables have been hypothesized to be associated with this complication after femoral neck fractures. the literature does not support differences regarding gender, but high rates of nonunion and avascular necrosis are more common in young adult patients. various explanations have been elaborated, including high energy trauma and its correlation with dislocated fractures in the young adult., while operating on 25 young adults on an ordinary table using the traditional watson - jones approach, described three cases of osteonecrosis (12%). protzman and burkhalter, reviewing 22 fractures in young patients aged under 40 years, found 86% of necrosis. we divided our cases according to age into two main groups : under 50 years (46 fractures) and over 50 years (50 fractures). the incidence of osteonecrosis was 22% (10/46) in the first group and 12% (6/50) in the second one. the author divided the fractures into not displaced (garden i and ii) or displaced (garden iii and iv). in our study, only 13 fractures were considered nondisplaced (14%) and 83 were considered displaced (86%). we did not find any osteonecrosis in the first group, while there was an incidence of 19% (16/83) in the second group (p = 0.12). conn and parker, when evaluating 375 nondisplaced fractures, observed necrosis in 4% (15/375). reviewed 84 cases of nondisplaced fractures and found an incidence of about 10% (8/84). this complication is more frequent. in an extensive meta - analysis, lu - yao observed 13.4% (9/64) after a minimum of 5 years of follow - up. haidukewych found 27% (14/51), and nikolopoulos. found 39.4% in displaced fractures (15 out of 38) after a mean follow - up of 4.7 years. kaplan. recently performed a study comparing open and closed reduction with internal fixation., in their historical paper, describe a long - term follow - up of 1503 subcapital fractures and conclude that the mortality rate increased when operation was delayed beyond 3 days following injury, but no significant difference was found in necrosis or late segmental collapse when delaying the operation up to 1 week. most of our patients were operated on in the first 72 hours (58% ; 56/96). however, a substantial number was operated on after 72 hours : 42% (40/96). the percentage of osteonecrosis in the latter group was 23% (9/40), being almost double that of the former : 13% (7/56). this suggests that it could be worse to fix the fracture more than 72 hours after the fracture 's onset, but no statistical difference was found between operating earlier or later in terms of necrosis (p = 0.41). advocates of early surgery suggest that prompt reduction can produce an unkinking of the proximal femoral vessels, thus leading to intracapsular decompression, restoring the blood flow to the femoral head and minimizing the risk of necrosis [33, 34 ]. other studies confirm that early surgery may decrease the rate of femoral head osteonecrosis [3538 ]. on the contrary, several studies have reported no difference in the rate of osteonecrosis with more than a 24-hour delay. upadhyay. performed a prospective and randomized study of 102 patients, comparing open and closed reduction with internal fixation. time to surgery did not affect the development of osteonecrosis. in a retrospective review of 73 he reported that 25% (17/73) of femoral neck fractures that were treated within 24 hours of diagnosis developed osteonecrosis. twenty percent of the fractures that were internally fixed after 24 hours developed the same complication (4/20). most authors agree that the best position is anatomical reduction or a slight valgus [6, 32, 38 ]. in our study, of the 96 fractures we considered as a good quality reduction, necrosis occurred in 16 cases (16%). there is a consensus that the anterior - superior position should be avoided [8, 16, 32 ]. were probably the first to call attention to the fact that a nail or screw placed too superior and anterior in the femoral head was associated with a considerable failure rate in women (37% in garden iii and 52% in garden iv). however, the present research demonstrates that the incidence of osteonecrosis is correlated with the position of the screw in the femoral head. since barnes 's study, there has been no paper in the literature regarding the position of the screw in relation to avascular necrosis. they were the first to call attention to the association between the anterior - superior position of the screw and worse results. the authors recognize that the present study has a nonrandomized nature, absence of control group, and a small number of patients, but we realize that our findings, although preliminary, are similar in relation to necrosis when comparing to the literature. no statistically significant association was found between gender, time elapsed to surgery, quality of reduction and fracture displacement, and the onset of avascular necrosis of the femoral head. the incidence of osteonecrosis in patients under 50 years was twofold higher than in patients over 50 years of age, but this difference was not statistically significant. the incidence of osteonecrosis was associated with the high and anterior position of the screw in the femoral head. | objectives. to study the correlation between avascular necrosis and the demographics, time elapsed from fracture to surgery, quality of reduction, garden classification, and the position of the screw following use of the dynamic hip screw (dhs) in the treatment of subcapital neck fractures. methods. a prospective study of 96 patients with subcapital neck fractures was carried out in a faculty hospital. patients underwent surgery with closed reduction and internal fixation with dhs. results. there were 58% male and 42% female patients, with a mean age of 53 years (+ /14). in terms of garden classification, 60% were garden iv, 26% were garden iii, and 14% were garden ii. nonunion was observed in three cases (3%) and was treated with valgus intertrochanteric osteotomy, in all cases leading to successful healing. avascular necrosis was observed in 16% of patients. the positioning of the screw into the femoral head showed a significant correlation with necrosis. conclusions. the incidence of necrosis in patients under the age of 50 years is twice as high as that in older patients. displacement is a predictive factor regarding osteonecrosis and is associated with a high and anterior position of the screw in the femoral head. level ii of evidence. study type : therapeutic study. |
neuroendocrine tumors of the lung include atypical and typical carcinoids, large cell neuroendocrine carcinomas and small cell lung carcinomas. typical carcinoids (tcs) and atypical carcinoids (acs) of the lung have rapidly increased in the last 30 years with an incidence of 1.57/100.000 in 2003. tcs are often regarded as benign due to their low proliferation rate (ki-67 < 2%). the treatment of choice is surgery, which can be curative in most cases. although tcs share histologic features with gastroenteropancreatic neuroendocrine tumors (gep - nets), they exhibit a lower tendency to form secondary tumors. tcs express thyroid transcription factor-1 (ttf-1) and cd56, whereas gep - nets do not. despite their low proliferation rate, tcs may recur and metastasize. currently, there are no specific guidelines for preoperative staging or follow - up of typical lung carcinoids. follow - up of these patients is often individualized and somatostatin receptor (sstr) based positron emission tomography (pet)/computed tomography (ct) is rarely performed. bronchoscopy was normal. preceding surgery, a [f]fluorodeoxyglucose (fdg)-pet / ct scan was performed as recommended for staging of pulmonary tumors. figure 1(a) [f]fdg pet / ct located a tumor with low glucose uptake in the lingula. (b) [ga]sstr - pet / ct detected somatostatin receptor positive lesions in the terminal ileum and peripancreatically. (a) [f]fdg pet / ct located a tumor with low glucose uptake in the lingula. (b) [ga]sstr - pet / ct detected somatostatin receptor positive lesions in the terminal ileum and peripancreatically. pathology demonstrated a 12 mm typical carcinoid (ki-67 < 5%, see fig. none of the lymph nodes removed were invaded ; the final staging was pt1 pn0 cm0. after surgery, follow - up was performed every 3 months by ct of the chest. it was noted that tumor marker chromogranin a was increasing in december 2010 and the patient was complaining about recurrent abdominal pain. sstr - pet / ct with [ga]dota - tyr3-octreotide pet / ct ([ga]dotatoc) was performed and demonstrated a tumor in the terminal ileum associated with an enlarged parapancreatic lymph node (fig. a radical right hemicolectomy encompassing lymphadenectomy was performed in february 2011, using gamma probe detection after [ga]dotatoc was given as tracer. pathology revealed a well - differentiated net from the ileocecal valve (size 10 mm, fig. the final union for international cancer control (uicc) staging was pt2, pn1, pm0, g1, l0, v0, r0, pn0. 4c), somatostatin receptor 2a and cdx-2, but negative for ttf1 (fig. 5c) indicating an intestinal origin without any relation to the tc removed 4 years earlier. (d) ttf-1 : lung. (a) net of the ileum (1.0 cm) after ileotomy. this case report describes the occurrence of two non - related well - differentiated nets in a single patient detected within 4 years. the first net demonstrated pathologic features of a pulmonary tc and the second, also a well - differentiated net, originated from the ileocecal valve. the intraoperative exertion of a gamma probe often results in the extension of the planned surgical procedure, especially in an extended lymph node resection. it permits the identification of previously occult metastases and the localization of hidden lymphatic lesions. although little is known about development of second nets in patients without multiple endocrine neoplasia syndromes, follow - up of patients with nets using sstr - pet / ct will help in the detection of tumor recurrence or other non - related nets. in our patient, the second net was only detected by a somatostatin receptor pet / ct 4 years after curative surgery of the tc of the left lung. 5a), it can be assumed that this tumor was already present in 2007, however [f]fdg / pet usually does not detect gep - nets with a low proliferation rate. in our case, after removal, we performed only local staging using thorax ct and bronchoscopy. if the net diagnosis is discovered after surgery, similar to gep - nets, systemic molecular imaging ([ga]sstr - pet / ct or octreotide scintigraphy) must be performed postoperatively. this rules out occult metastases and provides reference imaging for further comparative follow - up studies. however, because of the limited availability of this molecular imaging technique, it does not allow routine staging after surgery. in our opinion, this imaging procedure should be reserved for when increasing levels of biomarkers or clinical symptoms indicate a recurrence. if the net diagnosis is known or presumed preoperatively, accurate preoperative staging and a postoperative comparative study from the resection results are enabled through this imaging technique. this case report illustrates the clinical utility of sstr - pet / ct for the detection and follow - up of patients with nets of the lung and gastroenteropancreatic system. | abstractwell - differentiated neuroendocrine tumors (nets) of the lung occur as typical and atypical carcinoids. little is known about the biology of these tumors in respect of their ability to metastasize or the probability of development of concomitant neuroendocrine tumors. here we report a patient diagnosed with a second neuroendocrine tumor of the ileum 4 years after curative resection of a typical carcinoid of the left lung. the intestinal neuroendocrine tumor was successfully detected by gallium-68 based somatostatin receptor positron emission tomography (pet)/computed tomography (ct) and surgically removed using gamma probe detection based on the same labeling. this case report underlines the utility of somatostatin receptor pet / ct based detection and follow - up of nets. |
to understand how cells read off information from the genome at the right time at the right position, we have to learn the sequence motifs that the regulatory factors recognize and bind to. a large variety of experimental methods yield sequences that are enriched in binding sites of regulatory factors. methods that can discover these enriched motifs have therefore proven to be of great practical importance for modern biological research and a multitude of motif discovery methods have been developed (14). most of the tools can only be run on the command line, making them inaccessible to the majority of biologists. the most popular one is the meme suite server (5), within which the position weight matrix (pwm)-based meme and glam2 motif discovery programs can be run (6,7), alongside several related tools to compare the discovered motifs with libraries of literature motifs and to search for matches to the discovered motifs in sequence databases. with a higher order background model to describe sequences that should not carry the sought motifs, meme has shown state - of - the - art performance (8). to use higher order models, users have to upload their own model file generated using a meme command line tool, which will limit most users to the zero - order model with lower sensitivity. the scope web server combines three pattern - based motif discovery tools, which are specialized to find non - degenerate, degenerate and gapped motifs, into a single prediction using a winner takes all learning rule (9). the reganalyst server runs a motif discovery method that searches for the most enriched patterns using fixed thresholds for the maximum number of allowed mismatches. it was originally developed for mycobacterial and yeast sequences, on which it was reported to have higher sensitivity than scope (10). the webmotifs server takes gene names from human, mouse or saccharomyces cerevisiae as input, extracts promoter sequences, launches four motif discovery programs and displays the results in a uniform format (11). rsat is a web toolbox for regulatory sequence analysis that also offers several simple tools and gibbs sampling for motif discovery (12). finally, amadeus (13) is a software tool with a nicely designed graphical user interface that presents an alternative to these web services. although various published tools can score conservation in multiple sequence alignments of related species and a few can exploit the positional clustering of motifs, to our knowledge, none of the web services offers this useful functionality. in contrast, the xxmotif web server can combine enrichment p - values for pwms with p - values for sequence conservation and for positional clustering of motif occurrences. the binding site motifs of regulatory factors are described either with pwms or with patterns, such as consensus sequences with degenerate iupac characters, sometimes allowing for mismatches (14). a pwm is a statistical model represented by 4 l matrix that has weights for the four bases at each of the l binding sites positions. in contrast to patterns that either do or do not match, a pwm gives a more nuanced description of the binding affinity landscape. from a thermodynamic point of view, a pwm approximates the binding energy under the assumption that each position contributes independently of the others. although it is straightforward to calculate enrichment p - values for patterns, this is more challenging to do for pmws and usually involves time - consuming random sampling. therefore, all pwm - based methods to date have taken a likelihood - based approach for finding enriched pwms. xxmotif is the first pwm - based method to directly optimize the motif enrichment p - value in its pwm stage. xxmotif consists of three stages : a masking stage, a pattern stage, and a pwm stage. in the masking stage, when parts of sequences in the input set are identical or similar over longer regions, this region can give rise to a significant motif even if just these two occurrences are observed. the reason is that the motif is so long and informative that it would be very unlikely to observe even two such motifs by chance. hence, to avoid reporting false motifs stemming from regions of local homology, xxmotif masks regions of local homology found by an all - against - all sequence comparison using blast. for similar reasons, xxmasker also masks perfect repeats of length 50 or more base pairs. in the pattern stage, xxmotif calculates enrichment p - values for seed patterns, consisting of all 5-mers with up to two degenerate iupac characters, and all palindromic and tandemic 6-mer seeds with gaps up to size 11. for each seed pattern, an enrichment p - value is calculated using a binomial distribution and a length- and gap - dependent bonferroni correction factor. for each non - degenerate seed (i.e. without iupac characters), the five most significant matching iupac seed patterns are extended, allowing gaps of up to 3, until the p - value can not be improved anymore. iupac strings are then converted to pwms by counting the nucleotides at each position in the matching sequence segments. in the pwm stage, thousands of candidate pwms are iteratively optimized : similar pwms are merged, and pwms are extended (allowing gaps up to 2) or shortened, until their enrichment p - value can not be improved anymore. enrichment p - values give the statistical significance of the enrichment of a pwm in the positive sequence set compared with the expectation derived from the background model. enrichment p - values are calculated from the single - site p - values for each possible motif position. a single - site p - value quantifies the significance of the match of a single site to the pwm. it is the probability that a random site (generated from the background model) will obtain at least the same score. hence, the better the pwm score of the single site, the more significant and the nearer to zero is its single - site p - value. we developed an efficient branch - and - bound algorithm to compute the single - site p - values for all sites in the positive sequence set. the enrichment p - value is calculated from all single - site p - values in the input sequences using order statistics : the enrichment p - value is the probability to obtain by chance on a same - size set of background sequences at least k out of n possible motif positions with better single - site p - values than the kth single - site p - value actually observed. finally, the enrichment p - value can be combined with the p - values for conservation and localization into a total p - value. e - values are obtained by multiplying the total motif p - values with a bonferroni - like correction factor, which penalizes model complexity similar to the akaike information criterion. for a detailed description, guthoehrlein, m. siebert, s. luehr and j. sding, submitted for publication). xxmotif has been compared with various versions of five state - of - the - art methods for motif discovery (meme (7), weeder (15), priority (16), amadeus (5) and ermit (17)) on a standard benchmark set containing 352 datasets of chip - enriched sequences from s. cerevisiae (18), and the other containing 34 sets of metazoan sequences obtained with a wide range of experimental approaches (5). xxmotif showed 2050% higher sensitivity (number of correctly identified motifs) than the other tools on the harbison datasets (18) and 15300% on the metazoan datasets. the quality of the reported pwms was measured in a partial area under receiver operating characteristic curve (pauc) analysis and showed between 30 and 75% higher values than the other tools (h. hartmann, e.w. guthoehrlein, m. siebert, s. luehr and j. sding, submitted for publication). on the data upload page (figure 1a), users can enter the input sequence set and an optional background sequence set (up to 25 mb per file). the background sequences are used to learn the statistical background model, which describes how xxmotif will then try to find motifs that are enriched in the input set in comparison to the expectation derived from the background model. when no background sequences are supplied, a second - order background model is trained from the input sequences. figure 1.pages for submitting a job to the xxmotif web server : (a) upload input and background sequence sets, (b) set options for the motif search and (c) verify and submit. pages for submitting a job to the xxmotif web server : (a) upload input and background sequence sets, (b) set options for the motif search and (c) verify and submit. it should have a trinucleotide distribution similar to the positive sequences while not being enriched for the motifs we seek. more concretely, the background set should have a similar mono-, di- and trinucleotide composition as the positive set. if this is not the case, xxmotif may run very slowly because it tries to extend sequences too much and it may produce falsely significant motifs. if in doubt, it is better to omit the background and to let xxmotif learn the background model from the positive set. we are about to add an automatic quality test that will warn the user if the background set is not well chosen. to increase the sensitivity of the motif search, xxmotif can calculate motif conservation p - values during the search, which are combined with the enrichment p - values. in this case, the user can upload a set of input and background multiple sequence alignments, using the multiple fasta format. on the options page, the suggested first, the user can specify how many motif occurrences per input sequence are expected. for most transcription factor and microrna binding sites, we would expect multiple occurrences, for example. for core promoter motifs or splice sites when selecting the latter option, only the best occurrence per sequence is scored, whereas with the former option, all occurrences above a certain single - site significance p - value are scored. searching on both strands is recommended for all motifs that should occur with similar probabilities on both strands (i.e. as reverse complements of each other). this is true for most transcription factor and microrna binding sites, for example, but not for core promoter or splice site motifs. the order of the background model specifies how long the patterns are that xxmotif learns from the background sequence set. an eighth - order model learns the frequencies of 9-mer nucleotides to model the correlations between nearby nucleotides. this is the default option selected when a background set is supplied by the user. when the background model is learned from the positive set, the default order is set to 2. if we were to train a model of order 8 from the positive set, no motif shorter than 10 nucleotides could become significant. under advanced options, the user can first specify one of three similarity thresholds for merging motifs (low, medium and high). setting this threshold to high will produce longer lists of motifs consisting of groups of similar, partially redundant motifs, which were not similar enough to be merged with each other. setting the threshold to low will produce shorter, non - redundant lists of motifs, as similar motifs are merged into a single pwm. however, to be able to discern pwms of factors with similar binding affinities, the high threshold is preferable, as it prevents xxmotif from merging the similar but distinct motifs. the user can further specify which 5-mer and 6-mer patterns are evaluated as seed patterns to initiate the search. the number of uninformative (gap) positions in the 5-mer seeds can also be set. when setting this parameter to 1, all seeds of the types xxxxx, xnxxxx, xxnxxx, xxxnxx and xxxxnx will be assessed, for example, where x stands for an informative position and n stands for any nucleotide. usually, it is sufficient to choose zero here. xxmotif also allows changing the amount of pseudocounts added to the nucleotide counts in motif occurrences. the addition of pseudocounts ensures that the pwm constructed from the motif occurrences in the positive set can predict motif occurrences in new datasets better than without pseudocounts. the xxmasker tool can be switched off, which masks repeat regions and regions of local homology (see method summary section). upon pressing next step, a summary of all selected options is presented (figure 1c), and corrections can be made using the back button. after job submission, the user is directed to a status page, which can be bookmarked and automatically redirects to the results page when the job is finished. if the user has provided an email address, a notification with the result page url is sent. run time scales approximately linearly with the average sequence length and the number of sequences in the positive sequence set. the results page lists the web logos, e - values and number of sites of matched motifs found up to an e - value of 100 (figure 2a). when both strands were searched, the reverse complement versions of the motifs are also plotted. figure 2.sample results with boxes that can be expanded with the orange buttons on the left. (a) summary list of discovered motifs sorted by significance (e - value). (b) the multi distribution plot depicts positions and strand of motif occurrences on the input sequences. the single - site p - values are represented by the height of the box, their length corresponds to the motif length. (c) the localization plot is a histogram view of the positional distribution of selected motifs relative to an anchor point. sample results with boxes that can be expanded with the orange buttons on the left. (a) summary list of discovered motifs sorted by significance (e - value). (b) the multi distribution plot depicts positions and strand of motif occurrences on the input sequences. the single - site p - values are represented by the height of the box, their length corresponds to the motif length. (c) the localization plot is a histogram view of the positional distribution of selected motifs relative to an anchor point. multi distribution plot (figure 2b) depicts with colored boxes the position and strand of significant motif occurrences within the input sequences. the motifs to display in this plot can be selected by the user in the upper part of the plot. this allows plotting clustered binding sites marking, for example, cis - regulatory elements, co - occurring pairs of motifs and other positional biases. setting the mouse over a particular motif site will show the site s sequence, strand, start and end position, the single - site p - value measuring the match quality with the pwm and a conservation p - value (if multiple sequence alignments had been supplied). most significant motifs are drawn last and may hide less significant ones. when the input sequences are all of the same length, a localization plot can be displayed (figure 2c). this graph is useful to analyze positional preferences with respect to the fixed - length sequence window of the input sequences. it shows in a histogram view the positional distributions of all user - selected motif occurrences with each motif in a different color. for instance, motif 1 (tata - box) in figure 2b is exactly positioned between 33 to 27 bp with respect to the transcription start site (tss) at position 0, whereas motif 2 (yy1) is located mainly downstream of the tss. mouse - over in the histogram provides the position with respect to the anchor point and the number of counts of the motif. for instance, motif 4 in figure 2c has 15 counts sharply peaked at position 6 with respect to the tss and a detailed information about each motif can be obtained by clicking the expand buttons in the motif summary list. the motif distribution plot is similar to the multi distribution plot and indicates the positions of significant matches of the selected motif on the input sequences. the motif site table lists all significant matches with their sequence identifiers, strands, positions, the single - site p - values and the sequence contexts of the motif. figure 3.detailed motif view. the first box (motif distribution plot) plots the position of significant motif matches within the input sequences. the second box (motif site table) gives detailed information on all significant motif matches. detailed motif view. the first box (motif distribution plot) plots the position of significant motif matches within the input sequences. the second box (motif site table) gives detailed information on all significant motif matches. all data files generated by the xxmotif program, such as lists of motifs with their occurrence positions, p - values and site sequences, pwm weight coefficients and images of motif logos can be downloaded by expanding the box two sample input sets and pre - computed results allow the user to get a quick overview of the server s usage and results. the xxmotif web server runs on an apache server and is implemented using php, perl and r scripts. with the xxmotif web server, we aim to make a very sensitive and reliable motif discovery method easily accessible to non - expert users. the server has clearly structured input and results pages and offers various useful interactive analyses. it is unique in being able to include evidence from motif conservation and positional clustering in the motif search. we acknowledge financial support by the dfg, the center for protein science munich (cipsm), and a research professorship from the ludwig - maximilians - universitt mnchen, financed through the excellence initiative of the german bundesministerium fr bildung und forschung. | the discovery of regulatory motifs enriched in sets of dna or rna sequences is fundamental to the analysis of a great variety of functional genomics experiments. these motifs usually represent binding sites of proteins or non - coding rnas, which are best described by position weight matrices (pwms). we have recently developed xxmotif, a de novo motif discovery method that is able to directly optimize the statistical significance of pwms. xxmotif can also score conservation and positional clustering of motifs. the xxmotif server provides (i) a list of significantly overrepresented motif pwms with web logos and e - values ; (ii) a graph with color - coded boxes indicating the positions of selected motifs in the input sequences ; (iii) a histogram of the overall positional distribution for selected motifs and (iv) a page for each motif with all significant motif occurrences, their p - values for enrichment, conservation and localization, their sequence contexts and coordinates. free access : http://xxmotif.genzentrum.lmu.de. |
the combination of structural genomics efforts and computational modeling has resulted in a large amount of 3d structure information for proteins. however, to a large degree, this structural information has not been translated into functional information. for example, understanding substrate specificity, catalysis or inhibition, is still largely dependent on biochemical and biophysical analysis of individual proteins. while protein structure in principle encodes this mechanistic information, reliable computational tools and approaches to establish a connection between structure and function are still lacking. the molecular function of proteins is largely determined by their interaction with other molecules at binding sites on the protein surface. thus, localization and characterization of a ligand binding site can contribute to functional annotation of a protein ; it can guide mutational experiments, and be useful in predicting or verifying interactions. the identification of ligand binding sites can also be an important part of the drug discovery process. knowing the location of binding sites facilitates virtual screening for hits, lead optimization and identification of features that influence the selectivity of binding. hence, several methods have been developed for the identification of binding sites from protein structures (16) and sequences (710). the structure - based methods recognize geometrical features, such as clefts, or energetic features that describe the molecular interaction properties of the protein surface. in general, structure - based methods can be seen as complementary to sequence - based methods that exploit evolutionary information. here, we describe the sitehound - web server for identification of ligand binding sites in protein structures. it uses an energy - based approach to identify regions with high potential for interaction with ligands. a unique feature of sitehound - web is that it implements the use of different probes to characterize a protein structure, which enables not only the identification of different types of binding sites, but also a preliminary description of its interaction properties. the sitehound algorithm identifies potential ligand binding sites by recognizing regions characterized by favorable non - bonded interactions with a chemical probe (6). depending on the nature of the probe, different types of binding sites currently, a carbon probe and a phosphate probe are available for the identification of binding sites for drug - like molecules, and ligands containing phosphate groups, respectively. affinity maps (also called molecular interaction fields) describing the interaction of the probe and the protein on a regular 3d lattice are calculated using either the autogrid program (11) for the carbon probe, or the easymifs program (d. ghersi and r. sanchez, manuscript submitted for publication) for the phosphate probe. the remaining points are clustered according to their spatial proximity using an agglomerative hierarchical clustering algorithm. the final output is a list of interaction energy clusters corresponding to putative binding sites, which are ranked by total interaction energy (tie) (the sum of the energy values of all the points that belong to the same cluster). a test study carried out on 77 experimentally determined protein structures, corresponding to known protein ligand complexes, showed that the correct binding site was among the top three sitehound clusters in 95% of the cases (6). sitehound - web (http://sitehound.sanchezlab.org) was implemented using a python - cgi and javascript based platform. wrappers integrate programs modeller (12), autogrid (11), easymifs (d. ghersi and r. sanchez, manuscript submitted for publication), and sitehound (6), resulting in a completely automated identification of ligand binding sites from a standard pdb file. the processed pdb file is then passed to either autogrid or easymifs, depending on the user - selected probe. the output is displayed using html pages including an interactive 3d representation of the protein structure and the putative binding sites using the jmol java applet (http://www.jmol.org). sitehound - web requires a pdb file as input and the specification of a probe and clustering algorithm for the calculation. the input pdb file can either be uploaded or a pdb code can be specified. when specifying a pdb code the corresponding file is copied from the pdb database. the pdb file does not need to be preprocessed (e.g. removal of ligands) since the server does this automatically. two types of probes are currently available : a carbon probe for the identification of binding sites for molecules that interact mainly through van der waals contacts ; and a phosphate probe which is used to identify sites that bind to phosphorylated ligands. the carbon probe has been validated mainly with drug - like molecules (6) and the phosphate probe with phosphopeptides, phosphosugars, and atp (d. ghersi and r. sanchez, manuscript in preparation). the clustering algorithm determines the way in which sitehound combines individual affinity map points into clusters corresponding to putative binding sites. the average - linkage clustering tends to result in relatively spherical clusters and is the default for both probes. while only the use of average - linkage clustering has been tested extensively in sitehound, the single - linkage clustering algorithm is provided as an alternative to be used with the carbon probe for the identification of larger elongated binding sites, like those of peptides. once a request has been submitted, the calculation proceeds unless a multiple chain pdb file has been uploaded or selected. in this case, the server will provide the option to select one or more chains from the pdb file to be included in the calculation. after chain selection the calculation proceeds. for a medium - sized protein (150 residues), a typical calculation takes 1 min. however, running time also depends on the shape of the protein, with elongated proteins taking longer than spherical ones. the output of sitehound - web has two components : an interactive web screen displaying a summary of results with a 3d representation of the putative binding sites on the protein structure ; and downloadable files for offline analysis. a cluster data table (figure 1a) displays the top 10 ranking interaction energy clusters (i.e. putative binding sites). this table shows the rank, tie, coordinates, and volume for each cluster. the color of the rank corresponds to the color of the cluster in the 3d display. the tie, which is used to rank the clusters, is an indication of the strength of the clusters. significant clusters usually have ties that stand out against the background of weaker clusters (see clusters 1 and 2 in figure 1a ; and cluster 1 in figure 2a). the cluster coordinates correspond to the x, y and z coordinates of the center of each cluster. this can be used, for example, to set up a docking box centered around a putative binding site (6). finally, the volume of the cluster in is displayed in the last column. a 3d interactive view of the protein structure and the clusters (figure 1b) is provided using the jmol molecular viewer. this view interacts with the cluster selection panel (figure 1c), which can be used to toggle the display of any of the top 10 clusters on and off. a cluster details panel (figure 1d) provides a list of protein residues in the vicinity of a selected cluster. clicking on its corresponding rank in the cluster data table changes the selected cluster. finally, the download data panel (figure 1e) provides links to various data files. the cluster data file provides the same information as the cluster data table, but for all identified clusters. the dx file stores cluster data in the dx format which is useful for display in programs such as pymol (http://www.pymol.org) and chimera (13). the cluster pdb file contains the coordinates of the cluster points in pdb format ; it can be used to display the clusters in most molecular viewers (figure 3) and is the file used internally by sitehound - web to display the clusters using jmol. it can be used with the offline version of sitehound (d. ghersi and r. sanchez, manuscript submitted for publication) to explore different parameters for cluster analysis. the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the carbon probe and the average - linkage clustering algorithm is shown. (a) the cluster data table summarizes the information for the top 10 clusters ranked by total interaction energy. the cluster number indicates the rank of the cluster with the colors corresponding to the coloring of the cluster in the structure display and cluster selection windows. two clusters (circled with the dotted line) stand out has having significantly more favorable interaction energy than the rest. the coordinates for the center of the cluster and the cluster volume are also displayed. (b) the structure display window provides a 3d view of the clusters in the context of the protein structure using the jmol java applet (http://www.jmol.org). cluster selection panel allows toggling the display of individual clusters on or off. by default (d) the cluster details panel displays all residues in contact with the cluster selected in the cluster data window. (e) the download data panel provides links to various data files for offline analysis (see text for a description of each file). the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the phosphate probe and the average - linkage clustering algorithm is shown. only the structure display (a) and cluster 1 (circled) stands out as having significantly more favorable interaction energy with the phosphate probe than the rest of the clusters. the position of cluster 1 is intermediate between the two most favorable carbon probe clusters (figures 1 and 3). figure 3.combining sitehound - web outputs to describe the adenylate kinase binding site. (a) ribbon diagram of the yeast adenylate kinase structure showing the top ranking clusters from figures 1 and 2 as solid surfaces : phosphate probe cluster (red) and carbon probe clusters (green). (b) sitehound - web clusters superposed on the structure of the ap5a (bis(adenosine)-5-pentaphosphate) inhibitor of adenylate kinase (14). the phosphate probe correctly identifies the pathway of phosphoryl transfer, and the carbon probe correctly identifies the adenosine binding regions. the figure was prepared using the cluster pdb file downloadable output files from sitehound - web examples shown in figures 1 and 2, and the pymol molecular graphics program (http://www.pymol.org). the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the carbon probe and the average - linkage clustering algorithm is shown. (a) the cluster data table summarizes the information for the top 10 clusters ranked by total interaction energy. the cluster number indicates the rank of the cluster with the colors corresponding to the coloring of the cluster in the structure display and cluster selection windows. two clusters (circled with the dotted line) stand out has having significantly more favorable interaction energy than the rest. the coordinates for the center of the cluster and the cluster volume are also displayed. (b) the structure display window provides a 3d view of the clusters in the context of the protein structure using the jmol java applet (http://www.jmol.org). cluster selection panel allows toggling the display of individual clusters on or off. by default (d) the cluster details panel displays all residues in contact with the cluster selected in the cluster data window. (e) the download data panel provides links to various data files for offline analysis (see text for a description of each file). the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the phosphate probe and the average - linkage clustering algorithm is shown. only the structure display (a) and cluster data (b) panels are shown. cluster 1 (circled) stands out as having significantly more favorable interaction energy with the phosphate probe than the rest of the clusters. the position of cluster 1 is intermediate between the two most favorable carbon probe clusters (figures 1 and 3). (a) ribbon diagram of the yeast adenylate kinase structure showing the top ranking clusters from figures 1 and 2 as solid surfaces : phosphate probe cluster (red) and carbon probe clusters (green). (b) sitehound - web clusters superposed on the structure of the ap5a (bis(adenosine)-5-pentaphosphate) inhibitor of adenylate kinase (14). the phosphate probe correctly identifies the pathway of phosphoryl transfer, and the carbon probe correctly identifies the adenosine binding regions. the figure was prepared using the cluster pdb file downloadable output files from sitehound - web examples shown in figures 1 and 2, and the pymol molecular graphics program (http://www.pymol.org). the sitehound algorithm identifies potential ligand binding sites by recognizing regions characterized by favorable non - bonded interactions with a chemical probe (6). depending on the nature of the probe, different types of binding sites currently, a carbon probe and a phosphate probe are available for the identification of binding sites for drug - like molecules, and ligands containing phosphate groups, respectively. affinity maps (also called molecular interaction fields) describing the interaction of the probe and the protein on a regular 3d lattice are calculated using either the autogrid program (11) for the carbon probe, or the easymifs program (d. ghersi and r. sanchez, manuscript submitted for publication) for the phosphate probe. the remaining points are clustered according to their spatial proximity using an agglomerative hierarchical clustering algorithm. the final output is a list of interaction energy clusters corresponding to putative binding sites, which are ranked by total interaction energy (tie) (the sum of the energy values of all the points that belong to the same cluster). a test study carried out on 77 experimentally determined protein structures, corresponding to known protein ligand complexes, showed that the correct binding site was among the top three sitehound clusters in 95% of the cases (6). sitehound - web (http://sitehound.sanchezlab.org) was implemented using a python - cgi and javascript based platform. a series of python wrappers integrate programs modeller (12), autogrid (11), easymifs (d. ghersi and r. sanchez, manuscript submitted for publication), and sitehound (6), resulting in a completely automated identification of ligand binding sites from a standard pdb file. the processed pdb file is then passed to either autogrid or easymifs, depending on the user - selected probe. the resulting affinity map is then passed to sitehound. the output is displayed using html pages including an interactive 3d representation of the protein structure and the putative binding sites using the jmol java applet (http://www.jmol.org). sitehound - web requires a pdb file as input and the specification of a probe and clustering algorithm for the calculation. the input pdb file can either be uploaded or a pdb code can be specified. when specifying a pdb code the corresponding file is copied from the pdb database. the pdb file does not need to be preprocessed (e.g. removal of ligands) since the server does this automatically. two types of probes are currently available : a carbon probe for the identification of binding sites for molecules that interact mainly through van der waals contacts ; and a phosphate probe which is used to identify sites that bind to phosphorylated ligands. the carbon probe has been validated mainly with drug - like molecules (6) and the phosphate probe with phosphopeptides, phosphosugars, and atp (d. ghersi and r. sanchez, manuscript in preparation). the clustering algorithm determines the way in which sitehound combines individual affinity map points into clusters corresponding to putative binding sites. the average - linkage clustering tends to result in relatively spherical clusters and is the default for both probes. while only the use of average - linkage clustering has been tested extensively in sitehound, the single - linkage clustering algorithm is provided as an alternative to be used with the carbon probe for the identification of larger elongated binding sites, like those of peptides. once a request has been submitted, the calculation proceeds unless a multiple chain pdb file has been uploaded or selected. in this case, the server will provide the option to select one or more chains from the pdb file to be included in the calculation. after chain selection the calculation proceeds. for a medium - sized protein (150 residues), a typical calculation takes 1 min. however, running time also depends on the shape of the protein, with elongated proteins taking longer than spherical ones. the output of sitehound - web has two components : an interactive web screen displaying a summary of results with a 3d representation of the putative binding sites on the protein structure ; and downloadable files for offline analysis. a cluster data table (figure 1a) displays the top 10 ranking interaction energy clusters (i.e. putative binding sites). this table shows the rank, tie, coordinates, and volume for each cluster. the color of the rank corresponds to the color of the cluster in the 3d display. the tie, which is used to rank the clusters, is an indication of the strength of the clusters. significant clusters usually have ties that stand out against the background of weaker clusters (see clusters 1 and 2 in figure 1a ; and cluster 1 in figure 2a). the cluster coordinates correspond to the x, y and z coordinates of the center of each cluster. this can be used, for example, to set up a docking box centered around a putative binding site (6). finally, the volume of the cluster in is displayed in the last column. a 3d interactive view of the protein structure and the clusters (figure 1b) is provided using the jmol molecular viewer. this view interacts with the cluster selection panel (figure 1c), which can be used to toggle the display of any of the top 10 clusters on and off. the coloring of the clusters corresponds to their rank in the cluster data table. a cluster details panel (figure 1d) provides a list of protein residues in the vicinity of a selected cluster. clicking on its corresponding rank in the cluster data table changes the selected cluster. finally, the download data panel (figure 1e) provides links to various data files. cluster data file provides the same information as the cluster data table, but for all identified clusters. the dx file stores cluster data in the dx format which is useful for display in programs such as pymol (http://www.pymol.org) and chimera (13). the cluster pdb file contains the coordinates of the cluster points in pdb format ; it can be used to display the clusters in most molecular viewers (figure 3) and is the file used internally by sitehound - web to display the clusters using jmol. it can be used with the offline version of sitehound (d. ghersi and r. sanchez, manuscript submitted for publication) to explore different parameters for cluster analysis. the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the carbon probe and the average - linkage clustering algorithm is shown. (a) the cluster data table summarizes the information for the top 10 clusters ranked by total interaction energy. the cluster number indicates the rank of the cluster with the colors corresponding to the coloring of the cluster in the structure display and cluster selection windows. two clusters (circled with the dotted line) stand out has having significantly more favorable interaction energy than the rest. the coordinates for the center of the cluster and the cluster volume are also displayed. (b) the structure display window provides a 3d view of the clusters in the context of the protein structure using the jmol java applet (http://www.jmol.org). cluster selection panel allows toggling the display of individual clusters on or off. by default (d) the cluster details panel displays all residues in contact with the cluster selected in the cluster data window. data panel provides links to various data files for offline analysis (see text for a description of each file). the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the phosphate probe and the average - linkage clustering algorithm is shown. only the structure display (a) and cluster data (b) panels are shown. cluster 1 (circled) stands out as having significantly more favorable interaction energy with the phosphate probe than the rest of the clusters. the position of cluster 1 is intermediate between the two most favorable carbon probe clusters (figures 1 and 3). figure 3.combining sitehound - web outputs to describe the adenylate kinase binding site. (a) ribbon diagram of the yeast adenylate kinase structure showing the top ranking clusters from figures 1 and 2 as solid surfaces : phosphate probe cluster (red) and carbon probe clusters (green). (b) sitehound - web clusters superposed on the structure of the ap5a (bis(adenosine)-5-pentaphosphate) inhibitor of adenylate kinase (14). the phosphate probe correctly identifies the pathway of phosphoryl transfer, and the carbon probe correctly identifies the adenosine binding regions. the figure was prepared using the cluster pdb file downloadable output files from sitehound - web examples shown in figures 1 and 2, and the pymol molecular graphics program (http://www.pymol.org). the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the carbon probe and the average - linkage clustering algorithm is shown. (a) the cluster data table summarizes the information for the top 10 clusters ranked by total interaction energy. the cluster number indicates the rank of the cluster with the colors corresponding to the coloring of the cluster in the structure display and cluster selection windows. two clusters (circled with the dotted line) stand out has having significantly more favorable interaction energy than the rest. the coordinates for the center of the cluster and the cluster volume are also displayed. (b) the structure display window provides a 3d view of the clusters in the context of the protein structure using the jmol java applet (http://www.jmol.org). cluster selection panel allows toggling the display of individual clusters on or off. by default (d) the cluster details panel displays all residues in contact with the cluster selected in the cluster data window. (e) the download data panel provides links to various data files for offline analysis (see text for a description of each file). the output for yeast adenylate kinase (14) (pdb code 1aky) processed with the phosphate probe and the average - linkage clustering algorithm is shown. only the structure display (a) and cluster data (b) panels are shown. cluster 1 (circled) stands out as having significantly more favorable interaction energy with the phosphate probe than the rest of the clusters. the position of cluster 1 is intermediate between the two most favorable carbon probe clusters (figures 1 and 3). combining sitehound - web outputs to describe the adenylate kinase binding site. (a) ribbon diagram of the yeast adenylate kinase structure showing the top ranking clusters from figures 1 and 2 as solid surfaces : phosphate probe cluster (red) and carbon probe clusters (green). (b) sitehound - web clusters superposed on the structure of the ap5a (bis(adenosine)-5-pentaphosphate) inhibitor of adenylate kinase (14). the phosphate probe correctly identifies the pathway of phosphoryl transfer, and the carbon probe correctly identifies the adenosine binding regions. the figure was prepared using the cluster pdb file downloadable output files from sitehound - web examples shown in figures 1 and 2, and the pymol molecular graphics program (http://www.pymol.org). ligand binding site identification is an important tool in structural biology because it can bridge the structure - function gap in a homology - independent way. sitehound - web is a ligand binding site identification server that can provide information about the location and binding preference of sites in protein structures. it has a simple interface that only requires the user to select a protein structure and two options (probe and clustering algorithm). a unique feature of sitehound - web is its ability to identify different types of binding sites depending on the probe used for calculation. future development of sitehound will include the addition of more probes for characterization of a more diverse set of sites. because the method requires only the structure of the protein as input it can be used to complement sequence - based methods for identification of functionally important residues, which rely on evolutionary information. we expect sitehound - web to be especially useful in the context of structural annotation, and docking applications in which the binding site is unknown. while binding site identification methods can help in locating and characterizing the regions of the protein to which a ligand may bind, they can not guarantee that a given site will or will not bind a ligand. this is a problem that is better addressed by techniques such as virtual screening that can be carried out on the putative binding sites. national science foundation (mcb 0517352) ; the national institutes of health (gm081713). funding for open access charge : national institutes of health (gm081713). | sitehound - web (http://sitehound.sanchezlab.org) is a binding - site identification server powered by the sitehound program. given a protein structure in pdb format sitehound - web will identify regions of the protein characterized by favorable interactions with a probe molecule. these regions correspond to putative ligand binding sites. depending on the probe used in the calculation, sites with preference for different ligands will be identified. currently, a carbon probe for identification of binding sites for drug - like molecules, and a phosphate probe for phosphorylated ligands (atp, phoshopeptides, etc.) have been implemented. sitehound - web will display the results in html pages including an interactive 3d representation of the protein structure and the putative sites using the jmol java applet. various downloadable data files are also provided for offline data analysis. |
psychological science can make important contributions to prevention and treatment of chronic illness (taylor, 2006). to address the challenge, a new field of health psychology has evolved over the last 30 years. the divisions of health psychology of the british psychological society and the european health psychology society are also thriving. in 2006, the journal, health psychology [http://www.apa.org/journals/hea ], had the largest number of individual subscriptions amongst any empirical psychology journal. health psychology encompasses a variety of activities ranging from basic and clinical research, through education, and clinical service. a biopsychosocial model considers health as the complex interplay among biological disposition, behaviour, and social conditions (fava & sonino, 2008). behaviours include lifestyle variables such as tobacco use, risk taking, alcohol consumption, diet, and exercise. biological studies consider a range of variables, but the most thoroughly investigated topic has been the effect of psychological stress on immune functioning. a unifying theme in heath psychology is interest in the effects of these influences (behaviours, social conditions, and psychological stress) upon health outcomes. health psychology significantly overlaps with the related filed of behavioural medicine defined as the study of the interactions of behaviour with biology and the environment, and the application of that knowledge to improve the health and well - being of individuals, families, communities, and populations. the most important distinction between the fields is that behavioural medicine defines itself as multidisciplinary, while health psychology is considered to be a subdiscipline of psychology. in practice for example, most members of the society of behavioural medicine are also affiliated with the division of health psychology of the american psychological association. the strong body of research in health psychology and the allied field of behavioural medicine rarely finds its way into the clinical practice of medicine. centers for disease control estimates that nearly half of all adults suffer from one or more chronic diseases and that chronic disease care is responsible for an estimated 75% of health care spending (centers for disease control and prevention, 2008) there is substantial evidence that risks for heart disease, many cancers, chronic obstructive pulmonary disease, and stroke are at least partially the result of tobacco use, poor diet, or lack of physical activity (mokdad, marks, stroup & gerberding, 2004). sexual behaviours, alcohol and drug abuse, and other habits place people at increased risk for many other serious health problems. further, the full impact of many therapies for these conditions is often not realized because patients fail to use treatments as prescribed. contemporary practice guidelines often call for the use of behavioural counseling, but rarely offer guidance on how to apply the methods. in fact, the behavioural component is barely noted in some overviews (boden, 2003). funding for prevention and behavioural research lags far behind basic biological research, and there is typically only minimal support for behaviourally oriented providers in most clinical settings. in part, the failure to recognize the role of behaviour in health outcomes reflects the poor appreciation of underlying causes of death. behavioural or psychological factors play an important role in each of the top 10 causes of death in most developed countries (mokdad., 2004). tobacco smoking, for example, is a key risk factor for the top four causes of death : heart disease, cancer, stroke, and chronic obstructive pulmonary disease. even if we understood the genetic basis for these conditions, it is almost inconceivable that the genetic information would allow us to disregard the need to reduce tobacco consumption. in addition to behavioural factors playing a role in the development of chronic diseases, there is substantial evidence that modest behavioural intervention results in significant health benefits. even moderate weight loss and physical activity can prevent diabetes for those at heightened risk. a systematic randomized clinical trial demonstrated that lifestyle changes were not only more effective but also more cost - effective than pharmacological intervention in the prevention of type 2 diabetes (tuomilehto., 2001). a series of behavioural, public policy, and communications strategies has resulted in a remarkable decline in the use of tobacco products (messer., 2007), and these reductions may have resulted in a decline in deaths from heart disease, lung cancer, and copd. applications of psychological and behavioural principles have had a profound impact on the epidemic of hiv disease ; especially, there has been an impressive success regarding the transmission of hiv from mothers to their children. in the united states, hiv transmission rates have declined from more than 1500 per year to less than 50 (office of behavioural and social science research, 2007). when confronted with a choice between simple or complex solutions, we tend to favour the complex. contemporary approaches to biomedical research glorify the role of genetics and molecular biology. in the united states, the vast majority of national institutes of health (nih) dollars are devoted to technological interventions. clearly, genetics and molecular biology hold the key to the understanding of many important diseases. however, simple behavioural technologies can have a profound impact at a relatively low cost. part of the problem is that we think that behaviour change is easy to achieve.. however, diet programmes tend to produce only short - term benefits (mann., 2007). the literature in health psychology clearly documents that behavioural change is complex and difficult to understand. to realize the potential of modern behavioural science for enhancing the health of the population, we need to take several actions, including the following : 1.form better collaboration between health psychology and health care providers. clinicians may commonly encounter problems that would benefit from the systematic review of a sophisticated psychological investigator. for example, breast cancer management, particularly in the united states, has been very aggressive : most women receive adjuvant chemotherapy. growing literature now indicates that adjuvant chemotherapy may be associated with losses in cognitive function. in particular, the use of adjuvant therapy results in problems with both working and long - term memory (silverman, castellon & ganz, 2007) although there is still some controversy about the magnitude of the effects (ahles., 2008). selective estrogen receptor modulators, such as tamoxifen, might also produce a problem with cognitive functioning (vardy, rourke & tannock, 2007). success in treating cancer has created some new challenges. with a growing number of potential survivors comes the need to investigate social, emotional, and cognitive effects of survivorship and cancer treatment (ganz, 2008). despite the importance of these issues, we have devoted surprisingly little attention to the study of cognitive and social outcomes in cancer survivors. funding these specific collaborations or solicitation of interdisciplinary proposals may help advance these efforts.2.apply psychological methodologies to assess patient outcomes. a growing trend emphasizes the importance of measuring health outcome from the perspective of the patient. disease and disability are of concern because they affect life expectancy and/or life quality (kaplan & ries, 2008). for example, cancer and heart disease are the two major causes of premature death in the united states. a person with heart disease may face restrictions in daily living activities and may be unable to work or participate in social activities. even relatively minor diseases and disabilities affect quality of life. a cold, for example, may interfere with the ability to concentrate, work, or attend school. the cold, however, lasts only a short time. a chronic disease, such as arthritis, may affect the quality of life for a long time. within the last few years many major diseases, including arthritis (meenan, 1982), heart disease (grady., 2004), and diabetes, or even digestive problems (gralnek, hays, kilbourne, naliboff & mayer, 2000), are evaluated in terms of the degree to which they affect life quality and life expectancy (asakawa, rolfson, senthilselvan, feeny & johnson, 2008). one of the important puzzles in current outcomes research is that, although women live longer than men in most developed countries, women experience poorer self - reported outcomes during the years they are alive (kaplan, anderson & ake, 2001).we need a greater emphasis on the development of methods that can capture these outcomes. health psychology offers a rich tradition of measurement and can make valuable contributions to the assessment of patient - reported outcomes. some of the most common measures are the medical outcomes study 36 item short form (ware & gandek, 1998), the quality of well - being scale (kaplan & anderson, 1996), and the health utilities index (feeny, furlong, & barr, 1998). many people with advanced training in health psychology have expertise that can contribute to the development of these methods. health psychologists are typically well - versed in statistics, psychometrics, and experimental design in addition to their substantive training.3.move beyond documentation of disparities. one of the most popular topics of contemporary outcomes research is the documentation of health disparities, including differences in outcomes between men and women. there are now literally hundreds of studies showing that those with more economic resources have better health outcomes than those with fewer economic opportunities. we have fewer studies demonstrating how to turn our knowledge of disparities into interventions that reduce the consequences of social disadvantage. we need greater efforts to help attenuate the known disparities associated with social and economic deprivation and gender. health psychology and related fields have a rich history of the study of social and economic stressors and can make important contributions in this area (cohen, doyle & baum, 2006 ; cohen & hamrick, 2003).4.create an infrastructure that fosters multidisciplinary research. there are plenty of advocates for multidisciplinary collaboration. however, there are many fewer examples of successful multidisciplinary achievement. one of the best examples of a successful collaboration is the work by kielcolt - glaser and glaser that combines state - of - the - art psychosocial assessment with advanced methods from immunology. this collaboration has help redefine the influence of psychological stress on immune functioning (glaser & kiecolt - glaser, 2005). clinicians may commonly encounter problems that would benefit from the systematic review of a sophisticated psychological investigator. for example, breast cancer management, particularly in the united states, has been very aggressive : most women receive adjuvant chemotherapy. growing literature now indicates that adjuvant chemotherapy may be associated with losses in cognitive function. in particular, the use of adjuvant therapy results in problems with both working and long - term memory (silverman, castellon & ganz, 2007) although there is still some controversy about the magnitude of the effects (ahles., 2008 selective estrogen receptor modulators, such as tamoxifen, might also produce a problem with cognitive functioning (vardy, rourke & tannock, 2007). success in treating cancer has created some new challenges. with a growing number of potential survivors comes the need to investigate social, emotional, and cognitive effects of survivorship and cancer treatment (ganz, 2008). despite the importance of these issues, we have devoted surprisingly little attention to the study of cognitive and social outcomes in cancer survivors. a growing trend emphasizes the importance of measuring health outcome from the perspective of the patient. disease and disability are of concern because they affect life expectancy and/or life quality (kaplan & ries, 2008). for example, cancer and heart disease are the two major causes of premature death in the united states. in addition a person with heart disease may face restrictions in daily living activities and may be unable to work or participate in social activities. even relatively minor diseases and disabilities affect quality of life. a cold, for example, may interfere with the ability to concentrate, work, or attend school. a chronic disease, such as arthritis, may affect the quality of life for a long time. within the last few years, medical scientists have come to realize the importance of quality of life measurement. many major diseases, including arthritis (meenan, 1982), heart disease (grady., 2004), and diabetes, or even digestive problems (gralnek, hays, kilbourne, naliboff & mayer, 2000), are evaluated in terms of the degree to which they affect life quality and life expectancy (asakawa, rolfson, senthilselvan, feeny & johnson, 2008). one of the important puzzles in current outcomes research is that, although women live longer than men in most developed countries, women experience poorer self - reported outcomes during the years they are alive (kaplan, anderson & ake, 2001). we need a greater emphasis on the development of methods that can capture these outcomes. health psychology offers a rich tradition of measurement and can make valuable contributions to the assessment of patient - reported outcomes. some of the most common measures are the medical outcomes study 36 item short form (ware & gandek, 1998), the quality of well - being scale (kaplan & anderson, 1996), and the health utilities index (feeny, furlong, & barr, 1998). many people with advanced training in health psychology have expertise that can contribute to the development of these methods. health psychologists are typically well - versed in statistics, psychometrics, and experimental design in addition to their substantive training. one of the most popular topics of contemporary outcomes research is the documentation of health disparities, including differences in outcomes between men and women. there are now literally hundreds of studies showing that those with more economic resources have better health outcomes than those with fewer economic opportunities. we have fewer studies demonstrating how to turn our knowledge of disparities into interventions that reduce the consequences of social disadvantage. we need greater efforts to help attenuate the known disparities associated with social and economic deprivation and gender. health psychology and related fields have a rich history of the study of social and economic stressors and can make important contributions in this area (cohen, doyle & baum, 2006 ; cohen & hamrick, 2003). there are plenty of advocates for multidisciplinary collaboration. however, there are many fewer examples of successful multidisciplinary achievement. one of the best examples of a successful collaboration is the work by kielcolt - glaser and glaser that combines state - of - the - art psychosocial assessment with advanced methods from immunology. this collaboration has help redefine the influence of psychological stress on immune functioning (glaser & kiecolt - glaser, 2005). although many components of health are determined by genetic factors and environmental exposures, these interact with social and economic factors. differences between genders in health outcomes might be affected by differences in health habits, social support systems, and in coping with stress. health psychology offers an extensive literature and a set of validated methodologies that address many of these issues. in summary, health psychology and behavioural medicine have the potential to make important contributions to the health of populations. to realize this potential better, integration of medical science and medical practice is necessary. in summary, health psychology and behavioural medicine have the potential to make important contributions to the health of populations. to realize this potential better, integration of medical science and medical practice is necessary. robert m. kaplan, ph.d., is fred w. and pamela k. wasserman professor and chair of the department of health services at ucla and professor of medicine at the ucla david geffen school of medicine. from 1997 to 2004, he was professor and chair of the department of family and preventive medicine at the university of california, san diego. he is past president of several organisations, including the american psychological association division of health psychology, section j of the american association for the advancement of science (pacific), the international society for quality of life research, the society for behavioural medicine, and the academy of behavioural medicine research. he is a past chair of the behavioural science council of the american thoracic society. kaplan is currently editor - in - chief of health psychology and is the former editor - in - chief of the annals of behavioural medicine. further, he is the chair of the cost / effectiveness committee for the nhlbi national emphysema treatment trial (nett). kaplan is the author or co - author of more than 15 books and approximately 400 articles or chapters. the isi includes him in the listing of the most cited authors in the world (defined as above the 99.5th percentile). in 2005, he was elected to the institute of medicine of the national academies of sciences. he is also on the honorary international editorial advisory board of the mens sana monographs. | human behaviour plays a significant role in most of the leading causes of death. psychological science has the potential to enhance health outcomes through a better understanding of health promoting and health damaging behaviours. health psychology and the related field of behavioural medicine focus on the interplay among biological dispositions, behaviour, and social context. the field might advance by building better collaboration with other fields of medicine, sharing expertise on technical aspects of psychometric outcomes assessment, identifying behavioural interventions to reduce health disparities, and creating an infrastructure that fosters multidisciplinary research. |
toluene diisocyanate (tdi) is an imperative chemical substance used in the production of polyurethane foams, elastomers, paints and coatings and cause a variety of health problems in workers who are exposed in work places (1). health effects that induced by tdi consist of asthma, chronic obstructive lung disease, hypersensitivity pneumonitis, alveolitis, conjunctivitis, and rhinitis (2). the ability of tdi and the other diisocyanates to cause respiratory hypersensitivity is well known (3). occupational asthma (oa) is a respiratory disorder express by bronchial hyper reactivity caused by agents present in the air in the workplace ; it causes obstruction or sensitivity of the airways and is partly or completely reversible, instinctively or by treatment (4). with increasing rate of asthma morbidity and mortality rate in many developed countries over the past 1020 years (5,6), the incidence of oa is rising, because of increased exposure to work related toxic agents. although it is a quite frequent disorder, the roles of smoking and atopy in its pathogenesis are not totally known (7,8). although many clinical and epidemiological studies have been carried out to evaluate the effects of exposure to tdi in workplaces on human health, many questions remain unanswered. it is the first time in iran that tdi effects on exposed workers are assessed. this study aimed to determine the asthma symptoms and serum specific ige levels in tdi exposed workers and comparing the results with healthy control group. all the plants that use tdi in the manufacturing of paint and glue in the west of tehran province entered to the study and all the workers (550) completed modified initial questionnaire of the niosh. the questions were consist of asthma symptoms such as wheezing, cough, chest tightness, shortening of breath, cigarette consumption, number of daily cigarette consumption, family history of allergy and work duration. total ige and specific tdi ige tests were done for 26 workers who had asthma symptoms by rast method with r - biopharm, darmsiasi, germany. for each symptomatic exposed worker one worker selected as control if met these inclusion criteria : 1- sex and age matched 2- non asthmatic 3- did not exposed to tdi in work places. questions about cigarette consumption, number of daily cigarette consumption, and family history of allergy were asked from selected control group. total ige and specific tdi ige test were carried out for control group such as symptomatic exposed workers. data were analyzed by spss version 18 to calculate chi square test and or (odds ratio) and 95% cis (confidence interval). paired samples test was used to compare total ige means in exposed and unexposed groups. all the plants that use tdi in the manufacturing of paint and glue in the west of tehran province entered to the study and all the workers (550) completed modified initial questionnaire of the niosh. the questions were consist of asthma symptoms such as wheezing, cough, chest tightness, shortening of breath, cigarette consumption, number of daily cigarette consumption, family history of allergy and work duration. total ige and specific tdi ige tests were done for 26 workers who had asthma symptoms by rast method with r - biopharm, darmsiasi, germany. for each symptomatic exposed worker one worker selected as control if met these inclusion criteria : 1- sex and age matched 2- non asthmatic 3- did not exposed to tdi in work places. questions about cigarette consumption, number of daily cigarette consumption, and family history of allergy were asked from selected control group. total ige and specific tdi ige test were carried out for control group such as symptomatic exposed workers. data were analyzed by spss version 18 to calculate chi square test and or (odds ratio) and 95% cis (confidence interval). paired samples test was used to compare total ige means in exposed and unexposed groups. all of the workers were male and the mean age of symptomatic workers was 36.38 8.49 yr. among 550 tdi exposed workers 26 (4.7%) workers had asthma symptoms. among symptomatic workers ten workers (38%) stated that they ever had asthma but 9(34.6%) had physician asthma diagnosis. details of asthma symptoms including the frequency of wheezing, breath shortness, cough, and chest tightness are presented in table 1. other allergic signs were observed concomitantly with asthma symptoms : 17(65.4%) allergic rhinitis, 14(53.8%) eye allergic and 15(57.7%) skin allergic cases were observed. nine (34.6%) of workers who were exposed to tdi were active cigarette consumer versus 3(11.5%) unexposed workers, or=4.059 (ci= 0.95317.29) p=0.049 (table 1). six (23.1%) of exposed workers consumed daily more than 5 cigarettes in comparison with 2(7.7%) unexposed workers or=0.278 (ci=0.0501.531) p=0.124. nine (34.6%) of paint and glue plants workers had positive family history of atopy versus 1(3.8%) unexposed workers, or=13.24 (ci= 1.45305.41) p=0.0138 (table 2). tdi specific ige was found in 2 tdi exposed workers and 1 unexposed worker (p=0.5). mean of total ige was 339.05 iu / ml in exposed workers in compare of 52.19 iu / ml in unexposed workers (p=0.201). all the workers with positive specific ige (2 workers) were exposed to tdi more than 10 years. range of work duration in plants that consumed tdi was 127 years with mean of 10.586. isocyanates cause a variety of respiratory disorders such as occupational asthma (oa) with prevalence of 5% to 10% in exposed workers (9). other uncommon diseases like allergic alveolitis, and systemic symptoms also occur (10). in our study, we found 26 (4.7%) of tdi exposed workers had asthma symptoms that appears less than the other reported rates (1114). this difference may be related to the plants structure in west of tehran province, in the environmental observation of factories we found that the major parts of production have been carry out in the open places of plants such as yards. the work in the open places leads to decrease the tdi exposure and consequent low symptoms among workers. oa that was induced by ige - dependent agents is similar to clinical and pathologic features of allergic asthma that is not related to work (15,16). specific ige antibodies to tdi have been reported in a range of 0% to 40% (17,18). in this study we found specific ige in 2 symptomatic exposed workers and one unexposed worker that did not show statistically significant relation between specific ige and clinical symptoms of asthma, also we did not have any significant association of total ige in two groups. we should consider that although the presence of ige antibodies is highly diagnostic but it has no sensitivity in detecting isocyanates induced oa. it can be explained by the presence of more than one immunologic mechanism of respiratory sensitization in isosyanate induced asthma including ige antibody - independent mechanisms (19,20). in comparison of our clinical findings littorin. in 2007 reported bronchitis 10%, cough 28%, cough with mucus 34% and wheezing 27% in tdi exposed workers (21). our study showed that use of cigarette increases the risk of asthma symptoms 4 folds in tdi exposed workers, or=4.059 (ci= 0.95317.29) p=0.049, however we could not find any association between daily cigarette consumption and asthma symptoms. in agreement of our findings. showed that cigarette consumption is significantly higher in oa patients due to tdi (p=0.012) (14) whereas siracusa. found no relation between tdi induced oa and smoking (22), these contradictory results can explained by the healthy smokers effect healthy workers have more chance to get a job and continue it because they suffer less and their employer like to keep them rather than their unwell colleagues (23). we showed family history of atopy elevates the risk of asthma symptoms in tdi exposed workers versus unexposed workers or=13.24 (ci= 1.45305.41) p=0.0138. stated genetic factors can influence disease susceptibility because tdi induced asthma symptoms only in a small part of exposed workers can be detectable (24) and many researches were carried out to detect the influencing gens (2529). this study provides clinical and paraclinical data of workers who are exposed to tdi and points to a relation between atopy and smoking habit with asthma symptoms that offer preventing recommendations for tdi exposed workers and their heath administrators however further studies in this field is recommended. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors. | backgroundtoluene diisocyanate (tdi) is an imperative chemical substance used in the production of polyurethane foams, elastomers, paints and coatings that cause a variety of health problems in workers who are exposed in work places. this study aimed to determine the asthma symptoms and serum specific ige levels in tdi exposed workers and comparing the results with healthy control group.methods:all the plants that use tdi in the manufacturing of paint and glue in the west of tehran province entered to the study and all the workers (550) completed modified initial questionnaire of the niosh, the questions were consisted of asthma symptoms. for each symptomatic exposed worker one healthy, sex and age matched control selected. total ige and specific tdi ige tests were done for each case and control groups.results:among 550 tdi exposed workers, 26(4.7%) had asthma symptoms. nine (34.6%) of symptomatic workers who were exposed to tdi were active cigarette consumer versus 3(11.5%) unexposed workers, p=0.049(ci= 0.95317.29) or=4.059. nine (34.6%) workers had positive family history of atopy versus 1(3.8%) unexposed workers, p=0.0138 (ci= 1.45305.41) or=13.24. tdi specific ige was found in 2 tdi exposed workers and 1 unexposed worker (p=0.5). mean of total ige was 339.05 in exposed workers (p=0.201).conclusion : this study provides clinical and paraclinical data of workers exposed to tdi and points to a relation between atopy and smoking habit with asthma symptoms that offer preventing recommendations for tdi exposed workers and their heath administrators. |
the most common underlying mechanism of bioactive peptides has been studied in angiotensin - converting enzyme (ace) inhibition [24 ]. although the ace inhibitor effects of bioactive peptides are most often studied, the vasorelaxant activity has also shown an important evidence for lowering blood pressure. it is well established that dietary protein found in soy protein, milk casein, and sweet potato and its hydrolysates are capable of reducing blood pressure and modulating vascular activity. recently, there are many reports that dietary - protein - derived peptides lower blood pressure and modulate vasodilation from several sources including egg white, soy protein, and -casein. moreover, silk fibroin, a core protein of silk fiber, has been shown to have potential hypotensive and antioxidant actions by fibroin hydrolysate. silk - fibroin - derived dipeptides, such as glycine - tyrosine, also produce an antihypertensive effect through angiotensin - converting enzyme (ace) inhibition. sericin is a glue protein consisting of 20%30% of the total cocoon weight which is synthesized in the middle gland of the bombyx mori silkworm. sericin is composed of 18 amino acids and contains protein in a wide range of molecular weights from 10 to over 300 kda. sericin has shown numerous bioactivities, such as antioxidant, antitumor, antiproliferation, and anticholesterolemic properties. however, sericin and its hydrolysates have not been reported for vasorelaxation and blood pressure lowering. therefore, in the present study, we investigated the possible mechanism involved in the blood pressure - lowering and vasomodulating effects of sericin - derived oligopeptides. the sericin - rich protein solution was filtered through a cheese cloth to separate the extracted cocoons from the liquid part. the sericin solution obtained was subjected to enzymatic hydrolysis by protease (from bacillus species, 16 unit / g, ec no. one ml of protease enzyme solution (0.01 unit / ml protease enzyme in 0.036 m cacl2 solution at a 1 : 1 volumetric ration) was added to 300 ml of the obtained sericin solution and incubated under shaking conditions at 37c for 1 h. the solution was then heated to 90c for 15 min to stop the enzymatic activity and cooled to room temperature before centrifugation at 9500 g for 15 min at 4c to separate the solid portions. oligopeptides with a molecular weight lower than 5 kda were separated from larger oligopeptides by ultra membrane filtration using a hollow fiber membrane with 5000 mwco (molecular weight cutoff) (ge healthcare bio - sciences ab, uppsala, sweden). the oligopeptides solution obtained was freeze - dried and kept in a sealed container at room temperature until use. male wistar rats (200250 g) were obtained from the national laboratory animal center, mahidol university, salaya, nakornpathom, thailand. all animals were housed under a 12:12 h light - dark cycle conditions, with maintained temperature (24 1c). the experiment protocol was approved by the animal ethics committee in accordance with the guide for the care and use of laboratory animals prepared by chiang mai university. the rats were anesthetized by intraperitoneal injection of sodium pentobarbital (50 mg / kg bw). the femoral artery was cannulated with polyethylene tubing 50 (clay - adams pe-50) filled with 100 iu of heparin / ml connected to a pressure transducer to measure blood pressure. the blood pressure signal was amplified and converted to a digital signal by a bridge amplifier coupled with powerlab (adinstruments, sydney, australia). systolic blood pressure (sbp), diastolic blood pressure (dbp), and heart rate (hr) were recorded with labchart 7 software (adinstruments, sydney, australia). oligopeptides were administered via a cannula inserted into the femoral vein with similar tubing to facilitate the intravenous injection of oligopeptides (0.1 g1000 g / kg bw). animals were allowed to equilibrate at least 20 min before the administration of any drugs. arterial pressure was allowed to return to the baseline level before the subsequent injections were conducted. the rats were anesthetized by intraperitoneal injection of sodium pentobarbital (50 mg / kg bw). the thoracic aorta was immediately removed and cleaned from the connective tissues and fat. aortic rings (35 mm) were obtained and immediately immersed into ice - cold kreb 's solution (composition in mm : nacl 122 ; kcl 5 ; (hepes) 10 ; kh2po4 0.5 ; nah2po4 0.5 ; mgcl2 1 ; glucose 11 ; cacl2 1.8 ; ph 7.4) until use. the endothelium - denuded rings were obtained by mechanically removing the endothelial layer by gentle rubbing around the internal vascular surface. the aortic rings were mounted between a pair of platinum wires in an organ bath containing krebs ' solution, maintained at 37c and continuously bubbled with air. a resting tension of 1 gram was applied to each tissue and allowed to equilibrate at least 1 h. the endothelium integrity was verified by relaxation to ach (1 m) in rings precontracted by pe (1 m). the vascular endothelium was considered intact when aortic rings were relaxed 90% of the pe - induced precontractions, whereas the endothelium - denuded ring was confirmed with an absence of vasorelaxation. changes in isometric tension were recorded and analyzed through a force transducer (iworx systems, inc., nh, usa), coupled with bridge amplifier (adinstruments, sydney, australia), powerlab (adinstruments, sydney, australia), and signal virtualization by labchart 7 software (adinstruments, sydney, australia). vasorelaxant effects of oligopeptides were investigated in both endothelium - intact and endothelium - denuded aortic rings. after the ring was preequilibrated, the aortic ring was precontracted with pe (1 m) or kcl (80 mm) until the stability of tension was developed and followed by cumulative exposure to oligopeptides at the concentration of 0.00110 mg / ml. the extent of relaxation was expressed as the percentage of pe- or kcl - induced contraction. to investigate the mechanism responsible for oligopeptides - induced vasorelaxation, the endothelium - intact rings were precontracted with pe (1 m) for 30 min after being exposed to either l - name (100 m), an inhibitor of the no synthase (nos), indomethacin (10 m), an inhibitor of the cyclooxygenase (cox), or l - name plus indomethacin. and, then, vasorelaxation was carried out by the cumulative exposure to oligopeptides at the concentrations of 0.00110 mg / ml. to examine the role of k channels involvement in vasorelaxation, the endothelium - denuded ring was used for this determination by preincubation with one of the following k channel blockers : tetraethylammonium, a nonselective inhibitor of k channels (tea, 5 mm), 4-aminopyridine, an inhibitor of voltage - operated k channel (4-ap, 1 mm), glibenclamide, an inhibitor of k channels activated by adenosine triphosphate (10 m), and bacl2 (1 mm) for 30 min before pe (1 m) precontraction. then, the cumulative concentration response of oligopeptides at the concentrations of 0.00110 mg / ml was directly added. to evaluate whether oligopeptides possessed vasorelaxation via the sgc activation, the endothelium - intact ring was incubated with 1h - oxadiazolo[4,3-]quinoxalin-1-one, a selective inhibitor of the guanylyl cyclase enzyme (odq, 1 m) for 30 min before contraction with pe (1 m) treatment. the ability of vasorelaxation was compared in absence (control) and presence of odq. to investigate the effects of oligopeptides on ca channel, the endothelium - denuded aortic ring was placed under ca - free krebs ' solution for 20 min and then exposed for an additional 10 min to k (80 mm), ca - free solution for complete smooth muscle cell depolarization to open a voltage - operated ca channel (vocc). the cumulative concentration - response curve of cacl2 (ranging from 10 m to 10 mm) was obtained. after the maximal response was performed, the rings were washed out and replaced with ca - free solution for 20 min. the ca - free 80 mm k was reexposed to flowing with preincubation of either oligopeptides (1, 3, 5, and 10 mg / ml) or nifedipine, l - type ca channel blocker (1 m) for 20 min. the maximal contraction obtained with the control concentration response curve to cacl2 was taken as 100%, and all values were calculated as a percentage of the maximal response. to investigate the effect of oligopeptides on pe- or caffeine - sensitive intracellular calcium stores, endothelium - denuded rings were bathed in ca - free kreb 's solution containing 1 mm egta after incubation with 80 mm kcl for successful ca loading into sr. the transient contractions were obtained in aortic rings by pe (1 m) or caffeine (20 mm) in ca - free solution before and after being incubated with oligopeptides (1, 5, and 10 mg / ml). the results were expressed as percentage of the response induced by pe or caffeine alone. statistical analysis was performed using student 's t - test or one - way analysis of variance (anova) followed by tukey 's post hoc test. concentration - response curves were plotted, and experimental data were obtained by using nonlinear curves fit program (graphpad prism 5). the baselines of sbp, dbp, and hr were 122.8 1.64 mmhg, 107 3.74 mmhg, and 366 2.67 bpm, respectively. intravenous administration of oligopeptides dose dependently decreased sbp and dbp in rats (figures 1(a) and 1(b)). the hypotensive response in each dose of oligopeptides was completely recovered to the baseline within a few minutes. in addition, oligopeptides at all doses did not show any obvious effect on hr (figure 1(c)). oligopeptides significantly relaxed pe- and 80 mm kcl - precontracted aortic rings in a concentration - dependent manner. however, oligopeptides completely relaxed in pe- (emax = 95.46 1.86%) induced contractions in the aortic rings and partially relaxed in kcl- (80 mm, emax = 55.22 7.56%) induced contractions (figures 2(a) and 2(b)). the endothelium - denuded ring significantly decreased the vasodilator effects only on the pe precontraction (figure 2(a)), while, for 80 mm kcl, precontraction had no effects (figure 2(b)). no and prostacyclin are known to be vasorelaxing mediators derived from endothelium. in endothelium - intact preparation, oligopeptides relaxed the pe- (1 m) induced contractions with an ec50 value of 1.86 0.16 mg / ml (figure 3). in the presence of l - name and l - name plus indomethacin, the relaxant effect of oligopeptides against pe- (1 m) induced contraction was markedly attenuated with an ec50 value of 13.49 0.18 and 8.71 0.15 mg / ml, respectively (figure 3). by contrast, treatment of the aortic ring with indomethacin showed no modification in endothelium - intact rings (figure 3). to verify the role of k channel in oligopeptides - induced vasorelaxation, the endothelium - denuded ring was preincubated with different potassium channel inhibitors : tetraethylammonium (5 mm), 4-aminopyridine (1 mm), glibenclamide (10 m), or bacl2 (1 mm) before the ring was contracted with pe. all inhibitors did not alter the concentration - response curve for oligopeptides as shown in figures 4(a) and 4(b). however, the maximal relaxant activity of oligopeptides which were preincubated with tetraethylammonium was markedly reduced (emax = 54.82 2.63%) compared to the control (emax = 83.74 5.61%). odq (1 m) significantly abolished the oligopeptides - induced vasorelaxation in the endothelium - intact ring (figure 5). it markedly decreased both the potency (ec50 = 11.22 0.91 mg / ml) and maximal relaxation (emax = 12.09 4.63%) when compared to untreated control values (ec50 1.86 0.79 mg / ml, and emax = 95.03 1.86%). the concentration - response curves of cacl2 (10 m10 mm) were performed in the 80 mm kcl ca - free solution. the percentage of maximal response (emax) of cacl2 alone (100%) was attenuated in the presence of oligopeptides (1, 3, 5, and 10 mg / ml) in a concentration - dependent manner (83.02 6.78%, 54.00 1.98%, 39.52 2.28%, and 31.61 2.6%, resp.), while ec50 values were similar (figure 6). in addition, nifedipine (1 m) also abolished the contraction of cacl2. preincubation of endothelium - denuded rings with oligopeptides at the concentrations of 1, 5, and 10 mg / ml dose dependently decreased the transient contractions induced by pe (10 m) in ca - free krebs ' solution containing egta (1 mm) (figure 7(a)). by contrast, oligopeptides produced no significant effect on the transient contractions induced by caffeine (20 mm) in a similar condition (figure 7(b)). sericin is a protein derived from the silk cocoon that appears as waste in silk processing. sericin is a mixture of polypeptides of molecular mass varying between 10 and 300 kda and has high serine contents (30%33%). in the past decade, various biological activities regarding sericin have been reported in gastric injuries and protection against tumorigenesis, antioxidation, inhibition of tyrosinase, alcohol - induced liver, and uv - induced keratinocyte apoptosis. in the present study, sericin was hydrolyzed, and it generated the bioactive peptides with low - molecular- (5 kda) sized peptides. the sericin - derived oligopeptides exerted vasorelaxant activities in rats, which explain their hypotensive effects. the reduction of blood pressure was transient, and it recovered to baseline level in a few minutes by dose - dependent intravenous administration of oligopeptides. although the reduction of blood pressure occurred, the level of blood pressure was still within normotensive limits, whereas heart rate was unaffected. oligopeptides induced a concentration - dependent vasorelaxation on pe - induced precontractions in endothelium - intact and -denuded aortic rings, and this relaxation was attenuated by endothelium denudation. these results suggested that oligopeptides acted to cause vasorelaxation in endothelium - dependent aortic rings. the vascular endothelial cells pivotally acted in vascular homeostasis by modulating the vascular smooth muscle tone. thus, indomethacin, a cyclooxygenase inhibitor, and l - name, an inhibitor of no synthase, were employed to investigate the involvement of prostacyclin and no in vasodilation effect. the results showed that oligopeptides - induced vasorelaxation was markedly suppressed by l - name, but not by indomethacin, suggesting the participation of no in the vasorelaxation effect of oligopeptides. furthermore, l - name plus indomethacin revealed no further inhibition than that observed with l - name alone. this showed that no is a powerful relaxant mediator involvement in oligopeptides - induced vasorelaxation. it is well known that the no / sgc pathway is one of the most common potential mechanisms that induce vascular smooth muscle relaxation through activation of guanylyl cyclase, leading to the accumulation of cyclic gmp that inhibits ca influx. odq, a soluble guanyly cyclase inhibitor, was used to confirm the relationship of the vasorelaxant response of oligopeptides. this finding showed the significant inhibitory effects of odq in oligopeptides - induced endothelium - dependent vasorelaxation, which confirmed that the vasorelaxation of the aorta elicited by oligopeptides was mediated in the endothelium - dependent however, the vasorelaxation effect of oligopeptides was still observed in aortic endothelium - denuded rings, suggesting that oligopeptides have a direct effect on vascular smooth muscle cells. the opening of k channels or ca channel blocker in the vascular smooth muscle cells provides an important mechanism to dilate arteries. the vasorelaxant effect of oligopeptides was partially inhibited by the tea (ca - activated k channel blocker). other k blockers, glibenclamide (atp - sensitive k channel blocker), 4-ap (voltage - activated k channel blocker), and bacl2 (inwardly rectifying k channel blocker) had no effects, suggesting that the relaxant response of oligopeptides was involved in the role of k channel opening of ca - activated k channel in vascular smooth muscle cells. influx of extracellular ca through voltage and/or receptor - operated calcium channels (voccs and/or roccs) plays an important role in vascular smooth muscle contraction. we note that oligopeptides induced vasorelaxation in aortic rings precontracted with kcl or phenylephrine. from this result, it can be concluded that oligopeptides induced vasorelaxation via different pathways. it is well known that kcl induces smooth muscle contraction through the activation of voltage - dependent calcium channels and subsequent release of calcium from sarcoplasmic reticulum, whereas phenylephrine - induced vasoconstriction is mediated by the stimulation of g - proteins coupled to alpha - adrenoceptors. we then investigated the mechanism for the vasodilator action of oligopeptides that could directly inhibit the ca influx in the vascular smooth muscle cells. oligopeptides significantly reduced the contractile responseinduced by cacl2 in the endothelium - denuded ring, in concentration - dependent manner under a depolarizing solution. the contraction was abolished by nifedipine, a typical l - type voltage - operated calcium channel blocker, confirming the involvement of l - type voltage - operated calcium channels in the contractile response. the concentration - response curve of cacl2 decreased in emax, while the ec50 values were unchanged, suggesting that oligopeptides could act as a calcium channel blocker that interferes with ca influx through l - type ca channel of aorta smooth muscle membrane. the influences of oligopeptides in ca released from intracellular stores were sensitive to phenylephrine, and caffeine was also determined. the oligopeptides markedly decreased the contractions induced by phenylephrine, which stimulates ip3-dependent ca release from the intracellular store. by contrast, caffeine - induced contractions, which release ca from intracellular stores by ip3-independence, were not altered. thus, it seems likely that the vascular effects of oligopeptides involved a reduction of ip3-dependent ca releases form sr sensitive to phenylephrine [27, 28 ]. our results demonstrated that bioactive oligopeptides (5 kda) fractions obtained from silk sericin lower blood pressure by a direct effect on both endothelium and vascular smooth muscle leading to vasodilation. results from this study have also supported us to further identify and characterize bioactive peptides. this study demonstrated the hypotensive effect and vasorelaxant effect of silk sericin - derived oligopeptides on isolated rat aorta and the possible mechanisms. the results suggested that oligopeptides have a dose - dependent relaxing effect on the isolated rat aorta. the relaxing effect of oligopeptides is mediated through ca antagonism and the no / sgc / cgmp pathway, which possibly explains the fall in bp. these findings provide scientific evidence supporting the therapeutic uses of sericin - derived oligopeptides as vascular modulators. | sericin - derived oligopeptides obtained from silk cocoons were investigated for the in vivo hypotensive effect and investigated for the underlying mechanism involved in vasodilation in isolated rat thoracic aorta. in normotensive anesthetized rats, oligopeptides induced an immediate and transient hypotensive activity. in rat aortic rings, oligopeptides induced a concentration - dependent vasorelaxation in vessels precontracted with both kcl and phenylephrine (pe) with endothelium - intact or endothelium - denuded rings. in endothelium - intact rings, pretreatment with n-nitro - l - arginine methyl ester hydrochloride (l - name, 100 m), an inhibitor of the no synthase (nos) or 1h-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (odq, 1 m), a selective inhibitor of the guanylyl cyclase enzyme, significantly reduced the relaxant effect of oligopeptides. however, indomethacin, an inhibitor of the cyclooxygenase, had no effect on oligopeptides - induced relaxation. in addition, pretreatment with tetraethylammonium (tea, 5 mm) reduced the maximal relaxant effect induced by oligopeptides. by contrast, relaxation was not affected by 4-aminopyridine (4-ap, 1 mm), glibenclamide (10 m), or barium chloride (bacl2, 1 mm). in depolarization ca2 + -free solution, oligopeptides inhibited calcium chloride- (cacl2-) induced contraction in endothelium - denuded rings in a concentration - dependent manner. nevertheless, oligopeptides attenuated transient contractions in ca2 + -free medium containing egta (1 mm) induced by 1 m pe, but they were not affected by 20 mm caffeine. it is obvious that potent vasodilation effect of oligopeptides is mediated through both the endothelium and the vascular smooth muscle. |
monomethylmercury is a neurotoxin that poses significant risks to human health1 due to its bioaccumulation in food webs. sunlight degradation to inorganic mercury is an important component of the mercury cycle that maintains methylmercury at low concentrations in natural waters. rates of photodecomposition, however, can vary drastically between surface waters25 for reasons that are largely unknown. here, we show that photodegradation occurs through singlet oxygen, a highly reactive form of dissolved oxygen generated by sunlight irradiation of dissolved natural organic matter. the kinetics of degradation, however, depended on water constituents that bind methylmercury cations. relatively fast degradation rates (similar to observations in freshwater lakes) applied only to methylmercury species bound to organic sulfur - containing thiol ligands such as glutathione, mercaptoacetate, and humics. in contrast, methylmercury - chloride complexes, which are dominant in marine systems, were unreactive. binding by thiols lowered the excitation energy of the carbon - mercury bond on the methylmercury molecule67 and subsequently increased reactivity towards bond breakage and decomposition. our results explain methylmercury photodecomposition rates that are relatively rapid in freshwater lakes24 and slow in marine waters5. |
|
traumatic brain injuries (tbis) have multiple causes, from motor vehicle accidents, falls, sports - related injuries, violence, and military activity, making tbi a serious health concern around the world. the world health organization has stated that the incidence and long - term consequences of tbis will continue to increase over the next five years, representing a continual increase to this already existing major cause of death and disability. not only can tbi result in a patient 's loss of function, but, in some cases, tbi may progress into early dementia, depression, personality changes, and posttraumatic epilepsy. therefore, understanding the complex cascades of biological consequences is vital to improving diagnostic and treatment options. similar to a typical response against any tissue damage, tbi induces inflammatory and neuroinflammatory processes [24 ]. astrocytes and microglial cells are key central nervous system components of the neuroinflammatory response. following a tbi, these glial cells become activated, resulting in the release of proinflammatory molecules such as interleukin 1 beta (il-1), interleukin 6 (il-6), macrophage inflammatory protein (mip), and ccl2 [510 ]. one method to discern activated astrocytes is by their morphology and gfap expression [11, 12 ]. amongst the neuroinflammatory consequences of astrocyte activation, previous studies have indicated that astrocyte hypertrophy can provide an anatomical substrate for the aberrant growth of newborn dentate granule cells [1315 ]. more specifically, shapiro. demonstrated that because the glial cells at the border between the hilus and granule cell layer were closely apposed to the dcx+ processes, the latter processes grow into the hilus along an ectopic glial scaffold, where astrocytic processes preferentially orient into the hilus, rather than through the granule cell layer. this aberration is different than in the normal adult rodent brain, where gfap - expressing radial glial - like cells give birth to and wrap around new born dentate granule cells in a one - to - one relationship to nurture and guide the growth and integration of the newborn neurons. as part of this relationship, the radial glial cells extend a process that extends radially through the granule cell layer and the growing apical dendrite from the newborn neuron extends along this radial glial process. thus, the radial glial - like cell helps to guide the newborn neurons as they migrate from the subgranular zone and grow into the granule cell layer [16, 17 ]. in addition to the growing apical dendrite, newborn neurons in the normal adult rodent brain often sprout a basal dendrite early in their development. in the normal rodent brain, after about 72 hours, this transient basal dendrite from the newborn neuron will begin to retract or curve back such that they course parallel to the granule cell layer. however, following brain insults such as epileptogenic stimulus, neurogenesis is known to be altered, as is the relationship between newborn neurons and radial glial - like astrocytes [1416 ]. several studies have demonstrated a link between astrocyte activation and aberrant neurogenesis [14, 1922 ]. these alterations to neurogenesis include increased and/or decreased numbers of newborn neurons and altered survival, migration, and integration of the newborn neurons into existing brain circuitry. for example, following tbis or seizures, neurogenesis is typically increased in a transient fashion, such that, at short durations after injury or insult (30 days after injury, a decrease in the number of newborn neurons is observed [2325 ]. in addition, newborn neurons in the hippocampus have been observed to ectopically migrate into the hilus following seizures, and these ectopic cells contribute to aberrant hippocampal function [26, 27 ]. the growth and integration of newborn neurons are also observed after seizures, such that the newborn granule cells were observed to sprout basal dendrites that course deep into the hilus, where they are synaptically targeted by mossy fibers from granule cells [2830 ]. this granule cell to granule cell connectivity constitutes a recurrent circuitry, and computational models as well as electrophysiological studies have demonstrated that such a circuit significantly disrupts normal hippocampal functioning [31, 32 ]. considering the importance of hippocampal function to a wide variety of behavioral, emotional, reproductive, and cognitive functions, it is possible that alterations to hippocampal neurogenesis can negatively impact hippocampal function, leading to functional deficits that include disorders of learning and memory, affective behaviors, and cognitive dysfunction. indeed, these types of short- and long - term deficits are often seen after tbi in humans [3335 ] and in animal models [36, 37 ]. thus, it is possible that changes to newborn neurons and their associated astrocytes might occur following a tbi, thereby contributing to functional deficits. previous studies have shown that cortical astrocytes are activated soon after a tbi [5, 6 ]. other studies have demonstrated altered neurogenesis and activated astrocytes in the hippocampus at various time points and in various tbi animal models, as well as in clinical cases [3840 ]. given these data, we hypothesize that tbi causes astrocyte and neurogenic alterations in the hippocampus, such that the astrocytic changes provide an anatomical substrate for the aberrant growth of hilar basal dendrites from these newborn neurons. to test this hypothesis, we examined astrocytes, newborn neurons, and the relationship between these cell types in the hippocampus at 30 days following a tbi in mice. mice were randomly separated into two cohorts a sham group (n = 5) and an fpi group (n = 5). prior to sham or fpi procedures, all mice were anesthetized with an initial dose of 4% isoflurane and oxygen for anesthesia induction and maintained anesthesia on 2% isoflurane. all animals were placed in a stereotaxic instrument with an attachment for mouse surgery (stoelting, inc. a 2 mm hole was drilled into the skull over the left parietal cortex, making sure to leave the dura intact. a female luer - lock (plasticone) was connected to the hole in the skull and mice in the fpi group received a pressure pulse of 1.51.7 atm from the fpi apparatus through the luer - lock for 1216 ms. animals were housed singly after fpi with a 12-hour light - dark cycle (light on 6:00 and light off 18:00). 30 days after surgery, mice in both groups were sacrificed and fixed under anesthesia by transcardial perfusion as previously described [6, 8 ]. briefly, a peristaltic pump was used to deliver 0.9% saline through the left ventricle until the runoff through the cut right atrium ran clear. the brains were allowed to postfix for 24 hrs in the skull, after which they were extracted and fixed for 24 hours in 4% paraformaldehyde and subsequently cut into 50-micrometer - thick serial coronal sections with a vibratome. immature neurons were immunohistochemically stained for dcx as previously described [14, 16, 23 ]. incubation of the primary antibody was done on tissue slices (n = 4 slices per mouse for each group) incubated in the dark, rotating at room temperature, for 24 hours, in pbs containing 0.005% tween, 5% normal horse serum, and dcx antibodies to the n and c termini (1 : 500 each, santa cruz biotech). after staining, the tissue slices were rinsed 3 times for 5 minutes each in 0.01 m pbs. the tissue slices were next incubated for 90 minutes, rotating in the dark, at room temperature in pbs containing 0.005% tween, 5% normal horse serum, and fluorescently tagged donkey anti - goat antibody (1 : 200 ; alexa flour 488 ; invitrogen). after 90 minutes, the tissue slices were rinsed 3 times for 5 minutes each in 0.01 m pbs, before being mounted onto glass slides. slides were allowed to dry overnight and cover slips were applied with vectashield hardset (vector labs, burlingame, ca). the slides were coded for subsequent analysis by reviewers blind to the condition of the tissue. briefly, tissue slices (n = 4 - 5 slices per mouse for each group) were incubated in the dark, at room temperature, for 24 hours in a mixture of 0.01 m pbs, 3% normal goat serum, and cy3 fluorescently tagged, primary gfap antibody (1 : 1000 ; sigma). after staining, the tissue slices were washed 3 times in 0.01 m pbs, mounted onto glass slides, and cover slips were applied with vectashield hardset (vector labs, burlingame, ca). a series of images from the ipsi- and contralateral dentate gyri were captured on the olympus ix-81 laser scanning confocal microscope. these sections spanned the rostral - caudal extent of the hippocampus from 1.34 to 2.54 from bregma. equal sampling of the hippocampi within these coordinates was ensured by an investigator separate from the blinded raters (e.g., the coordinate for each slice was identified by an independent reviewer who did not partake in the image analysis). once the images were captured, they were loaded into powerpoint (microsoft 2010) and grids were superimposed over the images to allow random selection of the boxes for subsequent quantification at higher magnification. cellular and neuropil landmarks were used in the low magnification images to ensure that the borders were accurately observed during high magnification counting. upon loading into powerpoint, the images were coded a second time, and a different rater traced the borders of the hilus, the borders of the suprapyramidal subgranular zone extending into the first 4 layers of granule cells, and the borders of the infrapyramidal subgranular zone extending into the first 4 layers of granule cells (figure 1). per stereological guidelines, a grid containing an array of numbered 5000 m boxes was overlaid upon the traced regions of interest (figure 1). areas to be counted were identified using a random number generator to select the boxes in which counting would be performed (https://www.random.org/integers/). in most cases, 3 boxes from each region of interest were randomly selected for analysis using the random number generator. however, in the most rostral slices (1.34 to 1.55 from bregma), only 2 boxes were selected because of the decreased size of the granule cell layer and hilus. alternatively, in the most caudal sections (2.28 to 2.54 from bregma), 4 boxes were randomly selected because of the increased size of the granule cell layer and hilus. within each box, 1 lateral and 1 horizontal border were chosen as inclusion lines, and the other two borders were exclusion lines. all cells within the box, or touching the inclusion lines, were counted, whereas cells contacting the exclusion lines were omitted. images from the infra- and suprapyramidal cell layers of the left and right side of each slice were captured using the same blinding method as above for dcx counting. areas for analysis were determined by drawing boundaries around the suprapyramidal and infrapyramidal granule cell layers. the area of each granule cell layer was calculated using image j (nih v.1.49) and multiplied by the section thickness, as determined using the confocal microscope. all primary processes were counted throughout the entire traced granule cell layer by an experimenter blinded to the animal 's condition. secondary and tertiary branches were counted separately if they arborized within the upper 3/5ths of the granule cell layer. the origin of these processes was not considered, as the cell body was often outside of the plane of focus and the perikaryal cytoplasm does not always robustly stain with gfap. the data were then divided by the image 's calculated volume to obtain the number of processes per cubic micron:(1)number of radial glial processesarea of region of interestdepth of image series. in order to assess astrocyte hypertrophy in the hilus, we used a derivation of a previous densitometry protocol to quantify the intensity of pixels using image j (nih v.1.49). z - stack image series of 18 microns deep were captured on the confocal microscope, starting from the first visible astrocytic process at the top of the image for the right and left hilus, for all slices. all z - stack images were captured from coded slides, by an experimenter blinded to the condition of the animal. for image analysis, the z - stacks were merged into a single image (olympus v.3.2) and thresholded into a binary image using image j (nih v.1.49). as above, a second blinded reviewer randomly placed grids throughout these regions and used the image j software (nih v.1.49) to measure the mean grey values of the binary images. it should be noted that gfap+ cells at the border of the subgranular zone were excluded from analysis. the reason for this is that these cells typically have a very different appearance compared to cells within the hilus, because many of the cells at the subgranular zone border are progenitor (neuronal and/or astrocytic) cells in varying stages in the cell cycle. as such, these cells often appear vastly different than the hilar astrocytes, most of which lack the capabilities to give rise to newborn neurons. for all analysis, a spss was used to run student 's t - test to compare fpi and sham groups. data are reported as means with error bars representing standard error of the mean (sem). the appearance of dcx - labeled cells in the dentate gyrus of sham mice was relatively normal, whereas in fpi mice, the morphology and location of some of these cells appeared altered (figures 2(a), 2(b), 2(d), and 2(e)). analysis of the number of dcx - labeled cells in this region revealed no significant difference between the sham mice and the fpi mice (t = 0.645 ; p = 0.441, ns ; figure 2(c)). conversely, there was a significant increase in the number of immature granule cells in the hilus of fpi mice compared to sham mice (t = 10.961 ; p 2 weeks typically occurs with little to no seizure activity. eventually, most, if not all, of these rodents will go on to develop spontaneous epileptiform discharges that is analogous to temporal lobe epilepsy. in the pilocarpine model, as in our current study, hilar basal dendrite sprouting from immature granule cells is a prominent feature. of further interest is that, in the pilocarpine model, the hypertrophied astrocytes at the base of the granule cell layer were observed to express ccr2, which is the receptor for monocyte chemoattractant protein (mcp-1), also known as ccl2. signaling through the ccr2/ccl2 receptor / ligand has been shown to be involved in chemotactic guidance of neuroblast migration [7072 ]. considering that we have previously demonstrated an increase of ccl2 protein in our fpi model [5, 6 ], it is possible that this mechanism is involved in the aberrant sprouting of basal dendrites from the newborn neurons, as well as the ectopic migration of some of these granule cells into the hilus (figure 1). future studies are warranted to examine this possibility in conclusion, we demonstrate, for the first time, that radial glial fibers from gfap+ astrocytes at the base of the granule cell layer are chronically reduced following fpi and that the hypertrophied astrocytes in this region can provide an anatomical substrate for the aberrant growth and migration of immature neurons in the hippocampus. based on previous evidence of altered hippocampal function in response to such anatomical changes, future studies are needed to determine the potential of these alterations as targets for therapeutic intervention after tbi. | traumatic brain injury (tbi) is a widespread epidemic with severe cognitive, affective, and behavioral consequences. tbis typically result in a relatively rapid inflammatory and neuroinflammatory response. a major component of the neuroinflammatory response is astrocytes, a type of glial cell in the brain. astrocytes are important in maintaining the integrity of neuronal functioning, and it is possible that astrocyte hypertrophy after tbis might contribute to pathogenesis. the hippocampus is a unique brain region, because neurogenesis persists in adults. accumulating evidence supports the functional importance of these newborn neurons and their associated astrocytes. alterations to either of these cell types can influence neuronal functioning. to determine if hypertrophied astrocytes might negatively influence immature neurons in the dentate gyrus, astrocyte and newborn neurons were analyzed at 30 days following a tbi in mice. the results demonstrate a loss of radial glial - like processes extending through the granule cell layer after tbi, as well as ectopic growth and migration of immature dentate neurons. the results further show newborn neurons in close association with hypertrophied astrocytes, suggesting a role for the astrocytes in aberrant neurogenesis. future studies are needed to determine the functional significance of these alterations to the astrocyte / immature neurons after tbi. |
pleomorphic adenomas are benign salivary gland tumors, which predominantly affect the superficial lobe of the parotid gland. nature of the tumor can be explained on the basis of its epithelial and connective tissue origin.. surgical excision of the tumor mass forms the mainstay of treatment, with utmost care taken to preserve the facial nerve. this case report aims to throw light on an interesting case of pleomorphic adenoma of the parotid gland in a 50 years old female patient. the patient presented with a slowly progressing asymptomatic swelling on the left side of the face.. early diagnosis and treatment plan entails thorough history taking, clinical examination, coupled with radiographic and histopathological findings. pleomorphic adenoma (pa), also known as benign mixed tumor, is the most common salivary tumor, constituting up to two - thirds of all salivary gland neoplasms (1). mostly, pa is located in the parotid glands (85%), minor salivary glands (10%), and the submandibular glands (5%) (2). in the majority of cases, tumors originate in the superficial lobe. however, occasional cases may involve the deep lobe of the parotid gland (3) and the parapharyngeal space. minor salivary gland tumors are frequently encountered on the palate, followed by the lip, cheek, tongue and floor of the mouth (4). pa usually manifest as a slow progressing asymptomatic, parotid gland swelling without facial nerve involvement (5). they are best treated by a wide local excision with good safety margins and follow - up for at least 34 years (6). a 50 years old female patient reported to the outpatient department with a chief complaint of slow growing, painless swelling on the left side of face since 5 years. the swelling was initially small in size and had progressively increased with time to attain the present size. a well - defined, ovoid, multilobular swelling, 8 10 cm in diameter was seen on the left side of the face. the swelling had a superioinferior extent from left zygomatic arch to about 1 cm below the lower border of mandible and anteroposterior extent from mid body region to the posterior border of mandible. loss of wrinkling of the skin and engorged veins was also seen (figure 1). (a) frontal view and (b) lateral view of the face showing left sided facial swelling. a provisional diagnosis of benign tumor of the left parotid gland was taken into consideration. pleomorphic adenoma, warthin 's tumor and neuroma of the facial nerve (nerve sheath tumor) were considered as the most probable differential diagnosis. warthin 's tumor is usually seen in elderly males with a history of smoking, does not cause eversion of the ear lobe, located in the lower portion of the parotid (near angle of mandible), and 1015% cases show bilateral involvement. benign tumor of nerve sheath origin in the parotid gland poses difficulty in preoperative diagnosis because of the low frequency of occurrence (0.2% to 1.5%). also, preoperative diagnosis of a parotid tumor as neuroma seems challenging without accompanying facial nerve dysfunction. magnetic resonance imaging (mri) revealed a large (6.1 2.3 4.9 cm), well - defined, lobulated, heterogeneous lesion involving the left upper gingiva - buccal sulcus, left retromolar region and bilateral pterygoid muscles posteriorly. the lesion extended superiorly to the infratemporal fossa with infiltration of the infratemporal fat and caused bowing of the posterolateral wall of left maxillary sinus and laterally abutted the masseter muscle. lesion on t1 weighted mr image appeared hypointense and appeared hyperintense on t2 weighted mr images (figure 2). (a) axial mri - t1 weighted image showing a hypo intense lesion. fine needle aspiration cytology (fnac) was performed under local anesthesia and showed admixed epithelial, myoepithetial and mesenchymal tissue elements. after obtaining the informed consent of the patient, excision of the superior lobe of the left parotid gland along with the tumor mass was made. a modified blair incision was given to the left preauricular region ; platysma muscle and superficial musculoaponeurotic layer were dissected. the tumor was resected after separation from the facial nerve and the masseter muscle (figure 3) (a) blunt dissection with the exposed tumor mass. (b) intraoperative procedure showing the separation of tumor mass from the nerve bundles. histopathology revealed a well capsulated, highly cellular mass with interspersed epithelial cells and myoepithelial cells containing eosinophillic cytoplasm. chondroid and ductal areas along with fat and osteoid were also seen (figure 5). pleomorphic adenoma, myoepithelioma and adenoid cystic carcinoma were considered as the probable histologic differential diagnosis. the presence of chondromyxoid foci along with glanduloductal differentiation excluded the histological diagnosis of myoepithelioma. the characteristic features of chondromyxoid foci and glanduloductal differentiation confirmed the diagnosis of pleomorphic adenoma of the left parotid gland. (10x) (b) photomicrograph revealing the characteristic features of a pleomorphic adenoma includes islands and strands of epithelium in a myxoid stroma. (40x) the patient was periodically followed up for 3 years and no recurrences or complications were observed during this period (figure 6). (b) lateral view showing no recurrence of lesion after follow - up of 3 years. world health organization (1972) defined pa as a well - defined tumor characterized by its pleomorphic or mixed appearance. there is intermixing of the clearly recognizable epithelial component with mucoid, myxoid and chondroid component (7). although the lesion presents several histological features due to the different compounds with a myxoid or chondroid matrix, it is generally considered to be a benign neoplasm (8,9). the exact etiology is obscure although the incidence increases from 1520 years after exposure to radiation. few studies have suggested an association of the tumor with simian virus 40 (sv 40) (10). pa has a glandular origin in the head and neck region and usually manifests as a mobile, slow progressing, asymptomatic firm swelling that does not cause ulceration of the overlying mucosa (11). the majority of these tumors measure 26 cm in size when excised (12). however, large tumor may be seen as a single, irregular nodular mass stretching the overlying skin or mucosa (13). the tumor may weigh from several grams to more than 8 kilograms (14). parotid gland pa is usually seen below the lobule of the ear and overlying the angle of the mandible. facial nerve weakness is an infrequent sign in parotid tumors although large neglected tumors may present with facial nerve weakness (15, 16). oral retrotonsillar mass/ parapharyngeal space tumor may be a presenting sign in cases of deep lobe involvement (17). based on clinico - pathological and immune - histochemical features of 60 cases of pa in brazil, alves. reported that the tumor occurred commonly between the 3 and 5 decades of life, and 37/60 (62%) of the affected patients were women (18). our patient was a 50 years old female who presented with a slowly enlarging, multilobular, asymptomatic swelling on the left side of the face since 5 years. the swelling caused stretching of the overlying skin with visible engorged veins and slight deflection of the left ear lobule. grossly, the excised tumor mass measured 8 10 12 cm in diameter and weighed 1.8kgs. imaging modalities such as computed tomography (ct) and magnetic resonance imaging (mri) are essential aids in diagnosis. mri is favored on the basis of better soft tissue delineation, detailed tumor margin description and the tumor relationship with the surrounding structures (5). mri findings in the present case were suggestive of a large well - defined, heterogeneous lesion, which appeared hypointense on t1 weighted mr image and hyperintense on t2 weighted mr images. ultrasound imaging helps to differentiate cystic lesions from solid parotid masses, and is also used for assessment of intra - capsular versus extra - capsular tumors. pa 's have been identified by ultrasound based on their distinct margins and polycyclic shape (19). ultrasonographic findings of the present case showed a hypoechoic area in the left parotid gland. fnac is a reliable procedure that can guide the surgeon to choose the right surgical approach (20, 21). the procedure is usually performed following diagnostic imaging to rule out a vascular lesion although it is not the first choice diagnostic tool (22). the present case showed a combined pattern of epithelial, myoepithetial and mesenchymal components on fnac. the histopathology presents varied morphological patterns, showing epithelial and myoepithelial cells with interspersed areas of mesenchymal differentiation. epithelial cells typically form duct - like structures associated with non - ductal cells presenting varying shapes and forms. myxoid, cartilaginous, hyaline, or osseous differentiation is appreciated in the stromal component. the stroma is presented as a mixture of gland - like epithelium and mesenchyma - like tissue in varying proportions (13). as pleomorphic adenoma exhibits a varied histopathologic presentation, it may be confused histopathologically withmyoepithelioma, adenoid cystic carcinoma, mucoepidermoid carcinoma and basal cell adenoma. myoepitheliomas may be considered as a variant of pleomorphic adenoma, but lacking the typical feature of glandulo ductal differentiation (23). another characteristic feature of myothelioma is the absence of chondromyxoid or chondroid foci (24). adenoid cystic carcinoma shows epithelial and myoepithelial differentiation in three forms : cribriform, tubular, and solid (25). however, the infiltrative growth pattern and tendency for perineural invasion are the salient features of adenoid cystic carcinoma. the intermediary cells in mucoepidermoid carcinoma show similarity to the basal / myoepithelial cells of pleomorphic adenoma. although the intermediary cells have the potential to produce the extracellular material, they lack the ability to create the myxochondroid stroma. also, squamous differentiation (when present in pleomorphic adenoma) is generally well developed and may show keratinisation. this feature is less evident in carcinoma (26). basal cell adenoma is a subtype of pleomorphic adenoma, and was previously termed as monomorphic adenoma. the tumor can be histologically differentiated from pleomorphic adenoma by the absence of chondromyxoid stroma and the presence of a uniform basaloid epithelial pattern. histopathological features in the current case showed salient features of pleomorphic adenoma. a well - capsulated cellular mass of sheets and islands of epithelial cells and rounded myoepithelial cells, along with myxomatous background and ductal architecture, was clearly evident. aggressiveness and extent of the tumor mass and its relation with the facial nerve form the important criteria which dictate the choice of treatment of pleomorphic adenoma of the parotid gland. enucleation, enucleoresection and superficial or total parotidectomy with preservation of the facial nerve formed the mainstay of surgical treatment (27). in the present case, superior lobe of the left parotid gland with the tumor mass was excised with utmost care to preserve the facial nerve branches. pleomorphic adenomas need to be managed diligently as they have a tendency for recurrence and malignant transformation. rupture of the capsule and subsequent tumor spillage during excision are attributable risk factors for recurrence. up to 10% cases show malignant transformation and features predictive of malignant change include advancing age, massive tumor size, a long duration of the mass, occurrence in submandibular salivary gland, and hyalinized connective tissue (28). the patient in the current case was thoroughly followed up for a period of 3 years and no signs of recurrences were observed during the follow up. | backgroundpleomorphic adenomas are benign salivary gland tumors, which predominantly affect the superficial lobe of the parotid gland. the pleomorphic nature of the tumor can be explained on the basis of its epithelial and connective tissue origin. the tumor has a female predilection between 3050 years of age. slowly progressing asymptomatic swelling is the usual presentation of the tumor. surgical excision of the tumor mass forms the mainstay of treatment, with utmost care taken to preserve the facial nerve.case detailsthis case report aims to throw light on an interesting case of pleomorphic adenoma of the parotid gland in a 50 years old female patient. the patient presented with a slowly progressing asymptomatic swelling on the left side of the face. there is also a special emphasis to a detailed review of literature.conclusionsalivary gland neoplasms can occur at any site where salivary tissue is present. pleomorphic adenoma is the commonest salivary gland tumor characterized by diverse histomorphological features. early diagnosis and treatment plan entails thorough history taking, clinical examination, coupled with radiographic and histopathological findings. |
a technique of orthotopic rat liver transplantation has been shown in a recent journal of visualized experiments paper. portal vein and infra - hepatic vena cava anastomoses were performed using the quick - linker assisted cuff technique. this technique was chosen among other revisions of the original kamada 's technique, as it allows for easier and quicker anastomoses, results in a better hemodynamic, and can be implemented with a shorter learning curve. the quick - linker technique requires the use of a handle, an approximator and cuffs, all of which can be designed from common laboratory material according to the technique described in the present report. drill a 2 mm hole with a spherical diamond bit, mounted on a high - speed drill. widen the hole with fusiform or conic diamond bits. figures 1 and 2 can be used as stencils. convert the drill into a mini bench grinder and cut off half of one branch under the microscope using the high - speed mini bench grinder. make symmetrical grooves on both sides to allow for the handle to slide in completely. cut a longitudinal slit in the long arm and check that the center of the long arm and a well - positioned handle are on a same axis. make the branch as thin as possible and round off the piece with the low speed rotating brush. take fine - bore polyethylene tubing and round off one edge with an nr 10 scalpel. design a grove 0.5 mm from the edge, and carefully cut out a slope going down to the grove. drill a 2 mm hole with a spherical diamond bit, mounted on a high - speed drill. widen the hole with fusiform or conic diamond bits. figures 1 and 2 can be used as stencils. convert the drill into a mini bench grinder and the approximator is obtained by modifying straight surgical klemmer 's or kocher 's forceps. cut off half of one branch under the microscope using the high - speed mini bench grinder. make symmetrical grooves on both sides to allow for the handle to slide in completely. cut a longitudinal slit in the long arm and check that the center of the long arm and a well - positioned handle are on a same axis. make the branch as thin as possible and round off the piece with the low speed rotating brush. take fine - bore polyethylene tubing and round off one edge with an nr 10 scalpel. design a grove 0.5 mm from the edge, and carefully cut out a slope going down to the grove. this problem was due to the fact that the ring of the handle was too narrow, and it has been solved by setting the narrowest part of the handle ring at 0.5 mm. if printed with a scale 1:1 can be used to guide the handle shaping. click here to view larger figure. if printed with a scale 1:1 can be used to guide the handle shaping. click here to view larger figure. graft 's v.porta should be secured to the central groove, while recipient 's vessel to the lateral one. the present report describes the design and building of the quick - linker system for easier rat liver transplantation. rat liver transplantation is a popular model with 125 to 180 related papers published yearly since the early 1990 's (www.pubmed.com). it allows for a wide range of experiments including the exploration of immunological and graft preservation issues. the use of the " quick - linker " kit allows for easier and quicker anastomoses with guaranteed intima - to - intima contact. a detailed description and discussion of the technical steps of a rat liver transplantation the quick - linker kit can be built at low price from common laboratory material. the main challenge encountered has been related the breakdown of one handle during the final brushing, and that problem has been solved by setting the narrowest part of the handle ring at 0.5 mm (figures 1 and 2 show appropriate sizes). regarding the blade quality, only stainless steel should be considered. although slightly less flexible compared to the average carbon steel blade, stainless steel blades do not develop rust, allowing a lifetime use of the handles. of note, the design of the current handles and cuffs is the result of a process, which has led to the proposed sizes, allowing for the most efficient anastomoses. minimal variations can be tolerated in terms of length, with a usual length of about 4 mm (figures 3 and 4). regarding the approximator, the selected kocher 's forcep should have handles at least 4 cm from the fulcrum. this allows for a safe closure of the rack outside the animal 's abdomen. overall, the proposed device can allow easier vein anastomoses for the transplantation of liver and other types of grafts in rats. | orthotopic rat liver transplantation is a popular model, which has been shown in a recent jove paper with the use of the " quick - linker " device. this technique allows for easier venous cuff - anatomoses after a reasonable learning curve. the device is composed of two handles, which are carved out from scalpel blades, one approximator, which is obtained by modifying kocher 's forceps, and cuffs designed from fine - bore polyethylene tubing. the whole process can be performed at a low - cost using common laboratory material. the present report provides a step - by - step protocol for the design of the required pieces and includes stencils. |
