Datasets:

danieladeeko
/

proccessed_ccdv

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 120k rows

article stringlengths 0 682k	abstract stringlengths 146 3.69k
angiostrongyliasis caused by infection with angiostrongylus cantonensis is primarily characterized by eosinophilic meningitis, meningoencephalitis, or myelitis. ingestion of raw or half - cooked apple snails containing third stage larvae (l3) of a. cantonensis is the commonest route of infection. after ingestion by humans, the l3 migrate to the central nervous system (cns) via blood stream and cause eosinophilic meningitis, often associated with encephalitis and myelitis (meningo - encephalo - myelitis). at the same time, the larvae also can invade the eyes and cause various ocular symptoms including optic neuritis. recently diao. summarized a total of 35 cases of ocular angiostrongyliasis. we also made an extensive literature survey on ocular angiostrongyliasis and found 42 cases including the cases reviewed by diao.. of these, nearly a half (19 cases) were from thailand [4 - 13 ], including the first case report from that country in 1962 and the most recent case reported in 2013. there are a few sporadic reports of ocular angiostrongyliasis from other countries, mostly from asia. we have found 5 cases from sri lanka [14 - 18 ], 2 of which were cited by diao.. although diao. noted 3 cases from india, they mistakenly included 1 case from taiwan (their reference # 17, in our reference # 25) as an indian case. four cases have been reported from mainland china [21 - 24 ] and 2 cases from taiwan. among them, 1 case from taiwan was not cited in the review of diao.. one case from vietnam was not included in the list of diao 's cases. one case each was reported from indonesia, papua new guinea, malaysia, south africa, nepal, and jamaica, in the order of the reported year. the cases from malaysia and jamaica were not mentioned in the review of diao.. however, the picture provided in the publication shows that the worm is definitely not a gnathostoma larva : the body is filariform without an apparent head bulb, indicating that this worm is highly likely to be the larva of a. cantonensis. the oldest records were reported by joseph and nicholls in sri lanka in 1925 (redescribed by dissanike and cross in 2004). the most recent one was the optic neuritis case reported from khon kaen, thailand, by sinawat. in 2013. except for the case from jamaica, 41 out of 42 were recorded in asia, corresponding to the geographical distribution of this parasite. among 42 ocular angiostrongyliasis cases, 19 were from thailand, 5 from sri lanka and only 1 or 2 cases from other countries. since 47% of all angiostrongyliasis cases in general are from thailand and 27% from china, a high prevalence of ocular cases in thailand is to be expected. however, the low number of ocular cases reported from other countries in the region is unexpected. given the low frequency of the condition even in thailand, cases elsewhere might not be diagnosed correctly. alternatively, there might be an intra - species variation in the pathogenicity and behavior of the l3 in the host. related to this, genetic variation in relation to the geographic location of a. cantonensis has been reported. in addition to the sporadic cases listed in table 1, punyagupta. analyzed clinical features of 484 cases of typical eosinophilic meningitis and found that 16% of patients had visual impairment, while 12% had an optic disc abnormality such as papilledema or atrophy. in china, clinical features of angiostrongyliasis cases of an outbreak in wenzhou were analyzed and the ocular manifestation was listed as one of the major features. lv. reported 2 ocular cases among 33 angiostrongyliasis cases in an outbreak in dali. reported 16 cases of visual disorders with different degrees of severity, such as photophobia, blurred vision, diplopia, defect in the field vision and eye floaters out of 81 cases in an outbreak of angiostrongyliasis in beijing. in this outbreak, 25 patients showed severe symptoms and all ocular cases were found in this group. these reports indicate that the actual incidence of ocular angiostrongyliasis is likely much higher than commonly appreciated. the average age of the patients in 39 cases was 34 years (3 - 72 years), and unknown in the remaining 3 cases. there was an obvious sex difference (28 males, 12 females, and 2 unknown). except for 1 case from taiwan, all patients were affected only in 1 eye with no significant difference for the frequency of the affected sides (22 left and 19 right, including a case of bilateral necrotizing retinitis, data not available for 2 cases). in most instances, worms were found and surgically removed from the anterior chamber (14 cases) or from vitreous fluid (15 cases). in 10 cases, worms were found either on the retina or sub - retina. even in such retinal involvement cases, worms were successfully removed surgically. in 4 retinal involvement cases in thailand, laser ablation with or without oral steroids was successfully performed. among 30 cases of successful surgical removal, only 1 recorded the presence of 2 worms. in all other cases, ocular lesions seemed to be caused by a single worm. these ranged in length from 5 to 28 mm, but the majority was juveniles (young adults) around 10 mm long. the majority of ocular cases was not associated with cns symptoms. among the 42 ocular cases peripheral blood eosinophilia was noted in 11 cases and 6 of them were among the cases with cns symptoms. the very first report of optic neuritis due to a. cantonensis infection described a case from china. subsequently, 4 cases have been reported from thailand and 1 case from taiwan. the diagnosis of optic neuritis can be made clinically by visual symptoms, positive rapid relative afferent pupillary defect (rapd), and prolongation of visual evoked potentials (vep). in the first a. cantonensis infection - associated optic neuritis case from china, the patient complained of mild headache, a low - grade fever, and slight ataxia. at the beginning, this patient was treated as a case of influenza because of non - specific symptoms, but a. cantonensis infection was suspected after the sudden onset of retinal detachment. the first angiostrongyliasis - associated optic neuritis case in thailand was a 21-year - old man suffering from progressive headache for 2 weeks. repeated lumbar puncture could not relieve his headache and a week later he developed blurred vision in his left eye. the rapd of his left eye was positive and vep showed prolonged latency for this eye. angiostrongylus worm was found in the vitreous space and treated with the argon laser. in 2008, sinawat. studied 3 cases of optic neuritis caused by a. cantonensis. in all 3 cases, the fundus examination revealed generalized retinal pigment epithelial alteration, subretinal tracks, retinal edema, macular edema. and a pale disc, suggesting optic neuritis. in the first case, the patient, a 47-year - old man, complained of blurred vision in the left eye but denied headache. an immature male worm in the anterior chamber was aspirated by simcoe cannula after laser photocoagulation. the second case was a 27-year - old man presented with progressive visual loss in the left eye for 3 weeks. he presented with a 2-month history of eosinophilic meningitis before