the inflammasomes are a group of cytosolic protein complexes that function as a molecular platform for caspase-1-dependent proteolytic maturation and secretion of interleukin (il)-1 and il-18 (1 - 4). of the members of the nucleotide binding oligomerization domain (nod)-like receptor (nlr) inflammasomes, the nucleotide - binding domain and leucine - rich repeat protein 3 (nlrp3) inflammasome is the most extensively studied. activation of the nlrp3 inflammasome in response to diverse pathogenic and endogenous stimuli leads to the assembly of protein components of the complex : the cytoplasmic innate receptor nlrp3, the adaptor apoptosis - associated speck - like protein containing a card (asc), and the effector caspase-1 (1, 4, 5). the nlrp3 inflammasome is activated by two steps : a priming step is required to induce expression of both nlrp3 and pro - il-1 ; and a second step triggers assembly of the nlrp3 inflammasome after exposure to microbial toxins and ionophores or endogenous danger molecules (6, 7). in addition, the nlrp3 inflammasome is activated during infection of macrophages with various bacterial, viral, and fungal pathogens and is required for host immune defense to these pathogenic infections (6 - 8). the potent inflammatory activities of il-1 and il-18 by inflammasome activation are pathogenic in nlrp3-associated autoinflammatory disorders (5, 9). nlrp3 inflammasome activation can lead to excessive inflammatory responses and cell death, which is potentially hazardous to host defense during a variety of bacterial infections, while numerous bacteria and their components can activate or modulate nlrp3 inflammasome activation. in this review, we will examine how the nlrp3 inflammasome is activated and contributes to host defense during diverse bacterial infections. we will further discuss current knowledge of the strategies by which various pathogenic bacterial virulence factors modulate the nlrp3 inflammasome. the innate immune system rapidly recognizes and provides an immediate host defense response to microbial and endogenous stimuli. the germ - line encoded pattern recognition receptors (prrs) specific subsets of prrs, nod - like receptor (nlr) and the pyhin protein families, detect molecular patterns in the cytosol and activate the formation of supramolecular complexes, termed inflammasomes. the nlrp3 inflammasome, the best - characterized family member of inflammasomes, is a multi - protein complex composed of nlrp3, asc, and caspase-1 (1 - 4). the protein structure of nlrp3 contains an n - terminal pyrin domain (pyd), a central nacht (naip, ciita, het - e, and tp1), and a c - terminal leucine - rich region (4). a recent study with high resolution structure analysis showed that nlrp3 has a specific disulfide bond between cys-8 and cys-108 that may participate in regulation of nlrp3 activity by reactive oxygen species (10). after sensing signals, the three components - nlrp3, asc, and pro - caspase-1-assemble to form a typical multimeric inflammasome complex, which results in activation of caspase-1, leading to processing of pro - il-1 and pro - il-18 to their mature, biologically active, forms (3 - 5). during this activation, the adaptor protein asc, which contains an n - terminal pyd and a c - terminal caspase activation and recruitment domain (card), plays an important role in assembly of the nlrp3 inflammasome through its interaction with nlrp3 via a homotypic pyd interaction. recent studies have reported that the asc pyd domain is also required for its self - association, as well as interaction with nlrp3 (11). the first signal mediates transcriptional activation of pro - il-1 and nlrp3 through recognition of ligands for toll - like receptors (tlrs), il-1 receptor, and tumor necrosis factor (tnf) receptor. the second signal leads to inflammasome oligomerization and activation, thereby causing maturation and secretion of il-1 and il-18. the second signal may include a variety of pathogen - associated molecular pattern molecules (pamps) or damage - associated molecular patterns (damps) (2, 6, 9, 12). several important second signals have been reported ; i.e., plasma membrane disruption for bacterial toxins and atp ; internalization of particulate activators by phagocytosis (1) ; k efflux and pore formation by extracellular atp or bacterial toxins (13) ; or lysosomal destabilization with release of protease cathepsin b into the cytoplasm by particulate activators including silica, alum, fibrillar amyloid- protein, or uric acid crystals (1). a recent study has shown that liposomes trigger activation of the nlrp3 inflammasome through mitochondrial reactive oxygen species and calcium influx via the transient receptor potential melastatin 2 channel (14). during infection, bacterial pathogen escape from the lysosome after phagocytosis is an important signal inducing nlrp3 inflammasome activation (15). however, activation of the nlrp3 inflammasome appears to be dependent on various cell types and stimuli. for example, the nlrp3 inflammasome can be spontaneously activated by primary stimulation of human monocytes, during which stimulation of certain pamp and damp signals provide sufficient signals to trigger mature il-1 secretion (16). the general concepts of nlrp3 inflammasome activation and the two - signal model are shown in fig. 1. emerging evidence has also revealed involvement of other mechanisms / signaling molecules, beyond the core machinery of the inflammasome complex, in inflammasome activation. a recent study showed that double - stranded rna - dependent protein kinase (pkr, also known as eif2ak2) plays an important role in inflammasome activation through physical interaction with several inflammasome components, including nlrp3 (17). another study showed that guanylate binding protein (gbp) 5, a member of the interferon (ifn)-inducible gbp family, can physically interact with the pyrin domain of nlrp3 and contributes to oligomerization of the nlrp3 inflammasome complex (18). to activate nlrp3 inflammasome, it was suggested that the adaptor asc on mitochondria should be moved to nlrp3 on the endoplasmic reticulum (19, 20). a recent study proposed a spatial assembly model of microtubule - driven approximation between asc and nlrp3, which depends on a low intracellular concentration of nad+ and sirt2-dependent deacetylation of microtubules (20). the nlrp3 inflammasome - activating signals trigger the recruitment of nlrp3 to mitochondria, and this is dependent on mitochondrial antiviral signaling protein (mavs) (21), the mitochondrial outer membrane protein that was originally reported as a signaling adaptor leading the production of type 1 interferon (ifn) (22, 23). in addition, voltage - dependent anion channels (vdac) is essential for nlrp3 inflammasome activation through the uptake of ca into the mitochondria from mams (19). the current model of nlrp3 inflammasome activation and its assembly we discuss several bacterial pathogens and their products that induce nlrp3 inflammasomes in vitro and in vivo (fig. earlier studies showed that gram - positive staphylococcus aureus or listeria monocytogenes, but not salmonella typhimurium or francisella tularensis, require nlrp3 inflammasome activation (24). in addition, shigella flexneri can cause nlrp3-dependent necrosis ; i.e., pyronecrosis, in macrophages ; however, this necrotic death is not caspase-1 and il-1 dependent (25). other gram - negative enteropathogens, such as enterohemorrhagic escherichia coli (ehec) and citrobacter rodentium, induce nlrp3 inflammasome activation in bone marrow - derived macrophages in a toll - il-1 receptor (tir)-domain - containing adapter - inducing interferon- (trif)-dependent pathway. interestingly, trif plays an essential role in the activation of caspase-11 in nlrp3 inflammasome activation during gram - negative bacterial infection (26). gram - negative diplococcic neisseria gonorrhoeae infection promotes nlrp3 inflammasome activation through activation of cathepsin b and leads to nlrp3-dependent monocytic cell death (27). although mycobacterium tuberculosis (mtb) resists inflammasome activation (28), the atypical mycobacterium mycobacterium abscessus can induce the maturation and secretion of il-1 in human monocyte - derived macrophages (29). however, there are controversial results in mtb - induced nlrp3 inflammasome activation. in human monocytes / macrophages, the m. tuberculosis protein esat-6 was reported to stimulate nlrp3 inflammasome by disrupting cell membranes and allowing of ag85 to access cytosol (30). moreover, recent studies have shown that murine microglia primed with conditioned media from cultures of macrophages infected with mtb induce caspase-1 activation and il-1 secretion after mtb stimulation in a nlrp3- and asc - dependent manner, suggesting a role for microglialeukocyte interactions in the pathogenesis of tuberculous meningitis (31). interestingly, a recent study has shown that orientia tsutsugamushi, a pathogen causing scrub typhus, induces asc inflammasome activation to secrete il-1 in macrophages ; however, this was not dependent on nlrp3, nlrp4 or aim2 (32). chlamydia pneumoniae, a common respiratory pathogen in atypical pneumonia, induces maturation and secretion of il-1 in unprimed bone marrow - derived macrophages during productive infection. c. pneumoniae - dependent caspase-1 activation and il-1 maturation were dependent on nlrp3/asc (33). in addition, a variety of bacterial components induce nlrp3 inflammasome activation through diverse mechanisms. several bacterial toxins ; e.g., nigericin (streptomyces hygroscopicus), valinomycin (several streptomyces strain), maitotoxin (gambierdiscus toxicus), aerolysin (aeromonas hydrophila) and listeriolysin o (l. monocytogenes), trigger the nlrp3 inflammasome pathway through pore formation and plasma membrane disruption, as mentioned above (24, 34). the -hemolysin of group b streptococci, a frequent life - threatening systemic inflammation and meningitis, can induce secretion of il-1, as well as pro - il-1 synthesis, in bone marrow - derived dendritic cells. interestingly, the production of il-1 and pro - il-1 can be efficiently blocked by bafilomycin treatment, suggesting that group b streptococci - induced inflammasome activation is dependent on bacterial internalization and phagosomal acidification (35). in addition, the pneumolysin virulence factor of s. pneumoniae can induce the nlrp3 inflammasome, leading to enhanced secretion of cytokines, including il-17a and ifn- (36). recent studies have also reported that the s. aureus virulence factors -, -, and -hemolysin can activate the nlrp3 inflammasome during s. aureus pneumonia, although pulmonary injury induced by live s. aureus is not dependent on il-1 signaling (37). moreover, s. aureus pore - forming toxin pvl activates the nlrp3 inflammasome and subsequent pyronecrosis (38). a recent study showed that td92, a surface protein of treponema denticola, one of the major periodontopathogens, can induce nlrp3 inflammasome activation in macrophages through a direct interaction with the host cell membrane integrin 51 (39). moreover, the cholera toxin b of vibrio cholerae can induce non - canonical nlrp3 inflammasome activation in a caspase-11-dependent manner (40). the effector yopj of yersinia pestis, the causative agent of plague, also leads to activation of the nlrp3/asc / capsase-1 inflammasome in macrophages through a mechanism dependent on k efflux (41). bacterial mrna released from the lysosome can be sensed by nlrp3 inflammasome in the cytosol through detection of a special class of viability - associated pamps (42). the lipooligosaccharide structure of n. gonorrhoeae potently activates the nlrp3 signaling system, suggesting that the lipooligosaccharide structure is involved in the pathogenesis of gonococcal infections (27). accumulated knowledge of bacterial pathogens, their components, and the nlrp3 inflammasome activation will evoke a new avenue for understanding the pathogenesis, and/or developing potential strategies to treat, bacterial infections. extensive research has revealed that nlrp3 inflammasome activation contributes to host defense against numerous bacterial infections. mice lacking nlrp3, asc, or caspase-1 were more susceptible to group b streptococcal infection than wild - type mice, suggesting a critical role for the nlrp3 inflammasome in successful anti - streptococcal responses (35). streptococcal pneumolysin - induced nlrp3 inflammasome activation contributes to protective immunity through induction of il-17a and ifn- secretion against respiratory infection with s. pneumoniae (36). using a murine model of melioidosis, previous studies showed that the inflammasome components asc, caspase-1, and nlrp3 are critical for host defense against lung infection with burkholderia pseudomallei through synthesis and secretion of il-1 (43). in addition, mice lacking the inflammasome components nlrp3, nlrc4, and caspase-1 exhibited increased susceptibility to citrobacter rodentium infection, which is similar to human infection with enteropathogenic and enterohemorrhagic e. coli (44). in addition, il-1- and il-18-null mice also had increased bacterial burdens and showed an exacerbated pattern of histopathology (44). moreover, mice lacking both nlrp3 and nlrp4 are highly susceptible to s. typhimurium infection, suggesting the redundant roles of the two nlrs in host innate defense against salmonella infection (45). however, a recent study has shown that caspase-11-not nlrp3, nlrc4, or asc - is critical for host defense and enhanced clearance of bacteria using a s. typhimurium mutant strain (sifa), which can aberrantly enter the host cell cytosol (46). during chronic infections caused by mtb, inflammasome activation and generation of il-1 although aim2 inflammasomes appear to be protective against mtb infection (47), nlrp3 inflammasome activation is associated with the immunopathology of tuberculosis, rather than host defense against mtb infection (48, 49). in mycobacterium kansasii infection, nlrp3 inflammasome activation and secreted il-1 derived from caspase-1 activation play an important role in host defense and restriction of intracellular m. kansasii (50). moreover, gbp5-deficient mice are defective in caspase-1 cleavage and maturation of il-1/il-18 in vitro and impaired host defense against listerial infection in vivo (18). in this context, a recent study demonstrated that a network of immune cell populations spatially organized in lymph nodes can efficiently interact with lymphatic sinus - lining sentinel macrophages, and respond rapidly to inflammasome - induced il-18 produced by these phagocytes, leading to lymphoid cell ifn- secretion, which limits systemic spread of the pathogens (51). thus, inflammasome activation is important for a local and acute innate immune response to limit deep invasion of the lymph nodes by pathogenic bacteria (51). although the inflammasome activation plays a key role in limiting the spread of an invading pathogen, it can be deleterious due to tissue damage associated with chronic inflammatory responses. when inflammasome activation functions improperly or is uncontrolled, chronic inflammation may develop into various immune disorders, including crohn 's disease, ulcerative colitis, or arthritis (52). il-1 and il-18 are potent proinflammatory cytokines that are required for host defense against diverse infections, and simultaneously are involved in various inflammatory pathologies. in addition to processing il-1, inflammasome activation often results in the caspase-1-mediated pyroptotic form of cell death, which leads to bacterial exposure, efficient uptake, and killing by neutrophils (53). however, repeated rounds of pyroptosis can lead to severe inflammatory changes and significant damage to host tissues, particularly in the absence of downstream killing by neutrophils (53). trif signaling is essential for nlrp3 inflammasome activation by several gram - negative bacteria, and in detrimental inflammation associated with enteric infections (26). earlier studies showed that il-1 secreted by epithelial cells after chlamydia trachomatis infection is associated with tissue damage to the fallopian tube, potentially leading to infertility (54). it was also reported that c. trachomatis infection of human monocytes triggers secretion of il-1 through nlrp3 inflammasome activation, which induces an inflammatory response to this pathogen (55). in genital infection with chlamydia muridarum, mice lacking nlrp3, nlrc4, and asc showed no reduction in oviduct pathology compared with control mice, suggesting a limited role for the inflammasome pathway during genital chlamydial infection (56). in helicobacter pylori infection, il-1 is primarily proinflammatory, whereas il-18 counteracts the inflammatory responses induced by il-1 and th17 (57). interestingly, two caspase-1 substrates act together to achieve balanced control of helicobacter infection and avoid excessive gastric pathology (57). the gram - negative spirochete, borrelia burgdorferi, a pathogen of chronic lyme disease - associated arthritis, activates the inflammasome in a manner dependent on asc and caspase-1, but not nlrp3 (58, 59). in addition, il-1 is a major pathogenic mediator of lyme arthritis and is not required for control of lyme borreliosis in murine models (59, 60). activation of the nlrc4 inflammasome by the flagella of pseudomonas aeruginosa is deleterious to bacterial clearance in acute pneumonia and associated with increased cell death (61). in corneal infection with p. aeruginosa, caspase-1 deficiency leads to inhibition of cytokine and chemokine production, and reduced infiltration of polymorphonuclear leukocytes, suppressing corneal damage and inflammation (62). these studies suggest that targeting the inflammasome limits the pathological responses during p. aeruginosa infection. in mycobacterium marinum infection, the esx-1 (type vii) secretion system, a major virulence determinant, promotes nlrp3 and the asc - dependent inflammasome. however, nlrp3 inflammasome activation by m. marinum is responsible for host - detrimental effects without restricting bacterial growth (48). similarly, the esx-1 secretion system and esat-6 proteins induce nlrp3 inflammasome activation, which leads to necrotic death of thp-1 human macrophages via a syk tyrosine kinase (63). in vivo, an mtb aerosol infection study indicated that neither nlrp3 nor casp-1 null mice show any differences in pulmonary bacterial burden or long - term survival, when compared with wild - type mice (64). however, asc appears to be important in host protection against chronic mtb infection because asc - deficient mice exhibit reduced survival and defective granuloma formation (64). moreover, killed mtb, the immunostimulatory component in complete freund 's adjuvant, promotes experimental autoimmune encephalomyelitis through activation of the inflammasome complex in dendritic cells and increased il-17 production by cd4 and t cells (65). these findings suggest that modulation of inflammasome activation may prevent tissue damage and host death in response to a variety of bacterial infections. bacteria use diverse strategies to hijack or manipulate inflammasome activation in host cells (66). earlier studies indicated that p. aeruginosa exos, a type iii effector protein, negatively regulates caspase-1-dependent il-1 maturation through a mechanism dependent on its adp ribosyltransferase activity (67). in addition, yersinia yope and yopt prevent the activation of caspase-1 through inhibitory effects on rac1 (68). the yersinia type iii secreted effector protein, yopk, can inhibit inflammasome activation through interaction with the t3ss translocon (69). detection of the yersinia type iii secretion system (t3ss) by nlrp3 and nlrc4 induces the assembly of inflammasomes, and promotes bacterial clearance (69) ; yopk - mediated inhibition of inflammasome activation may have detrimental effects on host defense. in addition, legionella pneumophila can manipulate asc levels to modulate inflammasome and nf-b pathway activation, thus evading immune evasion and promoting growth (70). when asc was over - expressed in cells to maintain constant levels of protein during infection, caspase-1 activation and restriction of legionella growth resulted (70). the zinc metalloprotease zmp1 of mtb is involved in the prevention of inflammasome activation by mtb. zmp1-deleted mtb enhances the secretion of il-1 through inflammasome activation, which plays a role in mtb phagosomal maturation and enhancement of mycobacterial clearance in murine aerosol - infection models (28). the francisella tularensis ripa protein inhibits secretion of il-1, il-18, and tnf- by macrophages to escape from host immunity, and an f. tularensis ripa - deletion mutant (lvsripa) induced higher levels of inflammatory cytokines in animals (71). collectively, these data demonstrate that a class of bacterial components modulates inflammasome recognition and assembly to evade the host immune system and promote bacterial survival within host cells / tissues. nlrp3 inflammasome activation is crucial for recognition of cytosolic pathogenic microbes and allows the host to induce an appropriate protective innate immune response. a two - signal theory of triggering nlrp3 inflammasome assembly and activation has been proposed. however, evidence of activation or regulation of the inflammasome complex by other mechanisms / molecules has accumulated. interestingly, many bacteria and their products can manipulate and/or activate the nlrp3 inflammasome complex. future studies will identify additional host molecules or bacterial components that activate the inflammasome pathway. it is clear that nlrp3 inflammasome activation contributes to host defense during a variety of bacterial infections. however, chronic inflammation accompanied by dysregulated inflammasome activation during persistent infection may result in detrimental effects and immunopathologies. in addition, many pathogenic bacteria subvert the nlrp3 inflammasome pathways, often through inhibition of, or interaction with, the inflammasome core machinery by virulence factors. in future research, additional virulence factors and mechanisms by which successful microbial pathogens modulate host inflammasome pathways will be clarified. current knowledge of inflammasome activation or regulation by pathogens or their components must be expanded using appropriate genetic and/or animal models. understanding how pathogens subvert host inflammasome signaling pathways will contribute to development of interventions to control bacterial infection and provide protective innate immunity to the host. | the inflammasome is a multi - protein complex that induces maturation of inflammatory cytokines interleukin (il)-1 and il-18 through activation of caspase-1. several nucleotide binding oligomerization domain - like receptor family members, including nlrp3, recognize unique microbial and danger components and play a central role in inflammasome activation. the nlrp3 inflammasome is critical for maintenance of homeostasis against pathogenic infections. however, inflammasome activation acts as a double - edged sword for various bacterial infections. when the il-1 family of cytokines is secreted excessively, they cause tissue damage and extensive inflammatory responses that are potentially hazardous for the host. emerging evidence has shown that diverse bacterial pathogens or their components negatively regulate inflammasome activation to escape the immune response. in this review, we discuss the current knowledge of the roles and regulation of the nlrp3 inflammasome during bacterial infections. activation and regulation of the nlrp3 inflammasome should be tightly controlled to prevent virulence and pathology during infections. understanding the roles and regulatory mechanisms of the nlrp3 inflammasome is essential for developing potential treatment approaches against pathogenic infections. |
traumatic eye injuries (tei) involved about 3% of cases visited in emergency departments (ed) of developing countries (1). it is estimated that trauma causes blindness and visual impairment in many referees of ophthalmic emergency (2). most of these injuries are hard to diagnose in initial ed assessment. on the other hand, orbital computed tomography (oct) scan, magnetic resonance imaging (mri), ultrasonography, and slit - lamp are introduced as the most important imaging tools to evaluate tei (4 - 8). although mri presents high accurate and quality images, it is an expensive and time - consuming test, which is not accessible in all emergency centers. optical methods are cost effective and easy to use, but they have a low accuracy in evaluation of injuries to optical structures such as sclera, pupil, and cornea, as well as hemorrhage. while ultrasonography, known as a non - expensive, accessible, and safe method, has a high accuracy in evaluation of injuries to optical structures (3). when the patient is non - cooperative for fundoscopic tests or suffers from severe edema, chemosis, or hyphema, eye ultrasonography can present valuable and useful information to the physician (9). but, it should be mentioned that diagnostic accuracy of ultrasonography is highly dependent to operator proficiency and it is not reliable in detecting parenchymal injuries (10). lens dislocation is one of the critical cases of ophthalmic emergencies referred to partial or complete dislocation of eye lens from its natural location to posterior chamber. the fast diagnosis of such an injury can be greatly help improving the patients ' outcomes. diagnostic accuracy of ultrasonography in assessment of traumatic lens dislocation is evaluated in a few studies. whereas some of investigations suggested oct as an accurate method (12), others consider ultrasonography as a valuable diagnostic tool in detection of lens dislocation, especially in lack of oct (13 - 16). however, the low number of studied samples in this field is the critical limitation. therefore, the present study was performed to evaluate the diagnostic value of ultrasonography versus oct in traumatic lens dislocation. study design and setting : in this cross - sectional study the findings of ultrasonography and oct of multiple trauma patient with head trauma, referred to imam reza hospital, tabriz, iran, from july 2013 to june 2014, have been compared. octs (as a gold standard tool) were interpreted by a radiologist who was blind to the aim of study. the protocol of the present project was studied and confirmed by the ethical committee of tabriz university of medical sciences. the study protocol did not have any interference with treatment process and no danger threatened patients. the collected forms were anonymous and for each patient an especial code registered. before the study, patients filled the personal consent form. in this study, patients with irregularity of the globe contour, and lack of ability to cooperate for imaging were excluded from the study., the least needed samples were achieved 121 persons noticing to at least 93% sensitivity of ultrasonography to detect tei, 15% prevalence (12), 95% confidence interval (=0.05), 90% power (= 0.1), and maximum error of 1% (d= 0.01). the emergency medicine specialist was prospectively assessed demographic data (age, sex, and trauma mechanism), clinical symptoms of each patient, and registered them in data gathering form. ultrasonography was done using bedside machine (gh healthcare ; logiq 200, pro series ; korea) with 10 mhz micro - convex linear transducer in sagittal and transverse plane and closed eye technique with water - soluble gel. the findings of oct was interpreted by a radiologist blind to the goal of study and recorded. oct was done using a toshiba asteion 16 slices scanner with considering the one - millimeter distance between image slices. statistical analysis data were entered to spss version 21.0 and imaging findings reported as the frequency and percentage. for evaluating the quality of ultrasonography receiver operating characteristic (roc) curve was drown and finally sensitivity, specificity, accuracy, positive likelihood ratio, negative likelihood ratio, positive predictive value, and negative predictive value calculated. cohen 's kappa coefficient was presented to assess the agreement of ultrasonography with oct findings. the receiver operating characteristic (roc) curve of ultrasonography in detection of traumatic lens dislocation clinical and demographic characteristics of studied patients diagnostic accuracy of ultrasonography in detection of traumatic lens dislocation ci : confidence interval 130 patients with the mean age of 35.418.0 were entered to the study (75.4% male). five patients (3.8%) had systolic blood pressure below 90 and 32 ones (24.6%) suffered from tachycardia. gcs of 21 patients (16.15%) was below nine and in 35 ones (26.9%) within 9 - 13 (table 1). the most common mechanism of accident in the patients was related to car (39.2%), motorcycle (27.7%), and pedestrian accidents (15.4%), respectively. the findings of ultrasonography in 11 cases were compatible with oct with two false negative cases, while two false positive were found by ultrasonography. the area under the roc curve of ultrasonography in traumatic lens dislocation was achieved 0.9145 (95% cl : 0.81 - 1.0) (figure 1). sensitivity and specificity of ultrasonography were 84.6% (95% cl : 53.7 - 97.3) and 98.3% (95% cl : 93.3- 99.7), respectively. positive and negative likelihood ratio of this diagnostic test in detection of lens dislocation were calculated 49.5 (95% cl : 12.3 - 199.4) and 0.15 (95% cl : 0.04- 0.56), respectively (table 2). cohen 's kappa coefficient of 0.83 (95% cl : 0.66 - 1.0 ; p<0.0001) was representative of excellent agreement of these two tests. the findings of the present study showed 84.6% sensitivity and 98.3% specificity of eye ultrasonography in detection of traumatic lens dislocation., it seems that in cases, which oct is not possible, ultrasonography, could be an acceptable alternative for evaluation of lens dislocation. there are a few study assessed the diagnostic value of ultrasonography in detection of lens dislocation. imran. revealed that sensitivity and specificity of ultrasonography are 75% and 97.9% in diagnosis of lens dislocation, respectively (12). blavis and colleagues by study of 61 patients observed two cases of lens dislocation both of which was detected by ultrasonography (13). the trivial difference between previous studies and the present project could be due to operator - dependent of ultrasonography. on the other hand, reaching a certain diagnosis is time consuming and ophthalmic consultants are not present in all hospitals. all of these issues maybe lead to delay in detection and management whereas eye ultrasonography can be helpful in such situations in addition, eye ultrasound transducers for eye ultrasonography are different from common transducers applied in the ed (13). in addition, it should be mentioned that clinical evaluation of patients with tei is painful and not possible in many cases. although there is no information regarding the negative effect of entered energy by high frequency ultrasonography on eye structures, more investigation is required in this area. one of the limited studies in this field revealed that using ultrasonography with frequency of 10 to 60 mhz did not have any destructive effects on visual field and histological findings. but, the recent study showed that using ultrasonography causes to increase the internal temperature of eye (17). however, researchers expressed that this test should be used preciously until finding appropriate solutions to the above problems. the finding of this project was representative of 84.6% sensitivity, 98.3% specificity, and 96.9% accuracy of ultrasonography in detection of traumatic lens dislocation. it seems that in cases, which oct is not possible, ultrasonography, could be an acceptable option to assess traumatic eye injuries. all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors. | introduction : traumatic eye injuries (tei) involved about 3% of cases referred to the emergency departments of developing countries. lens dislocation is one of the critical cases of ophthalmic emergencies. the present study was aimed to evaluate the diagnostic accuracy of ultrasonography in detection of traumatic lens dislocation. methods : in this cross - sectional study the findings of ultrasonography and orbital computed tomography (oct) of head and face trauma patients, referred to imam reza hospital, tabriz, iran, from july 2013 to june 2014, have been compared. the sensitivity, specificity, positive and negative likelihood ratio, positive and negative predictive value, and accuracy of ultrasonography were calculated. cohen 's kappa coefficient was presented to assess the agreement of ultrasonography with oct findings. results : one hundred thirty patients with the mean age of 35.418.0 were evaluated (75.4% male). sensitivity and specificity of ultrasonography were 84.6% (95% cl : 53.7 - 97.3) and 98.3% (95% cl : 93.3- 99.7), respectively. in addition, positive and negative likelihood ratio were calculated 49.5 (95% cl : 12.3 - 199.4) and 0.15 (95% cl : 0.04- 0.56), respectively. cohen 's kappa coefficient of 0.83 (95% cl : 0.66 - 1.0 ; p<0.0001) was representative of excellent agreement of these two tests. conclusion : the finding of this project was representative of 84.6% sensitivity, 98.3% specificity, and 96.9% accuracy of ultrasonography in detection of traumatic lens dislocation. it seems that in cases, which oct is not possible, ultrasonography, could be an acceptable option to assess traumatic eye injuries. |
traditionally, health has been regarded as the absence of disease. however, over the decades, it has been recognized that the social, psychosocial, economic, and cultural factors influence health. this holistic concept implies that all sectors of the society influence health and emphasizes on promotion and protection of health. the world health organization (who) has defined health as a state of complete physical, mental, and social well - being and not merely the absence of disease or infirmity. hence, measuring health should not be confined to the use of exclusively clinical normative indicators. health being multidimensional is under the control of individual as well as is dependent on the environmental components (physical, biological, psychosocial), and further interaction of these factors may be health promoting or deleterious. in the recent years, the behavioral and psychosocial determinants of health have been recognized to play a pivotal role in causing health disorders. hence, public health research has increased its focus on social determinants of health and this has led to the emergence of theoretical approaches stressing the social context and its interaction with biological and psychological factors. one key factor which governs the health in today 's life is stress. stress has been defined as a physiological response to situations or issues that may not affect the person 's attitude or body positively. when stress occurs, most of the people are affected by poor or negative habits that may impact their health. many theoretical models have been proposed to promote oral health and to explain oral diseases. one such conceptual model focusing on both dimensions is the salutogenic theory and its core construct namely sense of coherence (soc). the soc concept was proposed by aaron antonovsky and was first published in the year 1983, which explains the relationship between health and stress. soc has been defined as a global orientation that expresses the extent to which one has a pervasive, enduring though dynamic feeling of confidence that : the stimuli deriving from one 's internal and external environments in the course of living are structured, predictable, and explicablethe resources are available to one to meet the demands posed by these stimulithese demands are challenges, worthy of investment, and engagement. the stimuli deriving from one 's internal and external environments in the course of living are structured, predictable, and explicable the resources are available to one to meet the demands posed by these stimuli these demands are challenges, worthy of investment, and engagement. the above three are referred to as the three components of soc ; they are comprehensibility, manageability, and meaningfulness. comprehensibility is the ability of people to understand what is happening around them ; manageability is the extent to which they feel capable of managing the situation ; and meaningfulness is the ability to find meaning in the situation. soc has been suggested to be highly applicable concept in the public health area because a strong soc is stated to decrease the likelihood of perceiving the social environment as stressful. this reduces the susceptibility to the health - damaging effect of chronic stress by lowering the likelihood of repeated negative emotions to stress perception. a strong evidence of soc is being related to health diseases and health - related behaviors. furthermore, association of soc to oral health was first reported by freire. in the year 2001 among 15-year - old children in middle west brazil ; their study concluded that the soc is a psychosocial determinant of adolescent 's oral health - related behavior affecting their pattern of dental attendance. however, correlation of soc with oral health behaviors, socioeconomic status, and periodontal status among indians has not been reported yet. with this background, our research goal was to evaluate the effect of soc ; hence, an attempt has been made in the present study to correlate the soc with oral health behaviors, socioeconomic status, and periodontal status among 3544 years adults visiting panineeya mahavidyalaya institute of dental sciences and research centre, hyderabad. before the commencement, the study protocol was submitted for approval, and the ethical clearance was obtained from the institutional review board of panineeya mahavidyalaya institute of dental sciences and research centre, hyderabad (pmvids / phd/0013/2011). written informed consent was obtained from all the study patients before clinical examination. adults aged 3544 years visiting the department of oral medicine and radiology of panineeya mahavidyalaya institute of dental sciences and research centre, hyderabad, for the first time were included in the study. a pilot study was conducted for 1 week, and the soc questionnaire was pretested and validated. the pilot study assessments were utilized for sample size estimation, planning of the main study, and also to finalize the survey pro forma. based on the prevalence of clinical loss of attachment (loa) scores, the sample size (n) was determined. subjects were included in the study based on the following inclusion and exclusion criteria. all adults aged 3544 years visiting panineeya mahavidyalaya institute of dental sciences and research centre, hyderabadthose visiting the dental hospital for the first timepatients willing to participate and who gave the written consent. all adults aged 3544 years visiting panineeya mahavidyalaya institute of dental sciences and research centre, hyderabad those visiting the dental hospital for the first time patients willing to participate and who gave the written consent. physically and mentally challenged individualsindividuals using antibiotics for more than 3 monthsindividuals unable to tolerate oral examination. physically and mentally challenged individuals individuals using antibiotics for more than 3 months individuals unable to tolerate oral examination. the following information was gathered from the study subjects : demographic information (age, sex, and marital status)socioeconomic status using kuppuswamy scaleoral health behaviors (type of cleaning, toothbrush, method of cleaning, materials used, and visit to dentist)perceived oral health status (good / poor). demographic information (age, sex, and marital status) socioeconomic status using kuppuswamy scale oral health behaviors (type of cleaning, toothbrush, method of cleaning, materials used, and visit to dentist) perceived oral health status (good / poor). the soc was measured using short version of the soc questionnaire by aaron antonovsky comprising 13-item measuring the following components : comprehensibility (q2, q5, q6, q8, q9, q10, and q11)manageability (q3 and q13)meaningfulness (q1, q4, q7, and q12). comprehensibility (q2, q5, q6, q8, q9, q10, and q11) manageability (q3 and q13) meaningfulness (q1, q4, q7, and q12). each item was scored on a seven - point likert scale with two opposite anchoring phrases (1 = very often, 7 = very seldom) and the questions q1 the soc score is an aggregation of all the scores with a range from 13 to 91, with higher scores reflecting high levels of soc. the clinical examination of all the patients was done by a single pretrained, precalibrated examiner to limit intraexaminer variability. the periodontal status was assessed using community periodontal index (cpi) and loss of attachment (loa) based on the codes and criteria according to the who proforma 1997. statistical package for social sciences software (version 18.0, statistical data2009 spss, inc., an ibm company, chicago, illinois, usa) was used to analyze the statistical data. mann whitney u - test and unpaired t - test were utilized to determine the association between mean scores of soc with oral health behaviors, socioeconomic status, and periodontal status. karl pearson 's correlation coefficient test was employed to find the correlation of soc with oral health behaviors, socioeconomic status, and periodontal status. all adults aged 3544 years visiting panineeya mahavidyalaya institute of dental sciences and research centre, hyderabadthose visiting the dental hospital for the first timepatients willing to participate and who gave the written consent. all adults aged 3544 years visiting panineeya mahavidyalaya institute of dental sciences and research centre, hyderabad those visiting the dental hospital for the first time patients willing to participate and who gave the written consent. physically and mentally challenged individualsindividuals using antibiotics for more than 3 monthsindividuals unable to tolerate oral examination. physically and mentally challenged individuals individuals using antibiotics for more than 3 months individuals unable to tolerate oral examination. the following information was gathered from the study subjects : demographic information (age, sex, and marital status)socioeconomic status using kuppuswamy scaleoral health behaviors (type of cleaning, toothbrush, method of cleaning, materials used, and visit to dentist)perceived oral health status (good / poor). demographic information (age, sex, and marital status) socioeconomic status using kuppuswamy scale oral health behaviors (type of cleaning, toothbrush, method of cleaning, materials used, and visit to dentist) perceived oral health status (good / poor). the soc was measured using short version of the soc questionnaire by aaron antonovsky comprising 13-item measuring the following components : comprehensibility (q2, q5, q6, q8, q9, q10, and q11)manageability (q3 and q13)meaningfulness (q1, q4, q7, and q12). comprehensibility (q2, q5, q6, q8, q9, q10, and q11) manageability (q3 and q13) meaningfulness (q1, q4, q7, and q12). each item was scored on a seven - point likert scale with two opposite anchoring phrases (1 = very often, 7 = very seldom) and the questions q1, q2, q3, q7, and q10 were reversed scored. the soc score is an aggregation of all the scores with a range from 13 to 91, with higher scores reflecting high levels of soc. the clinical examination of all the patients was done by a single pretrained, precalibrated examiner to limit intraexaminer variability. the periodontal status was assessed using community periodontal index (cpi) and loss of attachment (loa) based on the codes and criteria according to the who proforma 1997. statistical package for social sciences software (version 18.0, statistical data2009 spss, inc., an ibm company, chicago, illinois, usa) was used to analyze the statistical data. mann whitney u - test and unpaired t - test were utilized to determine the association between mean scores of soc with oral health behaviors, socioeconomic status, and periodontal status. karl pearson 's correlation coefficient test was employed to find the correlation of soc with oral health behaviors, socioeconomic status, and periodontal status. a total of 780 respondents comprising 269 (34.5%) males and 511 (65.5%) females participated in the study. a majority of the patients belonged to the age group of 3539 years, with a mean age of 38.5 2.8 years. most of the study subjects were married (763, 97.8%). according to kuppuswamy socioeconomic status, more number of patients belonged to upper lower class (iv) (263, 33.7%), followed by upper middle class (ii) (223, 28.6%) and lower middle class (iii) (177, 22.7%). on the other hand, very few patients belonged to upper class (i) (90, 11.5%) and lower class (v) (27, 3.5%). a significant difference was noted among the patients for socioeconomic status based on gender (p = 0.000). all the study patients used toothbrush (780, 100%) for teeth cleaning, with majority (387, 49.6%) using medium type of toothbrush. when the materials used for brushing was taken into account, around 747 (95.8%) of the patients preferred using toothpaste and only 33 (4.2%) patients used tooth powder. horizontal method of tooth cleaning was most common (461, 59.1%), followed by vertical method (168, 21.5%) and circular method (151, 19.3%). a good number of the patients 619 (79.4%) brushed once a day and 161 (20.6%) patients had the habit of brushing their teeth twice daily. a majority of patients, i.e., 623 (79.8%), preferred brushing before meals, 146 (18.7%) patients brushed before and after meals, and just 11 (1.4%) patients brushed after meals. the total of 688 (88.2%) patients used other oral hygiene aids such as dental floss and mouth rinses. there were 566 (72.6%) patients who previously visited the dentist, of which 415 (53.2%) were females and 151 (19.3%) were males. around 447 (57.3%) of the study patients perceived their oral health as poor and 333 (42.3%) study patients perceived as good oral health. when comparison of study patients for oral health behaviors was done based on gender, statistically significant difference was obtained for materials used for cleaning (p = 0.000), type of toothbrush used (p = 0.010), and visit to the dentist (p = 0.000). the soc scores for this group of study population ranged from 20 to 78, with an overall mean score of 48.2 10.4. when the mean soc scores were compared, females showed statistically significant difference for q2 has it happened in the past that you were surprised by the behavior of people whom you thought you knew well ? (3.9 2.5, p = 0.040) and q5 do you have the feeling that you are being treated unfairly ? the mean score for the question q13 how often do you have feelings that you are not sure you can keep under control ? was significantly high in males (4.3 2.5, p = 0.028) [table 1 ]. comparison of mean sense of coherence score for each question based on gender healthy periodontal status (cpi code 0) was observed for 67 (24.9%) males and 118 (23.1%) females. the code 1 of cpi, i.e., bleeding on probing, was more common among male patients (28, 10.4%), whereas calculus (code 2, 25.1%), shallow pocket (code 3, 26.8%), and deep pocket (code 4, 23.3%) were mostly seen in females. a statistically significant gender difference was noted among the patients for the scores of cpi (p = 0.000). while considering the distribution for loa, the results showed that 318 (62.2%) females and 178 (66.1%) males had code 0, i.e. normal 03 mm loa. the loa of 45 mm (code 1) was seen in 69 (13.5%) females and 36 (13.3%) males. furthermore, majority of female patients (73, 14.2%) had cementoenamel junction (cej) between the upper limit of the black band at 8.5 mm ring (code 2) and 51 (9.9%) male patients had cej between 8.5 and 11.5 mm ring (code 3). only 2 (0.7%) male patients had code 4, i.e. cej beyond 11.5 mm ring, but none of the female subjects have cej beyond 11.5 mm ring. loa scores were statistically significant based on gender (p = 0.000) [table 2 ]. comparison of community periodontal index and loss of attachment scores based on gender the overall mean soc was higher for males (48.3 10.2) as compared to females (48.2 10.5), but this was not significant statistically (p = 0.883). on the other hand, females had higher mean scores for comprehensibility (19.8 5.5) (p = 0.722) and manageability (13.9 5.9) (p = 0.063) when compared to males. nonetheless, meaningfulness component was statistically significant with higher mean score in males (48.3 10.2) and lower score in females (48.2 10.5) (p = 0.003). a statistically significant difference was noted for overall mean soc scores and its components for the different socioeconomic classes based on kuppuswamy scale. for the overall mean soc scores and manageability component, upper class (i) had the highest score (52.7 9.4, 16.2 4.8) and lower class (v) had the least score (40.3 5.7, 7.3 5.9) (p = 0.000). furthermore, comprehensibility component had higher mean score for lower class (v) (21.1 3.4) and lower score for lower middle class (iii) (18.5 6.1) (p = 0.011). on the other hand, the meaningfulness component had high mean score in upper middle class (ii) (16.2 4.9) and low mean score in lower class (v) (11.9 2.3) (p = 0.000) [table 3 ]. comparison of the overall mean sense of coherence and its components scores based on kuppuswamy socioeconomic scale a statistically significant difference was seen for overall soc based on oral health - related behaviors. for manageability and meaningfulness component, use of oral hygiene aids on the other hand, for the comprehensibility component, materials used for cleaning teeth, frequency of brushing, time of brushing, and visit to dentist were not statistically significant. the perceived oral health was statistically significant with soc and its components manageability and meaningfulness [table 4 ]. comparison of the overall mean sense of coherence and its components scores based on oral health behaviors the overall soc showed significantly negative correlation for socioeconomic status, type of toothbrush, perceived oral health, cpi, and loa whereas a significantly positive correlation was observed for frequency of brushing, time of brushing, use of other oral hygiene aids, and visit to dentist. the comprehensibility component had statistically negative correlation for type of toothbrush (r = 0.103) and method of cleaning (r = 0.078). on the contrary, a significant positive correlation was found for the use of other oral hygiene aids (r = 0.153) and frequency of changing toothbrush (r = 0.140). a statistically negative correlation for manageability component was seen with socioeconomic status (r = 0.270), type of toothbrush (r = 0.298), frequency of changing toothbrush (r = 0.146), perceived oral health (r = 0.288), cpi (0.316), and loa (r = 0.301). positive correlation was noted for frequency of brushing (r = 0.192), time of brushing (r = 0.190), and visit to dentist (r = 0.285). the meaningfulness component had statistically negative correlation with socioeconomic status (r = 0.234), type of toothbrush (r = 0.289), perceived oral health (r = 0.214), cpi (r = 0.279), and loa (0.209). a positive significant correlation was observed with method of cleaning (r = 0.117), frequency of brushing (r = 0.258), and time of brushing (r = 0.227) [table 5 ]. correlation of socioeconomic status, oral health behaviors, and periodontal status with sense of coherence by karl pearson s correlation coefficient the theory of salutogenesis was proposed by aaron antonovsky is based on two concepts : general resistance resources (grrs) and soc. the grrs comprise a broad range of resources such as social support, material resources, coping strategies, and family socialization that neutralizes the effects of stressful life events and promotes successful tension management. the soc is the central construct of the salutogenic theory which states that in order to create well - being, it is important for people to focus on their resources and capacity rather than on their diseases. the soc is a psychosocial factor that enables people to manage tension, identify, and mobilize resources to promote effective coping by finding solutions in a health promotion manner. the relationship between soc and health outcomes has been investigated in many studies, but its relationship with oral health has been found only in a few studies. therefore, the present study was designed to investigate the correlation of the soc with oral health behaviors, socioeconomic status, and periodontal status among 3544 years adults visiting panineeya mahavidyalaya institute of dental sciences and research centre, hyderabad. the theory purports that the level of soc that an individual achieves is determined at the age of 30, after which remains relatively stable. keeping this in mind in addition, the who suggested this age group as the standard monitoring group for health conditions of adults to determine the level of periodontitis. in the current study, we have used soc-13 item questionnaire, which is a short version of the soc-29 item. this scale was tested and validated in a study conducted by bonanato. and has an advantage over the full version, i.e., it takes less time to complete. therefore, the short version of soc (soc-13) questionnaire was employed in this study. cpi and loa indices are established measures for the assessment of periodontal problems in population by the who. therefore, in the present study, these indices were used to determine the periodontal status. the studies done by freire. and bernab. revealed that a stronger soc was significantly associated with better oral health behaviors. henceforth, in the present study, oral health behaviors were taken into account to know whether soc influences oral health behaviors among indian population. in our study, all the study patients used toothbrush (780, 100) and around 747 (95.8%) preferred using toothpaste and 688 (88.2%) used oral hygiene aids. likewise, in a study done by lindmark. and boman., majority of study subjects visited dentists for regular checkups. furthermore, majority of the study patients used medium type of toothbrush (387, 49.6%) and 59.1% of subjects used horizontal method of tooth cleaning. therefore, this result enlightens us that study patients had limited knowledge of oral health behaviors, and further, horizontal brushing method and usage of medium type of toothbrush were found to be more injurious to marginal gingiva leading to gingival recession. the results of the present study showed that 619 brushed once a day and 161 had a habit of brushing twice daily. literature provided by ayo - yusuf. on south african adolescents found that 225 had a habit of brushing at least twice a day. on contrary, another study done by ayo - yusuf. in 2009 among south african adolescents reported that a few subjects (136) do not brush daily. on the other hand, in a study done by lindmark., bernab., and savolainen., majority of subjects had habit of brushing twice or more number of times. in the current study, around 57.3% had perceived their oral health as poor and 42.3% perceived as good. on the contrary, a study conducted among swedish population by boman. reported that only 24% of study subjects perceived their oral health as poor and 76% as good. nonetheless, in a study by bernab. in finnish population, 34% of the study subjects reported poor perceived oral health. in the present study, 185 (23.7%) patients had healthy periodontal status and only 37 (4.7%) patients had bleeding on probing. in contrary, a study done by ayo - yusuf. found that 37.4% reported frequent gingival bleeding and one more study by lindmark. reported that 85 study subjects had healthy gingival. in this study, majority (496, 63.6%) of study subjects had loa < 03 mm (code 1). this may be attributed to the fact that the most of the study participants had graduate or postgraduate degree, which shows that they were educated and could maintain better oral health and furthermore most of the subjects visited dentist formerly. in the current study, though males had higher mean soc score, it was not significant as compared to females (p = 0.883) ; however, dorri. among iranian adolescents revealed that boys had stronger soc than girls and were statistically significant (p = 0.04). in the present study, soc and the mean soc and its component manageability were high among upper class (i) whereas comprehensibility component was high among lower class scores (ii) and meaningfulness component among upper middle class (ii). in our study, a significant difference was noted for soc with oral health - related behaviors (type of brush used, method of cleaning, materials used, frequency of brushing, use of oral hygiene aids, and visit to dentist) ; this indicates that a stronger soc was associated with better oral health behaviors. the study done by lindmark. revealed that only tooth - brushing frequency was significantly related with soc. however, previous studies have shown that strong soc is associated with tooth - brushing. the soc and two of its components were significantly and negatively related to cpi and loa scores. in addition, previous literature found that the subjects with higher soc have good oral health than subjects with weak soc. this might be due to the fact that higher soc among study subjects made them maintain good periodontal status. in the present study, it was found that good oral health behaviors and good periodontal status were associated with stronger soc. however, our study has certain limitations such as age - group comparison could not be done. the study was done among people visiting dental hospital and may present with bias ; hence, the results can not be generalized. furthermore, further investigations should be done among large group of populations to know how soc is related to oral health and even among all the applicable age - groups. the cross - sectional nature of the study does not permit us to check for causality. in the present study, soc was positively correlated to all oral health behaviors, except for type of toothbrush used frequency of changing the toothbrush and perceived oral health. when periodontal status was considered, soc was negatively correlated with cpi and loa scores, thus indicating good periodontal status. the present study concluded that a high level of soc was associated with good oral health behaviors such as frequency of brushing, time of brushing, use of oral hygiene aids, and visit to dentist, with periodontal status and socioeconomic status. | introduction : the sense of coherence (soc) has been suggested to be highly applicable concept in the public health area because a strong soc is stated to decrease the likelihood of perceiving the social environment as stressful. this reduces the susceptibility to the health - damaging effect of chronic stress by lowering the likelihood of repeated negative emotions to stress perception.materials and methods : the demographic data and general information of subjects ' oral health behaviors such as frequency of cleaning teeth, aids used to clean teeth, and dental attendance were recorded in the self - administered questionnaire. the soc - related data were obtained using the short version of antonovsky 's soc scale. the periodontal status was recorded based on the modified world health organization 1997 pro forma.results:the total of 780 respondents comprising 269 (34.5%) males and 511 (65.5%) females participated in the study. a significant difference was noted among the subjects for socioeconomic status based on gender (p = 0.000). the healthy periodontal status (community periodontal index [cpi ] code 0) was observed for 67 (24.9%) males and 118 (23.1%) females. the overall soc showed statistically negative correlation with socioeconomic status scale (r = 0.287). the cpi and loss of attachment (periodontal status) were significantly and negatively correlated with soc.conclusion:the present study concluded that a high level of soc was associated with good oral health behaviors, periodontal status, and socioeconomic status. |
protein conformational diversity is a key feature to understand protein function. since the early studies of max perutz on the t and r forms of hemoglobin, increasing experimental evidence supports the notion that native state of proteins is not unique. in fact, the native state is better represented by an ensemble of conformers in equilibrium describing the conformational diversity or dynamism of a protein (1). it has been showed that the ensemble description is essential to understand central biological aspects of protein function such as the catalytic process of enzymes (24), protein protein recognition (57), macromolecular process such as dna replication and protein folding by chaperonins (8), enzyme promiscuity (9), signal transduction (10,11) and the proteins ability to develop new functions (property known as evolvability) (12,13). despite that, the characterization of the equilibrium ensemble of conformers, involving the study of the structural and thermodynamic features of each individual conformer, represents a major challenge to overcome. in this way, experimentally, the nuclear magnetic resonance (nmr) spectroscopy is among the most widely used approaches representing a promising and active area of research (14). on the other hand, computational methods like coarse - grained molecular dynamics and monte carlo methods techniques, used in combination with normal mode analysis, have been revealed that they are useful tools to explore the conformational landscape of proteins (1519). finally, a completely different approach to study conformational diversity considers that crystallographic structures of the same protein obtained under different conditions are snapshots or instances of protein dynamism. this view is supported by the correlation found between the observed structural diversity determined by solution experiments such as nmr measurements and those coming from crystallographic structures of proteins obtained in different conditions (6,2025). also a good correlation was found when computational methods, such as molecular dynamics, were used to simulate protein dynamism and then compared with solution structures from nmr (26,27). with thousands of structures redundantly deposited in structural databases (28) the extension and distribution of the conformational diversity can be explored for a large number of proteins not accessible with the methodologies mentioned above. in this paper we have used this approach to develop a database of proteins with conformational diversity. here, we describe pcdb (from protein conformational diversity database), its web functionality and possible applications. as was mentioned above, conformational diversity is estimated from a redundant collection of structures for each protein domain deposited in the database. pcdb was developed from cath database v3.3 following its protein domain structural hierarchy and definitions (29). briefly, cath clusters proteins domains using structural and sequence similarities in a hierarchy defined by 9 levels called cathsolid where the d level assigns a number for each individual domain in the database and corresponds with the collection of different crystallographic structures for an individual protein. this level was used to build pcdb collecting all the proteins domains with at least two different crystallographic structures classified in cath. the current version of the pcdb contains 7989 protein domains from 4171 proteins and 34775 crystallographic structures and 1806 corresponding to nmr (table 1). table 1.summary of the data available in pcdb v1.0domains7989proteins4171structures36581maximum rmsdmax26.7average structures per domain4.7structures in class mainly alpha1728structures in class mainly beta2326structures in class mixed alpha - beta3790structures in class few secondary structure145accordingly to cath v3.3 (http://www.cathinfo.db) hierarchy (29). summary of the data available in pcdb v1.0 accordingly to cath v3.3 (http://www.cathinfo.db) hierarchy (29). the structures collected for each protein domain could have been crystallized under the same or different conditions. if the conditions were the same, it is known that rmsd between different structures is as much as 0.1 to 0.4 a (30). larger rmsd are expected when conformational diversity appears and this could happen when crystallization conditions varies among the structures considered. in fact rmsd as high as 23.4 have been reported in redundant studies of protein structures (28). following the addition of ligands, for example, it is well established that a conformational equilibrium shift towards a high affinity conformer could occurred originating changes in tertiary structure (12,31,32). besides, other changes in crystallization conditions like modifications in the oligomerization state (33), ph and temperature, as well as the presence of mutations (34) can also modify the relative stability of conformers and then originate differences between crystallographic structures for the same protein. in addition, different sequence modifications or crystallographic errors could introduce conformational diversity unrelated to biological reasons. considering that our method to measure conformational diversity relies in the quality of the crystallographic structure, the different criteria used to select the structures are explained below and a general pcdb building scheme can be found in supplementary figure s1. in pcdb, the structures are linked with information contained in pdb concerning the crystallization procedure and supplementary data that could help to understand the occurrence of conformational diversity. the factors considered are : the presence of ligands, mutations, changes in the oligomeric state and ph. the maximum rmsd (rmsdmax) among the redundant structures of each protein domain is used to evaluate the extension of the structural change. using the data in pcdb, we have found that at least one of these set of selected experimental features is involved in the 74% of all the domains (table 2), and in the 60% of the domains with more than 0.4 rmsdmax. besides the information provided for the crystallization procedure, each of the proteins deposited in pcdb was cross linked with different databases. in this way, a given extension of conformational diversity measured by rmsdmax can be related with diverse biological and structural information such as biological function [go terms (35) and enzyme commission numbers(ec) (36) ], structural classification [cath (29) ], taxonomy (ncbi taxonomic i d and genus and species names), metabolic pathways location, subcellular location, protein interactions, protein family, presence of characterized catalytic site [catalytic site atlas (37) ] and derived interpro links (38). table 2.number of proteins in pcdb with different factors possibly promoting the observed conformational diversitypossible condition promoting conformational diversitynumber of proteinsmutations268ligands568changes in oligomeric state536changes in ph1029mutations and ligands77mutations and changes in oligomeric state108mutations and changes in ph213ligands and changes in oligomeric state231ligands and changes in ph387changes in oligomeric state and ph613four conditions269 number of proteins in pcdb with different factors possibly promoting the observed conformational diversity pcdb is composed of a web application based on php language, connected with a mysql database. the database includes information derived from numerous biological databases and online servers and data acquired from personal scripting and programs. pcdb browsing capability is based on sql stored procedures that are executed dynamically, using php language. pcdb was built using the redundant structures from each protein domain collected from cath v3.3 (39) (see supplementary figure s1). the structures belonging to each protein domain were structurally aligned using mammoth (40) and the rmsdmax between conformers were registered. information about crystallization conditions was extracted from pdbml / xml files, as well as the oligomeric state, presence of sequence modifications, mutations, deletion and missing residues. post - translational modifications were extracted from the controlled vocabulary of post - translational modifications provided by uniprot. further biological information for each structure were extracted from different databases : pdb (30), sifts (http://www.ebi.ac.uk/msd/sifts/) and uniprot (41). conformational diversity is a central issue to understand protein function so its characterization could span multiple applications. pcdb database is designed to retrieve proteins with a given amount of conformational diversity measured by rmsdmax and allows relating this value with different levels of information. the main attribute to search pcdb concerns the extension of conformational diversity measured by rmsdmax. this type of search could be limited using a set of four attributes (presence of ligands, presence of mutations, changes in oligomerization state and changes in ph) considering the properties characterizing the experimental conditions of crystallization of each structure. these attributes can be selected separately or in different combinations (table 2) and can be used to explain the rmsdmax obtained for a given protein. in the example showed in figure 1, we were interested in searching pcdb for proteins with 510 rmsdmax between their respective structures due to the presence of ligands. therefore, the resulted extension of conformational diversity can be univocally associated to conformational changes upon ligand binding. also in figure 1, and below the search field, the field to customize the output information is displayed. in this section it is possible to select different levels of information from structural classification, protein function or subcellular location among others. it is also possible to retrieve the structural superposition of the conformers with the maximum rmsd. similar searches could explore pcbd using a single or a combination of the attributes producing conformational changes. furthermore, the biological and structural data contained in the customizable output field, could be used to explore different trends related with conformational diversity. figure 1.searching pcdb using the presence of ligands as possible origin of conformational diversity between 5 and 10 units of rmsdmax (1). in the format output section (2) it is possible to customize the biological and physicochemical information retrieved with the results. searching pcdb using the presence of ligands as possible origin of conformational diversity between 5 and 10 units of rmsdmax (1). in the format output section (2) it is possible to customize the biological and physicochemical information retrieved with the results. we are interested in increasing the amount and diversity of available biological and structural data for each domain represented in the database, to enhance possible correlations studies between conformational diversity and a broad spectrum of physiochemical parameters. one of our near future goals is to introduce sequence alignments for each deposited protein to derive evolutionary information such as the relative conservation of different positions and evolutionary rates. the link between the pattern of residue substitution and the extension of conformational diversity is a promising field to increase our understanding about protein evolution ; however it is almost an unexplored field yet. beside this, and following previous works, we would like to enrich pcdb introducing structures from close homologous proteins (21) in order to increase the conformational representation of the deposited domains. two main features differentiate pcdb from other databases containing information about conformational diversity in proteins (42,43). firstly, pcdb uses experimentally determined structures and secondly this data are related with biological and structural information to possible explains the observed conformational diversity extension. in the present version, pcdb contains 7989 protein domains with a broad range of conformational diversity from the trivial zero to 26.7 rmsdmax. in this way pcdb could be an essential tool to understand conformational diversity and by this means obtain a better understanding of protein function. proyectos de investigacion plurianuales (pip) conicet grant (112 - 200801 - 02849) and universidad nacional de quilmes grant (53/b056) ; ezequiel juritz has a type ii fellowship from conicet. | pcdb (http://www.pcdb.unq.edu.ar) is a database of protein conformational diversity. for each protein, the database contains the redundant compilation of all the corresponding crystallographic structures obtained under different conditions. these structures could be considered as different instances of protein dynamism. as a measure of the conformational diversity we use the maximum rmsd obtained comparing the structures deposited for each domain. the redundant structures were extracted following cath structural classification and cross linked with additional information. in this way it is possible to relate a given amount of conformational diversity with different levels of information, such as protein function, presence of ligands and mutations, structural classification, active site information and organism taxonomy among others. currently the database contains 7989 domains with a total of 36581 structures from 4171 different proteins. the maximum rmsd registered is 26.7 and the average of different structures per domain is 4.5. |
prior studies have demonstrated the efficacy and effectiveness of both typical (1st generation) and atypical (2nd generation) antipsychotic agents in reducing schizophrenic symptoms (purdon 2000 ; hirsch 2002 ; kane 2002). however, the likelihood of sustaining control of schizophrenic symptoms depends on the persistence of treatment (vanelli 2001 ; menzin 2003). the importance of sustained treatment in the clinical management of schizophrenia, coupled with known differential side effects associated with typical and atypical antipsychotic agents (kane 1996 ; allison 1999 ; leucht 1999 ; leslie and rosenheck 2001), has generated a lot of interest in comparing treatment persistence across antipsychotic agents (apa 1997 ; lehman and steinwachs 1998 ; va 1998 ; valenstein 2002 ; docherty 2003 ; lehman 2004 ; lieberman 2005 ; ren 2006). in assessing treatment persistence across different antipsychotic agents, prior studies have indicated that although antipsychotic agents significantly reduce the symptoms of schizophrenia, poor treatment persistence is quite common among many patients with schizophrenia (apa 1997 ; lehman and steinwachs 1998 ; va 1998 ; valenstein 2002 ; lehman 2004 ; lieberman 2005). one study indicated that about 60%79% of patients with schizophrenia who participated in the study discontinued pharmacologic treatment within a few months (tafesse 2003). another study reported that about 50% of patients with schizophrenia did not take their prescribed medications as directed (lacro 2002). similarly, studies using data from the veterans health administration (va) revealed that about 50% of the patients with schizophrenia who were discharged from hospitals did not remain in treatment over time (va 2002). these findings were recently corroborated by the catie (clinical antipsychotic trials of intervention effectiveness) trial, which reported that as many as 74% of the patients discontinued medication treatment before the 18th month following the start of the catie trial (lieberman 2005). poor treatment persistence of antipsychotic agents has been well documented to result in poor patient outcomes (ayuso - gutierrez and vega 1997 ; svarstaad 2001 ; menzin 2003 ; lehman 2004). using california medicaid (medical) prescription and medical claims data, tafesse and colleagues examined the relationship between treatment persistence of antipsychotic medications and hospitalization among patients with schizophrenia (tafesse 2003). the study yielded results indicating that patients with poor treatment persistence were 1.5 times more likely to be readmitted compared to patients with better treatment persistence. this result was also reported in a study by grogg and colleagues, in which they found that patients with low adherence were 49% more likely to have an inpatient hospitalization when compared with compliant patients (grogg 2002). recognizing the importance of treatment persistence in controlling symptoms of schizophrenia, a number of studies have compared levels of treatment persistence across different antipsychotic agents (cramer and rosenheck 1999 ; dixon 1999 ; vanelli 2001 ; dolder 2002 ; zhu 2003 ; ren 2006). for instance, some studies indicated that the use of atypical antipsychotic agents was associated with significantly less treatment switching than the use of typical antipsychotic agents (menzin 2003), and that only about 11% of patients with schizophrenia who were receiving typical antipsychotic agents achieved uninterrupted therapy, with a mean duration of 142 days over a year, or 39% of days covered (mccombs 1999). another study based on the va database, however, reported that treatment persistence with atypical antipsychotic agents was only modestly better than that with typical antipsychotic agents (cramer and rosenheck 1999). other studies reported that there were no statistically significant differences in the levels of treatment persistence of either typical or atypical antipsychotic agents (citrome and volavska 2002 ; dolder 2002), with about 44% and 48% of patients with schizophrenia continued to refill their prescriptions for atypical and typical antipsychotic agents, respectively (vanelli 2001). the existing body of literature focusing on the comparisons among antipsychotic agents with regard to treatment persistence remains largely problematic. in most of the studies, treatment persistence or time to discontinuation or switching to another antipsychotic agent is often calculated in terms of mean number of days from first initiation to first discontinuation or a first gap of 15 or 30 days (haynes 2001). this measurement of treatment persistence does not take into account the number of days from second or third initiation to second or third discontinuation of treatment (or treatment episodes beyond the first prescription). because patients who switch back to the same antipsychotic agent for a second or third time within a year may represent more complicated cases, treatment persistence using only the first treatment episode while excluding subsequent treatment episodes during a specified study period thus, in this present study, we offered an alternative approach, which included patients with multiple prescriptions of the same antipsychotic agent within a year following the initiation of the index drug. we also compared levels of treatment persistence, using conventional and our alternative approach, between typical and atypical antipsychotic agents. the study used two existing databases from the va : (1) pharmacy data from the va national pharmacy benefits management program (pbm) and (2) va national administrative data. the va is the largest integrated health care system in the united states, with approximately 4.2 million enrollees and about 5% of the total us market share for hospital services. the va administrative data consist of outpatient files, which provide information system about all outpatient clinic visits in the va, and inpatient files, which provide medical information about all discharges from va inpatient settings, including icd-9-cm codes representing admitting and discharge diagnoses (lamoreaux 1996). we identified patients with schizophrenia using the 295.xx icd-9-cm codes from the outpatient and inpatient files. to increase specificity of the icd-9-cm codes for schizophrenia, the study further identified patients with 1 inpatient or 2 outpatient icd-9-cm codes (7 days apart) of schizophrenia. this approach has been shown to increase specificity without sacrificing sensitivity (leslie and rosenheck 2001). pharmacy data came from the va national drug formulary, which are automated uniformly throughout the va system, and are updated monthly. the national pharmacy data consist of extensive prescription information for all va patients who obtain their prescriptions in the va system. this centralized database provides comprehensive prescription information : medication class, dose, dates of issues, fills, refills, and dispenses, quantity of pills dispensed, and number of days of medication dispensed. at the time of the study, the veterans enrolled in the va are entitled to medications with a us $ 7.00 co - payment arrangement. the economic incentive for veterans is almost always to obtain medications through va medical centers rather than from other systems of care. this system allows for tracking almost all antipsychotic medications, whereas in other civilian systems this might be extremely difficult given multiple sources for obtaining initial and refill prescriptions such as pharmacy chains. using the pharmacy data for va fiscal years (fy) 2000, 2001, 2002, 2003, and 2004, we defined initiation using a 6-month clean period in which a patient was not on the target drug prior to initiation. more specifically, patients were initiated on the target drug at any point of time within one year provided that they had not been on the target drug for 6 months prior to initiation. based on this definition of initiation, we created two non - overlapping periods using a floating date approach : 10/1/19993/31/2002 and 10/1/20023/31/2005. treatment persistence was measured as the length of time where a patient was continuously on any antipsychotic agents included in the study until discontinuation of treatment or until the first gap of 15 days without the target medication. we also conducted sensitivity analysis using a gap of 30 days as treatment discontinuation. unlike the conventional approach, which included only the first treatment episode, in calculating treatment persistence, the alternative approach that we proposed in the study incorporated all treatment episodes by calculating treatment persistence separately among patients with one treatment episode, among patients with two treatment episodes, and among patients with three treatment episodes. since poor treatment persistence is associated with poor tolerability of the side - effects of the medications, we opted to compare typical versus atypical antipsychotic agents, which are known to differ in side - effect profiles (allison 1999 ; chakos 2002). for typical antipsychotic agents as a class, we selected three agents, representing high potency (haloperidol), medium potency (perphenazine), and low potency (chlorpromazine), whereas for atypical antipsychotic agents as a class, we included three most commonly prescribed agents during period 1 : olanzapine, risperidone, and quetiapine, and we added ziprasidone during period 2. it is important to note that treatment persistence was measured at the individual drug level and then aggregated to the drug class level. for instance, for typical agents, if patient a switched from one typical to another typical, and patient b switched from one typical to one atypical, then treatment persistence was measured by taking the average of patient a s and b s length of time from the initiation date of the target drug to the date when the switch took place for the two patients, respectively. based on the above - described procedures, we found that it was quite common for patients with schizophrenia to have multiple prescriptions of the same antipsychotic agent after discontinuation, defined either as a gap of 15 or 30 days, within one year following the initiation of the index drug. as shown in table 1, between 10/1/1999 and 3/31/2002 when using a gap of 15 days to define treatment discontinuation, as many as 25% of the patients had multiple prescriptions of the same drug for both typical and atypical antipsychotic agents. this finding was corroborated by sensitivity analyses using both a gap of 30 days in defining treatment discontinuation as well as using data from period 2, or between 10/1/2002 and 3/31/2005. based on these results, we opted to use the first three treatment episodes to calculate treatment persistence, which captured about 98% or 99% of the patients using 15 days or 30 days as treatment discontinuation, respectively. using conventional approach in calculating treatment persistence, we found that patients taking atypical agents were more compliant than patients taking typical agents as exemplified by the higher levels of treatment persistence (table 2). during the period between 10/1/1999 and 3/31/2002, patients taking atypical agents remained on the index drug for 150 days (until there was a gap of 15 days) following initiation as compared to 107 days for those taking typical agents (p < 0.001). during the same period, patients taking atypical agents remained on the index drug for 174 days (until there was a gap of 30 days) compared with 122 days for those taking typical agents (p < 0.001). however, levels of treatment persistence with atypical agents saw a decline between the two study periods, whereas levels of treatment persistence with typical agents remained more or less the same. despite this reduced gap between the two classes of drugs between period 1 and period 2, the differences in the levels of treatment persistence between typical and atypical antipsychotic agents remained significant (p < 0.001). tables 3 and 4 present treatment persistence in terms of mean number of days on the index drug among those with one prescription episode, as well as treatment persistence for each prescription episode among those with two or three prescription episodes, respectively. as revealed in tables 3 and 4, the conventional approach in calculating treatment persistence included the prescription episode among patients with only one prescription episode, the first prescription episode among those with two prescription episodes, and the first prescription episode among those with three prescription episodes (shaded columns). among patients with one prescription episode, initiators of atypical antipsychotic agents had significantly longer mean number of treatment days than initiators of typical antipsychotic agents (p < 0.001) however, the differences in the level of treatment persistence between the two classes of antipsychotic agents were trivial when using the first prescription episodes among patients with two or three prescription episodes. on the other hand, of the prescription episodes that are not included in the conventional approach in calculating treatment persistence, we found that initiators of atypical agents had significantly better treatment persistence than initiators of typical agents (p < 0.001). these findings, which were also observed when we analyzed data from period 2 as well as using 30 days in defining treatment discontinuation, suggest that the conventional approach tends to underestimate the gap in treatment persistence between the typical and atypical agents. these findings highlight the need to incorporate all prescription episodes in the measurement of treatment persistence. the incorporation of all prescription episodes tended to represent routine clinical practices as a number of studies had indicated that switching across antipsychotic agents was quite common among patients with schizophrenia (ren 2003, 2005a). as shown in table 5 (see columns subtitled all episodes), we included all prescription episodes in the calculation of treatment persistence first by taking the sum of the number of days staying on the index drug for patients with two or three treatment episodes, and then by taking the average number of days staying on the index drug across the three patient groups, ie, those with one, two, or three treatment episodes. however, what we obtained from this approach was a measure that very much resembled the medication possession ratio (mpr), a commonly used measure of patient adherence with medication treatment (sclar 1991, 2001). this particular approach has one drawback, that is, by lumping together patients with different number of prescription episodes, one would not be able to capture the differences in treatment persistence between patients with one prescription episode and those with multiple prescription episodes. as discussed earlier, patients with multiple prescription episodes might represent more complicated cases of schizophrenia. to distinguish patients with one prescription from those with two or three prescriptions or treatment episodes, we offered an alternative approach, which was treatment episode - specific in which treatment persistence with typical and atypical antipsychotic agents was measured separately for patients with one, two, or three treatment episodes within one year following the initiation of the target drug. the results presented in table 5 indicate that consistent with the conventional approach, patients who were initiated on atypical agents had better treatment persistence than those who were initiated on typical agents in all three comparison groups, ie, those with one prescription, those with two treatment episodes, and those with three treatment episodes. in addition, levels of treatment persistence exhibited variation for patients with one, two, or three prescriptions. generally speaking, among patients with one prescription, initiators of typical agents tended to fare worst in the level of treatment persistence. this finding suggests that conventional approach in calculating treatment persistence tends to underestimate the gap between typical and atypical agents. take study period 1 and treatment discontinuation using a gap of 15 days as an example. using conventional approach, initiators of atypical agents stayed on the treatment 43 days longer than initiators of typical agents, whereas using our episode - specific approach among patients with one prescription, initiators of atypical agents remained on the treatment 54 days longer than initiators of typical agents. similar findings were also observed using data from study period 2 and using a gap of 30 days as treatment discontinuation. over the past two decades, interest has increased in studies on treatment persistence with antipsychotic agents (lehman and steinwachs 1998 ; valenstein 2002 ; lehman 2004 ; lieberman 2005 ; ren 2006). a number of studies have reported that poor treatment persistence with antipsychotic agents is a common problem among patients with schizophrenia (docherty 2003 ; tafesse 2003), which results in relapse of schizophrenic symptoms, increased outpatient visits, hospital admissions, and associated unnecessary medical expenses (grogg 2002 ; lacro. 2002 ; docherty 2003 ; tafesse 2003). recognizing the importance of treatment persistence to the sustained control of the symptoms of schizophrenia, prior studies have compared treatment persistence between typical and atypical antipsychotic agents, but yielded inconsistent findings. in this study the justification for this alternative approach is based on the observation that as many as 25% of the patients included in the study had at least two prescriptions of the same agent within one year following the initiation of the target drug. a close examination of the episode - specific mean number of treatment days revealed that for patients with multiple prescriptions, levels of treatment persistence tended to be universally lower at the initial episode(s), but much higher at the last episodes. this finding has important implication for the conventional approach in measuring treatment persistence. on the one hand, the conventional approach used only the first prescription, which combined the single prescription for patients who had one prescription with the two first prescriptions for patients who had two or three treatment episodes, respectively. on the other hand, the conventional approach excluded two treatment episodes (the last episodes for patients with two or three prescriptions). thus inclusion and exclusion criteria associated with the conventional approach are problematic and the results based on the approach are likely to be biased. recognizing that patients with one prescription might be different from those with two or three prescriptions, we advocated for an alternative approach in measuring treatment persistence, ie, the treatment episode - specific approach. this approach will enable us to distinguish patients with one prescription from those with two or three treatment episodes. as discussed earlier, patients with multiple treatment episodes might represent more complicated cases of schizophrenia. by comparing episode - specific treatment persistence, the alternative approach provided a fair comparison in treatment persistence across antipsychotic agents by avoiding the potential bias against those antipsychotic agents, which are more likely to be prescribed to patients who present with more severe mental diseases and therefore more likely to switch back and forth between medications. first, the study included predominantly male patients from the va health care services where female representation is typically low. we do not know whether the patterns of treatment persistence across antipsychotic agents observed in the present study are unique to male patients. it is possible that male and female patients may have different responses to antipsychotic agents in terms of efficacy or effectiveness as well as tolerability of side - effects, a subject that requires further research. second, the study only included three typical antipsychotic agents, which may not be representative of the first generation of antipsychotic agents. more research is needed to extend to other typical agents, especially those that are most commonly prescribed. similarly, future research needs to analyze atypical agents not only at the class level but also at the individual drug level. finally, due to the nature of observational study, ie, without implementing the randomized assignment rules, the results of the study can be affected by selection biases. despite the fact that observational studies represent the spectrum of routine medical practice better than randomized experiments, it is important for future observational studies to use statistical techniques, such as propensity scores and sensitivity analyses, to minimize the confounding errors associated with observational studies. despite these limitations, the results of the study have important implications for the care of patients with schizophrenia. with several antipsychotic drugs available, physicians are increasingly confronted with many critical choices in selecting medications that tend to benefit the patients. since poor treatment persistence contributed to an estimated 40% relapses (weiden and zygmund 1997), levels of treatment persistence have become an increasingly important factor in prescription choices by physicians of different antipsychotic agents. however, considering the inappropriateness of the conventional approach in measuring treatment persistence as well as the limitations of the present study, more research is needed to examine the extent to which adjunctive use of other agents, a common practice among patients with schizophrenia (ren 2004), will influence levels of treatment persistence. future research should also assess the impact of poor treatment persistence on a wide spectrum of patient outcomes (ren 2005b). a more comprehensive assessment using appropriate analytic methods should provide physicians with a better knowledge about treatment persistence associated with different antipsychotic agents and help them make prescription choices that will ultimately improve the care of schizophrenia. | prior studies have demonstrated the importance of treatment persistence with anti - psychotic agents in sustaining control of schizophrenic symptoms. however, the conventional approach in measuring treatment persistence tended to use only the first prescription episode even though some patients received multiple prescriptions (or multiple treatment episodes) of the same medication within one year following the initiation of the index drug. in this study, we used data from the veterans health administration in the united states to assess the extent to which patients received multiple prescriptions. the study found that about a quarter of the patients had two or more treatment episodes and that levels of treatment persistence tended to vary across treatment episodes. based on these results, we offered an alternative approach in which we calculated treatment persistence with typical and atypical antipsychotic agents separately for patients with one, two, or three treatment episodes. considering that patients with different number of treatment episodes might differ in disease profiles, this treatment episode - specific approach offered a fair comparison of the levels of treatment persistence across patients with different number of treatment episodes. future research needs to extend the analyses beyond two antipsychotic classes to individual antipsychotic agents. a more comprehensive assessment using appropriate analytic methods should help physicians make prescription choices that will ultimately improve the care of patients with schizophrenia. |
epidermoid cysts are benign sequestration cysts in body that may be either congenital or acquired. the congenital variety is related to aberrant embryogenic ectodermal implantation during at the time of closure of neural groove or when epithelial surfaces fuse. acquired cysts are due to traumatic iatrogenic implantation of epidermal fragments during trauma or surgery. epidermoid cysts are seen throughout the body with only 7% cases seen in oro - facial region and 1.6% within oral cavity. we herewith report a case of exceptional existence of intraoral multiple epidermoid cysts in both sides of the buccal mucosa in a 35-year - old male in the buccal cheek region. to the best of our knowledge a 35-year - old male reported to surgical department with the chief complaint of swelling in the both sides of buccal mucosa for 3 months, which was incidentally noticed. intraoral examination revealed a bilateral 1.5 cm 1.5 cm nontender swelling in lateral buccal mucosa with normal covering mucosa. extraorally, the skin overlying the swelling did not show any indurations. there was no associated regional lymphadenopathy. a detailed case history of the patient provided no association of cheek biting with the lesion. excision of the lesion lying immediately underlying the buccal mucosa was done under local anesthesia by giving an elliptical incision in the bilateral buccal mucosa. specimen on gross examination showed gray - white to gray - brown soft - tissue pieces, altogether measuring 0.5 cm 0.5 cm in size. microscopically, swelling from both the sides showed three subepidermal cysts arranged in linear fashion, lined by stratified squamous epithelium and lumen partially filled with keratin [figure 1a d ]. surrounding stroma showed fibrocollagenous tissue with mild diffuse chronic inflammatory infiltrate comprising lymphocytes, plasma cells, and macrophages. neither dysplasia nor malignancy was noted. a histopathological diagnosis of bilateral multiple epidermoid cysts was made. (a and b) both right and left side linearly arranged multiple linearly arranged epidermoid cysts with overlying stratified squamous epithelial clusters (h and e, 40) ; (c) section shows cyst lined by stratified squamous epithelium with granular cell layer. no appendages are noted within the wall of cyst (h and e, 100) ; (d) cyst wall lined by orthokeratotic stratified squamous epithelium with keratin flakes in the lumen (h and e, 400) most of the cases are reported in between 15 and 35 years of age group. the incidence of epidermoid cysts in head and neck has been reported from 1.6% to 6.9%. most of the intraoral cases are reported in the midline and floor of the mouth. rare cases are reported involving tongue, lips, uvula, temporomandibular joint, intracranial, maxilla and mandible, and buccal mucosa. intraoral epidermoid cyst often remains asymptomatic for years until they reach a size that interferes with mastication, speech, and very rarely breathing. epidermoid cysts may be classified as congenital or acquired even if there is no difference between the two on presentation or histologically. congenital cysts are dysembryogenetic lesions that arise from ectodermic elements entrapped during the midline fusion of the first and second branchial arches between the 3 and 4 weeks of intrauterine life. alternatively, they may arise from the tuberculum impar of his which, with each mandibular arch, forms the floor of the mouth and the body of the tongue. acquired cysts derive from traumatic or iatrogenic inclusion of epithelial cells or from the occlusion of a sebaceous gland duct. however, for formation of acquired cysts, a proper combination of events that is a history of trauma along with implanted epithelium that is capable of proliferation and coexistent minimal inflammation are needed to occur simultaneously. these events occurring bilaterally along with the linear arrangement of the cyst probably explain the rarity of this case. epidermoid, dermoid, and teratoid cysts are nonodontogenic cystic lesions of the oral cavity. they are rare lesions derived from germinal epithelium. while a dermoid cyst has an epidermal lining with skin adnexa such as hair follicles and sebaceous glands, the epidermoid cyst contains no such adnexa. teratoid cysts in addition to skin appendages have tissue from other embryonal sources such as respiratory, gastrointestinal, and connective tissues such as bundles of striated muscle and distinct areas of fat. however, to the best of our knowledge, till now, no case has been reported as multiple epidermoid cysts in bilateral buccal mucosa. however, numerous epidermoid cysts, especially in head and neck, are associated with gardner 's syndrome. differential diagnosis should include a variety of conditions which can be developmental, neoplastic, and infectious. infectious conditions such as odontogenic infections are mostly symptomatic and can be ruled out in the present case as it was not associated with any clinical symptoms. swelling due to lipid, salivary, and vascular benign tumors should be considered. among developmental category, an oral lymphoepithelial cyst which is seen adjacent to waldeyers 's ring should also be kept in mind. the bilaterality of the lesion and confirmation on histopathology help to rule out the above pathologies. cases which are symptomatic and others that have undergone malignant transformation have been reported in the literature. cortezzi and de albuquerque in 1994 reported an epidermoid cyst of the floor of the mouth that reached a huge proportion and caused a life threatening situation because of secondary infection. basal cell carcinoma and squamous cell carcinoma arising in the wall of an otherwise conventional epidermoid cyst has been seen. however, no carcinomatous transformation was noted in our case. epidermoid cysts are found to exist in rare site which emphasize the need for further research into the etiopathogenesis of the cysts. the present case shows no variation from the normal histopathology, but they prove to be significant because of its variation in their anatomical presentation that is buccal mucosa, multiplicity, and bilaterality. more importantly, if ever malignancy is confirmed in such cases, appropriate evaluation is need to be carried out followed by definitive management. | intraoral epidermoid cyst of buccal mucosa is generally an uncommon entity. epidermal inclusion cyst refers sequestration of epidermal elements into the dermal and deeper tissue during the fetal period in line of fusion of embryonic process or acquired due to implantation of the epithelium due to trauma or surgery. it usually presents as slow growing asymptomatic cysts but may be symptomatic due to large size, interfering with mastication and speech or secondary infection. surgical excision is done for removal of these cysts. we report an interesting case of multiple epidermal cysts in both sides of buccal mucosa in a 35-year - old male patient. |
sarcoidosis is a common systemic disorder of unknown etiology which is characterized by the formation of noncaseating epithelioid cell granulomas. in addition to their occurrence in systemic sarcoidosis, these granulomas have also been observed in various parenchymas and in the lymph nodes associated with other granulomatous diseases. granulomatous reactions occurring within lymph nodes draining carcinomas are a well - known but uncommon occurrence. these histologic changes have been termed sarcoid reactions, and such changes have been described in association with lymphoma and other solid tumors. however, the presence of this response in colorectal cancer has been considered to be quite rare, and only a few reports have mentioned the presence of granulomatous reactions in colorectal cancer. we herein report a rare case of adenocarcinoma of the ascending colon associated with sarcoid reaction in the regional lymph nodes. a 56-year - old japanese man was assessed for anemia. computed tomography of the abdomen performed to investigate the cause of anemia showed a tumor mass in his ascending colon and many enlarged regional lymph nodes (fig. laboratory data showed no abnormality except for anemia, with 9.0 mg / dl hemoglobin. the past clinical history mentioned hypertension, but neither inflammatory nor immunological disease. a typical ileocecal gross examination of the operative specimen revealed a tumor measuring 70 55 mm at the ileocecal valve, and many enlarged regional lymph nodes were present, suggesting metastasis of the lymph nodes. histopathological examination revealed moderately differentiated adenocarcinoma of the ascending colon which extended to the subserosa. there was no metastasis to the dissected lymph nodes ; however, noncaseous epithelioid granulomas with multinucleated giant cells without necrosis were observed (fig. we here report a rare case of adenocarcinoma of the ascending colon associated with sarcoid reaction in the regional lymph nodes. an association of sarcoid reaction with malignancy has been reported, and such reactions may occur in lymph nodes draining an area housing a malignant tumor, in the tumor itself, and even in nonregional tissues. sarcoid reactions have been described in association with lymphoma, testicular cancer and other solid tumors. however, this response in colorectal cancer has been considered to be quite rare, and there have been only a few publications that mention the presence of granulomatous reaction in colorectal cancer. the mechanism of tumor - associated sarcoid reaction in the regional nodes has not yet been elucidated. the possible mechanisms are summarized as follows : (1) a localized defense reaction to tumor cells themselves, (2) a simple tissue reaction to a tumor embolism in the lymphatic system or capillaries, and (3) an immunological reaction to substances released from the tumors transported along the lymphatic system [2, 3, 6, 13, 14 ]. sarcoid reaction has also been reported after interferon therapy in patients with malignant melanoma and after interleukin-2 therapy for renal cell carcinoma. thus, sarcoid reactions are most likely caused by antigenic factors derived from the tumor cells and could play an important role in the host 's defenses against metastatic extension. sarcoid reactions may manifest as local t - cell - mediated reactions, and in hodgkin 's disease and gastric cancer there is evidence that patients with sarcoid reactions in the regional lymph nodes have a better prognosis. it has been generally reported that patients with malignant tumors coexisting with sarcoid reactions have a good prognosis because this reaction commonly occurs in lymph nodes without metastasis. in fact, in our case and a few case reports of colon cancer with sarcoid reactions in the lymph nodes, there was no metastatic carcinoma in the dissected lymph nodes despite the large size of the tumor. in contrast, however, according to the few publications that mention lung - cancer - associated sarcoid reaction, such lesions do not influence the prognosis. to elucidate the relationship between this reaction and the prognosis of patients with cancer, especially colon cancer, an investigation based on a larger number of patients fdg - pet is useful for preoperative diagnosis of distant lymph node metastases of colorectal cancers. in present case, 18f - fdg - 18f - fdg - pet is very sensitive for a variety of malignancies, it can lack specificity. in addition to malignant tissue, any active infectious or inflammatory process, including sarcoidosis, can demonstrate fdg avidity [6, 24, 25 ]. thus, it is difficult to differentiate sarcoid reaction from lymph node metastases preoperatively, and there is no useful examination, except histopathological examination, for distinguishing lymphadenopathy caused by a sarcoid reaction from metastatic lymph nodes. in conclusion, we report a rare case of colon cancer with sarcoid reaction in the regional lymph nodes. the effect of the response on the prognosis in cases with colon cancer has not been fully elucidated due to the small number of such cases, and further analyses from a large number of cases are warranted to evaluate the relationship between sarcoid reaction and colon cancer. | lymph node swelling in the setting of malignancy generally suggests metastasis of the primary tumor. a granulomatous reaction, i.e. sarcoid reaction, occurring within the lymph nodes draining carcinomas is a well - known but uncommon occurrence. the phenomenon is especially rarely seen in colon carcinoma. we herein report a rare case of a 56-year - old japanese male with adenocarcinoma of the ascending colon associated with sarcoid reaction in the regional lymph nodes. a typical ileocecal resection and lymph node dissection were performed. histopathological examination revealed moderately differentiated adenocarcinoma of the ascending colon, and the dissected lymph nodes included epithelioid granulomas with multinucleated giant cells. these findings suggest the existence of a sarcoid reaction associated with colon carcinoma ; there was no metastasis in the dissected lymph nodes. the significance of this rare condition is discussed. |
microbial ecology provides the link between basic biochemical and molecular studies on toxicity reduction by microbial metabolism and environmental studies that determine exposure. this link provides the ability to determine which microorganisms are responsible for the actual transformations in nature, thereby establishing how predictive the laboratory pathway, kinetic, regulatory, and enzyme mechanistic information is for nature. this information can be important to the rate of toxicant removal, the type and concentration of intermediate product(s), and the identification of conditions that limit effective toxicant removal. nucleic acid - based methods now provide the main means to track important biodegrading populations. examples of these methods are given that illustrate tracking a biodegrading microbe injected into an aquifer, following community succession in a toluene - degrading fluidized bed reactor, aiding the isolation from nature of novel biodegrading organisms, and rapidly characterizing the extent of microbial diversity in an aquifer stimulated to co - metabolize trichloroethene.imagesfigure 2.figure 3.figure 4.figure 5. |
|
periodic limb movement disorder (plmd) is diagnosed when there are periodic limb movements during sleep (plms) exceeding norms for age, clinical sleep disturbance, and the absence of another primary sleep disorder or reason for the plms. pathological periodic limb movement index (plmi) is defined as > 15 movements / h in adults. periodic limb movement disorder is rarer than restless legs syndrome (rls), which is characterized by the sensory motor symptoms frequently associated with plms, usually occurring at night and leading to disrupted sleep and daytime fatigue as in neuromuscular disorders. several medications are known to induce and/or to worsen plmd (i.e., antidepressants, antihistamines, and antipsychotics). although alternative rls / plmd treatments include antiepileptic drugs (aeds), in contrast, topiramate (tpm)-induced rls also associated with plms was described in four patients affected by epilepsy,. we report a case of tpm - induced plmd in a patient affected by cryptogenic temporal lobe epilepsy lacking a history of previous sleep disorders. a 34-year - old male affected by cryptogenic temporal lobe epilepsy previously treated with carbamazepine (up to 1200 mg per day) manifested monthly complex partial seizures. topiramate slowly titrated up to 250 mg per day induced seizure freedom and, afterward, carbamazepine was discontinued. concurrently, he complained of insomnia, nonrestorative sleep, and daytime sleepiness (epworth sleepiness scale (ess) score : 16). in addition, his wife reported the appearance of frequent nocturnal leg movements that were never previously observed. serum examination (blood count, electrolytes, liver and renal function, thyroid hormones, and iron and ferritin levels) was unremarkable. therefore, our patient underwent a full polysomnography (psg) that showed a severe plmd (plmi : 62.7/h) associated with high plm arousal index (plmai : 11.9/h) ; low sleep efficiency ; high sleep latency, wakefulness after sleep onset, and number of awakenings ; high percentage of light sleep (n2) ; and low percentage of slow - wave sleep (n3) (see table 1). periodic limb movements during sleep were strictly associated with periodic electroencephalographic arousals and cyclic alternating pattern (cap). in particular, cap oscillations were triggered by plm with higher presence of cap subtypes a2 and a3 (see fig. 1). these cap subtypes represent an arousal phenomenon that likely leads to clinical correlates of disturbed sleep. therefore, because of the progressive impairment of insomnia and daytime dysfunction, tpm was slowly discontinued and switched to valproate up to 900 mg per day. during tpm discontinuation and after complete withdrawal, the patient underwent full psg (tpm : 50 mg per day). periodic limb movement index and periodic limb movement arousal index showed a significant improvement and, after tpm discontinuation, reached a normal value (plmi < 15/h). in addition, the cap rate exhibited a slight reduction, an increase of cap phase a1 and a parallel reduction of phases a2 and a3. all psg data are summarized in table 1. in order to evaluate the association between tpm and plmd, the naranjo probability scale documented a probable association (naranjo score : 8/13) between plmd and tpm intake. this is the first publication, to our knowledge, to describe tpm - induced plmd in a patient affected by cryptogenic temporal lobe epilepsy previously not complaining of sleep disorders. although there is a high night - to - night variability of plmi in plmd / rls that may influence our results, this issue is still controversial, and the nocturnal pattern of plm occurrence was highly reliable across nights, suggesting that a single - night study may be sufficiently sensitive to confirm diagnosis and associated sleep disturbances. therefore, we can state that plmd was probably induced by tpm in our patient. in addition, rls and plmd pathophysiology is highly debated ; a common central dysregulation of dopaminergic system seems to be implicated. although such aeds may be effective treatments for rls and plmd, tpm - induced rls was previously described in a few cases,. topiramate enhances gaba function and inhibits ampa and kainate glutamate pathways, inducing an extracellular modulation of dopamine release in the mesocorticolimbic dopamine system. these experimental lines of evidence are confirmed by its efficacy against alcohol, nicotine, and cocaine addictions,. therefore, we can hypothesize that tpm may modulate the dopaminergic pathway, thereby inducing plmd in subjects with specific individual susceptibility. on the other hand, high levels of eeg arousals and/or cap sequences prior to leg movements confirm the presence of sleep impairment in these patients,. periodic limb movements are short movements that can be entrained by central pattern generators in reciprocal oscillatory coupling. specifically, cap phases a2 and a3 that represent arousal phenomena are more probably associated with disturbed sleep as also demonstrated polygraphically in our patient (fig. 1). the patients are typically not aware of these limb movements, but quality of sleep may be compromised, and the bed partners might recognize plms. even though the literature failed to document a clear correlation between plms severity and sleep disruption, haba - rubio. found a correlation between plms and tiredness, sleep efficiency, and psychological well - being. periodic limb movement disorder, insomnia, and diurnal symptoms promptly recovered after drug discontinuation in our patient suggesting a probable association with tpm. we are aware that, regarding the mutual interactions between sleep and epilepsy, not only sleep deprivation and daytime sleepiness but also abnormal sleep per se represent well - known potential triggers for seizures and are themselves influenced by epilepsy in a sort of reciprocal effect. notwithstanding, comorbidities and pharmacological treatment are other commonly accepted major factors that influence this interplay. therefore, an accurate clinical history and psg study in selected cases could be useful in order to recognize potential drug - induced sleep disorders. on behalf of all authors, the corresponding author states that there is no conflict of interest. | periodic limb movement disorder (plmd) is characterized by pathological periodic limb movements during sleep, insomnia and/or diurnal sleepiness, and the absence of another primary sleep disorder. we report a patient with complex partial seizures who developed plmd while taking topiramate (tpm). he had no evidence of metabolic and/or other conditions inducing plmd. he also had fragmented sleep and disruptive plms on polysomnography, and plms subsided with change of antiepileptic drug. topiramate may modulate the dopaminergic pathway by inhibition of glutamate release, thereby inducing plmd as observed in our patient. although a single case does not allow any generalization, plmd should be considered in patients complaining of insomnia and treated with tpm. |
samples : edta - anticoagulated blood samples were collected from 51 sika deer (cervus nippon yesoensis) that were maintained in captivity for the purpose of meat processing in the kushiro district (hokkaido, japan) in june and july 2011. dna was extracted from 200 l of whole blood using the qiaamp dna blood mini kit (qiagen, hilden, germany), eluted with 200 l of buffer ae according to the manufacturer s instructions, and stored at 30c until use. screening and species - specific pcr : we screened all dna samples for the presence of hemoplasma using a previously described protocol. the f2/r2 primer set amplifies the 16s rrna gene of most hemoplasma species, including m. haemofelis, m. haemocanis, a 20-l reaction mixture for the screening pcr contained 2.5 l of 10x buffer, 2.5 l of 2 mm dntp, 1 l of 50 mm mgcl2, 0.75 u of taq polymerase (invitrogen, foster city, ca, u.s.a.), 1.0 l of each primer, 11.35 l of distilled water and 0.5 l of dna template. cycling conditions were as follows : initial denaturation at 95c for 5 min ; 35 cycles of denaturation at 95c for 30 sec, annealing at 60c for 30 sec, extension at 72c for 90 sec ; and a final extension at 72c for 5 min and cooling to 4c. all amplicons were electrophoresed on a 2.0% agarose gel in tbe buffer and visualized under uv light. to distinguish between candidatus m. haemocervae and candidatus m. erythrocervae, primers for the species - specific pcr were designed based on the 16s rrna gene sequences of candidatus m. haemocervae (ab558899) and candidatus m. erythrocervae (ab558897 and ab558898). the primer sets were cmhc f (5-ccgcgagtaggatagcagcc-3) and r2 for candidatus m. haemocervae, and cmec f (5-gcaaggggttccgcgtaaaa-3) and r2 for candidatus m. erythrocervae, respectively. pcr conditions were as previously described, except that the extension times were 60 sec. to evaluate their specificity, the method was initially tested using dna samples from deer confirmed to be positive for candidatus m. haemocervae and candidatus m. erythrocervae in this study. the specific pcr was performed for all deer samples which were positive in the screening pcr that targeted the 16s rrna gene as mentioned above. pcr assays for 16s rrna, 23s rrna and rnpb genes : sequences of the full 16s rrna gene were then assessed in several randomly selected samples that tested positive in the screening pcr. to determine the longer 16s rrna gene sequence of hemoplasma, 2 pcrs were performed using the following 2 primer sets : fd1 and r2, and f2 and rp2. pcr conditions were as previously described, except that the annealing temperatures were 58c for fd1/r2 and 52c for f2/rp2. based on the 23s rrna genes of deer hemoplasmas, including m. ovis - like sp. (hq197750, hq197751 and hq197752), deerhemo f (5-aaagagtgcgtaacagctcac-3) and deerhemo r (5-tcacgccggaattcttactt-3) were newly designed. to determine the 23s rrna gene sequence of hemoplasma, 2 pcrs were performed using the following 2 primer sets : 23s fw and deerhemo r, and deerhemo f and 23s rv. pcr conditions were as previously described, except that the annealing temperatures were 55c. the rnpb gene was amplified using a primer set described previously : 80f1 and 290r1. pcr conditions were as previously described, except that the annealing temperature was 50c. sequence and phylogenetic analyses : to determine nucleotide sequences of the positive samples, pcr products were purified using a qiaquick pcr purification kit (qiagen) or a qiaquick gel extraction kit (qiagen). direct sequence analysis was performed using bigdye terminator v3.1 cycle sequencing kit (applied biosystems, foster city, ca, u.s.a.). nucleotide sequence results were checked using the blast search program (http://www.ncbi.nlm.nih.gov/blast/blast.cgi) for comparison with other known sequences and aligned using clustal w software (http://www.genome.jp/tools/clustalw/). phylogenetic trees were created in mega software version 5.05 by the neighbor - joining method. nucleotide accession numbers : hemoplasma sequences from deer in this study were registered in genbank with the following accession numbers : for 16s rrna gene : kf306246 (no. 16), kf306249 (no. 33), kf306250 (no. 34) and kf306251 (no. 49) and for 23s rrna gene : kf306252 (no. 49) and rnpb gene : ab836744 (no. 13), ab836745 (no. 16), ab836746 (no. 33), ab836747 (no. 34) and ab836748 (no. 49). prevalence of hemoplasma infection : a total of 23/51 (45%) deer dna samples were positive for hemoplasmas in the screening pcr. the species - specific pcr was performed using dna samples from deer which were confirmed as candidatus m. haemocervae and candidatus m. erythrocervae by sequence analysis in this study. two pcrs were used to amplify each gene, and 439 and 363 bp amplicons were observed in candidatus m. haemocervae and candidatus m. erythrocervae positive samples, respectively (fig. candidatus mycoplasma haemocervae and (b) candidatus m. erythrocervae. lanes 1 and 2 : candidatus m. haemocervae ; lanes 3 and 4 : candidatus m. erythrocervae ; lane 5 : dual infection ; lane 6 : negative control (dw) ; lane m : molecular size marker (100 bp).). when the species - specific pcr was performed to screen pcr - positive samples, 12 and 17 samples were found to be positive for candidatus m. haemocervae and candidatus m. erythrocervae, respectively. six samples were found to be dual infections (table 1table 1.prevalence of hemoplasma infected deerpcr result (n=51)no. of deer (%) screening pcr positive23 (45.1) negative28 (54.9)species - specific pcrc. candidatus mycoplasma haemocervae and (b) candidatus m. erythrocervae. lanes 1 and 2 : candidatus m. haemocervae ; lanes 3 and 4 : candidatus m. erythrocervae ; lane 5 : dual infection ; lane 6 : negative control (dw) ; lane m : molecular size marker (100 bp). molecular characterization of hemoplasmas : the complete 16s rrna gene sequences were successfully determined for the 6 randomly chosen hemoplasma - positive samples. among cervine hemoplasma isolates, the 16s rrna gene sequences obtained from deer nos. 12, 16, 33 and 34 were most closely related to candidatus m. haemocervae (ab558899) with a percent identity of 99.86 to 99.32%. 16 which was representative sequence of candidatus m. haemocervae matched with a m. ovis - like sp. from white - tailed deer in america (fj824847) with a percent identity of 98.32%. candidatus m. erythrocervae (ab558898) with a percent identity of 99.79 to 99.71%. 49 which was representative sequence of candidatus m. erythrocervae matched 97.75% with a mycoplasma sp. (hq634379) detected from marsh deer in brazil, 97.79% with a mycoplasma sp. (table 2table 2.sequence identities (%) among (a) 16s rrna, (b) 23s rrna and (c) rnpb genes of candidatus mycoplasma haemocervae (isolate 16) and candidatus m. erythrocervae (isolate 49) detected in hokkaido sika deer. isolates 16 and 49 are one representative sequence of candidatus m. haemocervae and candidatus m. erythrocervae. genbank accession numbers of each hemoplasma detected in the other family cervidae are in parenthesissample no.m. ovis - like sp.mycoplasma sp.mycoplasma sp.mycoplasma sp.mycoplasma sp.deer-fawnb62-2b88-3group bgroup c(a) 16s rrna(fj824847)(hq634379)(hq634380)(kc512403)(kc512402)isolate 1698.3295.9195.196.395.77isolate 4995.9297.7593.5897.7997.8(b) 23s rrna(hq197752)(hq634381)(hq634382)nanaisolate ; mycoplasma sp. isolate from white - tailed deer in america (group a) (5).). ; mycoplasma sp. isolate from white - tailed deer in america (group a) (5). the 23s rrna genes from sample nos. 16 showed the closest relationship to m. ovis - like sp. from white - tailed deer in brazil (hq197752) with a percent identity of 97.61%. hemoplasma species in deer no. 49 were most closely related to mycoplasma sp. (hq634381) of marsh deer in brazil with a percent identity of 95.70% (table 2). (jq610624 and jq610628) recently described in a white - tailed deer from america (table 2). 12, 16, 33 and 34 was on a cluster separate from the m. ovis - like spp. in deer from brazil and america, and candidatus m. erythrocervae from deer nos. 13 and 49 was also on a cluster separate from the unclassified hemoplasma (hq634379) from marsh deer (fig. 12, 13, 16, 33, 34 and 49) and the other hemoplasma species based on 16s rrna gene using a neighbor - joining method. isolates b86, b175, deer - fawn, 0221, 2385 (hq634377 ; hq634378 ; fj824847 ; hq197746 ; hq197748), m. ovis (jf931135), candidatus m. haemocervae (ab558899), m. wenyonii(ay946266), mycoplasma sp. isolates b62 - 2, 1585, b88 - 3, group a, group b, group c (hq634379, hq197747, hq634380, kc512404, kc512403 and kc512402), candidatus m. erythrocervae (ab558898), candidatus m. haemominutum (ay150980), candidatus m. haematoparvum (ay383241), m. haemomuris (u82963), candidatus m. turicensis (dq825454), candidatus m. haemobos (eu367965), m. haemofelis (u88563), m. haemocanis (ay150973), m. suis (eu603330), candidatus m. haemolamae (nr074478) and candidatus m. kahanei (af338269) are shown. m. pneumonia (m29061) was used as an outgroup.). the 23s rrna gene - based phylogenetic tree revealed a similar result, wherein hemoplasmas from nos. 16 and 33 and from no. 49 were separated from the m. ovis - like spp. and the unclassified mycoplasma sp. 16, 33 and 49) and the other hemoplasma species based on 23s rrna gene using a neighbor - joining method. mycoplasma ovis - like sp. isolates 0221, b86 - 1, deer - fawn (hq197751 ; hq634383 ; hq197752), mycoplasma sp. isolates b62 - 2, 1585, b88 - 3 (hq634381 ; hq197750 ; hq634382), m. wenyonii (nr076982), m. suis (nc015153), m. haemocanis (nr076944), m. haemofelis isolates ohio2, langford1 (nc017520 ; nc014970) and candidatus m. haemolamae (nr076983) are shown. (jq610624) which are closely related to a m. ovis - like spp. 13, 16, 33, 34 and 49) and the other hemoplasma species based on rnpb gene using a neighbor - joining method. isolates group a, group b, group c (jq610624, jq610626 and jq610618), m. ovis (eu078612), m. wenyonii (eu078610), m. haemolamae (eu078613), candidatus m. haemominutum (eu078614), candidatus m. haematoparvum (eu078616), m. suis (eu078611), candidatus m. turicensis (ef212002), m. haemofelis (eu078617), m. haemocanis (eu078618) and candidatus m. kahanei (eu078615) are shown. m. fastidiosum (eu078609) was used as an outgroup.). 12, 13, 16, 33, 34 and 49) and the other hemoplasma species based on 16s rrna gene using a neighbor - joining method. isolates b86, b175, deer - fawn, 0221, 2385 (hq634377 ; hq634378 ; fj824847 ; hq197746 ; hq197748), m. ovis (jf931135), candidatus m. haemovis (jf931131), candidatus m. haemocervae (ab558899), m. wenyonii(ay946266), mycoplasma sp. isolates b62 - 2, 1585, b88 - 3, group a, group b, group c (hq634379, hq197747, hq634380, kc512404, kc512403 and kc512402), candidatus m. erythrocervae (ab558898), candidatus m. haematoparvum (ay383241), m. haemomuris (u82963), candidatus m. turicensis (dq825454), candidatus m. haemobos (eu367965), m. haemofelis (u88563), m. haemocanis (ay150973), m. suis (eu603330), candidatus m. haemolamae (nr074478) and candidatus m. kahanei (af338269) are shown. 16, 33 and 49) and the other hemoplasma species based on 23s rrna gene using a neighbor - joining method. mycoplasma ovis - like sp. isolates 0221, b86 - 1, deer - fawn (hq197751 ; hq634383 ; hq197752), mycoplasma sp. isolates b62 - 2, 1585, b88 - 3 (hq634381 ; hq197750 ; hq634382), m. wenyonii (nr076982), m. suis (nc015153), m. haemocanis (nr076944), m. haemofelis isolates ohio2, langford1 (nc017520 ; nc014970) and candidatus m. haemolamae (nr076983) are shown. 13, 16, 33, 34 and 49) and the other hemoplasma species based on rnpb gene using a neighbor - joining method. isolates group a, group b, group c (jq610624, jq610626 and jq610618), m. ovis (eu078612), m. wenyonii (eu078610), m. haemolamae (eu078613), candidatus m. haemominutum (eu078614), candidatus m. haematoparvum (eu078616), m. suis (eu078611), candidatus m. turicensis (ef212002), m. haemofelis (eu078617), m. haemocanis (eu078618) and candidatus m. kahanei (eu078615) are shown. in the present study, hemoplasma species were detected from 45% (23/51) of the blood samples from sika deer in hokkaido, japan, by screening pcr. a past study revealed that hemoplasma infections were found in only 9% (13/147) of free - ranging sika deer in iwate prefecture in the tohoku region of honshu island, japan. however, hemoplasma infections were found in 89.0% (65/73) of white - tailed deer in america and 87.1% (27/31) of brazilian deer, both groups of which were maintained in captivity or confined area. given that the sika deer in the present study had also been maintained in captivity, it seems that the high prevalence of hemoplasma infections is attributable to situations in which animals are in close contact with one another. as a result of the comparison of phylogenetic position of various hemoplasma strains which were found in the family cervidae using 16s, 23s rrna and rnpb genes, candidatus m. haemocervae obtained from hokkaido sika deer was closely related to a previously reported species which are so - called m. ovis - like spp. on 16s rrna (fj824847) and 23s rrna (hq634381) gene sequences, while low identity was shown on rnpb gene between those species. in addition, candidatus m. erythrocervae was closely related to a mycoplasma sp. (hq634379) detected from marsh deer in brazil on 16s rrna gene, while homology of 23s rrna gene sequence between those two species seemed to be low because the threshold of the 23s rrna gene sequence for identification between different bacterial species was 1.15%. moreover, phylogenetic trees based on the three genes also indicate that candidatus m. haemocervae and candidatus m. erythrocervae are independent from other cervine hemoplasma found in america and brazil. the phylogeny of hemoplasma species has been investigated based on the rnpb gene sequences, a more suitable target for phylogenetic discrimination of closely related taxa when compared with 16s rrna sequences. the rna polymerase beta subunit (rpob) and the 16s-23s rrna intergenic transcribed spacer (its) region were found to be reliable and useful taxonomic tools for species differentiation within the family mycoplasmataceae. further research is required to compare those genes among unclassified hemoplasma in the family cervidae, including candidatus m. haemocervae, candidatus m. erythrocervae, m. ovis - like sp. and other hemoplasma of free - ranging deer in america and brazil. however, a further study using free - ranging hokkaido sika deer is necessary, because animals using in this study were maintained in captivity. lower percent identities and divergent phylogenetic position support the notion that candidatus m. haemocervae and candidatus m. erythrocervae are potentially different species from the other cervine hemoplasma found in america and brazil. further investigation is needed to clarify phylogenetic position, molecular characterization and pathogenicity of deer hemoplasma in japan. | abstracthemotropic mycoplasmas (hemoplasmas) are cell - wall deficient, epierythrocytic bacteria that cause infectious anemia in several mammalian species. the prevalence of hemoplasma species was examined by screening and species - specific pcr using blood samples collected from 51 sika deer in hokkaido, japan. molecular analyses were performed for the 16s rrna, 23s rrna and rnase p rna (rnpb) gene sequences. a total of 23/51 (45%) deer dna samples were positive for hemoplasmas in the screening pcr. using species - specific pcr, 12 and 17 samples were positive for candidatus mycoplasma haemocervae and candidatus m. erythrocervae, respectively. sequencing and phylogenetic trees of those three genes indicate that the candidatus m. haemocervae and candidatus m. erythrocervae detected in japanese deer are potentially different species from the cervine hemoplasma found in deer from america and brazil. |