the onset of blurred vision. diode laser was directly applied to the parasite and the dead worm was surgically removed. the third case was a 36-year - old man who developed visual loss in his right eye for 1 week without any history of headache. in this case, the intraocular inflammation was not detected and the rapd was negative. the patient was a 27-year - old thai male presenting with progressive visual loss and a membrane - like floater in the right eye that had persisted for 1 month. the parasite found in the subretinal space was treated with a diode laser and surgically removed. a case of optic neuritis reported from taiwan was a 38-year - old man who suffered from headache and neck stiffness with blurred vision and color blindness in the left eye associated with binocular horizontal diplopia. the optic neuritis was confirmed by having a positive rapd and delayed vep in his left eye. the patient received larvicidal drugs and steroid treatment for 2 weeks, and his visual accuracy and color sense in the left eye were improved. as an overview (table 2), all optic neuritis patients were males. two cases in thailand were affected in the right eye and the other 4 in the left eye. unlike other infectious causes of optic neuritis, optic neuritis associated with ocular angiostrongyliasis is almost always unilateral. if both conditions coexist, eosinophilic meningitis will occur prior to optic neuritis or ocular involvement based on its life cycle. the postulated mechanism for optic neuritis is an increased intracranial pressure or direct invasion. in 2008, jin. performed mri examinations for 74 angiostrongyliasis patients and found 33 with abnormal mri including 1 optic neuritis case. in this optic neuritis case, related to this, optic nerve compression due to a. cantonensis was also reported from china. ocular involvement other than optic neuritis in angiostrongyliasis included blepharospasm, uveitis, macular edema, retinal edema, necrotic retinitis, panophthalmitis, papilledema, and optic nerve compression. in the case of necrotic retinitis reported from taiwan, the patient had sudden loss of vision in both eyes and yellow transudate of retina accompanied by bulla formed by bilateral retinal detachment. both serum and cerebrospinal fluid were antibody - positive against a. cantonensis by elisa, and serum and subretinal fluid were positive for a. cantonensis by western blotting. the most common diagnostic method for optic neuritis caused by a. cantonensis infection is ophthalmological examination (ophthalmoscope, erg, and vep). furthermore, inquiry of history of eating intermediate hosts of a. cantonensis is also a key for diagnosis. immunodiagnosis, including elisa, western blotting, and use of specific monoclonal antibodies, provide strong supportive evidence. the most reliable diagnostic method so far is to find put larvae or juveniles of a. cantonensis by ophthalmoscopy. the usual method of treatment of optic neuritis caused by a. cantonensis is surgical removal of the parasites. if the parasites have not yet caused tissues damage, laser - mediated killing of living worms is a recommended therapeutic measure, which is better than surgical removal. in addition, oral administration of steroids may improve visual acuity by reducing intraocular inflammation. anthelmintics, such as albendazole, are not recommended because dead parasites may cause serious intraocular inflammation. in spite of these therapeutic measures, as shown in table 2, only slight improvement of visual acuity occurred after treatment in most cases. for both optic and general ocular angiostrongyliasis, the outcome of therapy depends on the duration of infection and the initial visual acuity at the first visit of patients to doctors. although the incidence of optic neuritis in a. cantonensis infection is far lower than that of eosinophilic meningitis, its poor prognosis in terms of vision loss seriously affects the quality of the life of patients. at present, we do not fully know the answers to the following questions : how do larvae migrate into the eyes ? via blood flow or by other routes?what is the relationship between optic neuritis and eosinophilic meningitis?what is the relationship among clinical symptoms, pathological changes, and the prognosis ? what causes those pathological changes?how can we treat cases of optic neuritis due to a. cantonensis infection ? how do larvae migrate into the eyes ? via blood flow or by other routes ? what is the relationship among clinical symptoms, pathological changes, and the prognosis ? what causes those pathological changes ? how can we treat cases of optic neuritis due to a. cantonensis infection ? because only a limited number of optic neuritis cases have been reported, development of an animal model for a. cantonensis - associated optic neuritis is necessary. in the past 20 years, many animal experiments have been carried out using rodent models of a. cantonensis infection. among them, mice have been studied most extensively because of their susceptibility to the parasite. until now, however, there are no animal models for optic neuritis caused by a. cantonensis. rats and mice have provided research models for optic neuritis caused by other conditions, such as multiple sclerosis. in these models, histopathological changes of the retina and optic nerve were observed by h - e staining, and demyelination of the optic nerve was observed by electron microscopy. similarly, fundoscopy has been used to observe the damage to the optic papilla and erg / vep used to examine changes in vision and visual acuity. ganglion cells of the retina were also the focal point of the study of optic neuritis. similar methodology should be adopted for the study of optic neuritis caused by a. cantonensis. in our preliminary animal study using mice infected with a. cantonensis, we found the infected animals manifested obvious inflammatory infiltration in the retina and optic nerve, and demyelination was found in the optic nerve. meanwhile, vep and erg were very different compared with normal control animals (unpublished results). these results indicate a. cantonensis can cause pathological and clinical changes of eyes in experimental animals. in conclusion, ocular angiostrongyliasis was comprehensively reviewed with special focus on optic neuritis caused by a. cantonensis, and we put forward questions about the urgent problems which need to be solved. this study provides a baseline for future research on optic neuritis caused by a. cantonensis.	angiostrongyliasis, caused by angiostrongylus cantonensis infection, is a food - borne parasitic disease. its larvae evoke eosinophilic inflammation in the central nervous system, but can also cause pathological changes in the eyes. among ocular angiostrongyliasis cases, the incidence of optic neuritis is low and only few sporadic reports exist. some patients with optic neuritis developed obvious hypopsia or even vision loss, which would seriously influence the quality of life of patients. prompt treatment of optic neuritis caused by a. cantonensis is the key factor for minimizing the incidence of serious complications of this disease. in this review, we first provide a comprehensive overview of ocular angiostrongyliasis, and then focus on the clinical features of optic neuritis caused by a. cantonensis.
annual epidemics of seasonal influenza result in about 35 million cases of severe illness and 250 000500 000 deaths worldwide. healthcare workers (hcws) can be a key source for influenza transmission in communities and hospitals as they are exposed to both infected patients and high - risk groups [2, 3 ]. vaccination is the most effective way to prevent infection and severe outcomes and the principal measure to reduce the impact of epidemics, such as hospitalization, mortality and morbidity [2, 35 ]. moreover, studies suggest that the vaccination of hcws has substantial economic benefits as well as health - related benefits, including reduced absenteeism from work and the extra costs of sick leave and staff replacement [4, 6, 7 ]. for the above reasons, the world health organization (who), united kingdom department of health (doh), united states centers for disease control and prevention (cdc), other healthcare professional organizations and many countries ' government agencies [1, 9, 10 ] strongly recommend the annual seasonal influenza vaccination of hcws. however, studies suggest that influenza vaccine uptake in hcws is often low worldwide [1114 ]. for example, the overall seasonal vaccination rate in england for hcws was 264% for the 2009/2010 season. nurses, as the group having the most patient contact, are more reluctant to be vaccinated than other hcws [1623 ]. although predictors influencing nurses ' vaccination practices have been identified to some extent regarding knowledge and risk perception [1619, 2327 ], further studies are needed to explore the influences on nurses ' attitudes and practices regarding influenza vaccination and to identify the major influencing factors for their vaccination behaviours. this study aimed to examine the relationship between knowledge, risk perceptions, health beliefs towards seasonal influenza and vaccination and the vaccination behaviours of nurses. a cross - sectional survey was conducted of qualified nurses between 18 april and 18 october, 2010. qualified nurses attending continuing professional education courses at a large university in central london were invited to participate in the study. completed questionnaires were collected immediately by the investigator or returned by mail to the research team using freepost addressed envelopes. questionnaire completion was anonymous so that it was not possible to follow up non - response. the questionnaire collected the following data : (1) knowledge about seasonal influenza and vaccination (22 items requiring true, false or unsure responses) included five dimensions to assess general information, severity of influenza, influenza vaccination, high - risk groups and vaccination - recommended groups ; (2) risk perception (12 items with a 4-point likert scale) towards influenza and pandemic with three dimensions (i.e. personal vulnerability to illness, negative consequences of contracting influenza and severity of influenza) ; (3) health locus of control including internal, chance and powerful others dimensions assessed by the multidimensional health locus of control (mhlc) scales (18 items) ; (4) vaccination behaviours (nine items) including vaccination status (whether respondents had been vaccinated in the previous season), vaccination intent (whether respondents intended to be vaccinated next season) and vaccination history (how many times respondents had been vaccinated in the last 5 years) ; (5) reasons for accepting or refusing vaccination using two open questions ; and (6) demographic characteristics (10 items) including gender, age group, highest educational qualification, place of work, clinical speciality, year of qualification as a nurse and whether or not respondents had direct patient contact. the cronbach 's -coefficients for the three newly developed scales (sections 1, 2, 4) ranged from 0701 to 0763 and principal components analysis produced a good fit and confirmed the internal design of the instrument. the test or fisher 's exact test was used to explore the statistical differences between categorical variables. the independent - samples t test was used to compare statistical difference between continuous variables in two groups. the one - way between - groups analysis of variance (anova) was used to explore the differences between more than two groups. the two - step cluster analysis procedure was performed to explore the natural groupings (i.e. clusters) within the respondents. the clustering criterion was that the solution had smaller values of schwarz 's bayesian information criterion (bic), a reasonably large ratio of bic changes and a large ratio of distance measures. a p value 176 times more likely to have been vaccinated in the last 12 months than those with lower scores, controlling for all other factors in the model. knowledge score with an odds ratio of 105 indicated that knowledgeable respondents were more likely to be vaccinated than the unknowledgeable, controlling for other factors in the model. table 3logistic regression predicting likelihood of vaccination in the previous seasonor, odds ratio ; ci, confidence interval ; mhlc, multidimensional health locus of control. logistic regression predicting likelihood of vaccination in the previous season or, odds ratio ; ci, confidence interval ; mhlc, multidimensional health locus of control. the two - step cluster analysis procedure was used to explore the natural groupings within the respondents. first, the auto - clustering exploratory analysis was performed using the categorical variables of vaccination status, vaccination intent, vaccination history and the continuous variables of knowledge score and risk perception score. of the 522 respondents, 64 were automatically excluded from the analysis due to missing values on one or more of the variables. of the 458 respondents assigned to clusters, 195 (426%) were assigned to the first cluster, 143 (312%) to the second and 120 (262%) to the third. cluster 1 comprised only those never vaccinated and cluster 3 comprised only those vaccinated in the previous season with vaccination intent for next season. cluster 2 contained those unvaccinated in the previous season with no vaccination intent next season and with no history of vaccination (n=56, 392%), unvaccinated with intent and with no history (n=10, 70%), unvaccinated with intent and with history (n=20, 140%) and vaccinated with no intent (n=57, 399%), i.e. all other vaccination history groups. subsequently the analysis was performed using the combined categorical variables of vaccination status in the previous season (= yes) and vaccination