to explore the advantages of using artificial neural networks (anns) to recognize patterns in colposcopy to classify images in colposcopy. transversal, descriptive, and analytical study of a quantitative approach with an emphasis on diagnosis. the training test e validation set was composed of images collected from patients who underwent colposcopy. these images were provided by a gynecology clinic located in the city of cricima (brazil). the image database (n = 170) was divided ; 48 images were used for the training process, 58 images were used for the tests, and 64 images were used for the validation. a hybrid neural network based on kohonen self - organizing maps and multilayer perceptron (mlp) networks was used. the best results reached an accuracy of 72.15%, a sensibility of 69.78%, and a specificity of 68%. although the preliminary results still exhibit an average efficiency, the present approach is an innovative and promising technique that should be deeply explored in the context of the present study. a colposcopy is a test that allows the cervix to be viewed with up to 10 times magnification,1,2 which is essential for the evaluation of abnormalities or lesions (which are highly suggestive of cervical neoplasia)3,4 during cytopathological examinations and to assist in biopsies (which are essential for definitive diagnoses).5,6 infection with human papillomavirus (hpv) is a sexually transmitted disease and is considered a preneoplastic lesion. the incidence of hpv infection has increased in recent decades.710 the most common manifestation of hpv infection is subclinical, and the estimated prevalence of hpv infection is greater than 50% in sexually active women.1114 therefore, seeking a diagnostic imaging technique, such as colposcopy, medical informatics is proving increasingly helpful for certain clinical tasks, such as data storage, information retrieval, indication of warning signs, critical therapy, and image recognition interpretation.1518 the artificial neural networks (anns) used in medical informatics seek to provide methods for the classification of images from mathematical algorithms. anns are systems that are able to acquire, store, and use experiential knowledge to mimic the abilities of the biological nervous system.19 among the applications of anns, we highlight pattern recognition, which can greatly aid in the interpretation of imaging tests such as colposcopy and radiographs. currently, anns have been applied in several areas of medicine and have obtained approximately 8090% accuracy in areas such as oncology and mastology.20 in this context, the objective of this study is to use pattern recognition via anns for the automated classification of colposcopic images on dot pattern. a cross - sectional, descriptive, analytical, quantitative approach, with a diagnostic emphasis, approved by the ethics and human research board, was conducted. a hybrid neural network based on kohonen self - organizing maps and multilayer perceptron (mlp) network was used, and this model was chosen because it is a reasonably small net and as a result, it learns faster and reaches good generalization ability with a reasonably small sized training dataset.21 the training set consisted of images of patients submitted to colposcopy from january 2009 to may 2010 from a gynecology service in the city of cricima (santa catarina, brazil). a convenience sample was estimated by combining 179 images taken directly in the digital jpeg format (thus negating a need to scan the images) and authorized by informed consent for the original images. the database of images (n = 170) was subdivided into 48 images for training, 58 images for tests, and 64 images for validation, proportions suggested in previous studies.22 the neural network training was performed after the data collection and was divided into two parts. first, the images were processed without a filter, thereby resulting in 66 trials, with an accuracy rate of 65%. in the second step, each image was processed by the user with contrast enhancement, and then the euclidean distance of each image was found. the step after processing is divided into training, testing, and validation. at this stage, we used the application developed by the research group on applied computational intelligence and by the research group on information technology and communication in health of the universidade do extremo sul catarinense (santa catarina, brazil), whose interface is shown in figure 1. this software offers a hybrid neural network based on kohonen self - organizing maps and mlp networks.23 in the kohonen network training, 48 images were used. each of these images contained a sub - region of 64 64 pixels selected from the original image (fig. 1) by the software (this was the size that best characterized the dotted pattern, despite tests with 32 32 and 128 128 images, which resulted in lower accuracy values). the colposcopic image is read into the application, and then the user selects a region of interest with or without the dotted pattern, which will be handled by the library java advanced imaging (jai) and used in the neural network. the pixels are displayed and stored by the application that used the library jai, which makes the imaging. when selecting a region on the image to be used, the application stores the 64 64 pixels selected by the library jai area, and for the classification of a new image, the jai library is used again and each pixel is read to create a neuron network for each image pixel. the dot pattern was present in 20 of the images and absent in 28 of the images. the architecture of the kohonen network used for training was 64 neurons in the input layer and a two - dimensional lattice of 8 8 neurons in the kohonen layer. the output of this training was then used as the input for the mlp network trained with a backpropagation algorithm that classified the resulting feature map as belonging to either the group of images that show the dot pattern (class 1) or the group of images without this feature (class 2). the mlp network architecture used for training and classifying these patterns was defined with 3 layers, 64 neurons in the input layer, 45 neurons in the hidden layer, and 1 neuron in the output layer, and started with 10 iterations and ended in 400 iterations ; the learning rate started at 0.5 and ended at 0.6, a momentum of 0.4 with 500 iterations. the kohonen network structure was defined with two layers accomplished with an initial learning rate of 0.5 ending at 0.30 (although the final value was set at 0.01), a neighborhood size of 5 and an interval decrement in the neighborhood of 10, and the number of iterations starting at 10 and ending at 300. in the statistical analysis, we calculated the sensitivity, specificity, positive predictive value (ppv), negative predictive value (npv), positive likelihood ratio (lr+), negative likelihood ratio (lr), receiver operating characteristic (roc) curve, area under curve (auc) and accuracy of the validation of the ann, using the microsoft excel 2010 and ibm statistical package for the social sciences (spss) 21.0 software. the database of 170 images was used in training, testing, and validation. to reach the final state of ann, 126 cycles were performed in the training. the accuracy values obtained in the training ranged from 41.78% to 71.5%, and in the test, from 52.5% to 72.15%. the validation was performed with the highest accuracy of 72.15% for the neural network whose parameters are mentioned in the methods section. the sensitivity of the ann was 69.78%, and the specificity was 68.0% ; the ppv was 69.47%, and the npv was 68.29% ; and the calculations revealed an lr+ of 1.58 and an lr of 1.92. colposcopy is an important imaging method for the diagnosis and classification of cervical lesions.2 in our study, the accuracy demonstrated by the ann was 72.15%, which is below the average found in the literature of approximately 85%;2429 as an example, the study conducted in recife (pernambuco, brazil),24 which aimed to develop an intelligent system composed of anns and applied to the diagnosis of breast cancer in 2009, exhibited an accuracy of 95%. claude and colleagues30 developed a study for colposcopic image classification based on contour parameters used in a comparison study of different anns and the k - nearest neighbor reference method. they used 283 samples, and revealed that 95.8% of contour image set has been correctly classified.30 our findings revealed a lower accuracy, which can be explained by the neural network model applied, and the type of contour identified in our study (dotted), hardly characterized. researchers from alicante (spain) evaluated the accuracy of using three anns in the diagnosis of urological dysfunctions25 with the objective of assisting the diagnosis of varied and complex pathologies and helping to identify sick patients while reducing the cost and wear caused by medical treatment. the accuracy obtained was approximately 83%, thereby demonstrating the method s effectiveness in helping the clinician make more accurate diagnoses.25 such an accuracy was superior to that of our study, possibly because three anns were used instead of a single network. the standard colposcopic dot type consists of a focal point in which the capillaries form a dot image.1,2 speckles that are finer and smoother in appearance indicate a greater likeliness of classification of low - grade injury or metaplasia, especially if the intercapillary distance is small. the probability of high - grade injury increases when the dithering is coarser and less regular.1,2 researchers at the albert einstein college of medicine in the united states evaluated the reduction in the rates of false - negative cervical smears with the help of ann, and 487 images of smears of 228 women with documented biopsies of high - grade precursor lesions or invasive carcinoma, which were obtained from 10 different laboratories, were analyzed.26 the instrument was used to detect cytological abnormalities such as atypical squamous or glandular cells of undetermined significance, low- or high - grade squamous intraepithelial lesions, and carcinoma. the results indicate a significant reduction in the rate of false negatives, thereby facilitating early detection of premalignant lesions of the cervix and contributing to prevention of invasive carcinoma of the cervix.26 similar to our work, this study contributed to explaining new methods to aid in the early identification of changes in the uterine cervix. in brazil, a survey by the federal university of rio de janeiro employed anns for the classification of breast lesions through the analysis of samples based on digital images of a small section of examinations via fine - needle aspiration.27 for the classification of lesions, backpropagation using nine inputs to generate a logic output was used with the trained neural network algorithm, thereby indicating benignity or malignancy. another brazilian study performed in so paulo in 2007 used ann to classify postural patterns in children with mouth - breathing,28 and included 84 children, of whom 52 were mouth - breathing and 32 were nasal - breathing. the analysis contained anthropometric variables and measured diaphragm excursion and body posture. in the classification of posture, these results are also superior to the results obtained in this study.28 anns have also been used for the prediction of infectious diseases, such as hepatitis a, as demonstrated in a study conducted in 2005 in rio de janeiro, which achieved a specificity of 99%, a sensitivity of 70%, and an error rate of 12%.29 a study in santa catarina, brazil, that sought to aid in the diagnostic imaging of primary osteoarthritis of the lumbar spine obtained an accuracy of 62.85% in the use of an ann for the recognition of image patterns of osteophytes of the lumbar spine in the lateral view.23 as demonstrated above, the number of applications of anns is increasing, and they are increasingly used in various areas of medicine.19,20 in gynecology, anns were explored in an italian study that sought to help classify ovarian masses as malignant or non - malignant using images obtained by transvaginal ultrasound doppler flowmetry. the tests revealed a sensitivity of 96% and a specificity of 97.7%, which are greater than those in our study, perhaps because a different imaging method was used.31 several other studies have been conducted to evaluate the accuracy of neural networks in the classification of mammography images, and all obtained results demonstrate that the method would be effective in aiding in the early detection of suspicious lesions in the breast.20 our study also aimed to classify images, but the results were inferior. our research considered the use of a hybrid model based on kohonen self - organizing maps and mlp networks, which was successfully used in previous studies.21,32 thus, our study presented the first use of hybrid anns for pattern classification of dot images obtained via colposcopy. we recommend that future studies conduct tests with more images of patients that present or do not present dot patterns in the colposcopic examination, improve the methodology used in image processing to seek greater system accuracy, and we also recomends to refine the hybrid model used, the use of methods such as random forest and boosting and using other architectures of neural networks. although the neural network has exhibited moderate results because of the innovative nature of this study, its values demonstrate the potential of anns for helping the healthcare professional. the use of computers to aid in the analysis, interpretation, and classification of images has proven effective in the diagnoses of many medical specialties. the initial goal was not to provide high accuracy but to obtain a performance that is close to that of the specialist, thereby serving as a support tool and not as a substitute method and assisting in the learning process. | objectiveto explore the advantages of using artificial neural networks (anns) to recognize patterns in colposcopy to classify images in colposcopy.purposetransversal, descriptive, and analytical study of a quantitative approach with an emphasis on diagnosis. the training test e validation set was composed of images collected from patients who underwent colposcopy. these images were provided by a gynecology clinic located in the city of cricima (brazil). the image database (n = 170) was divided ; 48 images were used for the training process, 58 images were used for the tests, and 64 images were used for the validation. a hybrid neural network based on kohonen self - organizing maps and multilayer perceptron (mlp) networks was used.resultsafter 126 cycles, the validation was performed. the best results reached an accuracy of 72.15%, a sensibility of 69.78%, and a specificity of 68%.conclusionalthough the preliminary results still exhibit an average efficiency, the present approach is an innovative and promising technique that should be deeply explored in the context of the present study. |
a convenience sample of 160 public swimming pools from 2 metropolitan atlanta, georgia, counties was used to collect filter backwash samples for parasite examination during a 7-week period (late august october 2006). information on age of swimmers, pool type, pool size, and number of swimmers was gathered. filter backwashing is a cleaning process by which the water flow through the filter is reversed so that accumulated debris trapped in the filter is dislodged and directed to waste. all selected pools had a sand filter (most public pools in the metropolitan atlanta area use sand filters) and had been used by swimmers before the backwash cycle and sample collection began. one - liter samples of filter backwash were collected in wide - mouthed plastic bottles shortly after the filter flow grew turbid and were transported and stored at 4c before flocculation. the samples were calcium carbonate flocculated within 2 weeks, typically within a few days, after collection (8). pellets were stored in dnase, rnase - free, sterile microcentrifuge tubes. dna was extracted from 250350 mg of each pellet by using a fastprep dna kit (mp biomedical, solon, oh, usa) ; 20 l of polyvinyl pyrolidone (fw 40,000 ; fisher scientific, pittsburgh, pa, usa) was added to the cls - vf buffer provided in the kit. final purification used a qiaquick spin column kit (qiagen, valencia, ca, usa). real - time qpcr used the stratagene mx3000p thermocycler (stratagene, la jolla, ca, usa) and the triplex pcr reaction and amplification protocol described for entamoeba histolytica, giardia intestinalis, and cryptosporidium spp. (primers and probe amplify both c. parvum and c. hominis) with a reported sensitivity and specificity of 100% (9). sample inhibition was alleviated by repeating the qpcr with 4.7 g/l of bovine serum albumin (sigma, st. of the 160 filter backwash samples collected, 13 (8.1%) were positive for 1 or both parasites ; 10 (6.2%) were positive for g. intestinalis ; 2 (1.2%) were positive for cryptosporidium spp. ; and 1 (0.6%) was positive for both pathogen genera. because of the small amount of target dna, speciation was not possible with most samples the table summarizes parasite prevalence by age of swimmers, pool type, pool size, and number of swimmers. although 117 (73.1%) of all pools tested were commonly used by children (28 were designated for children only, 89 for children and adults), these pools accounted for 12 (92.3%) of 13 positive pools sampled. in comparison, 43 (26.9%) of 160 pools designated for adult use were associated with 1 (7.7%) of 13 positive pools. of the positive samples, 10 (76.9%) of 13 were found in community pools, although community pools accounted for 40% (64/160) of pools assayed. small - volume pools (16 y of age. residential and hotel / motel swimming pools were excluded from the study. although this study was small and the power low, estimates of the prevalence odds ratio (por) were calculated. those associations that were statistically significant for finding protozoa - positive samples were as follows : community pools (por 5.7, 95% confidence interval [ci ] 1.521.8) and weekly number of swimmers of < 75 (por 5.1, 95% ci 1.419.4). although the positive parasite sample prevalence was higher in pools frequented by children and adults (10.1%) than in pools designated for adults only (2.3%), the por was not significant (por 4.8, 95% ci 0.638.1), likely because of the small sample size. prior analysis of 22,131 us pool inspections demonstrated that children s pools had an increased incidence of critical pool code violations perhaps because their smaller volumes and depths make maintaining appropriate levels of disinfectant more difficult (4,10). in addition, younger children may be more likely to contaminate recreational water as a result of being incontinent or having higher levels of perianal fecal contamination (11). this finding necessitates greater vigilance in maintaining water quality for this population because they are more likely to contaminate the water and are more vulnerable to the severe effects of diarrheal illnesses. although an earlier sampling schedule may have detected more contamination, these findings suggest that contamination events in some pool types or with some swimmer compositions may be relatively common during the swim season. the prevalence of contamination found by this study is difficult to compare with that found by other studies that focus on serial samples from a small number of pools. however, the key finding, parasite detection, is repeated in all the studies cited (57). the risk for disease transmission is difficult to ascertain because most studies, including this one, have not measured viability of the parasites recovered from water or filter backwash. however, intact cryptosporidium oocysts observed following hyperchlorination to inactivate the parasite are commonly noninfectious (m.j. this study is limited by having a small sample size, by being a convenience sample, and by using backwash collected from pools with a single filter medium (i.e., sand) exclusively. in addition, the sensitivity and specificity of pcr detection in pool - associated backwash samples is unknown, although positive and negative controls reacted appropriately. although these deficiencies would likely lead to underestimates of the prevalence of parasites in this sample, clearly such study results are neither generalizable to all types of pools nor an accurate measure of national contamination levels. however, despite these deficiencies, the finding of swimming pool filter contamination by giardia sp. and cryptosporidium spp. is key and reinforces the need for continued emphasis on improving pool operation and maintenance (e.g., preventive hyperchlorination or flocculation on a routine basis). these improvements should also include consideration of supplementary inline disinfection systems known to inactivate cryptosporidium spp. these data also underscore the need for the general public, particularly immunocompromised persons, to understand recreational water associated illness transmission and adopt healthy swimming habits (e.g., no swimming when ill with diarrhea, no swallowing of pool water, improved hygiene) that are needed to reduce the risk for pathogen transmission. | cryptosporidium spp. and giardia intestinalis have been found in swimming pool filter backwash during outbreaks. to determine baseline prevalence, we sampled pools not associated with outbreaks and found that of 160 sampled pools, 13 (8.1%) were positive for 1 or both parasites ; 10 (6.2%) for giardia sp., 2 (1.2%) for cryptosporidium spp., and 1 (0.6%) for both. |
infectious diseases caused by bacterial, viral, fungal, or parasitic pathogens continue to be the leading cause of morbidity and mortality worldwide despite the availability of effective antimicrobial agents and vaccines over the last fifty years or more. the continual emergence of previously undescribed new pathogens, reemergence of old pathogens, and the rising crisis of antibiotics resistance will certainly heighten the global impact of microbial infections in the 21st century. these problems are mainly due to inadequate knowledge of the dynamic duality relationships between symbiosis (sym) and pathogenesis (pat) in microbial infections. the term symbiosis, which may have many variations on its definition, in this paper refers to living together through a close and prolonged association between two or more organisms of different species [3, 4 ]. there are two major limitations inherent in the conventional theories of microbial infection. on the one hand, in the past century, focusing research on individual virulence genes and the important pathogens has been the traditional approach to human infectious diseases. on the other hand, as joshua lederberg pointed out [6, 7 ], medical science is imbued with the manichaean view of the microbe - human host relationship : we good ; they evil. almost all broad - spectrum antimicrobial agents, which are in the best interest of pharmaceutical industries, kill both the good microbes as well as the bad germs. even though narrow - spectrum antiinfective agents are not narrow for pathogens, they also target both the good and bad microorganisms with a limited range of species. animals and plants are continually infected by an extensive diversity of symbiotic or invading organisms including bacteria, virus, fungus, or parasites. infection of bacteria by phages started long before the emergence of animals and plants. microbial infection is an evolutionary paradigm which is associated with coevolution between hosts and microbes [6, 7, 9 ]. this coevolution can be defined as the process of reciprocal and dynamic genetic changes in two or more species. the conventional wisdom in medicine holds that microbial infection is a pathogenic process in which a pathogen enters, establishes itself, and multiplies in the host. this represents zero - sum thinkingthe belief that if one player gains, other player must inevitably lose. methods and concepts of the zero - sum game theory have proved successful in studying the strategy of pure conflict. the most challenging issue in infectious diseases is how to dissect the dynamic sym - pat duality (dspd) in microbial infections using infectomics and mathematics such as focal point- (fp-) based game theory. game theory, defined in the broadest sense, is the study of the strategies of conflict, cooperation, and mixed situations in which both coexist. thomas schelling 's concept of focal point, which is an equilibrium usually standing out from the others, addressed the crucial question of how to interpret the multiplicity of equilibria [11, 12 ]. focal point, the principal component of schelling 's game theory, is a convergence point of expectations about actions in a game. this article attempts to enlarge the scope and application of focal point game theory in microbial infections, extending from the zero - sum games to the nonzero - sum games. our health is associated with the dynamic interactions of three microbial communities (nonpathogenic microbiota (np), conditional pathogens (cp), and unconditional pathogens (up)) with the hosts at three different health statuses (nonsusceptibility (ns), conditional susceptibility (cs), and unconditional susceptibility (us)) (see figure 1). np is the major microbial community which forms a healthy symbiotic superorganism with the hosts. the ecology and evolution of np - ns interaction are essential and fundamental for health. from birth to death, we share a benign coexistence with a vast, complex, and dynamic consortium of microbes. most of our microbial commensals reside in our gastrointestinal (gi) track packed with up to 100 trillion (10) microbes [1, 13 ]. these include stimulating the immune system, protecting the host from microbial invasion, and aiding digestion. the gut microbiota, which is essential for human homeostasis, is established rapidly after birth and remains relatively stable throughout the life. the gi mucosa provides a protective interface between the internal environment and the constant external challenge from food - derived antigens and microbes. cp and up are minor microbial communities that mainly contribute to the pathogenesis of microbial diseases. the distinction between the commensal and the pathogen in the cp community can be blurred because they may cause diseases under certain sub - health conditions of the hosts, or in immunocompromised hosts. for example, pneumococcus, meningococcus, and haemophilus bacteria regularly exist as part of the normal microbiota of the host respiratory track and are mostly carried asymptomatically despite the fact that they can cause well - defined diseases [14, 15 ]. microbes in the cp community dynamically evolve in two opposite directions, which are toward either the np (more cooperative or mutualistic) or up (more pathogenic) microbial community. microbes with high pathogenicity belong to the up microbial community. the three microbial communities and three statuses of the hosts are subjected to dynamic reciprocal changes driven by transfer of genetic materials. extending along the dynamic continuum from conflict to cooperation, microbial infections always involve symbiosis and pathogenesis, which are two fundamental components of the host - microbe interactions (see figure 2). there exists a dynamic sym - pat duality in microbial infection, which is the most fundamental issue of infectomics. dspd is reflected in the genotypic and phenotypic infectomes, which are encoded by the genomes of both the microbes and their hosts. the opposition and unity of sym and pat are indispensable, and the academic viewpoint that the unity of opposites of sym and pat gives impetus to the development of microbial infection is considered as the core idea and radical principle of the duality representations of microbial infections. in certain circumstances and at a certain stage of the development of microbial infection, each of the two aspects of sym and pat will transform from antagonism into mutualism or from mutualism into antagonism. sym and pat can be quantitated by measuring symbiotic index (si), which is quantitative fitness for the symbiotic partnership, and pathogenic index (pi), which is quantitative damage to the symbiotic partnership, respectively. the most crucial studies are to identify infectomic signatures specific for si and pi. the set of symbiotic or pathogenic parameters is defined as a function si(x) or pi(x). si(x) and pi(x) are continuous functions ranging from 0 to 1 to admit different degrees of sym and pat, respectively. si(x) = 0 and pi(x) = 0 indicate that x and x are perceived to be zero - symbiotic and zero - pathogenic, respectively. si(x) = 1 and pi(x) = 1 indicate that x and x are perceived to be completely symbiotic and completely pathogenic, respectively. intermediate values of si(x) and pi(x) indicate that x and x are perceived to be partially symbiotic and partially pathogenic, respectively. symbiotic points are used to determine the dynamic duality between sym and pat. the symbiotic point (sp) is a function of si and pi : (1)sp = f(si, pi). the focus of the dynamic duality research is to examine the ability of sp to transform situations of potential conflict (up - us and cp - cs) into situations of cooperation (np - ns). sp bears analogy to schelling 's focal point, which is any feature of such a game that provides a focus of convergence. in the games with multiple nash equilibria such an equilibrium is a focal point which can be easily recognized by all the players. thomas schelling 's strategy of conflict (1960) has been recognized as one of the most important works of game theory [11, 17 ]. there is no doubt that focal points play a central role in schelling 's game theory. understanding focal points is not only a key to improving game theory but also a key to dissecting sps. in this paper, three types of gtms are proposed for studies on np - ns interactions (cooperative game), up - us interactions (noncooperative games), and cp - cs interactions (dilemma or bargaining game). first, the ns - ns interactions are dissected with pure cooperative games in which each player chooses the strategy corresponding with the focal point in the expectation that the others will do the same. the significance of focal points can be shown most clearly in the pure cooperative games. as there is no conflict of interests in these games, all the players merely want to cooperate and they do not choose the alternative ways. analysis of the cooperative game issues is to focus on coalition formation and distribution of the gains through cooperation. the sp in the np - ns games tends to be maximal (see figure 2). secondly, noncooperative gtms are used for analysis of the up - us interactions. in contrast to cooperative games which focus on collective rationality and common interest, noncooperative games emphasize individual rationality and individual optimal strategy. the sp in the up - us games tends to be minimal (see figure 2). in games of pure conflict, defection is the equilibrium strategy and the total benefit to all players in the game, for every combination of strategies, always adds to zero (zero - sum). in the antagonistic up - us interaction model, the surviving strategies of the up community conflict with that of the us host. the up evolves to exploit the host as much as possible, and the host adapts to exclude or limit the damage caused by the up. thirdly, we consider the strategic use of focal point theory in mixed situations to analyze the cp - cs interactions in which there is both conflict and mutual dependence. the most well - known example is the prisoner 's dilemma game (a two - player game) in which each player chooses between a cooperating and defecting strategy. in this game the two - player game can be extended to the n - player prisoner 's dilemma game with arbitrary numbers of players. e. coli is one of the best understood and most thoroughly studied organisms and is advantageous as a model microorganism for the current studies. this bacterium is genotypically and phenotypically a highly diverse species, which is present in the three microbial communities (see table 1). most e. coli strains are commensals of higher vertebrates belonging to np, but some are pathogenic (cp and up). uropathogenic e. coli (upec) in the cp group are the most common cause of community - acquired urinary tract infection (uti). upec are responsible for about 80% of the estimated 150 million utis diagnosed annually. e. coli o157, which belong to the up group, is a major food pathogen. shigella species, the cause of dysentery, are now known to be multiple distinct lineages of e. coli. genomes of those e. coli strains have been sequenced (see table 1). recently, better e. coli strains (mds41, 42, 43) have been engineered in which about 15% of the genome has been removed with the use of synthetic biology. coliphage, a virus which infects e. coli, is a major contributor responsible for diversification of e. coli [20, 21 ]. from a population - dynamic view, the interactions between coliphage and e. coli are analogous to those of a predator and a prey. the development of microbial infections depends on the dynamic sym - pat duality, which is governed by the genomes of both the microbes and their hosts. molecular evolution of genetic structures for the sym - pat duality is influenced by both biotic and abiotic environmental factors in the ecosystems. there are three types of genetic / genomic determinants (ggds) that may contribute to the sym - pat duality of microbial infections under specific environmental conditions (see figure 3). the sym ggds from the microbial partner include symbiosis - related genomic islands (syi), plasmids, transposons, and microbiome, which is a collective genome of microbiota [2, 22, 23 ]. the symbiotic homeostasis of the superorganism formed by the microbiota and its host is governed by hologenome, a complex of the host genome and microbiome [22, 25 ]. these include pathogenicity islands (pai), virulence plasmids, pathogen - associated molecular patterns (pamps), and endogenous alarmins. pamps are a diverse group of microbial molecules, which are recognized by the host innate and adaptive immune system, primarily through toll - like receptors (tlrs). effector cells of the innate and adaptive immunity can release alarmins when they are activated by pamps. endogenous alarmins and exogenous pamps elicit similar responses by conveying a similar message. therefore, they constitute a larger family of damage - associated molecular patterns (damps). the third type of ggd pool has dual functions that depend on external and internal environments. these include ecological islands (eci), certain ggds from conditional pathogens (such as cp factors (cpfs) and cp islands (cpis)), and the host ggds with dual effects on microbial infections. the dual ggds contribute to the sym and pat duality in specific ecological niches and within particular organisms. the same ggd may act as an syi when the microbial recipient establishes a symbiotic relationship with its host, but becomes a pai when it is adapting the pathogenic niche. a comparative infectomic study suggests that gima, a 20-kb genomic island, is a typical cpi. the dual biological functions of gima depend on the genomic environments in e. coli strains. gima present in meningitic e. coli k1 genome (o18:k1:h7) is essential for bacterial crossing the blood - brain barrier to cause meningitis. in contrast, gima is required for the probiotic function of e. coli k24 strain a0 34/86 (o83:k24:h31), which has been safely and effectively used in czech pediatric clinics since 1967. the dual sym - pat properties of microbial determinants were also observed in photorhabdus, which is a genus of gram - negative bacteria mutualistically associated with entomophagous nematodes of the family heterorhabditiae. a hexa homologous gene from photorhabdus is able to regulate both symbiosis and pathogenesis. some microbes exhibit dual behavior as symbionts and pathogens in a manner dependent on the hosts. sooty mangabey (sm) monkeys infected with simian immunodeficiency virus (siv) do not develop acquired immunodeficiency syndrome (aids). in contrast, siv infection of non - natural host monkeys, such as rhesus macaques (rms), causes aids that closely resembles the human disease. similarly, polydnaviridae, a family of double - stranded dna viruses, have evolved complex life cycles in which they interact as symbionts with one host and as pathogens with another. all multicellular organisms, including human and flies, have evolved the conservative innate immune system as a double - edged sword. it enables the host not only to combat pathogens but also to develop microbial tolerance to cohabit nonpathogenic microbiota by maintaining the homeostatic balance between the host and microorganisms [24, 33 ]. tlrs play central roles in the activating process of the innate immune system with dual functions. they have recently been shown to be involved in modulating intestinal homeostasis by recognizing commensal bacteria. they also sense extracellular pamps by triggering signaling, which results in the activation of proinflammatory (pi) pathways. pi ligands of tlrs may be important for the activation and expansion of natural t regulatory cells (nattreg), which control both deleterious and protective immune responses upon microbial infections. both innate tlrs and specific t cell receptors (tcr) contribute to the dual functions of nattreg. the full range of the dual ggds in the immune system is unknown so far. however, it can be expected that the molecular evolution of the dual ggds during the host - microbe coevolution will certainly lead to dynamic changes in the sym - pat duality. sym and pat, the fundamental components of microbial infection, can be defined as a function si(x) or pi(x). si(x) and pi(x) are continuous functions ranging from 0 to 1 to admit different degrees of sym and pat, respectively (see figure 4). si(x) = 0 and pi(x) = 0 indicate that x and x are perceived to be zero - symbiotic and zero - pathogenic, respectively. si(x) = 1 and pi(x) = 1 indicate that x and x are perceived to be completely symbiotic and completely pathogenic, respectively. if si is close to or equal to 1, microbial infection is a physiological process. it is now well accepted that mitochondria were derived from an endosymbiotic relationship with internalized proteobacteria, via a progressive transfer of genetic material. the symbiotic nitrogen fixation process for converting atmospheric dinitrogen (n2) to ammonia (nh3) is essentially dependent on two partners : the host legume plant and bacteria belonging to the family rhizobiaceae. if the pi value approaches or reaches the maximum limit, microbial infection is more completely associated with a pathogenic process. intermediate values of si(x) and pi(x) indicate that x and x are perceived to be partially symbiotic and partially pathogenic, respectively. microbial infections induced by conditional pathogens represent a competitive relationship (see ii or iii in figure 4). for example, polydnaviruses have evolved complex life cycles in which they are able to adapt to a mutualistic partnership with one host and become pathogens with another. the outcome of a game is not only determined by one individual 's choices, but also depends on the strategies used by all the others. the dynamic sym - pat duality influenced by both microbes and their hosts is the key factor that determines the outcome of a game associated with microbial infection. one of the most fundamental issues in game theoretical solution concepts is that strategies used by individual players are based on the differences in payoff perceived by them. fps constitute shared expectations that coordinate the activities of diverse players collectively or independently seeking their goals. by harmonizing anticipated behaviors or responses despite the presence of imperfect information, individuals are able to coordinate their activities towards their ends. in 1960, schelling classified games into three major categories : pure cooperative game on one side, pure conflict games on the other, and combinations of partial cooperation / partial conflict games in between. the pure cooperative game models are used for dissecting np - ns interaction problems. the payoff matrix for a pure np - ns problem would resemble something like that in figure 5(a). in contrast, the pure up - us interaction, a situation of pure antagonism, is characterized by completely opposing interests, where the pathogenesis of microbial infection is the most predominant event. the payoff matrix for the pure up - us game would look something like that in figure 5(b). the state of microbial infection has conventionally been characterized as lying on the extreme conflict end. this depiction comes from the manichaean view of the microbe - human host relationship. this situation is depicted in figure 5(b) as a two - player game. in the pure conflict game, the relationships between the microbes and their hosts end up in a war of all against all in which the payoffs of the outcomes add to zero (zero - sum). the three microbial community principle and the dynamic sym - pat duality concept would help establish a holistic view of microbial infections. the cp - cs interaction is a situation where cooperation and conflict coexist. as illustrated in figure 5(c), the payoffs for the cp - cs games would lie midway between the pure cooperative and pure conflict games. the cp - cs problems are microbial dilemmas, in which there is a mixture of mutual dependence and conflict of partnerships and competition. the underlying idea arises naturally from the well - known games for the social dilemmas and the prisoner 's dilemma (pd), in which each player chooses between a cooperating and a defecting strategy. as shown in figure 5(c), each player receives a higher playoff by defecting than by cooperating, no matter what the other player chooses. the cp - cs interactions can coevolve toward two different directions, increasing (more cooperation) or decreasing (more antagonism) the sp (see figure 2). in this paper, focal point theory - based game models are proposed for analysis of the dynamic sym - pat duality in microbial infections. dspd is the most fundamental problem in infectomics, which is the integration of omics and mathematical / computational approaches. there are three types of infectomic approaches that can be used for the control of microbial infections : ecological infectomics, immunoinfectomics, and chemoinfectomics. developing novel immunological intervention strategies for the prevention and treatment of microbial infections using infectomic signatures and immunomic approaches falls within the field of immunoinfectomics. chemoinfectomics represents the most powerful approach to the development of a new generation of drugs for antimicrobial chemotherapy. as microbial infection is an ecological and evolutionary paradigm which is associated with coevolution between hosts and microbes (such as human host and microorganisms, phages, and bacteria) in dynamic ecosystems, two ecological infectomics - based spc approaches (increasing and decreasing sp) can be used for rational control of infectious diseases. the focus in sp increasing approaches is how to transform situations of potential conflict (pathogenesis) into cooperation (symbiosis) by dissecting the dynamic duality relationships between sym and pat in microbial infections and developing symbiotic agents (symbiotics) that favor a healthy symbiosis. symbiotics are defined as products that are beneficial to symbiotic ecology of the superorganisms consisting of microbes and their human hosts. these include microbial (e.g., probiotic bacteria) and nonmicrobial agents (e.g., prebiotics). the introduction of beneficial symbiotics with higher sp in our body should be a very attractive rationale for modulating the microbiota, improving the symbiotic homeostasis of the superorganism, and providing a microbial stimulus to the host immune system against pathogens. the use of probiotics has been suggested as a promising approach for combating infectious diseases, and delivering drugs and vaccines. decreasing sp is another rational strategy for control of microbial infections. as phages, which specifically kill bacteria, play an important role in the ecology, evolution, and virulence of a number of pathogens, there is a rational use of phages for treatment and prevention of bacterial infections. the use of phages to treat bacterial infections has a long history dating back to mid 1910 's. due to the availability of effective broad - spectrum antibiotics in the early 1940 's, phage therapy was discarded in western medicine at that time. the rising crisis of antibiotic resistance has recently increased great interest in phages and their use as natural antimicrobial agents to fight microbial infections. compared with commonly used antibiotics, recent studies have shown that coinfection with gb virus c (gbv - c) is associated with a decreased mortality in hiv - infected patients. therefore, reducing sp between microbial agents (such as phages and gbv - c) and targeted pathogens is another excellent ecological approach for the development of novel antimicrobial agents. in contrast to the ecological infectomics - based spc approaches that focus on the symbiotic relationships (such as np - ns and cp - cs interactions) between the hosts and microbial communities, immunoinfectomics- and chemoinfectomics - based spt approaches emphasize the use of antagonistic relationships (such as up - us interactions) between the hosts and microorganisms. it is important to point out that the spt approaches are intrinsically different from the conventional pathogen - targeting antimicrobial agents, which kill both pathogens and nonpathogens. the availability of the genomic information from both microbes and their hosts has resulted in exciting new progress in the field of immunoinfectomics. nanobody (the smallest fragment of naturally occurring single - domain antibody)-based technologies and immune epitope mapping have emerged as the very powerful tools for the discovery and development of novel antimicrobial agents. recently, a nanobody - conjugated human trypanolytic factor has been successfully used for an experimental therapy of african trypanosomiasis. concurrent advances in both high - throughput chemistry and infectomics have given rise to the field of chemoinfectomics for elucidating and validating drug targets, and generating novel therapeutics. chemoinfectomics refer to the use of small synthetic molecules that are highly specific for defined infectomic targets, for biological function analysis and to discover new drug leads. the progress towards understanding the dynamic sym - pat duality in microbial infections using focal point theory - based game models will greatly facilitate the use of ecological infectomics, immunoinfectomics, and chemoinfectomics for the rational control of infectious diseases. | extending along the dynamic continuum from conflict to cooperation, microbial infections always involve symbiosis (sym) and pathogenesis (pat). there exists a dynamic sym - pat duality (dspd) in microbial infection that is the most fundamental problem in infectomics. dspd is encoded by the genomes of both the microbes and their hosts. three focal point (fp) theory - based game models (pure cooperative, dilemma, and pure conflict) are proposed for resolving those problems. our health is associated with the dynamic interactions of three microbial communities (nonpathogenic microbiota (np) (cooperation), conditional pathogens (cp) (dilemma), and unconditional pathogens (up) (conflict)) with the hosts at different health statuses. sym and pat can be quantitated by measuring symbiotic index (si), which is quantitative fitness for the symbiotic partnership, and pathogenic index (pi), which is quantitative damage to the symbiotic partnership, respectively. symbiotic point (sp), which bears analogy to fp, is a function of si and pi. sp - converting and specific pathogen - targeting strategies can be used for the rational control of microbial infections. |
we performed three interrelated nested studies in an occupational cohort of 151,347 employees in finland (16). the eligible population of 151,347 participants was linked to national health and prescription registers through unique personal identification codes assigned to all citizens in finland. for all participants in the eligible population, the linkage to registers was 100% complete, and there was no sample attrition during the follow - up. study 1 examined differences in antidepressant medication use between 851 individuals with incident type 2 diabetes and their 4,234 individually matched diabetes - free control subjects with complete records of severe depression and prescribed antidepressant use over a fixed period of 4 years before the diagnosis of type 2 diabetes between 1 january 2001 and 31 december 2005. the randomly selected control subjects were drawn in a 5:1 ratio for each diabetes case subject, matching individually for age - group, sex, socioeconomic position, type of employment contract, type of employer, and geographic area. for a flow chart depicting sample selection, see supplementary efig. 1 (available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc10-1187/dc1). because we were unable to estimate absolute risk of diabetes associated with antidepressant use with the retrospective case - control design in study 1, we undertook study 2. it is a prospective follow - up of all 9,197 identified continuing antidepressant users (200 defined daily doses a year, i.e., a treatment lasting > 6 months). for comparison, we selected nonuser control subjects (n = 45,658) using the same record - based matching method as in study 1. a minimum follow - up for incident diabetes study 3 is a prospective follow - up of self - reported weight change between baseline survey in 20002002 and follow - up survey in 20042005 for all identified 1,404 antidepressant users participating in the surveys and their 4,133 matched control subjects (nonusers) (supplementary efig. 3, available in an online appendix). we used propensity - based matching (a quasi - experimental correction strategy) to select for each case subject one to three control subjects who had the same probability as the case subjects for receiving treatment with respect to depression status and other depression - related covariates, discarding unmatched individuals. antidepressant users were matched for the same characteristics as those used in studies 1 and 2 and also for diagnosed depression, ischemic heart disease, stroke, cancer, use of pain killers, hypnotics, or anxiolytics, self - rated psychological distress, sleeping problems, and anxiety to the closest control subject whose propensity score differed by 90 days (the social insurance institution of finland and the finnish centre for pensions registers) for icd-10 diagnostic codes f32f34. participants were defined as incident type 2 diabetes case subjects the first time they were listed in the central drug register as eligible for diabetes treatment due to type 2 diabetes (icd-10 code e11) between 1 january 2001 and 31 december 2005. the central drug register, maintained by the social insurance institution, lists all such patients with physician - documented evidence of fasting whole blood glucose 7.0 mmol / l (or fasting plasma glucose 8.0 mmol / l) and symptoms of diabetes, such as polyuria, polydipsia, and glucosuria. if symptoms are not present, evidence of a second elevated blood glucose level 7.0 mmol / l is required. to exclude prevalent diabetes (i.e., diabetes diagnosed before 31 january 2001), we also linked the data to the finnish hospital discharge register that lists all discharged hospital patients with information on dates of admission and discharge since 1987 and to the drug prescription register (social insurance institution) that includes all prescriptions for insulin medications, drugs to lower blood glucose, and other drugs for diabetes in finland nationwide since 1994, according to the who atc classification. all statistical analyses were performed using the sas 9.2 (sas institute, cary, nc). there were no clear differences in the associations of antidepressant use with diabetes or weight gain between men and women (p for all sex interactions > 0.26), so the data were pooled and sex - adjusted. full details of the measurements and statistical analysis are provided in the supplementary material (available in an online appendix). in brief, antidepressant use for each year of the observation the data contained information on the day of purchase ; dose, stated as the international standard defined daily dose ; and medication classified according to the who anatomical therapeutic chemical (atc) classification (15). we determined the consumption of antidepressants on the basis of defined daily doses for the purchases of all antidepressants (atc code n06a) and the following classes : tricyclic antidepressants (atc code n06aa), selective serotonin reuptake inhibitors (ssris) (atc code n06ab) and other antidepressants (atc codes n06af, n06ag, and n06ax ; for specific drugs, see supplementary etable 4, available in an online appendix). severe depression was defined by psychiatric hospital admission (the national hospital discharge register), record of long - term psychotherapy granted by the social insurance institution (minimum 1 year), or record of work disability > 90 days (the social insurance institution of finland and the finnish centre for pensions registers) for icd-10 diagnostic codes f32f34. participants were defined as incident type 2 diabetes case subjects the first time they were listed in the central drug register as eligible for diabetes treatment due to type 2 diabetes (icd-10 code e11) between 1 january 2001 and 31 december 2005. the central drug register, maintained by the social insurance institution, lists all such patients with physician - documented evidence of fasting whole blood glucose 7.0 mmol / l (or fasting plasma glucose 8.0 mmol / l) and symptoms of diabetes, such as polyuria, polydipsia, and glucosuria. if symptoms are not present, evidence of a second elevated blood glucose level 7.0 mmol / l is required. to exclude prevalent diabetes (i.e., diabetes diagnosed before 31 january 2001), we also linked the data to the finnish hospital discharge register that lists all discharged hospital patients with information on dates of admission and discharge since 1987 and to the drug prescription register (social insurance institution) that includes all prescriptions for insulin medications, drugs to lower blood glucose, and other drugs for diabetes in finland nationwide since 1994, according to the who atc classification. all statistical analyses were performed using the sas 9.2 (sas institute, cary, nc). there were no clear differences in the associations of antidepressant use with diabetes or weight gain between men and women (p for all sex interactions > 0.26), so the data were pooled and sex - adjusted. table 1 shows that antidepressant use was associated with increased risk of incident diabetes in both participants with no indication of severe depression (odds ratio [or ] 1.93 [95% ci 1.482.51 ] (comparison a in table 1) and participants with severe depression (2.65 [1.315.39 ] (comparison c in table 1). in contrast, there was a weaker association between severe depression and incident diabetes among both nonusers of antidepressants (1.20 [0.642.25 ]) (comparison a in table 1) and antidepressant users (1.65 [1.092.48 ]) (comparison b in table 1). this pattern of results was robust to adjustment for baseline chronic diseases, such as prevalent hypertension, coronary heart disease, stroke, and cancer. severe depression and use of antidepressant medication during the 4 years preceding diabetes diagnosis among participants with incident type 2 diabetes and individually matched control subjects results are based on conditional logistic regression analysis. yes refers to a minimum use of 200 defined daily doses of antidepressants and no to a use of 0199 defined daily doses during 4 years. prevalence of cardiovascular disease 4 years before the diabetes diagnosis was higher among diabetic case subjects than among control subjects (hypertension 28.0 vs. 9.3%, p 6 months of continuing antidepressant use during the 4-year period) or 400 defined daily doses (representing > 1 year of continuing use) were used to define antidepressant medication use (supplementary etable3, available in an online appendix) and for both tricyclic antidepressants and ssris (supplementary etables 4 and 5, available in an online appendix). a prospective analysis with 9,197 antidepressant users (200 defined daily doses within 1 year) and their 45,658 matched nontreated control subjects replicated the excess risk associated with long - term antidepressant use (supplementary etable 6, available in an online appendix). for 5 years, the absolute risk of incident diabetes was 1.8% for antidepressant users and (calculated based on a mean follow - up of 4.75 years [range 111 years ]). the corresponding absolute risk estimate for individuals treated with 200399 defined daily doses a year (n = 6,878) was 1.7% and for those with 400 defined daily doses a year (n = 2,319) was 2.3%. the relative risk estimates (hazard ratios) for incident diabetes associated with antidepressant use of 200399 defined daily doses and 400 defined daily doses compared with no use were 1.53 (95% ci 1.251.87) and 2.00 (1.512.66), respectively. p 6 months of continuing antidepressant use during the 4-year period) or 400 defined daily doses (representing > 1 year of continuing use) were used to define antidepressant medication use (supplementary etable3, available in an online appendix) and for both tricyclic antidepressants and ssris (supplementary etables 4 and 5, available in an online appendix). a prospective analysis with 9,197 antidepressant users (200 defined daily doses within 1 year) and their 45,658 matched nontreated control subjects replicated the excess risk associated with long - term antidepressant use (supplementary etable 6, available in an online appendix). for 5 years, the absolute risk of incident diabetes was 1.8% for antidepressant users and (calculated based on a mean follow - up of 4.75 years [range 111 years ]). the corresponding absolute risk estimate for individuals treated with 200399 defined daily doses a year (n = 6,878) was 1.7% and for those with 400 defined daily doses a year (n = 2,319) was 2.3%. the relative risk estimates (hazard ratios) for incident diabetes associated with antidepressant use of 200399 defined daily doses and 400 defined daily doses compared with no use were 1.53 (95% ci 1.251.87) and 2.00 (1.512.66), respectively. p 150,000 adults revealed a series of important results. first, antidepressant medication use, as indicated by completed prescriptions exceeding 200 defined daily doses, was associated with a doubling of the risk of diagnosed type 2 diabetes, irrespective of a record of severe depression. second, in absolute terms, the 5-year risk of diagnosed diabetes increased in a dose - response fashion, depending on the level of exposure to antidepressant medication : 1.1% in nonusers, 1.7% among those treated with 200399 daily defined doses 1 year, and 2.3% among those using 400 doses. third, supporting biological plausibility of this association, weight gain was more rapid among long - term antidepressant users than in nonusers matched for depression - related characteristics. our findings add to the existing evidence from recent studies. in the randomized diabetes prevention program of prediabetic individuals, use of antidepressants at baseline was associated with an increased risk of type 2 diabetes at follow - up, whereas self - reported depressive symptoms at baseline were not predictive of subsequent diabetes risk (9). general practice research database found that long - term use of antidepressants with high or moderate daily doses was associated with increased risk of diabetes, but treatment with lower daily doses was not (10). in the present study, the number of antidepressant users was 6 times higher than that in these two studies together, and we targeted a nonclinical occupational cohort including groups that were not covered by those studies, also took into account dose and duration of antidepressant use as well as baseline status of severe depression, and demonstrated a plausible mediating mechanism. other studies in the field have reported inconsistent findings. a norwegian cross - sectional health survey (11), a study of spontaneous reports listed in the who adverse drug reaction database (12), and an analysis of data from one province in canada (13) all found support for an association between antidepressant use and diabetes. in a community sample of adults aged 55 years, treatment with antidepressants was not associated with an increased risk of diabetes, but the study lacked adequate statistical power because the number of antidepressant users who developed diabetes was only four (17). analyses using prescription data from the pharmo database from the netherlands did not find an increased risk of diabetes among antidepressant users (18). however, that study did not consider the duration or the dose of antidepressant treatment. our findings and other studies (10) suggest that inclusion of short - term / low - dose treatments in the definition of antidepressant use is likely to dilute the association. in the present study, exposure to < 200 defined daily doses of antidepressants was not associated with diabetes risk. weight gain, both in relative and absolute terms, was greater among antidepressant users than among their control subjects matched for depression status using recorded and self - reported information on depression and related traits. a previous trajectory analysis of repeat bmi measurements found on average a 0.03 unit faster annual increase in bmi among individuals who later developed type 2 diabetes compared with those who remained disease - free (19). this translates to 0.1 kg excess weight gain per year for incident diabetes case subjects. with use of that metric, our findings suggest that antidepressant medication use is related to 0.3 kg excess yearly weight gain, a change clearly large enough to contribute to diabetes risk. our findings are in agreement with previous studies confirming that tricyclic antidepressants may induce weight gain and promote hyperglycemia (20,21) and showing that ssri use, despite being related to stable weight or even weight loss in the short term, is associated with an increased risk of weight gain in the longer term (22). in the weight gain study reported herein, we undertook a sensitivity analysis based on a subgroup of incident antidepressant medication users who started treatment between baseline and follow - up weight measurements, excluding all prevalent antidepressant users. this exclusion affected little estimated significant weight gain associated with ssris but showed even a greater weight gain in relation to tricyclic antidepressant treatment. because weight gain is a recognized side effect of tricyclic antidepressants, the main analysis may include an underrepresentation of patients who did not tolerate antidepressant treatment well (the depletion of susceptibility bias), contributing to an underestimation of the weight gain associated with tricyclic antidepressant treatment. information on the daily dose of antidepressant medication, based on who definitions of average maintenance dose, is an advantage because it enabled determination of the level of exposure to these drugs. use of records of completed antidepressant prescriptions is also a specific strength, because previous studies have typically relied on information on prescriptions irrespective of whether the patient actually filled them. our data on antidepressants, being based on physician - prescribed medication that was then purchased by the user from a pharmacy, are likely to be more accurate, although we can not ascertain the extent to which the medication purchased was actually taken. in this study, comprehensive records on medications and diagnoses of depression and diabetes from national registers unusually covered the entire cohort during the entire follow - up period. first, the assessment of type 2 diabetes and depression with records from national health registers does not capture nondiagnosed or nontreated diabetes or depression, introducing a source of misclassification. however, an association of antidepressant use and incident diabetes, similar to that found in the present study, has previously been confirmed in a study with glucose - based assessment of incident type 2 diabetes (9), which will capture case subjects with nondiagnosed and nontreated diabetes. although self - reported weights are correlated with objective weight measurements, there are errors in self - reports that are systematic instead of random, reflecting both roundings to the nearest point of heaping and a tendency to report weights closer to ideal weight. in the present study, the weight change calculated by deducting self - reported weight at follow - up from that at baseline may therefore have, if anything, underestimated large weight changes. the influence of antidepressant use on the accuracy of self - reporting is not known ; such impacts could potentially introduce some bias to our results. third, other mechanisms beyond weight gain, such as the hyperglycemic effects of noradrenergic activity of antidepressants, may have a role in the increased diabetes risk associated with antidepressants. further research is therefore needed to examine the entire pathway from antidepressant use to subsequent physical and biochemical changes, including weight gain and the onset of type 2 diabetes. given that diabetogenic effects are likely to vary depending on a drug 's chemical substance, antidepressant - specific analyses, beyond those of ssris and tricyclic medication, would be important and should cover, for example, the increasingly popular serotonin - norepinephrine reuptake inhibitors. fourth, the possibility of residual or unmeasured confounding can not be excluded in epidemiological studies such as ours. the fact that the association between antidepressant use and diabetes was similar in severely depressive patients and the remaining study members suggests that the observed association was not driven by confounding factors strongly related to depression. likewise, the association of antidepressant use and weight gain was robust to matching for 16 depression - related characteristics, such as ghq-12 caseness, a correlate of clinical depression (23). we therefore recommend confirmatory studies, such as postintervention follow - ups for existing antidepressant trials for assessment of diabetes risk in randomized data. potential diabetes risk is currently not taken into consideration in clinical guidelines for treating depression (8,24). we observed a substantially increased relative and modestly increased absolute risk of type 2 diabetes associated with continuing antidepressant medication use. if this risk reflects a causal effect, then it should be incorporated into clinical decision making in recurrent depression because diabetes is a serious disease with potentially fatal complications. information on the daily dose of antidepressant medication, based on who definitions of average maintenance dose, is an advantage because it enabled determination of the level of exposure to these drugs. use of records of completed antidepressant prescriptions is also a specific strength, because previous studies have typically relied on information on prescriptions irrespective of whether the patient actually filled them. our data on antidepressants, being based on physician - prescribed medication that was then purchased by the user from a pharmacy, are likely to be more accurate, although we can not ascertain the extent to which the medication purchased was actually taken. in this study, comprehensive records on medications and diagnoses of depression and diabetes from national registers unusually covered the entire cohort during the entire follow - up period. first, the assessment of type 2 diabetes and depression with records from national health registers does not capture nondiagnosed or nontreated diabetes or depression, introducing a source of misclassification. however, an association of antidepressant use and incident diabetes, similar to that found in the present study, has previously been confirmed in a study with glucose - based assessment of incident type 2 diabetes (9), which will capture case subjects with nondiagnosed and nontreated diabetes. although self - reported weights are correlated with objective weight measurements, there are errors in self - reports that are systematic instead of random, reflecting both roundings to the nearest point of heaping and a tendency to report weights closer to ideal weight. in the present study, the weight change calculated by deducting self - reported weight at follow - up from that at baseline may therefore have, if anything, underestimated large weight changes. the influence of antidepressant use on the accuracy of self - reporting is not known ; such impacts could potentially introduce some bias to our results. third, other mechanisms beyond weight gain, such as the hyperglycemic effects of noradrenergic activity of antidepressants, may have a role in the increased diabetes risk associated with antidepressants. further research is therefore needed to examine the entire pathway from antidepressant use to subsequent physical and biochemical changes, including weight gain and the onset of type 2 diabetes. given that diabetogenic effects are likely to vary depending on a drug 's chemical substance, antidepressant - specific analyses, beyond those of ssris and tricyclic medication, would be important and should cover, for example, the increasingly popular serotonin - norepinephrine reuptake inhibitors. fourth, the possibility of residual or unmeasured confounding can not be excluded in epidemiological studies such as ours. the fact that the association between antidepressant use and diabetes was similar in severely depressive patients and the remaining study members suggests that the observed association was not driven by confounding factors strongly related to depression. likewise, the association of antidepressant use and weight gain was robust to matching for 16 depression - related characteristics, such as ghq-12 caseness, a correlate of clinical depression (23). we therefore recommend confirmatory studies, such as postintervention follow - ups for existing antidepressant trials for assessment of diabetes risk in randomized data. potential diabetes risk is currently not taken into consideration in clinical guidelines for treating depression (8,24). we observed a substantially increased relative and modestly increased absolute risk of type 2 diabetes associated with continuing antidepressant medication use. if this risk reflects a causal effect, then it should be incorporated into clinical decision making in recurrent depression because diabetes is a serious disease with potentially fatal complications. | objectiveto examine antidepressant medication use as a risk factor for type 2 diabetes and weight gain.research design and methodsa series of nested studies within a prospective cohort of 151,347 working - aged men and women including 9,197 participants with continuing antidepressant medication, 224 with severe depression, and 851 with incident type 2 diabetes during a mean follow - up of 4.8 years, as indicated by national health and prescription registers (the public sector study, finland 19952005).resultsin the first analysis, the case subjects were individuals with incident type 2 diabetes compared with matched diabetes - free control subjects. antidepressant use of 200 defined daily doses was associated with a doubling of diabetes risk in both participants with no indication of severe depression (odds ratio 1.93 [95% ci 1.482.51 ]) and participants with severe depression (2.65 [1.315.39 ]). in further analyses, the exposed group was antidepressant users and the reference group was nonusers matched for depression - related characteristics. the 5-year absolute risk of diabetes was 1.1% for nonusers, 1.7% for individuals treated with 200399 defined daily doses a year, and 2.3% for those with 400 defined daily doses (ptrend < 0.0001). an average self - reported weight gain, based on repeated surveys, was 1.4 kg (2.5%) among nonusers and 2.5 kg (4.3%) among users of 200 defined daily doses (ptrend < 0.0001). separate analyses for tricyclic antidepressants and selective serotonin reuptake inhibitors replicated these findings.conclusionsin these data, continuing use of antidepressant medication was associated with an increased relative risk of type 2 diabetes, although the elevation in absolute risk was modest. |
implantation of a prosthetic aortic valve too small for the patient s body size could lead to an increased hemodynamic burden by creating left ventricular outflow obstruction, resulting in a higher mean transprosthetic pressure gradient (tpg). this condition after aortic valve replacement (avr) is known as prosthesis patient mismatch (ppm) and occurs when the effective orifice area (eoa) of the implanted valve prosthesis is too small in relation to the body surface area (bsa) of the patient [1, 2 ]. the eoai is calculated by dividing the corresponding eoa of each valve type and size by each patient s bsa. although different cut - off values exist to define ppm, usually a cut - off value of eoai 0.85 cm / m is chosen, as described by pibarot and colleagues. an eoai 6 weeks) mortalityvariableunivariate analysismultivariate analysis p hr (95 % ci) p hr (95 % ci)age (years) 6 weeks) mortality ci confidence interval, ef ejection fraction, hr hazard ratio, lv left ventricular entered as a continuous variable compared to low - gradient group compared to biological valves univariate analysis revealed the following predictors of late mortality : age, severely impaired lv function, hypertension, diabetes, pvd, renal dysfunction, copd, history of cva, the use of a mechanical prosthesis, concomitant cabg, cpb time and aortic cross - clamp time. ppm, severe ppm and tpg as a continuous variable or as categorical variable (gradient group) were not significant predictors of late mortality at univariate analysis. multivariate analysis revealed the following independent predictors of late mortality : age, diabetes, pvd, renal dysfunction, copd, history of cva and cpb time. the use of a mechanical prosthesis, concomitant cabg, aortic cross - clamp time, and tpg were not independent predictors of late mortality at multivariate analysis. goodness of fit of the final model was assessed with the chi - squared goodness - of - fit test : p 6 weeks) mortalityvariableunivariate analysismultivariate analysis p hr (95 % ci) p hr (95 % ci)age (years) 6 weeks) mortality ci confidence interval, ef ejection fraction, hr hazard ratio, lv left ventricular entered as a continuous variable compared to low - gradient group compared to biological valves univariate analysis revealed the following predictors of late mortality : age, severely impaired lv function, hypertension, diabetes, pvd, renal dysfunction, copd, history of cva, the use of a mechanical prosthesis, concomitant cabg, cpb time and aortic cross - clamp time. ppm, severe ppm and tpg as a continuous variable or as categorical variable (gradient group) were not significant predictors of late mortality at univariate analysis. multivariate analysis revealed the following independent predictors of late mortality : age, diabetes, pvd, renal dysfunction, copd, history of cva and cpb time. the use of a mechanical prosthesis, concomitant cabg, aortic cross - clamp time, and tpg were not independent predictors of late mortality at multivariate analysis. goodness of fit of the final model was assessed with the chi - squared goodness - of - fit test : p < 0.001. this study shows that a higher tpg measured at 6 weeks after surgery is not identified as an independent predictor of late mortality after avr or avr with cabg. this finding is reassuring when confronted with a postoperative pressure gradient at 6 weeks tte follow - up. however, we do not have follow - up data concerning the evolution of the tpg after 6 weeks. in most cases, the tpg measured in this condition will most likely be representative for the future since prosthetic - related factors, such as eoa, hemodynamic profile and surgeon - related factors such as suturing technique and sizing which may play a role in creating a tpg are already defined at that point. the etiology of tpg is complex and multifactorial and patient - related factors such as pannus and thrombus formation may evolve over time. pannus formation is a bio - reaction to the prosthesis [2830 ], usually originating from the ventricular site and its structure consists mainly of myofibroblasts and an extracellular matrix such as collagen fiber and thrombus can be a primary cause of pannus formation. on the other hand, a tpg can induce shear stress in the peri - annular tissue, which may also contribute to pannus formation. although pannus ingrowth can occur in the late postoperative period (mean interval from previous operation 9.6 2.0 years reported by kuniyoshi.), valve - related complications due to pannus formation are rare (incidence 0.24.5 % per patient year) and scarcely an issue with contemporary mechanical prostheses. late mortality is not affected by tpg probably because the gradient measured at 6 weeks after surgery is not likely to increase significantly. zimmerli. found that slight long - term increases in mean pressure gradients are normal findings and do not warrant a change in management strategy if unaccompanied by deterioration of symptoms or clinical signs. postoperative tpg has to be interpreted differently than the preoperative gradient measured in patients with aortic valve stenosis, which is a progressive disease with increasing gradients over time. in most cases a high tpg will still be a significant reduction in hemodynamic burden for the left ventricle compared to the even higher preoperative aortic valve gradient. this improved and stable situation for the conditioned left ventricle could be another explanation for the lack of influence of tpg on late mortality. although there was no significant difference in additive and logistic euroscores [38, 39 ] and both study populations were homogeneous for most risk factors, some baseline patient characteristics were significantly different between the two groups. patients in the high gradient group not only had a significantly higher bsa, but also a lower eoa resulting in a higher prevalence of ppm and severe ppm in this group. nevertheless, ppm and severe ppm were not significant predictors of late mortality and therefore unlikely to have a negative effect on survival in the high gradient group. the fact that ppm does not affect long - term survival is consistent with other studies [7, 19, 24, 4044 ]. most operative characteristics, such as the use of mechanical valve prostheses, concomitant cabg, cpb time, aortic cross - clamp time were significantly different between the groups. only cpb time was an independent predictor of late mortality whereas aortic cross - clamp time was not. aortic cross - clamp time is a reflection of the duration of the technical repair, whereas cpb time is a reflexion of the duration of the technical repair time and the time the patient needs to wean from cpb, hence a reflexion of the general condition of the heart. however, there was no significant difference in most comorbidities and euroscores between the groups. secondly, we focussed on the patients undergoing tte follow - up at 6 weeks after surgery and the effect of a high tpg on late mortality, thus excluding patients that died before having their tte follow - up at 6 weeks. the low prevalence of severe ppm (n = 7, 0.3 %), possibly caused by the above - mentioned surgical strategies to avoid ppm, limits the statistical analysis of this group. on the other hand, it is important to note that severe ppm is extremely rare when using straightforward surgical strategies to avoid ppm. we were not able to retrieve the cause of death that might be equally important and we did not have any information about quality of life after avr in relation to the tpg. finally, the relatively short mean follow - up of 5.5 years also limits conclusions about the long - term effect of tpg on survival. in conclusion, our findings indicate that tpg measured at 6 weeks after avr or avr with cabg is not an independent predictor of all - cause late mortality and there is no significant difference in long - term survival between patients with a low, medium or high tpg. | background in this study, we sought to determine the effect of the mean transprosthetic pressure gradient (tpg), measured at 6 weeks after aortic valve replacement (avr) or avr with coronary artery bypass grafting (cabg) on late all - cause mortality.methodsbetween january 1998 and march 2012, 2,276 patients (mean age 68 11 years) underwent tpg analysis at 6 weeks after avr (n = 1,318) or avr with cabg (n = 958) at a single institution. mean tpg was 11.6 7.8 mmhg and median tpg 11 mmhg. based on the tpg, the patients were split into three groups : patients with a low tpg (< 10 mmhg), patients with a medium tpg (1019 mmhg) and patients with a high tpg (20 mmhg). cox proportional - hazard regression analysis was used to determine univariate predictors and multivariate independent predictors of late mortality.resultsoverall survival for the entire group at 1, 3, 5, and 10 years was 97, 93, 87 and 67 %, respectively. there was no significant difference in long - term survival between patients with a low, medium or high tpg (p = 0.258). independent predictors of late mortality included age, diabetes, peripheral vascular disease, renal dysfunction, chronic obstructive pulmonary disease, a history of a cerebrovascular accident and cardiopulmonary bypass time. prosthesis patient mismatch (ppm), severe ppm and tpg measured at 6 weeks postoperatively were not significantly associated with late mortality.conclusionstpg measured at 6 weeks after avr or avr with cabg is not an independent predictor of all - cause late mortality and there is no significant difference in long - term survival between patients with a low, medium or high tpg. |
gnathostomiasis is a food - borne parasitic zoonosis caused by the third stage larvae of the genus gnathostoma. human infection is mainly resulted from eating raw or undercooked intermediate hosts (e.g. fish, eels, and loaches) or paratenic hosts (e.g. crustaceans, freshwater fish, and mammals) containing the third - stage (l3) larvae. the larvae can not mature in humans and keep migrating in the skin, subcutaneous tissues, or other organs. gnathostomiasis is characterized by intermittent creeping eruptions and/or migrating swellings and eosinophilia ; larval migration to other tissues (visceral larva migrans) can result in a serious consequence. if untreated, gnathostomiasis may remit and recur several times until death of the larvae up to 12 years after infection. the endemic foci of gnathostomiasis have been predominantly distributed in japan and southeast asia, particularly thailand, but the disease is also endemic in cambodia, laos, myanmar, indonesia, the philippines, and malaysia. human cases have also been reported in india, australia, brazil, and parts of south africa, and it has been regarded as an emerging disease. imported human cases of gnathostomiasis were also reported in the republic of korea. recently, it has been known that this disease is endemic in the pacific region of mexico. in china, gnathostomiasis occurred sporadically in 23 provinces, autonomous regions, or municipalities. until the year 2012, 57 cases of gnathostomiasis have been reported in the chinese literatures ; however, only 1 case was reported in english. also, to our knowledge, no human cases of gnathostomiasis have been reported in henan province, china. accordingly, the present study reports for the first time a human case of cutaneous gnathostomiasis in henan province, china. a 52-year - old lady from zhengzhou city of henan province, central china, presented to the parasitology department of zhengzhou university on 22 august 2011. she had a 3-month history of recurrent appearance of migratory reddish swelling in the upper arm and on the back. the initial lesions appeared on the left side of the back and subsequent lesions were observed in the left upper arm. these swellings were characterized by a migrating edema with a cord - like shape and pruritic nodules. the swellings reappeared in a different area close to the previous one after about 10 - 15 days of subsidence of the initial lesion. she was an officer, denied a history of travel abroad, and never had any pets, nor had a history of intimate exposure to stray cats, dogs, or other domestic animals. on physical examination, initial laboratory testing revealed a normal white blood cell count of 4,900, but with high eosinophilia (21.2%, 1,040 eosinophils / ml). the serum specific antibodies against tissue - dwelling parasites (paragonimus skrjabini, schistosoma japonicum, metacestode of taenia solium, and trichinella spiralis) were assayed by elisa or immunofluorescence test (ift), and shown to be negative. however, anti - sparganum antibodies were positive by elisa using excretory - secretory (es) antigens of spirometra erinacei spargana. the optical density (od) of the serum samples from this patient was 0.46, whereas the positive (patients with sparganosis) and negative (normal persons) controls were 0.55 and 0.21, respectively. serum samples were sent to the third affiliated hospital of sun yat - sen university and anti - sparganum antibodies were also positive. skin biopsy was performed at 1 cm of the anterior end of the nodule near the axilla on the left side of the back on 28 august 2011. histopathologic examination of the biopsy samples revealed a dense superficial and deep dermal infiltrate of eosinophils and neutrophils but did not show any parasites. one day after the skin biopsy, multiple migrating subcutaneous nodules reappeared on the patient 's back (fig. subcutaneous sparganosis was diagnosed on the basis of clinical manifestations and results of serologic tests, and the patient was treated with praziquantel (75 mg / kg / day in 3 doses for 3 days). however, 1 day after the treatment, new migratory swellings occurred in the left upper arm (fig. 1b) ; anti - sparganum antibodies were re - assayed and remained positive. on further inquiring, she recalled that she had eaten undercooked eels. thus, gnathostomiasis was highly suspected on this history, together with symptoms such as recurrent migratory subcutaneous nodule and eosinophilia. the serum sample was sent to the institute of parasitic diseases of zhejiang academy of medical sciences, dot immunogold filtration assay (digfa) using soluble antigens of the third stage larvae (l3) of g. spinigerum presented by mahidol university in thailand showed that anti - gnathostoma antibodies were strongly positive, and anti - sparganum antibodies were only weakly positive. the patient was treated with albendazole (1,000 mg / day, twice daily for 15 days). one day after the beginning of the treatment, the migrating swellings in the left upper arm tended to be confined and a papule developed (fig. however, parasites were not found by examination of the puncture samples of the blister. two days after the treatment, the papule disappeared but anti - gnathostoma antibodies were still positive ; laboratory testing revealed a white blood cell count of 5,800, with 5.5% eosinophils. after 1 month, laboratory findings showed an almost normal eosinophil count (3.3%). at her final follow - up at 18 months, although 13 species of the genus gnathostoma have been reported to date, 5 of them such as gnathostoma spinigerum, g. nipponicum, g. hispidum, g. doloresi, and g. binucleatum infect humans. out of these species, g. binucleatum is a major etiologic agent of gnathostomiasis in endemic areas of america, especially in mexico and venezuela. g. spinigerum is the most common and important agent of gnathostomiasis in china. out of 57 cases with gnathostomiasis reported in china during 1918 - 2012, 54 cases were caused by g. spinigerum, 2 by g. hispidum and 1 by g. doloresi. a previous survey showed that 23 species of animals (6 cyclops, 13 fish, 2 frogs, and 1 each of snake and bird) served as the first or second intermediate host, or a paratenic host of g. spinigerum in 3 provinces (jiangsu, anhui, and jiangxi) of china. the triad of eosinophilia, migratory lesions, and obvious exposure risk are highly suggestive of the diagnosis of gnathostomiasis. the exposure risk usually include consumption of raw or undercooked fish (in particular, swamp eels and loaches), or meat of intermediate or paratenic hosts. the definite diagnosis was established by isolation of larvae from the lesions, but this is often difficult in migratory skin lesions. the detection rate of larvae in skin biopsy specimens was only 24 - 34% of the cases. treatment with albendazole may promote outward migration of the larvae to the dermis, and stimulate development of a papule or pseudo - furuncle containing the larva. biopsy of a papule or pseudo - furuncle subsequent to treatment increases the likelihood of demonstrating the larva on skin biopsy specimens. regrettably, our patient disagreed with a second skin biopsy. with introduction of antigens from l3 larvae of g. spinigerum, the serodiagnosis of gnathostomiasis became more convenient and efficient, although cross - reactivity with other parasitic infections remained a problem. our patient was first misdiagnosed as sparganosis because of a cross - reactivity with in s. erinacei sparganun antigens.. found that a specific l3 antigen with a molecular mass of 24 kda had the greatest specificity and reacted only with sera from the patients with gnathostomiasis sera and not with those from other parasitic infections. hence, immunoblot is now regarded as the most valuable serologic test and can be used as a confirmatory test of gnathostomiasis when specific antibodies to 24 kda component of g. spinigerum l3 larvae were detected. although recommended dose of albendazole for gnathostomiasis is 400 mg / day for 21 days, our patient was cured with a shorter course of albendazole (1,000 mg / day for 15 days) treatment. although gnathostoma larvae were not found in the skin biopsy of our patient, the patient was diagnosed as cutaneous gnathostomiasis according to the following evidences : the history of eating undercooked eels, typical clinical manifestations (recurrent migratory subcutaneous nodule), persistent eosinophilia, specific anti - gnathostoma antibodies, and a cure by albendazole. the excellent therapeutic response to albendazole this case is most likely be caused by g. spinigerum which is the predominant agent of gnathostomiasis in china. because clinicians outside of high endemic areas are unfamiliar with the disease, and therefore diagnosis is often missed or prolonged. the classic triad of intermittent migratory swellings, persistent eosinophilia, and a history of eating raw freshwater fish should alert physicians to the possible diagnosis of gnathostomiasis. recently, some chinese people have the habit of eating raw fish ; sashimi was often served in restaurants and hotels. in addition, some inhabitants like to eat quick - fried eels or scalded eel fillets. if the fillet was too large and the time of scalding was insufficient, the temperature in the fillet center would not be sufficient to kill the larvae. recently, l3 of gnathostoma spp. have also been detected from wild swamp eels sold at the market in henan and zhejiang provinces (http://zjnews.zjol.com.cn/05zjnews/system/2011/10/28/017949925.shtml). in thailand, the infection rate of farmed and wild eels with g. spinigerum was 10.2% and 20.4%, respectively. moreover, swallowing live loaches have become a folk remedy in some areas of china since some inhabitants believe the live loaches to have a medicinal role for treating diseases. gnathostomiasis cases resulted from ingestion of native loaches or loaches imported from korea or mainland china were also reported in japan. gnathostoma larvae were found in imported chinese loaches in korea. to prevent human gnathostoma infection, the government, public health officials, and medical practitioners should be aware of misdiagnosis of zoonotic gnathostomiasis. the best strategies for preventing gnathostomiasis are to educate people to only consume fully cooked meat, especially avoiding raw and undercooked freshwater fish and loaches in endemic areas. in conclusion, we report here a case of cutaneous gnathostomiasis in henan province, china based on the history of eating undercooked eels, recurrent migratory subcutaneous nodule, persistent eosinophilia, specific anti - gnathostoma antibodies, and cure by albendazole. our study presents a risk of gnathostoma infection by consumption of undercooked freshwater fish ; therefore, fish inspection for gnathostoma larvae should be carried out for ensuring food safety and public health. | the present study reports a human case of cutaneous gnathostomiasis with recurrent migratory nodule and persistent eosinophilia in china. a 52-year - old woman from henan province, central china, presented with recurrent migratory reddish swelling and subcutaneous nodule in the left upper arm and on the back for 3 months. blood examination showed eosinophila (21.2%), and anti - sparganum antibodies were positive. skin biopsy of the lesion and histopathological examinations revealed dermal infiltrates of eosinophils but did not show any parasites. thus, the patient was first diagnosed as sparganosis ; however, new migratory swellings occurred after treatment with praziquantel for 3 days. on further inquiring, she recalled having eaten undercooked eels and specific antibodies to the larvae of gnathostoma spinigerum were detected. the patient was definitely diagnosed as cutaneous gnathostomiasis caused by gnathostoma sp. and treated with albendazole (1,000 mg / day) for 15 days, and the subsequent papule and blister developed after the treatment. after 1 month, laboratory findings indicated a reduced eosinophil count (3.3%). at her final follow - up 18 months later, the patient had no further symptoms and anti - gnathostoma antibodies became negative. conclusively, the present study is the first report on a human case of cutaneous gnathostomiasis in henan province, china, based on the past history (eating undercooked eels), clinical manifestations (migratory subcutaneous nodule and persistent eosinophilia), and a serological finding (positive for specific anti - gnathostoma antibodies). |
a 60-year - old man has been in your intensive care unit with septic shock for 5 days and he has required a norepinephrine infusion for the entire time. frank v ritacca, carmine simone and randy wax despite advances in providing care for patients with septic shock, mortality rates remain unacceptably high. exogenous corticosteroids have potent anti - inflammatory effects and their use for modulation of the host response in septic shock has been debated for decades. two meta - analyses have suggested that high - dose steroids are not beneficial in patients with septic shock. we believe there are recent data showing that low - dose corticosteroids hasten discontinuation of vasopressors in refractory septic shock, and may improve outcome. demonstration of an intact hypothalamic - pituitary - adrenal axis response has been associated with reduced mortality in septic shock. corticosteroids can regulate the synthesis and function of catecholamines and their receptors, which in turn control vascular tone and organ perfusion. proinflammatory cytokines released in sepsis alter steroid responsiveness, leading to the deleterious effects of catecholamine dysfunction and refractory hypotension. downregulation of catecholamine receptors occurs with prolonged use of exogenous catecholamines and this may be reversed with administration of low - dose steroids. restoring endogenous regulation of vasomotor tone would be desirable to preserve regional regulation of perfusion. three recent clinical trials have provided encouraging results for the use of corticosteroids in septic shock (table 1). patients were treated with corticosteroids at lower doses and for a longer interval than in previous trials. showed that patients receiving low - dose steroids had a significantly higher rate of shock reversal (stable blood pressure without fluid boluses or vasopressors). the treatment effect was present irrespective of hypothalamic - pituitary - adrenal axis function as measured by an adrenocorticotrophic hormone (acth) stimulation test. briegel. similarly found that low - dose corticosteroids could hasten independence from vasopressor support. although no mortality benefits were found, increased rates of shock reversal may imply decreased resource use (e.g. shorter length of stay in the intensive care unit) and complications (e.g. catheter - related infections). data published in abstract form from a multicenter trial testing low - dose corticosteroid and mineralocorticoid support led to a relative risk reduction of almost 30% in patients with septic shock. the survival benefit of combination therapy was significant only in patients with blunted response to acth stimulation. however, this may be due to a smaller number of patients in the normal response group. finally, one retrospective study suggests that low - dose corticosteroids may reduce post - traumatic stress disorder and improve health - related quality of life in survivors of septic shock. although exciting developments in targeted drug therapy for sepsis have occurred recently, supportive care remains key to maximizing survival in patients. even if subsequent studies do not confirm a mortality reduction, ' fewer days of vasopressor dependence ' may itself be an important outcome. given that the patient described for this debate appears to have been adequately treated for infection, repair of sepsis - induced dysregulation of vasomotor tone using low - dose corticosteroids is reasonable and appropriate. katherine g craig and keith r walley the debate surrounding the use of corticosteroids in septic patients has continued for over 30 years. two meta - analyses in the mid-1990s seemed to put an end to the controversy. the conclusions drawn from these works were that corticosteroids provided no benefit to patients with septic shock and that corticosteroids may actually cause harm, as evidenced by a slight increase in overall mortality. the debate has recently been re - opened by several small, prospective, randomized, placebo - controlled trials. a study by bollaert., in which septic patients requiring catecholamines were randomized to receive hydrocortisone (100 mg intravenously three times a day for 5 days) or placebo, found a significant reduction in the time it took to reverse shock, and a trend towards improved survival. while the results of this trial were impressive, care must be taken not to overinterpret the results ; it was a small clinical trial with only about 20 patients in each arm, and there was a relatively high mortality rate in the placebo arm (63%) for patients with septic shock. in a similar small trial by briegel., septic shock patients were randomized to receive either a placebo or hydrocortisone (100 mg intravenous bolus), followed by continuous infusion until septic shock resolved. the length of time for which vasopressor support was required was significantly reduced, and measures such as mean arterial pressure and systemic vascular resistance index were increased in patients treated with steroids. in addition, there were trends toward earlier reversal of organ dysfunction. it may be germane to recognize that all benefit of immunomodulatory therapy in adequately powered, randomized, controlled trials is confined to the most severely ill. this does not fit with the patient described in the aforementioned scenario. in view of conflicting older, yet strong, evidence (that high - dose steroids are not beneficial) and newer, yet preliminary, studies (that suggest low - dose steroids are beneficial), the question becomes one of whether steroid - induced reversal of vasopressor support confers any outcome benefits. the patient described in the present scenario is improving in all aspects of organ failure, but remains catecholamine dependent. a thorough examination and review of his management needs to be conducted to ensure no reversible cause of hypotension can be determined. there is ongoing debate in the literature as to the usefulness of this corticotropin stimulation test in so - called ' relative adrenal insufficient ' patients, although it may be of prognostic significance. a recent study by schroeder. found low basal plasma cortisol levels and diminished responses to corticotropin - releasing hormone in patients that died of septic shock as compared with those who survived., however, found an elevated basal cortisol level (34 g / dl) and a poor response to corticotropin (e.g. 9 g / dl elevation at 30 or 60 min) to be a predictor of the poorest survival in patients with sepsis. at this point in time there is not sufficient evidence to guide clinical practice. we therefore do not advocate use of steroids in this clinically improving patient without another indication. we must be cautious in our enthusiasm to try new therapies as history provides many examples of promising small clinical trials that have not held up to the test of time and larger, multicentered trials. in view of conflicting older, yet strong, evidence (that high - dose steroids are not beneficial) and newer, yet preliminary, studies (that suggest low - dose steroids are beneficial), the question becomes one of whether steroid - induced reversal of vasopressor support confers any outcome benefits. the patient described in the present scenario is improving in all aspects of organ failure, but remains catecholamine dependent. a thorough examination and review of his management there is ongoing debate in the literature as to the usefulness of this corticotropin stimulation test in so - called ' relative adrenal insufficient ' patients, although it may be of prognostic significance. a recent study by schroeder. found low basal plasma cortisol levels and diminished responses to corticotropin - releasing hormone in patients that died of septic shock as compared with those who survived., however, found an elevated basal cortisol level (34 g / dl) and a poor response to corticotropin (e.g. 9 g / dl elevation at 30 or 60 min) to be a predictor of the poorest survival in patients with sepsis. at this point in time there is not sufficient evidence to guide clinical practice. we therefore do not advocate use of steroids in this clinically improving patient without another indication. we must be cautious in our enthusiasm to try new therapies as history provides many examples of promising small clinical trials that have not held up to the test of time and larger, multicentered trials. frank v ritacca, carmine simone and randy wax applying data from trials using high - dose steroids is inappropriate and leads to therapeutic nihilism. life - saving therapy, such as low - dose beta - blockers in severe cardiomyopathy, met similar resistance because of poor experiences with identical drugs given in higher doses. a normal corticotropin stimulation test result can not exclude benefit of low - dose corticosteroids. although this patient is not ' most severely ill ', catecholamine receptor effects may be more important than the immunomodulatory effects of this therapy. katherine g craig and keith r walley while the foundations of the pro / con debates are remarkably similar, the resulting recommendations are not. dr ritacca and colleagues suggest that " appropriate supplementation of corticosteroids [be ] part of the regimen of supportive care ". first, with the level of evidence currently available it must be recognized that the use of steroids in sepsis, while promising, is still experimental, and should not be given the same status as routine measures of supportive care. second, even if a physician makes a conscious decision to try steroids, there are again no data to suggest a dose or timing for ' appropriate supplementation '. we urge restraint and recognition of the potential adverse side effects of, and lack of clear evidence for, steroid therapy in sepsis. | decision - making in the intensive care unit is often very difficult. although we are encouraged to make evidence - based decisions, this may be difficult for a number of reasons. to begin with, evidence may not exist to answer the clinical question. second, when there is evidence it may not be applicable to the patient in question or the clinician may be reluctant to apply it to the patient based on a number of secondary issues such as costs, premorbid condition or possible complications. finally, emotions are often highly charged when caring for patients that have a significant chance of death, and care - givers as well as families are frequently prepared to take chances on a therapy whose benefit is not entirely clear. steroid use in septic shock is an example of a therapy that makes some sense but has conflicting support in the literature. in this issue of critical care forum, the two sides of this often heated debate are brought to the forefront in an interesting format. |
the effect of the usb syllabus on resident education was assessed in a prospective observational cohort pilot study. the institutional review board approved the study and informed consent was obtained from study participants. the residency program in internal medicine at the jhbmc is an accreditation council for graduate medical education (acgme) accredited university - based training program that had 53 house officers during the academic year 20062007 (table 1). the stated goal of the residency program is to develop healers and leaders in medicine. all 53 residents of the jhbmc internal medicine residency program received a 256 mb usb drive with a hyperlinked electronic syllabus. characteristics of the study population (n = 53) the usb syllabus contained links to 187 primary scientific research articles. the links to the full - text articles were organized on the usb drive using an html webpage with a table of contents with 14 headings according to medical subspecialties (e.g., cardiology, endocrinology, etc.). the headings of the table of content were hyperlinked to specific heading locations on the html webpage, where each medical subspecialty was then divided into 212 context - related subheadings (e.g., cardiology had the subheadings atrial fibrillation, congestive heart failure, etc.). the titles of the individual articles were organized under the subheadings on the html webpage and provided the hyperlink to the full - text article in pdf format in the medical school 's digital library. the individual user could download the full - text article in pdf format using a structured folder system on the usb drive, resembling the headings and subheadings of the html webpage, to organize the downloaded primary and secondary scientific research articles. to comply with copyright regulations, the full - text pdf documents once the article was downloaded and stored in the pre - organized folder system, it could be used on any computer (e.g., at home) and its use was not dependent on internet access. one author (m.e.) surveyed local experts, senior faculty members in the department of medicine at the johns hopkins university school of medicine. the experts were asked to recommend the most influential and commonly cited primary and secondary research articles related to their field of specific expertise. the usb drives were usable at every usb port of any computer at jhbmc and the syllabus could be expanded and edited by the individual learner. the structured folder system was constructed in a way to allow for both expansion of the literature collection and for keeping track of reading progress. trainees were also encouraged to save other important information related to the acquisition of clinical competence on the my portfolio section of the usb including : (a) interesting patients seen, (b) presentations given, and (c) procedures performed. housestaff filled out a brief baseline survey before receiving the usb drive in september 2006. the baseline survey included questions pertaining to the following areas : (a) four demographic questions, (b) two questions about their reading of primary medical literature, and (c) seven questions related to the use of computers, usb drives, and use of educational resources. most questions had likert scale response options. at the conclusion of the study period in may 2007, the end - of - study survey primarily asked participants about (a) their reading of primary medical literature, (b) their use of and experiences with the usb syllabus, and (c) suggestions about ways to improve the usb syllabus. for each variable, we examined frequency of responses to look for irregularities in the distribution of responses. for the continuous variables, distributions and descriptive statistics were examined for evidence of skewness, outliers, and non - normality to ensure the appropriate use of parametric statistical tests. comparisons of the data from before and after the usb syllabus intervention were examined using t - tests and the wilcoxon signed - rank test. data were analyzed using stata 8.0 (stata corp., college station, tx, usa). the effect of the usb syllabus on resident education was assessed in a prospective observational cohort pilot study. the institutional review board approved the study and informed consent was obtained from study participants. the residency program in internal medicine at the jhbmc is an accreditation council for graduate medical education (acgme) accredited university - based training program that had 53 house officers during the academic year 20062007 (table 1). the stated goal of the residency program is to develop healers and leaders in medicine. all 53 residents of the jhbmc internal medicine residency program received a 256 mb usb drive with a hyperlinked electronic syllabus. the usb syllabus contained links to 187 primary scientific research articles. the links to the full - text articles were organized on the usb drive using an html webpage with a table of contents with 14 headings according to medical subspecialties (e.g., cardiology, endocrinology, etc.). the headings of the table of content were hyperlinked to specific heading locations on the html webpage, where each medical subspecialty was then divided into 212 context - related subheadings (e.g., cardiology had the subheadings atrial fibrillation, congestive heart failure, etc.). the titles of the individual articles were organized under the subheadings on the html webpage and provided the hyperlink to the full - text article in pdf format in the medical school 's digital library. the individual user could download the full - text article in pdf format using a structured folder system on the usb drive, resembling the headings and subheadings of the html webpage, to organize the downloaded primary and secondary scientific research articles. to comply with copyright regulations, the full - text pdf documents once the article was downloaded and stored in the pre - organized folder system, it could be used on any computer (e.g., at home) and its use was not dependent on internet access. one author (m.e.) surveyed local experts, senior faculty members in the department of medicine at the johns hopkins university school of medicine. the experts were asked to recommend the most influential and commonly cited primary and secondary research articles related to their field of specific expertise. the usb drives were usable at every usb port of any computer at jhbmc and the syllabus could be expanded and edited by the individual learner. the structured folder system was constructed in a way to allow for both expansion of the literature collection and for keeping track of reading progress. trainees were also encouraged to save other important information related to the acquisition of clinical competence on the my portfolio section of the usb including : (a) interesting patients seen, (b) presentations given, and (c) procedures performed. housestaff filled out a brief baseline survey before receiving the usb drive in september 2006. the baseline survey included questions pertaining to the following areas : (a) four demographic questions, (b) two questions about their reading of primary medical literature, and (c) seven questions related to the use of computers, usb drives, and use of educational resources. most questions had likert scale response options. at the conclusion of the study period in may 2007, the end - of - study survey primarily asked participants about (a) their reading of primary medical literature, (b) their use of and experiences with the usb syllabus, and (c) suggestions about ways to improve the usb syllabus. for each variable, we examined frequency of responses to look for irregularities in the distribution of responses. for the continuous variables, distributions and descriptive statistics were examined for evidence of skewness, outliers, and non - normality to ensure the appropriate use of parametric statistical tests. comparisons of the data from before and after the usb syllabus intervention were examined using t - tests and the wilcoxon signed - rank test. data were analyzed using stata 8.0 (stata corp., college station, tx, usa). forty - five of the 53 (85%) house officers at jhbmc completed the baseline survey. the majority of internal medicine house officers at jhbmc are planning a career in academic medicine (80%), most as clinical investigators (69%) (table 2). baseline characteristics of the 45 respondents almost all house officers (89%) had been using usb drives, and most (95%) affirmed that computer - based learning is valuable in medical education. with respect to the perceived educational value of resources at their disposal, at baseline (prior to the intervention) house officers rated electronic resources like uptodate as most valuable (mean 4.7, sd 0.8, on a five - point likert scale with 1 = useless and 5 = excellent). good (mean 3.6, sd 0.8) and textbooks were rated the least favorable (mean 3.1, sd 1.2). at the conclusion of the nine - month study period, 50 of 53 (94%) two of the 50 house officers (4%) lost their usb syllabus during the study period and both were given a replacement. in characterizing their experience, 45 of 50 house officers (90%) strongly agreed with the following : i liked the idea that i was given the usb syllabus. when asked, if their time using the usb syllabus was well spent, 80% agreed or strongly agreed. forty - nine of 50 house officers (98%) disagreed or strongly disagreed that there were technical difficulties using the usb syllabus. most house officers (86%) agreed or strongly agreed that the usb syllabus met their educational needs. similarly, 90% agreed or strongly agreed that the usb syllabus stimulated them to read more primary literature. when asked whether the usb syllabus helped them to take better care of patients, 88% agreed or strongly agreed. as 45 residents had filled out the baseline survey and 50 residents the post - intervention survey, we were able to compare pre- and post - surveys for 45 residents. self - reported original articles read by housestaff increased from 3.4 per month at baseline to 4.5 per month by the end of the nine - month study period, p < 0.005 (table 3). number of original articles read (n=45) note : number of original articles read by trainee per month according to level of training. the comparison between baseline survey and post - intervention survey was available for 45 residents. sixteen of the 45 (45%) increased their self - reported reading of original medical papers by more than three articles per month. post - graduate year 1 (pgy-1) level trainees showed the greatest self - reported increase in original articles read per month, from 2.0 to 3.2 per month, p = 0.01. housestaff rated original articles as being more valuable to them for the acquisition of knowledge after being exposed to this intervention as compared to baseline (p < 0.005) (fig. rating of the value of specific educational resources with respect to the trainees ' acquisition of knowledge at baseline and at the end of the study period (mean values). the comparison between baseline survey and post - intervention survey was available for 45 residents. review articles also were rated higher (p = 0.02), whereas the perceived value of other educational resources (electronic media like uptodate (p = 0.09) and textbooks (p=0.18)) did not change significantly. selected comments to an open - ended question are presented below. all comments were positive and spoke to the usefulness and merit of the usb syllabus.this is an awesome resource ! i do n't think i can do without this tool, now that i have it. ! often referred to it to find useful articles on common topics for my own benefit and for teaching medical students. i wish someone had thought of this sooner ! the introduction of the usb syllabus was a fantastic idea that should definitely be perpetuated. i do n't think i can do without this tool, now that i have it. ! often referred to it to find useful articles on common topics for my own benefit and for teaching medical students. i wish someone had thought of this sooner ! the introduction of the usb syllabus was a fantastic idea that should definitely be perpetuated. at the conclusion of the nine - month study period, 50 of 53 (94%) house officers completed the end of study survey. all 50 respondents (100%) reported using the usb syllabus. two of the 50 house officers (4%) lost their usb syllabus during the study period and both were given a replacement. in characterizing their experience, 45 of 50 house officers (90%) strongly agreed with the following : i liked the idea that i was given the usb syllabus. when asked, if their time using the usb syllabus was well spent, 80% agreed or strongly agreed. forty - nine of 50 house officers (98%) disagreed or strongly disagreed that there were technical difficulties using the usb syllabus. most house officers (86%) agreed or strongly agreed that the usb syllabus met their educational needs. similarly, 90% agreed or strongly agreed that the usb syllabus stimulated them to read more primary literature. when asked whether the usb syllabus helped them to take better care of patients, 88% agreed or strongly agreed. as 45 residents had filled out the baseline survey and 50 residents the post - intervention survey, we were able to compare pre- and post - surveys for 45 residents. self - reported original articles read by housestaff increased from 3.4 per month at baseline to 4.5 per month by the end of the nine - month study period, p < 0.005 (table 3). number of original articles read (n=45) note : number of original articles read by trainee per month according to level of training. the comparison between baseline survey and post - intervention survey was available for 45 residents. sixteen of the 45 (45%) increased their self - reported reading of original medical papers by more than three articles per month. post - graduate year 1 (pgy-1) level trainees showed the greatest self - reported increase in original articles read per month, from 2.0 to 3.2 per month, p = 0.01. housestaff rated original articles as being more valuable to them for the acquisition of knowledge after being exposed to this intervention as compared to baseline (p < 0.005) (fig. rating of the value of specific educational resources with respect to the trainees ' acquisition of knowledge at baseline and at the end of the study period (mean values). the comparison between baseline survey and post - intervention survey was available for 45 residents. review articles also were rated higher (p = 0.02), whereas the perceived value of other educational resources (electronic media like uptodate (p = 0.09) and textbooks (p=0.18)) did not change significantly. selected comments to an open - ended question are presented below. all comments were positive and spoke to the usefulness and merit of the usb syllabus.this is an awesome resource ! i do n't think i can do without this tool, now that i have it. ! often referred to it to find useful articles on common topics for my own benefit and for teaching medical students. i wish someone had thought of this sooner ! the introduction of the usb syllabus was a fantastic idea that should definitely be perpetuated. i do n't think i can do without this tool, now that i have it. ! often referred to it to find useful articles on common topics for my own benefit and for teaching medical students. the introduction of the usb syllabus was a fantastic idea that should definitely be perpetuated. in this pilot study of internal medicine house officers who were given a usb syllabus with pertinent research articles, it appears as if the intervention may have stimulated trainees to read more original articles. in addition to reading more landmark studies that had been chosen by senior clinicians because of their clinical relevance, house officers developed a newfound appreciation of the educational value of original research articles. all respondents were using the usb syllabus making it, percentage - wise, a highly accepted electronic medical education resource, comparing favorably to the use of electronic educational resources reported in the literature. kabrhel and colleagues reported on an online collection of emergency medicine literature for their trainees and showed that one month after its installation, 34% of residents were actively using the web - based electronic syllabus (6). using a similar approach, tannery. reported on an educational website developed as an adjunct education resource for a community and ambulatory medicine clerkship that included links to influential full - text journal articles and web resources (7). in contrast to these web - based educational interventions, the usb drive has several advantages : (a) favorite articles can be saved and read even without internet and server access, (b) the collection can be expanded and edited by the individual learner, and (c) other clinically relevant materials and information can be saved on it. the cohort of house officers in our study was comfortable with and frequently used electronic resources for their learning needs. this is in line with the reports by others and speaks to the technological sophistication of contemporary trainees (8, 9). lai studied reading habits in primary care internal medicine residents and noted that electronic materials were the most commonly used educational media : 98% reported using resources like uptodate regularly (8). resources like uptodate or emedicine, while wonderfully valuable and superb for finding answers or guidance efficiently, do not involve critical appraisal and do not challenge house officers to extract the relevant clinical messages. studies have shown that trainees primarily go to these authoritative resources, rather than original research articles, to answer their clinical questions (8, 10) and that time constraint is the primary obstacle related to evidence - based practice (11, 12). the usb syllabus described herein may have affected the concerns about efficiency, possibly because of its organization and the effort that went into article selection. if these factors were responsible for the residents ' increased reading of the primary medical literature, the syllabus has realized its primary goal. the usb syllabus was organized by specialty around common clinical questions in an easy to use format. the prepared format also provided trainees with an information management framework that allowed them to systematically keep track of their reading and learning. the house officers in our study felt that their time using the usb syllabus was well spent. developing effective reading habits during residency may very well continue throughout these physicians ' professional lives. the usb syllabus has the potential to have a positive influence on their approach to lifelong learning and information management (3). first, this study relied exclusively on self - report and we were unable to actually observe the trainees ' reading practices and patterns. second, our study design was observational and thus the findings in this paper represent associations rather than causality. as all residents received the usb syllabus, we can not test the educational effect against a control group. while some comments to the investigators during the study period make us believe that the increased reading of original research articles was because of the usb syllabus it is not possible to differentiate the effect of nine months of clinical training (study period) on reading habits of the housestaff from the educational impact of the usb syllabus. the curricula of the pgy-1, pgy-2, and pgy-3 year in the residency program at jhbmc differ significantly (pgy post - graduate year). the pgy-1 year in general has the longest working hours and least amount of elective time. in the pgy-2 and more so in the pgy-3 year the elective time increases and average working hours decrease. this difference in available time to read literature could explain why the post - intervention pgy-1 group was found to read fewer articles than the pre - intervention pgy-2 group (the baseline reading assessment was performed three months after the start of the academic year). third, reading more original medical literature by itself may not necessarily translate into practicing evidence - based medicine. windish and colleagues have found that some residents lack knowledge in biostatistics that may be needed to interpret published clinical research (13). although residents felt that the usb syllabus helped them in taking care of their patients, this study design did not allow us to test such hypotheses and we do not know if this resource translated into improved patient care and patient outcomes. fourth, it is unclear how the usb syllabus would compare to other electronic resources, e.g., web - based only formats. fifth, this pilot study was performed at an academic medical center, where the majority of residents reported planning a scientific career and the majority of graduates pursue academic careers. thus, the external validity and generalizibility of our findings to other residency programs remains unclear. finally, a limitation of the usb syllabus is that a structured mechanism to update the most recent best evidence is not included. however, one could envision a system of a web - based syllabus that includes regular updates combined with a personalized usb syllabus handed to house officers at the beginning of their training to capitalize on the benefit of each technology. first, this study relied exclusively on self - report and we were unable to actually observe the trainees ' reading practices and patterns. second, our study design was observational and thus the findings in this paper represent associations rather than causality. as all residents received the usb syllabus, we can not test the educational effect against a control group. while some comments to the investigators during the study period make us believe that the increased reading of original research articles was because of the usb syllabus it is not possible to differentiate the effect of nine months of clinical training (study period) on reading habits of the housestaff from the educational impact of the usb syllabus. the curricula of the pgy-1, pgy-2, and pgy-3 year in the residency program at jhbmc differ significantly (pgy post - graduate year). the pgy-1 year in general has the longest working hours and least amount of elective time. in the pgy-2 and more so in the pgy-3 year the elective time increases and average working hours decrease. this difference in available time to read literature could explain why the post - intervention pgy-1 group was found to read fewer articles than the pre - intervention pgy-2 group (the baseline reading assessment was performed three months after the start of the academic year). third, reading more original medical literature by itself may not necessarily translate into practicing evidence - based medicine. windish and colleagues have found that some residents lack knowledge in biostatistics that may be needed to interpret published clinical research (13). although residents felt that the usb syllabus helped them in taking care of their patients, this study design did not allow us to test such hypotheses and we do not know if this resource translated into improved patient care and patient outcomes. fourth, it is unclear how the usb syllabus would compare to other electronic resources, e.g., web - based only formats. fifth, this pilot study was performed at an academic medical center, where the majority of residents reported planning a scientific career and the majority of graduates pursue academic careers. thus, the external validity and generalizibility of our findings to other residency programs remains unclear. finally, a limitation of the usb syllabus is that a structured mechanism to update the most recent best evidence is not included. however, one could envision a system of a web - based syllabus that includes regular updates combined with a personalized usb syllabus handed to house officers at the beginning of their training to capitalize on the benefit of each technology. in conclusion, this usb drive - based electronic syllabus seems to have had a positive effect on resident education. importantly, this intervention eliminated the haphazard way in which trainees are exposed to the medical education. all three authors can recall points in their training when they were thrilled that they had been given a particular article by an attending physician and even felt somewhat covetous when seeing colleagues being given articles by role models. additional research may help to more accurately quantify the effect of a usb syllabus on residents ' reading practices and patient care, or how this intervention might influence the acquisition of the six acgme core competencies. creative solutions using computers and technology will allow us to more effectively educate the physicians of tomorrow in innovative ways. the authors have not received any funding or benefits from industry to conduct this study. | backgroundthe acquisition of new knowledge is a primary goal of residency training. retrieving and retaining influential primary and secondary medical literature can be challenging for house officers. we set out to investigate the effect of a universal serial bus (usb) drive loaded with landmark scientific articles on housestaff education in a pilot study.methodswe created a usb syllabus that contains 187 primary scientific research articles. the electronic syllabus had links to the full - text articles and was organized using an html webpage with a table of contents according to medical subspecialties. we performed a prospective cohort study of 53 house officers in the internal medicine residency program who received the usb syllabus. we evaluated the impact of the usb syllabus on resident education with surveys at the beginning and conclusion of the nine - month study period.resultsall 50 respondents (100%) reported to have used the usb syllabus. the self - reported number of original articles read each month was higher at the end of the nine - month study period compared to baseline. housestaff rated original articles as being a more valuable educational resource after the intervention.conclusionsan electronic syllabus with landmark scientific articles placed on a usb drive was widely utilized by housestaff, increased the self - reported reading of original scientific articles and seemed to have positively influenced residents ' attitude toward original medical literature. |
there has been a dramatic improvement in the survival outcome of acute lymphoblastic leukemia (all) patients with a better understanding of molecular biology, the use of combination chemotherapy protocols, risk stratification using clinical, genetic, and molecular parameters, improvements in supportive care, along with effective central nervous system (cns) prophylaxis. mcp 841 protocol has emerged to be an effective tool with tolerable toxicities and thus, is useful even for developing countries. bfm 90, bfm-95, and ukall - xi protocols are widely used in western countries but rarely used in limited resource settings due to their higher toxicities.. survival outcome in childhood all has reached over 80% in resource - rich nations. however, reports from various institutions in india suggest that the outcome is inferior to that achieved in the developed nations due to poor management of infections, leading to toxic deaths and also increased incidence of relapse. the patient population of india differs markedly from the western population with respect to the prevalence of illiteracy, poverty, malnutrition, and chronic infectious diseases. although multiple studies have been performed across the world ; there is a deficiency of data available on the prognostic factors, response to treatment, and research on the biology of all from the northwest indian perspective. our institute, being a regional cancer center, treats a significant proportion of all patients who are provided with the best possible treatment within resource and financial constraints. we present the findings of a retrospective study designed to estimate the relapse - free survival of all patients treated uniformly with mcp 841 protocol on the basis of various prognostic factors. the identification of prognostic factors and toxicities would help to determine the management lacunae and would lead to an overall improvement in the quality of care of all patients. a total of 310 previously untreated all patients from northwest india presenting to our oncology outpatient department (opd) from june 2002 to june 2008 who took treatment and were on regular follow - up for 5 years were selected in this retrospective hospital - based study. diagnosis of all was confirmed by bone marrow (bm) aspiration on the first visit. detailed clinical history, physical examination, peripheral blood film (pbf), and biochemical profiles, including liver and renal function tests, were performed at the initial presentation. cerebrospinal fluid (csf) was obtained for cytology in patients suspected of cns disease at presentation. csf - positive patients and those having l3 (french - american - british criteria) were not included in this study. the mcp 841 protocol, first used in india, includes effective drugs given in such a way that the minimal supportive care is required ; this factor is the main reason for the reduction in costs. the approximate cost of complete course of treatment with mcp 841 protocol in the indian setting is about 3000 usd (2,00,000 inr) ; however, the cost is highly dependent on the costs of hospital admission and transfusion. in our regional cancer center, these costs were minimal because of funding by the government. apart from this, most of the chemotherapy drugs were provided free of cost, further cutting the costs and making the treatment available within the reach of poor families. data were obtained from the records of these 310 carefully selected patients and were analyzed. ethical approval was not required for this study as the study was retrospective and the patients who were selected were treated with a standard institutional protocol. immunophenotyping (ipt) was performed in 205 patients who could afford it out of 310 cases using a panel of monoclonal antibodies, which included cd2, 4, 5, 7, 8, 10, 11b, 15, 19, 20, 36, 13, 33, hla - dr, and surface immunoglobulin (sig). t - cell all was defined as either cd5- or cd7-positive with or without additional t - cell markers but with negative b - cell antigens. the patient 's guardians were counseled regarding the need for strict adherence to the protocol and need for timely follow - up. patients received two induction cycles (i1 and i2), repeat induction (ri1), consolidation (c), and six maintenance cycles (m). cns prophylactic therapy included cranial irradiation (2,000 cgy) for children above the a1ge of 3 years. patients less than 3 years were treated with an alternative regimen (i2a) containing high dose cytarabine with granulocyte colony - stimulating factor (g - csf) support. all patients received 12 weekly intrathecal injections of methotrexate during the induction and consolidation phases of therapy in a dose of 8 mg, 10 mg, and 12 mg in children under 2 years, 2 - 3 years, and more than 3 years of age, respectively. table showing the mcp841 protocol with the various phases, along with the drugs used with their doses the patients were hospitalized in the leukemia ward of our hospital to start the induction protocol. complete blood count (cbc) was performed biweekly (thrice weekly if the patient had thrombocytopenia) and pbf was performed weekly. csf examination was performed monthly during the induction and consolidation phases to detect early cns relapse. during the maintenance phase complete remission (cr) was defined as less than 5% lymphoblasts in a normocellular bm in the absence of clinical evidence of disease. patients with more than 5% blasts at the end of induction regimen were considered as nonresponders. relapse was defined as the presence of unequivocal malignant blast cells (> 25%) in the bm or on histological or cytological documentation of blasts in extramedullary sites after the achievement of cr. the relapses were classified on the basis of the sites of relapses, that is, bm, cns, and testi(e)s. csf was examined in patients presenting with headache and vomiting. in case of bone marrow relapse, clinical examination of testes and a csf study were mandatory to rule out concurrent testis and cns disease, respectively. in cases with nontender testicular enlargement, fine - needle aspiration cytology (fnac) the presence of unequivocal blasts in csf irrespective of csf cell count and/or new onset cranial nerve palsy was considered as cns leukemia. at the start of the protocol, the patients relatives were counseled to deposit blood in our hospital 's blood bank in advance for the timely management of hematological complications. patients with high total leukocyte count (tlc) were prescribed allopurinol 100 - 600 mgm in two to three divided doses for the prevention of uric acid nephropathy. serum electrolytes were monitored in such patients due to the high risk of tumor lysis syndrome. povidone iodine gargle was given to maintain good oral hygiene and clotrimazole lozenges were used for prophylaxis of fungal infections. after sending blood for culture and sensitivity, empirical choice was ceftazidime / ceftriaxone with amikacin. the addition of fluconazole was considered if fever persisted for more than 72 h after starting iv antibiotics. blood transfusions were given if the hemoglobin level was below 8 g / dl and platelets when the count was below 20,000/cmm or in the presence of bleeding. the 5-year relapse - free survival was calculated on the basis of b - cell versus t - cell all, tlc at presentation > 1 lakh / cmm, age at presentation, sex, common acute lymphoblastic leukemia antigen (calla) positivity, the presence of blasts in pbf on day 15 of induction, and completion of protocol within prescribed time. meir survival curves were plotted and log - rank (mantel cox) test was performed for the comparison of survival curves ; statistical significance (p value) and chi - square values were calculated. the mean survival with 95% confidence interval (ci) assuming the proportional hazards assumption to be true in this calculation, cox regression analysis was performed by forward stepwise (likelihood ratio) method and hazard ratio with 95% ci was also obtained. all statistical calculations were performed using statistical package for the social sciences (spss) software for windows version 20.0 (ibm corp., patients received two induction cycles (i1 and i2), repeat induction (ri1), consolidation (c), and six maintenance cycles (m). cns prophylactic therapy included cranial irradiation (2,000 cgy) for children above the a1ge of 3 years. patients less than 3 years were treated with an alternative regimen (i2a) containing high dose cytarabine with granulocyte colony - stimulating factor (g - csf) support. all patients received 12 weekly intrathecal injections of methotrexate during the induction and consolidation phases of therapy in a dose of 8 mg, 10 mg, and 12 mg in children under 2 years, 2 - 3 years, and more than 3 years of age, respectively. table showing the mcp841 protocol with the various phases, along with the drugs used with their doses the patients were hospitalized in the leukemia ward of our hospital to start the induction protocol. complete blood count (cbc) was performed biweekly (thrice weekly if the patient had thrombocytopenia) and pbf was performed weekly. csf examination was performed monthly during the induction and consolidation phases to detect early cns relapse. during the maintenance phase complete remission (cr) was defined as less than 5% lymphoblasts in a normocellular bm in the absence of clinical evidence of disease. patients with more than 5% blasts at the end of induction regimen were considered as nonresponders. relapse was defined as the presence of unequivocal malignant blast cells (> 25%) in the bm or on histological or cytological documentation of blasts in extramedullary sites after the achievement of cr. the relapses were classified on the basis of the sites of relapses, that is, bm, cns, and testi(e)s. csf was examined in patients presenting with headache and vomiting. in case of bone marrow relapse, clinical examination of testes and a csf study were mandatory to rule out concurrent testis and cns disease, respectively. in cases with nontender testicular enlargement, fine - needle aspiration cytology (fnac) the presence of unequivocal blasts in csf irrespective of csf cell count and/or new onset cranial nerve palsy was considered as cns leukemia. at the start of the protocol, the patients relatives were counseled to deposit blood in our hospital 's blood bank in advance for the timely management of hematological complications. patients with high total leukocyte count (tlc) were prescribed allopurinol 100 - 600 mgm in two to three divided doses for the prevention of uric acid nephropathy. patients with tlc > 1 lakh / cmm received intravenous (iv) hydration 4 l / sqm, along with the injection sodium bicarbonate. serum electrolytes were monitored in such patients due to the high risk of tumor lysis syndrome. povidone iodine gargle was given to maintain good oral hygiene and clotrimazole lozenges were used for prophylaxis of fungal infections. febrile neutropenic patients were treated with iv antibiotics. after sending blood for culture and sensitivity, the addition of fluconazole was considered if fever persisted for more than 72 h after starting iv antibiotics. blood transfusions were given if the hemoglobin level was below 8 g / dl and platelets when the count was below 20,000/cmm or in the presence of bleeding. the 5-year relapse - free survival was calculated on the basis of b - cell versus t - cell all, tlc at presentation > 1 lakh / cmm, age at presentation, sex, common acute lymphoblastic leukemia antigen (calla) positivity, the presence of blasts in pbf on day 15 of induction, and completion of protocol within prescribed time. meir survival curves were plotted and log - rank (mantel cox) test was performed for the comparison of survival curves ; statistical significance (p value) and chi - square values were calculated. the mean survival with 95% confidence interval (ci) assuming the proportional hazards assumption to be true in this calculation, cox regression analysis was performed by forward stepwise (likelihood ratio) method and hazard ratio with 95% ci was also obtained. all statistical calculations were performed using statistical package for the social sciences (spss) software for windows version 20.0 (ibm corp., armonk the characteristics of patients at presentation are depicted in table 2. out of 310 patients, 215 (69%) were males, with the male / female ratio being 2.2:1. one hundred and sixty five (53.2%) patients were in remission at the end of 5 years of the starting of treatment. a total of 126 patients (40.6%) relapsed in 5 years from the start of the treatment. most of these relapses (n = 113, 89.6%) occurred while the patients were on treatment. table 3 shows the timing of relapse of these patients. the most frequent site of relapse was bm (n = 114, 90.4%) followed by cns (n = 7, 5.5%), testis (n = 3, 2.4%), and solitary bone (n = 2, 1.6%). thus, bm, cns, and testicular relapse rates were found in 39.1%, (n = 114 of 291), 2.4% (n = 7 of 291), and 1% (n = 3 of 291) of the patients, respectively. table showing baseline characteristics of patients with reference to demographic and hematologic parameters table showing the number of relapses as per the phase of treatment overall, the 5-year survival was 53.2%. meir analysis for b - cell all was 62% while for t cell it was 28% (p the mean survival for b and t lineages was 39.35 months and 26.38 months, respectively [hazards ratio (hr) 1.41, 95% ci 1.19 - 1.63, p 0.002 ]. table 4 summarizes the results of statistical tests for survival analysis for various subgroups. in patients with day 15 pbf without blast, relapse - free survival was 65% while in those with persistent blast, it was 45% (p 1 lakh at presentation, relapse - free survival was 68% and in those with tlc > 1 lakh had 41% survival with a mean survival of 42.51 months and 30.99 months, respectively (hr 2.14, 95% ci 1.76 - 2.48, p 20 years age group it was 15%, for the 3 - 10 years age group and 1115 years age group it was 65% and 64%, respectively, while for the 16 - 20 years age group, it was 59% (p 20 years, it was 18.34 months (hr 3.39, 95% ci 2.09 - 5.51, p 1 lakh / cmm) at presentation, apart from using it for eradicating blasts from cns in children 20 years had poorer survival probability (15 - 30%). cns relapse was observed in 2.4% of the patients who achieved remission. in an indian study by raje. the overall 5-year survival in our study was 53.2%, which was clearly lesser than not only western but also other indian studies. this could be attributed to the higher incidence of high - risk disease and differences in tumor biology in the northwest indian scenario. the mcp 841 protocol is an important landmark in the advancement of treatment and outcomes of childhood all in india. however, this protocol has some drawbacks, one of the biggest being that there is no risk stratification to either intensify or deintensify treatment. the study being a retrospective one, suffers from the usual drawback of the availability of limited data in the records of a busy cancer center. although cytogenetics and reverse transcription polymerase chain reaction (rt - pcr) tests are being now routinely performed in all patients, they were sparingly done few years back at our center. also, ipt reports entry in the records were limited, thereby restricting our analysis to b - cell versus t - cell and calla - positive versus calla - negative patients. hence, it was not possible to find out the detailed correlation seen between outcome and these reports. the study being a retrospective one, suffers from the usual drawback of the availability of limited data in the records of a busy cancer center. although cytogenetics and reverse transcription polymerase chain reaction (rt - pcr) tests are being now routinely performed in all patients, they were sparingly done few years back at our center. also, ipt reports entry in the records were limited, thereby restricting our analysis to b - cell versus t - cell and calla - positive versus calla - negative patients. hence, it was not possible to find out the detailed correlation seen between outcome and these reports. the data presented in this study clearly indicate the need of more aggressive treatment and more research on the biology of all in the indian setting. the greater distance of dedicated cancer centers, apart from ignorance, illiteracy, poverty, and belief in an alternate system of medicine can be implicated as the root causes of poor prognosis of all in india. mcp 841 protocol is a useful tool for treatment of all in children when more aggressive protocols can not be used. akap collected data, wrote the paper, performed statistical analysis and reviewed the literature. | background : a dramatic improvement in the survival of acute lymphoblastic leukemia (all) patients in the last three decades has been observed. mcp 841 protocol is an old but effective tool with tolerable toxicities. the objective of this study was to estimate the relapse - free survival of all patients treated uniformly with mcp 841 protocol on the basis of various prognostic factors.materials and methods : the study design was retrospective and it was conducted in a regional cancer center of northwest india. three hundred and ten all patients who underwent treatment with mcp 841 protocol and regular follow - up for up to 5 years were selected for this study. relapse - free survival was calculated by kaplan meier analysis and cox regression analysis was used to calculate the hazards ratio (hr) using statistical package for the social sciences (spss) software for windows version 20.0.results:fifty-four percent patients were 1 lakh / cmm had 41% survival [hr 2.14 (1.76 - 2.48) with, p < 0.001].conclusion : mcp 841 protocol is a useful tool for the treatment of all in children when more aggressive protocols can not be used. |
the best - known physiological role of active vitamin d or 1,25 (oh)2 vitamin d concerns the maintenance of calcium and phosphate homeostasis by promoting their intestinal absorption, thus ensuring their availability for the skeletal mineralisation process. to achieve this well - established endocrine effect, 1,25 (oh)2 vitamin d works in concert with 2 other hormones : parathyroid hormone (pth) and fibroblast growth factor-23 (fgf-23). aside from its well - characterised endocrine pathway, there is now a growing body of evidence which demonstrates that 1,25 (oh)2 vitamin d can directly affect bone cell differentiation and function by targeting key genes involved in bone formation and resorption. the targets for 1,25 (oh)2 vitamin d include lrp5, the wnt coreceptor that plays a key role in osteoblast proliferation, differentiation, and function. in addition, other genes which promote osteoclastogenesis are also regulated by 1,25 (oh)2 vitamin d and this includes rankl, produced by osteoblasts which stimulates bone resorption. moderate vitamin d deficiency is associated with decreased bone mineral density (bmd) and increased risk of fracture, particularly in the elderly. randomised controlled trials of vitamin d supplementation alone or combined with calcium have been shown to reduce fracture risk, in elderly institutionalized subjects. taken together these data indicates that vitamin d supplementation in this clinical setting improves bmd and decreases the risk of osteoporotic fracture. it has been postulated that higher serum concentrations of 25 (oh) vitamin d should be achieved to reduce fracture risk, particularly when vitamin d is given alone without calcium, although there is debate over the optimum serum concentration of 25 (oh) vitamin d needed for maximal antifracture efficacy. in addition, specific vitamin d dosing regimen may also be important as studies of vitamin d loading regimes have shown an increased risk in fracture risk, although the biological mechanisms remain unclear [7, 8 ]. it is plausible that several biological pathways may be implicated as 1,25 (oh)2 vitamin d via its receptor ; the vitamin d receptor (vdr) can regulate several osteoblastic and osteocytic genes which affect skeletal remodelling. excessive signalling by supraphysiological concentrations achieved by high loading doses of vitamin d may favour the expression of genes involved in bone resorption which are negative regulators of bone formation. in support of these hypotheses, recent studies have shown that large doses of vitamin d are associated with acute increases in bone resorption, which may be related to vitamin d - induced upregulation of rankl or proresorptive cytokines [9, 10 ]. we have shown that bolus intramuscular injections of 300,000 iu of vitamin d2 lead to increases in fgf-23 which may impact negatively on bone mineralisation. another hypothesis is that changes in factors involved in the regulation of the wnt signalling pathway may also be modulated by excess 1,25 (oh)2 vitamin d signalling in osteocytes or osteoblasts. proteins such as sclerostin and dickkopf-1 (dkk1) are 2 secreted wnt signalling antagonists, produced by osteocytes mainly [12, 13 ]. in animal models, acute as well as chronic pth administration reduces the expression of sclerostin by osteocytes. in clinical studies, circulating sclerostin has been shown to be inversely correlated with pth levels and free oestrogen index. a recent study showed an increase in serum sclerostin in men only following vitamin d (700 iu / day) and calcium supplementation (500 mg / day). dkk1 expression in colon epithelial cells has been shown to be upregulated by 1,25 (oh)2 vitamin d. in osteoblasts, we can therefore speculate that vitamin d signalling may affect the production of the 2 wnt inhibitors. it is biologically plausible that at physiological concentrations, 1,25 (oh)2 vitamin d has an anabolic effect on bone metabolism but at supraphysiological concentrations, such as those achieved with very high loading regimes, it may stimulate factors which have a suppressive effect on bone formation. the aim of this study was to determine changes in circulating concentrations of sclerostin and dkk1 following a loading dose of vitamin d2 (ergocalciferol) in subjects with vitamin d insufficiency. we studied 34 patients (13 m, 21 f) aged mean (sd) 61.3 (15.6) years with vitamin d insufficiency (25 (oh) vitamin d < 50 nmol / l) as determined by the routine automated immunoassay. the current study is a followup of previous work investigating the effects of a loading dose of vitamin d2 on circulating concentrations of 1,25 (oh)2 vitamin d and fgf-23 in patients with osteoporosis and vitamin d insufficiency in a subgroup of 34 subjects. they were recruited during their follow - up visit at the metabolic bone clinic over 12 months from october 2010 to september 2011 and had complete datasets which included measurement of serum sclerostin and dkk1. the serum 25 (oh) vitamin d concentration on routine analysis was mean (sd) 33.8 (15.5) a loading dose of 300,000 iu of ergocalciferol (vitamin d2) intramuscularly was given and all patients were asked to continue with their usual daily maintenance supplements of calcium (1.2 g) and vitamin d3 (800 iu). the study was approved by the local research ethics committee of guy 's and st thomas ' hospital nhs trust. non - fasting blood samples were collected at baseline and the subjects were followed longitudinally when additional samples were obtained at 1, 2, and 3 months. routine biochemical parameters were analysed immediately while additional serum and plasma samples were frozen and stored at 70c for subsequent analyses of 25 (oh) vitamin d and 1,25 (oh)2 vitamin d by liquid chromatography - tandem mass spectroscopy (lc - ms / ms), sclerostin, and dkk1, respectively. routine biochemical tests including albumin corrected calcium, phosphate, pth, and creatinine were determined by standard laboratory methods on the roche modular analysers (roche diagnostics limited, west sussex rh15 9ry, uk). the biochemical markers of bone turnover, ctx (-crosslaps) and total procollagen type 1 amino - terminal propeptide (pinp), were measured on the roche elecsys 2010 analyser as previously described. the assay cv for p1np was 5.7% and 4.8% at concentrations of 30.6 and 185 the routine assay for 25-hydroxyvitamin d (25 (oh) vitamin d) was an automated chemiluminescence immunoassay (clia) (liaison diasorin inc., 25 (oh) vitamin d2, 25 (oh) vitamin d3, 1,25 (oh)2 vitamin d2, and 1,25 (oh)2 vitamin d3 were also analysed at baseline and at 3 months simultaneously by liquid chromatography - tandem mass spectroscopy (lc - ms / ms), the gold standard methodology, as previously described. this method, unlike the immunoassays, is not affected by vitamin d binding protein concentrations and is able to equally detect 25 (oh) vitamin d2 and 25 (oh) vitamin d3. the recommended national institute of standards and technology (nist) standard reference material (srm) 972 was used as calibrator for the 25 (oh) vitamin d assay, hence avoiding issues surrounding assay standardisation as reported for certain commercial immunoassays. calibrators for 1,25 (oh)2 vitamin d were obtained from sigma - aldrich, dorset, uk. interassay cvs ranged between 5.6% and 6.6% for 1,25 (oh)2 vitamin d3 and 6.213.5% for (oh) vitamin d2 and 25 (oh) vitamin d3 concentrations. dkk1 was measured by an elisa (duoset elisa, r&d systems europe, ltd. the 96-well microtitre plates were coated with 100 l of anti - dkk1 monoclonal antibody diluted to 8.0 g / ml. the detection antibody (goat anti - human dkk1) was diluted to a concentration of 100 g / ml. the minimum detection limit was 631 pg / ml and the assay cv was 1.45% and 1.2% at dkk1 concentration of 889 pg / ml and 3254 pg / ml, respectively, the same batch to minimise variability. sclerostin was measured by an immunocapture enzyme assay (teco medical group, quidel corporation, san diego, usa). bone mineral density was measured at the lumbar spine (ls) and total hip (th) at baseline by dxa using the hologic discovery scanner (hologic inc., the cv for bmd measurement was 1.6% at the ls and th and 2.5% at the fn. univariate analysis, using pearson 's correlation or spearman 's rank correlation, was used to explore the relationship between dkk1 and sclerostin, with egfr, pth, and vitamin d metabolites at baseline and at 3 months. differences between the biochemical parameters at baseline and 3 months were determined using the student paired t test. percentage change in dkk1 at 1, 2, and 3 months compared to baseline was analysed using anova. multilinear regression analysis was used to explore the association between changes in sclerostin and dkk1 and changes in 1,25 (oh)2 vitamin d after adjustment for age, gender, bmi, and bmd at the ls and th and pth. all statistical analyses were performed using ibm spss statistics 20 (mac). a p value of < 0.05 (95% confidence interval) was considered as statistically significant. there was a marked increase in 25 (oh) vitamin d and 1,25 (oh)2 vitamin d, measured by lc - ms / ms, at 3 months as shown in table 2. no significant differences were observed between pth, serum calcium, and the bone turnover markers at 3 months compared to baseline in this subgroup. there were no significant differences in sclerostin at baseline and at 3 months between men and women. there was a small increase in dkk1 concentrations between baseline and at 3 months, following the bolus dose of vitamin d2, although this failed to reach significance (p = 0.2) table 2. in contrast, sclerostin increased significantly at 3 months (p = 0.033) table 2. sclerostin also increased in the subgroup of patients who were not on treatment with bisphosphonates (n = 9), although the results failed to reach significance (baseline : 0.553 (0.13), 3 months : 0.628 (0.16) ng / ml, p = 0.16). univariate analyses showed a significant positive correlation between sclerostin and dkk1 at baseline (r = 0.504, p = 0.002) as illustrated in figure 1(a) and 3 months (r = 0.42, p = 0.013) figure 1(b). there was no significant relationship between pth, 1,25 (oh)2 vitamin d, and 25 (oh) a significant inverse correlation was observed between sclerostin and egfr at 3 months (r = 0.494, p = 0.007). only the association between sclerostin and dkk1 remained significant at baseline (p < 0.001) and 3 months (p = 0.003) following multilinear regression analyses and adjustment for age, gender, pth, and vitamin d metabolites. in univariate analysis, a positive correlation was observed between % change in sclerostin and 1,25 (oh)2 vitamin d from baseline. the mean (sem) of the combined % change in the 2 wnt inhibitors were 23% (7.2), although the % change in dkk1 at 3 months was lower than sclerostin (dkk1 : 10% (5.3), sclerostin 13% (5)). we observed a trend towards a small and gradual increase in dkk1 (1 month : 2% (3.9), 2 months : 6% (4.1), and 3 months : 10% (5.3), p = 0.2). in a multilinear regression analysis with % change in sclerostin and dkk1 as dependent variable, following correction for confounders such as age, gender, bmi, bmd, and gfr, we found a positive significant association with % change in 1,25 (oh)2 vitamin d independent of changes in pth (p = 0.038) table 3. we have shown that increases in 1,25 (oh)2 vitamin d following a loading dose of vitamin d2 are associated with a significant increase in serum sclerostin. in multilinear regression % changes in the wnt inhibitors, sclerostin and dkk1 was significantly associated with increases in 1,25 (oh)2 vitamin d, independent of pth. vitamin d supplementation reduces the risk of fractures in populations with a high prevalence of vitamin d deficiency or insufficiency. there are however several studies, particularly when loading doses of vitamin d were given, where u or j shape association between bone health and vitamin d has been reported [7, 8 ]. thus, at lower doses, vitamin d has a protective or anabolic effect on bone health, but it could exert adverse or catabolic effects at higher doses. the mechanisms for such an effect are still not completely understood, although studies have shown an increase in bone resorption, following high bolus doses (300,000600,000 iu) [9, 10 ]. this has been postulated to be due to an increase in rankl production, although not demonstrated due to limitations in the measurement of circulating rankl concentrations. we have previously demonstrated increases in 2 potent proresorptive cytokines ; tumour - necrosis factor- (tnf-), and interleukin-1 (il-1) following a loading dose of 300,000 iu of vitamin d2. it is also possible that supraphysiological concentrations, such as those achieved in our study may affect bone formation, for instance increases in fgf-23, as previously documented, could result in reductions in bone formation and impairment in mineralisation. the marked increases in serum 25 (oh) vitamin d are in contrast to findings from a previous study. this is likely due to assay differences as we used lc - ms technology which detects 25 (oh) vitamin d2 and 25 (oh) vitamin d3 equally in contrast to immunoassays which underestimate 25 (oh) vitamin d2. 1,25 (oh)2d has been shown to regulate low density lipoprotein receptor - related protein-5 (lrp5), the wnt coreceptor essential for wnt signalling and bone formation. we hypothesised that high concentrations of 1,25 (oh)2 vitamin d could inhibit this pathway by up - regulating the wnt inhibitors ; sclerostin and dkk1 which bind to lrp5/6. both sclerostin and dkk1 are inhibitors of bone formation, although their tissue distribution is different. sclerostin is primarily expressed by osteocytes or late osteoblasts whereas dkk1 has a wider tissue distribution [12, 13 ]. in adults, the expression of dkk1 is abundant in osteoblasts and maturing osteocytes, although it is also expressed by other cell types including platelets. in disease, dkk1 is expressed by synovial fibroblasts, plasma cells, and colon cancer cells [18, 23, 24 ]. in our study, we observed a close correlation between both wnt inhibitors at baseline and after high dose vitamin d. this finding has not been demonstrated in all studies. one explanation for the divergence is the difference in assays used as they may measure different parts or fragments of the sclerostin and dkk1 molecule. sclerostin and dkk1 have been shown to be differentially regulated by treatment agents used in osteoporosis with increases in sclerostin and either no change or decreases in dkk1 seen with antiresorptive agents such as bisphosphonates and denosumab, respectively [2628 ]. on the other hand, with anabolic agents, such as teriparatide, decreases in sclerostin with later increases in dkk1 following prolonged treatment has been observed. similar findings have also been seen in chronic elevations in pth as in primary hyperparathyroidism. data from these studies suggest that early changes in sclerostin may be followed by a later reciprocal change in dkk1 which acts as a counter - regulatory mechanism. the findings also suggest that dkk1 response appears to be slower with significant changes occurring at 12 months and 18 months following teriparatide and denosumab, respectively. we observed a significant increase at 3 months in sclerostin following high dose vitamin d2. changes of similar magnitude as in our study have been reported following calcium and vitamin d supplementation for 2 years in men only, although the dose of vitamin d was lower than in our study and 1,25 (oh)2 vitamin d was not measured. we did not observe any difference in sclerostin at baseline and 3 months between men and women. more profound increases in sclerostin have been observed at earlier time points following potent antiresorptive agents such as intravenous zoledronate or denosumab. in the case of denosumab, an average increase of sclerostin of 29% was observed at 6 months which was maintained over 3 years. in contrast, with zoledronate, the increase in sclerostin was seen at early time points (7 days) with decline at 1 month and returning to baseline at 12 months. in our study, we do not have sclerostin measurements at serial time points and it is plausible that increases may have been larger at earlier time points. there was a trend towards a gradual increase in dkk1 which may be slower to respond compared to sclerostin. previous studies in a colon cell line showed dkk1 expression to be induced following treatment with 1,25 (oh)2 vitamin d at high concentrations (10 m). both wnt inhibitors appear to be upregulated by supraphysiological concentrations of 1,25 (oh)2d implying that inhibition of the wnt signalling pathway may be implicated in the catabolic actions of high levels of 1,25 (oh)2d. we did not see any significant change in p1np as the majority of the patients were already established on bisphosphonate at the time of administration of the loading dose of vitamin d2 and this may have masked the suppressive effect of sclerostin on bone formation. changes in the combined wnt inhibitors were significantly associated with the increases in 1,25 (oh)2 vitamin d. this appears to be independent of pth and gfr, suggesting an independent effect of 1,25 (oh)2 we also adjusted for bone density as studies suggest that circulating sclerostin may be related to the osteocyte pool. a recent animal study in knockout sclerostin mice shows that sclerostin may influence mineral metabolism and may have a direct inhibitory effect on 25-hydroxyvitamin d 1-hydroxylase gene (cyp27b1) mrna expression. furthermore, the study also shows that the absence of sclerostin leads to reduced fgf-23 concentrations suggesting that sclerostin may regulate fgf-23. we have previously demonstrated significant rises in serum phosphate and fgf-23 following high dose vitamin d2 taken together, these data would implicate sclerostin as another player in the feedback loop involving phosphate, fgf-23, and 1,25 (oh)2 vitamin d. further studies are required to explore this interesting possibility. secondly, as dkk1 appears to take longer time to respond to changes in 1,25 (oh)2 vitamin d, measurement at later time points would have been useful to compare differences in time course between sclerostin and dkk1. we could not determine whether the changes in the wnt inhibitors were associated with changes in bone formation or bone turnover as most of the patients were on bisphosphonates. bisphosphonates have also been shown to increase sclerostin, although the majority of patients were already established on bisphosphonates at study entry and none of the patients started bisphosphonates during the 3 months study period. nevertheless, our data show that the supraphysiological concentrations in 1,25 (oh)2 vitamin d achieved following a loading dose of vitamin d may inhibit wnt signalling and this may have adverse effects on the skeleton. further studies are needed to assess the effects of routine administration of bolus doses of vitamin d on bone health. | background. vitamin d is important for bone health, although high loading doses have been associated with an increase in fracture risk. the mechanisms remain uncertain. aim. we hypothesize that supraphysiological concentrations of 1,25 (oh)2 vitamin d may inhibit formation by increasing the production of wnt inhibitors : sclerostin and dkk1. subjects and methods. we measured serum sclerostin and dkk1 in 34 patients (21 f, 13 m) aged mean (sd) 61.3 (15.6) years with vitamin d deficiency / insufficiency treated with a loading dose of vitamin d2 (300,000 iu) intramuscularly. blood samples were taken at baseline and serially up to 3 months. results. serum 1,25 (oh)2 vitamin d increased markedly at 3 months (mean (sd) baseline 116 (63), 3 months : 229 (142) pmol / l, p < 0.001). there was a significant correlation between sclerostin and dkk1 at baseline (r = 0.504, p = 0.002) and at 3 months (r = 0.42, p = 0.013). a significant inverse correlation was observed between sclerostin and egfr at 3 months (r = 0.494, p = 0.007). sclerostin increased significantly at 3 months (p = 0.033). in a multilinear regression analysis with % change in sclerostin and dkk1 as dependent variable, a positive significant association was observed with % change in 1,25 (oh)2 vitamin d (p = 0.038), independent of changes in pth and following correction for confounders such as age, gender, bmi, bmd and egfr. conclusions. supraphysiological concentration in 1,25 (oh)2 vitamin d achieved following a loading dose of vitamin d increases sclerostin and may inhibit wnt signalling. this may have detrimental effects on bone. |
autism / autistic spectrum disorders (asd) are lifelong neurodevelopmental disorders diagnosed within the first 3 years of life. kanner1 described autism in 11 children manifesting symptoms of withdrawal from human contact as early as age 1 year and postulated the origins of asd in prenatal stages. the diagnostic and statistical manual of mental disorders iv - text revised (dsm - iv - tr) described autism as a complex neurobehavioral disorder characterized by varying degrees of social interaction deficits, flexibility of thinking, specific language abnormalities and/or delayed cognition, impaired verbal and non - verbal communication, failure to respond to certain stimuli with some restricted and extreme repetitive behavior or actions, stereotyped patterns of behavior or circumscribed interests, and association with several metabolic disorders. in recent years, autism has been shown to affect neural circuitry before 3 years of age. asds, encompassing full - syndrome autism (autistic disorder), asperger syndrome, tuberous sclerosis, angel man syndrome, congenital rubella, down syndrome, rett syndrome, asphyxia, childhood disintegrative disorder, and pervasive developmental disorder not otherwise specified (pddnos), are now grouped as asds, also known as pervasive developmental disorders (pdds).26 motor abnormalities in asd can be observed in infancy,7 and are apparent throughout childhood and into adulthood.8,9 the prevalence of autism has increased by more than tenfold in the last decade. epidemiological studies conducted in several states of the usa, the united kingdom, europe, and asia, estimate that 3.4 of every 10,000 children 310 years old will have autism.10 the prevalence of asds in saudi arabia is 6:1000,11 with a male to female ratio of 4.2:1.12 rates in the united states have increased from less than 3 per 10,000 children in the 1970s to between 34 and 93 children per 10,000 in the 2000s.13,14 the incidence of asd was only 1.4 cases in 10,000 omani children in the year 2011.16,17 a recent study in south korea demonstrated a considerably higher figure of approximately 1 in 38 (ie, 260 out of 10,000) children diagnosed with asd.18 in western australia, the prevalence of asd increased from 0.8/1000 in 1983 to 4.6/1000 in 1999, while this ratio increased from 6.6/1000 in 2000 to 9/1000 in 2006 in the united states.19 this growing prevalence will have enormous future public health implications and has stimulated intense research into potential etiologic factors. despite expanding research regarding asd, little is known regarding the pathology and etiology of these disorders ; however, the relative contribution of genetic, epigenetic, immune response, nutrient, toxins, environmental, bowel dysfunctions, inflammatory, and environmental susceptibility factors, as well as increased vulnerability to oxidative stress has been examined.2025 environmental factors, such as mercury, lead, measles, rubella virus, zinc, retinoic acid, maternal thalidomide, valproic acid, and alcohol use during pregnancy have been suggested to be involved in the etiology of autism.2629 autistic persons have a high prevalence of gastrointestinal disease and dysbiosis,30 epilepsy,31 autoimmune disease,32 and mental retardation33 have also been indicated in the etiology of autism. several studies have shown that an abnormal immune response may contribute to the etiology of certain forms of autism, including polymorphisms in immune genes controlling and regulating immune cell function, microglia and astroglia activation, production of proinflammatory cytokines, increased presence of central nervous system reactive antibodies, t cell activation, and innate immune activation.34 prenatal environmental factors, such as obstetrical suboptimality, alcohol exposure, and intrauterine infections, have also been reported to influence the occurrence of autism.35 in addition, emerging evidence points to inflammatory and apoptotic mechanisms as responsible for certain neuropsychiatric disorders, including autism. vargas suggested that neuroinflammatory processes occur in autistic brains by showing that transforming growth factor-1, macrophage chemo attractant protein 1, interleukin (il)6, and il10 are increased in the brain of autistic subjects. a number of studies have also shown that inflammatory cytokines, including tumor necrosis factor (tnf)-, interferon-, il1, il6, il8, and il12, are elevated in blood mononuclear cells, serum, plasma, and cerebrospinal fluid of autistic subjects.20,3640 dimayuga showed that overexpression of superoxide dismutase 1 (sod1) in microglial cells leads to a significant reduction in superoxide concentrations, with corresponding increases in h2o2 concentrations. they further showed that the release of the proinflammatory cytokines tnf and il6 is significantly attenuated by overexpression of sod1. el - ansary reported that lower concentrations of tnf and il6 in autistic patients may be related to overexpression of sod, which was previously reported as metabolic biomarker in saudi autistic patients.43 increasing evidence suggests that oxidative stress plays a role in the development and clinical manifestation of autism.44,45 in fact, oxidative stress plays a vital role in the pathology of several neurological diseases including alzheimer disease,46 parkinson s disease,47 down syndrome,48 schizophrenia,49 major depressive disorder,50 anxiety disorders such as panic disorder,51 and obsessive - compulsive disorder.52 it has been suggested that autism may result from an interaction between genetic, environmental, behavioral, and immunological factors, with oxidative stress as a mechanism linking these risk factors. no single gene has been found to be associated with autism, and involvement of multiple genes has been postulated. oxidative stress occurs as a result of an imbalance between the production of reactive oxygen species (ros) and endogenous antioxidants in living organisms.53 oxidative stress has been implicated in the pathogenesis of major psychiatric disorders, as the brain has comparatively greater vulnerability to oxidative damage than other organs.54 ros attack polyunsaturated fatty acids that are constitutive of cellular membranes, resulting in formation of lipid peroxidation (lpo) end products. several reports have indicated increased levels of other lpo markers in autism, confirming an increase in oxidative stress in autism. chauhan,55 james,56 and al - gadani reported higher lpo in the blood of children with autism as compared to their developmentally normal, non - autistic siblings. lpo occurs as a chain reaction between polyunsaturated fatty acids and ros, leading to the generation of lipid peroxides and hydrocarbon polymers, which are both highly toxic to the cell. malonyldialdehyde (mda) is generated by the peroxidation of polyunsaturated fatty acids and related esters and is used as a marker of lpo.58 one study showed that plasma mda content was higher in 13 of 15 (87%) of autistic subjects compared to in normal subjects. zoroglu reported increased thiobarbituric acid reactive species levels in the serum of autistic patients. in another study, the density of lipofuscin, a matrix of oxidized lipid and cross - linked protein that is formed as a result of oxidative injury in tissues, was observed to be higher in cortical brain areas concerned with social behavior and communication in autism.60 ming reported increased excretion of 8-isoprostane f2alpha as a marker of oxidative stress in the urine of children with autism. isoprostanes are produced from the free radical oxidation of arachidonic acid through non - enzymatic oxidation of cell membrane lipids. it is also evident that increased oxidative stress in autistic children leads to decreased levels of non - enzymatic antioxidants such as glutathione (gsh), vitamin e, and ascorbic acid and disturb their metabolism, reducing the ability to fight oxidative stress. antioxidant levels in patients with autism showed decreased activity of glutathione peroxidise (gpx) in plasma and in erythrocytes,62 reduced levels of total gsh, a lower redox ratio of reduced gsh to oxidized glutathione (gssg) in plasma,6366 as well as decreased catalase and superoxide dismutase (sod) activity in erythrocytes.59,62 several studies have identified alterations in enzymes that play a vital role in the defense mechanism against ros damage in autism. yorbik and sogut reported low activity of plasma antioxidant enzymes, particularly gpx and superoxide dismutase (sod), in autistic children. chauhan reported higher mda levels, while ceruloplasmin and transferrin levels were lower in autistic children. increased levels of lpo together with decreased levels of serum ceruloplasmin and transferrin suggest that children with autism are under increased oxidative stress, likely due to abnormal metabolism of pro - oxidant metal ions and/or decreased antioxidant proteins. evans evaluated the oxidative stress metabolites carboxyethylpyrrole and isolevuglandin (isolg) e2-protein adducts in cortical brain tissues in subjects diagnosed with autism. significant immune reactivity towards all of these markers of oxidative damage in the white matter, which often extended well into the grey matter of axons, was observed in every case of autism examined. these investigators reported that a striking thread - like pattern appears to be a hallmark of the autistic brain, which was not observed in any age - matched control brain. in another study, the density of lipofuscin, a matrix of oxidized lipid and cross - linked protein that forms as a result of oxidative injury to the tissues, was observed to be higher in cortical brain areas concerned with communication in subjects diagnosed with autism.69 geier reported well - defined increased levels of urine lipid peroxides and decreased levels of blood gsh and gpx in autistic patients. similarly, mostafa demarcated that autistic children have increased oxidative stress resulting from enhanced lpo and/or decreased gpx by inducing autoimmunity in autistic patients, indicating the potential role of oxidative stress. elevated levels of oxidative stress indicators such as no, mda, and protein carbonyl and reduced levels of antioxidant proteins such as ceruloplasmin and transferrin have also been reported in autistic children from the sultanate of oman.58,71 neuroligins belong to a family of postsynaptic cell adhesion proteins that can bind to presynaptic proteins known asneurexins.72,73 neuroligins are required for the maturation, stability, and/or maintenance of normal synaptic function.74 although four neuroligin genes have been identified in mammals, mutations in human genes encoding neuroligin 3 and neuroligin 4 have been recently associated with asd.75,76 as a result, a new model for asd has been developed that incorporates genetic - related changes to impaired synaptic processes in the pathobiology of autism.77,78 evidence to support this model stems from a recent study showing that the absence of neuroligin-3 can induce nonsyndromic autism in mice.79 a recent study showed that neuroligin - deficient mutants of caenorhabditis elegans are viable and do not display major impairments in motor function ; however, the sensory behaviors and sensory processing of these mutants appears to be defective and are similar to the traits observed in asd. these mutants also exhibit hypersensitivity to oxidative stress and exogenous pro - oxidant environmental factors such as mercury.80 this body of evidence provides an additional link between oxidative stress and genetic factors in the pathogenesis of asd. possible links between mitochondrial abnormalities and autism were initially suggested due to the deleterious consequences of mitochondrial disorders on neurodevelopment. indeed, mitochondrial disorders often result in central nervous system (cns) dysfunction, leading to developmental regression, learning disability, and various behavioral disturbances. genetic mutations in mitochondrial dna (mtdna) have been associated with myopathy, cardiomyopathy, neuropathy, seizures, optic atrophy, strokes, hearing loss, diabetes mellitus, and other clinical features.81 in some cases, autism can directly stem from mutations in mitochondrial dna (mtdna), as documented by graf,82 fillano,83 pons,84 weissman,85 shoffner,86 and lvarez - iglesias.87 the hypothesis of disturbed bioenergetics metabolism underlying autism has been suggested based on the detection of high lactate levels in some patients,8890 and by nuclear magnetic resonance (nmr) imaging as well as positron emission tomography (pet) scanning, which documented abnormalities in brain metabolism.91 a number of studies, including the detection of brain metabolism abnormalities and hyperlactacidemia, demonstrated a disturbance in brain energy metabolism in autistic patients, which may be a result of mitochondrial oxidative phosphorylation dysfunction in neuronal cells.82,84,91,92 several mitochondrial respiratory chain disorders have been associated with autism.84,89,93 hyperlactacidemia and an increased lactate / pyruvate ratio may result from several inherited metabolic defects of gluconeogenesis, pyruvate oxidation, the krebs cycle, or the respiratory chain. mutations in multiple genes may influence the observed changes in lactate and pyruvate levels, with genetic heterogeneity underlying mitochondrial dysfunction associated with autism.9496 the higher levels of plasma pyruvate found in children with autism are consistent with the higher levels of alanine (transamination product of pyruvate) and lactic acid.97,98 plasma pyruvate and lactate - to - pyruvate ratios suggest the presence of a pyruvate dehydrogenase complex (pdhc) deficiency, as previously reported.58,99,100 pdhc deficiency leads to in adequate removal of pyruvate and lactate, resulting in insufficient energy production. oxidative modifications and consequent inhibition of pdhc activity is consistent with the increased rate of hydrogen peroxide formation and reduced complex v activity observed in children with autism given the increased vulnerability of this complex to oxidative and nitrative stress.99,101 the lactate - to - pyruvate ratio accurately represents the redox state in the cytosol. for example, a lactate - to - pyruvate ratio of 12 in non - neurological controls is equivalent to a 750:1 ratio of oxidized nicotinamide adenine dinucleotide (nadh) to reduced nadh. similarly, a lactate - to - pyruvate ratio of 6 reported in autistic children is equivalent to a 1500:1 ratio of oxidized nadh to reduced nadh. this more oxidized cytosolic redox state in autism may favor anaerobic glycolysis over oxidative phosphorylation as a source of adenosine-5-triphosphate (atp). although skeletal muscle can tolerate this metabolic shift, consequences for brain function could be devastating due to the heavy reliance on mitochondrial oxidative phosphorylation for generating energy needed for cellular processes.100,102,103 the main function of the mammalian brain is generation and transmission of neural impulses. this requires creation and maintenance of ionic disequilibria, which, in terms of energy consumption, is a very costly process. in adult humans, the brain constitutes approximately 2% of body weight but receives 20% of the total blood supply. the brain utilizes oxygen at a rate of approximately 1.5 mmol / minute / g of tissue. since the consumption of each mole of oxygen generates 6 mol of atp during oxidative phosphorylation in the adult brain, at rest, 40%60% of this high rate of atp production and more during increased activity is used for ion movement.104 the end products of brain energy metabolism, such as acetylcholine, atp, and guanosine - triphosphate (gtp) are essential for powering basic cellular and molecular processes. acetylcholine mediates learning, memory, and cognition,105 while atp and/or gtp are necessary for protein synthesis,106 protein degradation,107 synaptic transmission,108 ion homeostasis,109 and signal transduction.110 glutamate exposure reduces the oxygen consumption rate and atp concentration in rat cerebral cortex neurons and has been implicated as a contributing factor in the pathogenesis of autism.111 disturbing energy metabolism makes brain cells more vulnerable to oxidative stress, glutamate - mediated neurotoxicity, and anoxic damage.112 mitochondria are membrane - enclosed organelles found in most eukaryotic cells, where they generate most of the cellular supply of atp, which is used as a source of chemical energy. additionally, mitochondria are involved in a range of other processes, such as signaling, cellular differentiation, cell death, and control of the cell cycle and cell growth. mitochondrial dysfunction has been implicated in several neuropsychiatric disorders, particularly in depression, anxiety, schizophrenia, autism, and alzheimer s dementia. furthermore, the presence of mutations at mitochondrial or nuclear dna (mtdna and ndna, respectively) levels has been linked to personality disorders, behavioral disturbances, thought alterations, impulsivity, learning impairment, cognitive impairment, and dementia. mitochondrial dysfunction in the cns of autistic individuals is supported by neuroimaging studies using pet and nmr spectroscopy, which have shown reduced glucose utilization and diminished atp levels, particularly in the cerebral cortex.113,114 at the biochemical level, moderate lactic acidosis has frequently been observed in autism.88,95,98,115 childhood mitochondrial respiratory chain disease involves impaired oxidative phosphorylation (oxphos) early in life, leading to atp depletion and abnormal neuropsychological development.84,116 asd is a well - recognized feature of childhood mitochondrial respiratory chain disease. many patients with oxphos disorders possess a mutation within the mtdna, which codes for 13 essential polypeptide components of the respiratory chain. since mtdna is nearly exclusively inherited from the mother, it is interesting that maternal factors also appear to be important in asd, raising the possibility that mtdna is a risk factor for developing the disorder. energy metabolism is central to life because cells can not exist without an adequate supply of atp. as previously mentioned, energy production for maintaining ionic disequilibria that is necessary for generation and transmission of nerve impulses is a primary function of the brain. the cns is particularly sensitive to disturbances in energy generation ; even a short - term interruption can lead to long - lasting, irreversible damage. if such a traumatic event occurs during birth, the consequences may last for a lifetime. hence, understanding the relationship between oxidative stress, energy metabolism, and function during brain development has practical implications in humans.117 the primary function of mitochondria is to produce atp, the primary energy source in the brain and in the body. atp, nadh, and nicotinamide adenine dinucleotide phosphate (nadph) are important co - factors for many metabolic processes in the body. many children with autism have lower muscle tone and decreased endurance ; these symptoms may be related to decreased atp levels.118,119 nadh is mainly involved in catabolic reactions (energy metabolism and mitochondrial function), whereas nadph is involved in anabolic reactions (antioxidation and reductive biosynthesis).120 decreased plasma atp may be related to impaired mitochondrial function, which has been reported in children with autism.85,95,96,121 children with autism show significantly elevated oxidative stress, as indicated by the increased gssg / gsh ratio (glutathione is the primary antioxidant in the body) and increased plasma nitrotyrosine. low levels of plasma atp reduced nadph and plasma tryptophan.122 although glutathione reductase and glucose-6-phosphate dehydrogenase are secondary antioxidant enzymes that help maintain a steady concentration of glutathione, nadph is necessary for optimal functioning of the primary antioxidant enzymes.123,124 this may be due to impaired function and/or amount of trans locator protein in the mitochondrial membrane, which would impair transport of atp from the mitochondria into the cytoplasm and into the plasma. superoxide and hydroxyl radicals are ros that can rapidly overwhelm endogenous scavenging mechanisms, damaging cellular macromolecules, including lipids, proteins, and nucleic acids. oxidants are also mediators in signaling involving mitochondria, dna repair enzymes, and transcription factors that may lead to apoptosis during reperfusion. mitochondria are heavily implicated in the formation of ros since excessive superoxide production during electron transport and inhibition of electron transport mechanisms by free radicals leads to further generation of oxygen radicals.125 mitochondrial oxygen radical production can be stimulated by impaired intracellular calcium, sodium, and adenosine diphosphate.122,126,127 multiple lines of evidence suggest that the influence of adenosine may be insufficient for causing asd, and that increased adenosine would reduce both physiological and behavioral hallmarks of asd.128 the multi - subunit nadh - ubiquinone oxidoreductase (complex i) is the first enzyme complex in the mitochondrial electron transport chain (etc). the iron sulfur protein fraction of complex 1 is made up of seven subunits, including nadh - ubiquinone oxidoreductase 1 alpha sub complex 5 (ndufa5).the ndufa5 gene is located on human chromosome7q32, which is a candidate region for autism.129 marui demonstrated an association between the ndufa5 gene and autism. the ndufa5 gene product is part of an enzyme complex involved in the mitochondrial etc. variations in this gene and mitochondrial dysfunction may play important roles in the etiology of autism. heguilen and lina reported that na / k - atpase and ca / mg - atpase activities in autism may be increased in response to increased intracellular calcium concentration, which may contribute to altered neocortical circuitry in the cerebellum and frontal cortex of individuals with autism. al - mosalem observed lower atp levels in red blood cells as well as elevated lactate and creatinine kinase (ck) activities in the plasma of saudi autistic children compared to age - matched controls. furthermore, activation of brain ck may be related to significant increases in the activities of na / k atpase and ca / mg atpase and marked decreases in expression of mitochondrial etc complexes in different regions of the brain in autistic subjects compared with their age - matched controls. this suggests that these enzymes contribute to abnormal energy circuit functioning in autism.134,135 creatine is a nitrogen - containing compound that serves as an energy shuttle between mitochondrial sites of atp production and the cytosol, where atp is utilized. disorders of creatine synthesis, characterized by brain creatinine deficiency, can lead to numerous deleterious symptoms including mental retardation, hypotonia, autism or behavioral problems, and seizures. the urine creatine / creatinine ratio is elevated in creatine transporter deficiency with normal plasma levels of creatine. the diagnosis is confirmed in all cases through dna testing or functional studies.136 mitochondria are responsible for most of the energy production through oxidative phosphorylation, a process requiring the action of various respiratory enzyme complexes, and the mitochondrial etc, which is located in the inner mitochondrial membrane.137 mitochondria produce atp by generating a proton gradient (membrane potential) through the action of five etc complexes, including complex 1 (nadh dehydrogenase), complex 2 (succinate dehydrogenase), complex 3 (cytochrome bc1 complex), complex 4 (cytochrome c oxidase), and atp synthase, also known as complex 5. here, electron transport couples with the translocation of protons from the mitochondrial matrix to the inter membrane space. the generated proton gradient is used by atp synthase to catalyze the formation of atp by phosphorylating adp.138 the number of mitochondria per cell is roughly related to the energy demands of the cell. the brain has a high energy demand ; thus, neurons contain a large number of mitochondria. the etc in mitochondria is also a primary mechanism for free radical generation.139,140 changes in the mitochondrial etc have been suggested as contributing factors in the pathogenesis of several diseases, including neuropsychiatric and neurodegenerative disorders.141143 chauhan showed that the expression of etc complexes (1, 2, 3, 4, and 5) is decreased in the cerebellum as well as frontal and temporal regions of the brain in children with autism, leading to abnormal energy metabolism and increased vulnerability to oxidative stress. autism is associated with a deficiency in complexes 3 and 4 of the mitochondrial respiratory chain, leading to an elevated lactate - to - pyruvate ratio.85,144,145 adiponectin is a protein that is produced by adipose tissue and involved in the control of energy metabolism.146 previous studies in japan, italy, and the sultanate of oman have suggested that altered levels of adiponectin reflect impairments in social interaction, and may be implicated in the pathophysiology of autism.147149 leptin, a peptide hormone mainly secreted by adipose tissue, is involved in the regulation of body weight and energy expenditure at the hypothalamic level. this may be involved in the regulation of neuroendocrine functions, the immune system, and inflammatory response, as well as play a role in development. involvement of some cytokine - like hormones and proinflammatory adipokines have been implicated in the pathophysiology of autism.150 l - tryptophan is an essential amino acid that can not be synthesized in the human body and must be supplied by the diet. for all amino acids, including l - tryptophan, only the l isomer is used in protein synthesis and can cross the blood tissue storage of tryptophan is relatively low and the overall tryptophan concentration in the body is the lowest among all amino acids, although only small amounts are necessary for general healthy nutrition. common sources of tryptophan include oats, bananas, dried prunes, milk, tuna fish, cheese, bread, chicken, turkey, peanuts, chocolate, and fruits such as cherries.151153 the kynurenine pathway (kp) is a major route of l - tryptophan catabolism, resulting in the production of the important pyridine nucleotide nicotinamide adenine dinucleotide (nad) and several neuroactive intermediates. tryptophan plays an important role in protein biosynthesis and as a precursor of various metabolic pathways (fig. 2), including serotonin, melatonin, kynurenine, and quinolinic acid (quin).153 its metabolism leads to production of many metabolites that may be physiologically valuable or even toxic.154 current estimates suggest that 95% of mammalian serotonin is localized within the gastrointestinal tract, and only 3% of dietary tryptophan is utilized for serotonin synthesis in the body. however, serotonin synthesis is one of the most important tryptophan pathways. only 1% of dietary tryptophan is used for serotonin synthesis in the brain. despite the relatively low concentration of brain serotonin compared to that in the body, it has a broad impact as a neurotransmitter and neuromodulator and has been implicated in numerous psychiatric conditions and psychological processes, including autism.90,122 deufemia155 suggested that low brain tryptophan availability due to a low serum try / lnaa (large natural amino acids) ratio may be one of the mechanisms involved in altering serotonergic function in autism, as well as lower total plasma tryptophan and try / lnaa ratio in people with signs of behavioral disturbances and depression. tryptophan is a precursor to the neurotransmitter serotonin, which is strongly linked to autism. evans and kauzna - czaplinska suggested that urinary levels of tryptophan are reduced in autistic children. serotonin deficiency is linked to the pathophysiology of many psychiatric disorders, ranging from depression, anxiety, obsessive - compulsive disorder, eating disorders, and dependence.157 psychiatric complications of neurodegeneration may originate from serotonin deficiency mediated by tryptophan depletion following kp activation. mao a plays a vital role in metabolizing neurotransmitters such as dopamine, norepinephrine, epinephrine, and serotonin. dysfunctions of mao a have been implicated in a variety of neuropsychiatric disorders, including depression, social anxiety, autism, and attention deficit hyperactivity disorder. essa reported reduced levels of mao a activity in children with autism, which may affect the metabolism of neurotransmitters associated with autism pathogenesis. beneficial effects of melatonin in asd include improved sleep, reduced sun downing, and reduced cognitive decline. nonetheless, inflammation associated with neurodegeneration may lead to melatonin deficiency through kp and through the mediation of tryptophan depletion. this deficiency would be expected to compromise melatonin - mediated antioxidant and free radical scavenger defenses, both of which are important in the pathogenesis of neurodegeneration.159 tryptophan depletion may represent an immune - mediated mechanism involved in the pathophysiology of autism, or it may exacerbate autistic symptoms during immunological stress. immune dysregulation during brain development can have dramatic effects on neuronal function.160162 increasing evidence suggests that immune dysregulation is associated with neurodevelopmental disorders, including asd.163,164 induction of the kp is associated with significant immunomodulatory changes, for which two non - mutually exclusive mechanisms have been proposed. first, kp activation results in tryptophan depletion and immune response impairment by reducing the availability of this essential amino acid. for example, increased kp activity in dendritic cells is associated with the complete blockade of clonal t - cell expansion ; tryptophan depletion and kp activation have been implicated in the development of immune tolerance associated with pregnancy and persistence of tumours.159 quin is an important excitotoxic metabolite of the kp ; there is accumulating evidence that quin is involved in neurotoxicity associated with several inflammatory brain diseases. like glutamate, quin is an agonist of the n - methyl - d - aspartate receptor and can induce excitotoxicity in human neurons and astrocytes.165,166 our group recently showed that quin can induce poly (adp - ribose) polymerase (parp) activation and subsequent intracellular nad depletion and atp stores, leading to a number of deleterious effects, such as mitochondrial permeability, overproduction of superoxide, and nitric oxide (no) production, which are relevant to the pathogenesis of autism and asd.166 interestingly, zimmerman reported a decrease in quin levels in the cerebrospinal fluid from autistic children. we previously demonstrated that fetal brain cells can only produce small amounts of quin due to lower enzyme capacity. therefore, the kp may not be fully functional in the cns of autistic individuals. moreover, analogous to this is tryptophan 2,3-dioxygenase, for which a genetic polymorphism in autism has already been described.168 the kp is associated with the formation of serotonin since it is generated from tryptophan through the catalytic activity of the enzyme tryptophan 5-hydroxylase (thp). most importantly, a thp2 gene polymorphism is clearly associated with autism and other neurological disorders.169 therefore, impaired synthesis of both quin and serotonin in autism may be related through dysregulated kp metabolism, which is likely due to abnormal mrna and protein expression of kp enzymes, leading to altered cell signaling during early development. the importance of maintaining intracellular nad and nadh levels for maintaining overall cellular integrity and function is well established. additionally, nad is an important contributor to energy (atp) production and serves as a cofactor for nad glycohydrolases involved in intracellular calcium regulation. furthermore, nad is cofactor for the dna repair enzyme parp, an essential intracellular enzyme for repair of dna damage caused by increased ros levels. excessive parp activity results in depletion of intracellular nad levels and contributes to cell death via energy restriction.. increased levels of nadh with decreased levels of atp, nad, and the nad / nadh ratio, and plasma tryptophan occurring in parallel with increased levels of oxidative stress has been observed in children with autism.45,58,122,170 therefore, we propose that impairing tryptophan has a major impact on the neurotoxic cascade observed in autism. this review indicates that understanding the role of oxidative stress may provide renewed insight into the pathophysiology of autism, which is likely affected by the environment, genetic factors, immunological factors, new treatments, and prevention. increased oxidative stress in autism may be due to (a) increased production of oxidative markers or (b) increased exposure to environmental pro - oxidants, or (c) deficiencies of antioxidants (ceruloplasmin, transferrin, sod, gpx, catalase, reduced glutathione), impaired energy metabolism (nad, nadh, atp, pyruvate, and lactate), and abnormal tryptophan catabolism. increased oxidative stress may lead to membrane lipid abnormalities, mitochondrial dysfunction, excitotoxicity, inflammation, and immune dysregulation in autism. | autism spectrum disorder (asd) is a pervasive neuro - developmental disorder characterized by impaired social interaction, reduced / absent verbal and non - verbal communication, and repetitive behavior during early childhood. the etiology of this developmental disorder is poorly understood, and no biomarkers have been identified. identification of novel biochemical markers related to autism would be advantageous for earlier clinical diagnosis and intervention. studies suggest that oxidative stress - induced mechanisms and reduced antioxidant defense, mitochondrial dysfunction, and impaired energy metabolism (nad+, nadh, atp, pyruvate, and lactate), are major causes of asd. this review provides renewed insight regarding current autism research related to oxidative stress, mitochondrial dysfunction, and altered tryptophan metabolism in asd. |
an advantage of rna - seq over other gene expression profiling technologies is that it allows a comprehensive assay that does not require probes for targets to be specified in advance. it has particularly been used for de novo detection of splice junctions and allows genome wide expression profiling of organisms with unknown genome sequence. by obtaining millions of short reads from the population of interest and by mapping these reads to the reference genome, rna - seq produces read count data. with enough reads from a sample, it has the potential to detect and quantify biologically significant rnas with low and moderate abundances. before detecting biologically significant rnas, systematic technical variations due to experimental variability various procedures for normalization of rna - seq have been proposed in literature, such as transcripts parts per million, trimmed mean of m values, and quantile normalization. though these methods have been frequently used, no comparative analysis has been presented so far. previous methods for identification of differential expressed genes include bloom. who identified differential expression by taking log ratio of the transcript counts ; hoen. used a student 's t - test and alternatively also applied a bayesian model of vncio.. suggested to use poisson model (and fisher 's exact test, or a likelihood ratio test as an approximation to it) to test for differential expression. recently published methods, edger and deseq use a negative binomial distribution to test for differential expression as it allows for over dispersion. we also propose two statistical methods for inferring differential expression for rna - seq data. methods for normalization, differential expression, along with the details of the dataset used to test the performance of our methods are detailed in the next section. results along with a systematic comparison are presented on three real datasets and we conclude with a brief discussion. conducted rna - seq experiment with liver and kidney of a single human male using illumina genome analyzer sequencing platform. each tissue was sequenced in seven lanes, split across two runs of the machine and two different cdna concentrations (1.5 pm, 3 pm). for this work, we only use data sequenced at 3 pm concentration (five lanes for each sample) and 17708 ensembl transcripts that mapped with the array probes. marioni. conducted rna - seq experiment with liver and kidney of a single human male using illumina genome analyzer sequencing platform. each tissue was sequenced in seven lanes, split across two runs of the machine and two different cdna concentrations (1.5 pm, 3 pm). for this work, we only use data sequenced at 3 pm concentration (five lanes for each sample) and 17708 ensembl transcripts that mapped with the array probes. profiled mirna expression from the normal peripheral blood mononuclear cells from two different individuals and cancer cells of myeloid lineage, k562 (chronic myelocytic leukemia) and hl60 (acute promyelocytic leukemia) using solexa technology. profiled mirna expression from the normal peripheral blood mononuclear cells from two different individuals and cancer cells of myeloid lineage, k562 (chronic myelocytic leukemia) and hl60 (acute promyelocytic leukemia) using solexa technology. analyzed 6 globin reduced with 6 nonreduced human whole blood rna samples using a tag sequencing method on the illumina high - throughput sequencing platform. mastrokolias. analyzed 6 globin reduced with 6 nonreduced human whole blood rna samples using a tag sequencing method on the illumina high - throughput sequencing platform. normalization is a procedure to remove nonbiological influence on biological data and to make data comparable across experiments, runs, and lanes. various normalization procedures have been proposed in literature for rna - seq and here we evaluate three different normalization methods : (1) transcripts parts per million, (2) trimmed mean of m values, (3) quantile normalization. at present, transcripts parts per million (tpm) is a standard procedure to normalize rna - seq data. using this method, number of reads of a transcript / sequence resulting normalized data is reported as reads (or transcripts) per million for each sample. one of the major problems with rna - seq data is that while the total number of reads for a sample is known, the composition of the rna population is unknown. thus, tpm normalization method has its limitations for datasets with marked different rna composition. trimmed mean of m values (tmm) normalization has been suggested to remove rna compositional bias as tmm equates the overall expression levels of genes between samples by estimation of relative rna production levels or scale factors. another method in use is quantile normalization which has previously been applied for microarrays. in quantile normalization, the distribution of read counts in each lane is matched to a reference distribution defined in terms of median counts across sorted lanes. we propose two methods for inferring differential expression across two biological conditions with technical replicates, each of which yields one test statistics per gene : (i) likelihood ratio method (lrm) (casella and berger), (ii) bayesian method (bm), an extension of technique due to audic and claverie for more than 2 replicates within a condition. let xj denotes the observed number of reads mapped to a gene in replicate j(j = 1,2, m) under condition-1 and let yj denotes the observed number of reads mapped to a gene in replicate j(j = 1,2, n) for condition-2. since the number of reads mapped to a gene represents a small (less than 5%) fraction of the total number of reads obtained after sequencing, we assume xj and yj to follow independent poisson distribution with different parameters. methods are detailed for a gene and the same need to be applied for all genes. for condition-1, j=1,2,,m, where j denotes the true expression level of gene in replicate j. as xj 's occur independently, the likelihood function of x1, x2, xm is given by (2)l = l(1,2,,xm)=j=1mejjxjxj!. to identify genes with similar read count across replicates, we test the null hypothesis h0 : 1 = 2 = = m = (say,) against the alternative h1 : i j for some i j. under h0, the maximum likelihood estimate (mle) of is given by (3)^=j=1mxjm = xm, where x = j=1xj and under h1, the mle of j is given by (4)^j = xj, j=1,2,,m. the likelihood ratio for testing 1 = 2 = = m = (say,) for condition-1 is given by (5)1=sup h0 lsup h1 l=(x / m)xj=1m(xj)xj=(x)xmxj=1m(xj)xj. similarly, for condition-2, yj follows poisson distribution with parameters j, j = 1,2,, n. as derived above, the likelihood ratio for testing 1 = 2 =, n = (say,) for condition-2 is given by (6)2=(y)ynyj=1n(yj)yj, where y = j=1yj. for identifying differentially expressed genes across the two conditions, for a gene, define x = j=1xj and y = j=1yj to be independent poisson random variables with parameters m and n, respectively, and test if. the joint likelihood of the two conditions is given as (7)l = l(, x1,x2,,xm;y1,y2,,yn)=j=1mexjxj!j=1neyjyj !, and the unconditional mle 's of and are given by x / m and y / n, respectively, mle of under the hypothesis = is (x + y)/(m + n). the likelihood ratio for testing = is given by (8)3=(mm+n)x(nm+n)y(x+y)x+yxxyy. we reject the null hypothesis for the small values of the statistic, 3. back in 1997, the method of audic and claverie was used to establish the probability distribution governing the occurrence of the same rare event in repeated experiments and was applied for the analysis of digital gene expression profiles. it was then described for only 2 replicates which we have attempted to extend to 3 or more replicates and apply to rna - seq data. as defined before, x1 represents the number of reads mapped to a gene in replicate 1 of the condition-1 and follows poisson distribution (9)p(x1)=ex1x1 !, where denotes the actual number of reads mapped to the gene. let x2 represents the number of reads mapped to a gene in replicate 2 of the condition-1. then, (10)p(x2 x1)=0p(d= x1)p(x2 d=)d, where p(d = x1) in above equation is the posterior probability of given x1 occurrences of a gene in an experiment and p(x2d =) = e/x2 ! is the probability of drawing x2 observations from poisson distribution with parameter. using bayes theorem, vncio. showed that, (11)p(x2 x1)=(x1+x2)!x1!x2!2(x1+x2 + 1), where the prior distribution p(d =) is taken as uniform distribution over the interval [0, ]. we extended the above results when the condition is replicated thrice and (12)p(x3 x1,x2)=0p(d= x1,x2)p(x3 d=)d. from bayes theorem, (13)p(d= x1,x2)=p(x1,x2 d=)p(d=)0p(x1,x2 d=)p(d=)d. again, using uniform prior for, we get (14)p(d= x1,x2)=2x1+x2 + 1e2x1+x2(x1+x2) !, which is a gamma random variable with scale parameter 2. this gives (15)p(x3 x1,x2)=2x1+x2 + 1(x1+x2+x3)!(x1+x2)!x3!3x1+x2+x3 + 1. therefore, (16)p(x3 x1,x2)p(x2 x1)=(x1+x2+x3)!x1!x2!x3!3x1+x2+x3 + 1. similarly, if the condition is replicated m times, we consider the following probability. (17)p~(x1,x2,,xp,,xm) = p(xm x1,x2,,xp, x1) = (x1+x2++xp++xm)!x1!x2!xm!mx1+x2++xm+1. in order to find genes with similar read counts within a condition, we find two numbers a, b such that (18)xp=0ap~(x1,x2,,xp,,xm)=,xp = bp~(x1,x2,,xp,,xm)=. equation (18) implies that if the observation xm of the mth replicate lies in the interval [a, b ] then we conclude with probability (1 2) that there are no systematic differences between the replicates. similarly, the results can be derived for n replicates of a gene in condition-2 (i.e., yj, j = 1,2,, n). for identifying differential expression across two conditions, define x1 = j=1xj, y1 = j=1yj to be independent poisson random variables with parameters m and n, respectively, and use (11). under the bayesian method, we can only identify genes that are different across two conditions if the number of replicates for the two conditions are the same (i.e., m = n). we assessed the variability within technical replicates using dataset 1 which comprises of liver and kidney tissue, each with five technical replicates and 17708 ensembl transcripts. boxplots of unnormalized data from both liver and kidney samples are shown in figure 1(a). we evaluate this variability statistically using a likelihood ratio method detailed in the previous section. the analysis was performed at 1%, 2.5%, 5%, and 10% levels while considering two, three, four, and five replicates on the un - normalized data from kidney. as shown in table 1, there is a decrease in the percentage of genes with similar counts as the number of replicates increases, which is expected ; however, the decreases is only marginal. the percentage of genes with similar counts also decrease with the increase in the levels. thus, dataset 1 is highly reproducible with few systematic differences among the replicates. we assess the impact of all three normalization methods using the likelihood ratio method at 1%, 2.5%, 5%, and 10% levels. we used data from liver tissue with five replicates without normalization, with tmm, quantile, and tpm normalization. it can be seen from table 2 that the percentage of genes with similar counts increased after tmm and quantile normalization and, thus, reduction in variability after normalization. a gain of 2% is achieved after tmm or quantile normalization while the performance of tpm normalization was found to be poor. figures 1, 2, and 3 represents boxplots of un - normalized, normalized after tpm, tmm and quantile for datasets 1, 2, and 3, respectively. we compared the two proposed methods for inferring differentially expressed (de) genes : likelihood ratio method and bayesian method on datasets 2 and 3. for comparison between any two biological conditions, the read count values from the conditions can be categorized under three categories. (2) when one sample has zero or low counts and a reasonable count in the other. this is an interesting biological phenomena where a gene is not expressed in one of the conditions. for the quantile normalized normal versus hl60 data (dataset 2), 19 mirnas are absent in either of the two samples and present with a reasonable count for the other and 155 mirnas were present with read count of at least 5 in both the samples. using the likelihood ratio method at 1% level of significance, all 19 mirnas absent in either of the two conditions were identified as de and out of the 155 mirnas, 57 were identified as de. using the bayesian method at 1% level of significance, mirnas absent in either of the two conditions were also identified as de and out of the 155 mirnas, 58 were identified as de. nearly same mirnas, except one, were identified as de using both the methods. we also analyzed this dataset using deseq and edger and they did not identify mirnas absent in one of the two conditions. of the 155 mirnas, deseq identified 3 mirnas as de with p value 0.01 and edger identified 4 mirnas as de with p value 0.01. see additional file 1, 2, and 3 in supplementary material available online at doi:10.5402/2012/817508 for detailed analysis and table 3 for a systematic comparison between methods for all three datasets. from additional file 1 in supplementary material, it is clear that likelihood ratio method and bayesian method give very similar results for normal versus hl60 and normal versus k562 datasets (dataset 2). both methods identified all mirnas previously identified as differentially expressed in vaz.. however, deseq and edger could not identify most of the de mirnas reported in vaz.. few mirnas experimentally verified using rnase protection assay (rpa) and real - time rt - pcr in vaz. in addition, we also identified differential expression of mir-181a family of hl60, previously reported in. for globin reduced versus non - reduced data (dataset 3), likelihood method reports 2513 significant genes at 1% level of significance, bayesian method reports 2344 at 1% level of significance, deseq reports 1505 with p value 0.01 and edger reports 2987 genes with p value 0.01. from these numbers alone, it is difficult to comment on the performance of any method. figure 4 demonstrates the distribution of expression strength of the significant gene list obtained from likelihood ratio method, deseq, edger, and all genes. one would expect the distribution of the significant gene lists to roughly follow the expression strength distribution for all genes. for likelihood ratio method and deseq, edger seems to be identifying genes from all expression strengths and thus not reflection biolog but the rigidity of its error models. few genes experimentally verified in mastrokolias. using qpcr (i.e., cxorf25, hba1, hba2, hbd, hbb) were obtained with high fold values in our analysis. table 4 shows how a confidence interval was evaluated in bayesian method for quantile normalized normal - hl60 data. hsa - let-7 g has a read count of 15117 in normal (condition-1) and 6236 in hl60 (condition-2). using (18), for one replicate, we estimated the lower and upper bound of the confidence interval around normal as 1386 and 1644. read count of 6236 for hsa - let-7 g in hl60 lies well outside the estimated confidence interval (1386, 1644). thus, the read count in normal and hl60 are significantly different and reported in table 3 as t(i.e. we assessed three different types of normalizations and showed that though illumina data is highly replicable before normalization, normalization further reduces the technical variability, likelihood ratio method was used to statistically evaluate variation across replicates. we also presented two methods for finding differentially expressed genes for rna - seq data with or without replicates, likelihood ratio method is a general method that does not impose any restriction on the equality of the number of replicates across the two conditions. bayesian method on the other hand can only be applied if there is equality on the number of replicates for the two conditions being compared. the performance of both the methods was compared to deseq, edger. for small rna dataset, likelihood ratio method and bayesian method perform similarly but better than edger and deseq. for dataset 3, the distribution of the significant gene lists from likelihood ratio method and deseq roughly follows the expression strength distribution for all genes. however, this was not true for edger. for both likelihood ratio method and bayesian method, we assume that the underlying distribution for observed number of reads to be poisson. poisson distribution is intuitively appealing and mathematically easy to handle but with a limitation that the mean and variance of poisson random variable are the same. to avoid this, the efficiency of the proposed methods in identifying differentially expressed genes, their mathematical convenience, and simplicity should make these methods extremely useful. | rna - seq is increasingly being used for gene expression profiling. in this approach, next - generation sequencing (ngs) platforms are used for sequencing. due to highly parallel nature, millions of reads are generated in a short time and at low cost. therefore analysis of the data is a major challenge and development of statistical and computational methods is essential for drawing meaningful conclusions from this huge data. in here, we assessed three different types of normalization (transcript parts per million, trimmed mean of m values, quantile normalization) and evaluated if normalized data reduces technical variability across replicates. in addition, we also proposed two novel methods for detecting differentially expressed genes between two biological conditions : (i) likelihood ratio method, and (ii) bayesian method. our proposed methods for finding differentially expressed genes were tested on three real datasets. our methods performed at least as well as, and often better than, the existing methods for analysis of differential expression. |
renal amyloidosis is characterized by the extracellular deposition of amyloid, a proteinaceous fibrilar material, presenting positive staining of congo red, in the kidney1). primary amyloidosis is extremely rare in children and the causes of secondary amyloidosis in children include familiar mediterranean fever (fmf), rheumatoid arthritis (ra), ankylosing spondylitis, inflammatory bowel disease, chronic infection such as tuberculosis, and cystic fibrosis (cf)2). bronchiectasis in children is most commonly associated with cf in industrialized countries, although there are many etiologies for bronchiectasis unrelated to cf3). herein, we present a 13-year - old korean girl who developed secondary renal amyloidosis by non - cf related bronchiectasis. a 13-year - old girl was admitted with dyspnea due to severe pneumonia and respiratory failure. on past medical history, she developed bronchiolitis at the early age of 1 month for the first time. since that time, pneumonia and bronchiolitis recurred several times a year up to school age. when she was 10-years - old, she was referred to our department for the evaluation of abnormal infiltration of both lung fields visible on a chest x - ray. at that time surgical removal of nasal polyps due to chronic sinusitis was decided and a chest x - ray was checked as one of preoperative evaluations. however, she had no respiratory symptoms or signs and her breathing sound on auscultation was clear. several evaluations to find the causes of this abnormal infiltration were performed, especially by tuberculosis tests. but afb stain, pcr and culture of sputum and urine were all negative and a mantoux test was also negative. several months before admission, she had been also diagnosed with hypothyroidism and gastritis at another hospital. on physical examination, she had lip cyanosis and clubbing fingers. a computed tomography (ct) scan showed multifocal bronchiectasis and extensive bronchiolitis (fig. 1). in the course of the admission, she was supported by mechanical ventilation for nearly one month and by the parenteral treatment of antibiotics for pseudomonas infection proven by culture of sputum. systemic and inhaled corticosteroids were also applied for short - term period. on admission, the laboratory findings of this girl were as follows : ph 7.37 and pco2 35 mmhg on arterial blood gas analysis, white blood cell count 22,860/mm, hemoglobin 9.3 g / dl, platelet count 757,000/mm, erythrocyte sedimentation rate 83 mm / hour, c - reactive protein 11.18 mg / dl, blood urea nitrogen (bun) 4.4 mg / dl, serum creatinine 0.42 mg / dl, total protein 4.8 g / dl, and albumin 1.8 g / dl. urinalysis showed protein (+ +), occult blood (+) and urine protein during 24 hours was 2,090 mg / m2. to elucidate the cause of bronchiectasis, several additional tests were also performed. immunologic studies showed normal levels of immunoglobulin (ig) g, iga, igm and 1-antitrypsin except for a mild elevation of ige. several weeks later a sweat test performed as one of the evaluations of cf was not specific and there was no mutation of the cf transmembrane conductance regulator (cftr) gene. after confirming non - cf related bronchiectasis, a mucosal biopsy of the nasal cavity was performed to rule out primary ciliary dyskinesia and the result was normal on an electron microscopy (em). six months later after an improvement of her respiratory condition, an ultrasonogram - guided renal biopsy was performed to reveal the cause of proteinuria. on light microscopy, there were many segmental homogeneous deposits of amyloid with positive congo red staining in the glomeruli and interstitium (fig. 2). immunohistochemistry revealed positive staining of the aa amyloid and immunofluorescent microscopy showed negative staining of igg, iga, igm, c3 and fibrinogen. em showed relatively straight, non - branching, randomly arranged amyloid fibrils in the mesangium of the glomeruli and these fibrils were approximately 10 nm in diameter (fig. 3a, 3b), compatible with secondary amyloidosis. at that time, serum amyloid a was remarkably elevated (62.0 mg / l, normal range : < 8.0 mg / l). at recent follow - up (22 months after admission), bun and serum creatinine were mildly elevated (34 mg / dl and 1.2 mg / dl, respectively) and proteinuria was improved with the results of the protein (+) in dipstick and decreased spot urine protein - creatinine ratio. the repeated chest film and ct scans showed no remarkable interval change and serum amyloid a slightly decreased than before (26.9 mg / l). amyloidosis is a group of diseases characterized by extracellular deposition of insoluble fibrous amyloid proteins which can be identified in biopsy specimens both by their characteristic appearance on the em and by their ability to bind congo red. and the major sites of amyloid deposition are in kidney, heart, skin, gastrointestinal tract, and liver4). clinically evident renal involvement mainly occurs in immunoglobulin light chains in primary systemic amyloidosis (al) or amyloid a in secondary amyloidosis (aa)4). because primary amyloidosis is extremely rare in children2), secondary amyloidosis is the major pattern of renal amyloidosis during childhood. causes of secondary amyloidosis in children include fmf, ra, ankylosing spondylitis, inflammatory bowel disease, chronic infections such as tuberculosis, cf2), and chronic granulomatous disease5). although fmf is the most common cause of secondary amyloidosis in childhood6), fmf is highly prevalent in some limited areas such as the middle east and turkey1, 7). tuberculosis and other chronic infections including bronchiectasis are other leading causes of systemic amyloidosis, followed in frequency by ra in other areas, especially developing countries1). the clinical manifestations of renal amyloidosis vary with the site of involvement and most often includes asymptomatic proteinuria and nephrotic syndrome, as well as renal insufficiency1). end - stage renal disease (esrd) is the cause of death in a minority of patients. moon) reported the first case of secondary renal amyloidosis in a 12-year - old girl with juvenile rheumatoid arthritis. conditions that predispose bronchiectasis in children include cf, ciliary dyskinesia, hypogammaglobulinemia, proximal airway narrowing, and kartagener syndrome3, 9). among these etiologies, cf is the most common cause of bronchiectasis in children, especially, in industrialized countries, although there are many etiologies for bronchiectasis unrelated to cf3). however, because cf is very rare in korea, the incidence of bronchiectasis in korean children is extremely low10). lung damage occurring after lower respiratory infection is still the most common cause of bronchiectasis in developing countries and a great problem in some parts of the world11). in our patient, she had a history of recurrent respiratory infections such as pneumonia, bronchiolitis and bronchitis from infancy. therefore, it is likely that an underlying etiology of the bronchiectasis in our patient is postinfectious. development and progression of secondary amyloidosis, in general, needs the long - term continuation of primary inflammatory conditions that induce the elevation of amyloid protein as one of the acute phase reactants. it was reported that the mean duration of bronchiectasis in patients with secondary amyloidosis to cause chronic renal failure was 22 years12). therefore, it is very difficult to find patients with secondary renal amyloidosis complicated by long - standing, non - cf related bronchiectasis during childhood in korea. in the pathogenesis of secondary amyloidosis, the importance of increased serum amyloid a (saa) has been demonstrated by the correlation between saa concentration and disease course in patients with established amyloidosis13). the outcomes were variable but, among those in whom the level of saa was persistently above 50 mg / l, the amyloid load usually increased and organ function deteriorated13). actually, in our patient, her saa was highly elevated (62.0 mg / l) and this confirmed the existence of uncontrolled systemic inflammation. if untreated, aa amyloidosis is a serious disease with a significant mortality due to esrd, infection, heart failure, bowel perforation, or gastrointestinal bleeding. in a japanese study of 42 patients with aa amyloidosis associated with rheumatoid arthritis the ten - year survival was 18 percents and was adversely impacted by the presence of azotemia and/or cardiac involvement at the time of diagnosis14). successful treatment of the underlying inflammatory process can lead to stabilization of or improvement in renal function, reduction in protein excretion, and partial resolution of amyloid deposit15). therefore, the decision was made to perform more aggressive treatments to decrease the frequency of recurrent infection originating from bronchiectasis and it was believed that this treatment could ultimately put off the progression of renal amyloidosis. on the other hand, saa levels in ra are increased in both patients with and without amyloidosis and this indicates that additional factors must be involved in pathogenesis16, 17). in spite of aggressive evaluations, the cause of bronchiectasis in our patient was not revealed, but we could rule out cf and ciliary dyskinesia which are major causes of bronchiectasis by several evaluations such as sweat test, study of cftr gene and mucosal biopsy on nasal cavity. to our knowledge, this report is the first case of secondary renal amyloidosis induced by non - cf related bronchiectasis in korean children. | a 13-year - old girl was diagnosed with non - cystic fibrosis (cf)-related multifocal bronchiectasis accompanied by nephrotic - range proteinuria of unknown cause. on renal biopsy, there were many segmental homogeneous deposits of amyloid tissue with positive congo red staining in the glomeruli and interstitium. on electron microscopy, relatively straight, non - branching, randomly arranged amyloid fibrils were showed in the mesangium of the glomeruli. these fibrils were approximately 10 nm in diameter, compatible with secondary amyloidosis. her level of serum amyloid a was remarkably elevated. to our knowledge, this girl is the first case of secondary renal amyloidosis induced by bronchiectasis in korean children. |
during april 928, 2007, five persons became ill and died within a few days at village belechuapara, nadia district, west bengal, india, which borders bangladesh. the index case - patient (case - patient 1) was a 35-year - old male farmer addicted to country liquor derived from palm juice. hundreds of bats were observed hanging from the trees around his residence, which strongly suggested association with the infection of the index case - patient and possibility of contamination of the liquor with bat excreta or secretions. three patients were close relatives of case - patient 1 : his 25-year - old brother (case - patient 2), his 30-year - old wife (case - patient 3), and his 39-year - old brother - in - law (case - patient 4). they became ill 12, 14, and 14 days, respectively, after contact with case - patient 1. in another person, a 28-year - old man (case - patient 5) who collected blood samples from and performed a computed tomography scan of the brain of case - patient 1, symptoms developed 12 days after contact brain and lung tissues from case - patient 3, cerebrospinal fluid (csf) from case - patient 4, and urine and csf from case - patient 5 were collected. blood samples were obtained from case - patients 4 and 5 and from 34 asymptomatic contacts from the village. serum samples from these persons were tested for immunoglobulin (ig) m and igg antibodies to niv (igm / igg anti - niv) with elisa by using reagents provided by the centers for disease control and prevention (atlanta, ga, usa). to detect niv rna, urine (250 l), csf (100 l), or autopsied brain or lung tissue (100 mg) were used, and rna was extracted by using trizol ls and trizol reagents (invitrogen life technologies, carlsbad, ca, usa). nested reverse transcription pcr (rt - pcr) was conducted by using nucleocapsid (n) gene based primers (8). the full - length genomic sequence was obtained from the lung of case - patient 3 by using 36 sets of primers (table a1), superscript ii rnase reverse transcriptase for reverse transcription (invitrogen), and pfx polymerase for amplification (invitrogen). the pcr products of predicted molecular size were gel eluted (qiaquick pcr purification kit ; qiagen, hilden, germany) and sequenced by using bigdye terminator cycle sequencing ready reaction kit (applied biosystems, foster city, ca, usa) and an automatic sequencer (abi prism 3100 genetic analyzer ; applied biosystems). phylogenetic analysis was conducted by using partial n gene and full niv genome sequences with the kimura 2-parameter distance model and neighbor - joining method available in mega version 3.1 software (www.megasoftware.net). the reliability of phylogenetic groupings was evaluated by the bootstrap test with 1,000 bootstrap replications. patients signs and symptoms included high fever (103f105f [39.4c49.6c ]) with and without chills, severe occipital headache, nausea, vomiting, respiratory distress, pain in calf muscles, slurred speech, twitching of facial muscles, altered sensorium, (focal) convulsions, unconsciousness, coma, and death. the first 3 case - patients died within 23 days after symptom onset ; case - patients 4 and 5 died after 5 and 6 days, respectively. results of serologic tests for malaria parasite, typhoid, anti - dengue igm, hiv, and hepatitis b surface antigen were negative. alanine aminotransferase, aspartate aminotransferase, creatine phosphokinase, and c - reactive protein were elevated. blood gas analysis in case - patient 4 (case - patient 5 values in parentheses) showed oxygen saturation 49.4% (71%), po2 36.1 mm hg (44.8 mm hg), pco2 44.4 mm hg (44.1 mm hg), hco3 15.7 mmol / l (19.1 mmol / l), and ph 7.166 (7.255). lumbar puncture of case - patient 5 showed opening pressure within reference range (1 drop / second), 2 cells / cm ; all cells observed were lymphocytes. chest radiograph indicated pulmonary edema, which suggested acute respiratory distress syndrome. at the time of admission, computed tomography and magnetic resonance imaging scans of the brain showed no abnormality. serum samples from case - patients 4 and 5 were positive for igm anti - niv. of the clinical samples screened, brain and lung tissues of case - patient 3, csf of case - patient 4, and urine of case - patient 5 were niv rna positive. of the 34 asymptomatic contacts, 1 was positive for igg anti - niv and negative for igm anti - niv and did not report any major illness in the past. this positivity may reflect a previous subclinical infection or cross - reactivity in elisa needing further follow - up. before this report partial n gene sequences confirmed niv in the clinical specimens from all 3 case - patients. phylogenetic analysis showed that similar to findings from the 2001 outbreak study (8), viruses from bangladesh and india clustered and diverged from the viruses from malaysia. fj513078) was closer to the virus from bangladesh (figure, panel b), with 99.2% (151 nt substitutions) and 99.80% (17 aa substitutions) identity at nucleotide and amino acid levels respectively. of the 151 nt substitutions, 9 occurred in the n open reading frame (orf),11 in the phosphoprotein orf, 8 in the matrix orf, 11 in the fusion glycoprotein orf, 7 in the attachment protein orf, and 47 in the large polymerase orf. fifty - eight substitutions occurred in nontranslated regions at the beginning and the end of each orf. the intergenic sequences between gene boundaries were highly conserved in the isolate from india, compared with the isolate from bangladesh, which showed 1 change (gaa to uaa) between the attachment protein and large polymerase genes. a) phylogenetic analysis based on partial nucleocapsid (n) gene nucleotide sequences (159 nt, according to nipah virus [niv ] bangladesh sequence, genbank accession no. ay988601, 168327 nt) of the 4 nivs sequenced during this study (boldface). five sequences of the viruses from siliguri (8) and from representative niv sequences obtained from genbank indicated by the respective accession numbers. b) full genome based phylogenetic analysis of the niv sequenced from the lung tissue of a patient (boldface). the table compares amino acid substitutions in the different regions of the genome of the isolate from india with those of the viruses from bangladesh and malaysia. of the 17 aa substitutions, 7 were unique to the isolate from india, and 10 were similar to the isolates from malaysia. overall, however, the isolate from india was closer to the isolate from bangladesh, although distinct differences were observed. genbank accession numbers of isolates examined : india (fj513078), bangladesh (ay988601), and malaysia (ay029767,ay029768, and aj564623). boldface indicates unique amino acids in the isolate from india. to our knowledge, this is the second report of an niv outbreak in india, identified within 1 week of the investigation. the first outbreak affected mainly hospital staff or persons visiting hospitalized patients ; the 74% case - fatality rate strongly suggested person - to - person transmission (8). both outbreaks (2001 and 2007) occurred in the state of west bengal bordering bangladesh wherein several outbreaks of the disease have been reported (7,913). however, fruit bats from west bengal have not been screened for evidence of niv infection. this state needs to create awareness about niv and obligatory testing of suspected case - patients. niv caused an intrafamilial outbreak with a 100% case - fatality rate, which confirmed person - to - person transmission. the niv strains from india and bangladesh were closer than the malaysian viruses. although the outbreaks occurred in neighboring geographic areas, niv outbreaks in bangladesh and india were not caused by the same virus strain or by spillover. | an intrafamilial outbreak in west bengal, india, involving 5 deaths and person - to - person transmission was attributed to nipah virus. full - genome sequence of nipah virus (18,252 nt) amplified from lung tissue showed 99.2% nt and 99.8% aa identity with the bangladesh-2004 isolate, suggesting a common source of the virus. |
pulmonary alveolar proteinosis (pap) was first described by rosen. in 1958 the clinical course of the disease is variable, ranging from spontaneous resolution to death due to pneumonia or respiratory failure. pulmonary alveolar proteinosis occurs in three clinically distinct forms : congenital, secondary, and idiopathic (acquired). congenital pap is a heterogeneous group of disorders (2) caused by mutations in the genes encoding surfactant protein b, c or c chain of the receptor for granulocyte - macrophage colony stimulating factor (gm - csf) (3, 4). secondary pap occurs as a consequence of any one of a heterogeneous group of underlying clinical conditions (hematologic cancers, pharmacologic immunosuppression, inhalation of inorganic dust or toxic fumes, and certain infections) that impair alveolar macrophage function, resulting in surfactant accumulation (5). idiopathic (acquired) pap is a disorder of unknown etiology that is thought to represent approximately 90% of pap cases. the prevalence of idiopathic pulmonary alveolar proteinosis has been estimated to be 0.37 per 100,000 persons (6 - 9). the median age at the time of diagnosis is 39 yr ; most patients are men, and 72% have a history of smoking (10). recent observations in transgenic mice and humans, however, have provided important clues about its pathogenesis. the first real clue was provided by the discovery that mice deficient in gm - csf develop a lung phenotype that is biochemically, histologically, physiologically, and ultrastructurally indistinguishable from idiopathic pap (11, 12). the observation of pap in gm - csf - deficient mice was quickly followed by the evaluation of gm - csf therapy, first in a single patient and then in several small series of patients (13 - 16). gm - csf deficiency has not been reported in humans (17, 18). however, a second vital pathogenic clue was the observation that primary pap is specifically and strongly associated with very high levels of gm - csf autoantibodies (19). so far, most reports have focused on pap patients from western countries, but reports on asian populations are extremely rare, with only one report based on a japanese population (20). the first case in korea was reported in 1987 (21) and kim and colleagues reviewed twelve cases in 1999 (22). we reviewed the clinical features, treatment outcomes, and prognosis of patients with idiopathic pap in korea. the data were collected from 10 clinical research centers in korea (college of medicine in university of ulsan, seoul national university, yonsei university, sungkyunkwan university, korea university, kyungpook national university, soonchunhyang university, gachon university, hallym university, and inha university). patients with pap were identified by review of the korean interstitial lung disease study group. the medical records of eligible patients were reviewed by one investigator of each institution, and data were extracted using a standard data collection instrument. the diagnosis of pap was confirmed by a physician diagnosis and pathologic specimens were obtained by video - assisted thoracoscopic surgery or transbronchial lung biopsy with bronchoalveolar lavage (bal). the symptoms and signs present at the initial assessment at each institution were used as data. arterial blood gas analysis, spirometry, and lung volume measurements were estimated at diagnosis and if possible, estimated again after whole lung lavage. eighty six percent of patients were symptomatic at diagnosis and the most common symptom at presentation was dyspnea, and followed by cough (table 2). the most prominent finding on physical examination was crackles in 50% of patients, with cyanosis present in one patient. the chest radiographs for all but one patient showed bilateral air - space disease with an ill - defined nodular or confluent pattern. high resolution computed tomography showed patchy ground - glass opacifications with superimposed interlobular septal thickening in all patients. on pulmonary function testing, a mild restrictive ventilatory defect was common, the mean percent predicted forced vital capacity (fvc) was slightly decreased at 77%, the mean percent predicted forced expiratory volume in one second (fev1) was normal at 84.6%, but the mean percent predicted total lung capacity (tlc) of 81% was not decreased. however, the percent predicted diffusing capacity of the lung for carbon monoxide (dlco) was disproportionately reduced (meansd ; 67.731.6) among 29 patients. arterial blood gas analysis showed hypoxemia with a mean room air partial pressure of oxygen (pao2) of 69.014.2 mmhg and a mean alveolar arterial o2 gradient ; d(a - a)o2 of 36.04.4 mmhg. the serum lactate dehydrogenase (ldh) level was elevated with a mean value of 455.4183.1 iu / l (range 153 to 834 iu / l). transbronchial lung biopsy was performed in 35 patients (92%) and video - assisted thoracoscopic surgery was performed in 16 patients (42%). diagnosis was established by transbronchial lung biopsy with bal or surgical lung biopsy. on light microscopic examination, we observed the characteristic finding of alveoli filled with a granular, eosinophilic material that stained with periodic acid - schiff, and a well - preserved alveolar architecture. whole lung lavage was indicated for patients who presented with dyspnea or hypoxemia and deteriorated chest radiography. whole lung lavage was performed in 26 patients (68%), of whom 11 patients underwent another lavage. we defined the recurrence as significant progression of respiratory symptoms attributable to pap or the application of further therapeutic interventions such as repeated lavage. we analyzed oxygenation / hypoxemia, spirometric measurements, lung volume parameters, and radiologic findings before and after whole lung lavage (table 3). oxygenation improved dramatically after therapeutic lavage, and hypoxemia was corrected in 16 of 17 patients for whom data were available. d(a - a)o2 also improved after lung lavage. there was no significant difference in the mean fvc before and after whole lung lavage (p=0.388), as analyzed using the wilcoxon signed rank test. fev1 was increased in six patients and decreased in six patients. the difference in fev1 before and after whole lung lavage was not statistically significant (p=0.609). tlc showed a slight improvement after lavage, but the difference before and after lavage was not significant (p=0.089). using radiologic evaluation with chest radiography or chest computed tomography, we found that 22 of 26 patients (85%) had improved after whole lung lavage therapy. radiologic studies after lavage was unavailable in 2 patients, no changes in 2 patients. the mean follow - up period was 3 yr (range, 0.04 to 11.5 yr). at the end of the study, 20 patients were alive, 2 patients had died, and 16 patients were no longer available for follow - up. one patient died soon after the whole lung lavage and the other patient died of advanced gastric cancer. the definition of disease recurrence varied between reports, but significant progression of respiratory symptoms due to pap and the application of further therapeutic lavage were considered as recurrences. pap recurred in 4 out of 24 patients (16.7%) during the follow - up period. of the four patients with a recurrence of pap, three underwent another whole lung lavage and the fourth patient was closely observed without lavage. pap was first recognized in 1958 by rosen and colleagues (1). since then seymour and presneill (10) analyzed 410 identifiable separate cases of pap in 241 separate initial publications ; most of these cases involved patients from western countries. asamoto and colleagues (20) reported on the clinical manifestations of pap in a japanese population. the japanese report was unique because it focused on an asian population with idiopathic pap, but it was different from the retrospective meta - analysis by seymour and colleagues (10) in several respects. first, two - thirds of the pathologic diagnoses were established by bronchoscopic biopsy instead of surgical lung biopsy. further, it reported that the therapeutic outcomes of whole lung lavage were superior to those of other studies (table 4). before our study, however, this was the only data available on idiopathic pap in asian population. in this study, we retrospectively reviewed 38 patients with idiopathic pap in korea. the median age at diagnosis was 52 yr for both genders, which is in contrast to the distribution of patients from the report by seymour and presneill (10) who reported a median age of 39 yr and a different median age in men and women (table 4). the median age in our study was close to that of the recent report on autoimmune pap in japan by inoue and colleagues (23). recently, the use of surgical lung biopsy has decreased (24, 25) because a diagnosis of pap can be established in approximately 75% of clinically suspected cases based on the typical findings of a milky fluid from the bal (25) that contains large and foamy alveolar macrophages or monocyte - like alveolar macrophage and an increased numbers of lymphocytes (26, 27). there are relatively few inflammatory cells of other cell types, unless superinfection is present. there is also a large amount of amorphous, lipoproteinaceous material that is characteristically eosinophilic, granular, and positive with a periodic acid - schiff stain (25, 27). in this study, pathologic diagnosis was established by surgical lung biopsy (42%) or transbronchial biopsy with bal (58%). milky fluid on bal and consistent transbronchial lung biopsy specimens provided diagnosis, such as surgical lung biopsy. pulmonary function test at diagnosis showed results that were similar to those of previous studies : a restrictive defect, with a disproportionate reduction in diffusing capacity, a slightly decreased mean fvc of 77.3% and a moderately decreased dlco of 67.7%. arterial blood gas analysis at the initial presentation also showed the same results ; pao2 was decreased to 69.0 mmhg and d(a - a)o2 was increased to 35.3 mmhg at the initial presentation. the efficacy of whole lung lavage was evaluated with radiologic findings and pulmonary function tests. after the therapeutic lavage, oxygenation parameters such as pao2 and d(a - a)o2 improved significantly in comparison to the initial examinations (fig. fvc and tlc improved slightly, but this improvement was not statistically significant (fig. they described the patients as either having stable persistent symptoms, progressive deterioration in their process, or spontaneous improvement. kariman and colleagues (28) reported that spontaneous resolution occurred in 24% of a series of 23 patients. seymour and presneill (10) reported that 24 of 303 patients (7.9%) showed a significant degree of spontaneous improvement. the reason for the variation in the amount of spontaneous resolution reported by different studies and authors may be because authors used different individual criteria. in our study, we defined spontaneous resolution as radiographic and symptomatic improvement until follow - up. based on these criteria, 5 of 38 patients (13%) showed spontaneous resolution. in the survival analysis, there was no difference between the lavage and no lavage groups (fig. the mean follow - up period from the time of whole lung lavage of 3 yr was too short to compare the survival between the lavage and no lavage groups. moreover, one patient died soon after therapeutic lavage in the lavage group and one patient died of stomach cancer in the no lavage group, but neither death was directly related to pap. this study has several limitations ; it was a retrospective study, the follow - up period was too short to analyze survival outcomes, and the smoking history of the patients was unavailable. the clinical features and pulmonary parameters of korean patients with idiopathic pap are consistent with reports in other published studies. | idiopathic pulmonary alveolar proteinosis (pap) is a rare disorder in which lipoproteinaceous material accumulates within alveoli. there were few reports on asian populations with idiopathic pap. we retrospectively reviewed 38 patients with idiopathic pap in korea. we assessed clinical features, therapeutic efficacy and outcomes of whole lung lavage in patients with idiopathic pap. the mean age at diagnosis was 52 yr. eighty six percent of patients were symptomatic at diagnosis. dyspnea and cough were the most common symptoms. crackles were the most common physical examination finding. on pulmonary function test, a mild restrictive ventilatory defect was common, with a predicted mean forced vital capacity (fvc) of 77% and forced expiratory volume in one second (fev1) of 84.6%. diffusing capacity was disproportionately reduced at 67.7%. arterial blood gas analysis revealed hypoxemia with a decreased pao2 of 69.0 mmhg and an increased d(a - a)o2 of 34.2 mmhg. after whole lung lavage, pao2, d(a - a)o2 and dlco were significantly improved, but fvc and total lung capacity (tlc) were not different. this is the first multicenter study to analyze 38 korean patients with idiopathic pap. the clinical features and pulmonary parameters of korean patients with idiopathic pap are consistent with reports in other published studies. whole lung lavage appears to be the most effective form of treatment. |
most stroke survivors experience changes in the level of consciousness, loss of motor and sensory functions, language disorder, and loss of cognitive and perceptual abilities. in addition, performance of activities of daily living becomes limited and participation in social activities decreases1, 2. in particular, functional activities are limited by stroke - induced impairment of movement, including balance, an important performance factor in functional activities3. in general, the stability of the body is achieved by actively adjusting physical stability and reacting to gravity, the support surface, visual perception, and the external environment through the interaction of various sensory and motor neurons4, 5. a reduction in balance ability leads to a decrease in the weight - bearing ratio of the lower limbs, or to paralysis, and acts as a factor in abnormal gait, affecting gait characteristics such as gait velocity, stride length, and cadence6, 7. hence, gait recovery is one of the most important goals in the rehabilitation of stroke patients9. the trunk muscles play an important role in functional activities such as balance and gait10, 11. they participate in voluntary trunk movement as agonists and synergists12, automatically responding to unpredictable perturbations13, and preparing for instability induced by upper and lower limb movements. they also play a role in adapting the trunk in space so that proper movement can be achieved14. however, stroke patients are unable to keep their weight on both feet evenly, owing to loss of trunk muscle strength and trunk control ability15, and have difficulties in performing functional activities because of a decrease in balance ability11. therefore, improvement of trunk control ability can result in balance and functional recovery of the extremities, and predict functional improvement in activities of daily living. training in a sitting position was reported to be effective at improving trunk control ability16, 17. in the study by encheff., 10 weeks horseback riding therapy was performed by 11 children whose mobility was decreased due to nerve damage. following the therapy, the position of the hip joint in the sagittal plane was greatly improved during the early stance and pre - swing phases. moreover, the trunk became more upright, and in consequence, postural adjustment in walking improved18. in the study by silkwood - sherer, 15 multiple sclerosis patients performed horseback riding therapy once a week for 14 weeks, and the outcome was assessed using the berg balance scale (bbs) and performance - oriented mobility assessment (poma). the efficacy of horseback riding therapy for the improvement of balance ability was confirmed, with increases in the bbs and poma scores of 9.15 and 10.38 points, respectively19. in addition, 20 stroke patients performed a 16-week horseback riding therapy, and improvements in their fugl - meyer assessment scale lower limbs and bbs scores were observed20. however, it is a fact that horseback riding therapy is difficult for many people to perform and its outcomes are impossible to generalize because of the high costs and difficulty of creating an environment for horseback riding therapy, issues which outweigh its benefits. the horseback riding simulator accurately reproduces the movements of a horse, has the same physiological effect as horseback riding therapy, and activates muscles for postural maintenance ; it also eliminates many of the disadvantages of the horseback riding therapy21, 22. present study aimed to examine the impact of horseback riding therapy program on the trunk balance and gait of chronic stroke patients, using a horseback riding simulator. the subjects of this study were 20 patients hospitalized for the treatment of stroke in 2 hospitals located in south korea (table 1table 1. general characteristics of subjectsgenderage (years)post - stroke duration (month)height (cm)weight (kg)male : 10, female : 763.9 8.723. 6 2.8165.7 2.964.0 4.3). all the subjects and their guardians voluntarily agreed to participate in the study after receiving explanations regarding the purpose and procedures of the experiment, and signed an informed consent statement before its start. the criteria for selecting the subjects were as follows : more than 6 months since the onset of non - traumatic and unilateral stroke, a brunnstrom stage higher than 4, a functional ambulation category (fac) higher than stage 3, no visual or hearing loss, and a mini - mental state examination - k score of 21 or higher. patients with cardiovascular diseases, uncontrolled diabetes, psychiatric problems, and bilateral stroke were excluded from the experiment. to assess the static and dynamic balance abilities in a sitting position and trunk coordination ability, we made assessments of the trunk impairment scale (tis) in 3 replicates and recorded the highest score28. the tis score has a maximum of 23 points, and higher scores are given for better trunk performance. a balance assessment device (biorescue, rm ingenierie, france), consisting of a force plate equipped with sensors, was used for static balance assessment in a standing position. the subjects stood with their feet set apart at approximately 30 degrees on the force plate, and a description was provided by an image on the monitor installed in front of the subjects. distance (cm), and velocity (cm / s) of body sway were measured while maintaining standing with the eyes open and closed for 30 seconds each. the mean value of the measurements from 3 replicates was calculated. to assess gait ability, we used the functional gait assessment (fga)24 and a gait analyzer (gaitrite, cir systems inc., the functional gait assessment, 10 items were measured on walkway, which was 6 m long and 30 cm wide and marked every 1.5 m. each item was scored from 0 to 4, with overall scores ranging from 0 to 30. in the gait analysis, velocity, cadence, stride length, and double limb support were measured when he subjects walked at a comfortable speed on the sensor - equipped electronic gait plate, which was 5 m long, 60 cm wide, and 0.6 cm high. the collected information was processed using the gaitrite gold version 3.2b software. to exclude acceleration and deceleration artifacts, data were collected 2 m from the start until 2 m from the end of the gait plate27. in the gait measurement, the mean value was calculated of the measurements obtained when subjects walked over gait plate 3 times. the simulated horseback riding therapy was performed for 30 minutes, 5 times a week for 6 weeks. the horseback riding simulator used for this experiment exactly reproduces the movement of the saddle and has speeds adjustable to 9 levels, ranging from 1.4 to 3.6 seconds / cycle (joba eu6414, national, ltd., japan). for the safety of the subjects, a frame was set to install a safety belt, and a physical therapist observed the patients while standing by their affected side. the 30-minute intervention consisted of a 5-minute warm - up, 20-minute horseback riding simulation training, and 5-minute cool - down. in the warm - up, the patients were asked to load their lower limbs in a sitting position and perform a turn task, looking back. the levels of load and turn were gradually increased. in the cool - down, these exercises were performed at levels ranging from fairly light (11) to somewhat hard (13) on ratings of perceived exertion23. the kolmogorov - smirnov test was used to test the data normality, and the paired t - test was used to compare outcome measures between before and after the training. the changes in trunk balance ability were determined based on the tis scores and pre- and post - experimental values of the sway area, distance, and velocity, with the eyes open and closed (table 2table 2. changes in trunk balance measured by the tis and balance measuring deviceparameterpre - testpost - testtis10.82 2.2114.17 2.48biorescue- eosway area (cm)129.16 8.50126.37 7.25sway length (mm)51.03 4.7446.55 8.13sway speed (cm / s)1.77 0.581.51 0.54biorescue- ecsway area (cm)214.05 5.83211.17 5.79sway length (mm)79.68 2.8076.56 2.74sway speed (cm / s)2.84 0.272.50 0.33tis : trunk impairment scale, eo : eyes open, ec : eyes close, p - value < 0.05, paired t - test). significant the differences in the tis scores were observed between before and after training : 10.82 2.21 points and 14.17 2.48 points (p < 0.05). moreover, with the eyes open, significant differences in sway area, distance, and velocity were found between before and after training, 129.16 8.50 mm and 126.37 7.25 mm, 51.03 4.74 cm and 46.55 8.13 cm, and 1.77 0.58 cm / s and 1.51 0.54 cm / s, respectively (p < 0.05) ; whereas with eyes closed, significant differences were observed between before and after training of 214.05 5.83 mm and 211.17 5.79 mm, 79.68 2.80 cm and 76.56 2.74 cm, and 2.84 0.27 cm / s and 2.50 0.33 cm / s, respectively (p < 0.05). tis : trunk impairment scale, eo : eyes open, ec : eyes close, p - value < 0.05, paired t - test gait ability was examined by measuring changes in fga score, gait velocity, cadence, stride length of the affected and unaffected sides, and double limb support of the affected and unaffected sides between before and after training. significant differences were found in fga score, 16.35 2.17 points and 19.94 2.27 points (p < 0.05) ; gait velocity, 39.80 14.75 cm / s and 49.73 18.69 cm / s ; cadence, 77.90 12.97 steps / min and 82.25 13.68 steps / min ; stride lengths of the affected and unaffected sides, 60.32 17.19 cm and 66.12 16.23 cm, and 59.15 17.06 cm and 64.06 17.39 cm ; and double limb support of the affected and unaffected sides, 55.27 13.81% and 47.84 11.36%, and 54.00 13.07% and 49.95 13.19% (p changes in gait measured by the fga and gait analyzerparameterpre - testpost - testfga16.35 2.1719.94 2.27gaitritevelocity (cm / s)39.80 14.7549.73 18.69cadence (steps / min)77.90 12.9782.25 13.68stride (affected) (cm)60.32 17.1966.12 16.23stride (non - affected) (cm)59.15 17.0664.06 17.39double support (%) 55.27 13.8147.84 11.36double support (non) (%) 54.00 13.0749.95 13.19fga : functional gait assessment, p - value < 0.05, paired t - test). fga : functional gait assessment, p - value < 0.05, paired t - test a decrease in trunk function due to stroke affects balance adjustment and gait, and leads to functional changes that are constraints on social participation. therefore, various approaches to the assessment and treatment of trunk control performance have been developed for stroke patients, because both are regarded as important elements in the rehabilitation of stroke patients14,16,17. the present study investigated the effects of a 6-week horseback riding simulation training on trunk balance of stroke patients. as a result of the training, the trunk control ability in a sitting position improved, as determined by the tis. in a study by silva., not only the postural control ability in a seated position but also the motor function of children with cerebral palsy was improved after horseback riding simulation training. furthermore, the subjects reported in a quality - of - life assessment that they were more satisfied because the training was more interesting and fun than their previous treatment21. in another study, herrero. conducted horseback riding simulation training, once a week for 10 weeks, for 38 children with cerebral palsy, and reported their sitting balance improved (effect size, 0.36 ; 95% confidence interval [ci ], 0.010.71). in particular, the training had a major impact on the group with severe disabilities (effect size, 0.80 ; 95% ci, 0.131.47). in the evaluation of their balance ability in a standing position, decreases were observed in sway area, distance, and velocity of the center of pressure with the eyes open and closed29. yasuhiro. also conducted horseback riding simulation training, twice a week for 12 weeks, for 23 elderly people aged 65 years and older, and reported their performance of the subjects in the one - leg standing with eyes open task of the functional reach test improved28. in the functional gait assessment of our present study, changes in gait ability and improvements in gait velocity, cadence, stride length, and double limb support were observed. studied the effects of horseback riding in 20 stroke patients who performed horseback riding therapy once a week for 16 weeks in addition to ordinary physical therapy. their fugl - meyer assessment scale lower limbs, bbs, and fac scores improved from 14.7 to 18.5 points, 46.1 to 49.0 points, and 3.6 to 3.8 points, respectively. compared with the control group, the scores in the assessment items for the lower limbs of the fugl - meyer assessment scale and bbs were improved by the horseback riding therapy. their results demonstrate that performing the horseback riding therapy in addition to the ordinary physical therapy has a positive effect on gait training20. moreover, when elderly people who experienced a fall performed horseback riding simulation training, an improvement was observed in the 5-m walking test at a comfortable speed, number of steps in the 5-m gait at a fast speed, flexion angle of the lumbar spine, and the tilt angle of the sacral vertebrae. the training was found to improve the balance ability necessary for gait and contributed to gait improvement28. in addition, uchiyama. performed a comparative 3-dimensional analysis of gait using 50 healthy adults and 11 horses. furthermore, only slight differences in heart rate, respiratory rate, and blood pressure were observed after 127 adults performed gait and horseback riding at a speed with similar acceleration patterns. therefore, the optimal therapeutic effect of horseback riding therapy has been demonstrated for patients with gait disorders, because it provides a similar stimulus to that generated by human gait28. the trunk control ability of stroke patients is an index which is used to indicate the recovery of performance in activities of daily living, and it is closely related to balance and gait17. horseback riding therapy improves trunk balance and postural adjustment by utilizing the repeated stimuli of a horse s movement to enhance the muscles around the pelvis, abdomen, and waist which are used to maintain posture30. however, horseback riding therapy is not feasible for many patients because of practical difficulties such as economic burden, lack of facilities for horseback riding therapy, shortage of professional therapists, fear of horses, and allergy. therefore, horseback riding simulation training was developed to reproduce its advantages and address the disadvantages. its efficacy for children with cerebral palsy and elderly people who have experienced a fall has been studied21, 28. the present study provides information on the efficacy of horseback riding simulation training for chronic stroke patients, and demonstrated that it improved their trunk balance and gait. however, our study was limited in terms of generalization, because we enrolled only a small number of subjects, and we could not completely control their activities of daily living. regardless of these limitations, our study was able to demonstrate that horseback riding simulation training has potential as a therapeutic method for improving the trunk balance and gait of stroke patients. however, future research studies with a larger number of subjects, longer application period, and assessment of functional levels of patients are required to validate our results. | [purpose ] the purpose of this study was to assess the effect of horseback riding simulation machine training on trunk balance and gait of patients with chronic stroke. [subjects and methods ] the subjects were 20 patients hospitalized for treatment after being diagnosed with stroke. horseback riding simulation training was provided for 30 minutes, 5 times a week, for 6 weeks. trunk balance was assessed using the trunk impairment scale (tis) and a balance measuring device (biorescue, rm ingenierie, france), and gait ability was measured using the functional gait assessment (fga) and a gait analyzer (gaitrite, cir system inc., usa). [results ] there were significant changes in movement area, distance and velocity of body sway as measured by the tis and the balance measuring device, and in gait velocity, cadence, stride length and double limb support as measured by the fga and gait analyzer. [conclusion ] horseback riding simulation training improved the trunk balance and gait of chronic stroke patients. this present study provides preliminary objective data for future research, and useful clinical information for physical therapists using horseback riding simulation machines as a treatment modality for patients with chronic stroke. |
traumatic brain injury (tbi) is a significant contributor to mortality and morbidity in children and adults throughout the world [1, 2 ]. there are over one million new cases of tbi each year in the united states alone and together these account for over 7.6 billion dollars in medical costs and other expenditures. however, the factors influencing positive outcomes and promoting resilience following these potentially devastating injuries are not completely understood. for example, a 2009 study by fay and colleagues found that four years after injury, well over half of the children sustaining a severe tbi had intact skills in at least three of four broad areas of psychosocial and cognitive functioning (e.g., neuropsychological functioning, behavioral functioning, adaptive skills, and academic skills). similarly, another study by mccauley. found that higher levels of resiliency and decreased depressed mood are correlated to decreased postinjury anxiety and postconcussive symptoms in adults. in psychology, the process by which individuals exhibit positive adaptation following exposure to a hardship is known as resilience. the concept of resilience has also been applied, although somewhat sparingly, to the process of improved recovery trajectories following a tbi [5, 7, 8 ]. researchers are now focusing on identifying what factors allow some people to beat the odds by overcoming the impairments caused by their injury (i.e., exhibit resilient functioning). in the current paper, we briefly review the factors that have been related to positive outcomes / resilience following a tbi in children and adults. the focus on protective verses risk factors is intentional as we wish to highlight variables that researchers and clinicians working with individuals following a tbi may consider when evaluating and designing rehabilitation programs. further, by couching our discussion in terms of factors promoting recovery we intend to emphasize the potential for positive outcomes following tbi, spur future research into these and other factors not yet identified, and facilitate an understanding of the mechanisms that promote resilience and neural plasticity following a tbi. for the purpose of this paper, we divided the factors that influence outcomes into two groups : static factors (i.e., nonmodifiable factors that are a consequence of the individual 's traits or demographics and can not be changed through interventions) and dynamic factors (i.e., modifiable factors that could be addressed through interventions). although the static factors can not be changed through intervention, they are important contributors for clinicians to keep in mind when treating patients after an injury. the most thoroughly researched of these include age, biological sex, intellectual ability / intelligence, and preinjury psychiatric history [2, 4, 9 ]. conversely, the dynamic factors that may be amenable to intervention and could potentially be incorporated into rehabilitation programs and treatment approaches include access to rehabilitation services, family functioning / social support, nutrition, and exercise [2, 4, 5, 79 ]. importantly, each of these factors could be the subject for an entire integrated review. however, the purpose of the current paper is to provide a succinct overview and synopsis of the recent research on factors promoting recovery following tbi. as such, whenever possible, we have concentrated our discussion on emerging trends and articles published in the past decade. age is a significant factor when evaluating the recovery trajectory of a patient who has sustained a tbi [1012 ]. due to the increased plasticity of the brain in younger people, it was once believed that the younger the person at the time of injury, the better the postinjury outcome [10, 11 ]. that is, younger children show attenuated recovery patterns compared to older children and younger adult populations due to their incomplete neurological development. in particular, brain regions such as the prefrontal cortex (and frontal lobes more generally) undergo a very protracted period of development making them exquisitely vulnerable to the effects of early brain insults. anderson. analyzed how the developing brain is affected by a tbi through analyzing children 's cognitive outcomes directly after and 12 months and 30 months after injury. the children were divided into two groups based on age, younger children (37 years) and older children (812 years) ; the children were also grouped by their injury type (i.e., mild, moderate, and severe). results indicated that younger children who sustained a more severe insult displayed attenuated cognitive recovery patterns compared to older participants who endured the same injury. karver. examined the effects of age at injury on the prevalence of behavioral deficits in children who sustained a tbi compared to children who sustained an orthopedic injury (oi). they found that children who sustained a tbi at an earlier age had higher parent - reported symptoms than children who sustained their injury at an older age.. found that individuals sustaining a tbi during childhood had poorer emotional perception than healthy controls, suggesting that deficits in emotional perception experienced during childhood may continue into adulthood for tbi survivors. these studies and similar investigations illustrate early neurological damage results in more deficits and a decreased likelihood of full recovery across domains of functioning. conversely, they suggest that individuals older at the time of their initial injury may fair better and exhibit a more positive outcome [17, 18 ]. although not as many studies exist with adults, the picture appears more complex. there is some evidence that a similar effect may be observed with regard to development of depression following a closed head injury in adults. specifically, studies involving adult participants suggest that older adults who sustained a tbi were less likely to develop major depression when compared to their younger adult peers. they compared older patients who endured a mild tbi (i.e., over 60 years old) to younger patients who also suffered from a mild tbi (i.e., under 60 years old) and found that the older patients seem to be relatively resilient to major depression after their injury. the authors hypothesized that depression may be less prevalent in general within the population of older adults included in the study. they argue that more research is needed in the future to understand the direct correlation between these findings. conversely, a recent study by schmidt. suggested that relatively older adults who sustained a mild tbi exhibited a greater number of sleep difficulties over the first three months after injury compared to adolescent and younger adults. taken together, findings in children clearly suggest that older age at injury is associated with better outcomes following a tbi [8, 18, 19 ]. although not as robust in adults, there is some evidence, at least with regard to depression, that a similar pattern may emerge following mild injuries. nonetheless, there have been few studies explicitly examining the relationship of age to specific outcomes in adult populations (e.g., studies comparing younger to middle - aged to older adults). multiple studies suggest that biological sex is another static factor that affects the recovery pattern following a tbi [2123 ]. according to the centers for disease control, men are three times more likely to die from a tbi than women, and much research has focused on how sex may influence recovery following these injuries [21, 23 ]. many studies have indicated that women have a better prognosis following closed head injuries, and gaining a thorough understanding of the determinants of this effect may lead to improvements in existing treatments or the development of entirely new therapies. most of the studies investigating the mechanisms behind this effect have focused on the role of progesterone as a protective factor. the precise mechanism that progesterone plays in the brain following a tbi remains unknown ; however, it has been found to decrease edema, guard the blood brain barrier, decrease inflammatory responses, increase progenitor cell levels, and regulate calcium signaling following the injury. interest in progesterone as a possible protective factor following tbi began after clinicians noticed that females appeared to have relatively better outcomes compared to males with injuries of similar severity [24, 25 ]. progesterone is hypothesized to improve outcomes in females by helping to reduce inflammation and apoptosis within the hippocampus in the acute and postacute period following an injury. although numerous studies suggested that women have an improved trajectory of recovery compared to men, following tbi [2325 ], renner. argued for an alternate explanation of these findings. specifically, the authors suggested that males and females differed on the severity of the injuries they sustained and that this difference accounted for generally better outcomes of females after a tbi. moreover, a few studies have indicated that males recover better from concussions compared to females. regardless of the mechanism, most of the available evidence suggested a difference in outcomes for males and females following a tbi with females generally showing a more accelerated trajectory of recovery [2124 ]. although level of education may be somewhat of a dynamic factor, the decision was made by the authors to categorize it as static because few studies have examined the specific role of postinjury education in promoting recovery after a tbi. the neurological damage that occurs during and after a tbi, specifically damage to the temporal and frontal lobes, frequently disrupts intellectual and cognitive abilities. complex reasoning and problem solving, executive functions, memory, attention, and psychosocial functioning are cognitive domains often compromised following a tbi and are significantly involved in intellectual abilities and educational attainment [2, 35 ]. research indicates that individuals with higher preinjury intellectual and cognitive abilities exhibit a positive recovery trajectory (i.e., return to baseline or near baseline functioning) when compared to their lower preinjury functioning peers [36, 37 ]. further, data suggest that individuals with higher preinjury intellectual abilities demonstrate fewer long - term cognitive deficits during the postinjury recovery period [36, 37 ], a finding indicative of greater cognitive reserve in these individuals. most research in this area has focused on children because of the impact of early injuries on intellectual and academic development. mcnally. examined how injury characteristics (i.e., type of injury) versus noninjury characteristics (i.e., preinjury symptoms and intelligence) predicted postconcussive symptoms in children who had a mild tbi compared to children sustaining an oi. they found that children with higher preinjury intellectual abilities demonstrated fewer physical postconcussive symptoms, whereas children with lower preinjury intellectual abilities displayed more postconcussive symptoms across domains. the authors maintained that their results demonstrated that children with lower preinjury cognitive abilities may not have the resources to adequately cope with neurological traumas especially when compared to their more intellectually precocious peers. although many children sustaining a tbi require special education following their injury, some studies suggested that preinjury academic skills are related to postinjury functioning. for example, catroppa and anderson analyzed preinjury intellectual functioning on academic success following pediatric tbi 6, 12, and 24 months after injury. results indicated that reading accuracy, spelling, arithmetic, and listening comprehension at 24 months after injury were best predicted by the child 's preinjury ability in these specific domains. the authors suggested that these cognitive abilities are established early on in the child 's life, prior to the injury, and may serve as a significant protective factor, buffering higher - performing children from the negative consequences following a tbi. these studies indicate that higher preinjury cognitive functioning facilitates recovery of skills after injury and leads to a better long - term outcome. importantly, there is a significant gap in our understanding of how post - injury educational attainment and programming influences long - term cognitive recovery and academic progress following a tbi. psychiatric sequelae are some of the most pervasive problems for individuals who have sustained a tbi. often, the psychiatric sequelae can be more devastating than the neurological and physical trauma the person initially endures. many people suffer from posttraumatic stress disorder (ptsd), depression, anxiety disorders, substance disorders, and various personality disorders after sustaining a tbi. although the precise causative factors for each specific psychiatric disorder following a tbi may vary, there is evidence that preinjury psychiatric history is an important variable in a person 's postinjury emotional adjustment and recovery of function following their trauma [5, 41 ]. a 2010 study examined the role of preinjury psychiatric status by using a multivariate analysis to study 100 community - based participants, from 1974 years of age, who sustained a tbi. the authors found that the preinjury psychiatric history of the participants was a substantial risk factor for developing a psychiatric disorder following their injury. specifically, 65% of participants were diagnosed with at least one psychiatric disorder after injury, and a significant number of these cases were novel psychiatric disorders. consequently, 46% of participants were diagnosed with postinjury depression, and of those diagnoses 72% (33 participants) were new - onset cases with depression arising after injury. the study also found that 38% of participants were diagnosed with postinjury anxiety, and of those diagnoses 74% (28 participants) were novel disorders. this research indicated that not only there was a correlation between existing preinjury and postinjury psychiatric disorders but also there was a significant correlation between preinjury psychiatric disorders and novel psychiatric disorders following a tbi. researchers have explored how preinjury mood influences the recovery trajectory of participants following a mild tbi. in this study, researchers examined how depressed mood influenced anxiety and postconcussive symptom severity the day of injury and one week and one month after injury. their results indicated that preinjury mood was significantly and positively correlated with anxiety and postconcussive symptom severity, suggesting the more depressive symptoms an individual exhibits prior to their injury, the worse the trajectory of their recovery in terms of postconcussive symptoms. taken together, various studies suggest that preinjury psychiatric functioning can influence the development of novel psychiatric functioning after injury and may thus play a pivotal role in promoting resilience following tbi [5, 41 ]. the above discussion has focused on static factors that are generally not modifiable (although as noted above, education does not fit neatly into either category). however, although it is important to understand the factors that may be stable / fixed and thus need to be accounted for by healthcare providers and researchers working with individuals sustaining a tbi, there are also a variety of dynamic factors that have been shown to positively influence recovery and can be potentially modified through intervention. the following discussion focuses on those variables that are considered dynamic and thus may be amenable to treatment. socioeconomic status (ses) is one of the most significant predictors of recovery following tbi. somewhat like education, ses however, the decision was made to place it in the dynamic category because much of the research in this area suggests that ses exerts its effect on recovery via indirect pathways such as access to appropriate follow - up medical care, adequate rehabilitation services, and educational training programs [2, 15, 19, 42, 43 ]. ses can influence the trajectory of recovery in a variety of domains including social cognition, emotion perception, behavior, adaptive abilities, and intellectual abilities [7, 19, 43 ]. catroppa and anderson analyzed the intellectual capabilities of 70 children who sustained mild, moderate, and severe tbis. they found that the best predictor of intellectual outcome following a tbi was socioeconomic status. similar results were obtained using a much more basic cognitive paradigm (i.e., emotion recognition). these researchers found that family resources of the children in the tbi group were significantly related to an increased recovery of emotion processing skills (specifically, perception of emotional prosody). these results appeared unique to the tbi group ; a similar pattern was not observed among the oi participants. the authors speculated that this finding may represent increased access to rehabilitation services and/or reduced stress levels in those families with relatively more economic resources. these researchers examined the relationship between ses and social cognitive skills in long - term, young - adult survivors of head injury. they compared young adult survivors with tbi to noninjured participants matched on age, sex, and ses. results showed that young adults in the high - ses tbi group exhibited similar social cognition skills to noninjured high - ses participants and significantly better performance when compared to the low - ses tbi group. other studies have also indicated that ses is a significant contributor to other outcomes (i.e., memory, behavior, adaptive ability, reading, and spelling) following a severe tbi (see anderson. and lajiness - o'neill.). it should be noted that some investigators have speculated that lower ses may increase the risk of tbi potentially increasing the complications and economic burden of tbi for this portion of the population. taken together, evidence indicates that ses is a major contributor to resilient function and long - term recovery following tbi across a number of cognitive and psychosocial domains. although the mechanisms of this relationship have not been well - elucidated, it is plausible that access to intervention and rehabilitation services likely play a significant role in promoting more positive outcomes for individuals with higher ses backgrounds [19, 4244 ]. the social support a person receives following tbi significantly influences their recovery trajectory [15, 47 ]. family stress in particular has been linked to a number of cognitive and social outcomes, especially in children following an injury. in one study, researchers examined the association of family functioning and academic performance in a group of children sustaining moderate tbi, severe tbi, or an oi. their results indicated that children sustaining a severe tbi who lived in a low - stress family environment exhibited an accelerated rate of academic recovery compared to children living in a high - stress family environment. wade. argued that families of children sustaining a severe tbi were more likely to experience greater stress when compared to families sustaining milder injuries. however, another research indicates that parental warmth serves as a protective factor following tbi, even in more severe injuries. wade and colleagues examined the association between parental warmth and behavioral problems in children following a tbi. results indicated children who experienced a severe tbi but were exposed to warm and responsive parenting demonstrated fewer behavioral problems, including internalizing difficulties, and adhd symptoms compared to children who were exposed to less parental warmth following their injury. further, this study determined that parental negativity exacerbated externalized behavior problems following a severe head injury. in adult populations, social support and family functioning are less researched although a number of studies have addressed this issue [51, 52 ]. one study analyzed adults who suffered from a severe tbi and found that stronger social support was related to both decreased depression and increased well - being in adults who had sustained a tbi. examined the family members of individuals who sustained a tbi and discovered that increased neurobehavioral impairments (i.e., depression and deficits in pragmatics) were closely related to family dysfunction in adults following a tbi. in summary, research in both child and adult populations suggests that improved family functioning and increased social support facilitate protective factors following a tbi [47, 4952 ]. under normal circumstances, the brain is a highly metabolic, active organ [2, 11, 55 ]. this metabolic activity is further enhanced when the brain is in a state of repair following an acute injury [11, 55 ]. consequently, the brain is vulnerable to inadequate energy input and deficits in specific micronutrients. this can result in a brain energy crisis, a state that hinders cell survival with implications for long - term cognitive function. given its high metabolic demands, adequate nutrition is an important protective factor that may help facilitate positive recovery following a tbi. recent studies suggest that nutrition during early life influences recovery from an acute brain injury. investigated the impact of pre- and perinatal nutrition on recovery following a subsequent brain injury. these investigators provided animals a pre- and perinatal diet that was either adequate or deficient in omega-3 fatty acids and then exposed the groups to a concussive injury once they reached maturity (about postnatal week 17). animals in the deficient group who sustained a concussive injury exhibited more anxiety - like behaviors when compared to the group that had adequate pre- and perinatal nutrition. within the concussed group exposed to the deficient diet, findings indicated decreases in adenosine monophosphate - activated protein kinase (ampk) and peroxisome proliferator - activated receptor gamma coactivator 1-alpha (pgc-1), which are both important in the formation of adenosine triphosphate (atp). other investigations have focused on the role of micronutrients following brain injury. in one study, cope and colleagues provided animals either a zinc deficient (5 ppm), zinc adequate (30 ppm), or zinc supplemented (180 ppm) diet for 4 weeks and then each animal underwent a concussive injury. results revealed that zinc adequate and zinc supplemented animals demonstrated significantly less anxiety - like behaviors, fewer behaviors indicative of depression, and better spatial learning and memory skills when compared to the zinc - deficient group. in addition to micronutrients, tbis require an increased demand for energy in the brain, creating an increased need for glucose [11, 55 ]. one study analyzed the effects of glucose following a controlled cortical impact (cci) using a rodent model. results indicated that administration of a dose of glucose directly following the cci significantly improved survival of cortical neurons. taken together, these results illustrated the importance of adequate nutrition early in life in promoting positive outcomes following a subsequent brain injury [5558 ]. despite the promising findings using animal models, very few empirical studies have examined the role of nutrition in promoting recovery after tbi in human participants. a systematic review of the influence of metabolism and nutrition following tbi suggested a relationship between mortality and morbidity when patients were introduced to solid food following their injury [59, 60 ]. although this may reflect the influence of injury severity, the authors argued that their finding was influenced by patients who were reintroduced to solid food earlier being better able to accommodate the increased metabolic rate and rapid protein breakdown that occur after a moderate or severe tbi. another more recent systematic review concluded that, despite some encouraging preclinical animal studies, the numerous inconsistencies within human studies preclude definitive conclusions regarding the role of nutrition within tbi recovery. these authors argued it is imperative that further research should be completed on human patients to determine if nutrient supplementation can provide the same types of neuroprotective effects for persons sustaining a closed head injury as suggested by animal models. in addition to its various long - term health benefits, exercise is another important dynamic factor that may influence recovery following a tbi [6265 ]. in healthy animals and humans, exercise increases neurogenesis in the hippocampus and is associated with improvements in learning and memory. exercise is related to decreases in neuronal apoptosis following a tbi. using an animal model of tbi, itoh and colleagues divided animals into an exercise and nonexercise group. results showed that the animals in the exercise group experienced less neuronal degeneration and apoptotic cell death in the brain region surrounding the injury location. animals in the exercise group also showed improved outcomes in learning and memory as indicated by decreased swim times in the morris water maze. although many of the studies examining the benefits of exercise following tbi have been conducted using animal models, a few investigations with human participants have been undertaken (see schneider. and fogelman and zafonte for a review). briefly, although these studies range in sophistication, scientific rigger, and generalizability, most data with human participants suggests that exercise may be a reasonable adjunct to treatment following a tbi and may facilitate positive outcomes. specifically, low - intensity aerobic exercise has been demonstrated to have a positive impact following mild tbi. similarly, contrary to the traditional wisdom of rest for an extended period of time following mild tbi, silverberg and iverson argue that more contemporary studies suggest that a brief period of rest followed by a relatively rapid return to noncontact activities including exercise is associated with better recovery across a wide range of populations. nonetheless, despite these promising findings and encouraging evidence from animal studies, a major gap in our understanding of the protective role of exercise is a lack of well - controlled, rigorous investigations that examine the effect of exercise across tbi severity and across child and adult populations. the interest on factors that influence recovery grew out of a desire to understand how and why certain people are able to rise above their experiences [4, 5, 68 ]. this brief review endeavored to explore the burgeoning literature that explores the various factors associated with positive recovery and resilience following a substantial closed head injury [5, 17, 26, 43, 56 ]. for the purpose of this review, these resilience promoting factors were defined as static (i.e., unmodifiable factors that can not be altered by intervention such as age, sex, intellectual abilities / education, preinjury psychiatric history) and dynamic factors (i.e., modifiable factors that may be amenable to treatment socioeconomic status, family functioning / social support, nutrition, exercise). as stated in the text, the decision to place these factors into these categories was arbitrary but was intended to reflect the current stage of knowledge. for example, education was placed in the static category because of the lack of research on the influence of postinjury education on recovery. likewise, ses was placed in the dynamic category because of the potential to address the hypothesized mechanism of this variable (i.e., restricted access to rehabilitation and other support services) [2, 43 ]. additionally, other variables such as the potential influence of genetic factors on tbi recovery were not included in this review because of the relative paucity of information regarding these factors. nonetheless, the influence of specific genes and gene - environment interactions on resilience following tbi appears to be a fruitful avenue for future investigations (see graham. for a brief discussion of this research). although there has been significant advancement in our understanding of factors that promote positive functioning and resilience following tbi, this brief review reveals substantial areas for future investigations. for example, the preponderance of research regarding the protective effects of age, intellectual abilities, and socioeconomic status following a tbi has been conducted with child participants. therefore, more systematic investigations are needed to determine how these variables impact the recovery of adults across the age range and how these factors influence outcomes, such as return to work, parenting, and family functioning [2, 79, 17, 19 ]. similarly, most of the research to date on factors such as nutrition and exercise has been conducted using animal models. although these studies and the small number of investigations with human participants yield valuable insights, clinical studies (i.e., randomized, placebo - controlled, double - blind investigations) using larger samples of human participants are necessary to determine if nutrition and exercise are useful adjuncts to treatment and enhance positive outcomes following a tbi [5961, 6365 ]. this brief review was intended to highlight factors that may influence recovery and promote resilience after a tbi in order to provide both practitioners and researchers insights into those areas that may need to be considered both in future studies and when designing rehabilitation programs for tbi survivors and their families. by focusing on factors that promote positive as opposed to negative outcomes, we wished to illustrate that a substantial degree of long - term recovery is possible and may be accentuated by additional studies that take a positive adaptation approach to examining postinjury functioning. further research into factors promoting recovery and resilience following tbi holds promise for improving interventions for a variety of neurologic populations. additionally, future research can shed light on the neurobiological, behavioral, and psychosocial underpinnings of positive adaptation and the resilience process more generally. these insights are necessary to design treatments that address the needs of patients across multiple levels and build on the innate strengths of individuals and their families who directly experience the impact of these devastating injuries. | traumatic brain injury (tbi) is the greatest contributing cause of death and disability among children and young adults in the united states. the current paper briefly summarizes contemporary literature on factors that can improve outcomes (i.e., promote resilience) for children and adults following tbi. for the purpose of this paper, the authors divided these factors into static or unmodifiable factors (i.e., age, sex, intellectual abilities / education, and preinjury psychiatric history) and dynamic or modifiable factors (i.e., socioeconomic status, family functioning / social support, nutrition, and exercise). drawing on human and animal studies, the research reviewed indicated that these various factors can improve outcomes in multiple domains of functioning (e.g., cognition, emotion regulation, health and wellness, behavior, etc.) following a tbi. however, many of these factors have not been studied across populations, have been limited to preclinical investigations, have been limited in their scope or follow - up, or have not involved a thorough evaluation of outcomes. thus, although promising, continued research is vital in the area of factors promoting resilience following tbi in children and adults. |