history and the continuous variables of knowledge and risk perception scores. the results were auto - clustered into four groups but not explainable. the procedure was repeated with the cluster number fixed to 2 due to the values of bic, ratio of bic changes and ratio of distance measures. of the total 188 vaccinated respondents, 12 were excluded due to missing values. of the remaining 176 respondents, 107 (608%) vaccinated cluster 1 comprised those vaccinated only in the previous season, i.e. the newly vaccinated group and vaccinated cluster 2 contained those vaccinated in the previous season who had more than one previous vaccination, i.e. the continuously vaccinated group. then, the same analysis was repeated for the unvaccinated respondents and two clusters emerged, i.e. unvaccinated cluster 1 (never vaccinated) and unvaccinated cluster 2 (used to be vaccinated). a comparison of variables across all clusters revealed that the never vaccinated had the lowest knowledge score, risk perception score and powerful others sub - score of mhlc compared to the other clusters (p 176 times more likely to have been vaccinated in the last 12 months than those with lower scores, controlling for all other factors in the model. knowledge score with an odds ratio of 105 indicated that knowledgeable respondents were more likely to be vaccinated than the unknowledgeable, controlling for other factors in the model. table 3logistic regression predicting likelihood of vaccination in the previous seasonor, odds ratio ; ci, confidence interval ; mhlc, multidimensional health locus of control. logistic regression predicting likelihood of vaccination in the previous season or, odds ratio ; ci, confidence interval ; mhlc, multidimensional health locus of control. the two - step cluster analysis procedure was used to explore the natural groupings within the respondents. first, the auto - clustering exploratory analysis was performed using the categorical variables of vaccination status, vaccination intent, vaccination history and the continuous variables of knowledge score and risk perception score. of the 522 respondents, 64 were automatically excluded from the analysis due to missing values on one or more of the variables. of the 458 respondents assigned to clusters, 195 (426%) were assigned to the first cluster, 143 (312%) to the second and 120 (262%) to the third. cluster 1 comprised only those never vaccinated and cluster 3 comprised only those vaccinated in the previous season with vaccination intent for next season. cluster 2 contained those unvaccinated in the previous season with no vaccination intent next season and with no history of vaccination (n=56, 392%), unvaccinated with intent and with no history (n=10, 70%), unvaccinated with intent and with history (n=20, 140%) and vaccinated with no intent (n=57, 399%), i.e. all other vaccination history groups. subsequently the analysis was performed using the combined categorical variables of vaccination status in the previous season (= yes) and vaccination history and the continuous variables of knowledge and risk perception scores. the results were auto - clustered into four groups but not explainable. the procedure was repeated with the cluster number fixed to 2 due to the values of bic, ratio of bic changes and ratio of distance measures. of the total 188 vaccinated respondents, 12 were excluded due to missing values. of the remaining 176 respondents, 107 (608%) vaccinated cluster 1 comprised those vaccinated only in the previous season, i.e. the newly vaccinated group and vaccinated cluster 2 contained those vaccinated in the previous season who had more than one previous vaccination, i.e. the continuously vaccinated group. then, the same analysis was repeated for the unvaccinated respondents and two clusters emerged, i.e. unvaccinated cluster 1 (never vaccinated) and unvaccinated cluster 2 (used to be vaccinated). a comparison of variables across all clusters revealed that the never vaccinated had the lowest knowledge score, risk perception score and powerful others sub - score of mhlc compared to the other clusters (p<0001, p<0001, p=0020, respectively) and this difference was statistically significant. for the vaccinated, there were no significant differences across any variable for the newly vaccinated and continuously vaccinated clusters although there was a trend of higher average scores for knowledge and risk perception in the newly vaccinated cluster compared to those of the other clusters (p=0652, p=0288, respectively). for the unvaccinated, there were no statistically significant differences across the variables except for the mhlc powerful others sub - score (p=0008). further comparisons were performed to explore whether there were differences across the different items of knowledge and risk perception in the clusters. in the clusters of never vaccinated, other vaccination history and vaccinated with intent, there were significant differences in knowledge related to general information, high - risk groups and vaccination of recommended groups with p values of < 0001, < 0003 and < 0006, respectively. on average those never vaccinated had the lowest score while those vaccinated with intent had the highest scores across all knowledge items. for only one item of risk perception, i.e. personal vulnerability to illness, was there a significant difference between the clusters of never vaccinated and other vaccination history and between never vaccinated and vaccinated with intent (p<0000 respectively). there was no statistically significant difference in the knowledge and risk perception item scores between the two vaccinated clusters. the newly vaccinated usually had higher scores than those of the continuously vaccinated except for one item, i.e. the vaccination of recommended groups. similarly, for the two unvaccinated clusters there was no difference for knowledge scores, but there was a significant difference in one risk perception item, i.e. personal vulnerability to illness (p=0001). those never vaccinated had a lower score for this item than those who used to be vaccinated and they were also less knowledgeable compared to the other group. in total 444/522 respondents answered one or two open questions representing a response rate of 851%. of these, 432 (783%) provided reasons for vaccination acceptance and 372 (713%) responded with reasons for vaccination refusal. there were 862% (162/188) of vaccinated and 822% (263/320) of unvaccinated respondents who provided at least one reason for being vaccinated and 649% (122/188) of the vaccinated and 772% (247/320) of the unvaccinated provided at least one reason for not being vaccinated. table 4summary of respondents ' reasons for vaccination uptake summary of respondents ' reasons for vaccination uptake table 5summary of respondents ' reasons for non - uptake of vaccination summary of respondents ' reasons for non - uptake of vaccination in this study, the seasonal influenza vaccination rate in nurses was 370% which is higher than previous reports of vaccination coverage ranging from 143264% in hcws in uk [12, 29, 30 ] and 16% in nurses reported by chalmers and similar to o'reilly. 