as technological advancements have been made in endoscopy, the occurrence of duodenal tumors has increased. but when we examine patients by endoscopy, tumors of the duodenum are not often diagnosed. most duodenal tumors of the first portion are benign, but the incidence of malignancy increases as they are more distally located. the main benign tumors of the duodenum are adenoma and brunner 's gland hyperplasia, but hyperplastic polyp is rare. both malignant and benign tumors of the duodenum tend to occur in the middle or older age groups. a polyp is defined as an abnormal growth of tissue projecting from a mucous membrane. the prevalence of duodenal polyps is estimated to be about 1% in patients referred for esophagogastroduodenoscopy (egd). most duodenal polyps are inflammatory polyps, brunner 's gland hyperplasia and have ectopic gastric mucosa. hyperplastic polyps usually occur in the setting of ectopic gastric mucosa and have an appearance that more closely mimics hyperplastic polyps of the gastric than the colonic type. the clinical symptoms of duodenal tumors are abdominal pain, vomiting, melena, fever and diarrhea, and sometimes they are asymptomatic. however, there are no specific symptoms of duodenal tumors. most duodenal polyps less than 1 cm in size do not require treatment if biopsy specimen is consistent with a benign tumor. sessile polyps larger than 2 cm, not specifically diagnosed by biopsy specimen, are excised during the operation. recently, capsule endoscopy (ce) and single- or double - balloon enteroscopy (sbe or dbe) have been developed and employed in clinical practice. ce and sbe or dbe can reveal bleeding lesions or tumors in the small intestine, which could not be detected by egd and colonoscopy. furthermore, approximately 5% of patients with gastrointestinal bleeding exhibit no identifiable source by upper endoscopy and colonoscopy. the cause of obscure gastrointestinal bleeding (ogib) is usually a lesion located in the small bowel, but also includes lesions that were overlooked during conventional endoscopy. the incidence of duodenal tumors detected by ce has not been confirmed. to our knowledge, only 5 cases of a duodenal hyperplastic polyp detected by egd have been reported, but this is the first case of a polyp detected by ce., we describe the case of a lobulated and pedunculated duodenal hyperplastic polyp detected by ce and treated with polypectomy, and present a review of the literature. a 71-year - old man was referred to our hospital in the middle of november 2009 for thorough investigation of asymptomatic iron deficiency anemia and occult blood in stools. emergency egd revealed gastric antral vascular ectasia (gave) in the antrum of the stomach. there were many coagula on gave, and these were thought to be the cause of tarry stool. follow - up egd 1 week later revealed no bleeding lesion along with improvement of gave, and the patient was discharged. subsequently, his hemoglobin (hb) level gradually decreased within 3 months (from 9.7 to 7.9 g / dl), but he had no symptoms. as the test for occult blood in stools was positive, egd and colonoscopy were performed. meanwhile, colonoscopy revealed diverticula but no bleeding lesions. in late november 2009, we performed ce to detect the source of occult blood in stools. a large lobulated polyp about 2.5 cm in diameter, with a long stem, was detected in the third portion of the duodenum (fig. the surface of the polyp was reddish and thought to be the cause of anemia. an air - contrast barium meal also revealed a lobulated and pedunculated polyp in the third portion of the duodenum. physical examination on admission revealed a well - developed, well - nourished man, and vital signs were normal. laboratory examinations were as follows : hb 7.9 g / dl, serum iron concentration 44 g / dl, ferritin 57.8 ng / ml. the polyp was 27 mm in diameter and histological examination showed an area of elongated crypts and villi with focal gastric - type surface epithelium. epithelial nuclear atypia was present at the base of the crypts, but this feature was generally less marked at the surface (fig. five days after polypectomy, egd showed no bleeding, and the patient was discharged. after treatment, his hb level improved gradually (from 7.9 to 14.2 g / dl) and did not decrease for 6 months. the main benign tumors of the duodenum are adenoma and brunner 's gland hyperplasia, but hyperplastic polyps are rare. duodenal tumors are often insidious with non - specific symptoms such as abdominal pain, anemia, and gastrointestinal bleeding. small and non - pedunculated hyperplastic polyps are sometimes seen in the bulb of the duodenum, but large and pedunculated polyps are reportedly very rare. the risk of development of focal adenocarcinoma in a hyperplastic polyp of the stomach is less than 1%. similarly, the malignant potential of duodenal hyperplastic polyp is thought to be very minimal. histological examination of those polyps following snare polypectomy shows no malignancy. in some patients with gastrointestinal tract bleeding of unknown origin, diagnosis can not be made after egd and colonoscopy. however, detection of the bleeding point recently has been enabled by the use of ce, sbe or dbe. ce, sbe and dbe have mainly been used to investigate ogib, polyposis syndromes, crohn 's disease, and celiac disease. although ce is used mainly to investigate the jejunum and ileum, duodenal tumors are occasionally detected. currently, epithelial gastric polyps are mainly divided into hyperplastic, adenomatous or fundic gland polyps. focal foveolar hyperplasia and pyloric - type glandular hyperplasia have been reported, but there is some confusion in the literature concerning duodenal hyperplastic polyps. our review of the medical literature in pubmed between 1975 and 2010 revealed 5 cases of duodenal hyperplastic polyps [11, 12, 13, 14, 15 ]. the details of all 6 reported cases, including our present case, are shown in table 1. there were 4 males and 2 females, and their mean age was 50.5 years (range 2 - 79 years). upper gastrointestinal series was performed in 3 cases, while egd was performed in all of them. polyps were mostly solitary, and a lobulated polyp was detected only in our case. histology revealed a hyperplastic polyp with no atypical cells in 5 cases and a hyperplasiogenic polyp with atypical cells in 1 case. the outcome was good with improvement of anemia in 2 cases and disappearance of the symptoms in 1 case. in our case only, the polyp, which was located in the third portion of the duodenum, was pedunculated and lobulated. moreover, our case is the only one that underwent ce. since a duodenal hyperplastic polyp is thought to have a minimal risk of malignancy, endoscopic treatment is effective for treatment of patients with anemia or abdominal symptoms from a duodenal polyp. in conclusion, in this report we presented the unique case of a lobulated and pedunculated hyperplastic polyp of the duodenum that was detected by ce and successfully treated with endoscopic snare polypectomy. ce is useful in detecting the bleeding lesion when patients present with anemia and ogib undetected by egd and colonoscopy. | we report herein the case of a lobulated and pedunculated hyperplastic polyp in the third portion of the duodenum causing anemia and occult blood in stools, which was detected by capsule endoscopy (ce) and treated with snare polypectomy. a 71-year - old man was referred to our hospital because of anemia and occult blood in stools. three months earlier, he had been admitted to another hospital because of hemorrhage from gastric antral vascular ectasia (gave). despite being treated for gave, hemoglobin decreased gradually. esophagogastroduodenoscopy (egd) and colonoscopy revealed no source of bleeding. however, ce revealed a polyp at the distal duodenum. barium meal and egd revealed a lobulated and pedunculated polyp in the third portion of the duodenum. the polyp was treated with snare polypectomy. histopathological examination of the polyp revealed hyperplasia. after treatment of the polyp, the anemia improved gradually. to our knowledge, there are only 6 reported cases of a duodenal hyperplastic polyp, including our case. the polyp was pedunculated in only 2 cases and lobulated only in our case. moreover, our case was diagnosed by ce. when a patient presents with anemia or obscure gastrointestinal bleeding undiagnosed by egd and colonoscopy, ce is useful for detecting the bleeding lesion. |
the effect of cardiac resynchronisation therapy (crt) in patients with heart failure without left bundle branch block (lbbb) is disputable. we present a case of a patient with rate - dependent lbbb. a 55-year - old woman with dilated cardiomyopathy, a left ventricular (lv) ejection fraction of 32% (bloodpool radionuclide scintigraphy) and new york heart association class iii despite optimal pharmacological therapy was referred for crt device implantation. a 24-h electrocardiogram registration showed complete lbbb that disappeared at slower heart rates between 70 and 80 bpm (fig. 1). since lbbb was present for the vast majority of the time, the patient was accepted for crt implantation according to current guidelines. echocardiography during narrow qrs showed a dilated left ventricle without visual signs of dyssynchrony, normal interventricular mechanical delay (18 ms) and no lv intraventricular dyssynchrony (septal to lateral strain delay 53 ms) or atrioventricular (av) dyssynchrony. 112-lead surface electrocardiogram during normal ventricular conduction and during left bundle branch block. a narrow qrs (90 ms), heart rate 67 bpm. b wide qrs (160 ms) with complete lbbb, heart rate 73 bpm 12-lead surface electrocardiogram during normal ventricular conduction and during left bundle branch block. a narrow qrs (90 ms), heart rate 67 bpm. b wide qrs (160 ms) with complete lbbb, heart rate 73 bpm the patient gave written informed consent for a study that was approved by the institutional ethics committee and complies with the declaration of helsinki. during implantation, paul, mn, usa) was placed in the left ventricle to optimise the av delay by measurement of the maximum rate of lv pressure rise (dp / dtmax). the leads were implanted transvenously in the right ventricular outflow tract, right atrial appendage, and in a coronary sinus tributary on the midposterolateral lv free wall. pacing leads, pressure recording, and 12-lead surface electrocardiogram were connected to an external pacing and data acquisition computer (flexstim ii, boston scientific corp., st.paul, mn, usa). the custom - made stimulation protocol consisted of cycles of six beats of atrio - biventricular pacing separated by periods of 14 beats of atrial pacing (aai, baseline). this cycle was repeated with biventricular pacing without atrial pacing (vdd), separated by periods of no pacing (sinus rhythm, baseline). each cycle with one of four av delays (20%, 40%, 60%, and 80% of intrinsic av conduction time) was repeated four times in random order. the optimal av delay was defined by the highest relative increase in dp / dtmax compared with baseline. complete lbbb was present during aai pacing at 85 bpm (qrs 160 ms, interventricular delay 130 ms on intracardiac electrograms). during sinus rhythm (75 bpm) there was no lbbb (qrs 90 ms, interventricular delay 60 ms). lbbb caused a sudden decline in average baseline dp / dtmax from 820 75 to 662 52 mmhg / s (p < 0.001, paired t test ; fig. optimised crt did not change dp / dtmax compared with baseline ; crt with short av delay worsened dp / dtmax (fig. 2acute haemodynamic response to cardiac resynchronisation therapy (crt) during left bundle branch block (lbbb) and normal ventricular activation. a absolute lv dp / dtmax values at baseline (no crt) and during crt with four different av delays. b relative increase in lv dp / dtmax during crt compared with baseline without crt. mean standard error are shown. squares narrow qrs, diamond lbbb, avi intrinsic atrioventricular interval, av delay atrioventricular delay acute haemodynamic response to cardiac resynchronisation therapy (crt) during left bundle branch block (lbbb) and normal ventricular activation. a absolute lv dp / dtmax values at baseline (no crt) and during crt with four different av delays. b relative increase in lv dp / dtmax during crt compared with baseline without crt. mean standard error are shown. squares narrow qrs, diamond lbbb, avi intrinsic atrioventricular interval, av delay atrioventricular delay lv dp / dtmax is a measure of systolic function that can reflect acute haemodynamic improvement achieved by crt [35 ]. in this case, acute decrease in haemodynamic function by induction of lbbb was previously shown in a preclinical model. systematic human research about the effect of crt during both conditions within the same patient is difficult since data before onset of lbbb are often lacking. in the absence of lbbb, biventricular pacing, crt also failed to improve quality of life and functional and echocardiographic parameters in heart failure patients with qrs < 130 ms and mechanical dyssynchrony. in this case, crt with a short av delay worsened dp / dtmax, which can be explained by impaired diastolic filling : advanced ventricular contraction causes premature mitral valve closure and thereby premature ending of atrial contraction (a wave truncation). during lbbb, biventricular pacing increased dp / dtmax by 20% ; it was thereby almost restored to the baseline level during normal ventricular conduction. crt is only effective during lbbb, and may have an adverse effect during normal intrinsic ventricular depolarisation. a rate - adaptive av delay that is long at slow heart rates and shortens quickly when the heart rate increases to around 75 bpm would promote predominantly intrinsic depolarisation during narrow qrs, and predominantly biventricular pacing during lbbb. however, most currently available crt - d devices do not have this programming option. since the heart rate was above the critical value during the majority of the time, one could argue that the crt - d can be programmed according to usual practice in patients with permanent lbbb. the presence of a rate - dependent lbbb demonstrated important basic crt principles : induction of lbbb had a pronounced negative effect on cardiac function as reflected by an acute decrease in lv dp / dtmax;during lbbb, biventricular pacing almost completely restored lv dp / dtmax to baseline level during intrinsic normal ventricular conduction;biventricular pacing had no beneficial effect on lv dp / dtmax during normal ventricular conduction. induction of lbbb had a pronounced negative effect on cardiac function as reflected by an acute decrease in lv dp / dtmax ; during lbbb, biventricular pacing almost completely restored lv dp / dtmax to baseline level during intrinsic normal ventricular conduction ; biventricular pacing had no beneficial effect on lv dp / dtmax during normal ventricular conduction. | a 55-year - old woman with dilated cardiomyopathy and rate - dependent left bundle branch block had a cardiac resynchronisation therapy (crt) device implanted. during implantation, the maximum rate of left ventricular pressure rise (dp / dtmax) was measured invasively. this case presents a description of the acute negative effect of a left bundle branch block on dp / dtmax, and the different effect of crt on left ventricular haemodynamic function in the presence and absence of a left bundle branch block. |
a 17-year - old girl presented with complaints of a progressively increasing swelling over the front of her left chest over the previous 5 months. the swelling was not painful, situated just adjacent to her left breast, with no associated shortness of breath. she did not complain of an engorgement of the left breast, nipple discharge, or retraction. there was no family history of similar complaints. on examination, her vital signs were stable. there was a large, hard, non - tender mass, 2530 cm in size, extending from just below the left clavicle to the 6th intercostal space and from the lateral border of the sternum to the mid - axillary line (fig. the mass itself was adherent to the chest wall although the overlying skin was not. the left breast had been lifted up by the mass and was not adherent to it. chest x - ray showed a diffuse opacification over the mid - lung field extending over to the lateral chest wall. a blood investigation revealed a raised lactate dehydrogenase and alkaline phosphatase, positive c - reactive protein, and normal total counts. contrast - enhanced computed tomography (ct) of the thorax showed evidence of irregular destruction and periosteal reaction involving the left 3rd rib (fig. 2). there was a large soft tissue component extending through the skin and the subcutaneous region, anterior mediastinum, and in the left upper lobe. this was causing compression of the left upper and lower lobe bronchus with a partial collapse of the underlying lung field. the lesion was also abutting the arch of the aorta and its branches and was found to be displacing the left brachiocephalic vein laterally. magnetic resonance imaging (mri) findings were similar with the lesion appearing hyper - intense in the t2-weighted images and hypointense in the t1-weighted images. fine - needle aspiration cytology from the mass was inconclusive, and a core - needle biopsy was taken, which was suggestive of chondrosarcoma. the patient was subsequently taken up for the exploration and excision of the mass. the chest was opened via a median sternotomy and the tumor freed from its anterior mediastinal attachment (fig. the superior, inferior, and lateral extents of the tumor were accessed via a left thoracotomy, dissecting under the sub - mammary plane, and the required resection of the 2nd to the 5th ribs. extensive involvement of the left lung parenchyma warranted a left pneumonectomy and a completion thoracoplasty to obliterate the potential space (fig. the biopsy report revealed features of a dedifferentiated chondrosarcoma with a highly pleomorphic sarcomatous component. large foci of necrosis were present, and the tumor was found to infiltrate the lung parenchyma. the patient had an uneventful postoperative course and was discharged on the 6th postoperative day. a wide variety of benign and malignant conditions are classified under tumors of the chest wall. the most common entities are rib metastases via a hematogenous spread and direct chest wall invasion from contiguous lung and breast carcinoma. primary chest wall tumors, which are quite rare, may arise from any of the soft - tissue, bony, or cartilaginous constituents of the chest wall, the latter comprising only one - third of the total number of cases. chondrosarcoma is the most common malignant primary tumor of both the bony thorax and, in fact, the entire chest wall. secondary chondrosarcomas occur in pre - existing benign cartilaginous neoplasms, such as the complication of a pre - existing enchondroma or osteochondroma. chondrosarcoma most commonly arises de novo within the medullary cavity of the bone (primary or central) but can result from a malignant transformation of the cartilage cap of a pre - existing benign cartilaginous tumor such as enchondroma or osteochondroma. a majority of the patients with thoracic chondrosarcoma present with an enlarging, painful, anterior chest wall mass arising from either the vicinity of the costochondral junction or the sternum. asymptomatic tumors detected incidentally by thoracic imaging are more likely to be benign. in a retrospective series of patients seen at the mayo clinic over 73 years, only 6.5% of the 96 patients were without physical findings or symptoms. a history of trauma associated with the tumor location has been implicated although its direct causation has not been established. a basic posteroanterior and lateral chest radiograph consists of the initial imaging work - up of these patients. a classic radiographic appearance of chondrosarcoma is a lobulated, mixed lytic and sclerotic lesion. ct is optimal for the detection and characterization of the chondroid matrix, which classically has well - formed rings and arcs of mineralization. mri is particularly useful for defining the vascular or neural involvement and, therefore, provides complementary information to the ct scan. positron emission tomography with fluorine-18 fluorodeoxyglucose is performed to rule out extrapulmonary metastases. percutaneous image - guided core - needle biopsy and sophisticated cytopathology techniques should yield a diagnosis in a majority of the cases. cellularity, nuclear atypia (including multinucleated cells), and increased proliferation (> 10%) are all indicators of an increasing grade and aggressive behavior. the less - differentiated component of dedifferentiated chondrosarcoma usually shows the multi - lineage histological features of malignant fibrous histiocytoma and fibrosarcoma. there is no indication of neoadjuvant radiation or chemotherapy in a suitable surgical candidate with a resectable thoracic chondrosarcoma. a wide resection of all thoracic diseases with appropriate margins, reconstruction of the bony chest wall to ensure preservation of respiratory mechanics, and soft - tissue coverage of reconstructive prostheses with healthy, vascularized tissue is the treatment of choice. the chondrosarcoma of the sternum should also be resected with at least a 4-cm margin. the ipsilateral lung should be carefully palpated for occult metastases, which should be resected prior to the commencement of reconstruction. in this patient, due to the extensive involvement of the chest wall and the lung parenchyma, pneumonectomy with thoracoplasty thoracoplasty is the surgical removal of the skeletal support of a portion of the chest. this is accomplished by the subperiosteal removal of a varying number of rib segments to approximate the chest wall to the underlying lung or mediastinum to effect lung collapse or pleural space obliteration. in spite of mutilating surgery, thoracoplasty is justified in developing nations where issues such as poor patient compliance, post pneumonectomy empyema, drug resistance, poor healthcare delivery systems, and a certain amount of mismanagement at the primary and secondary levels of healthcare need to be addressed. chondrosarcoma is relatively radioresistant, and conventional radiation therapy has demonstrated some efficacy and should be administered at the sites of positive pathologic margins (if a wider surgical margin can not be achieved) or in cases of unresectability. although considered a rare entity, chondrosarcoma of the chest wall is the most common malignant primary neoplasm. its occurrence in a young female and with such a dimension as that described above is extremely rare. a careful work - up as well as histological correlation is vital for the adequate management of these patients, who require a wide resection of the tumor supplemented with chest wall reconstruction, if possible. overall survival is good if the tumor has been adequately resected, respiratory mechanics preserved, and the margins are found to be free of involvement during a histopathological examination. | chondrosarcoma of the chest wall is a rare primary neoplasm found to occur in elderly men. patients present with an enlarging, painful, anterior chest wall mass arising from either the vicinity of the costochondral junction or the sternum. treatment includes wide resection with appropriate chest wall reconstruction. we report an unusual presentation of this uncommon tumor occurring as a huge chest wall mass in a young teenage girl. |
between february 1997 and may 2000, seven patients in whom tubular foreign bodies were present underwent removal procedures involving the coaxial snare technique (table 1). the foreign bodies were either stents which were malpositioned or had migrated from their correct position in the vascular system (n=2), a fragmented venous introducer sheath (n=1), or fragmented external drainage catheters in the biliary tree (n=2) or urinary tract (n=2). all procedures were performed with the loop snare coaxially oriented in relation to the guidewire, dilator, or catheter, and to describe them, we use the term ' coaxial snare technique '. the devices used for the procedure were a nitinol gooseneck snare (amplatz gooseneck ; microvena, vadnais heights, minn., u.s.a.), an angiographic catheter, and a 0.035-inch superelastic guidewire (glidewire ; terumo, tokyo, japan). to facilitate smooth engagement and withdrawal of the foreign bodies, a vascular sheath dilator was used in five patients. in cases involving malpositioned or misplaced vascular stents, the guidewire remained within the lumen of the stent, and the loop snare was carefully advanced coaxially over the guidewire until it was positioned around the stent 's proximal end. the loop was then tightened and the stent was withdrawn. in the case involving a rigid broken sheath in the right atrium, a loop snare was used to capture the broken fragment, which was then pulled back into the inferior vena cava. the femoral vein was punctured a second time, and using an angiographic catheter and guidewire, the lumen of the broken fragment was located. a vascular sheath dilator was then advanced over the guidewire, and after tight engagement of the dilator with the sheath fragment, the whole system was withdrawn simultaneously. in the other cases, involving the biliary or urinary systems, direct snaring either failed or was not attempted. instead, a guidewire was passed through the central lumen of each fragmented external drainage catheter ; a loop snare was then introduced coaxially over the extracorporeal end of the guidewire or catheter, which had already been passed through the fragmented catheter. after the barrel of the object was snared, the loop was closed around it and a vascular sheath dilator was introduced over the guidewire, facilitating tight engagement with the end of the catheter fragment., we conducted an ex - vivo experiment to demonstrate how the coaxial snare technique works. three items retrieved in our clinical cases, namely a vascular stent (10 mm in diameter, 8 cm in length), a small - bore catheter fragment (5-f), and a large - bore sheath fragment (8-f in internal diameter and 10-f in outer diameter), were used, together with a nitinol gooseneck snare (20 mm in loop diameter), two angiographic catheters (4-f and 5-f), a 0.035-inch guidewire, a 12-f dilator, and two vascular introducer sheaths (10 and 12-f). the retrieval or repositioning of various items present in the vascular, biliary, or urinary system was successful in all cases. in the two cases involving a misplaced vascular stent retrieval or repositioning was possible without changing the vascular sheath or additional vascular access. the fractured rigid venous sheath was retrieved using a minimum - sized vascular sheath (12-f), without folding. in the remaining four cases involving fractured catheters in the biliary or urinary system, the coaxial snare technique succeeded with the help of a coaxially engaged dilator. in no case were surgical procedures required, and no procedure - related complications were encountered. simple snaring of a stent and catheter fragment resulted in the formation of a right angle between them and the snare axis (figs. owing to this angulation problem, it was necessary to fold the foreign objects prior to their retrieval by means of a simple snare technique ; consequently, a much larger sheath was required for their extraction. in contrast, the coaxial snare technique greatly reduced the angle between the foreign objects and the snare axis, and allowed safe and smooth engagement between them and the sheath (figs. 1b, 2b, 2c). where a larger - bore venous sheath fragment was used, however, the extent to which the angle was reduced was insufficient to permit retrieval through the sheath (fig. although a larger - bore sheath can solve the problem, it carries the risk of vascular injury. as a variant of the coaxial snare technique, we used two access routes, the shorter one for a loop snare and the longer one for the retrieval of the sheath fragment. after capturing the fragment with a loop snare, 3b). in order to eliminate the shoulder between the guidewire and the fragment, and to facilitate smooth extraction, a dilator was then introduced through the sheath over the guidewire, and was tightly engaged with the end of the fragment (fig. case 1. a 48-year - old man with liver cirrhosis which led to massive variceal bleeding was referred to us for a transjugular intrahepatic portosystemic shunt (tips) procedure. after accessing the portal venous system via the right internal jugular route using a colapinto transjugular cholangiography / liver biopsy set (cook, bloomington, ind., we dilated the parenchymal tract between the middle hepatic and left portal vein using a 10 mm - diameter ultrathin diamond balloon catheter (medi - tech / boston scientific, watertown, mass. we tried to place a 10 mm - diameter, 8 cm - long niti - s stent (taewoong, seoul, korea) in the tract, but during deployment it migrated caudad to the main portal vein (fig. a guidewire was inserted into the stent 's central lumen, and an amplatz gooseneck snare, its loop 25 mm in diameter, was introduced over it and positioned around the stent (fig. 4b). after capturing and pulling the far proximal end of the stent by tightening the loop (fig. 4c), we were able to relocate the stent to its appropriate position (figs. 4c, 4d). case 3. a 42-year - old man with chronic renal failure underwent internal jugular venous catheterization at the bedside. during the procedure, the tip of the 8-f internal diameter venous introducer sheath fractured and migrated to the right atrium. because the fragment moved vigorously in accordance with the patient 's heartbeat, it was necessary to prevent its migration to the right ventricle or pulmonary circulation. under fluoroscopic guidance, we inserted a 10-mm gooseneck snare through the right common femoral vein, successfully grasping the fragment and carefully pulling it back into the inferior vena cava (fig. 5a). because the fragment was very stiff and its outer diameter was 10-f, it had to be removed without folding. to this end, we used the modified coaxial technique illustrated in the ex - vivo study (figs. 3b, 3c), inserting another 12-f vascular sheath (13 cm in length). the puncture site was more cranial to the previous one, used for insertion of the loop snare ; the central lumen of the fragment was carefully located using an angiographic catheter and guidewire, and the dilator for the vascular sheath after the dilator and the end of the sheath fragment were tightly engaged, the whole system was pulled back until the end of the fragment appeared at the femoral access site. it was grasped with forceps and successfully extracted after release of the loop snare and careful compression of the puncture site (fig. a 51-year - old man with renal tuberculosis underwent periodic tube change under fluoroscopic guidance. the external part of the nephrostomy catheter was resected close to the point at which it entered the body, and during the procedure, the remaining catheter fragment was inadvertently dislodged, entering the nephrostomy tract. several attempts to capture it caused its further migration into the pelvocalyceal system. we used a homemade loop snare and amplatz gooseneck snare, also employing the ' in - situ loop snare ' technique, as described by savader. (18), but because the fragment was tightly wedged against the wall, were unable to withdraw any part of it (fig., we managed to pass the guidewire through the central lumen of the catheter fragment, inserting the amplatz loop snare over the guidewire and easily capturing the proximal tip of the catheter fragment coaxially (fig. a dilator was introduced over the guidewire to eliminate the shoulder between it and the cut catheter end and to allow smooth extraction with minimal injury to the access route. the entire system was successfully extracted by simultaneously withdrawing the snare and dilator through the tract (fig. simple snaring of a stent and catheter fragment resulted in the formation of a right angle between them and the snare axis (figs. owing to this angulation problem, it was necessary to fold the foreign objects prior to their retrieval by means of a simple snare technique ; consequently, a much larger sheath was required for their extraction. in contrast, the coaxial snare technique greatly reduced the angle between the foreign objects and the snare axis, and allowed safe and smooth engagement between them and the sheath (figs. 1b, 2b, 2c). where a larger - bore venous sheath fragment was used, however, the extent to which the angle was reduced was insufficient to permit retrieval through the sheath (fig. although a larger - bore sheath can solve the problem, it carries the risk of vascular injury. as a variant of the coaxial snare technique, we used two access routes, the shorter one for a loop snare and the longer one for the retrieval of the sheath fragment. after capturing the fragment with a loop snare, 3b). in order to eliminate the shoulder between the guidewire and the fragment, and to facilitate smooth extraction, a dilator was then introduced through the sheath over the guidewire, and was tightly engaged with the end of the fragment (fig. case 1. a 48-year - old man with liver cirrhosis which led to massive variceal bleeding was referred to us for a transjugular intrahepatic portosystemic shunt (tips) procedure. after accessing the portal venous system via the right internal jugular route using a colapinto transjugular cholangiography / liver biopsy set (cook, bloomington, ind., we dilated the parenchymal tract between the middle hepatic and left portal vein using a 10 mm - diameter ultrathin diamond balloon catheter (medi - tech / boston scientific, watertown, mass. we tried to place a 10 mm - diameter, 8 cm - long niti - s stent (taewoong, seoul, korea) in the tract, but during deployment it migrated caudad to the main portal vein (fig. a guidewire was inserted into the stent 's central lumen, and an amplatz gooseneck snare, its loop 25 mm in diameter, was introduced over it and positioned around the stent (fig. 4b). after capturing and pulling the far proximal end of the stent by tightening the loop (fig. 4c), we were able to relocate the stent to its appropriate position (figs. 4c, 4d). case 3. a 42-year - old man with chronic renal failure underwent internal jugular venous catheterization at the bedside. during the procedure, the tip of the 8-f internal diameter venous introducer sheath fractured and migrated to the right atrium. because the fragment moved vigorously in accordance with the patient 's heartbeat, it was necessary to prevent its migration to the right ventricle or pulmonary circulation. under fluoroscopic guidance, we inserted a 10-mm gooseneck snare through the right common femoral vein, successfully grasping the fragment and carefully pulling it back into the inferior vena cava (fig. because the fragment was very stiff and its outer diameter was 10-f, it had to be removed without folding. to this end, we used the modified coaxial technique illustrated in the ex - vivo study (figs. 3b, 3c), inserting another 12-f vascular sheath (13 cm in length). the puncture site was more cranial to the previous one, used for insertion of the loop snare ; the central lumen of the fragment was carefully located using an angiographic catheter and guidewire, and the dilator for the vascular sheath was then introduced over the guidewire (fig. after the dilator and the end of the sheath fragment were tightly engaged, the whole system was pulled back until the end of the fragment appeared at the femoral access site. it was grasped with forceps and successfully extracted after release of the loop snare and careful compression of the puncture site (fig. a 51-year - old man with renal tuberculosis underwent periodic tube change under fluoroscopic guidance. the external part of the nephrostomy catheter was resected close to the point at which it entered the body, and during the procedure, the remaining catheter fragment was inadvertently dislodged, entering the nephrostomy tract. we used a homemade loop snare and amplatz gooseneck snare, also employing the ' in - situ loop snare ' technique, as described by savader. (18), but because the fragment was tightly wedged against the wall, were unable to withdraw any part of it (fig., we managed to pass the guidewire through the central lumen of the catheter fragment, inserting the amplatz loop snare over the guidewire and easily capturing the proximal tip of the catheter fragment coaxially (fig. 6b). a dilator was introduced over the guidewire to eliminate the shoulder between it and the cut catheter end and to allow smooth extraction with minimal injury to the access route. the entire system was successfully extracted by simultaneously withdrawing the snare and dilator through the tract (fig. with the increasing use of indwelling catheters and interventional devices, the percutaneous retrieval of iatrogenic foreign bodies has become more common. various techniques for retrieving unwanted objects from various systems have been reported : the devices used include the wire loop snare, retrieval basket, grasping forceps, tip - deflecting wire, pincher device, oversize sheath or catheter, and balloon catheter (1, 3, 4, 8, 14 - 17). since each technique has its own advantages and limitations, the decision as to which one to use in a particular case is reached only after extremely careful consideration. retrieval baskets have proved useful in foreign body removal (1, 8), though there must be a free end or doubled - over segment, and they can not be guided. many types of grasping forceps have been tried (4, 19), a major advantage of these over a snare or basket being their ability to seize a foreign body at its mid portion as well as its free ends. any part of the fragment is caught by alligator jaws and pulled out through a catheter or sheath. however, their large size and rigidity, as well as the potential for damage to the vessel wall, have limited their popular use. oversize sheaths or catheters can be used for the retrieval of foreign bodies such as iatrogenically placed guidewires or their fragments, but their applications are more limited than those of other devices (16, 20). the large number of reports on a variety of retrieval instruments and devices indicate that no particular technique has proven superior in all cases. however, loop snares are the devices most commonly used in retrieving foreign bodies, in part because they are inexpensive and simple, and can be assembled in any angiographic laboratory (1, 2). the snaring technique combines a high degree of success with very little risk of damage, but suffers certain limitations. to ensure a quick retrieval, experience and skill are required, and the outcome is successful only when the foreign body has a free - floating end or doubled - over segment that can be surrounded by the wire loop. because the nature, location and shape of a foreign body varies, so too does the snaring technique applied in a particular case (1, 16, 18, 21 - 23). when snaring of the free tip of a foreign body has failed, preliminary manipulation may be able to reorient or move the object by rotating and pulling it to a more easily accessible position (3, 24). successful preliminary manipulation may involve the use of a catheter, a steerable wire, or grasping forceps. the coaxial snare technique, as used in our cases, is a variant of the loop snare technique, and a number of reports have described its use (8, 9, 25, 26). in most of those cases, however, the guidewires used for deployment were still in place within the lumina of the misplaced stents or catheters. in five of our seven cases, we had no safety guidewire within the lumina of the objects involved, so actively located the central lumen of each object using an angiographic catheter and guidewire. according to our clinical experience and the results of the ex - vivo experimental study, the placement of a guidewire through the center of the objects not only allowed their rapid capture with a loop snare but also greatly reduced the angle between them and the snare axis. not only the use of the coaxial snare technique, but also the engagement of a dilator with the end of a fragmented catheter, eliminated the shoulder between the guidewire and the catheter and allowed its safe and smooth extraction without injury to the access route. however, it is sometimes very difficult to locate the lumen of a free - floating fragment within a greater patulous space ; where patency is impaired, as with a chronically indwelling catheter fragment, it may be impossible. for retrieval of an intravascular foreign body using the coaxial snare technique, the minimum inner diameter of the vascular sheath should be greater than the sum of the outer diameter of the foreign body and the catheter used with the loop snare. in order to minimize the profile of the retrieval system for large - bore intravascular foreign objects, the use of a coaxial system using dual vascular access, as in our case 3, should be considered. using this modified technique, it was possible -although an extra vascular access site was required for the loop snare- to retrieve a large - bore rigid intravascular foreign body without folding it. in this system, since the engaged dilator permits smooth extraction of the fragment through the access site, complete engagement between the fragment and the sheath is not mandatory. the profile of an introducer sheath can thus be minimized : one which is only slightly larger than the outer diameter of the foreign body is suitable. metallic stents are important as remedial components of the vascular, biliary, bronchial, urinary, and gastrointestinal systems. as with any procedure, however, there are potential complications, one of which is stent misplacement or migration. the literature includes cases of stent migration involving the biliary tree (12, 13) and the arterial system (9, 28), and of those which occur during tips procedures (25 - 27), and we have described the use of a loop snare to relocate or retrieve stents misplaced during a tips or pta procedure. the ability to retrieve or relocate misplaced stents improves the safety and efficacy of stenting procedures, and it is important, in case misplacement occurs, to keep the guidewire in place within the stent. technically, snaring and removing a stent by means of the coaxial snare technique is quite simple. to prevent the stent escaping completely, and in order to facilitate passage of the snare loop around it, it is essential that the guidewire remains within the stent throughout the procedure. after snaring its barrel, the stent can be either relocated to the desired position or removed. in some instances, the snare can not be positioned around the leading margin of the stent, a problem which is usually solved by inflating a balloon at its mouth, thus allowing the snare to pass more easily over the margin. broken diagnostic or indwelling catheter is a not uncommon problem, and one which may well arise if a catheter is reused, or stored for a long time. where catheters are broken, or foreign bodies with lumina are present, the coaxial snare technique can be safely used for retrieval. if direct snaring is possible and there is no chance of traumatic injury, the coaxial technique is not necessary. if, however, the lumina of the objects to be retrieved by the guidewire can be located, placement of the loop snare over the objects will be easier, and removal will be safer and smoother, as shown in our ex - vivo study and clinical cases. in conclusion, the coaxial snare technique, an application of the loop snare technique, allowed the safe and effective percutaneous retrieval of tubular foreign bodies or stents, without folding, and traumatic injury to the patient during the procedure was minimized. | objectiveto evaluate the utility and advantages of the coaxial snare technique in the retrieval of tubular foreign bodies.materials and methodsusing the coaxial snare technique, we attempted to retrieve tubular foreign bodies present in seven patients. the bodies were either stents which were malpositioned or had migrated from their correct position in the vascular system (n=2), a fragmented venous introducer sheath (n=1), fragmented drainage catheters in the biliary tree (n=2), or fractured external drainage catheters in the urinary tract (n=2). after passing a guidewire and/or a dilator through the lumina of these foreign bodies, we introduced a loop snare over the guidewire or dilator, thus capturing and retrieving them.resultsin all cases, it was possible to retrieve or reposition the various items, using a minimum - sized introducer sheath or a tract. no folding was involved. in no case were surgical procedures required, and no complications were encountered.conclusionthe coaxial snare technique, an application of the loop snare technique, is a useful and safe method for the retrieval of tubular foreign bodies, and one which involves minimal injury to the patient. |
a 46-year - old gentleman presented with sudden onset of loss of vision following blunt trauma to the right eye. the patient had sustained the injury when he was assaulted with a stone. he had undergone cataract surgery with posterior chamber (pc) iol in the right eye three months ago elsewhere. on examination his visual acuity was perception of light, accurate projection of rays in the right eye and 20/30, n6 in the left eye. anterior segment evaluation revealed iol haptic (" j " type) extrusion through the scleral tunnel with hyphema, aniridia and posterior capsular remnant in the right eye [figs 1,2 ]. his intraocular pressure (lop) was undetectably low in the right eye and 16mmhg in the left eye. he was diagnosed to have traumatic rd with vitreous hemorrhage with iol extrusion with total aniridia. he was advised iol haptic explantation, vitreoretinal surgery with encircling band and silicone oil. intraoperatively, after clearing the vitreous hemorrhage, the total rd was evident, with two peripheral retinal tears. the breaks were well supported after the application of silicon encircling band (mira - 240 with a width of 2.5 mm). hence c 3 f 8 (perfluoropropane) gas was used as a tamponade.. the inferior and nasal 180 posterior capsule was intact and was left behind for a secondary implant later. at six weeks follow - up his best - corrected visual acuity (bcva) was 20/120 + 1, ni0 with aphakic correction. anterior segment evaluation showed aphakia with aniridia and posterior capsular remnant in the right eye [fig. 3 ]. indirect ophthalmoscopy showed attached retina with epiretinal membrane (erm) and mild macular pucker in the right eye [fig. follow - up bcva was 20/80 (hazy), n8 in the right eye with correction. fundus examination showed attached retina with erm and internal limiting membrane striae in the right eye. optical coherence tomography (oct) showed erm and cystoid macular edema (cme). he underwent secondary aniridic pciol (io care baroda ; optic 10 mm, central 2.25 mm opaque with surrounding 5.5 mm clear, a constant 118.2) with erm removal in the right eye under local anesthesia. although a scleral fixated iol was planned, the iol when placed on the inferior capsular rim was found to be stable. the posterior capsule had fibrosed since the injury and hence provided adequate support without the need for scleral fixation. moreover, since the iol was rigid and measured 12.75 mm in length, it was found to be stable in the scleral sulcus. the incision had to be widened to 10 mm to accommodate the iol. at six weeks follow - up his bcva was 20/30 and n6, with -2.00 diopter cylinder x 170 and lop was 15 mmhg. indirect ophthalmoscopy revealed normal disc, macula and attached retina with good buckle effect [fig. optical coherence tomography revealed resolution of cme. at six months follow - up the above findings were maintained. these patients often describe discomfort or difficulty in brightly lit areas, such as on sunny days. a history of blunt trauma besides damage to the iris ; tends to be associated with trauma to the angle or zonules. the most common of these are traumatic cataract, retinal detachment and vitreous hemorrhage. both penetrating and blunt injuries can cause traumatic total iridectomy.1 in our case there was significant damage to the iris with a crescent of posterior capsule intact. iridoplasty, colored contact lenses and corneal tattooing have been developed to overcome the visual function impairments that arise from damage to the iris.2,3 however, when significant amounts of iris tissue are damaged or missing, iris repair may be impossible. in these eyes, several ophthalmologists have used this artificial iris implants called aniridic iol in patients with traumatic and congenital aniridia.4 additional procedures along with iol implantation may be required, including cataract surgery, transscleral iol fixation, keratoplasty and vitreoretinal procedures. a combined aniridic iol implantation and vitreoretinal procedure is possible without significant intraoperative complications.5 a black diaphragm iol design allows simultaneous treatment of aniridia and aphakia6 as was the situation in our case wherein the previously implanted iol had extruded through the scleral tunnel and was removed in the first sitting along with retinal detachment surgery. at the second sitting the aniridic iol the patient did not suffer from any of the complications associated with such similar procedures such as, persistent intraocular inflammation, glaucoma, endophthalmitis and residual photophobia. the patient had good visual recovery, with his vision being 20/30 on his last follow - up six months after the surgery. we present a rare case of traumatic aniridia with vitreous hemorrhage and retinal detachment, in which a good visual outcome was achieved after a combined surgery. after a detailed medline search, there were less than five such cases reported in the literature. both the cost factor and surgical time could be reduced with a combined approach giving an excellent cosmetic, visual and surgical outcome. | a 45-year - old man presented with post - traumatic aniridia. we describe the combined surgery done to treat both aniridia and epiretinal membrane simultaneously. a combined aniridia intraocular lens and vitreoretinal surgery was done. the case report highlights the advantage of combined surgery in terms of cost factor and surgical time. |
hallux valgus (hv) is a common deformity characterized by angulation of the hallux starting at the first metatarsophalangeal (mtp) joint towards the second toe. following the angulation of the first metatarsal bone towards the medial side, lateral deviation and internal rotation through the longitudinal axis occur in the hallux. the incidence of hv has been increasing and, if not treated, it may severely impair a patient s functional status. it is a painful, progressive condition and also negatively affects the appearance of the foot3. intrinsic and extrinsic factors affect the development of hv pathology. extended or extreme pronation of the rearfoot, acquired pes planus, achilles contracture, increased joint laxity, metatarsocuneiform joint hypermobility, low transverse arch, familial factors, increase in body weight, gender, cerebral palsy, and stroke are among the main intrinsic factors4, 5. it has been reported that long term activities carried out in a standing position also increase the intensity of pain1, 3. wearing high heels and shoes constricting the forefoot are among the extrinsic factors that accelerate the development of hv deformity and increase its intensity. therefore, hv has been reported to be more frequent among women and also among individuals living in shoe - wearing societies6, 7. although the underlying mechanisms of hv development have not been not fully elucidated, because it is also seen in non - shoe - wearing societies, it is possible that deformity caused by an underlying mechanism is aggravated by wearing wrong types of shoe, and symptoms may also increase with misuse of shoes7. individuals daily standing times and daily walking distances as well as the types of platforms on which they stand or walk are important factors affecting the intensity of their complaints as well as determining their physical limitations. pain is the most important and the most commonly reported hv - related complaint. pathologies and deformities occurring in the foot, which has an important function in terms of lower - extremity kinematics, cause pain and mobility problems, and may eventually result in insufficiency in physical activity8. furthermore, it was reported that the quality of life of hv patients complaining of both deformity and pain is more negatively affected than that of hv patients with no symptoms. studied osteoarthritis patients over the age of 55 and reported that increasing intensity of comorbid hv deformity has a negative effect on both general and foot - related quality of life9. it was also reported that along with increase in the angulation of the first mtp towards hallux valgus, increase in the intermetatarsal angle also has negative effects on the quality of life10. the aim of the present study was to clinically determine bilateral hv deformity, to present its relationship with changes in the position of the rear foot joints, and to determine its effects on the quality of life, pain, and related functional status of women with hv deformity. the study initially included 32 women with clinically diagnosed hv (age range : 2054 years). inclusion criteria were as follows : age range of 1855 years, bilateral deformity with right - dominance, first mtp angle of > 15 as radiologically determined by the referring physician, deformity intensity > 2 based on the manchester scale, muscle forces on ankle and foot > 4, no history of surgery, and no systemic disease, neurological, cognitive, mental, or psychological problems. informed consents were obtained from each participant and also permission from the local ethics committee was obtained (lut 09/37 - 26). demographic data (age, height, and body weight), symptoms accompanying deformity (hallux bunion and flatfoot), and familial hv history were recorded. the reason for this was because right - dominant people form the majority (90%) of the general population11 and the preferred cerebral lateralization status is related to foot and hand dominancy. in order to confirm the lower extremity dominancy of the participants, they were asked to stand still before stairs. then, they were commanded to climb and the first foot they used was recorded. the patients who used their right foot four or more times out of five trials were classified as right - dominant12. the mancester scale, developed by garrow, was used to determine the severity of the hv deformity of the participants. on the manchester scale, which is a valid and reliable clinical tool, the severity of deformity is determined by comparing the patient s foot with standardized images of feet with four grades of hv and the deformities are classified into four groups, as follows : none (1), mild (2), moderate (3), and severe (4)13. after evaluation the scale, lovett, was conducted for muscle groups (m. tibialis anterior, m. extensor digitorum communis, m. extensor hallucis longus and brevis, m. triceps surae) that may have an impact on the lower extremity, and thus walking and that cause secondary pathological changes in the foot and ankle. those participants with a muscle strength lower than 4 were excluded from the study14. hv angles were determined by measuring the angle between the axes of the first metatarsal and proximal phalanx at the dorsum of the foot and were recorded as in degrees15, 16. the results of goniometric measurement, which is a simple, low - cost, and risk - free measurement method, were found correlate with pain and the inter - metatarsal and inter - phalangeal angle, which are indicators of the level of deformity. it was also presented that this is a valid and reliable measurement method for measuring joint movement17. navicular height (nh) is the elevation of the navicular tuberosity from the ground in the full weight - bearing position18, 19. sagittal displacement of the navicular tuberosity may reflect extreme subtalar joint pronation, and thus insufficient support of the ligaments and muscle tendons in the medial longitudinal arch20. furthermore, it may show the degree of plantar flexion of the talus, which provides stabilization through subtalar joint pronation, on the calcaneus21. in the literature, nh has been reported to range between 6 3.4 and 9 4.2 mm. in a sitting position, in the sagittal plane, the difference of the height of the navicular bone between the subtalar neutral non - weight - bearing - position and the 50% weight - bearing position is called the navicular drop (nd). in the literature, an nh value of 15 mm or more is accepted as abnormal, and the normal value of nd is about 10 mm22. for the nh measurements, the height of the navicular tuberosity from the ground was measured using a caliper and recorded in millimeters. nh values were measured for both the left and right feet in both the weight - bearing and non - weight - bearing positions. the subtalar angle (sta) used to determine rearfoot rotation (valgus / varus), and is defined as the angle between the longitudinal line dividing the calcaneus midline and the line that bisects the distal third of the leg20. furthermore, sta, which is also defined as the angle between the upper achilles tendon and the distal extension of the rearfoot in a weight - bearing position to diagnose a normal foot when it is 04, physiological flatfoot when it is 520, and pathological flatfoot when it is over 2023. in the present study, sta values of the patients of left and right foot were measured using a goniometer in both weight - bearing and non - weight - bearing positions. the angular deviations towards varus were recorded as and those towards valgus were positive values recorded as. visual analog scale (vas) was used to determine the maximum pain level that individuals felt during walking due to hv deformity. the patients were asked to mark the level of pain they felt on 100 mm horizontal line for each foot and the point they marked was recorded in millimeters24. to evaluate the function affected by pain and deformity, scales developed by the american orthopaedic foot and ankle society (aofas) with established validity and reliability were used the aofas - hallux metatarsophalangeal - interphalangeal (mtp - ip) scale and the mid - foot scale (mf). using the aofas hallux mtp - ip scale, the pain around the mtp joint and its related functional impact as well as the alignment of the mtp joint were determined. using the aofas mf scale, pain, functional status and alignment in the mid - foot region were determined. the score range was from 0 to 100 with lower scores indicating greater deformity25. using the foot function index (ffi), information regarding the level of pain individuals felt during various activities (9 questions), difficulties individuals experience (9 questions), and related activity limitations (3 questions) was obtained. the index has 21 questions in 3 sections and patients are asked to state their condition on a scale of 0 to 10. section scores are calculated by dividing the total score of each section with the total number of questions included in the section and multiplying the result by 100. total scores are similarly calculated by adding up all the scores and dividing the total by the number of questions and multiplying the result by 100, and higher scores indicate greater pain / symptom26. the sf-36 survey was used to evaluate the participants health - related quality of life. sf-36 is a self - reported questionnaire which is composed of 36 items classified into 8 domains, namely, vitality, physical functioning, bodily pain, general health perceptions, physical role functioning, emotional role functioning, social role functioning, and mental health. the most distinctive feature of sf-36 is that it measures physical functioning and related abilities. the sub - scales evaluate health on a range from 0 to 100 ; 0 indicates poor health and 100 indicates the mean and range were used for variables obtained by direct measurement and frequency values were calculated for distributions of the categorical data. correlation analysis was used to investigate the relationships of hv deformity angle with pain, measurements regarding the position of the rearfoot, function, and the quality of life. since the data were not normally distributed, spearman s correlation coefficient was used. correlation values 0.4 were considered satisfactory (r 0.811.0 excellent, 0.610.80 very good, 0.410.60 good, 0.210.40 fair, and 0.000.20 poor). the mean age, height and weight of the participants were 40.5 10.3 years, 165.7 4.8 cm, and 69.7 11.1 kg, respectively. family histories of the patients showed that 16 patients (59.3%) had a family history of hv and 18 patients (66.7%) had a family history of bunions. patients hv angles, levels of pain, nh (weight - bearing and non - weight - bearing) and sta are presented in table 1table 1.mean and standard deviation (sd) values of the measures (n=27)mean sdhallux valgus angle ()non - weight - bearingright29.6 7.1left34.1 6.2navicular height (mm)weight - bearingright3.4 0.5left3.4 0.6non - weight - bearingright4.0 0.6left4.1 0.5subtalar angle ()weight - bearingright8.0 2.9left9.1 2.9non - weight - bearingright3.6 2.4left3.4 2.3pain (vas) mmduring walkingright4.5 2.8left6.2 2.8significant difference, p 0.05) ; however, there was a mild negative correlation between sub - domains of sf-36, namely physical role (r=0.433, p= 0.024), pain(r = 0.534, p= 0.004) and social function(r = 0.499, p= 0.008), and hv angle (p < 0.05). hv deformity is the most common painful condition affecting the foot and causes functional restrictions. most studies of hv patients have reported the results of interventions to decrease deformities and surgical treatments. however, therefore, our focus was on the effects of hv deformity on pain, rearfoot mechanics, functional status and quality of life. we included only female hv patients because it is known that hv is more prevalent among females than among males. this difference in prevalence may be due to tight shoes being preferred by females as well as structural differences1, 3. roddy. investigated the relation between age and hv in women and found that, compared to the below-40 age group, hv prevalence was 1.76 times higher in the 4049 age groups and 3.5 times higher in the 5059 age groups6. the mean age of the participants in the present study was 40.5 10.3 years. although hv is more prevalent in older age groups, the high prevalence that we observed in this young adult group, although the number of subjects in this study was not large enough to draw a conclusion, was surprising. the reason for this finding may be that the incidence and onset of deformities have been shifting towards younger ages in industrializing societies. it may also be related to increasing body weight and decreasing functional activity. in the present study, based on the determination of the position of the navicular bone with respect to the feiss line, all of the participants were found to have flatfoot with varying degrees from mild to severe. furthermore, based on the results of sta and nh, which are used to investigate the rearfoot mechanics, we found rearfoot over - pronation in the weight - bearing position in most of the participants. wong reported that flatfoot, which is caused by posterior tibial tendon dysfunction, causes abductor hallucis muscle dysfunction and thus prolonged and excessive pronation occurring in the subtalar joint results in structural flexibility in the foot, which results in the vulnerability of the foot to mechanical forces and shocks29. although our hypothesis was that angular values of the left and right feet and related parameters would not differ from each other, interestingly, the hv angle and sta / vas results show that the pathology of the left foot was more severe in the participants of the present study. the severity of deformity of the left foot may be associated with the fact that all participants were right - dominant. this result may mean that, in right - dominant patients the left foot is subjected to different load patterns and thus its load - handling capability is lower, and because of that it is prone to deformity. although the number of patients in this study was not sufficient enough to draw conclusions, the results highlight the importance of not ignoring the left foot in right - dominant patients. however, the result that angular values obtained for the left foot were higher than those of the right foot and that the increase in these values negatively affects the rear foot position, functional status, and quality of life, supports our hypothesis. in other words, the increase in the hv angle differentiates the left foot with regard to three sub - scales of ffi, total scores of aofas hallux mtp - ip and aofas - mf, and the physical role, pain, emotional role sub - domains of sf-36 indicating a decrease in functional status and the quality of life. in the present study, the results for the dominant foot demonstrate that the level of deformity in the foot that is dominant in functional activities and related functions and quality of life are affected less than expected. on the other hand, the results for the non - dominant foot show increase in hv deformity angle yields increased pain, and foot - specific functional status and general quality of life deteriorate due to pain and progressive deterioration in foot biomechanics. when healthcare professionals who are specialized in foot health, pathologies, deformities and treatment are making a treatment plan for hv, they should approach the patient holistically, and remember that the pathology may affect the patient s physical, emotional and social functions as well as the symptoms they perceive. we think that the results of the present study will guide future studies. this study had a limited scope as the entire group of participants comprised female cases. among the limitations of the present study are the low number of patients included in the study and lack of radiological data, which is considered the golden standard in the literature, for determining the level of deformity. | [purpose ] to investigate the relationship between hallux valgus (hv) deformity and the position of rearfoot joints, and its effects on the quality of life, pain, and related functional status of women with bilateral hallux valgus (hv). [subjects and methods ] the subjects were 27 right - dominant women. demographic data, hv angle, weight - bearing and non - weight - bearing subtalar pronation (sp), and navicular height were recorded. visual analog pain scale, foot function index (ffi), and the american orthopaedic foot and ankle society (aofas) first metatarsophalangeal- interphalangeal (mtp - ip) and aofas mid foot (mf) scales, and sf-36 were also used. [results ] hv angle, weight - bearing sp, and pain intensity of the left foot were higher. hv angle of left foot was correlated with all sub - scales of ffi, the pain parameter of aofas mtp - ip, and pain and total scores of aofas - mf scale. hv angle of the left foot correlated with physical role, pain, and social function sub - domains of sf-36. right hv angles were correlated with right foot pain and non - weight - bearing sp. [conclusion ] increasing hv angle and pathomechanical changes in the rear foot are correlated, resulting in increasing pain and thus decreasing functional status as well as decreasing quality of life. although all the participants were right - dominant, their left foot problems were more prominent. |
atrial septal defect (asd) is a form of congenital heart defect that enables blood flow between two compartments of the heart called the left and right atria. normally, the right and left atria are separated by a septum called the interatrial septum. if this septum is defective or absent, then oxygen - rich blood can flow directly from the left side of the heart to mix with the oxygen - poor blood in the right side of the heart, or vice versa.1 asd is one of the most common congenital cardiac defects and accounts for approximately 610% of all congenital cardiac defects.2 young children with asd are usually asymptomatic and could wait for elective surgical or catheter - based closure for 3 years or more.34 shunts from asd are usually detected in childhood or young adulthood. the defect is generally well tolerated in infants and young children, but symptoms of mild fatigue, poor growth or dyspnoea on exertion may be present.5 therefore, early closure could be beneficial for such infants. if the asd is small, it may not require any intervention, or it may close on its own. asd, and therefore the shunt, tends to increase with age, and repair usually takes place when asd is diagnosed.5 in asymptomatic patients with a large left - to - right shunt, surgical closure should be performed between 2 and 5 years of age.6 asd is not without morbidity. about 40% of such patients may present with cryptogenic stroke at adulthood ; paradoxical embolism has also been reported.7 surgical repair of asd is a well - established procedure and is very safe, with a negligible mortality rate.8 transcatheter occlusion of an asd was first described by king and colleagues in 1976.9 although satisfactory results have been reported with transcatheter occlusion of these defects with a number of devices, only one of them has received food and drug administration (fda) approval : the amplatzer atrial septal occluder (aga medical corporation ; golden valley, minn10). this study is carried out to determine the pattern and clinical profile of children with asd. it is also aimed at determining the different types of interventions done for these patients and their complications. the study was conducted at a paediatric cardiac centre, innova heart hospital, hyderabad, india, established in 2007. the hospital records showed that from april 2007 to june 2011, a total of 69 patients underwent surgical closure of asd. chinese duct occluder manufactured by shanghai shape memory alloy material co., ltd,11 which consists of metal mesh woven by nitinol wires with shape memory function, supper elasticity and polyethylene filled mesh. the occluder device has specifications of 4/6, 6/8, 8/10, 10/12, 12/14, 14/16 and 16/18 mm (diameter of waist pulmonary arterial end / diameter of aortic end), with lengths between 7 and 8 mm. the delivery system consists of loading sheath, delivery sheath and control wire, on the top of which there are screw threads. the diameter of outer sheath is 6 - 10 f. other duct occluders also included 4. the ado12 received fda approval with the specific indication for nonsurgical closure of patent ductus arteriosus. this device is a self - expandable device made from a nitinol wire mesh and polyester fabric. as the occluder is implanted, it expands outward, and the wires push against the rims of the asd. the operation was performed after puncture and systemic heparinisation (100 iu / kg). intra - operative, intravenous administration of antibiotics was started and continued for 24 hours to prevent infection. for infants, the operation was performed under general anaesthesia, whereas for older children, it was done under courteous sedation. record showed that 69 patients presented with asd and underwent interventional closure of the defect during the study period. forty (58%) patients were females while 29 (42%) patients were males, giving a male to female ratio of 1:1.4. their age ranged from 3.2 to 19 years, with a median age of 9.0 years. their weight ranged from 7.5 to 39.0 kg, whereas median weight was 31.5 kg. five patients (7.2%) were young children aged between 3 and 5 years [table 1 ]. forty - four (63.8%) of these children presented with symptoms of heart failure, whereas 47 (68.1%) of the cases repaired were large - sized asd. the majority had large - sized asd, whereas small asd accounted for 1.4% of cases. clinical profiles of asd and procedures used for repair the device used for the procedure was further shown to have a success rate of 88.4%, as shown in table 2. the most common interventional closure procedures done were searcare heart and amplatzer technique with a highest success rate obtained in 2010 [table 3 ]. this is in keeping with other studies.1314 the reason for this preponderance could be genetic., a common genetic variation near a gene called msx1 is strongly associated with the risk of asd, and females with asd may have more of this variation near msx1 than their male counterpart.15 we noted that majority of our patients with asd presented with symptoms of heart failure. majority of young children with asd are usually asymptomatic and could wait for elective surgical or catheter - based closure for 3 years or more. however, some infants with asd who suffer from congestive heart failure, frequent respiratory infection, failure to thrive and progressive moderate - to - severe pulmonary hypertension do so because of late presentation.16 a good number of our patients had a large - sized asd, which explains why we have so many symptomatic patients in our study. it is the degree of shunting that predisposes to increased pulmonary flow and subsequent cardiac decompensation. the aso is a self - expanding double - disc device with a central connection waist to stent the asd. preliminary human experience regarding its safety and efficiency in closing asd has been very encouraging.171819 the aso is one of the most frequently used devices to close asd and has been proven to be highly effective and safe in the short term. previous reports have confirmed that transcatheter closure of asd with the aso achieved comparable efficacy and safety to that of surgical closure. it has some additional advantages, which include less complication rate, requirement of a shorter hospital stay and avoidance of a permanent scar.20 this is true because we had little or no complications in our patients and their hospital stay was short. the procedure is done in the hybrid theatre or cardiac catheterisation laboratory and requires a team that includes an interventional radiologist or interventional cardiologist. the capital outlay may be more expensive than that in open surgical programme, thereby making the unit cost of interventional treatment higher on the average. asd is a common congenital heart disease with a high success rate for those who underwent surgery. the use of aso percutaneous closure devices has become the procedure of choice for closure of asd in suitable patients. | background : atrial septal defect (asd) is a congenital heart defect that leads to shunting of blood between left and right atria. it may be asymptomatic and sometimes may present with heart failure. surgical repair is definitive, but currently non - surgical procedure is used to close the defect.materials and methods : it is a retrospective study of patients who underwent transcatheter closure of asd at innova heart hospital, hyderabad, india. echocardiography was repeated at intervals of 24 hours, then at 1, 3 and 6 months after the procedure to assess complications. the morphological characteristics of the asd, including its diameter, location, shape and the width of surrounding septal margins, were also evaluated.results:from april 2007 to june 2011, 69 consecutive children (29 males, 40 females) with a median age of 9.0 years (range = 3.219 years) registered with diagnosis of asd. the median weight was 31.5 kg (range = 7.539.0 kg). five patients (7.2%) were young children aged 35 years. forty - four (63.8%) of these children presented with symptoms of heart failure, whereas 47 (68.1%) of the cases repaired with device were large - sized asd. the most common interventional procedures done were searcare heart and amplatzer technique with a highest success rate obtained in 2010.conclusions:asd is a common congenital heart disease with a high success rate for those who undergo intervention. |
although uncommon, leydig cell testicular neoplasms are the most common sex cord - stromal tumors and comprise 13% of all testicular neoplasms. the majority have been recognized in males between the ages of 20 and 60 years. the malignant variants occur only in adults and metastasis is the major criterion of malignancy. malignancy has not been reported in leydig cell tumors in children. it is thought that an endocrine role may contribute to the development of these tumors. they have a tendency to cause endocrine manifestations, and testicular swelling, decreased libido (20%) and gynecomastia (15%) are common symptoms in adults [4, 5 ]. leydig cell tumors were once managed primarily with radical orchiectomy [68 ]. however, testis sparing surgery has been used increasingly in both the adult and pediatric populations. here we report a new case with bilateral testicular leydig cell tumor in order to review the clinical, diagnostic and therapeutic aspects of this uncommon tumor. a 30-year - old patient presented with a complaint of infertility since two years of marriage. physical examination of the external genitalia revealed atrophic left testis and no palpable tumor mass and a solid painless mass in the upper right testicular pole in the patient. bilateral testicular tumor was shown by scrotal doppler ultrasound examination, which originated from the bilateral mediastinum testis. hormonal assay showed normal plasma levels of -fetoprotein (afp), -human chorionic gonadotropin (hcg), lactate dehydrogenase (ldh), estradiol, prolactin, follicle - stimulating hormone (fsh), luteinizing hormone (lh) and serum testosterone. the patient underwent bilateral radical orchiectomy ; because both tumors originated from the mediastinum testis, testis sparing surgery was not performed. a frozen section during surgery from the bilateral testis was suggestive for leydig cell tumor which was confirmed by histopathological examination showing bilateral leydig cell tumor of the testis. the gross examination of the right testis showed a well - circumscribed, brown homogeneous solid mass with soft consistency measuring 2.5 cm in diameter. the microscopic examination revealed a nodular pattern of large polygonal cells with round nuclei and eosinophilic cytoplasm (fig. tunica albuginea and spermatic cord involvement were not seen ; however, rete testis involvement was identified (fig. immunohistochemically, the tumor cells were positive for inhibin-, melan - a and cd56, but negative for acth and p53 (fig. h&e, 200 rete testis involvement, h&e, 100 melan - a immunoreactivity in tumor cells, 200 cd 56 immunoreactivity in tumor cells, 100 inhibin- immunoreactivity within the tumor cells (modified avidin biotin complex method / abc), 400 the tumor in the left testis was 2.5 cm in diameter. histopathological features of the left testicular tumor were similar to the tumor in the right testis. there was no disease recurrence in follow - up for 9 months and the patient is currently disease - free and under androgen supplementation for androgen insufficiency. for example, excessive stimulation of leydig cells with luteinizing hormone due to a disorder of the hypothalamic - pituitary axis may induce their oncogenesis. animal models have also demonstrated leydig cell tumorigenesis following long - term estrogen administration. although these tumors usually secrete testosterone, the production of estrogen, progesterone, and corticosteroids has also been shown. estrogen excess and feminizing syndromes may occur from the peripheral aromatization of testosterone or from the direct production of oestradiol by the tumor itself. in 20% of the cases, increased oestradiol and decreased testosterone levels result in feminization in the adult and masculinization in the child. the endocrinological manifestations may precede the palpable testicular mass, which is the most common presenting feature. presented the largest case study of leydig cell tumor and 32% of the patients referred for a testicular mass, 8% for gynaecomastia, 8% for testicular pain, 11% for infertility and 5% for isosexual pseudo - puberty. testicular tumor markers (-hcg, ldh, afp) were negative in all patients and one patient with gynecomastia showed high preoperative testosterone levels. in our case no hormonal abnormality was present, serum tumor markers were in the normal range, and palpable testicular mass was the only manifestation of the tumor. in pure leydig cell tumors, levels of serum tumor markers such as serum fetoprotein (afp), human chorionic gonadotropin (-hcg), and lactate dehydrogenase (ldh) must be within the reference range. but in most cases, patients present with an incidental finding of a testicular mass on scrotal ultrasonography during evaluation of hydroceles or varicoceles or during diagnostic workup for infertility, as in our case. giannarini. in a series with 17 patients with no bilateral lesions found that 5 patients (29.4%) presented with primary infertility, 4 (23.5%) with gynecomastia and 2 (11.8%) after selfpalpation of a scrotal mass. in the remaining 6 patients (35.3%) boys with estrogen - secreting tumors may present with feminizing symptoms such as gynecomastia or breast tenderness. adults with androgen - secreting tumors are generally asymptomatic. but in adults with estrogen - secreting tumors, loss of libido, erectile dysfunction, and infertility have been observed. scrotal ultrasonography is performed to confirm the diagnosis and most of the tumors are hypoechoic and show hypervascularization [9, 10 ]. mri may be an alternative diagnostic tool for small nonpalpable leydig cell tumors not otherwise visible on sonograms. if malignancy is suspected ct scanning of the abdomen and chest radiography are indicated. as in all intrascrotal tumors, the final diagnosis is based on the histopathological findings after removal of the tumor. macroscopically, leydig cell tumors present as well - circumscribed, yellow to brown masses within the testicle. microscopically, these tumors are composed of large, closely packed cells with eosinophilic cytoplasm, bland nuclei, and small nucleoli. reinke crystals are pale staining, cylindrical, rectangular, or rhomboid inclusions that are pathognomonic for leydig cell tumors and are found in up to 30% of patients with such tumors. all definitive diagnoses interpreted the neoplasia as benign lct using the criteria originally proposed by kim., which included dimensions (maximum neoplasia diameter), the presence of infiltrating margins and extratesticular extension, atypias, the presence of necrosis and of angioinvasion, and high mitotic index. leydig cell tumors have been primarily managed with radical inguinal orchiectomy [6, 9, 12 ]. however, conservative management with testis sparing surgery in younger adults and children were reported in the literature [8, 10 ]. inguinal orchiectomy should be performed with early control of the spermatic cord and without violation of the scrotal skin. testis sparing surgery with enucleation of the mass has been reported in children and younger adults in order to maintain fertility [1315 ]. bilateral radical orchiectomy was performed in our case ; because both tumors originated from the mediastinum testis, testis sparing surgery could not be performed. chemotherapy with the bleomycin - etoposide - platinum regimen used for germ cell malignancies has limited efficacy in managing malignant leydig cell tumors. the tyrosine kinase inhibitor imatinib has shown some chemotherapeutic activity in animal models, although this was not demonstrated in human trials. observation is sufficient in patients in whom a benign leydig cell tumor is treated with radical inguinal orchiectomy. patients with malignant tumors require regular follow - up imaging, including ct scanning of the chest and abdomen. metastatic sites include the liver (45%), lungs (40%), and bone (25%). in the review of the literature, there is no proven treatment of choice in case of progressive disease making any one superior to the others (surgery, radiotherapy and chemotherapy). on the other hand, when there are no metastases and there is no evidence of malignancy, a regular follow - up is preferred by clinical examination, ct scan or ultrasound of the abdomen and by measuring the testosterone and estradiol levels because of the risk of metastases many years after orchiectomy even in a histologically bland tumor. late onset of metastasis, up to 8 years after orchiectomy, has been reported, which supports the recommendation of long - term tumor surveillance for 10 - 15 years after surgery. the mean survival in patients with a malignant variant is 23 years [2, 3, 18 ]. | leydig cell tumors are rare testicular tumors of the male gonadal interstitium. although uncommon, leydig cell testicular neoplasms are the most common sex cord - stromal tumors and comprise 13% of all testicular neoplasms. this tumor is always benign in children and approximately 90% are benign in adults. in most cases, patients present with an incidental finding of a testicular mass on scrotal ultrasonography during evaluation of hydroceles or varicoceles or during diagnostic workup for infertility. leydig cell tumors have been primarily managed with radical inguinal orchiectomy. however, conservative management with testis - sparing surgery in younger adults and children were reported in the literature. here we report a case of bilateral leydig cell tumor of the testis treated with radical orchiectomy who presented with the complaint of infertilityand no disease recurrence in followup for 9 months. the patient is currently disease - free and under androgen supplemantation for androgen insufficiency. we recommend complete exam and diagnostic workup in patients with infertility and azoospermia. |
the perioperative behavioural studies demonstrate that children are at greater risk of experiencing turbulent anaesthetic induction and adverse behavioural sequelae. furthermore, children admitted to hospitals are displaced from their comfort zone of home and family. proper pre - operative planning is necessary to minimize adverse psychological effects in children during the entire perioperative experience. the ideal premedicant should have a rapid and reliable onset, minimal side effects, rapid recovery and should facilitate smooth induction of anaesthesia. midazolam is currently commercially available as oral preparation, but the intravenous formulation by the oral route has been found to be more reliable and effective. a dose of 0.250.5 mg / kg of midazolam orally has proven to be efficacious in children with fewer side - effects. a stabilised form of chloral hydrate, triclofos sodium is an older nonopiate, nonbenzodiazepine oral sedative - hypnotic drug used for paediatric sedation in a dosage of 40100 mg / kg for years. the oral solution is well - absorbed and produces hypnosis for 68 h. the study was designed to compare the effects of midazolam and triclofos sodium when given as oral premedication in children. the primary objective was the sedative effect after premedication, and the secondary objectives were the anxiolytic effect at the time of separation of children from parents and at the time of mask application during induction of anaesthesia. a written and informed consent was obtained from the parents of all children after explaining the nature of the study. in this prospective, randomised and double - blind study, sixty children of either gender participated in the study. children 0.5 mg / kg did not provide additional sedation or anxiolysis but caused side effects such as loss of balance and head control as well as dysphoria and blurred vision. the authors concluded that oral midazolam 0.5 mg / kg is a safe and effective premedication and its use as early as half an hour is acceptable. in another randomised, double - blind, placebo - controlled study of 124 children, an oral dose of 0.5 mg / kg midazolam was required to produce adequate sedation. they also found that there was no prolongation of time to discharge and no likelihood of overnight admission. hence, in our study, we selected oral midazolam 0.5 mg / kg 30 min before the induction of anaesthesia. intravenous preparation of midazolam was used by mixing it in a palatable vehicle and used orally. the parenteral preparation mixed with fruit juice without pulp (orange juice) to make it palatable so that each millilitre contained 1 mg of midazolam hydrochloride. the intravenous formulation by the oral route has been found to be more reliable and effective when compared to the oral formulation. one of the limitations of our study was the alteration in drug absorption based on ph changes induced by the diluent orange juice which was not addressed. to assess sedation and anxiety at their peak effects of drugs, we compared the sedation score at fixed time after each premedication. we also compared the behaviour of the children during separation from parents (separation anxiety) and co - operation inside the theatre while placing the face mask during induction. some investigators have found that anxiety scores and behaviour at induction were not different in children receiving placebo or oral midazolam (0.3 mg / kg) 83 38 min before induction of anaesthesia, but addition of chloral hydrate produced more calm and asleep patients at induction of anaesthesia. in a similar clinical study where both midazolam and chloral hydrate administered 65 12 min before induction found good anxiolysis in chloral hydrate group compared to midazolam group. they attributed the effect to the same time of administration of both the drugs. in our study majority of children were adequately sedated (awake, calm and quiet) in the midazolam group compared to triclofos sodium group which was found to be statistically significant. this observation was similar to a study where majority of children were awake, calm and quiet (25/27) in the midazolam group compared with trimeprazine (12/28). the mean duration from the administration of midazolam to separation was 33.83 1.42 min in this study. we found that most of the children who received oral midazolam were awake calm and quiet, easily separable and readily accepted the mask in the operation theatre. the time interval between drug administration to separation was limited to 3040 min which was similar to another study. in this study, the mean duration from the administration of triclofos sodium to separation was 64.16 1.80 min. the children were asleep, calm and quiet and easily separable from parents and cooperative in the operation theatre. thus, we found that both drugs are good agents for premedication in children, and an absolute silence was maintained in the pre - operative room. on comparing the separation scores, we found that there were equal numbers of children with successful separation in both groups (96.66%) only one child in each group had unsuccessful separation (3.33%). oral midazolam provided rapid anxiolysis, little sedation and easy separation within 30 min. because of the short half - life oral midazolam, it is an ideal drug for children coming for short procedures and day stay anaesthesia where excessive sedation has to be avoided. one study found that oral triclofos provided better sedation as compared to midazolam and midazolam premedicated children accepted the face mask better as compared to triclofos premedicated children. another study found midazolam and triclofos as equally effective in producing anxiolysis at the time of separation from parents. this is also in concordance with a study which found that midazolam premedication is better when compared to triclofos or promethazine for providing sedation and anxiolysis. even though midazolam and triclofos are considered as safe premedicants, two studies have described restlessness, in 15% patients in midazolam and triclofos group. we found no side effects attributable to oral midazolam and triclofos in the present study. the advantage of oral midazolam was that the children were adequately sedated, but it also reduced separation anxiety and improved the quality of induction of anaesthesia in the theatre. in addition, no adverse effects were seen in the group, and the premedicant was safe in children. | background and aims : the perioperative behavioural studies demonstrate that children are at greater risk of experiencing turbulent anaesthetic induction and adverse behavioural sequelae. we aimed to compare the efficacy of midazolam 0.5 mg / kg with triclofos sodium 100 mg / kg as oral premedication in children undergoing elective surgery.methods:in this prospective, randomised and double - blind study, sixty children posted for elective lower abdominal surgery were enrolled. the patients were randomly divided into midazolam group (group m) and triclofos sodium group (group t) of thirty each. group m received oral midazolam 0.5 mg / kg 30 min before induction, and group t received oral triclofos sodium 100 mg / kg 60 min before induction. all children were evaluated for level of sedation after premedication, behaviour at the time of separation from parents and at the time of mask placement for induction of anaesthesia. mann whitney u - test was used for comparing the grade of sedation, ease of separation and acceptance of face mask.results:oral midazolam produced adequate sedation in children after premedication in comparison to oral triclofos (p = 0.002). both drugs produced successful separation from parents, and the children were very cooperative during induction. no adverse effects attributable to the premedicants were seen.conclusions:oral midazolam is superior to triclofos sodium as a sedative anxiolytic in paediatric population. |
a point mutation in the beta - globulin gene alters the hemoglobin structure and results in chronic hemolytic anemia and increased blood viscosity. this leads to an heterogeneous phenotypic spectrum : increased morbidity and mortality is due to a higher susceptibility to infections, intermittent vaso - occlusive events and ischemic tissue injury with progressive organ dysfunction.1 hematopoietic stem cell transplantation (hsct) is the most consolidated curative treatment.2 when considering hsct for scd patients, expected scd morbidity should be balanced against the risk of transplant related mortality and morbidity, keeping in mind that scd is a disease with a life expectancy of over 50 years with contemporary treatment.3 more than 200 matched sibling donor (msd) transplants after a myeloablative conditioning regimen based on busulfan and cyclophosphamide were reported. the limitations associated with this strategy are the significant regimen related toxicity and the risk of graft failure. the transplant associated mortality is around 28% and graft failure is observed in around 1015% of patients.4,5,6,7,8,9,10,11 although better outcomes have been recently reported with the use of targeted busulfan therapy, the use of busulfan - based conditioning regimen is established only in the setting of msd transplant and only few scd patients in need of a hsct have a matched sibling available.12,13,14,15 the use of alternative donors such as matched unrelated donor (mud), mismatched unrelated donor (mmud), unrelated umbilical cord blood (ucb) and haploidentical family members is associated with higher mortality and morbidity, due to pre - existing organ dysfunction, alloimmunisation and risk of gvhd.2,16 moreover, suitable matched unrelated donors are difficult to find and experience is limited for umbilical cord blood or haploidentical donor hsct.17,18,19,20,21 in order to overcome the limitations of busulfan - based conditioning regimen and allow the use of alternative donors, different conditioning strategies have been proposed.22,23 recently, treosulfan became attractive to substitute busulfan due to its lower toxicity and good immune suppressive and myeloablative potential.24,25,26,27,28 this led to the use of treosulfan in patients with pre - existent morbidity (mainly primary immune deficiency or -thalassemia) or receiving a second transplant for malignant disorders.25,29,26,30,31,32,33,34,35 for these reasons, since 2010, at our institution busulfan was substituted with treosulfan as standard conditioning regimen for scd patients. we present our single - centre experience of hsct performed for scd patients employing treosulfan - based conditioning regimen also in haploidentical and mud hsct. from april 2010 to december 2015, all scd patients undergoing hsct at the pediatric hematology - oncology unit of the university of padova received a treosulfan - based conditioning regimen and are described in this retrospective cohort study. eligibility for hsct was determined on the basis of published guidelines and criteria included cerebral vasculopathy, recurrent episodes of acute chest syndrome (acs) or vaso - occlusive crises despite hydroxycarbamide treatment.36 donors were chosen on the basis of availability and considered in the following order : msd, mud, haploidentical donor and mmud. the preferred stem cell source was bone marrow or umbilical stem cells for msd, bone marrow for mud and t - depleted peripheral blood stem cells for haploidentical donors and mmud. the use of a combination of umbilical cord blood and bone marrow was employed in msd hsct if the cellularity of the umbilical cord graft was low.20 before t - cell depleted or mud hsct, autologous bone marrow stem cells were harvested and cryopreserved in order to be re - infused in case of graft rejection, due to the higher risk of this event after t - cell depletion.37 all patients received either red cell exchange transfusion or simple transfusion the day before the start of conditioning regimen in order to obtain a proportion of hbs < 30% and an hb level the haploidentical donors underwent pbsc collection after mobilization with subcutaneous filgrastim 10 g / kg twice daily from day -5 to day -1 and once on the day of collection. pbsc were collected using a cobe spectra apheresis system (bct terumo, lakewood, co). t - cell depletion was performed by removing tcr positive and cd19 positive cells through immuno - magnetic selection (clinimacs ; miltenyi biotec, bergisch gladbach, germany). all patients received thiotepa (8 mg / kg or 10 mg / kg in 2 doses on day -7), treosulfan (14 g / m2/day for 3 days from day -6 to day -4) and fludarabine (40 mg / m / day for 4 days from day -6 to day-3).29 fresenius anti - thymocyte globulins (atg) at the dose of 20 mg / kg / day were administered for 3 days in msd and mud transplants and 5 mg / kg / day for 4 days in t - depleted transplants. patient 8 and patient 11 received rituximab (200 mg / m) at day -1 to reduce the risk of ebv reactivation and gvhd after hsct.38 graft - vs - host disease (gvhd) prophylaxis for t - replete transplants consisted in short term methotrexate (10mg / kg for 4 doses), cyclosporine 1 mg / kg / day on days -7 to -2, and cyclosporine aiming at a pre - dose level of 100200 g / l for 6 months post hsct. the supportive measures, diagnosis and treatment strategy for acute gvhd employed at our institution were recently described.39 engraftment and chimerism were serially tracked after hsct. samples were obtained every 23 weeks up to day + 100 and monthly thereafter up to 18 months post - transplant in patient with complete donor chimerism. adverse events were graded according to common terminology criteria for adverse events (ctcae) v4. neutrophil and platelet recovery were defined as a neutrophil count 0.510/l for 3 consecutive days and as a platelet count 5010/l independently of platelet transfusions for 7 consecutive days. organ function was assessed pre - transplant and every year post - transplant by pulmonary function testing, echocardiography, growth and puberty evaluation and hormonal dosage (estradiol / testosterone, fsh, lh, t4 and tsh levels). transcranial doppler ultrasonography (tcd) was performed for all patients prior to the initiation of chronic transfusion and pre - hsct ; data were evaluated according to the criteria defined by the stop trial.40 brain magnetic resonance imaging (mri) and magnetic resonance angiography (mra) were performed pre - transplant, and repeated one year post transplant and every two years thereafter if lesions were detected. mri and mra were evaluated according to a standardized scoring system.41,42 cerebral vasculopathy was defined as abnormal transcranial doppler velocity associated with cerebral artery stenosis. immune reconstitution was evaluated by total lymphocyte count, cd4 + cell count and immunoglobulin dosage. data were recorded at day + 30, + 90, + 180 and + 365. eleven consecutive children affected by scd (7 females, 4 males) were transplanted at the pediatric hematology - oncology unit of the university of padova. the origin of patients was african (n = 6), caucasian (n = 4) or caribbean (n = 1). patient and transplant characteristics are summarized in table 1. seven patients were diagnosed at birth due to family history, the remaining at their first disease manifestation, between 7 month and 5 years of age. the hb genotype was hbss (n = 10) or hbs0 (n = 1, p7). before transplant patients were treated with chronic transfusion (n = 7), monthly red cell exchange transfusion (n = 2) and/or hydroxycarbamide (n = 5). patients were eligible for hsct due to cerebral vasculopathy (n=7), recurrent episodes of acute chest syndrome (acs) or vaso - occlusive crises despite hydroxycarbamide treatment (n = 4). patient 7 suffered also from recurrent splenic sequestration.36 the median age at hsct was 6.5 years (range : 416.3 years). at the time of hsct, only two patients had significant comorbidities : relapsing autoimmune hepatitis (p8) and an association of chiari i malformation and syringomyelia (p11). donor source was an hbs / a msd (n = 5), an hba / a msd (n = 2), a haploidentical hbs / a parent (mother, n = 1 and father, n = 1), hba / a mud (n = 1) or hba / a mmud (n=1, 8/12 hla loci donor / recipient matching). stem cell source was bone marrow (n=6, median total nucleated cells, tnc = 4,9 10 ^ 8/kg), combined bone marrow and umbilical cord blood (n=2, median tnc for bone marrow = 2,67 10/kg ; median tnc for cord blood = 2,44 10/kg) or peripheral blood stem cells (pbsc) (n=3, two haploidentical grafts and one mud graft, median cd34 + cells = 14,3 10/kg). one apheresis was sufficient to reach the target dose of cd34+cell (10 10/kg recipient) in both haploidentical donors. all patients achieved neutrophil and platelets engraftment at a median of 20 days (range : 1534 days) and 22 days (range : 1231 days) from hsc infusion, respectively iv non hematological toxicity occurred in 2 patients and consisted in grade iv stomatitis in one patient and acute disseminated encephalomyelitis in one patient. grade i ii gastrointestinal acute gvhd was diagnosed in 3 patients (haploidentical transplant, n = 1 ; mud transplant, n = 1, mmud transplant, n=1). these patients were successfully treated with calcineurin inhibitors (n = 3), steroid (n = 1) and extracorporeal photochemotherapy (n = 3) as per institutional protocol.39 no grade iii iv acute gvhd or chronic gvhd were observed. no secondary graft failure was observed. full donor chimerism was demonstrated in 6/11 patients and stable mixed chimerism was observed in 5/11 patients (45%). donor hematopoiesis ranged from 37% to 90%, but did not affect the hbs proportion : hbs was absent after a transplant from hba / a mud (n=1) or compatible with hbs carrier (median 40.5%, range 40.341,4%) in patients transplanted from a hbs / a msd (n=4). the lymphocyte count reached normal values for age at day + 180 in all patients except p11. median time to reach a cd3+cd4 + cell count higher than 400/l was 148 days for t - replete grafts (range 57203 days) and 245 days (range 237253 days) for t - deplete grafts. immunoglobulin replacement was necessary only in one patient (p11) who experienced ebv reactivation and received one dose of rituximab. despite serial monitoring no viral reactivation no episode compatible with acute chest syndrome, stroke or other sickle cell disease manifestation occurred. no patient experienced renal or hepatic dysfunction following transplantation. five patients had alteration on the pre transplant mri and evaluable data on follow - up (table 3). resolution or improvement of the vascular stenosis was detected in 3/5 patients. last post - transplant evaluation was performed after a median of 1315 days (range : 2681417). post - transplant lung function evaluation was performed in 7 patients (p13 and p58) and was normal for all of them after a median of 1104 days from transplant (range 3692304 days). hormonal function was evaluated in 7 patients (p13 and p58) after a median of 804 days from transplant (range 2051518 days). puberty was evaluable in 4 patients (p1, p2, p5 and p8 : 1 male and 3 females) : 3 had normal pubertal development and 1 patient (p8) experienced secondary gonadal failure. follow - up echocardiography (data available for 7 patients) and eye examination (data available for 5 patients) were normal. eleven consecutive children affected by scd (7 females, 4 males) were transplanted at the pediatric hematology - oncology unit of the university of padova. the origin of patients was african (n = 6), caucasian (n = 4) or caribbean (n = 1). patient and transplant characteristics are summarized in table 1. seven patients were diagnosed at birth due to family history, the remaining at their first disease manifestation, between 7 month and 5 years of age. the hb genotype was hbss (n = 10) or hbs0 (n = 1, p7). before transplant patients were treated with chronic transfusion (n = 7), monthly red cell exchange transfusion (n = 2) and/or hydroxycarbamide (n = 5). patients were eligible for hsct due to cerebral vasculopathy (n=7), recurrent episodes of acute chest syndrome (acs) or vaso - occlusive crises despite hydroxycarbamide treatment (n = 4). patient 7 suffered also from recurrent splenic sequestration.36 the median age at hsct was 6.5 years (range : 416.3 years). at the time of hsct, only two patients had significant comorbidities : relapsing autoimmune hepatitis (p8) and an association of chiari i malformation and syringomyelia (p11). donor source was an hbs / a msd (n = 5), an hba / a msd (n = 2), a haploidentical hbs / a parent (mother, n = 1 and father, n = 1), hba / a mud (n = 1) or hba / a mmud (n=1, 8/12 hla loci donor / recipient matching). stem cell source was bone marrow (n=6, median total nucleated cells, tnc = 4,9 10 ^ 8/kg), combined bone marrow and umbilical cord blood (n=2, median tnc for bone marrow = 2,67 10/kg ; median tnc for cord blood = 2,44 10/kg) or peripheral blood stem cells (pbsc) (n=3, two haploidentical grafts and one mud graft, median cd34 + cells = 14,3 10/kg). one apheresis was sufficient to reach the target dose of cd34+cell (10 10/kg recipient) in both haploidentical donors. all patients achieved neutrophil and platelets engraftment at a median of 20 days (range : 1534 days) and 22 days (range : 1231 days) from hsc infusion, respectively. no patient experienced primary graft failure. iv non hematological toxicity occurred in 2 patients and consisted in grade iv stomatitis in one patient and acute disseminated encephalomyelitis in one patient. grade i ii gastrointestinal acute gvhd was diagnosed in 3 patients (haploidentical transplant, n = 1 ; mud transplant, n = 1, mmud transplant, n=1). these patients were successfully treated with calcineurin inhibitors (n = 3), steroid (n = 1) and extracorporeal photochemotherapy (n = 3) as per institutional protocol.39 no grade iii iv acute gvhd or chronic gvhd were observed. full donor chimerism was demonstrated in 6/11 patients and stable mixed chimerism was observed in 5/11 patients (45%). donor hematopoiesis ranged from 37% to 90%, but did not affect the hbs proportion : hbs was absent after a transplant from hba / a mud (n=1) or compatible with hbs carrier (median 40.5%, range 40.341,4%) in patients transplanted from a hbs / a msd (n=4). the lymphocyte count reached normal values for age at day + 180 in all patients except p11. median time to reach a cd3+cd4 + cell count higher than 400/l was 148 days for t - replete grafts (range 57203 days) and 245 days (range 237253 days) for t - deplete grafts. immunoglobulin replacement was necessary only in one patient (p11) who experienced ebv reactivation and received one dose of rituximab. despite serial monitoring no viral reactivation no episode compatible with acute chest syndrome, stroke or other sickle cell disease manifestation occurred. no patient experienced renal or hepatic dysfunction following transplantation. five patients had alteration on the pre transplant mri and evaluable data on follow - up (table 3). resolution or improvement of the vascular stenosis was detected in 3/5 patients. last post - transplant evaluation was performed after a median of 1315 days (range : 2681417). post - transplant lung function evaluation was performed in 7 patients (p13 and p58) and was normal for all of them after a median of 1104 days from transplant (range 3692304 days). hormonal function was evaluated in 7 patients (p13 and p58) after a median of 804 days from transplant (range 2051518 days). puberty was evaluable in 4 patients (p1, p2, p5 and p8 : 1 male and 3 females) : 3 had normal pubertal development and 1 patient (p8) experienced secondary gonadal failure. follow - up echocardiography (data available for 7 patients) and eye examination (data available for 5 patients) were normal. we report a retrospective case series of 11 scd patients who received hsct after a treosulfan - based conditioning regimen. stable mixed chimerism was detected in a significant proportion of patients (45%), did not change after the discontinuation of immunosuppressive treatment and resulted in a cure of scd for all patients. previous experiences have demonstrated that full donor chimerism is not needed to cure scd due to the survival advantage for donor red cell in peripheral blood : pulmonary, gonadal and central nervous system status can be significantly ameliorated also when stable mixed chimerism is obtained.43,44,45,46,47 indeed, no clinical manifestation correlated with scd occurred after hsct in our cohort. since cerebral vasculopathy was the cause for transplant in 7 patients, we focused our attention on the evaluation of tcd and brain mri and mra. chronic transfusions resulted in normalization of pre - transplant tcd in all patients receiving this treatment. post - hsct mra data, evaluated with a standardized scoring system, were available for 5 patients and showed either a stabilization of the stenosis or amelioration. although improvement in vascular stenosis has been previously described in patients treated with chronic transfusion, hydroxycarbamide or hsct, the rate of improving patients in our cohort compares favorably with previous reports.37,48,49,50,51 these satisfactory outcomes could be possibly due to the screening program for cerebral vasculopathy performed at our center that led to the fact that all patients were transplanted before any clinically evident stroke.42 the safety profile of treosulfan conditioning regimen was excellent and incidence of adverse events was comparable to previous reports : no transplant - related mortality was observed and grade iii iv non hematological toxicity was limited to mucositis which resolved completely without sequelae.25,26 the neurological event in our case series can not be attributed with certainty to the treosulfan conditioning. this toxicity profile is similar to results obtained in adult patients transplanted after a non - myeloablative conditioning.52,53,54,55 grade i ii acute gvhd was observed in 3/11 patients in our cohort (27%) with no grade iii the gvhd cases were all among patients receiving an alternative donor transplant, no gvhd was observed among the 7 patients receiving a msd hsct and all the patients experiencing gvhd responded rapidly to first line treatment. to the best of our knowledge, data regarding organ damage related to hsct has not been previously reported for scd patients undergoing hsct after a treosulfan - based conditioning regimen. in our cohort, the decline in pulmonary and renal function observed after busulfan - based conditioning regimen was not present and growth, thyroid and cardiac function were preserved after hsct.37,43 although 3 patients had normal pubertal development, 1 patient that had reached puberty before hsct and for whom pre - transplant ovarian cryopreservation was performed, experienced secondary gonadal failure. this event highlights the opportunity to attentively evaluate possible long term effects on reproductive health and propose mitigating strategies before hsct.56 current knowledge about outcomes of treosulfan based conditioning regimen in scd is limited to a single - center experience reporting 15 patients who received a msd or mud hsct.26 we have nearly doubled the number of reported patients and we have described the use of treosulfan - based conditioning regimen for mmud or haploidentical donor hsct, which are considered investigational approaches in scd.16,37,57 to mitigate the risk of rejection and gvhd, tcr+ and cd19 + cell depletion was performed.38 in the mmud setting, this approach was reported as safe and efficacious for patients with acute myeloid leukemia or hurler syndrome but no scd patient has been described yet.58,59 if further investigations will confirm its feasibility and efficacy, haploidentical or mmud hsct in scd may open the possibility of cure for many patients without a msd or mud donor available.17,18,19 when employing alternative donors, a higher risk of gvhd and delayed immune reconstitution should be taken into account ; however, in our experience, these drawbacks can be managed by supportive therapy and are outweighed by the satisfactory outcomes. although pbsc mobilization with g - csf in hbs heterozygous parents is often perceived as risky, no significant adverse events were reported and, in our experience, both the haploidentical donors underwent pbsc mobilization and collection safely.60,61 the main limitation of our study is its retrospective nature and the report of a single center experience ; sample size was also limited and warrants further confirmation. moreover, in order to perform the tcr and cd19 depletion, a facility with experience in stem cell manipulation is needed. our data show that hsct after treosulfan based conditioning regimen for scd patients is effective and associated with low toxicity. end organ damage may be halted or even ameliorated as shown by the regression of cerebral vessel stenosis and white matter changes. this strategy is suitable also for alternative donor transplants and, if our data are confirmed in larger cohorts, could pave the way for expanding the access to hsct also to scd patients lacking a matched sibling or matched unrelated donor. | background and objectiveslack of suitable donors and regimen related toxicity are major barriers for hematopoietic stem cell transplantation (hsct) in patients with sickle cell disease (scd). the aim of the study is the assessment of efficacy and toxicity of treosulfan - based conditioning regimen for scd also when alternative donors such as mismatched unrelated donor and haploidentical donor are employed.methodswe report our single - center experience : 11 patients with scd received hsct with a treosulfan / thiotepa / fludarabine / anti - thymoglobulin conditioning regimen between 2010 and 2015. the donor was a matched sibling donor (n= 7), a haploidentical parent (n= 2), a matched unrelated donor (n= 1) or a mismatched unrelated donor (n=1). the haploidentical and mismatched unrelated donor grafts were manipulated by removing tcr and cd19 positive cells.resultsall patients survived the procedure and achieved stable engraftment. stable mixed chimerism was observed in 5/11 patients. grade iii iv regimen related toxicity was limited to mucositis and no grade iii iv graft - versus - host disease (gvhd) occurred. no scd manifestation was observed post transplant and cerebral vasculopathy improved in 3/5 evaluable patients. organ function evaluation showed no pulmonary, cardiac or renal toxicity but gonadal failure occurred in 1/4 evaluable patients.conclusionour data suggest that treosulfan is associated with low toxicity and may be employed also for unrelated and haploidentical donor hsct. |
the patient was prepared in the prone position over the radiolucent chest frame in a flexed position. the head and the upper back should be placed slightly lower than the lower back and buttocks for sufficient circulation of the head when the systolic blood pressure should be maintained at 90100 mmhg to reduce bleeding from the surgical field. the hip was flexed naturally about 70 and the knee needed to be protected with soft pillows. the surgeon examined the pressure under the patient 's knees by inserting the hand under the patient 's knees and made the hip and knee comfortable. if too tight, the patient would feel and complain anterior pain of the hip and knee within a few postoperative days. fluoroscopic confirmation of a certain level should be made before incision. using a 22-gauge spinal needle, dyeing of the disc was performed with indigo carmine just lateral side of the superior articular process at the disc level under the guidance of a 30 rotated fluoroscopy (fig. 1) to locate the torn site of the annulus or ruptured disc material under the scar tissue. two standard entry points on the skin were made at the upper and lower end margins of the inter - lamina space just beside the spinous process. the closer to the medial side of it, the better and wider the view on the inner side of the spinal canal. the mid - position was already covered by granulation tissue after the previous surgery and normal anatomic barrier of ligamentum flavum was absent. surrounding nominated structures were already imbedded by scar tissue so that there was no suspected referencing landmark just as in the primary surgery. bone touching on the lamina by a blunt dilator for making working space and water flow was the important step. the scar tissue was scratched off on the dorsal surface and medial edge of the lamina until a shaver and a radiofrequency device differentiated it from the naked bony margin of the lamina. scar release should be done from the medial side of the facet, distal lamina and then proximal lamina so that the dura under the heavy scar could be retracted medially with less tension from the surrounding scar tissue. an attempt was made to trace the bony margin of the pedicle to the base where adhesiolysis was performed in a piecemeal fashion with a freer and small - headed (2 mm) angled curette until the dye - tinged annulus or ruptured disc was exposed. an additional root retractor was not necessary due to the magnified view if the distal and proximal release from the lamina was done. there was little bleeding from the scar tissue so that the general field was far clearer than the primary surgery. so repeated probing under the dura and just beneath the torn site of the annulus was necessary. forceful irrigation of the inner side through the torn annulus and by a syringe with a long elastic needle should be followed to remove remnant fragments. if the causative fragment was successfully removed, pulsation of the dura and root could be observed. if there was no pulsation after removing of some fragments, the release state of the basal adhesion of the dura and root at the distal side should be confirmed again. the patient was prepared in the prone position over the radiolucent chest frame in a flexed position. the head and the upper back should be placed slightly lower than the lower back and buttocks for sufficient circulation of the head when the systolic blood pressure should be maintained at 90100 mmhg to reduce bleeding from the surgical field. the hip was flexed naturally about 70 and the knee needed to be protected with soft pillows. the surgeon examined the pressure under the patient 's knees by inserting the hand under the patient 's knees and made the hip and knee comfortable. if too tight, the patient would feel and complain anterior pain of the hip and knee within a few postoperative days. fluoroscopic confirmation of a certain level should be made before incision. using a 22-gauge spinal needle, dyeing of the disc was performed with indigo carmine just lateral side of the superior articular process at the disc level under the guidance of a 30 rotated fluoroscopy (fig. 1) to locate the torn site of the annulus or ruptured disc material under the scar tissue. two standard entry points on the skin were made at the upper and lower end margins of the inter - lamina space just beside the spinous process. the closer to the medial side of it, the better and wider the view on the inner side of the spinal canal. the mid - position was already covered by granulation tissue after the previous surgery and normal anatomic barrier of ligamentum flavum was absent. surrounding nominated structures were already imbedded by scar tissue so that there was no suspected referencing landmark just as in the primary surgery. bone touching on the lamina by a blunt dilator for making working space and water flow was the important step. the scar tissue was scratched off on the dorsal surface and medial edge of the lamina until a shaver and a radiofrequency device differentiated it from the naked bony margin of the lamina. scar release should be done from the medial side of the facet, distal lamina and then proximal lamina so that the dura under the heavy scar could be retracted medially with less tension from the surrounding scar tissue. an attempt was made to trace the bony margin of the pedicle to the base where adhesiolysis was performed in a piecemeal fashion with a freer and small - headed (2 mm) angled curette until the dye - tinged annulus or ruptured disc was exposed. an additional root retractor was not necessary due to the magnified view if the distal and proximal release from the lamina was done. there was little bleeding from the scar tissue so that the general field was far clearer than the primary surgery. due to the heavy scar, the mainly ruptured fragment might be missed at the initial probing. so repeated probing under the dura and just beneath the torn site of the annulus was necessary. forceful irrigation of the inner side through the torn annulus and by a syringe with a long elastic needle should be followed to remove remnant fragments. if the causative fragment was successfully removed, pulsation of the dura and root could be observed. if there was no pulsation after removing of some fragments, the release state of the basal adhesion of the dura and root at the distal side should be confirmed again. in this study, the bess was performed under about 28 to 35 times magnification and very bright illumination of 2,700 to 6,700 lux. these conditions were sufficient to enable differentiation of adhesive scar tissue surrounding neural structures from bony structures. in addition, the view was not fixed by a microscope and panoramic view could be obtained with free moving of an endoscope and dynamic handing of instruments without any disturbance by soft tissue retractors. this newly introduced technique is not yet prevalent and has not been recommended especially for revision surgery. until accustomed to the magnified endoscopic view and new anatomy, the surgeon is advised to dye the disc to make a reference point on the over - clouded scar tissue. differentiation of the scar tissue should be initiated from the bony margin of the lamina. the bony surface of the lamina should be exposed from the proximal to the distal of the facet for the dura to be totally released from the scar tension. this would help the dura and the root to avoid excessive tension during insertion of various instruments into the small gap. the scar tissue of soft tissue was clearly differentiated from the bony tissue under the endoscopic view so that the abutting margin between them was easily diverged by curetting. in order to protect the neural tissue, deeper intrusion along the bony surface from the facet to the base of the pedicle should be performed ; however, care should be taken not to go deeper inside while dividing the center of the scar tissue. by follow the bony tissue to the base of the pedicle, the disc level can be easily differentiated. the remnant disc fragments under the dura and torn disc space could be eliminated by forceful saline irrigation. after removal of the ruptured fragments, the traversing root should be decompressed by adhesiolysis from the basal scar tissue and distal laminectomy until pulsation of the dura and root could be felt under endoscopic visualization. even without the use of an additional root retractor for achievement of proper visualization, inlets should be located closely medial to the spinous process. the bess also has a weak point : due to the use of water, minor bleeding could completely block the view of the surgical site. radiofrequency devices with a big head could generate higher energy that could cause the muscle to twitch backward excessively before sufficient coagulation. however, the small - tipped radiofrequency device could coagulate only the bleeding foci or epidural vessels one by one with lower energy. if the surgical field becomes blurred, fluent water flow and minor bleeding should be checked first. the potential benefits of bess include preservation of the facet joint, obtainment of the working space through trimming of the lamina, and adhesiolysis of the dura without restriction. the range of view in the floating technique of bess is much wider than that of the conventional peld with a docking technique into the base of the lesion. this technical aspect can make quiet different results and overcome the limitation of the conventional peld. an adhesive surgical scar could make it harder to observe the base of the pedicle. repeated and aggressive retraction of the dura and traversing root during probing under the dura could result in battered root syndrome or a dura tear in olm. however, bess with sufficient magnification for inspection of the base facilitates probing and discectomy even through a very little space without a root retraction. insertion of a certain instrument can widen the view to examine the base of the pedicle and annulus. the 1.5 mm - diametered, upbite, pituitary dually plays as a retractor by turning its back on the dura and a grasper with medial rotation and insertion under the dura ; therefore, the small space is sufficient for the instrument to probe and remove the disc fragments. obtainment of a clear surgical field under water by control of epidural bleeding and bone bleeding is essential for successful performance of bess. if the surgical view were turbid due to bleeding, the procedure could not proceed any more. care should be taken not to raise the saline bag higher or compress it to make the turbid and blurred field washed out to see the structures more clearly. the outflow is narrower when an instrument is inserted and the pushed saline could go higher to the epidural space. then, the patient could feel and complain discomfort and pain in the neck due to the increased intracranial pressure. if lots of small bleeding from the fibrous scar tissue and trimmed cancellous bone surface could not be controlled in the early stage of learning curve, it is advised to ask an anesthesiologist to maintain systolic pressure below 100 mmhg just as in shoulder arthroscopy. the systolic pressure of 100120 mmhg of the arm in the prone position could mean much higher pressure in the back. bess in revision for recurrent ldh could permit wider microscopic decompression of a traversing root through successful removal of causative disc fragment. delicate and gentle handling of the neural structures in the surgery could also decrease the risk of over - manipulation by forceful retraction for visualization through tight scar tissue in a very narrow surgical field in revision surgery. therefore, bess could provide an enough working space and a sufficiently magnified and brightly illuminated view. we believe bess could be a viable alternative for recurrent ldh to the conventional olm or fusion surgery. | the major problems of revision surgery for recurrent lumbar disc herniation (ldh) include limited visualization due to adhesion of scar tissue, restricted handling of neural structures in insufficient visual field, and consequent higher risk of a dura tear and nerve root injury. therefore, clear differentiation of neural structures from scar tissue and adhesiolysis performed while preserving stability of the remnant facet joint would lower the risk of complications and unnecessary fusion surgery. biportal endoscopic spine surgery has several merits including sufficient magnification with panoramic view under very high illumination and free handling of instruments normally impossible in open spine surgery. it is supposed to be a highly recommendable alternative technique that is safer and less destructive than the other surgical options for recurrent ldh. |