's reported vaccination coverage of nurses in elderly care units. this higher vaccination rate might be explained to some extent by the uk media reports of the risk of seasonal influenza and h1n1 pandemics in 2009 which may have increased the sample nurses ' risk perception towards influenza and consequently changed their vaccination decisions as noted in a previous study. this study found that vaccination behaviours in nurses were more complex requiring an analysis of both vaccinated and unvaccinated nurses ' behaviours. more levels of vaccination behaviours existed in the sample with the two - step cluster analysis revealing three whole population clusters, i.e. those never vaccinated, those vaccinated this season with intent next year, and those with other vaccination history. two clusters, the newly vaccinated and continuously vaccinated, were identified for the vaccinated group and another two clusters, never vaccinated and used to be vaccinated, were identified in the unvaccinated group. to improve the influenza vaccination rates in nurses, it may be helpful to develop different strategies which target the nurse groups of the never vaccinated and the occasionally vaccinated. we found that a lack of knowledge about influenza and vaccination was a strong predictor of nurses ' vaccination behaviours, especially for those never vaccinated. this cluster had the lowest knowledge score, suggesting that increasing their knowledge might improve their vaccination behaviours. however, it seems there are persistent decliners who are in the habit of not having a vaccination. this suggests that future educational campaigns need to be persistent, durative, and intensive if their vaccination behaviours are to be modified. for those who had been vaccinated in the past but not in the current season, knowledge was also a predictor for their vaccination behaviours, which suggests that current vaccination campaigns have failed to address their misgivings about vaccination to maintain their compliance with the annual vaccination recommendation for hcws. between those occasionally vaccinated and continuously vaccinated, knowledge levels were not significantly different but the newly vaccinated in 2009 had on average higher knowledge scores than those continuously vaccinated. this may reflect an increase in their risk perceptions towards influenza due to widespread reporting of the risks in the media encouraging them to be vaccinated for the first time in their lives. this suggests that timing may be crucial to the success of vaccination campaigns making behaviour modification easier. future studies are required to explore the relationship between the content and timings of vaccination campaigns and nurses ' first vaccination uptake. this study showed that the perception of personal vulnerability to illness was important in nurses making vaccination decisions. but perceptions of the negative consequences of contracting influenza and severity of influenza were not major factors, a finding which is consistent with findings of previous studies. this suggests that future educational campaigns might be more effective if they focus on the negative personal consequences of contracting influenza and its sequelae rather than nurses ' professional duty to protect patients or other vulnerable groups. additionally, the reasons which nurses gave for having vaccination focused upon their personal health motivation rather than a professional responsibility regardless of whether they were vaccinated or unvaccinated. concerns about the vaccine 's side - effects and effectiveness or safety were the two most frequent reasons for not having a vaccination indicating continuing misconceptions about influenza vaccine in nurses. future educational campaigns may wish to consider providing targeted information to change these widespread myths in nurses. however, these concerns did not seem to influence vaccination decisions because both vaccinated as well as unvaccinated nurses noted these reasons against vaccination. it may be the case that 2 days of minor discomfort post - vaccination is tolerable when set against a year 's influenza protection. unvaccinated nurses reported no need as their reason not having a vaccination which is consistent with their low - risk perception of contracting influenza. the convenience of the vaccination programme was identified as an organizational reason highlighting the importance of easy access to vaccination to increase its coverage in nurses. our analysis of health locus of control data found that those never vaccinated had a lowest powerful others locus of control for their vaccination behaviours, indicating that they did not believe their health was something over which they had no control. this pattern of health beliefs towards influenza vaccination is consistent with their low - risk perception of personal vulnerability to illness and no need as their reason refusing vaccination and may be an important factor for never vaccinated nurses. further studies are needed to explore what may influence this pattern of health locus of control in order to modify nurses ' vaccination behaviours. some organizations have recently required mandatory seasonal influenza vaccination for hcws as a professional and ethical obligation to protect their patients ' health [33, 34 ]. however, ethical issues have been raised with mandatory vaccination because, while promoting the interests of patients and employers, it challenges hcws ' personal autonomy and freedom of choice [35, 36 ]. moreover, it has been suggested that vaccination is not the only avenue of influenza prevention and there are several other important measures that healthcare organizations may take to protect both patients and hcws. further previous studies have also suggested that not all hcws support mandatory vaccination. until mandatory influenza vaccination for hcws is accepted worldwide, continued efforts to improve nurses ' vaccination behaviours will be required. first, there is possible