a prospective clinical trial was conducted on a consecutive series of the patients with primary io overaction or secondary overaction due to superior oblique palsy. institutional review board approval was obtained and signed informed consent was obtained from all participants in accordance with the declaration of helsinki. exclusion criteria included presence of dvd, history of simultaneous or previous strabismus and/or ocular surgery, inadequate follow up, and concurrent conditions that might influence results such as eyelid anomalies and orbital disease. the patients who did not cooperate enough for taking measurements were also excluded such as small children and the patients with low vision who could not fixate properly. all patients received a thorough ophthalmic examination 1 day before surgery and 3 months thereafter. overaction of io was determined as overelevation in adduction and graded by a scale ranging from 0 to + 4. output measurements were consisted of pf, margin reflex distance (mrd) 12, lower lid function (llf), hertel value, and lower lid crease (llc). pf was measured by assessing the distance between the upper and lower eyelid margin at the point that bisected the light reflex on the cornea. mrd-1 represented the distance from the corneal light reflex to the upper eyelid margin whereas mrd-2 represented the distance to lower eyelid margin. llf was assessed by measuring eyelid excursion from extreme upgaze to extreme downgaze while holding the head still. hertel mirror exophthalmometer was used to measure the protrusion of the glob from the lateral orbital rim. all the stable measurements were taken by a handheld ruler while the patient sitting upright and fixating with that eye to a penlight held at 50 cm in front of the patient. all preoperative and postoperative measurements were always performed by the same examiner, who did not know the details of patients. to increase the reliability of the measurements, all were taken twice and the average value used, if there was any inconsistency a third measurement was considered. the hyperdeviation was measured with prism and cover test or with krimsky test if corrected visual acuity was inadequate for prism and cover test. all preoperative and postoperative examinations and measurements were made by the same observer, who was not masked to the data. all surgeries were done using a similar technique which was first described by elliot and nankin. in this original procedure, io was sutured just anterior to the insertion of the inferior rectus muscle ; however, we sutured the io posterior to the inferior rectus insertion. in brief, a lid speculum was inserted and the globe was maximally elevated and adducted. polyglactin 6 - 0 sutures were placed in the io near its insertion, with locking bites on either edge. then, the muscle was freed and the anterior arm of the suture was placed posterior to the temporal edge of the inferior rectus muscle insertion. the posterior arm was placed temporally and posteriorly within 23 mm [fig. 1 ]. hence, the new direction of the io insertion was also different from the original procedure of elliot and nankin. in original technique, the new io insertion should be just anterior but parallel to the inferior rectus insertion. the anterior arm of disinserted inferior oblique muscle placed 12 mm posterior to lateral edge of inferior rectus insertion. the posterior arm was placed temporally and posteriorly within 23 mm to anterior arm the differences of the collected data were calculated for statistical significance using the wilcoxon test. all surgeries were done using a similar technique which was first described by elliot and nankin. in this original procedure, io was sutured just anterior to the insertion of the inferior rectus muscle ; however, we sutured the io posterior to the inferior rectus insertion. in brief, a lid speculum was inserted and the globe was maximally elevated and adducted. polyglactin 6 - 0 sutures were placed in the io near its insertion, with locking bites on either edge. then, the muscle was freed and the anterior arm of the suture was placed posterior to the temporal edge of the inferior rectus muscle insertion. the posterior arm was placed temporally and posteriorly within 23 mm [fig. 1 ]. hence, the new direction of the io insertion was also different from the original procedure of elliot and nankin. in original technique, the new io insertion should be just anterior but parallel to the inferior rectus insertion. the anterior arm of disinserted inferior oblique muscle placed 12 mm posterior to lateral edge of inferior rectus insertion. the differences of the collected data were calculated for statistical significance using the wilcoxon test. a total of 19 eyes of 16 consecutive patients who met the criteria were included. the mean age of the patients was 8.7 7.1 years, with a range of 223 years. seven eyes (36.8%) of 4 cases had primary io overaction, while 12 eyes (63.2%) of 12 cases had secondary overaction due to superior oblique palsy. the surgery was performed unilaterally for one case with bilateral asymmetric primary io overaction because this case had severe amblyopia in that eye. the median preoperative grade of io overaction was 3.5 (ranging from 3 to 4), which decreased to 0 (ranging from 0 to 2) (p 0.05). comparable to our results, no postoperative pf asymmetry has been reported by goldchmit., after io anterior transposition in patients with unilateral io overaction. in their technique, the disinserted io was sutured adjacent to the lateral end of inferior rectus insertion bunched with one suture. they noted slight lower lid curvature deformity on forced upgaze in four of ten patients. farvardin and nazarpoor have observed mild fullness in 25% of the patients with superior oblique palsy following anterior transposition surgery in which the disinserted io was sutured just anterior to the lateral of inferior rectus insertion. however, they did not reported any elevation of lower lid on upgaze in their patients. however, kushner has mentioned that anterior transposition of the inferior io caused a narrowing of the pf and this could be cosmetically noticeable. he compared postoperative pf of patients who underwent io transposition surgery with control group who underwent standard recession without transposition. in this work, the outcomes of transposition surgery were evaluated in two separate groups in first group the io was placed at the level of inferior rectus insertion and in second group the io was placed 2 mm anterior to inferior rectus insertion. compared with the control both groups showed significant decrease in pf and gonzlez and cinciripini reported elevation deficiency, elevation of lower lid on upgaze and reduced inferior scleral show in the eyes following anterior transposition in which io reinserted 3 mm posterior from the limbus in the line of lateral edge of inferior rectus insertion. they speculated that the reason for lower lid elevation to be the advancement of the capsulopalpebral fascia extending to inferior rectus. some studies have reported that io transposition of 1 mm or more anterior to the inferior rectus muscle insertion as well as the lateral spreading of the posterior fibers more than 2 mm at the new insertion are risk factors for complications of this surgery such as anti - elevation syndrome and hypotropia. the lower lid elevation and fullness in lower lid on upgaze also noted more in this augmented anteriorization procedures. kushner demonstrated that if the posterior fibers of io are inserted more distant from the lateral extremity of the inferior rectus insertion, the effect on limitation of elevation would be greater, because these new fibers become more stretched. those cases can not be compared with ours because we performed anteriorization surgery in which io was placed posterior to the lateral end of the inferior rectus insertion thus, the posterior fibers had minor anteriorization. postoperatively no significant change on lower lid configuration and function parameters were observed in our patients. the small sample size and the parameters depending on patients cooperation such as pf, llf are main limitations of this study. we tried to overcome this issue by including only cooperative patients and using the average of two compatible measurements. due to close anatomic relationship of io with lower lid retractors, it is rational to expect an alteration of lower lid configuration and functioning with io surgery. in this study, we did not observe any significant effect on lower lid parameters with io anterior transposition in which we placed the io posterior to inferior rectus insertion. however, the alteration of these parameters might be more noticeable particularly in patients with greater degrees of anterior transpositions in which io placed anterior to inferior rectus insertion. placing the io posterior to the inferior rectus insertion avoiding further anterior transposition may enable successful surgical outcomes without any effect on eyelid configuration and functioning. further observations should also be done on a larger number of patients to confirm the effect of io anterior transposition on the eyelid tissues. | purpose : to evaluate the alteration of lower lid configuration and function with anterior transposition surgery of the inferior oblique (io) muscle.patients and methods : a prospective clinical trial was conducted on a consecutive series of patients underwent anterior transposition of the io as a sole operation. all patients received a thorough ophthalmic examination 1 day before and 3 months after surgery. output parameters were consisted of palpebral fissure, margin reflex distance 12, lower lid function, hertel value, and lower lid crease. the differences of the collected data were calculated for statistical significance by using the wilcoxon test.results:a total of 19 eyes of 16 consecutive patients were included. the median preoperative grade of io overaction was 3.5 (ranging from 3 to 4), which decreased to 0 (ranging from 0 to 2) postoperatively (p 0.05).conclusion : in this study, no significant effect on lower lid configuration and function was observed following io anterior transposition in which the disinserted muscle was placed posterior to inferior rectus insertion. |
this investigation was approved by the institutional review board of the catholic university of korea, seoul, korea, and followed the tenets of the declaration of helsinki. patients with glaucoma that met the inclusion criteria were consecutively included from patients examined for glaucoma at the glaucoma clinic of seoul st. inclusion criteria were best - corrected visual acuity of 20/40 or better, spherical equivalent within 7 spherical diopters (d) and 3 d cylinder. the inclusion criteria were eyes with a normal open angle, and the presence of a glaucomatous optic disc, such as diffuse or focal rim thinning, notching, optic disc hemorrhage, retinal nerve fiber layer (rnfl) defect with a corresponding vf defect meet our criteria for parafoveal scotoma (pfs) or peripheral nasal step (pns). patients with uveitis or diseases that may affect the peripapillary or macular area, or medication that may influence visual acuity were excluded. when both eyes met the inclusion criteria, one eye per subject was randomly selected for the study. all patients had performed complete ophthalmic examinations, including slit - lamp biomicroscopy, goldmann applanation tonometry, gonioscopy, axial length measurement, central corneal thickness measurement, and dilated fundus biomicroscopy. all participants underwent stereoscopic optic disc photography. using cirrus spectral - domain optical coherence tomography (sd - oct) version 6.0 (carl zeiss meditec, inc., dublin, ca, usa) the cirrus sd - oct automatically detects the center of the disc and then draws a circumpapillary circle (radius, 1.73 mm) from the cube data set for rnfl thickness analysis. poor - quality images with a signal strength less than 6, misalignment, or overt decentration of the measurement circle location, were discarded. average (360 measure), superonasal (91135), nasal (136225), inferonasal (226270), inferotemporal (271315), temporal (31645), and superotemporal (4690) rnfl thickness was used in the current study. retinal nerve fiber layer thickness of each sector was estimated by integrating the clock hour rnfl thickness from the cirrus oct. we used these sectors in accordance with the structure function correspondence map suggested by garway - heath. 1). (a) pattern deviation plot divided into two subfields of the humphrey vf. the parafoveal scotoma group included abnormal points within 12 points of a central 10 radius (dashed line). the peripheral nasal step group had abnormal points within 12 nasal peripheral points (dotted line) in one hemifield. (b) structure function correspondence map according to garway - heath. sn, superonasal ; n, nasal : in, inferonasal ; it, inferotemporal ; t, temporal ; st, superotemporal. all participants performed sap using 24 - 2, the sita standard program with a humphrey field analyzer (carl zeiss meditec, inc.). frequency doubling technology perimetry was performed using the 24 - 2 strategy with 5 stimuli and a spatial frequency of 0.5 cycles / deg, with temporal frequency of 18 hz with the fdt humphrey matrix (carl zeiss meditec, inc.). short - wavelength automated perimetry was examined with the 24 - 2 sita program of the humphrey field analyzer. each of the blue goldmann size v targets was displayed on a 100 cd / m yellow background. in all types of vf testing, the mean deviation (md) and pattern standard deviation (psd) were evaluated. on the pattern deviation plot, the percentages of significantly depressed vf points at p 0.05). with regard to fdt, the relationship between the average rnfl thickness and overall ms was significant in the pfs group (linear, r = 0.239, p = 0.003 ; second - order polynomial, r = 0.240, p = 0.014 ; logarithmic, r = 0.239, p = 0.003). there was no significant correlation between rnfl thickness and global ms for swap in all regression analyses (p > 0.05). function relationship between global mean sensitivity of vf and average rnfl thickness scatterplots showing the relationships between the global ms (db) of the vf and average rnfl thickness in patients with the pns (a, c) and pfs (b, d). global ms was measured by sap (a, b) and fdt (c, d). regression analyses with p 0.05). with regard to fdt, the relationship between the average rnfl thickness and overall ms was significant in the pfs group (linear, r = 0.239, p = 0.003 ; second - order polynomial, r = 0.240, p = 0.014 ; logarithmic, r = 0.239, p = 0.003). there was no significant correlation between rnfl thickness and global ms for swap in all regression analyses (p > 0.05). function relationship between global mean sensitivity of vf and average rnfl thickness scatterplots showing the relationships between the global ms (db) of the vf and average rnfl thickness in patients with the pns (a, c) and pfs (b, d). global ms was measured by sap (a, b) and fdt (c, d). table 4 shows the topographic structure function relationships between rnfl thickness and sap or fdt, and swap parameters in six vf sectors. in the pns group, superotemporal (r = 0.300, p = 0.001) and inferotemporal (r = 0.302, p = 0.001 ; fig. 4) rnfl thicknesses showed a linear relationship with the corresponding vf sensitivities in sap. significant correlations (r) between superotemporal and inferotemporal rnfl thicknesses with regional vf sensitivity were found for fdt and swap. structure function relationship between regional vf sensitivity measured with sap or fdt or swap and the corresponding peripapillary rnfl thickness structure function relationship between sectoral vf sensitivity (db) and the corresponding rnfl thickness in patients with the pns (a, b, d, e) and pfs (c, f). regression analyses with p 0.05). in addition, the temporal rnfl thickness of the pfs group showed no significant correlation with the corresponding ms in sap (linear and nonlinear regression analyses, all p > 0.05). poor correlations were found previously in the temporal sector between rnfl thickness measured using spectralis oct and the vf sensitivity measured using sap in the corresponding area. in one study investigating the structure function relationship using scanning laser polarimetry and sap in glaucoma patients, the strongest correlation was shown in the superotemporal sector, followed by inferotemporal sectors, while the temporal sector showed no statistically significant results. in another study evaluating structure function relationships using sd - oct, weak correlations were detected between temporal rnfl thickness and the corresponding vf areas. discrepancies were found among studies evaluating the structure function relationships in the temporal sector. we assumed that the use of different imaging devices or proportion of pfs patients may affect the structure function relationship in the temporal sector. in glaucoma with pfs, these findings corresponded to those of pinto., who reported that temporal rnfl thickness was significantly related to the corresponding vf sensitivity measured using fdt, but not with that using sap. in another study, temporal rnfl thickness measured by heidelberg retina tomography (hrt) had a weak correlation with ms in the corresponding vf area in fdt and sap. this was inconsistent with our findings and may be explained by differences in imaging device and their study population, including patients in the early to advanced stages of glaucoma or different proportion of pfs patients. the strength of the current study is that we observed the structure function relationship between ms in parafoveal vf area and temporal rnfl sector especially in patients with initial pfs. the ganglion cell layer is approximately four to six layers thick in the parafoveal region and thins to approximately two cells thick in the peripheral retina. approximately 50% of the rgcs are placed within 4.5 mm (16) of the fovea, an area that comprises only 7.3% of the total retina with a peak ganglion density approximately 1 mm from the foveal center. only four points of the 24 - 2 vf test fall within the central 8, the region containing more than 30% of the rgcs. therefore, early rgc loss often occurs in the central macular region, even in patients with vfs classified as normal. by using 24 - 2 sap alone a growing body of evidence suggests that 10 - 2 vf is more sensitive than 24 - 2 vf for detecting subtle changes in glaucomatous vf defects within the central 10 because more closely spaced test points are used in 10 - 2 vf. however, 10 - 2 vf has limitations because it can not test vf defects outside the central 10. thus, more sensitive 24 - 2 vf tests may be needed to detect paracentral vf defects. we assume that fdt using 24 - 2 strategy may be helpful not to miss paracentral vf defects. the favorable performance of fdt in glaucoma patients with pfs with regard to structure function relationship may be explained by the topography of fdt perimetry. in fdt, maintaining vf sensitivities with eccentricity may have a role in presenting the constant structure function relationship in glaucoma patients with pfs and pns. there are three other speculations for different structure function relationship between sap and fdt. first, sap with a stimulus of 0.43 may skip a considerable retinal area because test points are spaced 6 apart. fdt with a target of 5 covers a larger area, and is less likely to leave retina untested. second, swanson. found that sensitivity was higher for the frequency - doubling stimulus than for the size iii sap stimulus for magnocellular cells and parvocellular cells. third, receptive field radii of rgcs become smaller as the degree of eccentricity from fixation decreases. therefore, vf testing may skip more rgcs in the paracentral retina composed of rgcs with a smaller receptive field. frequency doubling technology with the larger target covers the greater retinal area with higher sensitivity than sap. the further studies are required to investigate the exact underlying mechanism explaining the favorable performance of fdt in glaucoma patients with pfs with regard to structure function relationship. short - wavelength automated perimetry is one of the most common vf testing technologies used in clinical practice, along with sap and fdt perimetry. reported that in 14 patients having open - angle glaucoma with focal optic disc damage, structural damage evaluated with hrt was topographically related to visual loss on blue yellow perimetry. however, the poorer relationship between rnfl thickness and swap sensitivity, compared to sap sensitivity, was observed in some studies. we found that swap performed relatively well in glaucoma with peripheral scotoma, whereas it did not in that with paracentral scotoma. our findings were corresponding to the previous study that the structure function relationship between temporal rnfl thickness and the paracentral vf defects were not significant, although overall rnfl thinning was relatively well correlated with swap damage. the topography of swap is steeper than corresponding sap, with vf sensitivity decreasing more rapidly with increasing eccentricity. in swap, higher range of vf sensitivities within the tested fields may explain the difference in the structure function relationship between glaucoma patients with paracentral and peripheral scotoma. these variability properties of fdt could result from increased stimulus size or decreased stimulus range. retest variability of vf by sap is greater within and near glaucomatous vf defects than to regions with normal sensitivity. increased variability with reductions in sensitivity is not present for frequency - doubling perimetry. good reproducibility for fdt may also have a role in enhancement of structure function relationships in glaucoma with pfs. short - wavelength automated perimetry had a relatively high degree of variability than that for white - on - white perimetry, such as sap. less reproducibility of swap may be a factor for weak structure function relationship in glaucoma. in the pfs group, there were significant correlations between superotemporal or inferotemporal rnfl thickness with regional vf sensitivity for sap, fdt, and swap. some points in the superotemporal or inferotemporal sector were within 10 in the vf in the structure function correspondence map (fig. in addition, glaucomatous damage occurs preferentially in the superotemporal or inferotemporal sectors of the optic nerve head. that can be one of reasons for significant correlations in superotemporal or inferotemporal sector in glaucoma patients with pfs. reported that rnfl thickness measurements for temporal quadrants showed higher variability than superior and inferior quadrants in normal and glaucomatous eyes. higher variability for temporal rnfl thickness measurements using sd - oct may contribute to poor structure function relationship in the temporal sector compared to the superotemporal or inferotemporal sector in patients with pfs. one of them is the relatively small sample size. as far as we know, however, this is the first study to investigate the structure function relationships with three types of perimetry in glaucoma patients with paracentral and peripheral scotoma. stimulus contrast was expressed as weber contrast (l / l) in sap or swap and as michelson contrast (lmax lmin / lmax + lmin) in matrix fdt perimetry. nevertheless, the comparison between different vf types with currently available techniques may be clinically significant. third, the structure function correspondence map suggested by garway - heath. was used in this study. corresponding sectors of the optic disc to vf test points may be changed if a different structure function model is used. further studies using different structure function models in glaucoma patients with paracentral scotoma may be helpful. because of the clinical significance of central visual disturbance, an accurate assessment of visual function in macular region is important. in glaucoma patients with paracentral scotoma, favorable performance of fdt was found with regard to the structure function relationship, even though good topographic correlations were found in glaucoma with peripheral scotoma using sap, fdt, or swap. therefore, fdt may be valuable to gain a better understanding of the structure function relationships, and have a role as an additional tool for evaluation of visual function in glaucoma with paracentral scotoma. further investigation of progression using fdt may be helpful in cases of glaucoma with pfs. | purposewe evaluated whether the structure function relationship in glaucoma patients with parafoveal scotoma or peripheral scotoma differs with the use of frequency doubling technology (fdt) or short - wavelength automated perimetry (swap) compared to standard automated perimetry (sap).methodsglaucoma patients with isolated parafoveal scotoma (pfs) within the central 10 of fixation in 1 hemifield and those with an isolated peripheral nasal step (pns) within the nasal periphery outside 10 of fixation in one hemifield were studied. peripapillary retinal nerve fiber layer (rnfl) thickness was measured using spectral - domain optical coherence tomography. the topographic relationships between structure and function were investigated.resultsin the pns group, superotemporal (r2 = 0.300, p = 0.001) and inferotemporal (r2 = 0.302, p = 0.001) rnfl thickness showed significant correlations with the corresponding visual field (vf) sensitivity using linear regression model in sap. in the pfs group, temporal rnfl thickness was not correlated with nasal mean sensitivity (ms) on sap (r2 = 0.103, p = 0.065). using fdt, however, the temporal rnfl thickness was correlated with nasal ms in the pfs group (r2 = 0.277, p = 0.001). using swap, the temporal rnfl thickness was not significantly associated with regional vf sensitivity in the pfs group (r2 = 0.052, p = 0.192).conclusionsin glaucoma with peripheral scotoma, the rnfl thickness was associated significantly with the corresponding vf loss in sap, fdt, and swap. in eyes with pfs, however, the topographic structure function relationships were not distinct with sap or swap. frequency doubling technology performed well in terms of structure function correlation in glaucoma with pfs. |
this is a retrospective case series where we obtained the data by reviewing the records of patients operated for optical p.k. 181 patients operated for optical p.k. at our institute between october 2005 and october 2007 and those who completed at least one - year follow - up were included for analysis. in patients who underwent multiple p.k.s, or bilateral p.k.s, (at our institute) patients presenting with failed grafts, who had undergone one or more grafts somewhere else, were included in analysis as previous failed grafts. exclusion criteria were pediatric cases, therapeutic, tectonic, lamellar grafts, and patients who followed up for less than a year. based on the preoperative diagnosis [table 1 ] good prognosis, which included quiet eyes with inactive corneal scars, corneal degenerations, and dystrophies with no corneal vascularization ; fair prognosis, which included patients of aphakic or pseudophakic bullous keratopathy, adherent leucomas, and corneal scars following perforations, descemetoceles. poor prognosis category consisted of congenital corneal scars, preexisting glaucoma, unstable ocular surface, postchemical injury corneal scars, post- herpes simplex keratitis (hsv) keratitis corneal scars, and all eyes with > 2 quadrants deep vessels. the patients operated for congenital hereditary endothelial dystrophy(ched) or congenital corneal scars were bilaterally blind, so after explaining about guarded visual prognosis (due to amblyopia), these patients were operated with expectation of gaining ambulatory vision postoperatively. indications for penetrating keratoplasty in situ corneoscleral rim excision was done for all eye donations and donor tissue was collected in m.k. tissue was labeled as excellent quality if epithelium was intact, stroma compact without any opacities or haze, no descemet 's membrane (dm) folds, and endothelial cell density (ecd) > 2 500 ; good quality if minimal exposure keratitis was present with light stromal haze, few dm folds, and ecd between 2 000 and 2 500 ; and fair quality if significant exposure was present, moderate degree of stromal haze with central dm folds, and ecd between 1 800 and 2 000. tissue evaluation was done by slit lamp observation and with bioptics lsm 12000 specular microscope, by ophthalmologists who had done their fellowship training in cornea. surgeries were done by two equally experienced surgeons who had done their fellowship training. in all cases, the donor grafts were 0.5 mm larger than the recipient. commonly used graft sizes were 8.0 7.5 mm, 7.5 7.0, and 8.5 8.0 mm. we used the manual disposable trephines for all cases. in all cases, interrupted suturing with 10/0 nylon was done. triple (pk with cataract extraction with iol), or pk with additional surgery like (anterior vitrectomy, pupilloplasty, intraocular lens explant, etc.) for further analysis [table 2 ]. postoperatively, patients were given prednisolone acetate (1%) eye drops, topical antibiotics, and artificial tears, antiglaucoma drugs if needed. routine follow - up schedule was every weekly for first month, biweekly for second month, monthly for 3 to 6 months, and every three months for one year. penetrating keratoplasties and associated procedures selective suture removal was started from third month onward, after assessing tightness of sutures on slit lamp examination, and calculating astigmatism by retinoscopy, keratometry, or topography. graft rejection was defined as presence of one or more of the following signs : mild if there were 1 to 5 keratic precipitates (kp), sub epithelial infiltrates, increased corneal thickness without increase in aqueous cells ; severe rejection if > 5 kps, inflammatory cells in the stroma (not due to infection), endothelial rejection line, or increased thickness with aqueous cells. graft clarity was graded as grade 4 if grafts were optically clear with excellent view of iris details, grade 2 - 3 (borderline) if there was moderate to significant corneal haze with or without good view of iris details, and grade 1 - 0 (failed) for opaque grafts with poor view of iris and anterior segment details. good visual improvement was defined as postoperative vision improvement two lines on snellen 's compared with preoperative vision, moderate as one line improvement, and no improvement if vision remained same or worsened. graft failure was defined as irreversible loss of optical clarity with the date of onset taken when the patient presented to cornea clinic with signs of irreversible rejection (for 3 months or more) or with failed graft. patients with no graft failure during follow - up period were considered as censored cases. kaplan - meier survival analysis was performed to calculate median survival (failure free) time of the grafts [table 3 ]. age, gender, corneal vascularization, previous failed grafts, hsv keratitis, post - perforation corneal scars, donor tissue quality, graft size and type of surgery, and postoperative glaucoma. log rank statistics was used to test the equality of estimates of survival functions among different strata of above correlates. univariate and multivariate cox proportional hazards models were used to assess the relationship between risk factors and graft failure event [table 4 ]. results were considered as significant with a two - sided p value of 60 years - 27 months, p = 0.950). graft survival in good prognosis cases was 27 months (95% ci : 20.42 - 33.52) and in poor prognosis cases was 14 months (95% ci : 6.26 - 21.73, p = 0.045) [fig. 2 ]. prognosis vs graft survival the prognosis of the case was determined on the basis of prior corneal vascularization, preexisting corneal perforation followed by scaring, history of herpes simplex keratitis (hsk), and history of previous ipsilateral corneal graft. the extent of vascularization of recipient bed correlates strongly with the graft survival, as demonstrated in the australian corneal graft registry (acgr) report so, we used quadrants of vascularization as one of the factors for grouping our cases into fair prognosis (intermediate risk) category and poor prognosis (high risk) category. in order to study the relation between individual risk factors like vascularization and graft survival, rather than low - risk vs high - risk group, our further analysis is designed accordingly. in eyes with more than two quadrants of vascularization (n = 45), and those with less than two quadrants of vascularization (n = 48), median graft survival was 18.55 months (95% ci : 15.6 21.4). in nonvascularized corneas (n = 77), in corneal scars following perforation (n = 72), graft survival was 17.96 months 1.43 (95% ci : 15.14 20.78), whereas cases in which there was no perforation (n = 98), median graft survival was 22.56 months 1.403 (95% ci : 19.81 - 5.31, p = 0.09, borderline significant) [fig. 4 ]. in post - hsv keratitis cases (n = 13), graft survival was 16.9 months (95% ci : 11.56 - 22.27), whereas in non - hsv keratitis (n = 157), graft survival was 20.95 months (95% ci : 18.72, 23.73, p = 0.544) [fig. 5 ]. in previous failed grafts (one or more grafts done elsewhere) (n = 21), median graft survival was 14 months (95% ci : 5.55 - 22.44 months). this was much lower than eyes with first - time grafts (n = 149) in which median graft survival was 27 months (95% ci : 21.11 32.88) ; however, this difference was not statistically significant (p = 0.207) [fig. 6 ]. in eyes with postoperative glaucoma, the median graft survival was 18.35 months (95% ci : 13.94 - 22.76) as compared with eyes without postoperative glaucoma (median, 21.59 months ; 95% ci : 19.30 - 23.88). graft survival in vascularized corneas graft survival in corneal perforations graft survival in hsv corneal scars graft survival in previous failed grafts postoperative glaucoma in our study, cases for which very good quality donor corneas (n = 8) were used, had longer graft survivals (25.42 months) as compared with other cases (n = 147, good quality graft ; n = 15, fair quality grafts), but this difference was not statistically significant (p = 0.41) [fig. donor tissue quality vs graft survival in our series, we found that graft survival did not differ significantly in small size grafts (7.5 7 mm) (n = 66), medium size (8 7.5 mm) (n = 85), or large size grafts (8.5 8 mm) (n = 19) (p = 0.549) [fig. 9 ]. graft size vs graft survival graft survival did not differ statistically (p = 0.303) in different types of surgeries namely pk, (n = 62), pk triple (n = 68), and pk with additional surgery (n = 40) [fig. 10 ]. additional surgeries included anterior vitrectomy (15), pupilloplasty (4), conjunctival limbal autografts (6), and iol explants / exchanges (15). type of surgery vs graft survival in patients who followed up regularly (n = 64), medial graft survival time was 27 months (95% ci : 20.43 - 33.56 months) as compared with irregular follow ups (n = 106) in whom median graft survival time was 11 months (95% ci : 4.28 - 17.71 months, p = 0.001) [fig. follow - up vs graft survival table 3 summarizes the median survival time in months of corneal grafts and association between covariates and graft failure. kaplan meier multivariate cox proportional hazard regression analysis was performed to evaluate the combined effect of ten risk factors [table 4 ]. of these, vascularization (p = 0.048) and scars following perforation (p = 0.012) were identified as significant risk factors for graft failure. immunological rejection (n = 15), surface problems like persistent epithelial defects (n = 8), graft infections (n = 8), postoperative glaucoma (10), traumatic graft dehiscence (n = 1), and primary endothelial failure (n = 1) were the causes of graft failure in our series. of 181 patients observed, adequate data for survival analysis could be obtained in 170 patients. eleven patients did not even come for the first follow - up ; therefore, these cases were excluded. since the event of interest in survival analysis is graft failure, for the remaining 170 cases, estimation of survival function was possible even though some of them did not complete one year of follow - up. of 170 patients, graft failure was observed among 54 (31.76%) patients during two - year follow - up period. median survival of grafts in the cohort was 27 months (95% confidence interval [ci ] : 20.47 33.52). 65% of the grafts survived at 12 months, whereas 52.5% of the grafts survived at 24 months [fig. 1 ]. kaplan meier curve for graft failure graft survival did not differ between 2 gender groups (male 23 months, females - 30 months, p = 0.119) and also between 2 recipient age groups (60 years - 27 months, p = 0.950). graft survival in good prognosis cases was 27 months (95% ci : 20.42 - 33.52) and in poor prognosis cases was 14 months (95% ci : 6.26 - 21.73, p = 0.045) [fig. 2 ]. prognosis vs graft survival the prognosis of the case was determined on the basis of prior corneal vascularization, preexisting corneal perforation followed by scaring, history of herpes simplex keratitis (hsk), and history of previous ipsilateral corneal graft. the extent of vascularization of recipient bed correlates strongly with the graft survival, as demonstrated in the australian corneal graft registry (acgr) report so, we used quadrants of vascularization as one of the factors for grouping our cases into fair prognosis (intermediate risk) category and poor prognosis (high risk) category. in order to study the relation between individual risk factors like vascularization and graft survival, rather than low - risk vs high - risk group, our further analysis is designed accordingly. in eyes with more than two quadrants of vascularization (n = 45), and those with less than two quadrants of vascularization (n = 48), median graft survival was 18.55 months (95% ci : 15.6 21.4). in nonvascularized corneas (n = 77), median graft survival was 22.69 months (95% ci : 19.83 - 25.55). (n = 72), graft survival was 17.96 months 1.43 (95% ci : 15.14 20.78), whereas cases in which there was no perforation (n = 98), median graft survival was 22.56 months 1.403 (95% ci : 19.81 - 5.31, p = 0.09, borderline significant) [fig. (n = 13), graft survival was 16.9 months (95% ci : 11.56 - 22.27), whereas in non - hsv keratitis (n = 157), graft survival was 20.95 months (95% ci : 18.72, 23.73, p = 0.544) [fig. 5 ]. in previous failed grafts (one or more grafts done elsewhere) (n = 21), median graft survival was 14 months (95% ci : 5.55 - 22.44 months). this was much lower than eyes with first - time grafts (n = 149) in which median graft survival was 27 months (95% ci : 21.11 32.88) ; however, this difference was not statistically significant (p = 0.207) [fig. 6 ]. in eyes with postoperative glaucoma, the median graft survival was 18.35 months (95% ci : 13.94 - 22.76) as compared with eyes without postoperative glaucoma (median, 21.59 months ; 95% ci : 19.30 - 23.88). graft survival in vascularized corneas graft survival in corneal perforations graft survival in hsv corneal scars graft survival in previous failed grafts postoperative glaucoma in our study, cases for which very good quality donor corneas (n = 8) were used, had longer graft survivals (25.42 months) as compared with other cases (n = 147, good quality graft ; n = 15, fair quality grafts), but this difference was not statistically significant (p = 0.41) [fig donor tissue quality vs graft survival in our series, we found that graft survival did not differ significantly in small size grafts (7.5 7 mm) (n = 66), medium size (8 7.5 mm) (n = 85), or large size grafts (8.5 8 mm) (n = 19) (p = 0.549) [fig. graft size vs graft survival graft survival did not differ statistically (p = 0.303) in different types of surgeries namely pk, (n = 62), pk triple (n = 68), and pk with additional surgery (n = 40) [fig. 10 ]. additional surgeries included anterior vitrectomy (15), pupilloplasty (4), conjunctival limbal autografts (6), and iol explants / exchanges (15). type of surgery vs graft survival in patients who followed up regularly (n = 64), medial graft survival time was 27 months (95% ci : 20.43 - 33.56 months) as compared with irregular follow ups (n = 106) in whom median graft survival time was 11 months (95% ci : 4.28 - 17.71 months, p = 0.001) [fig. follow - up vs graft survival table 3 summarizes the median survival time in months of corneal grafts and association between covariates and graft failure. kaplan meier multivariate cox proportional hazard regression analysis was performed to evaluate the combined effect of ten risk factors [table 4 ]. of these, vascularization (p = 0.048) and scars following perforation (p = 0.012) were identified as significant risk factors for graft failure. immunological rejection (n = 15), surface problems like persistent epithelial defects (n = 8), graft infections (n = 8), postoperative glaucoma (10), traumatic graft dehiscence (n = 1), and primary endothelial failure (n = 1) were the causes of graft failure in our series. corneal transplant surgery is the most commonly performed allograft and is said to be the most successful solid organ transplants, with short - term survival rates (1 year) as high as 90%. however, the long - term success rate diminishes to 73% at 5 years, 60% at 10 years, and 46% at 15 years as reported in acgr. reports from various graft registries of the developed countries show the indications for surgery being mainly keratoconus, other corneal dystrophies, followed by aphakic and pseudophakic bullous keratopathies. however, the scenario in developing world is quite different. firstly, the patient profile and indications for surgery differ. according to a study done in nepal, corneal scars following infectious keratitis, a study done in india to analyze survival rate of corneal transplants in a large series shows survival rates at 1, 2, and 5 years for first - time grafts to be 79.6%, 68.7%, and 46.5%, respectively. they are different from the western studies essentially due to differences in patient profile, different indications for surgery, differences in methods of storage of corneas, and socioeconomic factors affecting healthcare provision. our study shows much lower survival rates (at one year - 65%, at 2 years - 52.5%). there is a variety of reasons for this. in our series, only one - third of our cases (n = 65, 35.91%) were good prognosis cases like corneal dystrophies (gelatinous droplet keratopathy, 1 ; granular dystrophy, 1 ; macular dystrophy, 1), corneal degenerations (6), and central / paracentral scars (posttraumatic18, postinfectious 38). most of our patients (64%) are high - risk cases, which are at increased immunological risk of graft rejection due to factors like vascularized corneas, previous ipsilateral grafts, peripheral anterior synechiae, irregular anterior chamber, bullous keratopathies, herpetic eye disease with deep vascularization, etc. secondly, most of our corneal collection is through voluntary eye donations by home calls, our donors being in the age group 60 years and above, with average quality of donor tissue and comparatively lower endothelial cell counts. median survival in good prognosis cases (corneal dystrophies and degenerations, corneal scars, etc) was 27 months (95% ci : 20.42 - 33.52), whereas in poor prognosis cases (post - hsv corneal scars, previous failed grafts) was 14 months (95% ci : 6.26 - 21.73), the difference being statistically significant. prasad eye institute, india, also shows higher survival for corneal dystrophies (56%, 5-year survival rate) and lowest survival for previous failed grafts (21.2%, 5-year survival rate), although they have described results in terms of survival rates and not median survival time. in our analysis, we found that extent of deep vascularization did not correlate statistically with graft survival, but the presence or absence of it did. in our series, the singapore corneal transplant study (scts) also found lower graft survival in vascularized corneas compared with nonvascularized (p = 0.017). another study by price. too showed eyes with deep stromal vascularization three times more likely to experience rejection and failure (rr : 2.7, ci : 1.6 - 4.8, p<0.01). in our study, patients with previous corneal perforations had 45% more risk of failure (multivariate analysis). the sequel following perforation like vascularization, anterior synechiae with irregular anterior chamber, iridocorneal scar, and secondary glaucoma could have been responsible for lower survival rates. scts has also shown corneal perforation as a very significant risk factor for graft failure (hr - 3.16, ci : 1.92 - 5.19, p = 0.001). both these are well - established risk factors for graft failure, reported by various studies. we found lower average survival time in post - hsv keratitis (16.9 months) compared with non - hsv keratitis (20.95 months). this agrees with other reports like the study from switzerland, in which at 5 years, cumulative probability of graft survival in hsk patients was 40.85% compared with 50.15% in non - hsk. causes of graft failure in hsk patients were rejection (83.33%) and recurrence of hsk (16.66%). in our study, graft survival was lower (14 months) in previous failed grafts than that in first - time grafts (27 months). prior graft failure as a risk factor in subsequent grafts is a well - known fact established by khodadoust, where rejection rate of 40% after first graft, 68% after second, and 80% after third graft was found. we did not find statistically significant correlation between surgical factors like graft size, pk, and pk with associated procedure with graft survival. this is perhaps due to the fact that like most other reputed centers, we follow well - established practice patterns of surgical and postoperative treatment. we also found that patients who followed up regularly had better graft survival (27 months) than those who did not follow up (11 months). this once again emphasizes the need for good patient compliance and regular follow - up. in our series, major cause of graft failure was allograft rejection (34.88), followed by surface problems (18.6%), graft infections (18.6%), and glaucoma (23.25%). a study done by dandona. shows similar causes, e.g., rejection (29.2%), increased intraocular pressure (16.9%), infections (15.4%), and surface problems (12.7%). causes of non - improvement in vision were failed grafts (32), preexisting amblyopia (2), and preexisting optic disc pallor (2). we did not assess in details the effect of several donor tissue - related variables like death to in situ excision time, preservation time, age of the donor, hla matching or abo grouping of donor- recipient. also, we have not taken into account effect of factors like preexisting glaucoma, inflammation, type of suturing, postoperative anterior or posterior uveitis, systemic immunosuppressant, and rejection episodes. reversible graft rejection is an important risk factor, responsible for about one - third of corneal graft failures in acgr. also, our study shows survival rates for a relatively short period, i.e., 1 to 3 years. we are in a process of collecting and analyzing data over longer periods like 5 to 7 years. nearly one - third to half of our patients have been lost to follow - up (n = 69) causing several limitations to analysis. still to conclude, short - term success and survival of corneal grafts in this part of the developing world is reasonably good. our study has validated the normally accepted facts regarding outcome and survival of corneal grafts. further improvements in eye banking facilities, adopting hospital cornea retrieval programme to procure young donor corneas, and better patient counseling to ensure good follow - up are needed to improve long - term survival of corneal grafts. | aim : to study the indications, risk factors, postoperative course, and long - term survival of corneal transplants done for optical purposes.design:retrospective case series.materials and methods : data were obtained by reviewing the records of 181 patients operated at our institute (h.v. desai eye hospital) between october 2005 and october 2007 for optical penetrating keratoplasty. patients with less than one year of follow up, pediatric cases, therapeutic, tectonic, and lamellar keratoplasties were excluded. kaplan meier survival analysis was used to calculate median survival time of grafts and to see correlation between nine variables viz. age, gender, corneal vascularization, previous failed grafts, previous herpes simplex keratitis, post - perforation corneal scars, donor tissue quality, graft size, type of surgery and follow - up. these variables were also used for univariate and multivariate analysis using cox proportional hazard regression modeling.results:median survival of the cohort was 27 months (95% confidence interval : 20.47 - 33.52). one- and two - year survival rates were 65% and 52.5%, respectively. median survival was significantly lower in poor prognosis cases (14 months) than good prognosis cases (27 months, p = 0.0405). graft survival was lower in vascularized corneas (18.55 months, p = 0.030) and in post - perforation corneal scars (17.96 months, p = 0.09, borderline significance). multivariate analysis showed that the same factors were predictive of graft failure.conclusion:long-term survival of grafts at our center is different from centers in western world. more high - risk cases, paucity of excellent quality donor corneas, and differences in patient profile could be the contributory factors. |
endoscopic retrograde cholangiopancreatography (ercp) and endoscopic ultrasound (eus) are increasingly utilized in the field of gastroenterology to diagnose and treat various upper gastrointestinal diseases. more than 500,000 ercps are performed annually in the united states for pancreaticobiliary disorders and the role of eus has continued to expand over the past three decades to include a wide range of diagnostic and therapeutic interventions 1 2. non - forward - viewing ercp duodenoscopes and eus linear echoendoscopes are utilized in the upper gastrointestinal tract to perform various diagnostic and therapeutic maneuvers. their endoscopic fields of view limit visualization of the lumen compared to the standard upper endoscope because these endoscopes are not designed to diagnose upper gastrointestinal tract lesions. duodenoscopes and linear echoendoscopes are side - viewing and oblique - viewing endoscopes, respectively, with a field of view of 100 degrees, as compared to the 140-degree field of view of the standard gastroscope (table1). in addition, these non - forward - viewing endoscopes have a larger diameter and more rigid distal tip, limiting their maneuverability and angulation range. while these scopes are used for specific indications, the examination of the upper gastrointestinal tract is limited and luminal lesions may be missed. a recent study evaluating the utility of standard upper endoscopy before eus demonstrated that clinically meaningful lesions were found on esophagogastroduodenoscopy (egd) in 22 % of patients 3. this study shows that a substantial amount of patients undergoing eus have significant incidental luminal lesions. however, this study did not assess whether non - forward - viewing echoendoscopes would have missed meaningful lesions without the use of a gastroscope. eus, endoscopic ultrasound ; ercp, endoscopic retrograde cholangiopancreatography although an increasing number of ercp and eus procedures are being performed, there is currently no consensus on the use of a standard gastroscope in tandem with these procedures. thus, the prevalence of missed luminal lesions when only using a non - forward - viewing endoscope is unclear. the purpose of the current study was to examine the prevalence of clinically significant incidental upper gastrointestinal tract lesions that were found using a standard forward - viewing gastroscope following an ercp or eus exam using a duodenoscope or linear echoendoscope. we hypothesized prior to analyzing the data that linear eus and ercp would miss significant esophageal gastrointestinal lesions but not gastric or duodenal lesions. this was hypothesized because very little esophageal mucosa is seen while traversing the esophagus with a linear echoendoscope or duodenoscope. this is a retrospective analysis of a single therapeutic endoscopist s procedures from 10/1/2013 to 6/1/2014 at a tertiary care medical center. after two missed gastric adenocarcinomas were presented at the hospital tumor board in patients who had previously undergone ercps by another gastroenterologist, the institution adopted as standard of care routine egd at the time of all ercp or eus examinations. the endoscopist chose to perform the ercp or eus first before the egd because his previous standard of care was to perform linear eus or ercp without a formal egd if the patient had no upper gastrointestinal tract symptoms and, in the event that patient tolerability of the procedure was not ideal and early termination of the procedure was required, the maximum time would be allotted to the main eus or ercp procedure. patients were included in this study if they : 1) underwent ercp and/or eus using a duodenoscope (tjf - q180v, olympus america, center valley, pa, usa) or a curved linear echoendoscope (gf - uct180, olympus america, center valley, pa, usa) followed by an egd using a standard forward - viewing gastroscope (hq190, olympus america, center valley, pa, usa) during a single procedure ; and 2) did not have dysphagia or other upper gastrointestinal tract symptoms. all patients signed informed consent for ercp and/or eus and egd prior to the procedure. patients were excluded from this analysis if : 1) they required an egd for diagnostic purposes ; 2) they had dysphagia ; 3) there was a clinical suspicion of upper gastrointestinal tract lesions ; 4) eus was performed using a radial echoendoscope ; 5) eus exam was not a pancreaticobiliary exam ; and 6) they had altered pancreaticobiliary anatomy. all endoscopy reports recorded endoscopic lesions detected in the upper gastrointestinal tract. the data collected included age, gender, ethnicity, exam type, and indication for exam. the oblique - viewing linear echoendoscope and side - viewing duodenoscope were passed in the usual fashion for the relevant eus and ercp exams. upper gastrointestinal luminal findings visualized during passage of the scopes were recorded separately for each procedure. the primary outcome of the study was to determine the proportion of clinically significant missed incidental lesions when using a side- or oblique - viewing endoscope as compared to the standard forward - viewing endoscope. significant additional lesions found with a forward - viewing gastroscope were defined as findings that led to a change in the patient s medication regimen, additional endoscopic surveillance or interventions, or the need for other imaging studies. gastric erythema, helicobacter pylori - negative gastritis, hiatal hernias or other anatomic abnormalities that did not affect management were not considered significant findings. differences between groups were determined by using the student s t test or wilcoxon test for continuous variables and the fisher exact test for categorical variables. the retrospective study was approved by the hofstra north shore long island jewish school of medicine institutional review board. a total of 168 patients were identified who underwent ercp and/or eus using a side- or oblique - viewing endoscope followed by an egd using a forward - viewing gastroscope during a single procedure. sixty - eight men (40 %) and 100 women (60 %) were identified. the median patient age was 55 years (range : 19 92). the most common indications for the initial procedure were known or suspected choledocholithiasis, pancreatic mass, chronic pancreatitis, or evaluation of dilated pancreatic or bile ducts. cbd, common bile duct ; ruq, right upper quadrant ; pd, pancreatic duct ; fap, familial adenomatous polyposis. of the 168 patients, 52 procedures were done with a duodenoscope followed by a gastroscope, 83 procedures were done with a curved linear echoendoscope followed by a gastroscope, and 33 patients were done using both a linear echoendoscope and a duodenoscope followed by a gastroscope. of the latter patients, 14 (8 %) had significant incidental clinical lesions found using a non - forward - viewing endoscope, including gastric / duodenal ulcers, h. pylori gastritis, duodenal polyp, and an ampullary adenoma, all of which were not included in the calculations for lesions missed by non - forward - viewing endoscopes. clinically significant additional lesions diagnosed with a gastroscope but missed by a non - forward - viewing endoscope were found in 30/168 patients (18 %). egd with a gastroscope after a linear eus resulted in additional lesion findings in 17/83 patients (20.5 %, = 13.385, p = 0.00025). egd with a gastroscope after an ercp with a duodenoscope resulted in additional lesions findings in 10 /52 patients (19.2 %, = 9.987, p = 0.00157). egd with a gastroscope after the use of both a linear echoendoscope and a duodenoscope resulted in additional lesions findings in 3/33 patients (9 %, = 3.219, p = 0.07). hgd, high - grade dysplasia both medication and procedural changes additional lesions diagnosed with a forward - viewing gastroscope and missed with a side - viewing duodenoscope included barrett s esophagus (2), esophageal candidiasis (1), esophageal varices (1), reflux esophagitis (1), focal h. pylori - positive gastritis (2), and gastric ulcers in the antrum (2) and fundus (1). additional lesions missed with an oblique - viewing linear echoendoscope included barrett s esophagus (2), esophageal candidiasis (1), esophageal varices (2), reflux esophagitis (1), esophageal ulcer (1), focal h. pylori gastritis (5), gastric ulcer in the antrum (1), gastric adenoma with high - grade dysplasia in the fundus (1), duodenal angioectasia (second part) (1), and adenomatous duodenal polyps (second part) (2). focal h. pylori gastritis was seen as focal erythema that histology from biopsies showed h. pylori. finally, lesions missed by both non - forward - viewing endoscopes in a single procedure included barrett s esophagus (2) and esophageal varices (1) (table 3). two lesions, a duodenal polyp and an ampullary adenoma, were visualized with a side - viewing duodenoscope and not seen with the standard gastroscope. no adverse events were reported in any of the patients undergoing standard egd following a eus or ercp. while these endoscopes are required to traverse the upper gastrointestinal tract to obtain their images, it is unclear if the endoscopist should be performing a detailed exam of the upper gastrointestinal tract during the same procedure. our study helps answer this question as the literature to our knowledge is surprisingly sparse on this topic. in our study we found that significant incidental upper gastrointestinal lesions is found when a formal exam is performed with a gastroscope. a recent study of 204 patients found that 22 % were found to have clinically meaningful lesions on egd prior to eus for pancreaticobiliary indications and the authors of the study supported performing an egd for any patient undergoing eus 3. however, in the study, an egd was performed before the eus exam, and therefore it is not known if the clinically meaningful lesions would have been detected by an oblique - viewing echoendoscope without performing an egd. in our study, an egd was performed after a linear eus exam and resulted in additional lesions findings in 17/83 patients (20.5 %). furthermore, no studies have evaluated the role of an egd in detecting clinically meaningful lesions when performed either before or after an ercp. in our study, an egd with a gastroscope after an ercp with a duodenoscope resulted in additional lesions findings in 10/52 patients (19.2 %). a previous study of 172 patients compared egd and endoscopic ultrasound with radial eus for the evaluation of upper abdominal pain and demonstrated combined luminal findings in 25 % of the patients 4. patients were randomized to undergo luminal examination with both a standard gastroscope and an oblique - viewing radial echoendoscope by separate gastroenterologists in tandem prior to sonographic examination. in the subset analysis, there were no overall differences between the two scopes for detecting mucosal lesions, but the radial echoendoscope missed several barrett s esophagus, gastric ulcers, and submucosal lesions. the ability to take biopsies with the radial scope was also limited, requiring a 56 % conversion rate to a standard endoscope. however, this study cohort only included patients who were referred to gastroenterologists for diagnostic egds to evaluate their upper abdominal pain, therefore, the findings can not be extrapolated to asymptomatic patients and patients referred for eus for other indications. another study of 200 patients with dyspepsia demonstrated that oblique - viewing radial eus had sensitivity and specificity of 80 % and 95 %, respectively, for detecting luminal lesions when compared to egd 5. in this study, patients who were referred for dyspepsia underwent radial eus followed by egd to look for both luminal and extraluminal etiologies of their symptoms. luminal lesions that were missed by eus included duodenal ulcers and reflux esophagitis. given that the primary goal of this study was to evaluate an eus - based management strategy for dyspepsia, only findings that accounted for dyspeptic symptoms were reported. this study cohort included only patients with dyspepsia. because clinically significant lesions do not always cause symptoms, these findings do not translate to our study population who were undergoing eus for both symptomatic and asymptomatic indications. our study evaluated patients referred for ercp and/or eus. although it is not known how many patients had undergone previous upper endoscopic evaluation prior to the procedures analyzed, our findings demonstrate the importance of performing an egd during ercp and/or eus. our results among 168 patients showed that egd with a forward - viewing gastroscope yielded additional meaningful findings in 19 % (10 /52) of patients following an ercp with a duodenoscope, 20 % (17/83) of patients following a linear eus, and 9 % (3/33) of patients utilizing both a duodenoscope and a linear echoendoscope. our findings coincide with previous published rates of incidental lesions requiring management changes found during egd performed for various reasons, which range from 22 % to 62 %, but it is the first to show the high miss rate of significant lesions with both duodenoscopes and linear eus echoendoscopes 3 6 7. prior to data analysis, we hypothesized that nearly all of the missed lesions during non - forward - viewing endoscopy would be esophageal given the semi-blind passage of the scope through the narrowed tubular lumen of the esophagus compared to the stomach and duodenum. however, 15/30 of the missed lesions (50 %) were found in the stomach and duodenum, suggesting that luminal diameter was not the main factor contributing to missed lesions. additional lesions diagnosed by egd requiring endoscopic treatment included argon plasma coagulation (apc) of an angioectasia, endoscopic mucosal resection of a gastric adenoma with high - grade dysplasia, and variceal band ligation. additional lesions requiring further endoscopic surveillance included barrett s esophagus, esophageal varices, and gastric ulcers. additional significant medical interventions included treatment for h. pylori, esophageal varices, and cirrhosis workup and management. one patient with a pancreatic head cyst causing partial duodenal obstruction diagnosed on forward - viewing endoscopy was admitted to the hospital for management of her symptoms. in this study, we performed the egd after the indicated ercp or eus procedure to maximize time for the main procedure in the event that the procedure had to be terminated prematurely. previous data have suggested that performing standard upper endoscopy prior to eus may detect luminal lesions that will affect subsequent eus in 9.8 % to 12 % of patients, thus preventing potential complications during eus 3 8. however, other studies have shown eus to be a safe procedure with a low complication rate even if performed without a prior egd 9. in our study, zero adverse events / complications were experienced during non - forward - viewing exams. it should be noted that these patients had no upper gastrointestinal symptoms. patients with upper gastrointestinal symptoms underwent egd first and were not included in this study. this study strongly supports the notion that standard forward - viewing endoscopy should be performed at the same session of pancreaticobiliary eus and ercp. this study did not evaluate the increased cost of performing a standard egd. the previously described study on this topic did not evaluate cost effectiveness either 3. the additional costs would be significant as there are costs associated with cleaning the additional gastroscope, equipment to biopsy (e. g., biopsy forceps), provide additional therapy (e. g., apc of lesions), physician fee for the additional procedure, etc. however, the additional lesions discovered in this cohort were significant and would likely be clinically significant in the future, adding to the cost of future gastrointestinal healthcare (e. g., cost of gastrointestinal bleeding in incidentally found vascular ectasias or varices, gastric cancer in the incidental gastric adenoma with high - grade dysplasia, duodenal cancer in the incidental duodenal adenoma, etc). it is also possible that some of the incidentally found lesions increased healthcare costs without clinical benefit (e. g., enrolling patients with incidentally found non - dysplastic barrett s esophagus that will not progress to neoplasia in a surveillance program, eradication of h. pylori that never would have caused significant disease, etc.). future studies are needed to investigate the cost effectiveness of forward - viewing endoscopy at the time of pancreaticobiliary eus and ercp. this study also shows that in patients without upper gastrointestinal symptoms who undergo pancreaticobiliary eus or ercp, the order of forward - viewing endoscopic exam is irrelevant. there were no complications associated with the forward - viewing endoscopy when performed after eus or ercp. there is a theoretical risk that an oblique or side - viewing scope which traverses an unknown esophageal or duodenal stricture / lesion could possibly lead to a perforation. for this theoretical risk only, we would recommend that the forward - viewing endoscopy be performed before every pancreaticobiliary eus and ercp. this study has certain limitations which should be noted, including the limitations inherent in its retrospective design. however, all endoscopic findings for each exam were recorded separately on the procedure report, thus the groups were not difficult to compare. other practicing therapeutic endoscopists at our institution were not included in the study because their standard of care was to perform an egd prior to the eus or ercp. in addition, an inherent limitation for which we can not account is the theoretical subconscious decreased effort of the endoscopist to look for incidental upper gastrointestinal tract lesions knowing that a forward - viewing endoscopy is going to be performed. however, a significant number of lesions were discovered on eus and ercp before forward - viewing endoscopy, which makes this less likely. in summary, the current study demonstrates that non - forward - viewing duodenoscopes and linear echoendoscopes miss a significant number of meaningful incidental upper gastrointestinal luminal lesions. performing an upper endoscopy with a forward - viewing gastroscope at the time of ercp or eus leads to an increased yield of meaningful incidental upper gastrointestinal lesions. gastroenterologists who perform linear eus or ercp should strongly consider performing a formal egd with a gastroscope at the time of the eus or ercp exam. | background and study aims : it is unknown whether significant incidental upper gastrointestinal lesions are missed when using non - forward - viewing endoscopes without completing a forward - viewing exam in linear endoscopic ultrasound (eus) or endoscopic retrograde cholangiopancreatography (ercp) exams. we evaluated whether significant upper gi lesions are missed during eus and ercp when upper endoscopy is not performed routinely with a gastroscope. patients and methods : a retrospective analysis was performed in which an egd with a forward - viewing gastroscope was performed after using a non - forward - viewing endoscope (linear echoendoscope, duodenoscope, or both) during a single procedure. upper gastrointestinal tract findings were recorded separately for each procedure. significant lesions found with a forward - viewing gastroscope were defined as findings that led to a change in the patient s medication regimen, additional endoscopic surveillance / interventions, or the need for other imaging studies. results : a total of 168 patients were evaluated. in 83 patients, a linear echoendoscope was used, in 52 patients a duodenoscope was used, and in 33 patients both devices were used. clinically significant additional lesions diagnosed with a gastroscope but missed by a non - forward - viewing endoscope were found in 30 /168 patients (18 %). egd after linear eus resulted in additional lesion findings in 17 /83 patients (20.5 %, 2 = 13.385, p = 0.00025). egd after use of a duodenoscope resulted in additional lesions findings in 10 /52 patients (19.2 %, 2 = 9.987, p = 0.00157). egd after the use of both a linear echoendoscope and a duodenoscope resulted in additional lesions findings in 3/33 patients (9 %, 2 = 3.219, p = 0.07). conclusion : non forward - viewing endoscopes miss a significant amount of incidental upper gastrointestinal lesions during pancreaticobiliary endoscopy. performing an egd with a gastroscope at the time of linear eus or ercp can lead to increased yield of upper gastrointestinal lesions. |
eed is a localized, low - grade form of leukocytoclastic vasculitis of unknown pathogenesis characterized by persistent, symmetrical, red - purple papules, nodules, and plaques affecting the extensor surfaces of the extremities, the ears, trunk and buttocks. dermatitis herpetiformis is an autoimmune blistering disease characterized by granular deposits of immunoglobulin a (iga) in dermal papillae. the common link between these two disorders is the deposition of ig a antibodies, underlying gluten sensitivity in both, their association with celiac disease and response to treatment with dapsone. a 50-year - old male presented with firm skin - colored and erythematous nodules over the knuckles, elbows, buttocks, knees, and lower legs which gradually increased in size in since 3 years duration [figure 1 ]. complete blood picture, liver function tests, urine routine, blood sugar were within normal limits. biopsy of the nodules of the knuckles showed focal parakeratosis and mild spongiosis in the epidermis, perivascular neutrophilic infiltrate in the dermis, neutrophils in the vessel wall and leukocytoclasia [figure 2 ]. immunofluorescence showed linear iga deposits in the basement membrane zone and weak granular perivascular c3 and fibrinogen deposits [figure 3 ]. four years ago itchy vesicles over the back and arms were detected in the patient. he was administered dapsone which leads to disappearance of lesions with recurrence after stopping treatment. with the clinical presentation, biopsy and immunofluorescence results, a diagnosis of erythema elevatum diutinum on a background of dermatitis herpetiformis was made. skin - colored nodules over the knuckles neutrophilic vasculitis with leucocytoclasia (h and e, 400) linear iga deposits in the basement membrane zone dermal papillary microabscess (h and e, 400) erythema elevatum diutinum (eed) is a rare cutaneous condition that initially presents as leukocytoclastic vasculitis (lccv) of the skin and later resolves with fibrosis clinically characterized by persistent red - purple to yellow papules, plaques, and nodules. the symmetrical lesions typically affect the acral surfaces of the body, especially the extensor surfaces of the hands, but other areas such as the buttocks may also be involved. antecedent bacterial infections, collagen vascular diseases, myeloproliferative diseases, human immunodeficiency virus infection, cryoglobulinemia, wegener granulomatosis, crohn disease, systemic fungal diseases, iga paraproteinemia, and other associations have been reported. histopathologically, eed initially presents as a leukocytoclastic vasculitis (lccv) with polymorphonuclear neutrophils, extravasated red cells, nuclear dust, and fibrin deposits in the walls of the small arterioles. dermatitis herpetiformis (dh) is characterized by chronic, intensely pruritic, polymorphic, vesicles usually appearing on elbows, knees, buttocks, and scalp associated with gluten - sensitive enteropathy there are granular iga deposits in the dermal papillae by the direct immunofluorescence in the perilesional skin of patients with dermatitis herpetiformis. the close association of iga with erythema elevatum diutinum and dermatitis herpetiformis is well known. because of the association with iga, the presence of erythema elevatum diutinum in a patient with chronic dermatitis herpetiformis is not surprising. the iga in the skin may be an epiphenomenon or may represent deposition in the skin along with other immune complexes. aftab mn. have reported a case of erythema elevatum diutinum arising in the setting of dermatitis herpetiformis. they concluded that iga immune complexes within the basement membrane zone region may trigger a cascade that eventuates into a blister or the formation of the chronic vasculitis of erythema elevatum diutinum. | erythema elevatum diutinum (eed) is a rare skin disease that initially presents as leucocytoclastic vasculitis and later resolves with fibrosis. dermatitis herpetiformis is an autoimmune blistering disease characterized by granular deposits of immunoglobulin a (iga) in dermal papillae. we report a rare association of these two disorders. |
non - hodgkin lymphoma (nhl) consists of a heterogeneous group of malignancies with varied clinical presentation and biological behaviors. the estimated number of new cases in 2014 is 70 000, which represents 4% of all cancers diagnosed and 3% of cancer deaths in the united states. the histological subtypes of nhl are typically classified as indolent and aggressive histologies. although nhl is predominantly managed with chemotherapy, radiation therapy is used as definitive treatment among patients with early - stage indolent lymphoma and natural killer (nk) t - cell lymphoma. radiation therapy is also used as consolidative treatment in patients with early - stage and bulky aggressive histologies following chemotherapy. despite growing evidence of the benefit of radiation therapy for patients with nhl, concerns regarding radiation - associated late toxicities persist and, consequently, radiation therapy is omitted in the management strategy of many patients for whom it may be of benefit. in an effort to reduce radiation - related toxicity, these include reducing the dose of radiation in both definitive and consolidative radiotherapy, smaller field sizes and using modern radiotherapy techniques, such as intensity - modulated radiation therapy. there are several studies examining the dosimetric benefits of proton therapy in patients with hodgkin lymphoma (hl) [68 ] ; however, there are limited published data reporting outcomes of patients with nhl treated with proton therapy. the present study evaluated the disease control, toxicities and radiation dose delivered to various organs at risk (oars) using proton therapy either definitively or in combination with chemotherapy among a cohort of consecutively treated patients with nhl. between january 2008 and january 2014, 11 patients with nhl were treated with definitive (n = 6) or consolidative radiation therapy (n = 5). all patients were treated on an institutional review board - approved outcomes tracking protocol with proton therapy. prospectively collected data in the charts were extracted, including patient and disease characteristics prior to treatment, chemotherapy, proton treatment plan and acute and late side effects and disease control. this cohort included four patients with indolent orbital lymphoma, three patients with primary mediastinal lymphoma, two patients with plasmablastic lymphoma and two patients with nk t - cell lymphoma. malt, mucosa - associated lymphoid tissue ; dlbcl, diffuse large b - cell lymphoma ; cvad, cyclophosphamide, vincristine, doxorubicin and dexamethasone ; nk, natural killer ; r - chop, rituximab, cyclophosphamide, doxorubicin (hydroxydaunomycin), vincristine and prednisolone ; c, cycles ; cr, complete response ; r - ice, rituximab, carboplatin and etoposide ; r - eshap, rituximab, etoposide, methylprednisolone, cytarabine and cisplatin ; hyper - cvad, hyperfractionated cyclophosphamide, vincristine, doxorubicin and dexamethasone ; smile, dexamethasone, methotrexate, ifosfamide, l - asparaginase and etoposide ; rbe, relative biological effectiveness ; fx, fractions ; bid, twice daily ; ned, no evidence of disease ; awd, alive with disease. patients were simulated supine with custom immobilization devices including vaclok bags (civco medical solutions, orange city, ia) and aquaplast facemasks (qfix, avondale, pa) for those patients with disease involving the head and neck region. all patients underwent a three - dimensional (3d) computed tomography (ct) scan with intravenous contrast. patients with mediastinal disease or abdominal disease underwent a 4d ct simulation to account for respiratory motion during planning. scans were transferred to mimvista (mim software, cleveland, oh), and fusions with diagnostic scans were generated. both the pre- and post - chemotherapy staging scans were fused for patients treated with chemotherapy. a modified involved - field treatment plan was developed for all patients, similar to the involved - site radiation therapy guidelines. in patients with indolent orbital lymphoma, partial orbital radiation was given, where the gross tumor volume (gtv) included gross disease seen on ct simulation, the clinical target volume (ctv) included the pre - biopsy volume as defined on the pre - biopsy ct or magnetic resonance imaging (mri) scan fused to the ct simulation, and the planned target volume (ptv) was the ctv with a 5 mm margin to account for set - up uncertainty. in patients with nk t - cell lymphoma, the gtv included the sites of involved disease seen on the pretreatment positron emission tomography (pet)/ct scan fused to the ct simulation, while the ctv included a 5 mm margin within the soft tissue in addition to the entire lymph node station in which enlarged lymph nodes were found. a ptv margin of 5 mm on the ctv was used. in patients with primary mediastinal b cell lymphoma and lymphoblastic lymphoma, the gtv was the residual disease seen at the time of ct simulation, while the ctv included all mediastinal, hilar and cervical lymph node stations that were involved at the time of diagnosis with expansion to account for 4d motion of the mediastinum of up to 5 mm, and the ptv was a 58 mm margin on the ctv. target and oar volumes were transferred into eclipse (varian medical systems, salt lake city, ut) and 3d conformal proton plans were generated. a smearing factor was included in the proton range compensator design to account for any intrafraction or interfraction motion perpendicular to the beam. distal and proximal margins were calculated for each proton beam (ctv depth mm 1.025 + 1.5 mm) to account for ct - number - to - proton - stopping - power conversion uncertainties (2.5%). a 1.5 mm water - equivalent margin was added to the range to account for proton beam reproducibility (1 mm), water measurement uncertainty during commissioning (0.3 mm) and range compensator fabrication error (0.2 mm). field apertures were calculated from the ptv with a block margin to account for the proton beam penumbra at the target depth, and range compensators were calculated using an 810 mm smearing margin. the minimum target coverage parameter was ptv dose to 95% volume (d95%) greater than 95%. thoracic oar dose constraints were lung volume receiving 20 gy (v20) < 30%, mean lung dose < 14 gy and mean heart dose < 20 gy. the median follow - up for all patients was 38 months, and seven of the nine living patients have more than 2 years of follow - up. one patient with nk t - cell lymphoma had progressive disease immediately after completing radiation therapy and died. another patient with plasmablastic lymphoma was diagnosed with a gastro- esophageal junction tumor outside the radiation field during follow - up and died 6 years following treatment. the 3-year overall survival rate for the cohort was 91% and the 3-year local control rate was 91%. table ii summarizes acute and late radiation - associated toxicities for the entire cohort of 11 patients. four patients were treated with definitive proton therapy for indolent orbital lymphoma in an effort to reduce the dose to the brain. two of these patients had mucosa - associated lymphoid tissue (malt) lymphoma and received 30.6 gy (relative biological effectiveness, rbe) in 1.8 gy fractions. the other two patients had low - grade follicular lymphoma and received 24 gy (rbe) in 1.5 gy fractions. all four patients tolerated proton therapy well, with grade 12 dermatitis (n = 4), grade 12 headache (n = 2) and/or grade 1 fatigue (n = 2). three patients later developed grade 3 cataracts in the treated eye. in these patients, the lens had been either entirely in the ptv (n = 2) or partially in the ptv (n = 1). one patient developed late grade 1 anhidrosis and another patient developed late grade 1 epiphoria. three patients were treated with consolidative proton therapy for primary mediastinal b - cell lymphoma to reduce the radiation dose to the heart, lungs, esophagus and breasts. two of these patients had a complete response to six cycles of r - chop (rituximab, cyclophosphamide, doxorubicin, vincristine and prednisolone) chemotherapy and one patient required second - line chemotherapy with continued pet - positive residual disease before high - dose chemotherapy with autologous stem cell transplant. the dose of proton therapy delivered ranged from 30.6 to 41.4 gy in 1.51.8 gy fractions. acute toxicities included grade 1 to 2 dermatitis (n = 3), grade 1 fatigue (n = 3) and other grade 1 gastrointestinal (n = 2) and pulmonary toxicities (n = 2). at the time of last follow - up there were no grade 2 or greater late toxicities. this included one located in the head and neck and the other in the stomach and left adrenal gland. the patient with the head and neck site developed a ge junction cancer out - of - field a few years following treatment and died approximately 6 years following proton therapy. acute toxicities were grade 1 nausea (n = 1), grade 1 mucositis (n = 1) and grade 2 dermatitis (n = 1). there were no grade 2 or greater late toxicities. finally, two patients received definitive proton therapy for treatment of nk t - cell lymphoma of the head and neck region in an effort to reduce the dose to the parotid glands, oral cavity and brain. one patient had progressive disease and died 5 months later, while the other patient is a 4-year - old boy with involvement extending from the nasopharynx to hypopharynx, who is free of disease at 9 months after completing treatment. acute toxicities were grade 12 dermatitis (n = 2), grade 2 mucositis, grade 2 laryngeal edema requiring steroids, grade 3 dysphagia (n = 1) and grade 2 anorexia (n = 1). this study is the first to report on a cohort of patients with nhl treated with proton therapy. proton therapy led to local control rates similar to what is expected with photon radiation, but was delivered with the objective of reducing the long - term side effects of radiation. several published studies have evaluated the use of proton therapy in hl, but there are few data regarding outcomes of patients treated with proton therapy for nhl. three studies have evaluated the dosimetric impact of using proton therapy in nhl, including studies from massachusetts general hospital (mgh ; boston, ma), m. d. anderson cancer center (mdacc ; houston, tx) and university of florida (uf ; jacksonville, fl) and there is a case report from loma linda university medical center (llumc ; loma linda, ca). the study from mgh included four patients with diffuse large b - cell nhl involving the mediastinum treated with proton therapy, and showed reduced cardiac, lung, spinal cord and integral doses with excellent disease control and minimal acute toxicities. the study from mdacc discussing proton therapy in mediastinal lymphoma included two patients with nhl and showed similar results. the uf study evaluating the dosimetric benefit of proton therapy compared with 3d conformal radiotherapy in two patients with primary mediastinal b - cell lymphoma demonstrated a clinically meaningful reduction in dose to the heart, lungs and esophagus. finally, a case report from llumc demonstrated that proton therapy can minimize the volume of normal brain tissue receiving low- to moderate - dose radiation in a patient with primary b - cell lymphoma. these dosimetric studies provide a rationale for the use of proton therapy in the treatment of nhl to potentially reduce the risk of late radiation toxicities., who demonstrated a 50% reduction in secondary cancer development among patients treated at mgh with proton therapy compared with matched patients from the surveillance, epidemiology, and end results (seer) program registry. all three patients with primary mediastinal b - cell lymphoma had an excellent response to consolidative proton therapy and no evidence of disease during follow - up. patients with primary mediastinal b - cell lymphoma generally present at a young age, similar to those with hl involving the mediastinum, and would likely derive the same benefits with proton therapy as patients with hl. in a prospective study, hoppe. demonstrated significant and clinically meaningful dose reduction with proton therapy when compared with 3d and intensity - modulated radiation therapy. these patients with nhl represent an important cohort who should be considered for consolidative treatment with proton therapy. furthermore, many of these patients are being treated with dose - dense chemotherapy regimens in an effort to avoid radiation therapy and its associated toxicities. therefore, in the few patients receiving radiation therapy as part of their treatment, proton therapy should be strongly considered. in patients with orbital lymphoma, local disease control outcomes were favorable and consistent with outcomes described in the literature [1921 ]. given that the majority of patients with indolent orbital lymphoma achieve long - term survival, it is important to minimize the potential for late treatment - associated toxicities. the patients in this cohort had similar rates of subacute toxicities (i.e. cataracts, anhidrosis) to patients treated with photon therapy. proton therapy has the advantage of sparing the dose to the pituitary, ipsilateral temporal lobe and ipsilateral hippocampal head, all of which receive low - dose radiation with similarly fractionated conventional photon therapy. other effective strategies for treating orbital lymphoma have been investigated. in 2011, lowry. published their results of 361 sites of indolent nhl randomized to 4045 gy in 2023 fractions or 24 gy in 12 fractions and 640 sites of aggressive nhl randomized to 4045 gy in 2023 fractions or 30 gy in 15 fractions. there was no difference in overall response rate, progression - free survival or overall survival between the standard- and low - dose arms in either group. analyzed a cohort of 20 patients with nhl with ocular adnexal involvement treated with low - dose radiation consisting of two fractions of 2 gy. at a median follow - up of 26 months, the treatment was well tolerated, with mild acute side effects in 30% and no late toxicities. furthermore, patients treated with this low - dose regimen have the option of re - irradiation in the case of local - regional relapse. with conjuctival malt lymphoma (provided there is no disease behind the equator of the globe on high - quality orbital mri), patients can be treated effectively with an anterior orthovoltage field (250300 kv). considering that very low doses for orbital lymphoma are emerging as an effective alternative, the true value of its use in patients with indolent histologies still remains to be seen. however, more aggressive histologies of the orbit require higher doses, which would benefit from proton therapy. although this study demonstrates that proton therapy can be safely and effectively delivered to patients with nhl involving other anatomical areas, including the abdomen and head and neck region, nhl includes a broad range of anatomic disease locations and histologic subtypes, making it difficult to generalize the benefits of a particular radiation modality among all cases of nhl. while low - grade indolent lymphoma (predominantly malt and follicular lymphoma) and nk t - cell lymphoma can be effectively treated with radiation therapy alone, aggressive histologies (diffuse large b - cell lymphoma, plasmablastic and burkitt lymphoma) require individualized chemotherapy regimens in combination with radiation therapy. current national comprehensive cancer network (nccn) guidelines include photons, electrons or protons as appropriate treatment modalities for nhl, depending on clinical judgement. although ideal, a randomized controlled trial comparing proton and photon therapy based on a primary endpoint of late toxicity is unlikely because of the numerous potential sites of disease, the long time interval between treatment delivery and manifestation of late side effects, and the shrinking role of radiation owing to persistent concerns of radiation - associated toxicities by medical oncologists. in addition to offering lower radiation doses and involved site radiation therapy, proton therapy may allow more patients to receive the most effective and safe treatment. the major limitations of the present study are its small sample size and the diversity of primary disease sites and histologies among patients with nhl. despite nccn endorsement for the use of proton therapy in cases where the dose to the oars can be reduced significantly compared with photon radiation, many patients evaluated at our center for proton therapy for whom the proton plans were superior to the photon plans could not obtain insurance coverage for the treatment of their nhl with protons. these experiences illustrate the challenges that researchers face when investigating the role of proton therapy for different diseases. the present study did not examine all possible clinical scenarios in which proton therapy may benefit patients with nhl ; the patients included in this study represent a typical cross - section of disease presentations encountered by radiation oncologists. more long - term follow - up of all surviving patients included in this study is essential for continued monitoring of disease status and late toxicities. longer follow - up and additional patients are needed to confirm our findings. given the variable disease locations, histologies and biologic behaviors of nhl, prospective studies evaluating proton therapy in the treatment of this disease will be complex, and likely require pooled data from multiple institutions to demonstrate adequate local control and lower rates of late toxicities. disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal. | proton therapy (pt) is a highly conformal type of radiation therapy that can target the tumor while sparing dose to surrounding normal tissues. this study reviews a single institution 's experience managing patients with non - hodgkin lymphoma (nhl) treated with pt. eleven patients with nhl were treated with pt from january 2008 to january 2014 on an institutional review board - approved outcomes tracking protocol, and included patients with indolent orbital lymphoma (n = 4), primary mediastinal b - cell lymphoma (n = 3), plasmablastic lymphoma (n = 2) and natural killer (nk) t - cell lymphoma (n = 2). the median follow - up was 38 months. the 2-year rate of local control was 91%, with one patient with nk t - cell lymphoma having recurrence in - field. toxicities were limited to grade 2 at highest, during follow - up. pt is a feasible and effective treatment for nhl. early outcomes are favorable. longer follow - up and more patients are needed to confirm our findings. |
it is where life begins, and it never ends. in this story, there once were two sisters who were happy and healthy and enjoying life together (figure 1). but then, all of a sudden, my sister was losing weight unexpectedly, and her weight was close to 90 lb. i remember my mother looking up her symptoms in her medical books and saying, i remember my sister saying, no, i do nt. the author (left) and her sister as children (a), and the author (right) and her sister today (b). there was no self - monitoring of blood glucose (smbg) at that time, and diets were strict. my sister was taught to weigh and measure her food and to follow the ada exchange diet the gold standard at the time. i remember being so impressed with how well she followed her diet in the beginning, and i felt so relieved. i thought to myself, she will be okay ; she knows what to do, and she can take care of herself. but i quickly learned that this was easier said than done. i noticed that, after the first 6 months of amazing diligence, my sister seemed weary of the process and was having challenges with high blood glucose. she kindly told me that it was her diabetes and that she just wanted me to be her sister and not get involved. for many years, i watched from the sidelines, hoping and looking for an opportunity to help. it is no surprise that i delved into the area of nutrition and diabetes and became very passionate about helping people with diabetes. as i counseled patients with diabetes, it was so very clear to me that the diet was the hardest part of the diabetes self - care regimen. one day, knowing that my sister still might not be open to discussing her own challenges with me, i asked her for help in my practice. i said that i wanted to know how i could help my patients more, and i thought that she could give me some guidance. i wanted to understand why it was that she did so well in the beginning with following the diabetes care plan, but then seemed to drop it all together. i was given a list of all the things i could nt eat and was told to weigh and measure all my foods. after 6 months of carefully weighing all my food portions, i decided that i could not live the rest of my life eating two - thirds of an apple for lunch. i decided i would just do the best i could to try to eat healthy and exercise regularly. as her sister, my heart sank. as a dietitian, i thought to myself, it was not doable, and she gave up ! clearly, she felt that, if having diabetes meant doing all of these things to perfection, she would have to risk living with the consequences of high blood glucose and hope for the best. this is my area, and i need to do whatever i can so that this does not happen to one more person with diabetes, at least not on my watch ! i became passionate about making sure that my messages about diet were realistic and doable and tailored for each patient. i wanted to be sure that i focused on realistic, patient - selected goals that instilled the hope that managing diabetes can be doable., i had the amazing opportunity to get involved in research with the diabetes control and complications trial (dcct), a study designed to compare the effects of conventional diabetes treatment to intensive therapy on the development of long - term complications in people with type 1 diabetes. the goals of intensive therapy were to maintain near - normal blood glucose levels and aim for an a1c 6.5% (1). in 1983, we had the advantages of smbg technology, multiple daily injection regimens, insulin pumps, and a1c testing to help tailor our treatment approaches, allowing us to focus on what really worked. here was my opportunity to contribute to making a difference in the lives of people with type 1 diabetes, particularly in the area of diet. we had an education checklist for dcct participants that outlined all of the diet - related topics we would review so that they could better manage their diabetes. i remember sitting at a meeting with my colleague, beverly halford, discussing how many different topics there were and how much information these patients needed to learn and process and how that could be overwhelming. at the same time, as a study group, we soon realized that the goal of intensifying insulin therapy to achieve a1c targets without hypoglycemia and weight gain could not be accomplished without attention to diet (1,2). if only we knew which aspects of diet were most important in achieving better blood glucose control, then we could help patients prioritize which diet behaviors were most important to focus on. that is, maybe we could make the diet component more doable by focusing on the need to know versus the nice to know. we decided to conduct an ancillary study (3) to try to determine which diet behaviors were associated with better a1c outcomes. to do so, we asked 623 intensively treated patients to complete a survey about the methods they used in implementing dietary advice, adhering to meal plans, managing changes in food intake, treating hypoglycemia, limiting consumption of concentrated sweets, and timing insulin in relation to meals and snacking habits. we learned that, in the context of intensive therapy, there were six diet behaviors that were associated with lower a1c values (table 1) (3). the information learned through this study was used from that point forward by dcct dietitians to help study participants get closer to their a1c targets so that, as a research group, we could achieve the clinically meaningful separations in glycemic control that we needed to study the course of diabetes control and complications. dietary behaviors associated with lower a1c in the dcct (3) we now know, based on the dcct results, that every 10% reduction in a1c results in a 43% risk reduction in retinopathy and that the legacy of the dcct s intensive diabetes therapy regimen continues its imprint on diabetes - related health outcomes 30 years later (4,5). i now know as a dietitian and diabetes educator how to help patients with type 1 diabetes separate the wheat from the chaff by focusing on the need to know instead of the nice to know. everybody wants to prevent diabetes. in 1996, our research team became involved in the diabetes prevention program (dpp). this randomized, controlled trial was exciting because it was designed to compare a lifestyle intervention aimed at 7% weight loss and increased activity to a diabetes medication (metformin) and to placebo with regard to effects on diabetes incidence in individuals with impaired glucose tolerance (6). as a dpp co - investigator and lifestyle coach, i was involved nationally in helping design the lifestyle intervention. as we screened study participants, i remember wondering whether people who did not yet have a disease would be motivated to engage in a treatment to prevent it. we soon found out that, when people learned that they were at risk to develop diabetes, they were highly motivated to prevent it. the story of tim, one of my dpp participants, tells all. at 47 years of age tim s doctor told him he was highly likely to develop diabetes within 5 years of his twin brother because they had the same genes. he decided to join the dpp because he wanted to do everything he could to prevent diabetes. when tim joined the dpp, he was 510 tall and weighed 200 lb ; his bmi was 27 kg / m. he was excited to learn that he was randomly assigned to the lifestyle intervention program. he learned that his lifestyle intervention goals would be to lose 7% of his body weight to a target weight of 186 lb and to increase his activity level to 150 min / week. he rated his motivation to change his lifestyle at a 9 on a 10-point scale, and his self - confidence to do so as 5 out of 10 because he had never been on a weight loss program before. tim s wife attended almost all of his individual coaching sessions to learn how she could support his efforts. based on tim s initial weight, he was assigned a fat intake goal of 42 g / day based on his calorie goal of 1,500 kcal / day. at first, tim and his wife found keeping food records and learning about the sources of extra fat and calories in their diet to be time - consuming. however, with practice, feedback, and support, tim found that he could change his eating habits and lose weight while still enjoying his favorite foods. over time, he found that the process became easier, and the lifestyle changes became his new eating routine. after 6 months in the dpp, tim had lost 16 lb, to a weight of 184 lb, and he was exercising for 200400 min / week. through his participation in the dpp, tim now weighed 50 lb less than his twin brother (figure 2). for the remainder of the program, he continued to have individual follow - up visits every 46 weeks, and at the end of the dpp, he had maintained his weight of 184 lb. when he was debriefed on his results at the end of the dpp, he learned that, after 4 years of lifestyle intervention, he had reverted to normal glucose tolerance by both fasting and 2-hour postprandial blood glucose criteria at that time (7). tim and the other dpp participants learned that, compared to placebo, metformin can reduce the risk of developing diabetes by 31%, and lifestyle intervention aimed at 7% weight loss and 150 min / week of activity can reduce that risk by 58% (6). the effectiveness of a modest lifestyle change was approximately double that of the medication intervention. tim, at age 64, had delayed diabetes for 17 years beyond his identical twin brother. his most recent weight was 192 lb (4% weight loss from his dpp baseline), and he is exercising 300 min / week, doubling the original dpp exercise goal of 150 min / week. tim s story tells us that modest lifestyle change seems to trump the expression of high - risk genes. lifestyle intervention participants who had the transcription factor gene tcf7l2, which is associated with susceptibility to type 2 diabetes due to impaired -cell function, did not develop diabetes at the same rates as participants in the metformin or placebo groups with the same high - risk gene (8). the same findings were replicated when those with the highest genetic risk score who received lifestyle intervention were found to have significantly lower diabetes incidence rates than their counterparts in the placebo group (9). tim s story and these research results inspire me to continue to help patients with lifestyle change. i can provide a message of hope based on the evidence that preventing or delaying diabetes is doable with modest lifestyle change. i can encourage them by telling them that they are not doomed to develop diabetes if they have high - risk genes in their family history ; losing 810 lb could make a big difference, and every pound they lose matters. that is why one size does not fit all and no one diet is right for everyone. early in the dpp, i was excited about the potential of weight loss and increased activity to prevent diabetes. in my clinical practice, i had already witnessed the power of small weight losses and modest changes in activity to dramatically improve blood glucose control in my patients who already had type 2 diabetes. what if the lifestyle program works to prevent diabetes ? what will we need to know ? knowing that there are so many nutrition, activity, and behavioral topics to review with patients to help them lose weight, i asked myself, is there a way to make this more doable ? can we help patients prioritize their focus on the behaviors that are most important in predicting sustainable weight loss ? how can we discern the need to know from the nice to know? i decided to conduct another ancillary study to try to identify the most important modifiable predictors of achieving the activity and weight loss goals in both the short term and long term. at the end of the dpp, we learned that weight loss was the dominant predictor of diabetes prevention and that, for every kilogram of weight loss, there was a 16% reduction in risk for developing diabetes. we also know that lifestyle participants who did not meet the weight loss goal at year 1, but who achieved the physical activity goal of 150 min / week of brisk activity, had a 44% lower incidence of diabetes (10). although the lifestyle intervention was successful, not everyone was able to achieve the weight loss targets. it turned out that 49% of lifestyle participants achieved the 7% weight loss goal at 6 months, and 37% maintained the 7% weight loss at study end (11). in our ancillary study, 274 lifestyle participants (25% of the cohort) completed questionnaires to assess their weight loss history and a variety of psychological and behavioral factors. the questionnaires were administered at baseline and at 6 months after completion of the 16-session core lifestyle curriculum. we learned that the most important psychological predictor of weight loss was low - fat diet self - efficacy self - confidence in their ability to follow a low - fat diet. for each unit improvement in low - fat diet self - efficacy score during the core curriculum, there was an almost threefold greater likelihood of achieving the 7% weight loss goal at study end (12). in the dpp, we promoted self - efficacy by teaching participants skills related to setting small achievable goals, self - monitoring and balancing fat intake, stimulus control, managing stress and high - risk situations, and problem solving, which could explain these self - efficacy improvements. we additionally learned that the most important behavioral predictor of weight outcomes was flexible dietary restraint. for each unit increase in dietary restraint skills during the core curriculum, there was a 4.3-fold greater likelihood of achieving the 7% weight loss goal at study end (12). teaching patients flexible dietary restraint skills appears to be key. rather than trying to adhere to a specific diet plan, dpp participants had the flexibility to find their own way. participants self - monitored their weight and their eating and could compensate by eating less in response to any small increases in weight or any overeating episodes. they experienced this as a successful balancing of eating behavior rather than as a setback or failure to follow their diet and eat perfectly. as health care providers and diabetes educators, we can focus our energies on teaching dietary restraint skills and on other strategies that promote self - efficacy for both diet and activity behaviors. this evidence reminds me that people with diabetes need to be repeatedly reassured that they do not have to eat and exercise perfectly ; they need some structure, but they also need to learn to balance that structure with some flexibility with themselves by aiming to eat better on more days than not and by fitting activity into their lifestyle in ways that work for them. having the flexibility to find their own way to achieve clinical goals makes lifestyle change more doable and more sustainable. i was fortunate to be involved as a co - investigator and lead interventionist in the look ahead trial, helping to design the lifestyle intervention that was based on the dpp (13). look ahead randomly assigned 5,145 patients with type 2 diabetes who were overweight to receive either a lifestyle intervention with goals of 7% weight loss and 175 min / week of activity or a program of diabetes support and education to see whether the lifestyle intervention would reduce cardiovascular morbidity and mortality over the long term (14). after a median follow - up of 9.6 years, the lifestyle intervention did not reduce cardiovascular events defined as heart attack, stroke, hospitalization for angina, or death compared with a program of diabetes support and education (14). for me as a diabetes educator, however, the clinical implications of the look ahead trial go way beyond the headlines. as we debriefed our lifestyle intervention group participants on the results of the trial, we heard a common refrain that was best articulated by bob, one of our trial participants. do nt lose sight of the impact that this lifestyle program has made on our quality of life. a multitude of published articles speak to the positive impact of the lifestyle intervention, not only on cardiovascular disease risk factors (i.e., improvements in a1c, blood pressure, and lipid levels with less medication use and associated costs), but also on numerous other conditions (table 2) (15). when we examine the list of benefits, it is so clear why the lifestyle participants felt so adamant about how much better they felt, both physically and psychologically. the initial weight losses with this lifestyle intervention are among the best achieved through lifestyle modification. benefits of lifestyle intervention versus diabetes support and education in the look ahead trial (15) diabetes remission rate body image dissatisfaction number of medications the look ahead lifestyle program, modeled on that of the dpp and including the proactive use of meal replacements, clearly needs to be translated into the clinical practice setting for patients with type 2 diabetes. this goal is particularly important in light of the findings from the shield study (study to help improve early evaluation and management of risk factors leading to diabetes). the shield study, a 5-year, prospective survey of > 22,000 adults with or at risk for type 2 diabetes, had two key findings. first, people know what to do but do not know how to do it ; that is, they know they are supposed to lose weight and increase their activity, but they just do nt have the skills or know how to do it in a sustainable way. second, more effective interventions are needed to help patients improve health - related behaviors (16). in 2012, i received funding to conduct a pilot study adapting the look ahead lifestyle intervention for clinical practice in a program called improving diabetes outcomes through lifestyle change (idolc). idolc compared an adapted look ahead lifestyle intervention to usual care. in this study, we randomly assigned 57 primary care patients with type 2 diabetes to receive either a 19-week group lifestyle program adapted from look ahead or usual care, defined as individual medical nutrition therapy sessions with a dietitian. compared to the look ahead participants, idolc participants were more likely to be male (60% in idolc vs. 40% in look ahead), slightly older (62 vs. 59 years of age), and had comparable ethnic representation. at baseline, the idolc intervention cohort was more medically complex and had a higher rate of insulin use (70% vs. 15% in look ahead) and a higher mean a1c (8.2% vs. 7.3% in look ahead), with comparable initial bmis. our results show that, despite prevalent use of insulin and sulfonylureas, more than twice as many lifestyle group participants met the 5% weight loss target, with one - third losing 10% (table 3). this was achieved with simultaneous improvements in glycemic control and significant reductions in medication use (17). patients reported greater improvements in dietary restraint skills, low - fat diet behaviors, and self - efficacy for following a low - fat diet. weight and diabetes outcomes at 6 months in the idolc trial (17) the idolc lifestyle intervention program has been well received, and kevin s experience in the program is just one of many positive, heart - warming stories that we have witnessed. he was 61 years old, weighed 276 lb, and participated in no regular physical activity. kevin was on 60 units of glargine insulin and metformin and had an a1c of 7.9%. his blood pressure and lipids were well controlled with medications. after participating in the 19-week program, he was able to discontinue insulin and lisinopril at the end of the intervention and had an a1c of 6.3%. eighteen months later1 year after completion of the intervention he had lost a total of 62 lb. kevin s story emphasizes an important message from the shield study : people know what to do ; they just need to learn how to do it. it s not about willpower, it s about lifestyle skill power, and we can teach skills to help people make sustainable lifestyle changes. twenty - two months after starting the program, kevin is 68 lb lighter, with the abcs of diabetes control (a1c, blood pressure, and cholesterol) all still in the target range. his a1c is 5.9%, and he is on a trial off of metformin treatment. based on the success of our pilot study, we have now received 5 years of national institutes of health funding to conduct a larger - scale translation study called real health diabetes (figure 3). in the real health diabetes study, we will randomly assign 210 community health center patients who have type 2 diabetes to receive one of three treatments : 1) dietitian referral for individual medical nutrition therapy, 2) a lifestyle intervention delivered via in - person group, or 3) a lifestyle intervention delivered via a new approach using a telephone conference call group to find out whether this could be a way to extend the reach of the program. our primary study outcome will be the mean percentage of weight loss at 6 months, 1 year, 2 years (end of the intervention), and finally at 3 years (after 1 year of no intervention) to assess sustainability. we will also assess a variety of medical, psychological, and behavioral outcomes and quality of life. after 20 years of work designing and implementing these lifestyle programs, there is one thing i know for sure. lifestyle programs can provide patients with diabetes more of what they truly want and need : better health outcomes, less medication use, better quality of life, the continued ability to enjoy eating, and, most importantly, the know - how to achieve their weight loss and activity goals. so, what does it mean to make a meaningful difference ? for me, as a diabetes educator and dietitian, it is not just about contributing to landmark research studies in the area of diabetes and obesity. it is about creating a can - do feeling and improving the well - being of the patients who are struggling to manage these lifestyle - related conditions. we all know that the twin epidemics of diabetes and obesity are growing exponentially and that there is much more work to do. but each of us can commit to brightening the corner where we are. for me, it is not about what i do, but rather how i do it. patients come to me feeling discouraged about managing their diabetes or their weight, and we talk about the steps that they can take to improve their health. when i see their eyes brighten and their hopes rising, and i hear them say that s doable, my heart skips a beat because i know i have had a meaningful conversation, and that means it has been a successful day. for me, the final lesson and the moral of this story for diabetes educators is that it s not just about what you do, but also how you do it that can make living with diabetes more doable for your patients. our collective story on making a meaningful difference for people with diabetes is still being written. | editor s note : this article is adapted from the address ms. delahanty delivered as the recipient of the american diabetes association s (ada) outstanding educator in diabetes award for 2015. she delivered the address in june 2015 at the association s 75th scientific sessions in boston, mass. a webcast of this speech is available for viewing at the ada website (http://professional.diabetes.org/webcasts). |
currently, 1/9 people older than 65 years of age have alzheimer s disease (ad), and 1/3 of people older than 85 are diagnosed with ad. as the aging population expands, the projected number of ad cases is expected to triple by 2050, with economic costs escalating from $ 214 billion in 2014 to $ 1.2 trillion in 2050 (alzheimer s association facts 2014). this represents an enormous economic and societal challenge, particularly given the limited efficacy of currently available ad therapeutics. in terms of ad prevention, attention to diet, exercise, and cardiovascular health are likely to help reduce the risk of developing ad. however, identification of specific molecular pathways that could be targeted for prevention in aging and at - risk populations is an urgently needed strategy to help stem this dementia epidemic. given that the prevalence of ad doubles every 5 years in persons above the age of 65 and given the average human longevity of ~80 years, preventive strategies that could delay the onset of cognitive decline by only 5 years may reduce disease burden by half. recent data indicate that cyclooxygenase / pge2/ep receptor signaling may play important roles in preclinical development of ad in both human epidemiology and in mouse models of ad. pathological changes in ad consist of amyloid accumulation, tau phosphorylation, and synaptic and neuronal loss. these pathological hallmarks develop in the context of a potent and chronic inflammatory response characterized by glial activation, generation of cytokines and chemokines, complement proteins, inflammatory enzymes, and oxidative stress [2, 3 ]. this chronic inflammatory response is not only injurious to synapses, neurons, and circuits, but is persistent and non - resolving. recent studies indicate that the pre - clinical development of ad begins years to decades before initial diagnosis. while the initiating pathological events are not well defined, they are likely to involve synergistic interactions between a oligomer - mediated synaptic injury and dysregulated inflammatory responses. amyloid peptide generation and accumulation is an initiating event, and precedes onset of symptoms by years to decades. however, amyloid pet imaging studies suggest that a peptide accumulation can occur in subjects who do not have evidence of cognitive decline, leading to the hypothesis that a peptide accumulation is necessary but not sufficient for progression to ad. one or more additional factors may be necessary. in that regard, recent gwas studies of sporadic late - onset ad have identified genes involved in the innate immune response that are expressed in microglia, the resident myeloid cells of the central nervous system (cns). these microglial genes include the sialic acid - binding immunoglobulin - like lectin cd33 [6 - 8 ] and trem2 [9, 10 ] which regulate phagocytosis and a peptide clearance [11 - 13 ], and the complement receptor cr1 [14, 15 ]. these findings indicate that the microglial immune response may play a pathogenic role in the development of ad. microglia have embryonic origins [16, 17 ] and genetic signatures [18 - 20 ] that distinguish them from monocytes and other tissue macrophages. like other tissue macrophages, however, because microglia reside in the brain, they have additional and unique functions, including the establishment, maintenance, and pruning of synapses that are dynamically regulated by synaptic activity [21 - 24 ]. microglia can also regulate synaptic activity through mechanisms that are beginning to be identified, including secretion of neuroactive and neurotrophic factors. a role for microglia in the development of ad may therefore involve not only perpetuation of dysfunctional innate immune responses to accumulating a peptides and dying synapses and neurons, as the current literature supports, but may also involve direct effects of microglia on synapse integrity and function. the primary action of nsaids is the enzymatic inhibition of the cyclooxygenases cox-1 and cox-2, cytosolic enzymes that generate pgh2 from membrane stores of arachidonic acid. pgh2 is the precursor of the prostaglandins pge2, pgd2, pgi2, and pgf2a, and the thromboxane txa2. in epidemiologic studies of cognitively normal aging populations, nsaids prevent and delay development of ad [26 - 31 ]. although selected nsaids may have cyclooxygenase - independent effects, structurally distinct nsaids, including ibuprofen, naproxen, and sulindac all reduce risk of developing ad in large epidemiologic studies [27, 28, 30 ] suggesting that inflammatory prostaglandin signaling plays an important role in pre - clinical development of ad. interestingly, the beneficial effects of nsaids are restricted to the pre - clinical asymptomatic phase, as nsaids or selective cox-2 inhibitors do not help patients with mild cognitive impairment (mci) or ad [31 - 36 ]. nsaids however are not a good choice for large scale ad prevention because both toxic as well as beneficial downstream prostaglandin signaling pathways are inhibited and lead to adverse effects, including renal and gastric toxicity and increased risk for vascular disease. recent studies have identified beneficial prostaglandin signaling pathways downstream of nsaid action, including the vasodilatory prostacyclin pgi2 receptor and the neuroprotective, anti - inflammatory, and vasodilatory pge2 ep4 receptor [38 - 42 ]. this major limitation may help explain why in mci and ad, nsaids show no benefit, either because protective downstream prostaglandin pathways are inhibited or disease progression is already too advanced. inhibition of cox enzymatic activity by nsaids therefore has different consequences depending on timing of ad development, and inhibition of cox-1/cox-2 by non - selective nsaids is beneficial in preventing disease in healthy aging individuals but ineffectual once symptoms begin [31, 43 ]. given the expanding population of aging individuals and the anticipated rise in ad cases, understanding the molecular mechanisms by which nsaids prevent ad has taken on significant urgency. targeting of toxic inflammatory prostaglandin signaling downstream of cox may potentially slow or prevent progression to ad. pge2, pgd2, pgi2, and pgf2a, and the thromboxane txa2 are lipid signaling molecules that bind and activate specific g - protein - coupled receptors designated ep (for e - prostanoid receptor), dp, ip, fp, and tp, respectively. pge2 in particular has generated interest as a potential inflammatory agent in pre - clinical ad, as it was found to be increased 5-fold in cerebrospinal fluid (csf) of patients with early or probable ad [45, 46 ], but then declined with disease progression. in parallel, levels of the breakdown product of prostacyclin (pgi2), widely considered to be anti - inflammatory, were significantly decreased in csf of probable ad subjects. pge2 binds four g - protein coupled receptors (gpcrs) termed e - prostanoid receptors (ep1 - 4) that have distinct downstream signaling cascades and cellular distributions in brain. in vivo, all four ep receptors are expressed in neurons ; microglial expression of ep2, ep3, and ep4 receptors has been confirmed in mouse brain [41, 47, 48 ]. activation of ep receptors leads to changes in the production of camp and/or phosphoinositol turnover and ca mobilization. ep2 and ep4 receptors couple positively to gs to increase camp formation whereas ep3 couples negatively to camp through gi ; ep1 couples to gq, and activation results in increased intracellular calcium concentrations. to better understand the inflammatory pge2 signaling pathway in the context of a peptide accumulation, investigators have studied mouse models of familial ad, where transgenic mice express mutant forms of the amyloid precursor protein (app) and/or presenilin 1 (ps1) genes. microglial activation and elaboration of inflammatory and oxidative stress are well documented in these models, particularly as these mutant app mice age and accumulate a42 and a40 peptides. mutant app models display either loss of synapses or loss of synaptic proteins that are associated with spatial memory deficits, and these have been linked to effects of a oligomers, which are directly toxic to synapses, and to effects of inflammatory mediators like il1 or tnf. however, because mutant app models do not develop significant neuronal loss and tau pathology, two hallmarks of mci and ad in human subjects, these models are believed to be more reflective of the pre - clinical or asymptomatic phases of human ad. if considered in this way, the beneficial effects of nsaids have been validated in these mutant app models, where a correlation between nsaid administration and reduction of brain inflammation, a deposition, and rescue of learning and memory deficits has been established [53 - 56 ]. early studies examining in vivo effects of ep2 signaling in innate immunity demonstrated a significant reduction in lipid peroxidation following intracerebroventricular (icv) administration of lipopolysaccharide (lps), a canonical inducer of the innate immune response. lps - dependent increases in f2-isoprostanes, which are free radical - generated isomers of prostaglandin pgf2a, and f4-neuroprostanes (isops), which are products of neuronal docosohexanoic acid (dha) oxidation, were significantly suppressed in cerebral cortex of ep2-/- mice. in vitro studies parsing out the cellular specificity of the ep2 oxidative effect demonstrated that microglial ep2 elicited paracrine neurotoxicity in co - cultures of neurons and lps - primed microglia, and this effect was dependent on increased inducible nitric oxide synthase (inos) and cox-2 activity. in vivo, in the appswe - ps1e9 model of ad (app - ps1), global deletion of ep2 also led to significant decreases in lipid peroxidation in aging app - ps1 mice, suggesting a toxic inflammatory role for the ep2 receptor. additional in vivo studies demonstrated that global deletion of ep2 reduced expression of oxidative enzymes inos and components of the nadph oxidase complex in the app - ps1 model of ad, and reduced expression of cox-1, cox-2, inos, and many components of the nadph oxidase complex in a related model of familial amyotrophic lateral sclerosis (als). a major target of the innate immune response in the cns is the clearance of toxic and misfolded proteins. the accumulation of misfolded or aggregated proteins is a common feature of several chronic neurodegenerative diseases, including ad, parkinson s disease, huntington s disease, and als. however, with progression of disease, notably in ad models, the healthy phagocytic response of microglia to a peptides falters, either because microglia become ineffective or because they are overwhelmed by levels of accumulating a peptides. in parallel with progression of pathology in ad model mice, microglia also develop a more toxic inflammatory phenotype. this leads to a damaging feed - forward cycle, with increasing accumulation of toxic a peptide assemblies along with increased elaboration of toxic cytokines. in ad model mice, a signaling through toll - like receptors 2 and 4 (tlr2 and tlr4) drives downstream activation of nf-b transcription factors as a central inflammatory pathway in ad. a role for microglial ep2 in inhibiting phagocytosis of a fibrils was demonstrated in an ex vivo acute preparation using ad brain sections coated with ep2-/- microglia. microglia lacking ep2 receptor cleared human a peptides more effectively than wild type microglia, and ep2-/- microglia were associated with lower paracrine neurotoxicity. in vivo, in the app - ps1 model, deletion of ep2 resulted in significant reductions in total a40 and a42 levels and amyloid plaque deposition, an outcome likely reflecting both a more benign inflammatory milieu and an enhanced clearance of a peptides. in chimeric app - ps1 mice subjected to whole body irradiation followed by transplantation of wild type or ep2-/- bone marrow, levels of amyloid plaque were reduced in app - ps1 mice receiving wild type bone marrow, however ep2-/- bone marrow elicited even larger decreases in cerebral cortical plaque load. a role for ep2 signaling in phagocytosis has been shown in non - cns models, where myeloid ep2 suppresses phagocytosis of latex beads [67, 68 ] and bacteria [69 - 72 ]. recent in vivo studies using conditional knockout strategies have further defined the critical toxicity of microglial ep2 signaling in models of ad. conditional knock down of myeloid ep2 receptor using the cd11bcre recombinase line, where levels of myeloid ep2 are reduced ~50%, had multiple beneficial effects and restored healthy microglial responses to a peptides. cell - specific knockout of microglial ep2 increased microglial clearance of a peptides and suppressed toxic inflammatory gene expression. in addition, unbiased genomic studies of microglia isolated from brain revealed that knockdown of microglial ep2 receptor increased generation and local signaling of insulin - like growth factor 1 (igf1) in hippocampus in response to a peptide stimulation. igf1 promotes synaptogenesis, neurogenesis, and neuroprotection through the pi3k / akt pathway in brain. deletion of microglial ep2 also increased expression of members of the ppar signaling pathway, including rxr which along with its binding partner ppar reduces proinflammatory gene expression and enhances clearance of a peptides. rxr is also the target of the fda - approved rxr agonist bexarotene (targretin) that has been shown in some studies to lower interstitial levels of soluble a peptides and to prevent memory deficits in ad model mice [77, 78 ]. additional genes suppressed by ep2 signaling in microglia but intimately related to a peptide clearance included the cholesterol transporter abca1 and apolipoprotein e (apoe), proteins that enhance proteolytic degradation of soluble a peptides [81, 82 ]. in addition, lipoprotein lipase (lpl), which binds a peptide, was also upregulated in hippocampus with ep2 microglial deletion ; interestingly, an intronic polymorphism in lpl is associated with reduced lpl mrna, increased amyloid and neurofibrillary tangle densities, and increased prevalence of ad. the upregulation of these genes in microglial ep2 knockout mice suggests that ep2-deficient microglia respond to a42 peptides in vivo by inducing anti - inflammatory and a - clearing nuclear hormone receptor signaling genes. consistent with this beneficial effect of reduced ep2 signaling, conditional deletion of microglial ep2 in the app - ps1 model prevented synaptic injury and spatial memory deficits. the toxic effects of microglial ep2 contrast significantly with the beneficial anti - inflammatory effects of microglial ep4 in vivo. previous in vivo studies of innate immune responses to lps had identified a pronounced anti - inflammatory effect of microglial ep4 activation that was associated with reduced nuclear translocation of nf-b subunits p65 and p50 in myeloid cells. conversely, following lps stimulation in vivo, conditional deletion of the ep4 receptor in myeloid cells led to an increase in brain pro - inflammatory gene expression and lipid peroxidation, suggesting that the function of myeloid ep4 is to attenuate and/or terminate innate immune responses. subsequent studies of a42-mediated inflammatory responses confirmed the anti - inflammatory nature of microglial ep4 signaling, where in primary microglial cells, ep4 stimulation attenuated levels of a42-induced inflammatory factors and potentiated phagocytosis of a42. unbiased genomic studies showed that ep4 receptor activation broadly opposed a42-driven gene expression changes in microglia, with significant enrichment of targets of irf1, irf7, and nf-b transcription factors. in vivo, in app - ps1 mice deficient for microglial ep4, inflammatory gene expression, oxidative protein modification, and a deposition in brain were significantly increased at early stages of pathology, but not at later stages, suggesting an early anti - inflammatory function of microglial ep4 signaling in the app - ps1 model. thus, although both the ep2 and ep4 receptors are positively coupled to camp, they appear to have divergent inflammatory functions in models of a peptide mediated neuroinflammation and neurodegeneration. the carboxy terminal cytoplasmic tail of the ep4 receptor is significantly longer than that of the ep2 receptor and can recruit distinct signaling molecules, a difference likely to influence downstream signaling of the ep4 versus ep2 receptors. the ep3 receptor is a central component in the regulation of the febrile response [87, 88 ]. in classical models of innate immunity, the function of inflammatory ep3 has been explored in a model of bacterial lung infection, where deletion of ep3 resulted in a marked increase in clearance of bacteria, reduced neutrophil ingress, and improved survival, a phenotype reminiscent of the pro - phagocytic and anti - inflammatory effects of ep2 deletion, as discussed above. in the brain, ep3 has mainly been localized to neurons, however immunocytochemical induction of ep3 expression has been observed in striatal microglia in the setting of an excitotoxic lesion induced by injection of quinolinic acid, a potent ligand at the glutamatergic n - methyl - d - aspartate (nmda) receptor. this suggests that although ep3 may not be expressed in microglia under physiological conditions, in the appropriate inflammatory or injury contexts, ep3 might be induced and contribute to innate immune responses. the function of ep3 signaling has been examined in two models relevant to ad, namely the icv a injection model, which elicits a potent and long lasting inflammatory response to a peptides [90, 91 ] and in the app - ps1 model. in a recent study, the induction of pro - inflammatory gene expression, cytokine generation, and lipid peroxidation following icv a42 was significantly abrogated in ep3-/- mice, suggesting that microglial ep3 signaling engaged a toxic inflammatory response to a peptides. in the app - ps1 model, deletion of ep3 significantly blunted the induction of proteins capable of increasing oxidative injury, including inos, components of the nadph oxidase complex, and cox-2. moreover, suggestive of a role in a clearance, app - ps1 mice lacking either one or both ep3 alleles had significantly lower amyloid accumulation. this effect is consistent with the lung infection studies mentioned above, where deletion of ep3 led to enhanced clearance of bacteria. however, it is also possible ep3 deletion impacted on the generation of a peptide from app, as prior studies have correlated increased oxidative stress and inflammation with increased expression and activity of - secretase [93, 94 ], the first enzyme to cleave app in the formation of the a42 peptide. indeed, loss of ep3 receptor in the app - ps1 background resulted in decreased - secretase expression and activity. this would suggest that in the app - ps1 model, ep3 signaling may both suppress a clearance, and by increasing inflammatory oxidative stress, increase the generation of a peptide. interestingly, loss of just one allele of ep3 in the app - ps1 background had significant effects on a peptide levels. of the four ep receptors, the role of inflammatory ep1 in ad is less clear. ep1 is highly expressed in neurons [95, 96 ] and functions in neuronal survival. in models of neuronal injury, including nmda excitotoxicity and cerebral ischemia, pharmacologic or genetic deletion of ep1 reduces cerebral injury [96 - 98 ]. however, ep1 expression is not found in microglia after hypoxia - ischemia, nor does microglial activation induce neurotoxicity in hippocampal slices treated with lps and ifn. a lack of effect of inflammatory ep1 would suggest that the toxic function of this receptor is primarily neuronal. supporting this conclusion are findings that inflammation sensitive neural progenitor cells (npc) in the subgranular zone of the dentate gyrus are vulnerable to microglial ep2 signaling and npc ep1 signaling. pre - clinical development of ad begins decades prior to diagnosis, and nsaids act during this time period to delay onset and progression to ad. the early accumulation of a42 peptides, beginning years to decades before cognitive symptoms arise, triggers microglial inflammatory responses that are initially robust, but falter as disease progresses. a summary of findings relevant to inflammatory actions of the pge2 ep2, ep3, and ep4 receptors in the app - ps1 model are diagrammed in fig. (1). the opposing actions of the ep2/ep3 and ep4 receptors highlight the importance of targeting selected ep receptors downstream of cox-1/cox-2, as upstream inhibition of cox-1/cox-2 activity may inhibit beneficial as well as toxic pge2 ep receptor signaling. this is a potential future indication, as we await the identification and validation of biomarkers that can reliably predict subjects at risk for ad. | the inflammatory response is a fundamental driving force in the pathogenesis of alzheimer s disease (ad). in the setting of accumulating immunogenic a peptide assemblies, microglia, the innate immune cells of the brain, generate a non - resolving immune response and fail to adequately clear accumulating a peptides, accelerating neuronal and synaptic injury. pathological, biomarker, and imaging studies point to a prominent role of the innate immune response in ad development, and the molecular components of this response are beginning to be unraveled. the inflammatory cyclooxygenase - pge2 pathway is implicated in pre - clinical development of ad, both in epidemiology of normal aging populations and in transgenic mouse models of familial ad. the cyclooxygenase - pge2 pathway modulates the inflammatory response to accumulating a peptides through actions of specific e - prostanoid g - protein coupled receptors. |