selection bias of a convenience sample ; however, the broad range of qualified nurses together with a high response rate strengthen the results. the extent of bias is unknown especially regarding nurses not working in london or in different care settings. second, the survey relied on self - report vaccination data ; however, zimmerman. found that self - report data were reliable in comparison with medical records. third, the three factors explored relating to nurses ' vaccination behaviours explained only 87119% of the variance according to the logistic regression analysis (although it was statistically significant) and therefore our results can not fully explain nurses ' vaccination behaviours. additional predictors will need to be introduced into the model in future studies to fully explain nurses ' vaccination behaviours. in conclusion knowledge and risk perception were identified as two predictors influencing nurses ' vaccination decisions with the health belief pattern of less powerful others being an important predictor in the never vaccinated ; however, there are other influential factors which need to be identified in future studies.	summarythe relationship between knowledge, risk perceptions, health belief towards seasonal influenza and vaccination and the vaccination behaviours of nurses was explored. qualified nurses attending continuing professional education courses at a large london university between 18 april and 18 october 2010 were surveyed (522/672 ; response rate 777%). of these, 826% worked in hospitals ; 370% reported receiving seasonal influenza vaccination in the previous season and 449% reported never being vaccinated during the last 5 years. all respondents were categorized using two - step cluster analyses into never, occasionally, and continuously vaccinated groups. nurses vaccinated the season before had higher scores of knowledge and risk perception compared to the unvaccinated (p<0001). nurses never vaccinated had the lowest scores of knowledge and risk perception compared to other groups (p<0001). nurses ' seasonal influenza vaccination behaviours are complex. knowledge and risk perception predict uptake of vaccination in nurses.
in denmark, mebendazole and pyrvinium are used in the treatment of enterobiasis caused by enterobius vermicularis (threadworm, seatworm, or pinworm). treatment of the whole family is therefore recommended, if a child has been infected. pinworms are commonly resided in the colon, but can in rare cases migrate to the vagina or bladder and cause a variety of symptoms such as vaginitis, cervicitis, endometritis, myometritis, and salpingitis.. there is, however, limited information concerning the frequency of use of these drugs during pregnancy, and whether these recommendations are followed. studies in pregnant women have not shown negative birth outcomes associated with exposure to mebendazole [58 ]. both drugs have a low absorption level in the intestine, which suggests that they are safe to use during pregnancy. however, both drugs are labelled as category c, which indicates that more information is needed to ascertain their safety during pregnancy. in order to estimate possible public health consequences of prenatal exposure, it is important to know the number of pregnant women being treated with mebendazole or pyrvinium. the aim of this study is therefore to investigate the exposure to pyrvinium and mebendazole during pregnancy in a nationwide cohort. all subjects and information about them were gathered from three danish national registries and statistics denmark : the danish fertility database, the danish national hospital register, and the danish national prescription register. from these registers and statistics denmark, information at individual level was gathered via the unique personal identification number given to all danish residents at birth or upon immigration. from the danish fertility database we identified all births in denmark from january 1st, 1997 to december 31st, 2007 and the personal i d numbers of the respective mothers. we also gathered information about maternal parity, date of conception, and date of delivery from this database. the date of conception is based on ultrasound estimates and information on date of last menstrual period. gestational age was defined as starting on the day of conception, which was defined as the first day of the last menstrual period plus 14 days. this definition of gestational age should not be confused with the classical gestational age the danish national hospital register has since 1977 included individual level data on all discharges from danish hospitals, and since 1994 also individual level data on all outpatient visits. from this register we acquired the pregnant mothers smoking habits according to the international classification of diseases (icd-10, danish revision), codes dut00 - 99. from two subsets held by statistics denmark (the population 's education register and the income statistics register) we identified the mothers ' highest level of completed education and their annual household income at birth year the danish national prescription register contains information on all redeemed prescriptions from danish pharmacies since 1995. we identified all prescriptions redeemed by the mothers in the study period via their personal i d number. to identify exposure we used the anatomical therapeutic chemical (atc) classification ; p02cx01 for pyrvinium and p02ca01 for mebendazole. pyrvinium is also available over - the - counter in danish pharmacies ; why an estimation of the redeemed prescription for pyrvinium could underestimate the true exposure. the date of redemption of a prescription for mebendazole or pyrvinium was used to identify exposure, which was classified according to first, second, and third trimester. first trimester was defined as the period between day of conception and day 84 of pregnancy, second trimester between day 85 and 196 of pregnancy, and third trimester between day 197 of pregnancy, and birth. cases were divided into three groups : exposed to pyrvinium, exposed to mebendazole, and exposed to both pyrvinium and mebendazole. treatment against pinworm infections consists of two doses given two weeks apart to prevent reinfection. the second treatment may therefore extend into the following trimester. to analyze differences in patterns of redemption before and after pregnancy, we furthermore identified women exposed to pyrvinium and mebendazole 03 and 69 months before and after pregnancy. to assess the development of exposure to pyrvinium or mebendazole over the years we