we conducted a retrospective cohort study of all adult, nondiabetic patients undergoing a first kidney transplant at the mayo clinic arizona between june 1999 and january 2008. after institutional review board approval, we identified the study cohort by systematic chart review. absence of diabetes before transplantation was documented in the form submitted to united network for organ sharing, with the information obtained from documentation provided by a medical care provider before transplant. additionally, all patients had a fasting plasma glucose 30% ; the day of tacrolimus initiation was variable for each patient. mycophenolate mofetil and tacrolimus were the maintenance immunosuppressants for all patients who did not require ongoing steroid therapy. nodat was diagnosed if a patient had hba1c 6.5%, fasting venous plasma glucose 126 mg / dl, or was receiving diet or medical therapy for diabetes between 1 month and 1 year posttransplant. 6.5% has recently been adopted as a new diagnostic criterion for diabetes (7), and we used these composite diagnostic criteria previously (6). the time period for development of nodat (1 month to 1 year posttransplant) was chosen because patients are clinically stable and on stable doses of immunosuppression by 4 weeks posttransplant, and this period excludes patients who developed transient hyperglycemia in the immediate posttransplant period as a result of stress of surgery and/or high - dose corticosteroid therapy. additionally, the highest incidence of nodat occurs within the 1st year posttransplant (3,4). in addition to demographic, anthropometric, and pretransplant laboratory assessments, we ascertained pretransplant if corticosteroids would be used posttransplant for nontransplant indications or as maintenance immunosuppression. logistic regression was used to determine the risk of nodat associated with pretransplant patient characteristics. we first constructed univariate models to determine the association of individual pretransplant variables with development of nodat. variables significant at p 30% ; the day of tacrolimus initiation was variable for each patient. mycophenolate mofetil and tacrolimus were the maintenance immunosuppressants for all patients who did not require ongoing steroid therapy. nodat was diagnosed if a patient had hba1c 6.5%, fasting venous plasma glucose 126 mg / dl, or was receiving diet or medical therapy for diabetes between 1 month and 1 year posttransplant. 6.5% has recently been adopted as a new diagnostic criterion for diabetes (7), and we used these composite diagnostic criteria previously (6). the time period for development of nodat (1 month to 1 year posttransplant) was chosen because patients are clinically stable and on stable doses of immunosuppression by 4 weeks posttransplant, and this period excludes patients who developed transient hyperglycemia in the immediate posttransplant period as a result of stress of surgery and/or high - dose corticosteroid therapy. additionally, the highest incidence of nodat occurs within the 1st year posttransplant (3,4). in addition to demographic, anthropometric, and pretransplant laboratory assessments, we ascertained pretransplant if corticosteroids would be used posttransplant for nontransplant indications or as maintenance immunosuppression. logistic regression was used to determine the risk of nodat associated with pretransplant patient characteristics. we first constructed univariate models to determine the association of individual pretransplant variables with development of nodat. variables significant at p < 0.10 in univariate models were then included in multivariate analyses. we conducted two multivariate analyses : 1) a standard model, in which continuous variables and discrete variables were included without categorization ; and 2) a dichotomized model, where variables were assigned binary values, using clinically relevant cut points. three models of the pretransplant risk score were then created from the multivariate logistic regression models : 1) a standard model, in which both continuous and discrete variables were included and weighted according to the -coefficients in the multivariate logistic model ; 2) a dichotomous model, in which continuous variables were dichotomized based on clinically relevant cut points (values below and above the cut point were assigned a value of 0 and 1, respectively) and were weighted according to the -coefficients in the multivariate logistic model ; and 3) a summary score calculated as the sum of the points accrued by each individual using the dichotomized measures from the dichotomous model. receiver operating curves (rocs) were created for each of the three models to compare the accuracy of each in predicting nodat. statistical analyses were conducted with stata statistical software, version 10.0 (statacorp, college station, tx) or sas version 9.2. patient characteristics and their associations with nodat are described in tables 1 and 2, respectively. maintenance immunosuppression was predominantly tacrolimus and mycophenolate mofetil : 93 and 86% were prescribed tacrolimus at 4 and 12 months posttransplant, respectively. clinical characteristics of the study participants association of variables and development of nodat in univariate logistic regression analysis of 316 patients in whom all variables were measured, seven pretransplant risk factors older age, higher pretransplant fasting glucose, triglycerides and bmi, family history of t2 dm, use of gout medicines, and use of corticosteroids posttransplant (ascertained pretransplant)were associated with higher risk of nodat (p < 0.10). risk factors with p 0.10 were not included : minority race, dialysis modality pretransplant, donor type, duration of dialysis, uric acid, and hepatitis c seropositivity. pretransplant age, fasting glucose, fasting triglycerides, and use of corticosteroids posttransplant were associated with increased risk of nodat in multivariate analyses in both the standard model and in the dichotomized model (table 3). logistic regression models : association of continuous variables and dichotomized variables to development of nodat table values are odds ratio (95% ci), p value for the given variable. the risk calculators created from the multivariate analyses were as follows : probability of nodat = 1/ 1 + e(fn[x ]) where f[x ] = 9.6288 + 0.02397 age (years) at transplant + 0.5624 (if family history of t2 dm) + 0.7624 (if steroid maintenance) + 0.03021 pretransplant fasting glucose (mg / dl) + 0.0259 pretransplant bmi (kg / m) + 0.4467 log2 pretransplant triglyceride (mg / dl) + 0.7481 (if gout medicine used pretransplant). probability of nodat = 1/ 1 + e(fn[x ]) where f[x ] = 2.4684 + 0.5396 (if transplant age 50 years) + 0.4914 (if family history of t2 dm) + 0.7410 (if steroid maintenance) + 0.7285 (if pretransplant fasting glucose 100 mg / dl) + 0.3693 (if pretransplant bmi 30 kg / m) + 0.8440 (if pretransplant triglyceride 200 mg / dl) + 0.7917 (if gout medicine used pretransplant). one point was assigned to each of the following : age above 50 years, family history of t2 dm, pretransplant assignment to corticosteroid maintenance protocol, pretransplant fasting glucose 100 mg / dl, pretransplant bmi 30 kg / m, pretransplant triglycerides 200 mg / dl, and use of gout medicine areas under the roc for predicting nodat were 0.72, 0.71, and 0.70 for the three models, respectively, and not significantly different from each other (fig. the summary scores were also grouped as low (0 or 1), intermediate (2 or 3), or a high - risk group (4, 5, or 6) ; prediction of nodat by group is shown in fig. probability of nodat = 1/ 1 + e(fn[x ]) where f[x ] = 9.6288 + 0.02397 age (years) at transplant + 0.5624 (if family history of t2 dm) + 0.7624 (if steroid maintenance) + 0.03021 pretransplant fasting glucose (mg / dl) + 0.0259 pretransplant bmi (kg / m) + 0.4467 log2 pretransplant triglyceride (mg / dl) + 0.7481 (if gout medicine used pretransplant). probability of nodat = 1/ 1 + e(fn[x ]) where f[x ] = 2.4684 + 0.5396 (if transplant age 50 years) + 0.4914 (if family history of t2 dm) + 0.7410 (if steroid maintenance) + 0.7285 (if pretransplant fasting glucose 100 mg / dl) + 0.3693 (if pretransplant bmi 30 kg / m) + 0.8440 (if pretransplant triglyceride 200 mg / dl) + 0.7917 (if gout medicine used pretransplant). one point was assigned to each of the following : age above 50 years, family history of t2 dm, pretransplant assignment to corticosteroid maintenance protocol, pretransplant fasting glucose 100 mg / dl, pretransplant bmi 30 kg / m, pretransplant triglycerides 200 mg / dl, and use of gout medicine. areas under the roc for predicting nodat were 0.72, 0.71, and 0.70 for the three models, respectively, and not significantly different from each other (fig. the summary scores were also grouped as low (0 or 1), intermediate (2 or 3), or a high - risk group (4, 5, or 6) ; prediction of nodat by group is shown in fig. a simple risk score using the sum of seven dichotomized pretransplant risk factors is as good at predicting nodat as a standard multivariate model using continuous variables in this sample from one institution. a score of 07, calculated from pretransplant age, family history of t2 dm, bmi, fasting glucose and triglycerides, use of gout medicine, and predicted use of corticosteroids posttransplant (nontransplant indications or immunologic indications) predicted incidence of nodat at 1 year posttransplant. the risk of nodat ranged from 7%, for a score of 0, to 56%, for a score of 4. a simple summary score is valuable because it demonstrates the additive nature of the individual variables and integrates the impact of single baseline variables on development of nodat. we constructed three logistic regression models for predicting nodat, ranging from a model that used continuous variables as such to a simple score that adds the number of variables having values above a cut point. we included a dichotomous model as an intermediate, in which each variable was dichotomized but weighted according to its importance rather than weighted equally as in the summary score. we anticipated that the continuous model would provide the best predictive power and the summary score the least. although this was the case, surprisingly there were no important or statistically significant differences in the predictive abilities of the three models, as judged by areas under the roc (fig. the simplest model can be used at the bedside for rapid evaluation without extensive computation. before applying this to other populations or settings, serum uric acid and gout have been identified as risk factors for t2 dm but have not been reported as risk factors for nodat. interestingly, serum uric acid itself did not predict nodat, but gout medication did. most patients with end - stage renal disease undergoing dialysis have elevated serum uric acid levels because of renal failure and inadequate clearance by dialysis, but do not develop gout. rather, other factors predict gout in patients with end - stage renal disease, including african american ethnicity, older age, bmi, female sex, hypertension, and alcohol use (8). in end - stage renal disease patients undergoing dialysis therapy, gout is a risk factor for mortality (8) but has not been reported as an independent risk factor for diabetes. alternatively, the medicines for gout may themselves be diabetogenic, but we are unaware of evidence for this. this question should be pursued in studies that are large enough to include users of different types of gout medicines. these risk scores were developed primarily for future application in clinical trials to evaluate measures to prevent nodat. like many other risk calculators, these were created for a specific population of patients scheduled to undergo kidney transplantation and may not apply to general patient populations. however, the risk scores may eventually prove to be clinically useful in patients similar to those in our cohort. of the pretransplant risk factors for nodat that emerged from this study, only bmi, fasting glucose, and triglycerides are amenable to modification. treatment for gout, although a significant risk factor, is more likely a marker of genetic and metabolic abnormalities, some of which may be modifiable by dietary and other measures. use of corticosteroid therapy posttransplant may or may not be modifiable, depending on its indications. whether lifestyle modification or medicines will reduce the risk for nodat remains an important question. the diabetes prevention program and other clinical trials showed that t2 dm could be delayed or prevented (913). because nodat has a significant impact on graft survival, patient survival, and cost, prevention of nodat may be very valuable. if prevention of nodat in patients at risk is possible, the simple risk score could be used to identify those pretransplant patients at the greatest need of intervention. the question of which patients should be enrolled in such clinical trials or given interventions, however, depends on more than their estimated risk. although our simple risk score separated those with low risk (12% developed nodat) from those at high risk (56% developed nodat), the majority of the cases (50 of 85) occurred in those at intermediate risk (fig. if safe, effective, and affordable interventions were available, consideration should be given to providing them to all transplant patients. on the other hand, if the only effective interventions had serious side effects or other costs, they might be appropriate only for those at higher risk first, we used a composite definition of nodat (fasting venous glucose 126 mg / dl, hba1c 6.5%, or drug therapy for diabetes) rather than the american diabetes association diagnostic criteria. although our criteria have been used previously (6), our definition differed from the 2010 american diabetes association criteria (7) by not using an oral glucose tolerance test. however, hba1c 6.5% has recently been suggested as the sole diagnostic criterion for diabetes (14). had we used an oral glucose tolerance test, it is likely that some of our patients would have been excluded for having pretransplant diabetes and some additional ones would have been diagnosed with nodat. second, because precise time to event was not available, we used logistic regression rather than time - to - event analysis to develop our risk score. this was appropriate because of the short time period to event (within 1 year) and no loss to follow - up before 1 year posttransplant. finally, this study was performed in a single center with a cohort of 318 patients. kidney transplantation is widely acknowledged to be the best therapy for end - stage renal disease, but its advantages are severely undermined by nodat. nodat diminishes patient and allograft survival and quality of life and increases the cost of care. the use of a simple summary risk score can identify patients at highest risk of nodat so that interventions may begin. the pretransplant risk factors for future nodat overlap with those for t2 dm in general, thus emphasizing the need for future clinical intervention studies similar to the diabetes prevention program to decrease nodat. | objectivenew - onset diabetes after kidney transplantation (nodat) has adverse clinical and economic implications. a risk score for nodat could help identify research subjects for intervention studies.research design and methodswe conducted a single - center retrospective cohort study using pretransplant clinical and laboratory measurements to construct a risk score for nodat. nodat was defined by hemoglobin a1c (hba1c) 6.5%, fasting serum glucose 126 mg / dl, or prescribed therapy for diabetes within 1 year posttransplant. three multivariate logistic regression models were constructed : 1) standard model, with both continuous and discrete variables ; 2) dichotomous model, with continuous variables dichotomized at clinically relevant cut points ; and 3) summary score defined as the sum of the points accrued using the terms from the dichotomous model.resultsa total of 316 subjects had seven pretransplant variables with p < 0.10 in univariate logistic regression analyses (age, planned corticosteroid therapy posttransplant, prescription for gout medicine, bmi, fasting glucose and triglycerides, and family history of type 2 diabetes) that were selected for multivariate models. areas under receiver operating curves for all three models were similar (0.72, 0.71, and 0.70). a simple risk score calculated as the sum of points from the seven variables performed as well as the other two models in identifying risk of nodat.conclusionsa risk score computed from seven simple pretransplant variables can identify risk of nodat. |
achalasia cardia is a rare primary esophageal motor disorder, which is diagnosed on the basis of esophageal manometry.1 typical manometry findings in achalasia are aperistalsis of esophageal body and incomplete relaxation of lower esophageal sphincter (les).2 based on average esophageal body amplitude, achalasia is classified into classic (40 mmhg) and vigorous types (> 40 mmhg).3 vigorous achalasia is considered as the early stage in the natural history of the disease.4,5 treatment of achalasia is usually palliative in nature.6 there are 3 main modes of therapy : pneumatic dilation (pd), botulinum toxin injection (both through endoscopic means) and surgery (heller 's cardiomyotomy). moreover, it is cost - effective compared to botulinum toxin injection and surgery.8 - 10 pd can be performed with different dilators of variable balloon compliances. low compliance polyethylene pneumatic dilator (rigiflex dilator) is most widely used because of its theoretical advantages over the high compliance balloon dilator.11 most feared complication of pd is esophageal perforation. perforation rate varies from less than 1% to 3% in various studies.12 - 16 furthermore, pd is effective in 64%-87% patients.12 also, a proportion of initial responders experience recurrence during long - term follow - up. therefore, it is important to predict which patient is less likely to respond or develop recurrence following an initial response for the following reasons ; (1) to devise treatment strategy in a given patient, (2) to prognosticate, (3) to plan early re - intervention, if required, and (4) to help understand pathophysiology of the disease. the studies published in literature addressing the issue on predictors of outcome of pd (tables 1 - 3) differ in type of dilator used, symptom scores used to assess the outcomes (response and recurrence), treatment protocol for management of recurrence and investigations used to predict outcomes etc. in spite of such heterogeneity between the studies, these do provide valuable information, which can guide physician in planning treatment strategy. the first large prospective study was done by ponce in which 157 patients with achalasia underwent pd with witzel dilator. patients who had post - pd lower esophageal sphincter pressure (lesp) 15 mmhg and lesp > 30 mmhg. the limitation of this study was lack of use of conventional statistics including multivariate analysis. mehta reported a retrospective study on 52 patients using rigiflex balloon in whom 81% responded to pd. on univariate analysis, non - responders were younger in age (50 mmhg) and reduced mid - esophageal contractions (amplitude 50% reduced) lesp and good esophageal emptying may be offered repeated pd in the unlikely event of recurrence. thirty - five mm instead of 30 mm balloon should be tried for first pd, particularly in males. a prospective study with large number of patients and long - term follow - up is needed. both timed barium esophagogram and manometry, especially high resolution manometry should be done at baseline and post - pd, so that they can be compared in their value in predicting outcome. the response to pd depends on age and gender of the patient and size of the balloon used for pd. the long - term response can be predicted with the help of post - pd manometry and timed barium esophagogram. | pneumatic dilation (pd) is an effective treatment for achalasia cardia. outcome of pd, however, varies among different studies. recently, some groups started considering laparoscopic myotomy to be competitive to pd in treatment of achalasia considering dreaded complication like perforation following the latter therapeutic approach. therefore, there is need to predict outcome of pd for achalasia, so that appropriate therapy, both for treatment nave and for treatment failed patients can be chosen. apart from age and gender, 2 investigations, namely post - pd manometry and timed barium esophagogram are most often used to predict outcome after pd. even though there are studies available in the literature with regard to these modalities to predict outcome of pd, these are quite few in number, including small number of patients, primarily because of rarity of the disease. in this article, we review the literature predicting outcome of pd for achalasia. |
cardiovascular disease is a major cause of morbidity and mortality and accounts for up to 70% of the major adverse clinical advents in the first year following liver transplantation. indeed, cardiovascular disease remains the leading cause of non graft - related death in the longer term. although the high incidence of cardiovascular events post - transplant is regarded as being multifactorial, the increased prevalence of components of the metabolic syndrome (abdominal obesity, atherogenic dyslipidemia, hypertension, insulin resistance glucose intolerance, proinflmatory state, and prothrombotic state) attributed to the immunosuppressant therapy post - transplant, is important. the exact prevalence of coronary artery disease (cad) in patients with end - stage liver disease (esld) being evaluated for orthotopic liver transplantation (olt) is unclear based on the available definition and diagnostic methods used for diagnosing cad in this population. the assessment of cad with coronary angiography (ca) in patients who were being evaluated for olt revealed that among those who had no prior history of ischemic heart disease and were currently asymptomatic, 13.3% had coronary stenosis greater than 70%. however, based on data from other studies utilizing ca as a diagnostic technique for cad diagnosis, the prevalence rate ranged from 2.9 to 24.5%.[59 ] given a 2.5% prevalence rate of cad in the asymptomatic men in the general population, the former belief that cad is uncommon in patients with esld no longer appears to be true. experience with stress myocardial perfusion single - photon emission computed tomography (mps) in patients with esld is limited and conflicting. a normal stress mps study identified patients at a very low risk for early and late cardiac events despite a high risk profile. furthermore, the prevalence of abnormal mps in this study was 9%. in contrary, davidson. found a very limited role of mps testing in cardiac risk assessment before liver transplantation because only 13% of patients who underwent preoperative mps testing had positive scans, which reflects a low prevalence of cad in this population. furthermore, only one of those (1.5%) had a high - risk scan. similarly, only one patient with known cad had a reduced left ventricular ejection fraction (lvef). subsequently, the author please see above change from investigator to name of the author concluded that routine mps testing to rule out cardiomyopathy does not appear justified in asymptomatic (from a cardiac standpoint) patients with esld. no major cardiac perioperative events (death or myocardial infarction) were noted in the study population. also, some investigators found a limited role for noninvasive stress mps testing in cardiac risk assessment before liver transplantation and demonstrated that stress mps imaging has a poor predictive value for cad in olt candidates. the aim of this study was to determine the prevalence of abnormal mps as a marker of cad and abnormal lvef as marker of cardiomypathy or heart failure in all patients with esld undergoing assessment for olt. the long - term goal will be to correlate these findings with cardiovascular events postoperatively. one hundred sixty - seven consecutive patients with end - stage liver who are being considered for olt were enrolled in this study. the electronic and paper charts of each patient were reviewed, and baseline demographics, medical history, and etiology of esld were recorded. patients with known cad, unstable medial conditions or nondiagnostic stress mps studies were excluded. in our institution, preoperative mps imaging is performed as a routine investigation in all transplant candidates who have two or more cad risk factors such as dm, htn, hypercholesterolemia, or symptoms suggestive of cad. mps with technetium-99 m sestamibi or technetium-99 m myoview imaging was performed according to the standard recent guidelines of american society of nuclear cardiology (asnc). stress testing was done with dipyridamole in 137 patients and treadmill exercise in 23 patients. abnormal spect imaging results were defined as reversible (ischemia) or fixed (scar) perfusion defects (or both) and quantified as small, moderate, or large. abnormal stress spect was classified as low risk (perfusion defect less than 10% of the myocardium), moderate risk (perfusion defect in the range of 1020% of the myocardium) and high risk (perfusion defect more than 20% of the myocardium) and abnormal ejection fraction (ef) of less than 35%. categorical data are presented as percent frequencies and compared between groups by chi - square or fisher 's exact test. one hundred sixty - seven consecutive patients with end - stage liver who are being considered for olt were enrolled in this study. the electronic and paper charts of each patient were reviewed, and baseline demographics, medical history, and etiology of esld were recorded. patients with known cad, unstable medial conditions or nondiagnostic stress mps studies were excluded. in our institution, preoperative mps imaging is performed as a routine investigation in all transplant candidates who have two or more cad risk factors such as dm, htn, hypercholesterolemia, or symptoms suggestive of cad. mps with technetium-99 m sestamibi or technetium-99 m myoview imaging was performed according to the standard recent guidelines of american society of nuclear cardiology (asnc). stress testing was done with dipyridamole in 137 patients and treadmill exercise in 23 patients. abnormal spect imaging results were defined as reversible (ischemia) or fixed (scar) perfusion defects (or both) and quantified as small, moderate, or large. abnormal stress spect was classified as low risk (perfusion defect less than 10% of the myocardium), moderate risk (perfusion defect in the range of 1020% of the myocardium) and high risk (perfusion defect more than 20% of the myocardium) and abnormal ejection fraction (ef) of less than 35%. categorical data are presented as percent frequencies and compared between groups by chi - square or fisher 's exact test. only 7 patients out of 167 were excluded for one or more of the following reasons. the mps study was not diagnostic in three patients due to one or more of the following excessive extracardiac activity motion artifacts or left bundle branch block (lbbb) and false - positive result could not be excluded ; and three patients refused to have stress test and/or stress imaging [figure 1 ]. thirteen patients out of total 160 had abnormal stress spect that corresponds to 8% of the estimated prevalence. the number of low-, moderate-, and high - risk scans was 7, 2, 4, respectively. twelve (7.5%) out of 160 patients who completed rest and gated stress imaging had low lvef (less than 50%). clinical characteristic of the study population nondiagnostic myocardial perfusion spect in a 59-year - old male who was a liver transplant candidate. stress images shows extensive extracardiac activity adjacent to the inferior wall of the left ventricle (arrows), a common finding in patients with liver disease due to ascites and bowel activity. the rest of the images show normal myocardial perfusion. to role out coronary artery disease, coronary computed tomography was performed, and showed normal coronary arteries (sax : short axis, vla : vertical long axis, hla : horizontal long axis) cad risk factors were as follows : dm 65 (41%), htn 54 (39%), hypercholesterolemia 40 (25%), smoking 29 (18%), male gender, and age more than 55 years. there was a strong correlation between abnormal mps and dm (p=0.46) and male gender (0.26), but there was no association with htn (p=1), hypercholesterolemia (p=0.849), age (p=0.047), smoking (p=0.62) or etiology of the liver disease (p=0.79). in multivariate analysis, the only significant correlation was observed with male gender (odds ratio 7). in our patient population, the etiology of esld was as follows : hepatitis c (hc) 75 (47%), hepatitis b (hep b) 45 (28%), cryptogenic 15 (9%), nonalcoholic steatohepatitisnash 7 (4%) and others (include primary sclerosing cholangitis, autoimmune hepatitis, wilson disease, schistosomiasis, and alcoholic liver disease) 18 (11%) [figure 2 ]. the etiology of the liver disease had no correlation with result of stress mps imaging. the etiology of end - stage liver disease that is being considered for liver transplantation. only 7 patients out of 167 were excluded for one or more of the following reasons. the mps study was not diagnostic in three patients due to one or more of the following excessive extracardiac activity motion artifacts or left bundle branch block (lbbb) and false - positive result could not be excluded ; and three patients refused to have stress test and/or stress imaging [figure 1 ]. thirteen patients out of total 160 had abnormal stress spect that corresponds to 8% of the estimated prevalence. the number of low-, moderate-, and high - risk scans was 7, 2, 4, respectively. twelve (7.5%) out of 160 patients who completed rest and gated stress imaging had low lvef (less than 50%). clinical characteristic of the study population nondiagnostic myocardial perfusion spect in a 59-year - old male who was a liver transplant candidate. stress images shows extensive extracardiac activity adjacent to the inferior wall of the left ventricle (arrows), a common finding in patients with liver disease due to ascites and bowel activity. the rest of the images show normal myocardial perfusion. to role out coronary artery disease, coronary computed tomography was performed, and showed normal coronary arteries (sax : short axis, vla : vertical long axis, hla : horizontal long axis) cad risk factors were as follows : dm 65 (41%), htn 54 (39%), hypercholesterolemia 40 (25%), smoking 29 (18%), male gender, and age more than 55 years. there was a strong correlation between abnormal mps and dm (p=0.46) and male gender (0.26), but there was no association with htn (p=1), hypercholesterolemia (p=0.849), age (p=0.047), smoking (p=0.62) or etiology of the liver disease (p=0.79). in multivariate analysis, the only significant correlation was observed with male gender (odds ratio 7). in our patient population, the etiology of esld was as follows : hepatitis c (hc) 75 (47%), hepatitis b (hep b) 45 (28%), cryptogenic 15 (9%), nonalcoholic steatohepatitisnash 7 (4%) and others (include primary sclerosing cholangitis, autoimmune hepatitis, wilson disease, schistosomiasis, and alcoholic liver disease) 18 (11%) [figure 2 ]. the etiology of the liver disease had no correlation with result of stress mps imaging. the etiology of end - stage liver disease that is being considered for liver transplantation. the main conclusion of this study is that the prevalence of abnormal stress mps in patients with esld who are being evaluated for olt is low (only 8%). furthermore, the prevalence of high - risk stress spect is very low ; only 4 patients (2.5%) had abnormally high - risk scan out of 160. in addition, there is a significant association between abnormal ef and abnormal mps, suggesting that the etiology of cardiomypathy in esld is most likely to be cad. the exact prevalence of cad in patients with esld is extremely variable based on current literature. unfortunately, the prevalence of abnormal spect in our general population is unknown for comparison. however, our data are concordant with those of the previous studies of zoghbi. and kryzhanovski. zoghbi. demonstrated that the mps studies were normal in 91% of patients despite the high - risk profile of these patients compared with those with no mps studies, and most importantly, they found that patients with normal perfusion and left ventricular function had a low cardiac event rate during the 2-year post - transplant period. only 1.5% had high - risk scan, and 7.9% and 3% had low- and intermediate - risk scan, respectively. unfortunately, the sensitivity and specificity of mps in patients with esld have been reported to be very low in previous studies. davidson. found the sensitivity and specificity of mps in patients with esld and compared the mps with ca and found that the sensitivity and specificity are 37% and 63%, respectively. this is very low compared to the sensitivity and specificity of stress mps in the general population, which have been reported to be 8390% and 8292%, respectively. the poor sensitivity of stress mps in patients with esld has been postulated to some factors that include decreased arterial vascular resistance and impaired typical response of the coronary arteries to vasodilator agents. other noninvasive cardiac imaging techniques such as dobutamine stress echocardiography dse may be more sensitive but less specific for screening cad in this population. it has been shown that the sensitivity and specificity of dse in esld is 75% and 57%, respectively, although only 18 patients were studied. some authors have suggested that the true prevalence of the occurrence, nature, and clinical implication of cad in patients with esld can only be studied using a very large and randomly selected groups of patients with different etiologies of liver disease and cirrhosis, who undergo a detailed cardiovascular assessment including mps, rest and stress echocardiography, and ca. this evaluation must include the presence or absence of cad risk factors and other possible factors that are common with this population such as anemia, pulmonary condition and nutritional and metabolic derangements. our data show that the prevalence of abnormal systolic dysfunction in this population is 7.5% (12 out of 160 patients) having a strong correlation with abnormal stress mps. this finding suggests that the etiology of cardiomypathy in esld is most likely related to cad. it has been thought that the prevalence of cardiomyopathy is greater in patients with esld than in the general population. patients with esld have multiple problems that place them at a risk of heart failure. patients with liver disease have defects in both systolic and diastolic function which only become obvious with physiologic stress such as liver transplantation. in addition to cad, there are some factors that may contribute to cardiomyopathy in esld. cirrhotic cardiomyopathy and occur to some degree in all patients with liver disease. although the clinical presentation of the cirrhotic cardiomyopathy can be variable, all patients have four common features. these are : (1) baseline increased cardiac output ; (2) attenuated systolic contraction and diastolic relaxation ; (3) electrophysiological abnormalities including repolarization change ; and (4) a reduced response of the heart to direct beta stimulation (-incompetence).these changes occur in the absence of overt congestive failure. in our population, dm (p=0.046) and male gender (p=0.26) were the most predictive risk factors for the spect result, but there was no association between mps result and htn, hypercholesterolemia, etiology of esl, or age. our results are very similar to those of cary. who showed that diabetes was the most predictive risk factor, and those without risk factors do not require extensive preoperative cardiac evaluation. moderate or severe insulin resistance was found in one study to be 77.2% in patients with esld, presumably a reflection of esld. insulin resistance is important in the pathogenesis of the metabolic syndrome, and a correlation between components of the metabolic syndrome and the coronary artery calcification, which is a surrogate for coronary artery atherosclerosis, was found. there was no correlation with ca which is currently the gold standard for assessment of cad ; subsequently, this prevalence was based on mps result only. in addition, perioperative complications such as myocardial ischemia, myocardial infarction, or heart failure and postoperative follow - up are not available. the exact prevalence of cad in patients with esld is extremely variable based on current literature. unfortunately, the prevalence of abnormal spect in our general population is unknown for comparison. however, our data are concordant with those of the previous studies of zoghbi. and kryzhanovski. demonstrated that the mps studies were normal in 91% of patients despite the high - risk profile of these patients compared with those with no mps studies, and most importantly, they found that patients with normal perfusion and left ventricular function had a low cardiac event rate during the 2-year post - transplant period. only 1.5% had high - risk scan, and 7.9% and 3% had low- and intermediate - risk scan, respectively. unfortunately, the sensitivity and specificity of mps in patients with esld have been reported to be very low in previous studies. davidson. found the sensitivity and specificity of mps in patients with esld and compared the mps with ca and found that the sensitivity and specificity are 37% and 63%, respectively. this is very low compared to the sensitivity and specificity of stress mps in the general population, which have been reported to be 8390% and 8292%, respectively. the poor sensitivity of stress mps in patients with esld has been postulated to some factors that include decreased arterial vascular resistance and impaired typical response of the coronary arteries to vasodilator agents. other noninvasive cardiac imaging techniques such as dobutamine stress echocardiography dse may be more sensitive but less specific for screening cad in this population. it has been shown that the sensitivity and specificity of dse in esld is 75% and 57%, respectively, although only 18 patients were studied. some authors have suggested that the true prevalence of the occurrence, nature, and clinical implication of cad in patients with esld can only be studied using a very large and randomly selected groups of patients with different etiologies of liver disease and cirrhosis, who undergo a detailed cardiovascular assessment including mps, rest and stress echocardiography, and ca. this evaluation must include the presence or absence of cad risk factors and other possible factors that are common with this population such as anemia, pulmonary condition and nutritional and metabolic derangements. our data show that the prevalence of abnormal systolic dysfunction in this population is 7.5% (12 out of 160 patients) having a strong correlation with abnormal stress mps. this finding suggests that the etiology of cardiomypathy in esld is most likely related to cad. it has been thought that the prevalence of cardiomyopathy is greater in patients with esld than in the general population. patients with esld have multiple problems that place them at a risk of heart failure. patients with liver disease have defects in both systolic and diastolic function which only become obvious with physiologic stress such as liver transplantation. in addition to cad, there are some factors that may contribute to cardiomyopathy in esld. cirrhotic cardiomyopathy and occur to some degree in all patients with liver disease. although the clinical presentation of the cirrhotic cardiomyopathy can be variable, all patients have four common features. these are : (1) baseline increased cardiac output ; (2) attenuated systolic contraction and diastolic relaxation ; (3) electrophysiological abnormalities including repolarization change ; and (4) a reduced response of the heart to direct beta stimulation (-incompetence).these changes occur in the absence of overt congestive failure. in our population, dm (p=0.046) and male gender (p=0.26) were the most predictive risk factors for the spect result, but there was no association between mps result and htn, hypercholesterolemia, etiology of esl, or age. our results are very similar to those of cary. who showed that diabetes was the most predictive risk factor, and those without risk factors do not require extensive preoperative cardiac evaluation. moderate or severe insulin resistance was found in one study to be 77.2% in patients with esld, presumably a reflection of esld. insulin resistance is important in the pathogenesis of the metabolic syndrome, and a correlation between components of the metabolic syndrome and the coronary artery calcification, which is a surrogate for coronary artery atherosclerosis, was found. there was no correlation with ca which is currently the gold standard for assessment of cad ; subsequently, this prevalence was based on mps result only. in addition, perioperative complications such as myocardial ischemia, myocardial infarction, or heart failure and postoperative follow - up are not available. based on our data, the estimated prevalence of abnormal mps and lvef in patients with esld is found to be approximately 8%. the most independent risk factors for cad in these patients are dm and male gender. there is no association between mps and cad risk factors such as htn, hypercholesterolemia, or smoking history. currently, there are still limited data regarding the prevalence of cad in esld and usefulness of mps in these patients. a large, randomized, prospective study is highly recommended to assess the true prevalence of cad and usefulness of mps in patients with esld. | background : the prevalence of coronary artery disease (cad) in end - stage liver disease (esld) being evaluated for orthotopic liver transplantation (olt) is unclear based on variable definition used for cad.objective:the aim of this study to investigate the prevalence of abnormal stress myocardial perfusion single - photon emission computed tomography (mps) imaging, as a marker for cad, among patients with esld who were referred for stress mps imaging as a routine work up before olt.materials and methods : this was a single - center, retrospective study. we reviewed data on 167 patients who were referred for mps as a routine work up before olt over the last 2 years. all patients underwent evaluation for cad risk factors [age, hypercholesterolemia, diabetes mellitus (dm), hypertension (htn), and smoking ], and stress mps as per standard protocol.results:the total number of patients referred for stress mps was 167. seven patients (4% of total study population) were excluded from the study due to poor and/or nondiagnostic studies. 147 patients (92%) had normal, but only 13 patients (8%) had abnormal mps scans. dm and male gender were the most independent risk factors for abnormal mps with p value of 0.046, and 0.26, respectively. there was no significant association between the abnormal mps result and htn, hypercholesterolemia, smoking, age or etiology of the liver disease.conclusion:based on our data, the prevalence of abnormal mps and left ventricular ejection fraction in patients with esld was found to be 8%. dm and male gender were the most independent predictor factors for abnormal mps. true prevalence of cad and usefulness of mps in patients with esld can only be studied using a very large and randomized prospective study. |
motoneuron loss is the common feature of several neurodegenerative diseases, as well as mechanical injuries affecting the spinal cord (sc). among neurodegenerative diseases, amyotrophic lateral sclerosis (als) and spinal muscular atrophy (sma) represent the most common diseases affecting spinal and brainstem motoneurons. this disease affects mainly the lower motoneurons within the sc and brainstem, but the pyramidal neurons located in the motor cortex are also frequently damaged. this results in progressive muscle atrophy and spasticity, which ultimately cause death due to respiratory dysfunction [1, 4 ]. als is a heterogeneous disease complex that could be subdivided into two main groups : familial als (fals), which accounts for only 10% of patients, and the more frequent form with no family history, affecting the remaining 90% of als patients, namely, the sporadic als (sals) [1, 4 ]. the molecular mechanisms of als pathogenesis remain far to be fully understood and appear extremely heterogeneous. however, a number of gene mutations have been found in fals patients, including a missense mutation in the sod1 gene, encoding for superoxide dismutase 1 protein, which is the most frequent gene mutation found in fals. more recently, aberrant accumulation of either mutant or wild type tar dna - binding protein of 43 kda (tdp-43) has been found in both fals and sals, thus accounting for a common mechanism involving aberrant rna processing and glutamate excitotoxicity [1, 410 ]. sma is the most common inherited motoneuron disease and the main genetic cause of newborn mortality. like als in contrast to the multifactorial origin of als, this disease is unambiguously caused by the recessive mutations or deletion of the survival motor neuron-1 gene (smn1) [1113 ]. a number of animal models have been developed attempting to recapitulate at least some of the genetic, anatomical, and functional defects observed in the human als and sma [10, 1417 ]. these models have also been used for testing the efficacy of different repairing strategies such as rehabilitation, pharmacological, genetic, or cell - based approaches [10, 1626 ]. sc injury (sci) or nerve damage could also result in severe loss of grey matter neurons, including motoneurons [27, 28 ]. the mechanism of cell loss after contusion injury is complex : the mechanical damage of sc tissue (primary injury) destroys many local neurons, but it is followed by a secondary injury that kills a larger neuronal and glial population because of several pathological phenomena, including inflammation or vascular damage. although the described neurodegenerative or traumatic sc diseases are different in their etiology and pathogenesis, they share a common outcome characterized by the death of lower motoneurons. regardless of the pathological reason for motoneuron loss, several studies have investigated the possibility of repairing the motoneuron - depleted sc by using different repairing strategies. these studies have used several animal models of selective motoneuron depletion [30, 31 ]. in the present paper, we performed a comprehensive review of the literature about the use of rodent models of neurotoxic spinal motoneuron degeneration, with a focus on two models obtained by intramuscular injection of volkensin or cholera toxin - b saporin (ctb - sap). in particular, the experimental applications of these models to mimic neurodegenerative diseases, to dissect the molecular mechanisms of neuroplastic changes underlying the functional recovery after motoneuron loss, and to evaluate the effectiveness of several strategies of neural repair are extensively discussed in comparison to the other available preclinical models of disease. the first evidences about the effects of neurotoxins on motoneurons were provided as early as fifty years ago, with some studies showing the effects of tetanus and botulinum toxins on spinal motoneurons [3234 ]. afterwards, functional neuroanatomy studies have relied on the effects of lesions to investigate the function of neural systems, and a large variety of neurotoxins has been used to destroy specific cell populations. for instance, excitotoxins such as kainic acids [35, 36 ] or monoamine toxins including 6-hydroxydopamine have been used to produce selective lesions based on the neurotransmitter specificity, but these compounds have shown incomplete anatomical and cell - type specificity. a substantial improvement of these methods of molecular neurosurgery has been provided by the development of axonally transported toxins such as lectins [3841 ], immunotoxins [4245 ], tracer - toxins, and neuropeptide - conjugated toxins. when injected into the target region, these toxins are captured by axon terminals and retrogradely transported towards the cell body, thus causing cell death by ribosome inactivation and apoptosis. plant derived lectins are anatomically but not cell - type selective, being able to kill any neuron projecting to the injection site, by suicide retrograde transport [3941, 46, 47 ]. this term refers to the uptake and axonal transport of toxins by neurons projecting to the injection site, thus causing a selective lesion based on the specific neural connection rather than cell phenotype [31, 42, 47, 48 ]. conversely, immunotoxins as well as tracer- or neuropeptide - conjugated toxins are both anatomically and cell - type selective, since they are internalized by cells after specific chemical binding [30, 42, 49 ]. a large number of plant derived neurotoxic proteins have been isolated and characterized, thus showing their ability to damage eukaryotic cells by acting on ribosome and catalytically disrupting the elongation step of protein synthesis [51, 52 ]. these ribosome - inactivating proteins (rips) include ricin (from ricinus communis), abrin (from abrus precatorius), modeccin (from adenia digitata), and volkensin (from adenia volkensii) [38, 39, 50, 52 ]. all these rips are axonally transported by peripheral nerves but, among these, modeccin and volkensin are more efficient to kill neurons of the central nervous system (cns) by suicide transport [4042, 46, 53 ]. among the above described rips, volkensin appeared to be the most toxic on cns neurons and it has been the most frequently used to create animal models of spinal motoneuron degeneration. as early as in 1992, ngrdi and vrbov used volkensin with the aim of creating a reliable model of motoneuron degeneration. similar long - term effects of volkensin on the sc results were shown by leanza and stanzani (1998) after intramuscular injection of 2.0 ng of this rip in newborn rats. these authors have reported an extensive and long - lasting depletion of spinal motoneurons (about 90%) as measured at either two or eight months after the lesion. afterwards, this rodent model was used, also by our research group, either as recipients in experimental approaches of transplant - induced regeneration (see section 4) [5557 ] or as models for testing the intrinsic potential for spontaneous regeneration (see section 3). a substantial improvement of neurotoxic lesion protocols came from the development of targeted rips by conjugation with a specific carrier, such as an antibody, a neuropeptide, or a retrograde tracer [30, 42, 44, 45, 49, 50, 59 ]. saporin, an rip from saponaria officinalis, is the most used toxin to prepare targeted neurotoxins. the latter is responsible for the specific binding to the gm1 membrane receptor, internalization, and retrograde transport [60, 61 ]. given these properties, cholera toxin - b subunit could be used either as a retrograde tracer [30, 62 ] or as a targeted neurotoxin after conjugation with saporin. a number of in vivo experiments have used cholera toxin - b saporin (ctb - sap) and demonstrated its effectiveness in removing any neuron expressing gm1 ganglioside [30, 49, 6365 ]. recently, our group has developed a mouse model of lumbar sc motoneuron degeneration by injection of ctb - sap into the gastrocnemius muscle. the toxin has been injected into the medial and lateral gastrocnemius muscles at a dose of 3.0 g / muscle and caused a partial depletion of lumbar motoneuron (2530%), accompanied by an evident impairment of the hindlimb motor function. given the moderate severity of the lesion, this model is suitable for evaluating the spontaneous recovery of locomotion and the underlying sc plastic changes, such as neurogenesis or synaptic plasticity (see section 3) [6669 ]. several evidences have demonstrated that adult mammals could achieve a significant range of spontaneous sensory - motor recovery after injury or disease, by means of various forms of neuroplasticity. this plasticity includes the recruitment of neural precursor cells (npcs) and the formation of new pathways as well as synaptic plasticity, within the affected tissue and/or in sensory and supraspinal pathways [7073 ]. however, this spontaneous plastic potential is inadequate for allowing complete regeneration and recovery of function, but some therapeutic interventions are able to recruit and potentiate this intrinsic capacity, thus producing a better outcome. since it has been found that sc plasticity is activity - dependent, a number of studies have demonstrated the effectiveness of exercise training and other methods of spinal learning in both animal models and human sci patients [70, 7577 ]. some information is also available about plastic changes occurring in neurodegenerative diseases and, in particular, in motoneuron disease. it is known, for instance, that plastic changes could occur in parkinson 's disease as well as in the respiratory system and brain of als patients [7981 ], but the beneficial effect of exercise training is still controversial [82, 83 ]. given the progressive nature of these diseases, it is obvious that any compensatory change will ultimately be ineffective. despite these limitations, a better understanding of the plastic phenomena occurring in animal models of motoneuron disease would help in elucidating the molecular mechanisms of diseases and finding new putative targets for therapy. anatomical rearrangement and functional compensatory changes in spinal and supraspinal circuitry have been reported in rodent models of neuronal degeneration induced by nerve crushing [84, 85 ]. the previously described murine model of selective ctb - sap induced motoneuron depletion developed in our laboratory has been deeply characterized to evaluate its capacity for spontaneous sensory - motor recovery. noteworthy, a relevant increase of motor performance measured at the grid walk or rotarod test has been observed as early as one month after toxin injection, despite a permanent though moderate motoneuron removal [66, 68, 69 ]. the cellular and molecular mechanisms underlying this remarkable functional recovery have been studied, including the activation of endogenous npcs, the spontaneous events of synaptic plasticity [6669 ], and the expression and functional roles of neurotrophic factors and/or other molecular factors including cell fate determinants [6668 ] and tdp-43. npcs proliferation and differentiation take place spontaneously in the adult mammals only in the subventricular zone and hippocampus [86, 87 ]. however, multipotent npcs could be isolated from the entire adult cns, including the sc [8890 ]. several experiments have demonstrated that these cells could be mobilized after sci but, unfortunately, they only generate migratory cells that differentiate to astrocytes and participate in scar formation [89, 91, 92 ]. notably, astrocyte activation could also be caused by a selective neurotoxic neuron removal by volkensin suicide transport in either brain or sc [31, 93 ]. moreover, a significant amount of cell proliferation and increase of gfap - positive astrocytes have been found in the sc ventral horn, after selective motoneuron removal by intramuscular injection of ctb - sap. glial reaction is a classical response to cns tissue damage, which generally also involves glial cells themselves and induces a series of events that amplifies and maintains glial activation [94, 95 ]. therefore, the glial reaction observed after selective neuronal loss, with the absence of severe tissue damage and inflammation, could have different origin as well as different consequences on regenerative processes. intrinsic and extrinsic molecular factors regulating adult neurogenesis have been widely explored [86, 97 ]. sonic hedgehog (shh) is a secreted glycoprotein promoting npcs proliferation and differentiation to neurons and oligodendrocytes, during both development and adulthood [98, 99 ]. the notch-1 pathway and its inhibitor numb are also involved in the regulation of npcs proliferation, cell fate determination, dendritic morphology, and axon guidance in embryonic and adult cns [100103 ], including sc [104, 105 ]. noggin is a secreted glycoprotein responsible for neural induction during development, by acting as an inhibitor of bone morphogenetic proteins. as shown by chen and colleagues (2005), shh, notch-1, and numb expression are increased in the sc after compression injury. however, unlike their embryonic counterparts, npcs are unable to generate neurons in the adult sc. recently, some experiments have been performed to investigate the expression and the functional role of shh, notch-1, numb, and noggin on the murine model of ctb - sap induced motoneuron depletion [66, 68 ]. in contrast to those observed in sci models, shh and numb expressions appear transiently decreased after motoneuron removal and then recovered in association with the spontaneous functional recovery, whereas noggin expression progressively increases [66, 68 ]. the reasons for the discrepancy between mechanical and neurotoxic lesion models are elusive but some explanations could be proposed. for instance, mechanical damage affects several neuronal and glial populations, whereas the described neurotoxic lesion selectively kills motoneurons in spatially restricted regions. moreover, ependymal cells undergo a robust proliferation immediately after a mechanical injury [89, 108 ], whereas they seem unresponsive in the ctb - sap model (see figure 1). interestingly, a pattern of npcs proliferation and reactive gliosis closely resembling that found in ctb - sap models, with no evidence of neurogenesis, was found in transgenic mouse models of als expressing the mutated human sod1 gene [109, 110 ]. unfortunately, further information concerning these endogenous repairing potentials of als affected sc is still lacking, and the results provided by neurotoxic models are therefore of great importance. however, these processes need to be further clarified because they denote the importance of the role of environmental cues on the behavior of spinal npcs. it is also likely that an experimental approach aimed at artificially modifying shh, numb, and noggin signaling into the sc could stimulate npcs proliferation, reduce glial reaction, and probably drive cell differentiation towards neuronal phenotype. another process promoting the functional restoration consists of the reorganization of spinal, supraspinal, and sensory pathways by mechanisms involving activity - dependent synaptic plasticity [71, 74, 111 ]. as previously described, a significant amount of spontaneous locomotor recovery is possible in rodent models of both sci and motoneuron disease and could be driven, at least partially, by mechanisms of synaptic plasticity [6669, 112, 113 ]. the molecular feature of synaptic plasticity has been extensively studied in the hippocampus, as it represents the principal mechanism underlying learning and memory. in fact, it is known that long - term modifications of synaptic efficacy are regulated presynaptically by the expression and phosphorylation of various synaptic vesicle proteins including synapsin - i [114116 ] and postsynaptically by changes in the expression and trafficking of glutamate receptors. in particular, alpha - amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa) ionotropic glutamate receptors are fundamental for cortical and hippocampal synaptic plasticity [117120 ]. the emerging role of astrocytes and their expression of connexins in the modulation of synaptic strength are also noteworthy [121, 122 ]. a fundamental role in modulating both pre- and postsynaptic changes is exerted by brain - derived neurotrophic factor (bdnf) [123125 ]. in fact, synapsin - i is considered as a downstream effector of bdnf [123, 125 ]. moreover, it seems clear that the activity - dependent release of bdnf could regulate the synthesis and synaptic delivery of ampa receptors in different brain areas [126, 127 ] and, conversely, the glutamate receptor activity could modulate bdnf release [128, 129 ]. interestingly, several authors have shown that such mechanisms could take place also in the intact and lesioned sc [112, 113, 130 ], as well as in the mouse model of ctb - sap induced motoneuron loss developed in our laboratory. in particular, we have found that the spontaneous recovery of locomotion observed in the motoneuron - depleted mice is linked to the expression levels of both synapsin - i and ampa receptors [6668 ]. moreover, this model has confirmed the described role of bdnf and has also provided evidence about novel functional roles of shh, numb, and noggin that, in addition to the traditional role as cell fate determinants, could also participate in modulating synaptic plasticity and functional recovery [6669 ] (see figure 1). information about the occurrence of synaptic plasticity in patients or animal models of als is poor. however, it is noteworthy that the expression of synaptic vesicle proteins is significantly decreased in the sc ventral horn of als patients, thus again confirming that ctb - sap models could be interesting research tools for research in motoneuron disease. tdp-43 is a nuclear dna / rna - binding protein encoded by a highly conserved gene and involved in mrna processing [132, 133 ]. recently, tdp-43 was found in the cytoplasmic protein aggregates observed in some neurons of patients affected by als [6, 133 ]. therefore, increasing attention has been devoted to the toxic effects of mutant tdp-43 on motoneurons but, more recently, it is becoming likely that some of these effects could depend on the loss of function of the normal tdp-43 [5, 7, 133, 134 ]. in addition to the described classical role, tdp-43 could be involved in apoptosis, microrna biogenesis, and cell proliferation. notably, tdp-43 has been found in the dendrites, where it could affect local rna translation in an activity - dependent manner [135, 136 ]. moreover, tdp-43 is crucial for synaptic formation and plasticity, as well as for locomotion in drosophila [134, 137, 138 ]. it has been recently shown in our model of motoneuron loss that synapsin - i expression is linked to that of tdp-43 and that the latter correlates with the expression of ampa receptor subunits glur1, glur2, and glur4. as mentioned above, synaptic plasticity is modulated by ampa receptor trafficking and in particular by the regulation of ca - permeable ampa receptors [117119 ]. the ion permeation is linked to the amount of q / r - unedited glur2 subunits included into the ampa channels. therefore, given that tdp-43 is likely involved in the q / r - editing of glur2 subunits, one of the proposed mechanisms of motoneuron death in als is the glutamate toxicity caused by the aberrant increase of unedited glur2 subunits [5, 8 ]. similar processes could take place in the ctb - sap sc lesion model and, interestingly, the same events could affect synaptic plasticity in this model. unlike the functional linkage between ampa receptors and tdp-43, the association between synapsin - i and tdp-43 is absolutely novel and suggests a model where tdp-43 could affect synaptic strength by modulating the expression of both synapsin - i and ampa receptors (see figure 1). this hypothesis is supported by other evidences that tdp-43 is present at synapses and controls the local synthesis of synaptic proteins [135, 139 ]. other recent findings have shown that the lack of tdp-43 could affect synapses and cause locomotor deficits in drosophila [134, 137 ]. given the increasing interest in mouse models of tdp-43 gain or loss of function as models of neurodegenerative diseases, including als [10, 16, 140 ], is likely that the elucidation of the physiological role of tdp-43 in the sc would provide an important contribution. to date, neurodegenerative disorders such as als and sma do not benefit from any effective therapy. riluzole represents the only approved therapy for als, but its effects consist in prolonging survival and delaying the use of supportive care by a few months. as previously discussed, the adult sc is capable of a significant amount of spontaneous functional restoration, and this is particularly evident in rodent models of sc injury or disease [66, 68, 71, 74, 111 ]. although this capacity is not enough to allow full recovery, it is anyway encouraging because the elucidation of the underlying cellular and molecular mechanisms would provide novel therapeutic tools and targets, thus improving the expected clinical outcomes. as the spontaneous functional recovery could be driven by the recruitment of npcs, regeneration of damaged neurons, and events of synaptic plasticity occurring within the spared circuitries. however, further studies employing representative preclinical models, as well as the design of clinical trials, are mandatory to make this increasing knowledge available for translational applications. the activity - dependent nature of plastic changes within the sc [71, 74 ] has suggested the possibility that the damaged sc could be retrained in an attempt to modify the activity of the spared circuitries and compensate for the partial loss of neurons and connections. locomotor training has proven to be beneficial in spinalized animals [76, 112, 113 ], by mechanisms of activity - dependent bdnf - induced synaptic plasticity [112, 113, 130, 143 ]. significant clinical improvement could also be achieved by human sci patients as a result of locomotor training [70, 75 ]. the importance of plastic changes in motoneuron diseases needs further investigations and the data provided by neurotoxic models would also be helpful as previously discussed. few studies have investigated the therapeutic value of exercise training in either human patients or animal models of motoneuron disease and produced controversial findings. a couple of studies involving sod1 mouse models demonstrated that a moderate exercise could produce neuroprotective effects on motoneurons, although the impact on the life span is controversial [144146 ]. moreover, the beneficial effects seem to be dependent on the type of physical exercise. similar results have been provided by a small number of studies involving human patients [82, 83 ], thus indicating that further studies are needed to clarify the relationships among neuronal activity, motoneuron vulnerability, and neuroprotection. in this respect, important insights have been provided by the previously described ctb - sap sc lesion model (see section 3) [6669 ], but some of them require further investigation and clinical trials. in particular, the role of neurotrophins and other growth factors has been confirmed in different animal models including the ctb - sap lesioned and the other established animal models of disease [17, 147 ]. however, human trials showed inconsistent or negative effects of growth factors due to different reasons such as bioavailability, poor penetration through the blood - brain barrier, and inadequate or excessive dosing. other studies for effective treatments have focused on the neuromuscular junction and the role of the skeletal muscle as source of chemical and cellular cues sustaining neuronal survival, axonal growth, and synaptic connections, such as trophic support or the role on nogo - a. the ctb - sap model could help in investigating this aspect without unwanted environmental cues, which are normally present in the genetic models of als or sma. cell transplantation was one of the first repairing approaches used in models of sc injury and disease. transplantation of fetal motoneurons was successfully used in models of motoneuron loss induced by nerve crushing, kainic acid, or volkensin [5557, 150 ] and demonstrated that the grafts were able to survive and develop as functionally active mature motoneurons [5557, 150 ], although their capacity of muscle reinnervation was limited. more recently, cell - based strategies have relied on the potential beneficial effects of stem cells such as embryonic, neural, mesenchymal, and induced pluripotent stem cells [1926, 151153 ]. a number of preclinical studies have proven that stem cell therapy is able to delay the disease progression, rescue motoneuron function, and extend survival in animal models of als or sma. it is obvious, for instance, that replacement of lost motoneurons is an important goal in repairing strategies, but some limitations still occur as previously described, including integration into the host tissue and reinnervation. moreover, resident as well as grafted neurons could be susceptible to degeneration if exposed to a toxic microenvironment like that present within the diseased neural tissue. transplantation of cells including different stem cell types could provide trophic support, remove toxic cues, and exert immunomodulatory effects, which ultimately could result in neuroprotection for motoneurons [1926, 151153 ]. the use of a neurotoxic model, where motoneuron depletion is not accompanied by a chronic disease state or toxic environment, could offer a different point of view for elucidating the beneficial effects of cell - based therapies. a number of stem cell clinical trials [19, 154 ] have shown that some cell - based protocols could be safe and produce promising though modest effects. regarding the cell source, mesenchymal stem cells could be easily obtained from patients and are considered suitable for autologous transplantation. they can be obtained by reprogramming somatic cells without viral methods and differentiated towards multiple phenotypes [1926, 151154 ]. however, to achieve effective cell - based therapies suitable for clinical application, several issues should be addressed, including the optimization of delivery protocols (route of administration, dose) and the better elucidation of the graft - host interaction. the ideal route of administration should produce the best therapeutic effects with the minimal invasiveness. intrathecal or intravenous administration could represent effective approaches, because they ensure the widespread distribution of cells, which is ideal when degeneration is not limited to a small area. however, cells must be able to penetrate the blood - brain barrier and migrate correctly towards the affected areas. again, several preclinical studies are needed, by using different animal models, to address these important goals. as previously discussed, npcs proliferation occurs in different animal models of motoneuron loss, including neurotoxic and als models, but external interventions are needed to potentiate this capacity and drive npcs differentiation towards the neuronal phenotype [66, 109, 110 ]. bambakidis and colleagues (2003) have treated sc lesioned rats with shh and provided evidence of increased npcs proliferation and their differentiation as oligodendrocytes and neurons [73, 155 ]. in addition, shh promotes survival and exerts neuroprotective effects on cns neurons including motoneurons [156, 157 ]. a recent study showed that g93a mouse model of als produced spontaneous npcs proliferation within sc lamina x, which was increased by lithium administration. moreover, lithium - treated animals showed increased neuronal differentiation and attenuation of disease progression. another growth factor not only stimulating neurogenesis but also promoting neuronal survival, migration, and axon guidance in als models as well as protection of motoneurons against excitotoxicity is vascular endothelial growth factor (vegf) [158, 159 ]. beneficial effects of many other growth factors and morphogens, as well as hormones, on sc repair have been published by several authors. axonal growth and other plastic changes could be promoted, for instance, by noggin and bdnf [113, 160162 ], whereas testosterone treatment has proven to exert neuroprotective effects on motoneurons in ctb - sap lesion models, by preventing dendritic atrophy after removal of surrounding motoneuron [63, 65 ]. further studies are needed to better understand the mechanism of neurodegeneration as well as develop effective methods of therapy and rehabilitation. in this respect, although a large number of studies will be obviously conducted on mouse models of als and sma, the above - described neurotoxic models of motoneuron degeneration will certainly be useful as well. moreover, motoneuron - depleted sc is a simple and powerful tool for cell transplantation and for testing plastic changes and the consequent functional outcome. despite the difference between neurotoxic and genetic rodent models, the described similar effects on neurogenesis and the involvement of tdp-43 and the multiple roles of neurotrophins and morphogens would open a number of novel research pathways aimed at the dissection of pathogenesis and selection of new therapeutic targets and tools for the treatment of motoneuron diseases. | retrogradely transported toxins are widely used to set up protocols for selective lesioning of the nervous system. these methods could be collectively named molecular neurosurgery because they are able to destroy specific types of neurons by using targeted neurotoxins. lectins such as ricin, volkensin, or modeccin and neuropeptide- or antibody - conjugated saporin represent the most effective toxins used for neuronal lesioning. some of these specific neurotoxins could be used to induce selective depletion of spinal motoneurons. in this review, we extensively describe two rodent models of motoneuron degeneration induced by volkensin or cholera toxin - b saporin. in particular, we focus on the possible experimental use of these models to mimic neurodegenerative diseases, to dissect the molecular mechanisms of neuroplastic changes underlying the spontaneous functional recovery after motoneuron death, and finally to test different strategies of neural repair. the potential clinical applications of these approaches are also discussed. |
recently, in addition to the high prevalence of infectious diseases, the incidence of noncommunicable disease is alarmingly increasing in the developing countries. although there are some more recent studies indicating the decline of cvd in africa, ncds are generally showing rapid rise in these countries. one of the explanations for the increase is the economic and social transformation taking place in these countries, and the lifestyle changes resulted from such transformation. hypertension is one of the noncommunicable diseases that is advancing at fast pace in african countries. the trend is unexpected given the socioeconomic status of people in these countries, as the disease is believed to be disease of the rich and developed nations. besides being a major cause of death, hypertension is a major risk factor for many chronic diseases like coronary heart disease, stroke, heart failure, kidney disease, and others. it is responsible for about 6% (9 million) of deaths worldwide and affects about one billion people globally. its global prevalence among older adults aged 25 and over is around 40% in 2008. the highest of this effect falls on the people in middle and low income countries. low income countries like sub - saharan africa are experiencing unexpected rise in the incidence of hypertension. the few studies conducted in ethiopia are also showing high prevalence of the disease in the country. according to one study another more recent study conducted in the capital shows that approximately 30% of adults in addis ababa have hypertension. added to the silent nature of the disease and the poor health seeking behavior of the people, as the country is going through a rapid economic development, and social and behavioral change, the figure is estimated to be higher. income, education, and occupation are the most commonly used indicators or measures of the socioeconomic status of an individual. although its measurement is difficult in the developing countries, household income has shown consistent association to the general measures of health. educational status is also widely used as a measure of socioeconomic status and is related to many health outcomes. educational attainment reflects a household 's ability to avoid risky behaviors and practice good health. it reflects health risks and protection factors related to the occupation and provision of source of income to practice good health behavior. there are significant evidences indicating an inverse association between socioeconomic status and hypertension in the developed countries [1214 ]. this is because in the developed countries individuals with high socioeconomic status may be the early adopters of healthy lifestyles that help to lower the risk of hypertension. but, in the developing countries, these groups are early adopters of harmful lifestyles characterized by smoking, diets with high energy and fats, and sedentary lifestyles. the inverse association of socioeconomic status with hypertension is not evident in the developing countries. the results from the few studies conducted in the developing countries have shown inconsistent results. for instance a study from nigeria among adults aged 3060 years found an inverse association between socioeconomic status and hypertension. in contrary to this finding, a study on civil servants in the same nation found that those at higher occupational levels had higher hypertension when compared with those at lower occupational levels. another cross sectional home to home study conducted in urban population in dar es salaam, tanzania, aged 25 to 64 came up with a result similar to that of the developed countries. however, the use of different measurement of socioeconomic status and the stages of their economic development in these countries have made comparisons across other literatures difficult. the results from many middle income countries are also showing positive association between socioeconomic status and hypertension. a study in rural indian adults shows the highest socioeconomic group had almost double the prevalence of hypertension as those from the lowest socioeconomic group. another study within the same country has also showed a significantly positive relationship between socioeconomic status and hypertension. in study undertaken among jamaican women, there are significant study results indicating the high prevalence of hypertension among the bank workers [19, 20 ]. in contrast some studies undertaken in africa are showing the prevalence of hypertension being higher among teachers compared to the bankers. in ethiopia little therefore the current study aims to examine the association between socioeconomic status and hypertension among the bankers and teachers in the capital, addis ababa. this study is based on a cross sectional study conducted for the purpose of assessing the prevalence of noncommunicable diseases among working adults in addis ababa, ethiopia. the study was conducted by addis continental institute of public health in collaboration with university of washington multidisciplinary international research training program. study populations are permanent employees of the commercial bank of ethiopia and teachers in government schools in addis ababa. first two study sites, the commercial bank of ethiopia and public schools, were purposefully selected based on their work force stability. then probability proportional to size sampling procedures was used to select both commercial bank of ethiopia branch offices and government schools. from each of the selected locations, all employees were invited to participate. more details of the methodology are described elsewhere [21, 22 ]. the study was conducted in accordance with the who 's step wise approach for noncommunicable disease surveillance in the developing countries [21, 23 ]. it is often measured as a combination of education, income, and occupation [10, 12 ]. the responses were grouped into two wider categories : diploma and below and degree and above. three income categories are identified based on the 50% median income classification and used for analysis [24, 25 ] it was measured using a digital measuring device (microlife bp a50, microlife ag, switzerland) with the participant sitting after resting for at least 5 minutes. blood pressure was measured 3 times, with at least 3 minutes between consecutive measurements. in accordance with the who recommendation the mean systolic and diastolic blood pressure from the second and third measurements were considered for analysis. for the purpose of this study people with systolic blood pressure greater than or equal to 140 mmhg, or diastolic pressure greater than or equal to 90 mmhg, or people with normal blood pressure who are taking antihypertensive drug therapy were classified as hypertensive. classification of hypertension was determined according to joint national committee on prevention, detection, evaluation and treatment of high blood pressure (see table 1). weight and height. participants were weighed using a solar - powered scale with an accuracy of 100 grams. their height was measured using an adjustable wooden measuring board, specifically designed to provide accurate measurements [22, 23 ]. body mass index (bmi) was calculated as weight in kilograms divided by the square of height in meters. bmi < 18.5 represents underweight, 18.5 to < 25 stands for normal weight, 25 to < 30 refers to overweight, and obesity is decided when bmi 30. data completeness and consistency were checked by running frequency on each variable. after excluding participants with missing bp measurement data and pregnant women (n = 339) from the original study sample, frequencies and percentages were used for descriptive statistics to see the distribution of the different variables. bivariate and multivariate logistic regressions were conducted to see the association between the measures of socioeconomic status and hypertension. adjusted odds ratios (aor) with 95% confidence interval were reported. as the study has collected data on all the variables related to ncds, for this study participants with no bp measurement data (n = 318) and pregnant women (n = 21) were excluded from the original study sample. accordingly a total of 1866 study subjects (1124 men and 742 women) with complete data on all the variables were included in the study. as table 2 indicates, the majority, 1,124 (60.2%), of the participants were male and 742 (39.8%) were female with the male to female sex ratio of 1.5 : 1. the mean age of the participants was 36.03 with a standard deviation of 11.91 years. majority of the respondents (54.1%) were in the middle income category earning between 15,000 and 48,000 ethiopian birr per year. slightly more than half (51.9%) of the participants had first degree and above and the other half (48.1%) are diploma and below, making educational status normally distributed (table 3). as table 3 indicates, the majority (55.3%) of the participants had a normal bmi, while 26.3% were overweight. 83 (4.4) of the participants are current smokers and 9.1% were previous smokers. the prevalence of hypertension in the study is 21% (95% ci = 19.15, 22.85). 127 (6.8%) of the hypertensive participants are currently receiving bp treatment. only 278 (14.9%) of the participants are aware of their hypertension status before the interview. the results from the bivariate logistic regression indicate that males tend to be more hypertensive than females (or : 1.43, 95% ci : 1.131.81) (figure 1). the odds of hypertension increases with increase in age : 3544 (or : 3.11, 95% ci : 1.944.99), 4455 (or : 7.786, 95% ci : 5.02112.075), and above 50 (or : 14.23, 95% ci : 8.7223.23). a higher prevalence of hypertension was observed among middle income groups (or : 2.26, 95% ci : 1.663.07) ; a statistically significant prevalence is also observed among the higher income groups (or : 1.75, 95% ci : 1.212.52). however, as table 4 shows, there was no statically significant difference in prevalence of hypertension among the educational categories (p value = 0.536) and occupation of the participants (p value = 0.197). this study identified hypertension as a significant health problem among bankers and teachers in addis ababa. these figures are higher compared with the 10.5% prevalence among the general population of ethiopia and lower than the 30% prevalence among adults in addis ababa in previous studies. the prevalence of hypertension in this study is consistent with 19.3% reported in nigeria and 21.8% for uganda. all the significant factors which have proven to be related with the incidence of hypertension were entered into the multivariate regression model. in addition checks were conducted and no multicollinearity was found among the variables used for measuring socioeconomic status. from the socioeconomic status measures used, even after adjustment is made educational status and occupation have shown no significant association with the prevalence of hypertension. the association of income with hypertension in this study is consistent with the findings from many low and middle income countries [1, 12, 31 ]. this finding indicates that in the context of the developing country having a higher income is not necessarily protective of health as it is in the developed world. this is probably due to the lifestyle of this group of people in these countries. these groups may use this income to provide more resources that may be used mostly for purchasing calorie - dense foods and excessive drinking, and in some instances it is a cause of sedentary lifestyles which are the underlying risk factors of hypertension. among this study population no significant association between education and hypertension was found. the absence of the association in this study may be due to the nature of the study population. in this study however, studies done in the developing countries like tanzania, nigeria, and ghana found out that education is inversely associated with the odds of developing hypertension [16, 31 ]. although there is a lack of studies that compared the two population groups, in studies conducted independently, the odds of developing hypertension is higher among the bank workers [19, 20 ]. in those studies it is explained that bankers ' job is more stressful and sedentary (table 5). to the best of our knowledge this is the first study that assessed the association between socioeconomic status and hypertension in ethiopia. even though the study has come up with important findings, there are certain limitations worth mentioning here. first of all, the fact that our study participants are all working professionals who are urban residents and fairly well educated makes the generalizing of the result to the larger population difficult. secondly as the study is based on secondary data the problem of social desirability bias is mentioned in the original study. participants may withhold information regarding their life - style habits that may not be generally acceptable for working adults (smoking, drinking, etc.) which may result in an underestimation of these behaviors. this study highlights the high prevalence of hypertension in the study population. as in many other developing countries hypertension is becoming a serious public health concern among working adults like teachers and bankers in ethiopia. like many developing and middle income countries, in this study better income is positively associated with higher odds of having hypertension. however, no association between hypertension and measures of socioeconomic status like education and occupation was found in this study. as hypertension is becoming a serious public health concern in ethiopia, it has to be given due concern in the health agenda of the country as one of top priority. it rather influences the practice of risky behavioral factors that are responsible for hypertension. therefore promoting healthy lifestyles and interventions in lifestyle modifications related to the behavioral risk factors awareness creation and promotion of healthy behaviors have to be widely conducted, especially in the better income groups so that they will make rational decision in choosing their behaviors. particularly, the long term consequences that arise from these lifestyles have to be stressed to the society in general and these groups in particular. future studies are also highly recommended to confirm these findings in general population with varying measures of socioeconomic status. | background. the social and economic changes taking place in developing countries are influencing the pace at which hypertension and its risk factors are expanding. as opposed to the already established inverse association in developed nations, the association between socioeconomic status and hypertension in developing countries is poor and inconsistent. this study aims to determine the association between socioeconomic status and hypertension among teachers and bankers in addis ababa, ethiopia. methods. this study is based on a cross - sectional study conducted to assess the prevalence of ncds in addis ababa, ethiopia. the study was undertaken among workers of the commercial bank of ethiopia and teachers of public schools in 2010. results. majority of participants were teachers (70.3%). most of the respondents (54.1%) earn an annual income between 15,000 etb and 48,000 etb, and 51.9% of them have educational status of first degree and above. among the socioeconomic factors income was strongly associated with the odds of having hypertension (aor : 2.17 with 95% ci : 1.582.98). conclusions. higher burden of hypertension is observed among teachers and bankers in addis ababa, ethiopia. promotion of healthy behaviors and interventions that target higher income groups needs to be put in place. |
transvaginal ultrasound - guided oocyte pick - up (opu) for assisted reproductive technology (art) treatment was first reported in 1985 (1). since then, this technique has been rapidly widespread throughout the world, as a replacement for laparoscopic oocyte retrieval. currently, the ovarian stimulation protocol for art treatment is changing from hyperstimulation to mild or minimal stimulation protocol by minimizing the dose of parenteral follicle stimulation or shifting to oral medicine (2). as a result, the number of follicles punctured and oocytes retrieved during opu has decreased. in our clinic, the average number of retrieved oocytes among patients aged 3740 years has been reported as 3.7 (3), and no anesthesia (either local or general) is used during opu in more than half of our patients. however, even when only a single follicle is punctured, oocyte retrieval can be painful. therefore a method for reducing pain during oocyte retrieval is needed, particularly for cases where anesthesia is not used. recently, a newly designed needle for opu was launched with the aim of reducing pain during opu (4). the tip of the needle (i.e. the last 50 mm, the part that penetrates into the tissues) is thinner than standard, with the remainder of the needle having a larger diameter. an initial study showed that overall pain experienced during opu with the reduced needle was significantly lower than that with the standard needle (4). however, there were limitations with that study : several follicles were aspirated during each procedure, and local anesthesia was administrated. for studies investigating the effect of a new needle, it is important to ensure that number of aspirated follicles is the same in both study groups and that perceived pain is not masked by analgesic treatment. therefore, in the present study, an attempt was made to evaluate the effect of reduced needle on pain and vaginal bleeding associated with single - follicle opu in patients who did not receive any analgesic treatment. from may through november 2013, 100 patients were screened for the study and 75 were enrolled (figure 1). twenty - five screened patients could not be enrolled in this study because they ovulated before planned oocyte aspiration. therefore, there were no protocol violations and all analyses were performed according to the intention to treat. ovarian follicles were matured by either a natural cycle or a clomiphene citrate cycle. signed informed consent was obtained from all patients, and this study was approved by the institutional board of the sugiyama clinic. flow chart showing patients progression through the study the study was registered with the umin clinical trials registry, study number umin000014 800. patients were randomized on the day of oocyte retrieval into either the reduced needle (rn) group or the standard needle (sn) group, with a 1:1 allocation ratio. the needle used for the procedure was not known to the patient but for practical reasons it was known to the treating physician. all opu procedures were performed trans - vaginally, by a single physician, with ultra - sonography to guide the needle. patients were randomly assigned to one of the two groups on the day of oocyte aspiration. in each case, a single follicle with a mean diameter of > 17 mm was aspirated, using either a reduced needle with a 17 gauge body and a 20 gauge tip (sense, vitrolife, sweden ; rn group) or a standard 19 gauge needle (uniever oocyte aspiration needle, japan ; sn group). all needles were connected to a syringe (via a luer connection) for manual suction, meaning that the aspiration pressure could be controlled as needed. if an oocyte could not be retrieved following puncture, follicle flushing was performed up to 5 times. pain was rated by each patient immediately after the opu by means of a visual analogue scale (vas), comprising a vertical line from 0 cm (no pain) to 10 cm (unbearable pain) (5). all patients were asked by the same medical doctor to mark the vas with their rating of the overall pain for the whole procedure. the pain perceived by patients 30 min after the procedure, captured in the same way as overall pain, was a secondary endpoint. bleeding from the vaginal wall (at the point of needle penetration) was also evaluated after opu. bleeding was defined as continuous signs of bleeding even after the application of direct compression for 30 s, and no bleeding defined as cessation of blood loss after direct compression. the in vitro fertilization (ivf) procedure used in the present study has been described previously (6). the retrieved oocyte was fertilized by conventional insemination or intracytoplasmic sperm injection (icsi) three to five hours after follicle aspiration. the presence of two pronuclei with extrusion of the second polar body was taken as the evidence of successful fertilization. embryos were evaluated microscopically before transfer, and those with more than seven blastomeres and less than 10% fragmentation were classified as morphologically good - quality embryos (mges) (7). embryos were placed transcervically into the uterus using a soft et catheter (kitazato, japan) (8). pregnancy was recognized when the development of a gestational sac was evident from transvaginal ultrasound on the 21st day after embryo transfer. the level of pain associated with the procedures is higher when it is performed without anesthesia, and the average vas score for the primary endpoint overall pain experience was anticipated to be 5.0 cm with the standard needle. the reduced needle was expected to reduce the vas pain score by 1.2 cm (24%), a clinically significant difference. forty - four patients would be needed in each study group to demonstrate this difference with 80% power and a significance level of 0.05 (two - tailed tests). fisher s exact test was used to analyze dichotomous data and student s t - test and wilcoxon test when normality distribution was rejected were used for continuous variables from may through november 2013, 100 patients were screened for the study and 75 were enrolled (figure 1). twenty - five screened patients could not be enrolled in this study because they ovulated before planned oocyte aspiration. therefore, there were no protocol violations and all analyses were performed according to the intention to treat. ovarian follicles were matured by either a natural cycle or a clomiphene citrate cycle. signed informed consent was obtained from all patients, and this study was approved by the institutional board of the sugiyama clinic. flow chart showing patients progression through the study the study was registered with the umin clinical trials registry, study number umin000014 800. patients were randomized on the day of oocyte retrieval into either the reduced needle (rn) group or the standard needle (sn) group, with a 1:1 allocation ratio. the needle used for the procedure was not known to the patient but for practical reasons it was known to the treating physician. all opu procedures were performed trans - vaginally, by a single physician, with ultra - sonography to guide the needle. patients were randomly assigned to one of the two groups on the day of oocyte aspiration. in each case, a single follicle with a mean diameter of > 17 mm was aspirated, using either a reduced needle with a 17 gauge body and a 20 gauge tip (sense, vitrolife, sweden ; rn group) or a standard 19 gauge needle (uniever oocyte aspiration needle, japan ; sn group). all needles were connected to a syringe (via a luer connection) for manual suction, meaning that the aspiration pressure could be controlled as needed. if an oocyte could not be retrieved following puncture, follicle flushing was performed up to 5 times. from may through november 2013, 100 patients were screened for the study and 75 were enrolled (figure 1). twenty - five screened patients could not be enrolled in this study because they ovulated before planned oocyte aspiration. therefore, there were no protocol violations and all analyses were performed according to the intention to treat. ovarian follicles were matured by either a natural cycle or a clomiphene citrate cycle. signed informed consent was obtained from all patients, and this study was approved by the institutional board of the sugiyama clinic. flow chart showing patients progression through the study the study was registered with the umin clinical trials registry, study number umin000014 800. patients were randomized on the day of oocyte retrieval into either the reduced needle (rn) group or the standard needle (sn) group, with a 1:1 allocation ratio. the needle used for the procedure was not known to the patient but for practical reasons it was known to the treating physician. all opu procedures were performed trans - vaginally, by a single physician, with ultra - sonography to guide the needle. patients were randomly assigned to one of the two groups on the day of oocyte aspiration. in each case, a single follicle with a mean diameter of > 17 mm was aspirated, using either a reduced needle with a 17 gauge body and a 20 gauge tip (sense, vitrolife, sweden ; rn group) or a standard 19 gauge needle (uniever oocyte aspiration needle, japan ; sn group). all needles were connected to a syringe (via a luer connection) for manual suction, meaning that the aspiration pressure could be controlled as needed. if an oocyte could not be retrieved following puncture, follicle flushing was performed up to 5 times. pain was rated by each patient immediately after the opu by means of a visual analogue scale (vas), comprising a vertical line from 0 cm (no pain) to 10 cm (unbearable pain) (5). all patients were asked by the same medical doctor to mark the vas with their rating of the overall pain for the whole procedure. the pain perceived by patients 30 min after the procedure, captured in the same way as overall pain, was a secondary endpoint. bleeding from the vaginal wall (at the point of needle penetration) was also evaluated after opu. bleeding was defined as continuous signs of bleeding even after the application of direct compression for 30 s, and no bleeding defined as cessation of blood loss after direct compression. the in vitro fertilization (ivf) procedure used in the present study has been described previously (6). the retrieved oocyte was fertilized by conventional insemination or intracytoplasmic sperm injection (icsi) three to five hours after follicle aspiration. the presence of two pronuclei with extrusion of the second polar body was taken as the evidence of successful fertilization. embryos were evaluated microscopically before transfer, and those with more than seven blastomeres and less than 10% fragmentation were classified as morphologically good - quality embryos (mges) (7). embryos were placed transcervically into the uterus using a soft et catheter (kitazato, japan) (8). pregnancy was recognized when the development of a gestational sac was evident from transvaginal ultrasound on the 21st day after embryo transfer. the level of pain associated with the procedures is higher when it is performed without anesthesia, and the average vas score for the primary endpoint overall pain experience was anticipated to be 5.0 cm with the standard needle. the reduced needle was expected to reduce the vas pain score by 1.2 cm (24%), a clinically significant difference. forty - four patients would be needed in each study group to demonstrate this difference with 80% power and a significance level of 0.05 (two - tailed tests). fisher s exact test was used to analyze dichotomous data and student s t - test and wilcoxon test when normality distribution was rejected were used for continuous variables pain was rated by each patient immediately after the opu by means of a visual analogue scale (vas), comprising a vertical line from 0 cm (no pain) to 10 cm (unbearable pain) (5). all patients were asked by the same medical doctor to mark the vas with their rating of the overall pain for the whole procedure. the pain perceived by patients 30 min after the procedure, captured in the same way as overall pain, was a secondary endpoint. bleeding from the vaginal wall (at the point of needle penetration) was also evaluated after opu. bleeding was defined as continuous signs of bleeding even after the application of direct compression for 30 s, and no bleeding defined as cessation of blood loss after direct compression. the in vitro fertilization (ivf) procedure used in the present study has been described previously (6). the retrieved oocyte was fertilized by conventional insemination or intracytoplasmic sperm injection (icsi) three to five hours after follicle aspiration. the presence of two pronuclei with extrusion of the second polar body was taken as the evidence of successful fertilization. embryos were evaluated microscopically before transfer, and those with more than seven blastomeres and less than 10% fragmentation were classified as morphologically good - quality embryos (mges) (7). embryos were placed transcervically into the uterus using a soft et catheter (kitazato, japan) (8). pregnancy was recognized when the development of a gestational sac was evident from transvaginal ultrasound on the 21st day after embryo transfer. the level of pain associated with the procedures is higher when it is performed without anesthesia, and the average vas score for the primary endpoint overall pain experience was anticipated to be 5.0 cm with the standard needle. the reduced needle was expected to reduce the vas pain score by 1.2 cm (24%), a clinically significant difference. forty - four patients would be needed in each study group to demonstrate this difference with 80% power and a significance level of 0.05 (two - tailed tests). fisher s exact test was used to analyze dichotomous data and student s t - test and wilcoxon test when normality distribution was rejected were used for continuous variables next, they underwent opu with either the rn or the sn (figure 1). the number of patients enrolled was lower than estimated in the sample size calculation. patients baseline characteristics and data relating to the opu procedure are summarized in table 1. the average age in the rn group was 40.83.9 years, compared with 40.33.6 years in the sn group. the mean number of retrieved oocytes was 0.970.16 in the rn group and 0.970.16 in the sn group, while the percentages of mature oocytes were 86.5% and 91.8% in the two groups, respectively. overall, there were no significant differences between the two groups in baseline characteristics or opu procedure data. baseline characteristics and oocyte pick - up (opu) procedure data in the reduced needle (rn) and standard needle (sn) groups meansd ; ns : not significant there was no significant difference in fertilization rate between the rn group and sn group (table 2). the pregnancy rate was numerically higher in the rn group (33.3% vs. 16.6%), although this difference did not reach statistical significance (table 2). assisted reproductive technology (art) outcomes in the reduced needle (rn) and standard needle (sn) groups mges : morphologically good - quality embryos ; ns : not significant the results relating to pain are shown in table 3. the mean vas score for overall pain experienced during opu was 3.22.0 cm in the rn group, significantly lower than the one in the sn group 4.92.2 (p<0.01). there was no significant difference in pain experienced 30 min after opu between - groups. the frequency of bleeding from the vaginal wall after opu was reduced by 26.3% in the rn group compared with the sn group (p<0.05 ; table 3). pain and frequency of bleeding in the reduced needle (rn) and standard needle (sn) groups meansd ; ns : not significant another strategy is to use a thinner needle for the procedure. in the present study, overall pain during oocyte aspiration was significantly lower with a newly designed reduced needle with a thinner tip, in comparison with the standard needle. no negative effects were found with the rn group in relation to oocyte fertilization, embryo morphology, or pregnancy rate. it is difficult to evaluate pain experience during opu, because many factors can have an influence such as fear of pain, anxiety, physician s skill, operation time and technical factors including needle diameter and sharpness during opu. analgesia is another potential factor, although that was not the case here because analgesic was not used. in a previous study of the rn, all patients received local anesthetic using paracetamol and had paracercivcal block with lidocaine (4). moreover, all patients received ovarian stimulation, meaning that several follicles were aspirated and the total opu time was longer than the time in the present study. under such conditions, it may be difficult to evaluate accurately the effect of the rn on pain. in the present study, it was hoped that the effect of the rn might be more obvious because patients had only one follicle aspirated and no analgesic drugs were used. in addition, to avoid possible bias related to multiple operators, all opus were performed by a single physician in the present study. consequently, a reduction in vas pain score was observed from 4.9 to 3.2 cm, a much larger relative reduction than in the previous study where corresponding vas scores were 2.6 and 2.1 cm. too much reduction of the needle diameter risks damaging the oocytes, although few studies have investigated this issue. with bovine oocytes, it has been demonstrated that both the diameter and bevel of the needle, as well as the aspiration vacuum, affect the recovery rate and developmental competence of oocyte (10, 11). previous investigation of the rn used in the present study concluded that human oocytes are unaffected by using a needle with a 20 gauge tip and an aspiration pressure of 90120 mmhg (4). previously, a prototype needle similar to the rn investigated in this study was created. like the needle reported here, the prototype had a luer connection, a 17 gauge body and a 20 gauge tip. the oocyte recovery rate with this needle was comparable with that of a conventional needle. however, approximately 50% of retrieved oocytes had degenerated and it was concluded that the prototype needle was harmful for oocytes (data not shown). this may be attributable to the way in which the prototype was made : where the two constituent needles was joined, the inner wall would not have been smooth and the flow of fluid passed this point would potentially have been turbulent. since the study was performed by a single physician on single - follicle oocyte retrievals with no analgesic treatment, patient perceived pain and physician perceived bleeding could be appropriately studied. still, one potential limitation of the current study was the relatively small number of the patients recruited. however, statistical analysis demonstrated that the study had sufficient power to detect an important difference. it was also thought that the patients would like to change our clinical practice quickly, taking into account the outcome of the study. another potential limitation of the study was that the type of needle was not blind to the physician. however, since the technique and average opu time were the same in both groups, it is unlikely that this would impact the results. this needle is not only useful for single - follicle oocyte retrievals in patients with no analgesic treatment but also more broadly in patients with fear of aspiration and those with a low threshold for pain. it will also be useful for patients with a history of bleeding and patients undergoing fertility preservation in conjunction with blood cancer treatment such as leukemia or lymphoma. patient perceived pain during single - follicle oocyte retrieval without analgesic was significantly lower with the newly designed aspiration needle with a thin tip than with a standard needle. in addition, post - procedural bleeding from the vaginal wall was lower with the rn. | background : the purpose of this study was to evaluate the effect of needle type on pain and bleeding during oocyte pick - up (opu).methods : from may through november 2013, patients undergoing opu from a single follicle without any analgesic treatment were including this study. eligible patients (n=75) were randomized 1:1 to undergo the procedure with either a reduced needle (17 gauge body, 20 gauge tip ; rn group) or a standard needle (19 gauge ; sn group). overall pain was assessed by patients using a visual analogue scale (vas), and vaginal bleeding after the procedure was recorded. fisher exact, t - test or wilcoxon test were used, and p<0.05 was considered to be statistically significant.results:the percentage of mature oocytes was 86.5% in the rn group and 91.7% in the sn group. pain during opu was significantly lower in the rn group than in the sn group (mean vas scoresd : 3.22.0 cm vs. 4.92.2 cm, p<0.01 ; meansd). the frequency of vaginal bleeding was also significantly lower in the sn group (26.3% vs. 48.6% ; p<0.05). the frequency of bleeding in the rn group was also significantly lower than that in the sn group (26.3% vs. 48.6% ; p<0.05). no significant differences were found between the two groups with regard to fertilization and pregnancy rates.conclusion:the newly designed needle significantly reduced pain and vaginal bleeding associated with single - follicle opu in patients receiving no analgesic treatment, in comparison with a standard needle. the rn had no adverse effect on the quality of retrieved oocytes. |
patients over 30 years of age with type 2 diabetes, diabetic retinopathy, and a visual acuity of 20 / 50 or better were enrolled in this prospective observational study. all participants were seen at seoul national university hospital from october 2011 to march 2012. the baseline pobf analyses were performed in conjunction with a transcranial doppler (tcd) examination and blood pressure (bp) measurements. ophthalmic evaluations of best - corrected visual acuity (bcva), iop, and cirrus hd optical coherence tomography (oct ; carl zeiss meditec, dublin, ca, usa) measurements were performed. one week after the administration of cilostazol (pletal ; otsuka pharmaceutical, tokyo, japan), all examinations were repeated. all pobf examinations were performed by a single trained examiner (djh) to reduce inter - examiner bias. the central foveal thickness (cft, the mean retinal thickness of the central 1 mm circle), the macular cube volume, and the macular cube average thickness were measured using a cirrus hd oct unit. when both eyes were eligible for the study, each eye was individually evaluated ; however, a computer algorithm randomly selected only one eye for use in the statistical analysis. the type of diabetic retinopathy was also classified into two subgroups : a non - proliferative diabetic retinopathy (npdr) group and a panretinal photocoagulation (prp)-treated proliferative diabetic retinopathy (pdr) group. upon enrollment, the clinical history of each patient was thoroughly evaluated. after screening, patients were administered cilostazol twice daily at a dose of 100 mg for 1 week (200 mg per day). patients who were taking aspirin at the time of enrollment in this study were asked to stop aspirin treatment for 2 weeks before beginning the cilostazol regimen. the 200-mg cilostazol dose was continued for 1 week if no complication or severe event was observed. the administration of any other anti - platelet drugs that could strongly influence the effect of cilostazol was prohibited during the study period. however, pre - existing prescription drugs for chronic diseases such as hypertension and diabetic mellitus were continued throughout the study period. patients with the following conditions were excluded from the study : a history of retinal surgery ; ocular diseases, excluding diabetic retinopathy ; new retinal vessels observed with fluorescein angiography ; macular edema with a cft exceeding 300 m ; severe hypertension (defined as having a systolic bp greater than 180 mmhg or a diastolic bp greater than 110 mmhg) ; hypersensitivity to the cilostazol treatment ; pregnancy or the possibility of pregnancy ; uncontrolled diabetes (hemoglobin a1c > 8%) ; angina pectoris, myocardial infarction, or heart failure. a pobf analyzer was used to assess blood flow according to methods previously described. this noninvasive technique assessing ocular blood flow is based on the iop pulse. a modified applanation prism with distensible film at the contact surface is used to measure blood velocity. a pneumotonometer is used to create a waveform representing the ocular pulse. the amplitude and pulse rate (pr) of this waveform the pobf analyzer has been found to be reliable and reproducible in measuring ocular pulse amplitude (pa), pulse volume (pv), pr, and pobf. the tcd studies were performed using a tcd150 m device (spencer technologies, seattle, wa, usa) (fig. 1b), which calculates a power m - mode doppler image and provides a single - gate spectrogram. the peak systolic velocity (psv), mean flow velocity (mfv), end diastolic velocity (edv), and pulsatility index (pi) of the ophthalmic artery were evaluated at baseline and 1 week after the administration of cilostazol. the ophthalmic artery can be situated above or below the optic nerve in the posterior orbit and passes forward into the nasal orbit in a horizontal plane slightly superior to that of the optic nerve. these vessels were examined at a point approximately 25 mm behind the globe in the nasal orbit. at this point, the pi was calculated using the following formula (psv edv) / (mfv), which was used to characterize the peripheral vascular resistance. changes between values measured at baseline and those measured 1 week after the administration of cilostazol were evaluated using the paired t - test and wilcoxon signed - rank test for normally distributed data and data that were not normally distributed, respectively. significant differences in the pobf analyzer and tcd values between the subgroups (npdr group vs. prp - treated pdr group) were evaluated using the mann - whitney test for nonparametric data. analysis of covariance was performed to adjust for age, gender, and the duration of diabetes mellitus in the subgroup analysis. spearman 's nonparametric regression analysis was used to determine the correlation between pobf and tcd at the ophthalmic artery. a p - value less than 0.05 was considered to be statistically significant. the study was approved by the institutional review board of seoul national university hospital (no. 0620113380) and followed the guidelines of good clinical practice. written informed consent for participation was obtained from all patients after they had been given a thorough explanation of this study. the study was carried out in accordance with the tenets of the declaration of helsinki. patients over 30 years of age with type 2 diabetes, diabetic retinopathy, and a visual acuity of 20 / 50 or better were enrolled in this prospective observational study. all participants were seen at seoul national university hospital from october 2011 to march 2012. the baseline pobf analyses were performed in conjunction with a transcranial doppler (tcd) examination and blood pressure (bp) measurements. ophthalmic evaluations of best - corrected visual acuity (bcva), iop, and cirrus hd optical coherence tomography (oct ; carl zeiss meditec, dublin, ca, usa) measurements were performed. one week after the administration of cilostazol (pletal ; otsuka pharmaceutical, tokyo, japan), all examinations were repeated. all pobf examinations were performed by a single trained examiner (djh) to reduce inter - examiner bias. the central foveal thickness (cft, the mean retinal thickness of the central 1 mm circle), the macular cube volume, and the macular cube average thickness were measured using a cirrus hd oct unit. when both eyes were eligible for the study, each eye was individually evaluated ; however, a computer algorithm randomly selected only one eye for use in the statistical analysis. the type of diabetic retinopathy was also classified into two subgroups : a non - proliferative diabetic retinopathy (npdr) group and a panretinal photocoagulation (prp)-treated proliferative diabetic retinopathy (pdr) group. upon enrollment, the clinical history of each patient was thoroughly evaluated. after screening, patients were administered cilostazol twice daily at a dose of 100 mg for 1 week (200 mg per day). patients who were taking aspirin at the time of enrollment in this study were asked to stop aspirin treatment for 2 weeks before beginning the cilostazol regimen. the 200-mg cilostazol dose was continued for 1 week if no complication or severe event was observed. the administration of any other anti - platelet drugs that could strongly influence the effect of cilostazol was prohibited during the study period. however, pre - existing prescription drugs for chronic diseases such as hypertension and diabetic mellitus were continued throughout the study period. patients with the following conditions were excluded from the study : a history of retinal surgery ; ocular diseases, excluding diabetic retinopathy ; new retinal vessels observed with fluorescein angiography ; macular edema with a cft exceeding 300 m ; severe hypertension (defined as having a systolic bp greater than 180 mmhg or a diastolic bp greater than 110 mmhg) ; hypersensitivity to the cilostazol treatment ; pregnancy or the possibility of pregnancy ; uncontrolled diabetes (hemoglobin a1c > 8%) ; angina pectoris, myocardial infarction, or heart failure. a pobf analyzer was used to assess blood flow according to methods previously described. this noninvasive technique assessing ocular blood flow is based on the iop pulse. a modified applanation prism with distensible film at the contact surface is used to measure blood velocity. a pneumotonometer is used to create a waveform representing the ocular pulse. the amplitude and pulse rate (pr) of this waveform the pobf analyzer has been found to be reliable and reproducible in measuring ocular pulse amplitude (pa), pulse volume (pv), pr, and pobf. the tcd studies were performed using a tcd150 m device (spencer technologies, seattle, wa, usa) (fig. 1b), which calculates a power m - mode doppler image and provides a single - gate spectrogram. the peak systolic velocity (psv), mean flow velocity (mfv), end diastolic velocity (edv), and pulsatility index (pi) of the ophthalmic artery were evaluated at baseline and 1 week after the administration of cilostazol. the ophthalmic artery can be situated above or below the optic nerve in the posterior orbit and passes forward into the nasal orbit in a horizontal plane slightly superior to that of the optic nerve. these vessels were examined at a point approximately 25 mm behind the globe in the nasal orbit. at this point, the pi was calculated using the following formula (psv edv) / (mfv), which was used to characterize the peripheral vascular resistance. statistical analyses were performed using a commercially available software package pasw ver. 18.0 (spss inc., chicago, il, usa). changes between values measured at baseline and those measured 1 week after the administration of cilostazol were evaluated using the paired t - test and wilcoxon signed - rank test for normally distributed data and data that were not normally distributed, respectively. significant differences in the pobf analyzer and tcd values between the subgroups (npdr group vs. prp - treated pdr group) were evaluated using the mann - whitney test for nonparametric data. analysis of covariance was performed to adjust for age, gender, and the duration of diabetes mellitus in the subgroup analysis. spearman 's nonparametric regression analysis was used to determine the correlation between pobf and tcd at the ophthalmic artery. the study was approved by the institutional review board of seoul national university hospital (no. 0620113380) and followed the guidelines of good clinical practice. written informed consent for participation was obtained from all patients after they had been given a thorough explanation of this study. the study was carried out in accordance with the tenets of the declaration of helsinki. the mean age was 62.5 12.0 years and 16 patients (64%) were male. the pdr group (18.4 6.4 years) had a longer duration of diabetes mellitus than the npdr group (11.6 6.0 years) (p = 0.001). cilostazol was well tolerated by all of the patients, and no complications or severe adverse events were observed during the 1 week of administration. there were no significant changes in visual acuity, iop, or bp after medication. among the oct parameters, there were no significant changes in the cft (255.9 26.4 m vs. 254.0 27.4 m, p = 0.111), macular cube volume (10.32 1.0 mm vs. 10.3 1.0 mm, p = 0.845), or macular cube average thickness (286.7 29.0 m vs. 287.3 28.2 m, p = 0.111), respectively. the pa, pr, and pobf measurements exhibited significant changes after cilostazol administration, as shown in table 1. at 1 week after cilostazol administration, pa had decreased by 17.9% (2.8 1.3 mmhg vs. 2.3 0.9 mmhg, p 0.05). neither age nor gender was found to be a significant predictor of changes in pobf or mfv (p = 0.275 and p = 0.114, respectively). the pa, pr, and pobf measurements exhibited significant changes after cilostazol administration, as shown in table 1. at 1 week after cilostazol administration, pa had decreased by 17.9% (2.8 1.3 mmhg vs. 2.3 0.9 mmhg, p 0.05). neither age nor gender was found to be a significant predictor of changes in pobf or mfv (p = 0.275 and p = 0.114, respectively). in this study, ocular blood flow as assessed by the pobf analyzer increased with oral administration of cilostazol in patients with diabetic retinopathy patients. this increase in ocular blood flow was parallel to the increase in retrobulbar vessel blood flow velocity as measured with tcd. the same trend of increased ocular blood flow was observed irrespective of the degree of diabetic retinopathy. the average increase in pobf observed in this study was 17.1%. this change in ocular blood flow was significant even after considering the previously proven test / retest variability. furthermore, to minimize the interobserver variability, all measurements were performed by a single experienced operator, which is very important in measuring pobf. pobf values have a wide normal range and low discriminating power, so intra - individual comparisons with repeated examinations, as performed in this study, are more useful than inter - individual comparisons. pobf analysis also showed that cilostazol administration significantly decreased pa and increased pr, which have been reported to be negatively correlated with each other in healthy subjects, and pv did not change significantly. these trends may explain the increase in pobf, which is affected by pa, pr, and pv. however, the outcomes of the present study should be discussed with an awareness of the associated instrumental limitations. currently, there is no established gold standard for the assessment of ocular blood flow, and therefore validation of any given method is limited to comparison with other methods. although the measurement of ocular blood flow with the pobf analyzer has empirical validity, it is necessary to consider the accuracy of our results. this is important because the measurement of blood flow from the ocular pulse is based on specific assumptions, hence no single method may provide a complete description of ocular blood flow. we therefore performed tcd to also evaluate retrobulbar vessel velocity, and found that the mean velocity in the ophthalmic artery had increased by 11.7 %. these changes in the tcd parameters of retrobulbar hemodynamics suggest that cilostazol treatment may modulate the velocity of blood in the retrobulbar vessels. changes in pobf were found to moderately correlate with changes in mfv by tcd, although ocular blood flow accounts for only a small portion of blood flow through the ophthalmic artery. changes in pobf also correlated with changes in psv and edv as well as mfv. despite the fact that the pobf and tcd measure different phenomena, the simultaneous increase in pobf and retrobulbar blood flow, as measured by the tcd, raises the possibility that the increase in pobf may reflect an actual increase in ocular blood flow, which may be affected by the increase in retrobulbar blood flow. although cilostazol reportedly enhances cerebral blood flow in cases of chronic cerebral infarction, its effect on ocular blood flow has not been investigated, and its ability to increase ocular blood flow remains unknown, especially in the diabetic state. to the best of our knowledge, this is the first study designed to elucidate the effect of systemic medication on ocular blood flow in patients with diabetic retinopathy. it may be speculated that the increased ocular blood flow observed in this study was due to the vasodilatory effect of cilostazol, as cilostazol is known to act as a platelet inhibitor and vasodilator. the pi calculated from the parameters measured by tcd, which reflects vascular resistance, showed no significant change. the blood flow velocity was observed to increase, thereby increasing the retrobulbar blood flow. cilostazol may affect the autoregulatory function of ocular blood flow and cause the vascular resistance to remain constant despite increased cerebral blood flow, thereby allowing increased ocular blood flow. no significant change was identified in the iop, bp, bcva, and oct thickness parameters, such as the cft and the macular cube volume at 1 week after the administration of cilostazol. with the increased ocular blood flow induced by cilostazol additionally, cilostazol may have a direct effect on inducing vasodilation in the ocular vasculature. spectral domain - oct parameters do not represent retinal blood flow, and there are no reliable methods currently available to assess retinal blood flow. the challenge of evaluating the effects of cilostazol on retinal blood flow and its long - term clinical outcomes remains to be solved in future studies. previous studies on cilostazol reported a lower mean pobf in the prp - treated pdr group as compared to the npdr group. however, our results showed no significant difference in pobf values between the npdr group and pdr groups. in addition, the pobf of the npdr and pdr groups were higher than those reported in previous studies for patients with diabetic retinopathy. reported a mean value of 15.9 l / sec for the npdr group, which was lower than the values reported in this study. reported mean values of 15.7 l / sec for moderate to severe npdr and 10.3 l / sec for prp - treated pdr, both of which were also lower than the values reported in this study (16.8 l / sec for npdr and 19.6 l / sec for pdr). this may be due to variability in the conditions of the patients enrolled in these studies, as most related studies have reported a small sample size, and only patients with relatively good vision were enrolled in our study. in addition, the interpretation and comparison of the pobf values may be limited by differences in patient age, sex, and the classification of diabetic retinopathy. the clinical significance of this increase in ocular blood flow with the administration of cilostazol in patients with diabetic retinopathy remains to be evaluated. studies describing the role of altered ocular blood flow in patients with diabetic retinopathy report conflicting results. increased ocular blood flow does not directly correlate with either improved visual acuity or delayed progression of diabetic retinopathy. our understanding of the role of ocular blood flow in the pathophysiology of diabetic retinopathy is in its infancy, and attempts to pharmacologically modify the progression of diabetic retinopathy are also in their primitive stages. to the best of our knowledge, our study is the first to evaluate the effects of systemic medication on ocular blood flow in diabetic retinopathy. the results of this study suggest that cilostazol may have potential value in increasing ocular blood flow in patients with diabetic retinopathy, although the long - term benefits need to be elucidated. with regard to safety, none of the patients in this study showed any complications or severe adverse events during medication administration. moreover, in a recent report, the addition of cilostazol to a regimen of aspirin therapy did not increase the bleeding tendency when compared with a regimen consisting of aspirin alone. cilostazol treatment could therefore safely be added to an ongoing antiplatelet regimen without increasing the risk of bleeding in patients with diabetic retinopathy. there are some limitations to this study that should be considered when interpreting the results. a large - scale long - term comparative study with a control group will be necessary to confirm these findings. in this study, cilostazol increased ocular blood flow by more than 10% without any significant side effects in patients with diabetic retinopathy. this demonstrates its potential as a tool for increasing blood flow in diabetic retinopathy, although its long - term clinical benefit remains to be clarified. further studies are required to investigate whether increased ocular blood flow due to cilostazol can slow the progression of diabetic retinopathy or improve visual outcome. | purposeto investigate the effect of cilostazol on ocular hemodynamics and to determine whether the administration of cilostazol increases the ocular blood flow in patients with diabetic retinopathy.methodsthis prospective observational study investigated the effect of orally administered cilostazol on diabetic retinopathy. before and after administration for 1 week, pulsatile ocular blood flow (pobf) and retrobulbar hemodynamics were measured using a pobf analyzer and transcranial doppler imaging, respectively. visual acuity, intraocular pressure, and blood pressure were also evaluated before and after treatment.resultstwenty-five eyes of 25 patients were included in this study. pobf increased significantly (16.8 4.6 l / sec vs. 19.6 6.2 l / sec, p < 0.001) after administration of cilostazol, while no significant change was identified in visual acuity, intraocular pressure, and blood pressure. mean flow velocity in the ophthalmic artery as measured with transcranial doppler imaging also increased significantly after medication (23.5 5.6 cm / sec vs. 26.0 6.9 cm / sec, p = 0.001). the change in pobf directly correlated with the change in mean flow velocity (r = 0.419, p = 0.007).conclusionscilostazol was effective in increasing ocular blood flow in patients with diabetic retinopathy, possibly by modulating retrobulbar circulation. |
in recent decades, intensive research in the field of oxidative damage indicates that exercise exacerbates the generation of reactive oxygen (ros) and reactive nitrogen species (rns), some of which are free - radicals [15 ]. a free - radical ros / rns refer to oxygen or nitrogen containing free - radicals and their non - free - radical derivatives. aerobic organisms produce free - radicals as a consequence of the oxygen metabolism, and, obviously, exercise causes an increase in oxygen utilization in mitochondria, resulting in elevated radical generation. an estimated 2% to 5% of the oxygen consumed (vo2) during normal mitochondrial metabolism in aerobic organisms may be converted to radicals and their products. during exercise, the vo2 uptake is higher than at rest because of the increasing energy demand in many tissues, mainly in muscle. the increase in oxygen uptake is related to substantial rise in the production of free - radicals generated during mitochondrial respiration. several potential alternative sources of free - radicals, such as oxidase systems associated with membranes, nitric oxide production, and phagocytic processes, as well as an increase in lactate formation, as happens in exhaustive exercise, have been proposed to contribute significantly to the overproduction of free - radicals. the elevation of metabolism by exercise results in a greater production of superoxide radicals, which are dismutated to hydrogen peroxide (h2o2) by superoxide dismutase (sod). h2o2, a molecule that readily crosses cell membranes, can be detoxified to water and oxygen by other enzymes, that is, catalase (cat) and glutathione peroxidase (gpx). but when these transformations do not take place, h2o2 is, via the fenton reaction, converted to the hydroxyl radical, the most toxic ros because of its high reactivity [6, 12 ]. numerous studies have shown that muscle cells also release superoxide into the extracellular space [11, 13 ], so free - radicals readily reach the blood and act on other cells. there is a general consensus that free - radical generation during exercise occurs predominantly in skeletal and heart muscles ; however, the invasive nature of obtaining biopsies from exercising humans limits their access. therefore, some reports have claimed that the concentration of several oxidative stress markers increase immediately in the plasma after an acute exercise [14, 15 ]. antioxidants are defined as any substance that, when present at low concentration compared to those of an oxidizable substrate, significantly delays or prevents the oxidation of that substrate. the first are low molecular weight proteins, which minimize oxidative damage by catalyzing chemical reactions to detoxify free - radicals in cells and tissues and can be synthesised due to the redox - activation of specific genes, primarily by affecting the binding of transcription factors to dna. during exercise, free - radicals generated can activate different redox - sensitive transcription factors, including nf-b, which leads to an elevation in the expression of some antioxidant enzymes. nonenzymatic antioxidants are generally small molecules that directly scavenge ros, preventing them from disfiguring lipids, proteins, or nucleic acids. glutathione, an important intracellular antioxidant, is converted to its oxidized form (gssg) by gpx when it is used as a scavenger ; it is converted back to its reduced form by glutathione reductase (gr). moreover, both animals and humans subjected to a long - term heavy exercise became more resistant to oxidative damage [18, 19 ]. fisher. studied the activity of sod, cat, and gpx after high - intensity interval training, and they found that all of these enzymes activities were increased. none of these studies have compared different types of exercise and observed changes in activities of four antioxidant enzymes and in the total antioxidant status in plasma. herein, we evaluated the antioxidant status after three protocols of acute exercise in untrained healthy men. plasma samples were collected for the measurement of cat, gr, gpx, and sod activities and total antioxidant status (tas) as a general marker of antioxidant defences. thirty - four healthy male volunteers, aged 1929 (23.0 0.41), were involved in this study. only males were included to avoid any distortion in the hormonal response to physical exercise caused by sex differences. none of the subjects participated regularly in sport competitions, and they did not engage in any form of vigorous exercise or take medications for 24 hours before the study was performed. all subjects underwent an extensive previous medical evaluation that included a history and physical examination, electrocardiogram, and biochemical profile to discard possible pathologies. subjects gave their informed written consent to participate in the study, designed according to the principles of the declaration of helsinki (1964) and approved by the ethical committee of clinical investigation of aragon with the statement code c02/2010. exercise was performed on an electronically regulated cycloergometer between 08:00 and 10:30 a.m. after an overnight fast. three ergometric tests were performed on each subject in random order at intervals of at least 1 week. firstly, the maximal oxygen consumption (vo2max) and the maximal working capacity (mwc) were determined using a continuous progressive exercise test, where the work load was increased by 10 watts every minute. the initial load was 100 watts less than the mwc determined in the first test. finally, the subjects pedaled for 30 minutes at a submaximal workload chosen at 70% of the expected maximum for each individual. peripheral venous blood samples obtained before exercise (a), and immediately after a continuous progressive exercise test (b), a strenuous test performed until exhaustion (c), and a submaximal exercise (70% of the expected maximum workload) for 30 minutes (d) were drawn by antecubital venepuncture and collected into lithium heparin - containing tubes. 10 ml of blood were collected at each sampling time. blood samples were immediately centrifuged at 1.000 g for 10 minutes in a beckman allegra 64r refrigerated centrifuge (fullerton, usa). plasma was stored in 250 l aliquots at 30c until tas and enzyme activities were determined. the total antioxidant status method relies on the ability of plasma antioxidant substances to inhibit the oxidation of 2,2-azino - di-[3-ethylbenzthiazioline sulphonate ] (abts) to the radical cation abts by metmyoglobin. this molecule formed a relative stable green substance which was measured spectrophotometrically at 600 nm. the capacity of the antioxidants in the sample to prevent abts oxidation is compared with that of trolox, a water - soluble tocopherol analogue, and is quantified as millimolar trolox equivalents. when h2o2 was added at low concentration (0.2 m) to a sample with cat, this enzyme catalyzed the transformation of this substrate to oxygen and water. to check the activity, a kinetic curve had to be measured during 30 seconds at = 240 nm using a molar extinction coefficient 43.6 cm m to know the amount of h2o2 eliminated. catalytic activity of gr was measured following the decrease in the absorbance at = 340 nm for 3 minutes due to the oxidation of nadph to nadp, in presence of gssg, as described by goldberg and spooner. the molar extinction coefficient is = 6.2210 cm m. to determine gpx activity, the continuous decrease in nadph concentration was measured, while gsh levels were maintained, following the flohe and gunzler method. this method is based on the rise of the absorbance, during 3 minutes at = 340 nm, because of the oxidation of nadph in presence of gsh, t - butyl hydroperoxide, gr, and the sample. the molar extinction coefficient used for the calculations is = 6.2210 cm m. one cat, gr, or gpx enzymatic unit (units) was defined as that amount of the enzyme that catalyzes the conversion of 1 micromole of substrate per minute. sod activity was measured as the inhibition of the rate of reduction of cytochrome c by the superoxide radical (o2), observed at 550 nm. o2 was first produced by the reaction of xanthine and oxygen catalyzed by xanthine oxidase. the definition of one unit of sod is the amount of protein that inhibits the rate of cytochrome c reduction by 50%. data were analysed using repeated - measures anovas. where significant main effects were found, pairwise comparisons were conducted using bonferroni adjustments for multiple comparisons. total antioxidant status after all the three acute exercise protocols tested in this study : continuous progressive (1.62 0.07), strenuous (1.66 0.08) and submaximal exercises (1.61 0.08) was elevated when compared with basal status (1.53 0.07) as illustrated in figure 1. the strenuous protocol produced the highest increase in cat activity (42.29 2.84) although the continuous progressive (24.85 2.35) and submaximal exercises (29.19 3.89) also significantly elevated cat activity relative to that at rest (18.54 1.97) (figure 2). both gr and gpx were elevated after submaximal exercises and even higher activity values of these enzymes were obtained after progressive and strenuous exercises (figures 3 and 4). gr increases from a basal level of 0.021 0.002 to b : 0.031 0.003, c : 0.031 0.003, and d : 0.026 0.003. gpx level was also higher after exercises b : 1.03 0.3, c : 1.02 0.03, and d : 1.02 0.03 from a basal level of 0.94 0.02. the sod activity rose significantly after the strenuous exercise (0.028 0.007), but it is after the nonexhaustive test (0.033 0.007) when the highest increase took place versus the basal value (0.018 0.004) (figure 5). oxidative stress is an imbalance between ros / rns generation and antioxidants levels in favour of the former. although there is a general consensus that free - radical overproduction due to exercise occurs mainly in the active skeletal muscles [3234 ], it is also well documented that exercise causes systemic oxidative damage.. found an augmentation of malondialdehyde, a marker of lipid peroxidation due to oxidative stress, in lymphocytes after a single bout of intense exercise. in addition, ajmani. noted an increase in membrane rigidity in erythrocytes after a strenuous exercise because of oxidative stress. the main finding of our work was the increase of the tas in human blood after a single bout of exercise, either maximal or submaximal. plasma tas is a combination of various antioxidant defences, including enzymatic and nonenzymatic systems. as shown herein, child. found higher tas levels in the plasma after an exhaustive exercise, that is, equivalent to a half marathon, and they concluded that uric acid, an important component of the antioxidant system, is responsible for one third of the tas increase. although uric acid may contribute to the antioxidant defences, another possible explanation for the elevation of tas is changes in other antioxidants, for example, gsh, melatonin, or the antioxidant enzymes. we also demonstrate that cat, gpx, gr, and sod activities were higher after exercise than at rest. previous reports have shown increases of gpx, gr, and cat activities in the skeletal muscle during exercise. [39, 40 ] observed in two consecutive studies that an acute bout of exercise increased antioxidant enzymatic activities in rat muscle. in the first report the second study was designed to compare both maximal and submaximal protocols of exercise, and, as we found, gpx, gr, and cat activities were enhanced by exercise. sod activity also increased after a single period of exhaustive exercise and during the recovery, following a nondamaging aerobic exercise in a cycloergometer. in this report, muscle samples were taken from the vastus lateralis muscle of the exercised leg in humans by biopsy. the effect of acute exercise on the antioxidant enzyme activities appears to be systemic, involving many organs. following a single exhaustive swimming test, terblanche reported that cat activity was higher compared to the rest in several tissues : liver, heart, kidney, or lung in male and in female rats ; thereby, these authors proposed that increasing cat activity during acute exercise may be a defence mechanism in protecting the tissues against hydrogen peroxide generation. also, cat and sod activities in rat lung tissue was increased significantly after the effort in young rats, a response that was significantly depressed in old rats. the invasive nature of obtaining muscular biopsies from exercising humans limits their access ; thus, a number of studies have directed their efforts to the blood. thus, aguil. have recently found an elevation in cat and gr activities in the erythrocytes, while cases. found cat, gpx, and sod rises in lymphocytes after a single bicycle ride or swimming. these authors proposed that oxidative stress and the necessity of protection against oxidative damage may be responsible, at least partially, for the elevation in the activity of these enzymes induced by exercise. however, cat and gpx activities in human neutrophils decreased after a single bout of exercise, perhaps because these cells released the enzymes into the plasma. also reported that the activity of extracellular sod and gpx rose from basal status after an acute bout of aerobic. although one hour later, during recovery, the antioxidant enzyme activities fell back to basal levels. however, enzyme activities were increased again 24 hours later because a possible genetic upregulation of these enzymes. shin. studied the effect of 6 months aerobic endurance training on the response to the acute exercise and reported that antioxidant enzyme activities were much higher than after pretraining test. a possible explanation for the reinforcement of the antioxidant system due to training is that exercise stimulates the expression of the genes involved in the regulation of the antioxidant enzymes in a redox sensitive signal transduction pathways, mainly nf-b. it is reported the importance of the nuclear factor in the expression of sod and inducible nitric oxide synthase (inos) in rat skeletal muscle. ji. observed that exercising rats injected with allopurinol, a competitive inhibitor of xanthine oxidase, attenuated ros production compared to untreated group, and also nf-b binding was dramatically enhanced by exercise but inhibited by allopurinol treatment. it is also reported that physical exercise (80% vo2max for 1 hour) resulted in nf-b activation in peripheral blood cells of physically fit young men. in the other hand, another study shows how an eccentric exercise for 45 minutes did not increase the expression of this transcription factor. so, the influence of different exercise protocols of training in the redox status in many cells or tissues remains unclear [48, 5457 ]. in conclusion, the data reported herein provide evidence that a single bout of maximal and submaximal acute exercise enhances plasma tas in healthy human subjects. this increase may be a consequence of an improvement in the plasma activities of cat, gpx, gr, and sod. based on our observations and previous studies which reported that exercise causes a significant augmentation of the concentrations of several antioxidant scavengers, presumably due to its interactions with the free - radical overproduction [58, 59 ], it seems reasonable to propose that exercise may play a beneficial role because of its ability to increase the antioxidant defense mechanisms against oxidative stress. | antioxidant defences are essential for cellular redox regulation. since free - radical production may be enhanced by physical activity, herein, we evaluated the effect of acute exercise on total antioxidant status (tas) and the plasma activities of catalase, glutathione reductase, glutathione peroxidase, and superoxide dismutase and its possible relation to oxidative stress resulting from exercise. healthy untrained male subjects (n = 34) performed three cycloergometric tests, including maximal and submaximal episodes. venous blood samples were collected before and immediately after each different exercise. tas and enzyme activities were assessed by spectrophotometry. an increase of the antioxidant enzyme activities in plasma was detected after both maximal and submaximal exercise periods. moreover, under our experimental conditions, exercise also led to an augmentation of tas levels. these findings are consistent with the idea that acute exercise may play a beneficial role because of its ability to increase antioxidant defense mechanisms through a redox sensitive pathway. |