studied the incidence for each year in the study period. maternal characteristics (age, parity, smoking, income, and education) are presented as frequencies with percentages. differences between categorical variables for the exposed versus unexposed were assessed by chi - square () tests. we considered two - sided p values 35 years (0% missing data). parity was defined as the number of previous live births, and classified into four groups : 0, 1, 2, and > 2 birth(s) (< 1% missing data). we classified highest level of completed education into three groups : low, medium, and high (4.0% missing data). annual household income during the year of birth was classified into quartiles (< 1% missing data). statistical analyses and data management were all performed using sas 9.2 (sas institute inc., all personal information held in the registers was encrypted and analyzed on computers held by statistics denmark. we excluded 117 records due to coding errors, 17 duplicate records, and 40 675 records with missing data on gestational age. our final study population consisted of 718, 900 births 94.63% of all recorded births. we identified 4715 (0.65%) mothers redeeming a prescription for pyrvinium or mebendazole during pregnancy ; 1606 (0.22%) for pyrvinium, 2575 (0.36%) for mebendazole, and 534 (0.07%) for both drugs (figure 1). of the 1606 women redeeming a prescription for pyrvinium, 245 redeemed the drug twice, and 39 redeemed it more than twice during pregnancy. of the 2575 women redeeming a prescription for mebendazole, 508 redeemed the drug twice, and 31 redeemed it more than twice during pregnancy. the exposure over the three trimesters was as follows.pyrvinium : 449 pregnancies in the first trimester, of which 434 were exposed from day 14 to 84 after conception, which is believed to be the most vulnerable period for congenital malformations, 792 pregnancies in the second trimester, and 445 pregnancies in the third trimester. mebendazole : 1031 pregnancies in first the trimester, of which 694 were exposed from day 14 to 84 after conception, 943 pregnancies in the second trimester, and 674 pregnancies in the third trimester.mebendazole and pyrvinium : 153 pregnancies in the first trimester, of which 139 were exposed from day 14 to 84 after conception, 241 pregnancies in the second trimester, and 124 pregnancies in the third trimester. pyrvinium : 449 pregnancies in the first trimester, of which 434 were exposed from day 14 to 84 after conception, which is believed to be the most vulnerable period for congenital malformations, 792 pregnancies in the second trimester, and 445 pregnancies in the third trimester. mebendazole : 1031 pregnancies in first the trimester, of which 694 were exposed from day 14 to 84 after conception, 943 pregnancies in the second trimester, and 674 pregnancies in the third trimester. mebendazole and pyrvinium : 153 pregnancies in the first trimester, of which 139 were exposed from day 14 to 84 after conception, 241 pregnancies in the second trimester, and 124 pregnancies in the third trimester. the number of women redeeming a prescription for a drug 03 months before pregnancy was 36 for pyrvinium, 2414 for mebendazole, and 17 for both drugs. the number of women redeeming a prescription for a drug 03 months after pregnancy was 104 for pyrvinium, 2559 for mebendazole, and 40 for both drugs. the number of women redeeming a prescription for a drug 69 months before pregnancy was 32 for pyrvinium, 2320 for mebendazole, and 15 for both drugs. the number of women redeeming a prescription for a drug 69 months after pregnancy was 45 for pyrvinium, 2725 for mebendazole, and 30 for both drugs. we compared the number of women redeeming a prescription in the three months before pregnancy with the first trimester and found a significant increase in redeemed prescriptions for pyrvinium (p < 0.0001) and a significant decrease in the number of women redeeming a prescription for mebendazole (p < 0.0001). when comparing the number of women redeeming a prescription in the third trimester with the three months after birth, we found a significant decrease in the number of women redeeming a prescription for pyrvinium (p < 0.0001) and a significant increase in number of women redeeming a prescription for mebendazole (p < 0.0001). the percentage of pregnant women redeeming a prescription for pyrvinium or mebendazole in the study period (19972007) varied between 0.20% and 0.25% for pyrvinium, 0.26% and 0.56% for mebendazole, and 0.04% and 0.09% for both drugs (figure 2). women exposed to pyrvinium, mebendazole, or both drugs during pregnancy were older (p < 0.0001) and had a higher parity (p < 0.0001) compared to unexposed. mebendazole - exposed women had a lower level of completed education (p = 0.002) but no significant difference in income (p = 0.25) compared to unexposed, while pyrvinium exposed did not differ in level of education (p = 0.54) or income (p = 0.47) compared to unexposed. women who had been exposed to both drugs during pregnancy had a higher level of education (p = 0.001) and a higher income (p = 0.04) compared to unexposed women. we found no difference in the proportion of smokers in any of the exposed groups compared to the unexposed group (p = 0.80, 0.96, and 0.94). having more than 2 children compared to no children resulted in an or = 7.07 (95% ci 5.758.68) for exposure to pyrvinium during pregnancy and an or = 20.76 (95% ci 17.3124.88) for exposure to mebendazole during pregnancy when compared to being unexposed. having two children compared to no children resulted in an or = 5.38 (95% ci 4.566.35) for exposure to pyrvinium during pregnancy and an or = 12.70 (95% ci 10.7914.94) for exposure to mebendazole during pregnancy when compared to being unexposed. having one child compared to no children resulted in an or = 2.31 (95% ci 1.982.69) for exposure to pyrvinium and an or = 4.30 (95% ci 3.675.04) for exposure to mebendazole during pregnancy when compared to being unexposed. among the 718, 900 births in our study cohort, 0.65% of the mothers redeemed prescriptions for pyrvinium, mebendazole, or both drugs during pregnancy. this incidence appears to have been steady between 1997 and 2007 (figure 2). we observed a shift towards using pyrvinium during pregnancy, which reflects the recommendation to prefer this drug in pregnancy (figure 1). even so mebendazole is still the more redeemed drug. as could be expected, having a higher parity the most likely explanation is that having a higher number of children increases the risk of them being infected with pinworms. the number of siblings in a household has