psoriasis is a lifelong, chronic, and immune - mediated systemic disease with preferential skin involvement, which affects approximately 13% of the caucasian population [1, 2 ]. psoriasis may appear at any age ; however, over 75% of patients belong to a clear subgroup, that develops the disease before the age of 40 (type 1 or early - onset psoriasis) [3, 4 ]. the most common clinical variant is plaque - type psoriasis, characterized by erythematous scaly plaques, round or oval, variable in size, frequently located in scalp, lower back, umbilical region, intergluteal cleft, knees, and elbows [1, 5, 6 ]. as a clinically heterogeneous disease, psoriasis presents several degrees of severity and a wide array of presentations in different patients. approximately 80% of psoriasis patients have mild disease, with skin plaques usually covering less than 10% of the body surface area (bsa). however, some patients have moderate to / or severe disease, with greater than 10% of the bsa involvement [3, 6 ]. the different presentations of psoriasis require a variable approach to treatment and the current treatment concept advocates that the type of therapy prescribed should be appropriated to disease severity. although there is a wide range of therapies available for the treatment of psoriasis, either systemic or topical agents, the use of topical therapy (figure 1) remains a key component of the management of almost all psoriasis patients. while mild disease is commonly treated only with topical agents, the use of topical therapy as adjuvant therapy in moderate - to - severe disease may also be helpful and can potentially reduce the amount of phototherapy or systemic agent required to achieve satisfactory disease control. topical therapies available for mild - to - moderate psoriasis involve a great number of different agents, including [3, 7, 8]emollients;tars;dithranol;topical retinoids (tazarotene);calcineurin inhibitors (pimecrolimus and tacrolimus);keratolytics (salicylic acid, urea);topical vitamin d analogues (calcitriol, tacalcitol, and calcipotriol);topical corticosteroids. topical retinoids (tazarotene) ; calcineurin inhibitors (pimecrolimus and tacrolimus) ; keratolytics (salicylic acid, urea) ; topical vitamin d analogues (calcitriol, tacalcitol, and calcipotriol) ; topical corticosteroids. since their introduction to dermatology, more than 50 years ago, topical corticosteroids have become the mainstay of treatment of various dermatoses including psoriasis, mainly due to their immunosuppressive, anti - inflammatory and antiproliferative properties, which makes this class of drugs an useful therapy for this immune - mediated disease [9, 10 ]. although topical corticosteroids are an integral part of the psoriasis therapeutic armamentarium, limitations due to the occurrence of well - known cutaneous adverse effects such as atrophy, striae and/or telangiectases, and also potential systemic adverse events prevent their optimal long - term and extensive utilization. therefore, strategies such as the weekend - only / pulse therapy regimen or combining topical corticosteroids with other topical agents may improve their efficacy and safety profile over longer periods [11, 12 ]. the purpose of the therapy is to reduce the extent and severity of psoriasis to the point at which it is no longer detrimental to a patient 's quality of life. treatment choice should always be tailored to match the individual patient 's needs and his expectations. when employed under these circumstances, a topical treatment regimen is more likely to produce a satisfactory clinical outcome [3, 8 ]. corticosteroids remain first - line treatment in the management of all grades of psoriasis, both as monotherapy or as a complement to systemic therapy. they are available in a wide range of preparations including gel, cream, ointment, foam, lotion, oil and spray, and a new and innovative vehicle (table 1) [3, 16 ]. according to cornell and stoughton, we know that the vehicle can directly modify a preparation 's therapeutic and adverse effects by changing the pharmacokinetics of the topical corticoid molecule. therefore, the development of an improved vehicle for corticosteroids is at the forefront of dermatologic research [16, 17 ]. although the decision of the agent depends on patient 's choice, distribution of disease and local availability, bioassays comparing vehicles and corticoid molecules have demonstrated that ointments are the most effective, followed by creams and lotions. a recent study with clobetasol has suggested spray vehicle to be slightly more efficacious than other vehicles. besides the important role of specific factors involved in the formulation of the spray, this greater efficacy may be due to increased patient compliance with an odorless, easy to apply, low residue, and elegant vehicle [3, 16, 18 ]. in 1985, stoughton and cornell classified corticosteroids potency according to their vasoconstrictive properties [3, 11, 17 ]. while in the usa there are seven potency groups, the uk considers four classes : mild (class iv), moderately potent (class iii), potent (class ii), and very potent (class i) [3, 11, 19, 20 ]. lower - potency corticosteroids are particularly recommended to apply on the face, groin, axillary areas, and in infants and children, whereas mid- and higher - potency corticosteroids are commonly used as initial therapy on all other areas in adults. superpotent corticosteroids are mainly used for stubborn, cutaneous plaques or lesions on the palms, soles, and/or scalp [11, 21, 22 ]. regardless of the inexistence of studies to prove the assurance of topical corticosteroid use on the scalp beyond 4 weeks, in general, high - potency topical corticosteroids can be successfully and safely used. the reason for that safety is possibly due to the presence of dense vascularization and abundance of adnexal structures on the scalp that minimize the possibility of tachyphylaxis and side effects such as skin atrophy [23, 24 ]. as an initial therapy to achieve a faster improvement of lesions, in clinical practice, potent and superpotent corticosteroids are often used ; however, they should not be used for more than 2 weeks and the patient should be under close surveillance [3, 11, 20, 25 ]. psoriasis is a clinically heterogeneous disease, and its individual presentation can make the selection of the most appropriated treatment difficult. to overcome the variable nature of the disease and also the several options of treatment, there are currently two sets of guidelines from germany and usa available for the different forms of topical treatment, which allow = a more effective therapy decision and to decide when patients move from topical to systemic treatment. however, there are huge differences between recommendations from different countries [7, 9 ]. while german guidelines recommend a combination of topical steroids with salicylic acid (broad combination is possible ; care must be taken regarding steroid side effects), usa guidelines suggest the use of topical steroids as monotherapy in mild - to - moderate psoriasis or in combination with other topical agents, uv light or systemic agents in moderate - to - severe disease. neutrophils, plasmacytoid dendritic cells (dcs), and cd11c (myeloid) dcs are present in psoriatic lesions as part of the innate immunity. acquired immunity is diverted towards a t helper 1 (th1) cd4 cells - mediated response producing ifn-, tnf-, and interleukin-2 (il-2), along with t cytotoxic (tc) cd8 cells. recently, th17 cells have been suggested to be involved in the pathogenesis of psoriasis synthesizing il-17a, il-17f, and il-22. th17 cells ' differentiation, proliferation, and survival are dependent on il-6, tgf, il-1, il-23, and il-21. particularly, il23 is important for the pathogenicity at later stages of th17 development. il-23 and il-12 share a common p40 subunit, which is covalently linked to either a p35 or p19 subunit forming il-12 or il-23, respectively. il-23, secreted by activated myeloid dendritic cells, will drive t - cell differentiation toward th17 subset and also release il-12, inducing th1 differentiation. il-17a leads to joint pathology due to its potential activity of inducing rankl and its synergistic effect with il-1 and tnf-. th17 cells produce il-22, which have potent keratinocyte proliferative ability. il-22, along with il-17, induces stat3 activation and cytokine / chemokine production, showing that way, an important role in the physiopathology of psoriasis. anti - il-17 monoclonal antibodies (ain457 and ly2439821) may be useful in patients with psoriasis and autoimmune arthritis, as showed by successful experiments in animal models. further clinical trials with these anti - il-17 monoclonal antibody preparations in psoriasis and psoriatic arthritis are necessary. corticosteroids act in two different ways at the cellular level, divided into genomic and nongenomic pathways. the genomic pathway refers to the glucocorticoid receptor (gr) and to its activation by cortisol, subsequent receptor homodimerization, and binding to glucocorticoid - responsive elements (gres). when the ligand is absent, the glucocorticoid receptor accumulates in the cytoplasm complexing with proteins, including the large heat shock proteins hsp90 and hsp70. but when the ligand binds to the receptor, this complex is disrupted and the gr migrates to the nucleus. upon dimerisation of gr and binding to a palindromic promoter sequence, the glucocorticoid response elements, the transcription of genes with anti - inflammatory functions such as tyrosine amino transferase (tat), phosphoenolpyruvate carboxykinase (pepck), il-10, -adrenergic receptor, il-1-receptor antagonist, and dual - specificity protein phosphatase 1 (dusp-1) are promoted. gc negatively regulates the expression of proinflammatory genes by transrepression, for example, cytokines, growth factors, adhesion molecules, nitric oxide, prostanoids, and other autacoids. further, coactivators or corepressors help modifying the structure of chromatin, enabling the dna transcription. the cortisol - glucocorticoid receptor complex may interact with nuclear factor-b leading to its transrepression (nf-b) [30, 31 ]. the nongenomic pathway takes membrane - bound receptors and second messengers into account, and it is responsible for the rapid effects of glucocorticoids that occur in a few minutes. this pathway does not require de novo protein synthesis and acts by modulating the level of activation and responsiveness of target cells, such as monocytes, t cells, and platelets [33, 34 ]. the glucocorticoid receptor is encoded by the gr gene, localized to chromosome 5q31 - 32 locus. posttranscriptional processing includes splicing of exon 9, yielding either gr mrna or gr mrna. glucocorticoid receptor isoform is responsible for the known actions of cortisol, whereas glucocorticoid receptor isoform appears to play a regulatory role. glucocorticoids possess numerous functions such as anti - inflammatory, antimitotic, apoptotic, vasoconstrictive and immunomodulatory functions. these properties are closely associated with their efficacy in the skin disease treatment (figure 2). anti - inflammatory propertiesthe inflammatory process is controlled by the glucocorticoids ' activity, enhancing the transcription of anti - inflammatory genes and decreasing the transcription of inflammatory genes (figure 3). glucocorticoids induce the expression of annexin a1 (also known as lipocortin 1 ; encoded by anxa 1) and alxr (the annexin a1 receptor) by mechanisms still not known. although in normal skin annexin a1 has been identified within cytoplasm, in diseased skin the intracellular localization of annexin a1 is apparently modified. in lesional psoriatic skin, annexin a1 appears only in the cell membrane, suggesting a translocation of the protein. this transition may occur to promote the binding of annexin a1 to phospholipids, therefore reducing the production of inflammatory prostanoids. annexin a1 inhibits phospholipase a2 (pla2), thus blocking the synthesis of arachidonate - derived eicosanoids (prostaglandins, prostacyclins, leukotrienes, and thromboxanes). this blocking is furthered by the repression of glucocorticoid - mediated cyclooxygenase 2 transcription [3841 ]. it remains unclear if the reduction of these substances levels come first and then plaque resolution, or if the normalization of prostanoid levels follows plaque clearance.exogenous and endogenous annexin a1 may regulate the innate immune cells activities controlling its levels of activation. annexin a1 signals throw a formyl peptide receptor 2 (fpr2, alxr in humans). despite the activation of alxr singnalling can occur by the annexin a1 autocrine, paracrine, and juxtacrine functions, the juxtacrine interaction seems to be the mechanism by which the anti - inflammatory process occurs. concerning the innate response, it seems that the upregulation of the annexin a1 expression by leukocytes induced by glucocorticoids may be responsible for the inhibition of leukocytes response. glucocorticoids also increase the secretion of annexin a1 by macrophages and the annexin a1 secreted by mast cells and monocytes, promotes the clearance of apoptotic neutrophils by macrophages. endogenous annexin a1 is also released from apoptotic neutrophils and acts on macrophages promoting phagocytosis and removal of the apoptotic cells contrasting with the innate immunity, the adaptive immune system seems to act in a different way. activation of t cells results in the release of annexin a1 and in the expression of alxr. although, glicocorticoids may reduce the annexin a1 expression within t - cell exposure as a consequence, there is an inhibition of t - cell activation and t cells differentiate into t helper 2 [42, 43 ]. the inflammatory process is controlled by the glucocorticoids ' activity, enhancing the transcription of anti - inflammatory genes and decreasing the transcription of inflammatory genes (figure 3). glucocorticoids induce the expression of annexin a1 (also known as lipocortin 1 ; encoded by anxa 1) and alxr (the annexin a1 receptor) by mechanisms still not known. although in normal skin annexin a1 has been identified within cytoplasm, in diseased skin the intracellular localization of annexin a1 is apparently modified. in lesional psoriatic skin, annexin a1 appears only in the cell membrane, suggesting a translocation of the protein. this transition may occur to promote the binding of annexin a1 to phospholipids, therefore reducing the production of inflammatory prostanoids. annexin a1 inhibits phospholipase a2 (pla2), thus blocking the synthesis of arachidonate - derived eicosanoids (prostaglandins, prostacyclins, leukotrienes, and thromboxanes). this blocking is furthered by the repression of glucocorticoid - mediated cyclooxygenase 2 transcription [3841 ]. it remains unclear if the reduction of these substances levels come first and then plaque resolution, or if the normalization of prostanoid levels follows plaque clearance. exogenous and endogenous annexin a1 may regulate the innate immune cells activities controlling its levels of activation. annexin a1 signals throw a formyl peptide receptor 2 (fpr2, alxr in humans). despite the activation of alxr singnalling can occur by the annexin a1 autocrine, paracrine, and juxtacrine functions, the juxtacrine interaction seems to be the mechanism by which the anti - inflammatory process occurs. concerning the innate response, it seems that the upregulation of the annexin a1 expression by leukocytes induced by glucocorticoids may be responsible for the inhibition of leukocytes response. glucocorticoids also increase the secretion of annexin a1 by macrophages and the annexin a1 secreted by mast cells and monocytes, promotes the clearance of apoptotic neutrophils by macrophages. endogenous annexin a1 is also released from apoptotic neutrophils and acts on macrophages promoting phagocytosis and removal of the apoptotic cells. contrasting with the innate immunity, the adaptive immune system seems to act in a different way. activation of t cells results in the release of annexin a1 and in the expression of alxr. although, glicocorticoids may reduce the annexin a1 expression within t - cell exposure as a consequence, there is an inhibition of t - cell activation and t cells differentiate into t helper 2 [42, 43 ]. mapk phosphatase 1 owes its anti - inflammatory properties to the interference in the mapk pathway. mapk phosphatase 1 dephosphorylates and hence further inactivates c - jun (the terminal kinase in the mapk pathway). the inactivation of mapks and also of mapk - interacting kinase by mkp-1 is due to the inhibition of pla2 activity mediated by glucocorticoids. if glucocorticoids induce mkp-1 to suppress the inflammation, it seems that glucocorticoids resistance in some inflammatory diseases could be related to defects in the expression, or function, of mkp-1. it has been described in some inflammatory diseases that c - jun n terminal kinase and p38 activities are increased, becoming possible targets for clinical intervention. possible mechanisms for glucocorticoids resistance may be associated with a failure in the inhibition of c - jun n terminal kinase and p38 because these kinases negatively regulate gr function. for example, an initial defect in glucocorticoids - induced mkp-1 expression / activity might increase mapk activity, thus impairing the gr function. as a consequence of this failure, an increase in transcription of proinflammatory genes, or in the instability of the mrnas, may occur. alternative to the hyperactive mapk pathway, a reduced number of activated gr within the nucleus or a lack of interaction with the basal transcription process may be a reason for steroid resistance. it can be relevant, concerning the glucocorticoid tachyphylaxia, whether these mechanisms can be implicated [44, 45 ]. c - jun is a transcription factor recognized to form homodimers and heterodimers with c - fos, the latter combination resulting in the activator protein 1 (ap-1). both c - jun homodimer and ap-1 heterodimer there is also evidence of direct protein - protein interactions between the glucocorticoid receptor and c - jun homodimers and ap-1 heterodimers, conferring to the nongenomic pathway of cortisol a large share of the anti - inflammatory action of glucocorticoids. other genomic mechanisms include the direct repression of the nf-b transcription factor by the glucocorticoid receptor. nf-b binds to dna and induces transcription of genes encoding cytokines, chemokines, complement proteins, cell - adhesion, molecules and cyclooxygenase 2, all associated with inflammation. it is unquestionable that the expression and activity of several cytokines relevant to inflammatory diseases may be inhibited by treatment with glucocorticoids. these cytokines include il-1, il-2, il-3, il-6, il-11, tnf-, gm - csf, and chemokines that call inflammatory cells to the site of inflammation, namely, il-8, rantes, mcp-1, mcp-3, mcp-4, mip-1, and eotaxin. furthermore, the inflammatory process receptors, such as nk1 and nk2-receptors, are involved in the transcription of genes coding for these mediated inflammatory receptors by glucocorticoids activity. the glucocorticoids suppressive effects are related with inhibition of cytokine gene expression by inhibiting the transcription factors that regulate their expression, rather than binding to their promoter regions. regarding genomic and nongenomic pathways, it seems that the nongenomic pathway stands out powerful enough to mediate the anti - inflammation process by itself. in an experiment, the gr mouse gene was mutated so that the glucocorticoid receptor lost the ability to dimerize, and thus bind dna. in these gr mice, glucocorticoids were only allowed to act via the nongenomic pathway. a phorbol 12-myristate 13-acetate- (pma-) mediated ear edema was then induced in both wild - type and gr mice. surprisingly, the edema was reduced in both strands of mice after administration of dexamethasone. additionally, dexamethasone suppressed serum tnf- and il-6, and lipopolysaccharide (lps)-induced transcription of tnf-, il-6, il-1, and cyclooxygenase 2 genes in both wild - type and mutant mice. nitric oxide (no) has a relevant function in multiple systems modeling physiological and pathological processes in the skin, namely, vasodilation, immunomodulation, inflammation, and oxidative damage to cells and tissues. the synthesis of no is dependent of the nitric oxid synthases (nos), a family of enzymes with three isoforms, the constitutive endothelial enos, neuronal nnos, and the inducible inos. while glucocorticoids restrain the induction of inos, they do not produce any effect over enos and nnos activity. it is thought that inhibition of no by glucocorticoids occurs only in the presence of high no levels, caused by inflammatory substances such as lipopolysaccharides or cytokines, in a similar way to the cox system. the nitric oxide synthases ' inhibitors appear to be related with the no role in erythema and oedema formation in psoriasis. moreover, inos was found in lesional psoriatic skin [37, 48 ]. the modulation of mast cell numbers and activity has been suggested as an additional mechanism for the anti - inflammatory properties. these cells have numerous pro - inflammatory mediators, as histamine and prostaglandins, which are released, in response to mast cell degranulation. thereby, we may obtain an anti - inflammatory action by inhibiting this mast cell reaction. the use of glucocorticosteroids diminishes the number of mast cell in the skin, which is responsible for reducing histamine content in the treated skin [37, 49 ]. antiproliferative propertiesanother beneficial action of the topical glucocorticoids is their antimitotic activity, which has been suggested as providing positive results in the treatment of psoriasis, where cell turnover rate of the skin is substantially elevated. studies on normal and psoriatic skin suggest that topical glucocorticoids decrease the number of epidermal mitoses. dexamethasone may have an anti - proliferative effect over the a549 cell line, which is associated with an increase of annexin a1. it would be of interest to find out whether the antimitotic power of glucocorticoids is caused by these effects on annexin a1 in order to develop new therapeutic tools and diminish the skin thinning. another beneficial action of the topical glucocorticoids is their antimitotic activity, which has been suggested as providing positive results in the treatment of psoriasis, where cell turnover rate of the skin is substantially elevated. studies on normal and psoriatic skin suggest that topical glucocorticoids decrease the number of epidermal mitoses. dexamethasone may have an anti - proliferative effect over the a549 cell line, which is associated with an increase of annexin a1. it would be of interest to find out whether the antimitotic power of glucocorticoids is caused by these effects on annexin a1 in order to develop new therapeutic tools and diminish the skin thinning. these drugs decrease the survival of both types of cells, leading to programmed cell death or apoptosis. the apoptosis of eosinophils appears to be related with a blockade of the il-5 and gm - csf effects, of which eosinophils are dependent. on the contrary, these drugs decrease the survival of both types of cells, leading to programmed cell death or apoptosis. the apoptosis of eosinophils appears to be related with a blockade of the il-5 and gm - csf effects, of which eosinophils are dependent. on the contrary, vasoconstrictive propertiesalthough associated with an unclear mechanism, the vascular action has been proposed to be part of the anti - inflammatory effects of glucocorticoids, since there is a reduction in blood flow to the inflamed site. vasoconstriction, also termed blanching, when related to skin surface, forms the basis of the standard assay for evaluation of the potency of topical glucocorticoids. although associated with an unclear mechanism, the vascular action has been proposed to be part of the anti - inflammatory effects of glucocorticoids, since there is a reduction in blood flow to the inflamed site. vasoconstriction, also termed blanching, when related to skin surface, forms the basis of the standard assay for evaluation of the potency of topical glucocorticoids. immunosuppressive propertiesthe regulation of several aspects of immune - cell function is also pertinent to the cutaneous function of glucocorticoids, conferring an additional benefit in treatment of dermal diseases. in addition to inhibiting humoral factors involved in the inflammatory response and the leukocyte migration to sites of inflammation, glucocorticoids interfere with the function of endothelial cells, granulocytes, and fibroblasts. therefore, glucocorticoids commonly repress maturation, differentiation, and proliferation of all immune cells, including dcs and macrophages. suppressing dendritic cells and macrophages, and consequently the production of t helper 1-cell - inducing cytokine interleukin-12 (il-12), glucocorticoids generate a shift in adaptive immune responses from a th1 type to a th2 type. furthermore, these drugs may amplify delayed - type hypersensitivity. the regulation of several aspects of immune - cell function is also pertinent to the cutaneous function of glucocorticoids, conferring an additional benefit in treatment of dermal diseases. in addition to inhibiting humoral factors involved in the inflammatory response and the leukocyte migration to sites of inflammation, glucocorticoids interfere with the function of endothelial cells, granulocytes, and fibroblasts. therefore, glucocorticoids commonly repress maturation, differentiation, and proliferation of all immune cells, including dcs and macrophages. suppressing dendritic cells and macrophages, and consequently the production of t helper 1-cell - inducing cytokine interleukin-12 (il-12), glucocorticoids generate a shift in adaptive immune responses from a th1 type to a th2 type. furthermore, these drugs may amplify delayed - type hypersensitivity. considering the broad array of interactions between glucocorticoids and specific and nonspecific molecular targets within the cell (figure 3), it is expectable that prescribing corticosteroids may produce a wide range of undesirable adverse effects. this has led, in fact, to a steroid phobia among patients. the adverse effects of glucocorticoids tend to be more severe with systemic rather than with topical treatment. nevertheless, glucocorticoid topical therapy for cutaneous and pulmonary (nasal administration) diseases is known to be associated with systemic adverse reactions [52, 53 ]. the impaired barrier function in psoriatic skin facilitates the cutaneous penetration of the topical corticosteroid independently from its potency. the concomitant vasodilatation in psoriatic vessels increases the possibility of topical corticosteroids to reach the systemic vessels. a large extent of body surface and long - term use of topical corticosteroids may conduct to a higher concentration of corticosteroids in the blood, leading to systemic side effects. the risk of systemic side effects associated with chronic topical corticosteroid use increases with high - potency formulations. as anti - inflammation is one of the main goals in the treatment of psoriasis, it should be noted that the lack of immune function, a state of immunosuppression, brings about opportunistic infections that the human organism would otherwise efficiently deal with. among these, there are infections caused by candida spp., or reinfections caused by previously latent virus, like cytomegalovirus. overt cataract and glaucoma may also develop [55, 56 ], due to the effects that glucocorticoids have on the endocrine and cardiovascular systems. exogenous corticosteroids are not inactivated by 11-hydroxysteroid dehydrogenase, so they actually activate the mineralocorticoid receptor allowing enacs to increase serum na levels and causing hypertension. other glucocorticoids cardiovascular adverse effects include a hypercoagulability state and dyslipidemia [58, 59 ]. the correlation with the glucose metabolism is notorious, since glucocorticoids may aggravate previous diabetes mellitus. indeed, the united states of america 's national health and wellness survey (nhws) identified psoriasis to be associated with cardiovascular risk factors such as hypertension, hypercholesterolemia, and diabetes. glucose-6-phosphatase, a key enzyme in the gluconeogenesis pathway, is encoded by the g6pase gene. the g6pase gene promoter includes a glucocorticoid - responsive element (gre), this way augmenting the gluconeogenesis rate after glucocorticoid receptor activation. high levels of glucocorticoids in the bloodstream imbalance the hypothalamus - pituitary - adrenal axis equilibrium and suppress the acth levels, as a result of a negative regulatory effect on acth release. it leads to adrenal cortex atrophy and, thereafter, to complications like hypogonadism, inhibition of growth, or osteoporosis. the pathophysiology underlying osseous degradation is related to the upregulation of the receptor activator of nuclear factor kappa - b ligand (rankl) mrna by glucocorticoids, helping osteoclasts to differentiate and therefore degrading bone. on the other hand, it was found that proteolysis is augmented in myocytes, due to a glucocorticoid - mediated increase in the transcription of genes - encoding proteins linked to the ubiquitin - proteasome pathway. the very first contact that the patient has with topical corticosteroids is mostly through skin. although corticosteroids help mitigate psoriatic lesions, cutaneous side effects are numerous and not rare. hypertrichosis, steroid acne, perioral dermatitis, erythema, and telangiectasia may also occur. erythema and telangiectasia together with skin atrophy may lead to permanent rubeosis steroidica (figure 4). glucocorticoids - mediated skin atrophy involves thinning of the epidermis and dermis (and even hypodermis), resulting in increased water permeability and, thus, in increased transepidermal water loss [66, 67 ]. transforming growth factor (tgf-) is a signaling molecule that, among other actions, promotes production of collagen, using smad proteins as second messengers. activated gr negatively regulates smad3 through a protein - protein interaction, in this way, blocking expression of the col1a2 gene, which encodes a type i collagen chain. coincidentally, tgf- plays a central role in the epithelial - to - mesenchymal transition (emt), an essential mechanism for cicatrization [7173 ]. furthermore, glucocorticoids reduce collagenases, which are part of the matrix metalloproteinases (mmps) and tissue inhibitors of the metalloproteinases timp-1 and timp-2. striae formation, which occurs in hypercortisolism and may occur after long - term topical treatment with glucocorticoids, may be explained by the skin tensile strength determined by type i and type iii collagens [7477 ]. the thinning of epidermis caused by glucocorticoids ' long - term topical treatment appears also to be related with the repression of k5k14 keratin genes, which are markers of the basal keratinocytes. additionally, these drugs inhibit k6k16 keratin genes, markers of activated keratinocytes, therefore promoting impaired wound healing. special attention should be paid when applying topical corticosteroids in the presence of an infection, as there is a risk of exacerbation. topical corticosteroids can inhibit the skin 's ability to fight against bacterial or fungal infections. a common example of this inhibition is seen when a topical steroid is applied to an itchy groin rash. if this is a fungal infection, the rash gets redder, itchier, and spreads more extensively than a normal mycosis. the result is a tinea incognito, a rash with bizarre pattern of widespread inflammation. glucocorticoids ' adverse effects are an obstacle to psoriasis treatment. abolishing these reactions and at the same time maintaining glucocorticoids efficacy selective glucocorticoid receptor agonists (segras or, alternatively, dissociating glucocorticoids), nitrosteroids, and liposomal glucocorticoids are under development. to this date the type of psoriasis and drug metabolism in the skin are the main factors that influence bioavailability of topical corticosteroids. alterations in the epidermal permeability barrier may contribute to psoriasis, as evidenced by the enhanced transepidermal water loss. recently, an association between the gene of psoriasis and variations in the late cornified envelope gene loci has been confirmed, establishing a relation between an alteration of the permeability in the epidermis and the pathogenesis of the disease. there is also the 500 dalton rule for the skin penetration of chemical compounds and drugs, which states that molecules above that weight are not capable of crossing the stratum corneum. for instance, topical tacrolimus (802 da) is not effective in chronic plaque - type psoriasis but it is useful in psoriasis in the face or intertriginous areas, in pustular psoriasis, and when combined with descaling agents [8386 ]. skin acts as a barrier due to its physicochemical properties and to the enzymes present in the keratinocytes (cytochrome p450 enzymes), which inactivate some topical corticosteroids and metabolize others in more active substances. corticosteroids are lipophilic and readily migrate through the cell membrane to bind the corticoid receptor thus forming dimers, which then migrate to the cell nucleus inducing the therapeutic effect by regulating gene expression. fluticasone propionate and methylprednisolone aceponate are very lipophilic, and due to that they have an increased bioavailability ; but while the first one is hydrolyzed in an inactive substance, the last one is hydrolyzed by cutaneous esterase 's in a more active metabolite. one of the most important points to achieve the success in treatment is to choose the best corticosteroid formulation according to each patient. there is an array of manufactured vehicles including creams, ointments, lotions, foams, oils, gels, solutions, drops, shampoos, sprays, and tape ; the efficacy rates between them are roughly comparable. for example, scalp, foams, gels, or sprays may be more easy to apply, and so, a better result is expected. the vehicle has a therapeutic effect ; scalp lipogel without active ingredients showed response rates of over 20% in scalp psoriasis. also a 15%47% response to placebo was described with emollients in psoriatic patients, but it is already known that hydration improves signs and symptoms of psoriasis [6, 21 ]. ointments are composed by more than 70%, of lipids, lipid - rich creams by 70% and creams only 15% to 25%. in contrast to what was assumed, a recent study with betamethasone with a low - lipid content formulation showed a higher efficiency than high - lipid concentrated creams and ointments, confirming the need of tailor therapies to individual patients and the impact of bioavailability of specific components of the vehicles. we can add specific ingredients to increase bioavailability ; for instance, propylene glycol is a percutaneous absorption enhancer of hydrocortisone. the volume of the prescription should be planned considering the frequency and the effective dose ; the fingertip unit is used as a pattern for the topical agent required. dressings are also used, enhancing the drug delivery, and this choice depends on local availability and patient preference. when applied in a higher concentration, or multiple times a day, the levels of a corticoid (triamcinolone acetonide) in the stratum corneum of the skin, after 24 h topical treatments in psoriasis should be specific to each topographic region, and steroids are absorbed at different rates in different parts of the body as follows : eyelids and genitals absorb 30%;face absorbs 7%;armpit absorbs 4%;forearm absorbs 1%;palm absorbs 0,1%;sole absorbs 0,05%. eyelids and genitals absorb 30% ; vitamin d analogues and low - potency steroids in a cream base are indicated for psoriasis of the face or flexures. the scalp skin has very specific properties, it is covered by hair and sebaceous glands are abundant ; therefore, a large proportion of the drug applied is wasted and adhered to the hair not having contact with the scalp. new vehicles are proposed to improve the treatment of scalp psoriasis such as calcipotriol - betamethasone dipropionate scalp lipogel, clobetasol propionate and betamethasone valerate foam, clobetasol propionate shampoo, and clobetasol propionate 0.05% spray. combined treatments with different biological targets are already accepted, usually having an additive or synergistic effect. these treatments act by adding the effects on different targets (t - cell functions, innate immunity, epidermal differentiation, and proliferation), reducing the side effects and managing recalcitrant lesions. combination therapy has emerged with the development of new noncorticosteroid preparations, but before the merge we have to make sure that the two combinations are compatible, synergistic, and safe. as an example, calcipotriol is just compatible with tar gel and halobetasol propionate preparations and it has a superior effect when combined with halobetasol ointment. also ammonium lactate is compatible with hydrocortisone valerate and halobetasol propionate, and it has been shown to protect against skin atrophy [10, 99 ]. salicylic acid, vitamin d analogues and retinoids, with different mechanisms of action, are usually combined with topical corticosteroids. concerning polytherapy versus fixed - dose combinations, the last one requires less frequent applications and has a higher adherence from the patients. these agents were found in the sequence of the discovery that oral vitamin d had a therapeutic effect on psoriatic plaques. while vitamin d has mainly antiproliferative (epidermal) effects, corticosteroids have mainly anti - inflammatory (dermal) effects. the vitamin d analogues correct epidermal hyperproliferation, abnormal angiogenesis, and keratinization and induces apoptosis in inflammatory cells by acting through vitamin d receptors present on keratinocytes and lymphocytes. they also modulate the decrease of il-1 and il-6 levels, the reducing of cd45ro and c8 t cells. vitamin d analogues and corticosteroids are the combining topical agents of choice in psoriasis showing a superior efficacy when compared with monotherapy. the most common side effects are skin irritation, dryness, peeling, erythema, and edema, which can occur in up to 35% of the patients. adverse effects will diminish along the time. at the moment, three vitamin d analogues are approved for the treatment of psoriasis : calcitriol, calcipotriol, and tacalcitol. the corticosteroids effects can be diminished by administrating calcipotriol 0.03% once daily in the morning plus betamethasone valerate once daily in the evening. calcipotriol is the vitamin d analogue most widely accepted for the combination therapy with corticosteroids, although not all corticosteroids can be mixed with calcipotriol due to incompatibilities. a combined ointment with calcipotriol and betamethasone dipropionate is already being used and showing good results, giving to the patient 's skin stability and optimal delivery of both substances. cutaneous atrophy caused by this ointment is similar to the corticosteroid alone during a 4-week treatment period [104, 105 ]. recent data says that the combination has proved to be superior in efficacy than the individual components alone. this combination of calcipotriol and betamethasone dipropionate is approved for use in trunk and extremities, but it is not recommended for face, intertriginous areas, and scalp. although this combination has now been developed as an oily lipogel indicated for scalp psoriasis, showing the same efficacy, safety, and tolerability as the ointment [91, 107 ]. salicylic acid is a topical keratolytic used in the treatment of a variety of papulosquamous lesions such as psoriasis. its mechanism of action is still unclear, but it is believed to act by inducing disruption of keratinocyte - keratinocyte binding and softening of the stratum corneum by decreasing its ph. salicylic acid has a filtering effect reducing the efficacy of uvb therapy, so it should not be applied before treatment. usually, salicylic acid is safe ; however, with long - term use in large skin areas, systemic salicylic acid toxicity can occur. studies with tritiated triamcinolone acetonide, desoximetasone, and hydrocortisone 17-valerate showed that salicylic acid enhance the efficacy of these corticosteroids by increasing their penetration in skin. this faster penetration of corticosteroids in skin does not occur when mixed with other ingredients such as camphor, menthol, phenol, or urea. fixed - dose combinations such as salicylic acid and betamethasone propionate or salicylic acid with diflucortolone are already available in some countries and they show similar efficacy. they both appear to be efficacious and well tolerated during short - term period treatment of plaque psoriasis and their use is recommended for limited areas of skin : for thick, scaly, and psoriatic plaques. tazarotene was the first topic retinoid found to be effective for mild - to - moderate psoriasis and it is available in cream or gel form. tazarotene is a retinoid derivate which binds the retinoic acid receptor (rar) in a class - specific manner, preferentially binding rar- and rar- than rar-. this regulation of transcription result in reduced keratinocyte proliferation, normalized keratinocyte differentiation, and decreased inflammation. its protective role against cutaneous atrophy from corticosteroid induction, may be important already shown by the retinoid tretinoin. this retinoid may cause skin irritation in up to 30% of users, and this irritation was more pronounced in patients receiving tazarotene plus corticosteroids than in those receiving calcipotriol. retinoids may reduce uvb tolerance, and tazarotene has proven to be more efficacious than uvb alone. as the systemic retinoids, although tazarotene showed to be chemically compatible with a number of topical corticosteroids, no experiment testing over two weeks of treatment has been performed. taking into account one of the most important features of psoriasis, its chronic nature, the therapeutic approach should be prolonged, which makes it challenging to use high - potency topical corticosteroids safely in long - term management of the disease [3, 11 ]. therefore, therapy should be monitored by a competent healthcare professional to limit the risk of cutaneous or systemic side effects, and some general principles should be followed to minimize these effects (figure 5). the untoward effects of topical corticosteroids have been well documented and can be widely categorized as local (atrophy, telangiectasia, striae distensae, folliculitis, acne, and purpura) or systemic (hypertension, osteoporosis, cushing 's syndrome, cataracts, glaucoma, diabetes, and avascular necrosis of the femoral head or humeral head) [3, 11 ]. in order to reduce side effects for long - term use of topical corticosteroids, a number of new therapy regimens have been studied. one of them is weekend or pulse therapy where three consecutive doses of corticosteroids at 12 h intervals are given on the weekends, following a successful initial cleared or almost cleared therapeutic response to daily potent topical corticosteroids application [115, 116 ]. the combination of topical corticosteroids with other topical anti - inflammatory agents, as steroid - sparing therapies, can result in an improvement of efficacy with less side effects. sequential therapy with higher - potency corticosteroids in combination with a vitamin d analogue such as calcipotriene can increase short - term efficacy and decrease side effects in long - term treatment. another successful combination is topical corticosteroids and tazarotene, which has improved efficacy compared to tazarotene therapy alone [114, 118, 119 ]. whilst corticosteroids maximize efficacy and minimize toxicity of tazarotene, this drug reduces the development of corticosteroid - induced cutaneous atrophy. salicylic acid can also be applied in combination with mild - potency corticosteroids increasing the skin penetration. besides the combination with other topical agents, corticosteroids are often used in combination with uvb phototherapy, traditional systemic agents (acitretin, cyclosporine, and methotrexate), and biological agents. the topical corticosteroid recommendations suggest, for the most corticosteroids, 60 g, as a maximum dosage per week, and for some superpotent corticosteroids 50 g per week. however, there are particularly cases in which patients need to exceed what the package insert recommends, and in those circumstances the possibility of systemic absorption must be considered. for thick areas that are more resistant to steroid side effects such as the palms and soles, limited occlusion may be necessary and would require close followup, but for more prone areas such as the axillae, groin, and face, occlusion is more probable to result in adverse effects. children are more susceptible to systemic side effects, like hypothalamic - pituitary - adrenal axis suppression, compared with adult patients, owing to their greater body surface area - to - weight ratio. accordingly, lower - potency corticosteroids are frequently applied in infants and children [3, 11, 120 ]. the face and the intertriginous areas are particularly sensitive to untoward effects. for that reason, the protracted use of corticosteroids, even with lower potency, can be associated with telangiectasia on the face and formation of striae on intertriginous sites such as the groin, axillae, or under the breasts. even though safety of topical corticosteroids and other topical treatments has been recently reviewed, additional studies of topical corticosteroids are imperative. mild - to - moderate psoriasis can be controlled with topical therapy ; however, topical therapy should be administrated with adjunctive therapy in severe and extended psoriasis. glucocorticoid research is an ongoing process with the development of hyperselective therapeutic agents acting at different stages of the psoriasis inflammatory response. one of the most desired targets of the new drugs is to induce selective transrepression. after corrected and sustained use of topical steroids, the capillaries in the dermis do not constrict as well as before, requiring higher doses or more frequent applications of steroids to achieve the former results. the ability of the blood vessels to constrict as before eventually returns to normal after stopping therapy. the common and known clinical perception of tachyphylaxis may also be significantly related to issues of compliance outside the study group, or to vessels flare unrelated to therapy. du vivier and stoughton, in 1975, were the first describing the persistence and recurrence of psoriasis in patients who were previously treated with topical corticosteroids with a successful result. the question remains if this is a truly clinical entity or if it is just due to a nonadherence to the topical regimen. rebound caused by abruptly withdrawal, or ending of steroid therapy by the individual him / herself, can result in sudden worsening of psoriasis. furthermore, the psoriasis may return more aggressively. a localized or a mild form of psoriasis may become generalized, or a generalized form can be precipitated as pustular or erythrodermic form, when patients do not wean gradually off of corticosteroids. the treatment should be tailored in an individual manner, prescribing to each patient the most suitable vehicle. despite ointments being clinically more effective in psoriasis symptoms, what really matters is the desire of the patient, and the way he / she adheres to the topical treatment better to a different vehicle, some will prefer ointments, others gel or spray, and others will prefer occlusion therapy. tight supervision during the treatment with topical corticosteroids by giving support and answers to patient concerns must be provided, and this can make the difference between a successful treatment and a worsening of the disease. | psoriasis is a lifelong, chronic, and immune - mediated systemic disease, which affects approximately 13% of the caucasian population. the different presentations of psoriasis require different approaches to treatment and appropriate prescriptions according to disease severity. the use of topical therapy remains a key component of the management of almost all psoriasis patients, and while mild disease is commonly treated only with topical agents, the use of topical therapy as adjuvant therapy in moderate - to - severe disease may also be helpful. this paper focuses on the cutaneous mechanisms of action of corticosteroids and on the currently available topical treatments, taking into account adverse effects, bioavailability, new combination treatments, and strategies to improve the safety of corticosteroids. it is established that the treatment choice should be tailored to match the individual patient 's needs and his / her expectations, prescribing to each patient the most suitable vehicle. |
we describe the lymphoscintigraphy findings of a 25-year - old female patient who was undergoing presurgical workup for lymphangiomas of the vulva. she had a history of treatment for disseminated tuberculosis 6 years back and presented with herpetiform oozing vesicles in the external genitalia. single - photon emission computed tomography / computed tomography (spect / ct) confirmed cutaneous tracer accumulation in the vulval lesions and demonstrated the presence of densely calcified inguinal nodes secondary to healed tuberculosis as the etiology of secondary lymphangioma. |
|
urologists have traditionally received their surgical training through the halstedian apprenticeship model of see one, do one, teach one. despite the original success of this model, it relied heavily upon the accumulation of considerable operating experience gathered during several years of demanding training. over the last few decades, there has been a significant increase in the number of minimally invasive urological procedures. as these complex operations often possess steep learning curves, it is of some concern that trainee operating exposure has recently been limited by the introduction of initiatives such as the european working time directive. furthermore, with a growing debate about whether it is safe and/or ethical to train on patients, there is a clear need for change to traditional surgical education. simulation is an appealing tool for modern urology training, allowing trainees to repeatedly practice a procedure, as a result bypassing the early, error - prone phase of the learning curve in an environment which does not jeopardize patient safety. furthermore, with high fidelity simulators, it is possible to also teach non - technical skills, such as leadership, communication and teamwork which complement technical urological skills. this article will review the current role of urological simulators by discussing how they can best be incorporated into training programs, by assessing the availability and validity of current models and by considering what current challenges and limitations they face. the author performed a thorough literature review of the electronic databases medline, embase and google scholar. it is important to stress that simulation is an adjunct rather than a replacement of clinical training. to fully exploit the benefit of simulation simulation thus becomes a safe means to maximize the effectiveness of training in the restricted number of hours possible. an optimal simulation program would involve trainees receiving repeated exposure to the simulator over an extended period of time. it is vital that the student receives feedback on their performance, enabling them to target their learning appropriately. trainees can often start with low fidelity simulators to grasp basic surgical skills before moving onto full - procedural simulations as they progress through their training. in the uk, trainees can now log simulator experience into the intercollegiate surgical curriculum program logbook. furthermore, the feasibility and acceptability of a centrally - coordinated simulation - based urology training program named simulate has been determined, describing a potential way in which to deliver technical and non - technical skills in a structured manner. for the endourological procedures of cystoscopy and ureterorenoscopy, numerous high - fidelity bench - top models and virtual reality (vr) simulators have been created. high - fidelity simulators, such as the uro - scopic trainer (limbs and things, uk), consist of physical mannequins and allow trainees to practice using the standard operating instruments. brehmer and swartz found that repeated training on a bench - top simulator for semi - rigid ureteroscopy significantly improved resident performance and made trainees feel more comfortable with the instruments and procedures. other studies have confirmed the face, content and construct validity of numerous high fidelity ureterorenoscopy and cystoscopy simulators. virtual reality trainers, such as the uro - mentor (simbionix, usa), simulate surgical procedures through interactions with computer interfaces. demonstrated that repeated exposure of novices to the uro - mentor simulator (for flexible cystoscopy) produced encouraging results ; global rating scale score and time for procedure completion improved, with a decrease in the amount of trauma caused. additionally, good construct validity was noted. an essential factor in determining the usefulness of simulation as an educational tool is whether the skills learnt from simulation are actually transferable to the clinical setting. in a randomised controlled trial, schout. showed that trainees who received cysto - urethroscopy training on the uro - mentor vr performed significantly better than those with no vr training when performing cysto - urethroscopy on real patients. when comparing simulators, chou. showed that there was no significant difference in ureteroscopy performance (on a porcine model) between medical students trained on the uro - mentor vr simulator compared to a high fidelity model. interestingly, some authors have queried whether these highly - technical expensive models are necessary. matsumoto. showed that whilst simulation improves endourological performance, there was no significant difference between the groups that trained with a low fidelity model which cost 14 compared to the high fidelity model costing 2600. turp is a commonly performed, but challenging procedure. as errors during this procedure can cause serious complications, it is concerning that the mean number of turps completed by residents over the course of their training was halved from 120 to 60 between the time period of 1990 and 2000. as a result bright. demonstrated the face and construct validity of the turpsim vr simulator (simbionix, usa) with novices improving turp performance upon repeated training, but experts still performing significantly better. kllstrm. showed that following training on the pelvicvision turp vr simulator (meleritmedical ab), trainees performed significantly better turp on patients, with a 65% increase in the number of residents able to perform a turp. aydin. recently confirmed the construct validity of the greenlight simulator (american medical systems inc, usa) for photoselective vaporization of the prostate. likewise, the face and content validity for a new holmium laser enucleation of the prostate (holep) simulator has been determined, with 84% of the participants believing that the simulator would be useful for training. it has been reported that during percutaneous nephrolithotomy, as few as 11% of urologists routinely obtain percutaneous renal access without the aid of a radiologist. therefore, as trainees may not receive training from their seniors on how to achieve access, simulation could potentially enhance training in this area. mishra. proved the validity of the perc mentor vr renal access simulator (mentor graphics, usa). they found that while experts were faster and more efficient at gaining access on the simulator, novices improved their performance over the course of training for numerous metrics, such as fluoroscopy time. furthermore, they then compared the abilities of five novices to attain renal access in a pig before and after training on the vr simulator. whereas only one of the pre - trained group achieved access, all five did so safely after training, thus confirming predictive validity. an inexpensive, fluoro - less, physical c - arm trainer (simportal) has also been described, but awaits validation. as laparoscopic procedures become more common in urology, a variety of simulators have been developed. while the training of general laparoscopic skills on low - fidelity box trainers may improve performance of individual skills such as suturing time, studies suggest that it has limited impact on the overall operative performance of trainees during in vivo laparoscopic nephrectomy. brewin. confirmed the validity of the first vr laparoscopic nephrectomy simulator with experts rating it to be a useful training tool with above average realism. with repetition, trainees improved their overall simulator performance, with faster, more efficient and safer task execution. given the increasing adoption of complex robotic - assisted urological procedures with steep learning curves, the role of simulation to train qualified and trainee urologists in these skills is sure to play a big part in the future of urological simulation. cho. demonstrated that virtual reality simulation with the dv - trainer (mimic technologies, inc., seattle, wa) improved surgeon performance on the da vinci surgical system (intuitive surgical, inc., it is now apparent that for a positive patient outcome in urological surgery, technical surgical ability must be complemented by excellent, non - technical skills such as decision making, teamwork and communication. non - technical skills can be improved by simulation in mock operating theatres with full - participation from the entire surgical, anaesthetic and nursing teams. between 94 - 100% of trainees noted this type of high fidelity simulation to be useful for developing communication skills. interestingly, non - technical skills have not been found to necessarily correlate with experience, suggesting that more advanced trainees may also benefit from training upon these simulators. structured, simulation - based curricula, incorporating both technical and non - technical skills has been shown to be feasible and effective for teaching ureteroscopy to trainees. life - threatening emergency situations can also be simulated with studies demonstrating a significant reduction in the time taken to initiate resuscitation protocols. one consideration tutors need to consider is that simulation can be resource demanding, with a need for faculty, equipment and a location to be provided. another consideration is that there is no agreed consensus on how to validate simulation tools, with different investigators adopting different approaches. given the difficult, expensive and potential ethical challenges of conducting randomised trials to determine whether specific simulators actually improve the operating performance of trainees, educators often have to select simulators based on their own judgement. more work is needed to compare different simulators and to identify which ones are more effective at training students. for example, the learning curve for prostate cancer recurrence after radical prostatectomy does not plateau until approximately 250 procedures have been performed. therefore, it is important to appreciate that simulation training alone will not be sufficient for trainees to bypass this curve and to meet the requirements for certification at the end of training. rather, simulation should complement other essential components of urology training programs such as participation in mentorship schemes and clinical fellowships, which also aid progression along the learning curve. urology trainees consistently claim clinical fellowships to be a necessary undertaking in order to achieve clinical competence. fellowships help trainees to improve both procedural confidence and competence, while also allowing the development of super - specialist skills. indeed, 5-day mini fellowship programs are effective at teaching urologists new procedures such as robot - assisted laparoscopic prostatectomy, with skills learnt retained in both the short and long - term. indeed, fellowships undertaken at high - volume centers of excellence are useful to ensure trainees accumulate an adequate procedural caseload necessary to develop the surgical skills essential for a positive surgical outcome [40, 41 ]. it is important to stress that simulation is an adjunct rather than a replacement of clinical training. to fully exploit the benefit of simulation simulation thus becomes a safe means to maximize the effectiveness of training in the restricted number of hours possible. an optimal simulation program would involve trainees receiving repeated exposure to the simulator over an extended period of time. it is vital that the student receives feedback on their performance, enabling them to target their learning appropriately. trainees can often start with low fidelity simulators to grasp basic surgical skills before moving onto full - procedural simulations as they progress through their training. in the uk, trainees can now log simulator experience into the intercollegiate surgical curriculum program logbook. furthermore, the feasibility and acceptability of a centrally - coordinated simulation - based urology training program named simulate has been determined, describing a potential way in which to deliver technical and non - technical skills in a structured manner. for the endourological procedures of cystoscopy and ureterorenoscopy, numerous high - fidelity bench - top models and virtual reality (vr) simulators have been created. high - fidelity simulators, such as the uro - scopic trainer (limbs and things, uk), consist of physical mannequins and allow trainees to practice using the standard operating instruments. brehmer and swartz found that repeated training on a bench - top simulator for semi - rigid ureteroscopy significantly improved resident performance and made trainees feel more comfortable with the instruments and procedures. other studies have confirmed the face, content and construct validity of numerous high fidelity ureterorenoscopy and cystoscopy simulators. virtual reality trainers, such as the uro - mentor (simbionix, usa), simulate surgical procedures through interactions with computer interfaces. demonstrated that repeated exposure of novices to the uro - mentor simulator (for flexible cystoscopy) produced encouraging results ; global rating scale score and time for procedure completion improved, with a decrease in the amount of trauma caused. additionally, good construct validity was noted. an essential factor in determining the usefulness of simulation as an educational tool is whether the skills learnt from simulation are actually transferable to the clinical setting. in a randomised controlled trial, schout. showed that trainees who received cysto - urethroscopy training on the uro - mentor vr performed significantly better than those with no vr training when performing cysto - urethroscopy on real patients. when comparing simulators, chou. showed that there was no significant difference in ureteroscopy performance (on a porcine model) between medical students trained on the uro - mentor vr simulator compared to a high fidelity model. interestingly, some authors have queried whether these highly - technical expensive models are necessary. matsumoto. showed that whilst simulation improves endourological performance, there was no significant difference between the groups that trained with a low fidelity model which cost 14 compared to the high fidelity model costing 2600. turp is a commonly performed, but challenging procedure. as errors during this procedure can cause serious complications, it is concerning that the mean number of turps completed by residents over the course of their training was halved from 120 to 60 between the time period of 1990 and 2000. as a result bright. demonstrated the face and construct validity of the turpsim vr simulator (simbionix, usa) with novices improving turp performance upon repeated training, but experts still performing significantly better. kllstrm. showed that following training on the pelvicvision turp vr simulator (meleritmedical ab), trainees performed significantly better turp on patients, with a 65% increase in the number of residents able to perform a turp. aydin. recently confirmed the construct validity of the greenlight simulator (american medical systems inc, usa) for photoselective vaporization of the prostate. likewise, the face and content validity for a new holmium laser enucleation of the prostate (holep) simulator has been determined, with 84% of the participants believing that the simulator would be useful for training. it has been reported that during percutaneous nephrolithotomy, as few as 11% of urologists routinely obtain percutaneous renal access without the aid of a radiologist. therefore, as trainees may not receive training from their seniors on how to achieve access, simulation could potentially enhance training in this area. mishra. proved the validity of the perc mentor vr renal access simulator (mentor graphics, usa). they found that while experts were faster and more efficient at gaining access on the simulator, novices improved their performance over the course of training for numerous metrics, such as fluoroscopy time. furthermore, they then compared the abilities of five novices to attain renal access in a pig before and after training on the vr simulator. whereas only one of the pre - trained group achieved access, all five did so safely after training, thus confirming predictive validity. an inexpensive, fluoro - less, physical c - arm trainer (simportal) has also been described, but awaits validation. as laparoscopic procedures become more common in urology, a variety of simulators have been developed. while the training of general laparoscopic skills on low - fidelity box trainers may improve performance of individual skills such as suturing time, studies suggest that it has limited impact on the overall operative performance of trainees during in vivo laparoscopic nephrectomy. brewin. confirmed the validity of the first vr laparoscopic nephrectomy simulator with experts rating it to be a useful training tool with above average realism. with repetition, trainees improved their overall simulator performance, with faster, more efficient and safer task execution. given the increasing adoption of complex robotic - assisted urological procedures with steep learning curves, the role of simulation to train qualified and trainee urologists in these skills is sure to play a big part in the future of urological simulation. cho. demonstrated that virtual reality simulation with the dv - trainer (mimic technologies, inc., seattle, wa) improved surgeon performance on the da vinci surgical system (intuitive surgical, inc., it is now apparent that for a positive patient outcome in urological surgery, technical surgical ability must be complemented by excellent, non - technical skills such as decision making, teamwork and communication. non - technical skills can be improved by simulation in mock operating theatres with full - participation from the entire surgical, anaesthetic and nursing teams. between 94 - 100% of trainees noted this type of high fidelity simulation to be useful for developing communication skills. interestingly, non - technical skills have not been found to necessarily correlate with experience, suggesting that more advanced trainees may also benefit from training upon these simulators. structured, simulation - based curricula, incorporating both technical and non - technical skills has been shown to be feasible and effective for teaching ureteroscopy to trainees. life - threatening emergency situations can also be simulated with studies demonstrating a significant reduction in the time taken to initiate resuscitation protocols. one consideration tutors need to consider is that simulation can be resource demanding, with a need for faculty, equipment and a location to be provided. another consideration is that there is no agreed consensus on how to validate simulation tools, with different investigators adopting different approaches. given the difficult, expensive and potential ethical challenges of conducting randomised trials to determine whether specific simulators actually improve the operating performance of trainees, educators often have to select simulators based on their own judgement. more work is needed to compare different simulators and to identify which ones are more effective at training students. for example, the learning curve for prostate cancer recurrence after radical prostatectomy does not plateau until approximately 250 procedures have been performed. therefore, it is important to appreciate that simulation training alone will not be sufficient for trainees to bypass this curve and to meet the requirements for certification at the end of training. rather, simulation should complement other essential components of urology training programs such as participation in mentorship schemes and clinical fellowships, which also aid progression along the learning curve. urology trainees consistently claim clinical fellowships to be a necessary undertaking in order to achieve clinical competence. fellowships help trainees to improve both procedural confidence and competence, while also allowing the development of super - specialist skills. indeed, 5-day mini fellowship programs are effective at teaching urologists new procedures such as robot - assisted laparoscopic prostatectomy, with skills learnt retained in both the short and long - term. indeed, fellowships undertaken at high - volume centers of excellence are useful to ensure trainees accumulate an adequate procedural caseload necessary to develop the surgical skills essential for a positive surgical outcome [40, 41 ]. to conclude, there are numerous simulators available to teach both technical and non - technical urological skills. despite the need for more validation and comparative studies, evidence suggests that these simulators help trainees to bypass the early steps of the learning curve. in order to maximize the efficiency of these simulators, they should be incorporated within proficiency - based curricula alongside other initiatives such as clinical fellowships. by deepening the understanding of how simulation improves trainee performance, we can be sure to optimize the training for urology trainees in an increasingly restrictive educational environment. | introductionsimulation is becoming an increasingly popular educational tool in numerous surgical specialities, including urology. this article reviews the current role of urological simulators ; discussing their need, availability, incorporation and current limitations.material and methodsa literature review of the electronic databases medline, embase and google scholar was performed.resultsfor increasingly limited urological training programs, simulation can act as a valuable adjunct to clinical training. evidence suggests that simulation enables the trainee to bypass the early, error - prone part of the surgical learning curve. it should be incorporated into proficiency - based curricula, with junior trainees initially beginning with low fidelity simulators to grasp basic surgical skills before moving onto full - procedural simulation as they progress through their training. a wide variety of simulators of differing fidelity are currently available, teaching both technical (eg. cystoscopy) and non - technical (eg. communication) urological surgical skills. whist numerous studies have assessed the face, content and construct validity of various urological simulators, further work needs to be undertaken to determine whether the skills learnt actually improve trainee performance in the operating room. then, educators will be able to make informed decisions about whether these resource demanding (financially and in terms of demands on faculty) simulators are a worthwhile educational tool.conclusionsalthough further investigation is required, urological simulators appear to have a considerable role for developing both technical and non - technical urological skills in an increasingly restricted educational environment in modern urogynecology. |
we investigated four single nucleotide polymorphisms in the gene - encoding angiotensin converting enzyme 2 (ace2), a gene on the x - chromosome whose raas product modulates cardiac structure and function, for association with hypertrophic traits in 227 individuals belonging to 22 hcm families with known founder disease - causing mutations. after adjustment for hypertrophy - influencing factors, including the particular disease - causing mutation, we find association between the g - allele of rs879922 and increased left ventricular mass (effect size : 18.7 g), maximum interventricular septal thickness (effect size : 1.9 mm) as well as maximum posterior wall thickness (effect size : 0.7 mm). these data demonstrate that ace2 plays a role in modifying the extent of hypertrophy that develops in hcm, independent of the effect of the disease - causing mutation or blood pressure. hypertrophic cardiomyopathy (hcm ; omim # 192600) is a primary cardiac muscle disorder classically caused by mutations (> 400) in genes encoding components of the thick and thin filaments of the cardiac sarcomere (http://genetics.med.harvard.edu/~seidman/cg3/index.html). extreme variability of the hypertrophic phenotype is a hallmark feature of hcm and has been attributed in part to allelic effects of the disease - causing gene. evidence from human and transgenic animal studies indicates that the degree of hypertrophy that develops in response to the causal mutation is modified by environmental factors (including demographic factors such as age, sex and body size), as well as by other genetic factors (semsarian. genes within the renin - angiotensin - aldosterone system (raas) have been investigated as modifiers of the hypertrophic variability in hcm in recent years (marian 2002 ; ortlepp. 2002), and much emphasis has been placed on the possible role of the angiotensin - converting - enzyme (ace) i in the development of hypertrophy. however, subsequently, a second ace, aceii, has been discovered and its product, viz. angiotensin-(1 - 7), has been found to antagonize the vasoconstriction mediated by its substrate, angiotensin ii. lieb. found that minor alleles of four single nucleotide polymorphisms (snps) in the x - chromosomally located aceii gene (ace2) were associated with increases in hypertrophic parameters, viz. left ventricular mass indexed to body size (lvmi), as well as end - diastolic interventricular septal wall thickness (ivs) in males, but not in females (lieb.. also reported that minor alleles of other snps in ace2 were again associated with increased ivs in male but not female hcm patients (wang., it is possible that the effect of the unknown hcm - causing mutations in the case cohort could confound the results. hence, we aimed to investigate the role of ace2 variants in the extent of hypertrophy that develops in genotype - known hcm patients belonging to families in which any of three south african hcm founder mutations segregate. the study was approved by the university of stellenbosch health sciences faculty s institutional review board (n04/03/062). twenty - two consecutively referred index cases bearing one of the previously reported south african hcm - founder mutations (7 r92wtnnt2, 3 r403wmyh7 and 11 a797tmyh7) were identified and pedigree tracing was performed (revera. individuals who gave informed written consent were tested for carrier - status for each of the three founder mutations, as previously described (moolman - smook. blood pressure was taken, twice : in the sitting position, after 5 min of bed rest, and the second measurement was used. individuals were coded as hypertensive if they had systolic blood pressure 140 mm hg, or diastolic blood pressure 90, or were on anti - hypertensive medication. medical history, and demographic data (age, sex, height, weight) were recorded for each participant. we performed standard electrocardiography on a mac1200st after 5 min of rest in the supine position, and from this derived resting heart rate. echocardiography was performed anew on all participating individuals, using a standardized procedure to measure the wall thickness in 16 left ventricular wall segments, by a single experienced echocardiographer (mr) who was blinded to mutation status, according to recommendations of the american society of echocardiography (schiller. lvm was calculated using the american society of echocardiography s recommended formula for estimation of lvm from 2d - lv linear dimensions:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{lvm } } = 0.8\, \times \left ({ 1.04\left [{ \left ({ { \text{lvidd } } + { \text{pwtd } } + { \text{swtd } } } \right)^{{3 } } -\left ({ { \text{lvidd } } } \right)^{{3 } } } \right ] } \right) + 0.6\,{\text{g}}. $ $ \end{document } as the ld structure of this (and other) regions of the genome has not been reported in the study population, we relied on density selection of snps. rs1978124 (intron 1), rs2285666 (intron 3), rs879922 (intron 11) and rs4646179 (exon 16), spread through the length of ace2 at an average spacing of ~8 kb, were selected from dbsnp. these snps were chosen because they had been validated by frequency, had been found associated with cardiovascular traits in previous studies (lieb. ace2 genomic regions containing the variants of interest were pcr amplified from subjects genomic dna using standard methodology (moolman - smook. 1999) ; primers and annealing temperature used are given in table 1. variants were genotyped by allele - specific restriction enzyme digestion of the pcr amplicons and fragment sizes detected by gel electrophoresis (table 1). ten percent of samples, randomly selected for each amplicon, were nucleotide sequenced to verify genotyping results. furthermore, mendelian inheritance within families was assessed by pedstats, using x - chromosome settings, and inconsistencies were resolved by re-genotyping.table 1summary of pcr - based allele - specific restriction enzyme analysis used for genotyping of ace2 variantsvariantprimers (53)restriction enzymeamplicon size (bp)major allele sizes (bp)minor allele sizes (bp)detection methodrs1978124f : tcttcctggctccttctcagcsau96i1,044 t (1044)c (962, 82)1.5% agarose electrophoresisr : accacaatggcagagaaagggrs2285666f : gtttgtaacccagataatccalui130c (130)t (78, 52)12% pager : gttgaaacacacatatctgcrs879922f : ttgtgttaagatcttgtcccbfai188c (188)g (146, 42)12% pager : aataaactgagctccagcrs4646179f : tacagggaggaggatgtgcghpych4iv680 t (328, 229, 123)c (328, 152, 123, 77)2.5% agarose electrophoresisr : tgatggcaatacctgtccacgbp base pairs, page polyacrylamide gel electrophoresis summary of pcr - based allele - specific restriction enzyme analysis used for genotyping of ace2 variants bp base pairs, page polyacrylamide gel electrophoresis quantile normalization was used to convert each trait to approximate normality (pilia. 2006). associations of ace2 variants with heritable hypertrophy traits, viz. left ventricular mass (lvm), maximum interventricular septal thickness (maxivs) and maximum posterior wall thickness (maxpw), were assessed with specialized mixed - effects models utilizing per - individual random effects which are correlated according to kinship coefficients (r package kinship, function lmekin). furthermore, concomitant adjustment was made for factors known to influence cardiac hypertrophy, viz. age, sex, body surface area, heart rate, systolic and diastolic blood pressure, hypertension diagnosis, as well as the identity of the disease - causing mutation, by including these as covariates in the analyses. we then formally tested the interaction between sex and genotype, after modeling the genotypes as the number of minor alleles (additive term), and a dominance term, which was only non - zero for heterozygous females (cordell and clayton 2005). this model is equivalent to modeling the genotypes as categories, labeling the male genotypes differently to the female genotypes. when the interaction between sex and genotype was not statistically significant, it was discarded from the model. the dominance term was similarly discarded if not significantly different from zero. as effect sizes derived from analysis of transformed data can not be interpreted in terms of the original measurement units, we also modeled the raw data in terms of the genotypes of the associated variant rs879922, with adjustment for confounders and to obtain informative effect sizes. because there were only two gg homozygotes in the group, we combined them with the heterozygotes to estimate the effect of at least one g - allele. linkage disequilibrium between the four markers and hardy weinberg equilibrium in the study cohort was assessed by haploview vs3.32. the study was approved by the university of stellenbosch health sciences faculty s institutional review board (n04/03/062). twenty - two consecutively referred index cases bearing one of the previously reported south african hcm - founder mutations (7 r92wtnnt2, 3 r403wmyh7 and 11 a797tmyh7) were identified and pedigree tracing was performed (revera. individuals who gave informed written consent were tested for carrier - status for each of the three founder mutations, as previously described (moolman - smook. blood pressure was taken, twice : in the sitting position, after 5 min of bed rest, and the second measurement was used. individuals were coded as hypertensive if they had systolic blood pressure 140 mm hg, or diastolic blood pressure 90, or were on anti - hypertensive medication. medical history, and demographic data (age, sex, height, weight) were recorded for each participant. we performed standard electrocardiography on a mac1200st after 5 min of rest in the supine position, and from this derived resting heart rate. echocardiography was performed anew on all participating individuals, using a standardized procedure to measure the wall thickness in 16 left ventricular wall segments, by a single experienced echocardiographer (mr) who was blinded to mutation status, according to recommendations of the american society of echocardiography (schiller. lvm was calculated using the american society of echocardiography s recommended formula for estimation of lvm from 2d - lv linear dimensions:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{lvm } } = 0.8\, \times \left ({ 1.04\left [{ \left ({ { \text{lvidd } } + { \text{pwtd } } + { \text{swtd } } } \right)^{{3 } } -\left ({ { \text{lvidd } } } \right)^{{3 } } } \right ] } \right) + 0.6\,{\text{g}}. $ $ \end{document } as the ld structure of this (and other) regions of the genome has not been reported in the study population, we relied on density selection of snps. rs1978124 (intron 1), rs2285666 (intron 3), rs879922 (intron 11) and rs4646179 (exon 16), spread through the length of ace2 at an average spacing of ~8 kb, were selected from dbsnp. these snps were chosen because they had been validated by frequency, had been found associated with cardiovascular traits in previous studies (lieb. ace2 genomic regions containing the variants of interest were pcr amplified from subjects genomic dna using standard methodology (moolman - smook. variants were genotyped by allele - specific restriction enzyme digestion of the pcr amplicons and fragment sizes detected by gel electrophoresis (table 1). two independent observers, blinded to phenotypic data, performed allele - calling. ten percent of samples, randomly selected for each amplicon, were nucleotide sequenced to verify genotyping results. furthermore, mendelian inheritance within families was assessed by pedstats, using x - chromosome settings, and inconsistencies were resolved by re-genotyping.table 1summary of pcr - based allele - specific restriction enzyme analysis used for genotyping of ace2 variantsvariantprimers (53)restriction enzymeamplicon size (bp)major allele sizes (bp)minor allele sizes (bp)detection methodrs1978124f : tcttcctggctccttctcagcsau96i1,044 t (1044)c (962, 82)1.5% agarose electrophoresisr : accacaatggcagagaaagggrs2285666f : gtttgtaacccagataatccalui130c (130)t (78, 52)12% pager : gttgaaacacacatatctgcrs879922f : ttgtgttaagatcttgtcccbfai188c (188)g (146, 42)12% pager : aataaactgagctccagcrs4646179f : tacagggaggaggatgtgcghpych4iv680 t (328, 229, 123)c (328, 152, 123, 77)2.5% agarose electrophoresisr : tgatggcaatacctgtccacgbp base pairs, page polyacrylamide gel electrophoresis summary of pcr - based allele - specific restriction enzyme analysis used for genotyping of ace2 variants bp base pairs, page polyacrylamide gel electrophoresis quantile normalization was used to convert each trait to approximate normality (pilia. 2006). associations of ace2 variants with heritable hypertrophy traits, viz. left ventricular mass (lvm), maximum interventricular septal thickness (maxivs) and maximum posterior wall thickness (maxpw), were assessed with specialized mixed - effects models utilizing per - individual random effects which are correlated according to kinship coefficients (r package kinship, function lmekin). furthermore, concomitant adjustment was made for factors known to influence cardiac hypertrophy, viz. age, sex, body surface area, heart rate, systolic and diastolic blood pressure, hypertension diagnosis, as well as the identity of the disease - causing mutation, by including these as covariates in the analyses. we then formally tested the interaction between sex and genotype, after modeling the genotypes as the number of minor alleles (additive term), and a dominance term, which was only non - zero for heterozygous females (cordell and clayton 2005). this model is equivalent to modeling the genotypes as categories, labeling the male genotypes differently to the female genotypes. when the interaction between sex and genotype was not statistically significant, it was discarded from the model. the dominance term was similarly discarded if not significantly different from zero. as effect sizes derived from analysis of transformed data can not be interpreted in terms of the original measurement units, we also modeled the raw data in terms of the genotypes of the associated variant rs879922, with adjustment for confounders and to obtain informative effect sizes. because there were only two gg homozygotes in the group, we combined them with the heterozygotes to estimate the effect of at least one g - allele. linkage disequilibrium between the four markers and hardy weinberg equilibrium in the study cohort was assessed by haploview vs3.32. three hundred and twenty individuals belonging to 7 r92wtnnt2, 3 r403wmyh7 and 12 a797tmyh7 families were genotyped for variants in ace2 ; of these, 227 individuals, including all hcm mutation - carriers, consented to clinical investigation ; clinical and demographic traits of these individuals are summarized in table 2.table 2basic statistics of relevant clinical and demographic traits in the study cohort, stratified by hcm - mutation statushcm - mutation bearerscontrolsn = 127n = 100median(q1,q3)median(q1,q3)age (years)41(25,53)41(29,51)bsa (kg / m)1.8(1.6,2.0)1.8(1.7,2.0)systbp (mm hg)120(110,130)120(110,130)diastbp (mm hg)80(70,80)80(70,90)heart rate (bpm)66(60,75)69(62,76)lvm (g)166(125,218)126(103,158)mivst (mm)13.9(10.4,19.6)10.2(9.0,11.3)mpw (mm)10.1(9.0,11.6)9.0(8.0,9.7)because of the skewness of some distributions, data are summarised here as median (interquartile range), and were quantile normalized prior to association analysis(q1, q3) = q1, first quartile, q3, third quartile ; bsa, body surface area ; syst, systolic ; bp, blood pressure ; diast, diastolic ; bpm, beats per minute ; lvm, left ventricular mass ; g, grams ; mivst, maximum interventricular septal thickness ; mm, millimeter ; mpw, maximum posterior wall thickness basic statistics of relevant clinical and demographic traits in the study cohort, stratified by hcm - mutation status because of the skewness of some distributions, data are summarised here as median (interquartile range), and were quantile normalized prior to association analysis (q1, q3) = q1, first quartile, q3, third quartile ; bsa, body surface area ; syst, systolic ; bp, blood pressure ; diast, diastolic ; bpm, beats per minute ; lvm, left ventricular mass ; g, grams ; mivst, maximum interventricular septal thickness ; mm, millimeter ; mpw, maximum posterior wall thickness all markers were in hardy weinberg equilibrium in the unrelated individuals and there was no relevant correlation between the snps (all r 0.1). genotype frequencies of the markers in the study population are given in table 3.table 3genotype frequencies for ace2 variants in the complete study cohort, stratified by gendermalefemalecgcccgggrs19781240.380.620.160.310.53rs22856660.810.190.590.380.03rs8799220.770.230.500.490.01rs46461790.980.020.980.020.00 genotype frequencies for ace2 variants in the complete study cohort, stratified by gender statististically, there were no significant interactions between sex and genotype, so that no sex - specific effects of alleles were observed (results not shown). as the dominance term was not significantly different from zero, we could model the genotypes as single numerical factors, specified as the number of minor - alleles carried by the individual ; thus males had a maximum of one of these alleles and females a maximum of two (additive coding) (cordell and clayton 2005). the p values for significance tests of the additive term, after removing the dominance term from the model, are shown in table 4. while there was no evidence for association between hypertrophy traits and ace2 snps rs1978124, rs2285666 or rs4646179, the g - allele of rs879922 was found to have a significant effect on all three of the investigated hypertrophic traits, increasing each by a modest amount. the effect sizes of the g - allele on untransformed, covariate - adjusted traits were 18.7 g for lvm, 1.9 mm for maxivs and 0.7 mm for maxpw (table 4).table 4effect size (beta), standard error (se) and p value for tests of association of variants in ace2 snplvmechomax ivstmax pwbetasep valuebetasep valuebetasep valuers19781248.05.90.11901.140.620.24480.3150.2340.0772rs22856666.78.50.65440.020.800.77960.2460.2760.1825rs87992218.79.40.02051.870.870.03930.6570.3050.0090rs464617926.927.00.48133.712.560.29990.1540.8930.6102effect size and standard error are given in original units of measurement for traits, for ease of interpretation, while p values are for tests on quantile normalised traits. beta is the effect on the trait of adding a g - allelelvm left ventricular mass, maxivst maximum interventricular septal thickness, maxpw maximum posterior wall thickness effect size (beta), standard error (se) and p value for tests of association of variants in ace2 effect size and standard error are given in original units of measurement for traits, for ease of interpretation, while p values are for tests on quantile normalised traits. beta is the effect on the trait of adding a g - allele lvm left ventricular mass, maxivst maximum interventricular septal thickness, maxpw maximum posterior wall thickness in this study, we used hcm families, in which the disease is caused by defined founder mutations, to assess the role of variants in ace2 in hypertrophy development, independent of factors that are known to influence this phenomenon. we find that the g - allele of rs879922 is associated with increased hypertrophy, viz. lieb. previously reported association of the rs879922 g - allele, singly as well as within a four - marker haplotype (with rs4646156, rs4240157 and rs233575), with modestly increased lvm and maxivs in the general male population in augsburg, germany (lieb. wang. recently reported association of other ace2 variants, rs2106809 and rs663677, with maxivs, again only in a group of male hcm patients, with unknown primary disease - causing mutations (wang. although ace2 maps to a hypertension quantitative trait locus identified in three different rat models of hypertension, no association between ace2 variants and hypertension has been found to date (benjafield. ; wang. 2008). in our study, association with hypertrophy was also independent of blood pressure per se or diagnosis of hypertension. taken together, our data indicate a role for variation in ace2 in modifying the development of left ventricular hypertrophy. furthermore, the results suggest that the genetic modifiers of the cardiac hypertrophy that develops in response to a primary hcm - causing mutation may also be involved in hypertrophy development in the general population. the effect size of the g - allele of rs879922 is modest, as has been previously described for other raas gene variants (mayosi. 2003), which may suggest that the hypertrophic phenotype is the cumulative result of a number of genes of moderate effect. as rs879922 occurs within an intron and does not have any obvious functional role, it is possible that the association noted in this study, as well as that of lieb. the extent of variation in this gene and the ld distribution across the genome in the study population is unknown. however, rs879922 tags at least 28 additional hapmap snps in the ceu, yri and jpt + chb populations. in the ceu and yri hapmap populations, variation in ace2 is predominantly captured by two and three haplotype blocks, respectively ; rs879922 is located within a haplotype block involving the 3 approximately third of the gene, which may indicate that the functional variant lies in this region of the gene. due to the highly variable distribution of left ventricular hypertrophy in hcm, it is difficult to distinguish a single echocardiographic measure that accurately quantifies the extent of hypertrophy in all patients. although lvm is most often used to quantify hypertrophy in hcm, it is known to be an inaccurate measure when echocardiographically derived, due to the asymmetric nature of hypertrophy in hcm. we did not employ bonferroni correction for multiple testing, as the traits investigated are highly correlated, and such correction is considered over - conservative, risking the rejection of important findings, while bayesian methods for correction rely on knowledge of prior probability of involvement, which is currently unknown for most genetic variants (campbell and rudan 2002). however, even if the over - stringent bonferroni correction for four independent tests (for the four markers) were performed, the association noted for rs879922 with maxpw would remain significant, and that with lvm remain a trend. although the number of subjects assessed in this study is modest, our data adds to previous investigations in confirming the involvement of ace2 in the development of cardiac hypertrophy, independent of blood pressure or indeed other hypertrophy covariates, in hcm patients. furthermore, in our study, the use of data derived from hcm families carrying known, founder mutations afforded benefits over case - control studies, such as additional control of genotyping accuracy, control over the variability introduced by distinct primary disease - causing mutations, and avoidance of the confounding effect of occult population stratification. furthermore, our study combined with that of lieb. and wang. supports a more consistent role for the recently identified component of raas, aceii, than the discordant findings for the original acei, in modulating cardiac hypertrophy, and in particular in modifying the extent of hypertrophy that develops in response to hcm - causing mutations. | hypertrophic cardiomyopathy, a common, inherited cardiac muscle disease, is primarily caused by mutations in sarcomeric protein - encoding genes and is characterized by overgrowth of ventricular muscle that is highly variable in extent and location. this variability has been partially attributed to locus and allelic heterogeneity of the disease - causing gene, but other factors, including unknown genetic factors, also modulate the extent of hypertrophy that develops in response to the defective sarcomeric functioning. components of the renin - angiotensin - aldosterone system are plausible candidate hypertrophy modifiers because of their role in controlling blood pressure and biological effects on cardiomyocyte hypertrophy. |
tension pneumothorax occurs due to a one way communication between lung parenchyma and the pleural cavity leading to air entrapment in the pleural cavity with each inspiration with inability to release it during expiration. it requires prompt diagnosis and immediate treatment or it may lead to respiratory failure and cardiovascular collapse [1, 2 ]. tension pneumothorax developing postoperatively after cardiac surgery is not uncommon but occurrence intraoperatively during cardiac surgery is rare and not yet reported in the english literature. we report a case of tension pneumothorax occurring intraoperatively during off pump coronary artery bypass grafting (opcab). a 62 years, 60 kg male with coronary artery disease, past history of smoking (60 pack - years), history of dyspnoea and chest pain on exertion, nyha grade ii - iii ; since one year was electively admitted for opcab. there was no history of chronic cough, recurrent respiratory tract infections, previous hospitalization, use of beta2 agonist or steroids, or history suggestive of chronic obstructive pulmonary disease (copd), occupational lung disease or tuberculosis. transthoracic echocardiography showed no regional wall motion abnormality (rwma) with normal valvular and left ventricular (lv) function. induction of general anesthesia was uneventful and anesthesia was induced with fentanyl sulphate, midazolam, thiopentone sodium and maintained with isoflurane and air oxygen mixture. pulmonary artery catheter introducer sheath and a triple lumen central venous catheter were inserted in the right internal jugular vein under ultrasound guidance in the first attempt without any complication. the left pleura was opened whilst harvesting the left internal mammary artery while the right pleura remained intact. the patient was mechanically ventilated on volume control ventilation mode under low flow anesthesia at 1.0 litre / minute with a tidal volume (tv) of 8 ml / kg, respiratory rate of 14/min and i : e ratio of 1:2.5 without application of peep, achieving a peak inspiratory pressure (pip) of 18 cm of h2o. during coronary artery grafting the tidal volume was decreased to 5 ml / kg and respiratory rate increased to 20 breaths / min because the left lung was obscuring the surgical field. post induction arterial blood gas analysis (abg) showed pao2 of 80 mm hg on fio2 of 0.6 with rest of the values in normal range. intraoperative endotracheal suctioning revealed excessive tracheobronchial secretions, simultaneously fio2 was raised to 1.0 and subsequent abg remained within normal limits. however, at the time of grafting of proximal ends of saphenous vein to the aorta, we observed a partial collapse of the left lung and the ventilator bellows not inflating fully. this raised a suspicion of a leak in the breathing circuit but we did not find any circuit leak. an attempt was made to auscultate the chest but was not successful because the patient was draped with sterile towels. the anesthesia machine was cross - checked by a biomedical engineer but no technical error was detected. the inspiratory gas flow was increased to 3.0 liter / minute resulting in adequate expansion of the left lung, restoration of tidal volume and full inflation of ventilator bellows. the heart rate (hr) increased to 130 beats / min with decrease in arterial blood pressure (abp) to 80/60 mm hg without any significant change in pip, pulmonary artery pressure (pap), 22/14 mm hg and central venous pressure (cvp), 9 mm hg. it was thought that the hemodynamic instability was due to the effect of chest closure and therefore was managed by administering fluid boluses and titrated increase in the dose of norepinephrine and epinephrine. at the end of the procedure, when all drapes were removed and dressing had been applied on the surgical wound while the patient was still on mechanical ventilation, there was an increase in pip to 40 cm h2o. this was immediately followed by increase in hr to 150/min and a decrease in abp to 60/40 mm hg. we attempted to manage this episode as the previous one and transesophageal echocardiography (tee) was called for. an increase in cvp to 14 mm hg and pap to 28/20 mm hg with a decrease in cardiac index (ci) and cardiac output (co) were observed. auscultation of the chest revealed decreased breath sounds on the right side of the chest and crepitus was palpable over the neck and chest. this led to suspicion of subcutaneous emphysema and a diagnosis of tension pneumothorax was made. immediately tube thoracostomy was performed on the right side and a gush of air bubbles were observed in the under water seal drainage system followed by normalization of heart rate, blood pressure and pulmonary artery pressure. tee performed subsequently to rule out any signs of myocardial ischemia revealed normal lv function, adequately filled lv, no rwma and no valvular regurgitation. the patient was then shifted to the postoperative intensive care unit and a chest radiograph obtained which revealed full lung expansion and mild subcutaneous emphysema. the trachea was extubated on the first postoperative day, chest tubes were removed on the third postoperative day without any evidence of pneumothorax on chest radiograph. rest of the postoperative period was uneventful and the patient was discharged on the seventh postoperative day. tension pneumothorax is a life threatening condition and its occurrence intraoperatively should be promptly diagnosed and treated [3, 4 ]. the most common causes are regional blocks (40% of reported cases), airway instrumentation (19%), barotrauma (16%), and placement of central venous lines (7%). the cause of tension pneumothorax was thought to be rupture of an emphysematous bulla that might have been present on the right lung particularly since the chest radiograph showed emphysematous changes despite normal pft. moreover the patient was a chronic smoker and during surgery the lungs were observed to be hyperinflated. a communication between lung parenchyma and pleural space may act as a one way valve allowing air to enter inside the pleural cavity during inspiration but preventing the air from escaping naturally during expiration. this results in an expanding pneumothorax that forces the lungs to collapse, increases intrathoracic pressure that causes decrease in venous return to the heart, decrease in stroke volume, cardiac output, cardiac index, blood pressure and tachycardia eventually leading to hemodynamic compromise. reported a rise in padp consistent with the development of pneumothorax in 3 patients (2 on mechanical ventilation). yu and lee reported an increase only in padp with pneumothorax and they considered it could be due to the transmission of the intrapleural pressure to the pulmonary vasculature. connolly reported the first and only description of a patient with tension pneumothorax in whom all hemodynamic and abg parameters were measured. the authors described the onset of hypoxemia, acidosis, increased cvp, pap and decrease of co, consistent with the development of pneumothorax. standard medical reference texts state that the immediate life - saving treatment for tension pneumothorax is needle decompression but there are case reports describing patients with tension pneumothorax managed successfully by chest tube drainage, without performing immediate needle decompression. many experts would proceed directly to definitive treatment and bypass the step of needle decompression if the capability to perform tube thoracostomy is immediately available, and this is what we opted for. mechanically ventilated patients, the physician may suspect tension pneumothorax when there is an increase in pleural pressures necessitating an increase in peak airway pressure in order to deliver the same tv. decreased expiratory volumes secondary to air leakage into the pleural space and increased end - expiratory pressure, even after discontinuation of peep, are two other signs of tension pneumothorax in these patients. increased pap and decreased co or ci are other parameters suggestive of tension pneumothorax. hemodynamic instability, hypoxia and/or increased oxygen requirements occur within minutes during positive pressure ventilation in comparison to hours during spontaneous respiration. in our case there were many signs indicating tension pneumothorax, such as a decrease in expiratory tv followed by increase in padp, decrease in co and ci leading to hemodynamic instability and, however, since most of the signs also indicate hypovolaemia and contractile deficit that may occur frequently during opcab, this may lead to delay in diagnosis and treatment of the condition. we hypothesize that, at the time of the first episode, start of a small pneumothorax resulted in reduction in minute volume without hemodynamic or airway pressure changes. the pneumothorax slowly progressed resulting in the second episode which was associated with hemodynamic changes but since the chest was still partially open the hemodynamics could be stabilized by fluid administration and inotropic support. however after chest closure the tension pneumothorax caused rapid, profound hemodynamic changes in the now closed chest cavity. we would like to highlight that intraoperative tension pneumothorax may definitely manifest after chest closure in cardiac surgical procedures. we conclude that the diagnosis of tension pneumothorax remains a challenge in mechanically ventilated patients under anesthesia. the presence of a cardiogenic shock - like picture, poor response to inotropes, increased inspiratory airway pressure, loss of tidal volume in a patient undergoing cardiac surgery may also be due to a tension pneumothorax. | tension pneumothorax is a life threatening condition that occurs when the intrapleural pressure exceeds atmospheric pressure. it requires prompt diagnosis and immediate treatment. tension pneumothorax developing postoperatively after cardiac surgery is not uncommon but occurrence in the operating room during cardiac surgery is rare. we report a case of tension pneumothorax intraoperatively during off pump coronary artery bypass grafting. |
ankle sprain is a common injury for athletes who perform cutting maneuvers, landings, or frequent jumps or make contact with other players1. approximately 4075% of individuals develop residual symptoms or chronic ankle dysfunction due to lateral ankle sprain2. in addition, functional ankle instability may affect the postural control and whole body balance. ross. quantified the time required for stabilization during single - leg jump landing. they concluded that their functional ankle instability group took significantly longer to stabilize in the sagittal and frontal planes of motion3. based on the findings of the abovementioned studies, individuals with functional ankle instability have a greater risk of injury because of their poor postural control, balance, and proprioception. ankle taping has been proved to reduce impact force and to balance the ankle power4. peak dorsiflexion and average eversion moments were significantly reduced in sidestepping tasks after taping5. proper ankle taping decreases inversion and plantar flexion, which may be related to the most common injury mechanisms6. some scholars also reported that kinesio tape may improve static restraint without altering dynamic postural control or peak motion7. to summarize the above reports, taping and bracing have been widely practiced as both preventative and rehabilitative interventions for ankle sprains by providing mechanical support and enhancing proprioception8. so far, limited research has been performed in spite of biomechanical evaluation of jump landing with kinesio taping. the aim of this study was to investigate the effect of the kinesio taping on the ankle functional instability (fi) of athletes during the landing phase in three - dimensional (3d) biomechanics analysis. from the hypothesized biomechanical view, kinesio taping had a positive effect on peak ankle plantar flexion moment and peak vertical ground reaction forces in the fi group. ten male athletes with ankle functional instability (fi) were recruited in this study from a college volleyball team. (age, 231.58 years ; height, 172.36.27 cm ; weight, 70.29.11 kg). the inclusion criteria of the fi group were as follows : (1) no structural instability or other anatomy structure disorder, (2) a feeling of giving way in the ankle joint during exercise or daily activities, and (3) history of ankle sprain, but not in the past six months9. subjects were excluded if painful gait or painful range of motion was observed during the data collection procedure. each subject s age, height, weight, and previous injury history were recorded. a physical therapist applied the anterior drawer test and talar tilt test to exclude subjects with ankle mechanical instability. each participant was requested to perform two tasks, the countermovement jump and vertical jump with run - up. each subject rested more than seven days between two conditions (with and without kinesio tape), and performed the countermovement jump and vertical jump with run - up randomly. in the vertical jump with run - up movement, the subjects take a stride with their dominant leg and then jump as high as possible. in the countermovement jump, the subjects start from an upright standing position and then flex the knees and hips to make a preliminary downward movement. the subjects were asked to jump as high as possible in both jump movements. kinesio tape was applied to each participant s ankle by a professional athletic trainer. the taping methods used included application of tape in the basketweave pattern with application of horseshoe and reinforcing strips10. the tape applied was a 5-cm kinesio tape (kinesio tex products, nkt-050, japan). the procedure for ankle taping was as follows : the tibialis anterior was taped with elasticity of 6070% (fig. 1b), and then the area from the medial malleolus to the lateral malleolus was taped (fig. finally we applied tape with a basketweave pattern, which was followed by application of heel locks with elasticity of 4050% (fig. kinesio taping procedures twenty - one reflective markers were placed on anatomic landmarks of the bilateral lower limbs for each subject. the selected anatomic landmarks were the sacrum, bilateral anterior superior iliac spine, medial and lateral epicondyles of the femur, lateral thigh, lateral shank, calcaneus, medial and lateral malleolus, and base of the second metatarsal bone11. a vicon612 motion analysis system (oxford metrics group, oxford, uk) with six cameras was used to collect the trajectories of the markers at 250 hz. watertown, ma, usa) was used to record the ground reaction forces and moments at 1,000 hz sampling rates. these two devices were initiated with a trigger, and the synchronization was recorded. the study protocols were approved by the ethics committee of national taiwan college of physical education (no. 98002). all participants signed an informed consent form and agreed to participate in the test. nf1 and nf2 were defined as the first and second peak vertical ground reaction forces normalized by each subject s body weight. t1 and t2 were defined as the times to the first and second peak vertical ground reaction forces after landing11. for smoothing the trajectories of the markers, a generalized cross - validation spline smoothing routine at a cutoff frequency of 6 hz was used in this study12. programs custom made with the matlab computer language (the mathworks, inc, natick, ma, usa) were used to calculate the joint moments of the lower limbs using the inverse dynamic method and the parameters of ground reaction forces. the independent t test was used to compare the differences between the countermovement jump and vertical jump with run - up. ninety - five percent confidence intervals (95% ci) were calculated for the difference between groups and conditions. a statistical significant difference was observed only in the vertical jump with run - up group (p=0.02, table 1table 1.the first (nf1) and second (nf2) peak vertical ground reaction forces normalized by each subject s body weightunit = n / kgcountermovement jumpvertical jump with run - upnf1nf2nf1nf2non - taped1.560.23 4.030.761.720.515.311.00taped1.370.183.640.681.750.494.550.72significance#significant difference with and without taping (p<0.05)). to further investigate the effect of kinesio taping on the vertical ground reaction force, the first (nf1) and second (nf2) peak vertical ground reaction forces we found that the nf2 in the vertical jump with run - up decreased significantly after application of kinesio tape. we then compared the types of jump, and the results showed that larger values were observed for the vertical jump with run - up than the countermovement jump. significant difference with and without taping (p<0.05) regarding the peak ankle inversion moment, the moment decreased after taping, but no statistical difference was revealed. in addition, there was no significant difference between the two types of jump. furthermore, a larger plantar flexion moment was measured in the vertical jump with run - up than the countermovement jump during landing (table 2table 2.the peak moment of ankle plantar flexionunit = nm / kgcountermovementjumpvertical jumpwith run - upsignificancenon - taped0.090.040.170.06taped0.060.020.120.05significance##significant difference with and without taping (p<0.05). significant difference between tasks (p<0.05) the times to the first (t1) and second (t2) peak vertical ground reaction forces after landing are shown in table 3table 3.the times to the first (t1) and second (t2) peak vertical ground reaction forces after landingunit = mscountermovement jump vertical jump with run - upt1t2t1t2non - taped11.362.91 62.778.3410.413.8953.0115.75taped13.293.6066.826.9710.633.5953.0513.8. no significant difference was observed for the effect of taping on the times to the first (t1) and second (t2) peak vertical ground reaction forces. a positive effect was observed on the peak vertical ground reaction forces and peak ankle plantar flexion moment in the vertical jump with kinesio taping with run - up. these experimental results provide useful information for attenuating the risk of both jump movements in athletes with ankle functional instability. ankle sprains that occur during landing may result from uncertain factors, such as uneven stance and exertion of excessive force. large ground reaction forces at landing have been reported, and the same results were obtained in this study13. in the vertical jump with run - up, there was a significant difference in nf2 after taping. it seems that taping has an important effect on the vertical jump with run - up. the findings for the instability group may due to distinct recruitment of muscle fibers of the skeletal muscle during the jump exercise. in the study of simon., it was speculated that an injured population with an actual proprioceptive deficit would respond differently14. ankle functional instability is a proprioceptive deficit. thus, it is likely more effective for sensory input of the skin to modulate muscle performance. in our study, the knee angle was not controlled in the subject, and this could be a reason why no significant differences occurred during the countermovement jump. mcnitt - gray reported an nf2 of 4.16 1.3 n / kg (jumping height 0.32 m). the results of the present study were in agreement with those of the study of mcnitt - gray13. however, riemann s study revealed that nf1 and nf2 were significantly higher in a non - taped group than a taped group during a jumping motion15. the difference in nf1 might have been due to the various heights that the subjects jumped. the subjects landed after jumping to a height of 0.59 m in riemann s study, while the subjects landed after jumping to a height of only 0.40 m in this study. thus, the difference between the studies may be due to use of different subjects. the ankle plantar flexion moment decreased significantly both in the countermovement jump and vertical jump with run - up after kinesio taping. they concluded that taping decreased joint position errors in plantar flexion but not inversion. in our results for plantar flexion moment, it appears that application of kinesio tape may restrict the range of motion of the ankle (table 2). postural amendment, decreased inflammation and pain, feelings of comfort, and normalization of joint range of motion after application of elastic taping have been pointed out by many scholars9. from a biomechanical perspective, using elastic taping would affect the joint reposition sense and proprioception. application of kinesio tape may support the muscles and ligaments and reduce sudden force concentration during the landing phase, and it may especially decrease the plantar flexion moment. on the other hand, kinesio taping did not improve the ankle sensory sense in the healthy subjects in the study of halseth. the mechanism for instability group whether same for healthy group need to be further discussed. mcnitt - gray s study reported a mean value of t2 of about 61 ms for a jump with a height of 0.32 m. in our study, the average jumping height was 0.40 m, and the mean t2 value was 63.73 ms13. nigg mentioned that the duration between muscle contraction for energy absorption and landing was about 5070 ms. larger ground reaction forces in this period (50 ms) would increase the risk of injury18. in our study, the time of the second (t2) peak vertical ground reaction force was often greater than 50 ms, and this may be a reason for recurrence of ankle sprains in countermovement jumping and vertical jumping. in retrospect, there is a clear need for further clinical and science research of taping. the results would help the athletes with ankle functional instability to select appropriate management. although we made an effort to investigate the effect of kinesio taping, there are many limitations of this study. this is because very few subjects met the criteria of ankle functional instability. also, potential subjects were worried about the risk of reinjury and rejected our invitation. we investigated the characteristics of the vertical jump with run - up and countermovement jump in subjects with functional ankle instability. this study proved the beneficial effect of kinesio taping on the ground reaction force in the sagittal plane and peak ankle plantar flexion moment. fortunately, ankle kinesio taping plays an important role in reducing the moment of the ankle joint. these findings may provide some suggestions for avoiding lateral ankle sprain. in terms of clinical application, kinesio taping may be applied to individuals with ankle instability and may be considered as alternative intervention in the sports rehabilitation field. | [purpose ] limited research has been performed in spite of biomechanical evaluation of jump landing with kinesio taping. therefore, the main objective of this study was to evaluate the effect of kinesio taping applied to athletes. in this study, the authors wished to investigate the effect of kinesio taping during a vertical jump with run - up and countermovement jump on ankle functional instability. [subjects and methods ] ten male athletes with ankle functional instability (fi) were recruited in this study from a college volleyball team. each participant was requested to perform two tasks, the countermovement jump and vertical jump with run - up. infrared high - speed cameras and force plates were used to assess the effect of ankle taping. [results ] the results showed that the peak ground reaction force in the sagittal plane during a vertical jump with run - up slowed down after kinesio taping and that the peak ankle plantar flexion moment in both types of jump also decreased. [conclusion ] in conclusion, this study proved the effect of kinesio taping on ankle functional instability, which was evaluated by measuring the vertical ground reaction force and peak plantar flexion moment. its finding may allow us to provide some recommendations for athletes and trainers. |
an increase in overweight and obesity is an important problem to be addressed in public health. in particular, patients with schizophrenia are well known to be prone to be overweight (13). obesity and being overweight increase the risks of dyslipidemia, hypertension, cardiovascular disease, insulin - resistant diabetes, and type 2 diabetes mellitus (5, 6). furthermore, the psychological effect of obesity in patients with schizophrenia have been suggested, particularly its association with depressive symptoms (7). previous studies have indicated that one of the causes of obesity in patients with schizophrenia is a poor choice of diet. according to surveys in the u.k., patients with schizophrenia showed a higher fat intake and lower intakes of fiber and vitamins than the general population and reference population (8, 9). in a survey in iran, patients with schizophrenia showed higher intakes of hydrogenated fats, full - fat cream, and carbonated drinks than individuals without mental disorder (10). it has been reported that patients with schizophrenia are likely to die early due to cardiovascular disease, which may be related to the low intake of fruit and vegetables (11). these findings suggest that a poor dietary intake has a major effect on obesity and physical health in patients with schizophrenia. obesity and overweight are generally known to result from nutritional excess and decreased physical activities, and the body mass index (bmi) is mainly used as an indicator of overweight and obesity. in a nutrition survey in the general population, the bmi closely related with the dietary in - take and individuals with protein, fat, carbohydrate and fiber (12). therefore, even in patients with schizophrenia, the intake of individual nutrient may differ depending on their bmis. in previous nutrition surveys in patients with schizophrenia, differences in gender and races and comparison with the general population have been mainly studied, (10, 11, 13) and no surveys have clarified or discussed the characteristics of their dietary intake focusing on the bmi. in this study, we investigated the characteristics of the dietary intake in patients with schizophrenia in japan, comparing them between bmi strata. this study aimed to obtain helpful suggestions for supporting their dietary life from the comparison between patients with schizophrenia and the general population. subjects were chosen diagnosed with schizophrenia by psychiatrists and correspond to criteria from the diagnostic and statistical manual of mental disorders, fourth edition (dsm - iv). subjects of age 20 years and above who had schizophrenia of at least one year living in the community were included in the study. we obtained informed consent before the survey from 60 community - based japanese patients with schizophrenia who received the explanation about the survey verbally and in writing before consent. among them, 51 subjects (25 men and 26 women) for whom there were no flaws in the questionnaire and photography for the nutrition survey were included in the analysis. this study was approved by the ethical review board of aomori university of health and welfare before implementation (approval no. demographic variables collected were age, gender, age of onset, and anthropometric indices including bmi, height, and weight. height was assessed using a handle - type height meter. with shoes removed (in socks), back and buttocks were measured standing upright with the heel touching the pillars of the height gauge. with both arms hanging down at the sides, body weight was measured with subjects wearing light clothing on a digital scale that can measure in 50 g units. the bmi of each subject was calculated from his / her height (m) and weight (kg) as the index of build. following the illustrated instructions, the subjects took the photographs of food that they ate with a camera and recorded the food in a dietary check sheet. they were instructed to take the photographs of all the food they ate, including snacks, using a disposable camera. they were instructed to take the photographs of food with chopsticks or a spoon so that the sizes could be compared. according to the national health and nutrition examination survey (14), the dietary check sheet had spaces to record the food and beverages that the subjects consumed and the weights of the food and beverages as well as spaces to check the cooking methods (baked, fried, boiled, or deep - fried). we instructed the subjects to take photographs before and after eating food to calculate the accurate intake. the names and weights of food were determined from the photographs and dietary check sheets collected. for the food consisting of several materials, the name and weight of each material were determined. if it was difficult to determine them, approximate weights were estimated based on food guidebooks. the weight of the food that changed after cooking was corrected to be the weight before change. the nutrient intake was estimated using excel add - in software (excel eiyou - kun ver. 6.0, kenpakusha co., ltd.) with the standard tables of food composition in japan fifth revised and enlarged edition. the nutrient in - take was analyzed by a single national registered dietitian to avoid possible bias. national health and nutrition survey (nhns) in the comparison of nutritional data between patients with schizophrenia and the general population, the results of the national health and nutrition survey, 2010 were used. the survey analyzed the conditions of the body, nutritional intake, and lifestyle by gender and age group. as the features of these survey items, the results are shown by age group and gender ; due to the different number of subjects in each item, the anthropometric indices of those who underwent the nutrition intake survey are not shown. the nhns nutrition survey was performed with the food weighing method for 1 day (other than sundays and national holidays) in each family. the nutritional data in the population aged 20 years and older were used as the general population for comparison in this study. the subjects were classified into 2 groups on the basis of their bmi values : bmi 25 kg / cm. the high intakes of phosphorus and salt may reflect the fact that they often used fast food products. patients with schizophrenia tended to have a lower fiber intake and higher salt intake than the nhns group. the characteristics of the dietary intake in patients with schizophrenia were lower intakes of calcium and fiber and a higher intake of fat than the dietary reference intakes in japan, which suggested the food constitution that is likely to increase body weight. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. | background : patients with schizophrenia reportedly have a high prevalence of obesity. one of the reasons is a poor choice of diet. the goal of this study was to clarify characteristics of the dietary intake across the strata of the body mass index (bmi) and to compare the general population and patients with schizophrenia in japan.methods:this is a cross - sectional study of 51 patients with schizophrenia residing in rural areas in 2011. anthropometric indices (of height, weight, body mass index) were measured at the commencement of the survey. intakes of energy, protein, fat, carbohydrate, calcium, phosphorus, vitamins, total fiber, and salt were noted through a 3-day dietary recording. the nutrient intake was estimated using excel add - in software (excel eiyou - kun ver. 6.0, kenpakusha co., ltd.). patients were divided into two groups : those with a bmi 25 kg / m2 and with a bmi < 25 kg / m2, and the differences in their nutrition intake were analyzed. to compare these patients with the general population, the results of the national health and nutrition survey, 2010 (nhns) were used (the nhns group). for statistical analysis, an unpaired t - test was performed with p < 0.05.results:patients with a bmi 25 kg / m2 had the higher intakes than those with a bmi < 25 kg / m2 of energy, fat and phosphorus and salt. patients with schizophrenia showed higher intakes of energy, carbohydrate, fat, calcium, phosphorus and salt than the nhns group.conclusion:the characteristics of the dietary intake in patients with schizophrenia were suggested the food constitution that is likely to increase the body weight. |
hepatoid adenocarcinomas are tumors that arise outside the liver but which resemble hepatic tissue and produce alpha - fetoprotein (afp). hepatoid adenocarcinomas have been identified in many sites, including the stomach, lung, rectum, renal pelvis, ovary, uterus, and vagina. until now, only one case of hepatoid adenocarcinoma of uterine corpus carcinosarcoma and elevated serum afp has been reported. we report two cases of afp - producing hepatoid adenocarcinomas of uterine corpus carcinosarcoma with rhabdoid differentiation, and discuss the pathologic features and clinical significance of this pattern of differentiation in uterine corpus tumors. a 63-year - old multiparous woman, gravida 4, para 3, complained of abnormal vaginal bleeding of 2 months ' duration. vaginal ultrasonogram and magnetic resonance imaging showed a polypoid mass of 14 10 cm in size in the uterus, possibly representing a carcinosarcoma or leiomyosarcoma. the patient underwent a total abdominal hysterectomy, bilateral salpingo - oophorectomy and pelvic lymphadenectomy. the resected enlarged uterus, weighing 560 g and measuring 14 12 7 cm, had a smooth glistening surface. the polypoid tumor originated from the uterine cavity when the anterior wall of the uterus was opened. microscopic examination showed that the polypoid tumor was a mixture of carcinomatous and sarcomatous components (fig. the tumor had invaded the uterine cervix, but no metastases were found in the dissected lymph nodes. the large pleomorphic cells were positive for desmin, actin, cd10, myod1, and myoglobin and could be regarded as being rhabdomyosarcoma. the tumor was histopathologically diagnosed as heterologous uterine corpus carcinosarcoma associated with afp - producing hepatoid adenocarcinoma. postoperatively, the patient received six courses of chemotherapy with paclitaxel (175 mg / m) and carboplatin (auc 5). after the third course of chemotherapy, the patient 's serum afp level decreased to 4.5 ng / ml. the patient is alive with no evidence of recurrence or increase in the serum afp level in the 2 years since treatment. an 82-year - old woman, gravida 0, para 0, she had undergone surgery due to breast cancer at the age of 68. on pelvic examination, portio vaginalis could not be detected, so the endometrial pap smear could not be done. magnetic resonance imaging revealed an enhanced mass, 8 cm in size, in the uterine corpus cavity, possibly representing malignant tumor. the serum afp level was elevated (401 ng / ml), but no elevation of other markers, such as carcinoembryonic antigen or carbohydrate antigen 125, was observed. a total abdominal hysterectomy with bilateral salpingo - oophorectomy and pelvic washings was carried out. a partially necrotic polyp, 8 cm in size, was present within the endometrial cavity, which infiltrated into the myometrium for about two - thirds of its thickness but did not invade the cervix. the carcinomatous component was an endometrioid adenocarcinoma with trabecular hepatoid cells, mostly showing hepatocellular carcinoma - like proliferation. immunohistochemistry showed focal positivity of tumor cells with desmin, myod1, and cd10. on pathologic examination, the tumor was interpreted as being a heterologous uterine corpus carcinosarcoma associated with afp - producing hepatoid adenocarcinoma. we did not carry out any adjuvant chemotherapy or irradiation because of the patient 's advanced age, in addition, she and her family refused these therapies. two months after the surgery, the patient 's serum afp level decreased to a normal level. however, multiple lung metastases with a high - serum afp level reappeared and the patient died 1 year after the operation. a 63-year - old multiparous woman, gravida 4, para 3, complained of abnormal vaginal bleeding of 2 months ' duration. vaginal ultrasonogram and magnetic resonance imaging showed a polypoid mass of 14 10 cm in size in the uterus, possibly representing a carcinosarcoma or leiomyosarcoma. the patient underwent a total abdominal hysterectomy, bilateral salpingo - oophorectomy and pelvic lymphadenectomy. the resected enlarged uterus, weighing 560 g and measuring 14 12 7 cm, had a smooth glistening surface. the polypoid tumor originated from the uterine cavity when the anterior wall of the uterus was opened. microscopic examination showed that the polypoid tumor was a mixture of carcinomatous and sarcomatous components (fig. the tumor had invaded the uterine cervix, but no metastases were found in the dissected lymph nodes. the large pleomorphic cells were positive for desmin, actin, cd10, myod1, and myoglobin and could be regarded as being rhabdomyosarcoma. the tumor was histopathologically diagnosed as heterologous uterine corpus carcinosarcoma associated with afp - producing hepatoid adenocarcinoma. postoperatively, the patient received six courses of chemotherapy with paclitaxel (175 mg / m) and carboplatin (auc 5). after the third course of chemotherapy, the patient 's serum afp level decreased to 4.5 ng / ml. the patient is alive with no evidence of recurrence or increase in the serum afp level in the 2 years since treatment. an 82-year - old woman, gravida 0, para 0, was referred to our hospital with vaginal bleeding of 2 months ' duration. she had undergone surgery due to breast cancer at the age of 68. on pelvic examination, portio vaginalis could not be detected, so the endometrial pap smear could not be done. magnetic resonance imaging revealed an enhanced mass, 8 cm in size, in the uterine corpus cavity, possibly representing malignant tumor. the serum afp level was elevated (401 ng / ml), but no elevation of other markers, such as carcinoembryonic antigen or carbohydrate antigen 125, was observed. a total abdominal hysterectomy with bilateral salpingo - oophorectomy and pelvic washings was carried out. a partially necrotic polyp, 8 cm in size, was present within the endometrial cavity, which infiltrated into the myometrium for about two - thirds of its thickness but did not invade the cervix. the carcinomatous component was an endometrioid adenocarcinoma with trabecular hepatoid cells, mostly showing hepatocellular carcinoma - like proliferation. on pathologic examination, the tumor was interpreted as being a heterologous uterine corpus carcinosarcoma associated with afp - producing hepatoid adenocarcinoma. we did not carry out any adjuvant chemotherapy or irradiation because of the patient 's advanced age, in addition, she and her family refused these therapies. two months after the surgery, the patient 's serum afp level decreased to a normal level. however, multiple lung metastases with a high - serum afp level reappeared and the patient died 1 year after the operation. they defined hepatoid adenocarcinoma as afp - producing carcinoma with a mixture of tubular or papillary adenocarcinoma, with abundant, eosinophilic cytoplasm and centrally located nuclei. hepatoid adenocarcinoma has mostly been found in the stomach, but also occurs in many other organs, including the uterus and ovaries. afp - producing tumors other than hepatoma and germ cell tumors have been widely reported, especially in hepatoid adenocarcinoma. in uterine corpus carcinosarcoma six cases of hepatoid adenocarcinoma of the uterine corpus have been reported in the literature. four cases were categorized as endometrial carcinoma [2, 3, 4, 5 ] and two as carcinosarcoma [6, 7 ]. microscopically, in both our cases, the tumor cells were composed of hepatoid adenocarcinoma and sarcoma components including rhabdomyosarcoma. our two cases are also examples of hepatoid adenocarcinomas of uterine corpus carcinosarcoma, because of the close resemblance of the neoplastic cells to hepatoid cells and because of the afp production. in the present cases judging from the changes in serum afp values, the afp content of the tumor and the immunohistochemical localization of afp in the tumor tissue, afp was produced by the tumor. in our cases, a close correlation was noted between shrinkage of the pelvic tumor and declining afp levels. the world health organization classification of uterine mesenchymal tumors places rhabdomyosarcoma in the category of mesenchymal tumors composed of heterologous elements. we consider that immunohistochemical support is necessary for a definitive diagnosis of rhabdomyosarcoma. in our cases, desmin was positive. it is a muscle marker and does not help distinguish between a rhabdomyosarcoma and a leiomyosarcoma. this provides unequivocal evidence that the two neoplasms in this report exhibit skeletal muscle differentiation. to date, four cases of uterine carcinosarcoma with rhabdoid features have been reported [6, 9, 10 ]. all four patients were initially treated surgically with subsequent chemotherapy. in the three cases where clinical follow - up was available, two patients died of disease. carcinosarcoma of the uterine corpus is a rare and aggressive neoplasm that contains both carcinomatous and sarcomatous histologic elements. carcinosarcoma of the uterine corpus is characterized by a high incidence of advanced stage at diagnosis and high recurrence rates after local therapy. when advanced or recurrent disease is diagnosed, controlling it is difficult and chemotherapy is minimally successful. some drugs that have been examined as single - agent therapy options are as follows : adriamycin, ifosfamide, cisplatin, and paclitaxel. paclitaxel is a novel antineoplastic agent derived from the bark of the pacific yew tree, taxus brevifolia. the gynecologic oncology group has tested paclitaxel in a variety of studies and has reported activity in ovarian cancer and adenocarcinoma of the endometrium, as well as in squamous and nonsquamous cancers of the cervix. the combination of paclitaxel and carboplatin demonstrated higher activity than that found in previous studies in patients with advanced or recurrent uterine carcinosarcoma. in our first case, adjuvant chemotherapy comprising paclitaxel and carboplatin was administered after surgery, and 2 years after the end of treatment, the patient is still disease - free. we described two cases of carcinosarcoma of the uterine corpus with afp - producing hepatoid adenocarcinoma. further studies with clinical follow - up are necessary to determine the best treatment modalities. | we report two cases of uterine carcinosarcoma associated with alpha - fetoprotein (afp)-producing hepatoid adenocarcinoma. samples were obtained from two women aged 63 and 82 years. serum afp levels of the two samples were 10,131 and 401 ng / ml, respectively. histologically, in both cases the tumor cells were composed of hepatoid adenocarcinoma component and sarcoma component including rhabdomyosarcoma. immunohistochemical analyses revealed that afp was expressed in the cytoplasm of the carcinomatous component. after surgery, the patients received six courses of carboplatin / paclitaxel chemotherapy, and the serum levels of afp decreased to normal range. the first patient is alive and well at the 2-year follow - up, while the second patient died of disease 1 year after initial operative treatment. this is, to our knowledge, the second report of carcinosarcoma of the uterine corpus with afp - producing hepatoid adenocarcinoma, as proven by immunohistochemical analyses. |
Subsets and Splits