previously been linked with increasing risk of pinworm infections [15, 16 ]. we found no other studies exploring the frequency of exposure to pyrvinium or mebendazole in pregnant women. the prevalence of pinworm infections in children has been reported to be similar in denmark as in sweden, norway, and estonia. therefore, we believe that the proportion of pregnant women exposed to anthelmintics may be similar in these countries. this danish nationwide cohort study includes information on all births and the mothers ' redemption of prescriptions of pyrvinium and mebendazole in the study period. information from the danish national registers used in this study was obtained prospectively and not based on questionnaires or interviews. danish pharmacies are obliged to register all redeemed prescriptions as part of the national health care reimbursement scheme. as a result, the accuracy of our results, however, depends on the association between the redemption of prescriptions for pyrvinium or mebendazole and actual drug ingestion, since the redemptions of prescriptions for pyrvinium or mebendazole are used as proxy measures for exposure to the drugs. lack of compliance would lead to misclassifying unexposed women to be exposed, which would overestimate the exposure. the exposure to pyrvinium and mebendazole is based on information on redeemed and paid prescriptions, which increases the probability of exposure. women may be more prone to receive treatment to avoid a possible risk of reinfection. a major limitation in this study is the underestimated exposure to pyrvinium, since pyrvinium is also available over - the - counter in danish pharmacies. information from the danish medicines agency on the total amount of pyrvinium purchased in pharmacies in the years 19992007 states that only 47% of all sales was by the use of a prescription. this percentage may be different among pregnant women, but surely indicates that the true exposure to pyrvinium among pregnant women is higher than that found in this study. we believe this number to be even higher since pyrvinium is also sold over - the - counter. limited information on birth outcomes is available at present time, and considering the number of exposed pregnancies, we recommend that studies are to be undertaken to assess the safety of pyrvinium and mebendazole during pregnancy.	purpose. families with children are frequently exposed to pinworm infection and treatment involves the whole family. information on consequences of exposure during, pregnancy is limited. the aim of this study was to investigate the exposure to pyrvinium and mebendazole before, during, and after pregnancy in a danish nationwide cohort. methods. from nationwide administrative registers, we identified 718, 900 births in denmark between january 1997 and december 2007 as well as maternal prescription data of anthelmintics and maternal characteristics. redemption of a prescription for pyrvinium or mebendazole was used to identify exposure. results. 4715 women redeemed a prescription for pyrvinium or mebendazole during pregnancy ; 1606 for pyrvinium, 2575 for mebendazole, and 534 for both drugs. having > 2 children compared to having no previous children was associated with exposure to pyrvinium (or : 7.1, 95% ci : 5.88.7) and mebendazole (or : 20.8, 95% ci : 17.324.9). conclusion. 4715 pregnant women redeemed a prescription for either mebendazole or pyrvinium. we believe the exposure to be even higher since pyrvinium is also sold over - the - counter. limited information on birth outcomes is available at present time, and considering the number of exposed pregnancies, we recommend that studies are to be undertaken to assess the safety of pyrvinium and mebendazole during pregnancy.
peripheral nerve injury is a common disease, the proliferation of glia and extraneural connective tissue in peripheral nerve defect may hinder the growth of anagenetic axon or misguide the growth cone of axon ; thus, the anagenetic axon can not reach the target organ or even results in the formation of neuroma at the nerve stumps ; therefore, the defect of nerve must be bridged by graft to induce the nerve regeneration. as the golden standard of the peripheral nerve defects therapy, the autologous nerve graft was effective for nerve repair, but the source of autologous nerve graft was limited and the application of this graft was limited by several elements such as the injury to donor for graft acquisition and the limited length for nerve defect repairment. other methods, such as nerve allograft, nonnerve tissue graft, and artificial nerve tissue graft, had been used, but their effect was not satisfactory. this research intended to use the schwann cells - like cells that differentiated from adipose derived stem cells (adscs) as the seed cells and acellular nerve graft processed by chemical method as the three - dimensional cells scaffolds to construct the tissue - engineering peripheral nerve graft which used to repair the sciatic nerve defect of rats, thus providing the experimental base for the clinical application. twenty - five sprague - dawley rats and sixty f344 inbred rats (provided by animal experimental center of zhengzhou university) weighing around 200 g were used ; all animals utilized in this research were cared for according to the policies and principles established by the animal welfare act and the nih guide for the care and use of laboratory animals. twenty - five sprague - dawley rats were sacrificed by intraperitoneal anesthesia with 10% chloral hydrate solution (0.5 ml/100 g). after immersion sterilized in 75% alcohol for 15 min, bilateral sciatic nerves of 20 mm (total 50 nerves) were harvested for experiment under aseptic conditions. the isolated sciatic nerves were cleaned of external debris under a lzl-21 dissecting microscopy (zhenjiang, jiangsu, china). fifteen f344 inbred rats were sacrificed by intraperitoneal anesthesia with 10% chloral hydrate solution (0.5 ml/100 g). after immersion sterilized in 75% alcohol for 15 min, bilateral inguinal fat pad was harvested for experiment under aseptic conditions and minced after washing by pbs (phosphate buffer solution) and then dissociated with 0.075% collagenase type i for 90 min ; the solution was passed through a 75 m filter to remove undissociated tissue and then neutralized by the dmem of low glucose that contains 20% (v / v) fetal bovine serum and centrifuged at 1000 g for 8 min. the stromal cell pellets were resuspended in dmem of low glucose that contains 20% (v / v) fetal bovine serum with 1% (v / v) penicillin / streptomycin solution, inoculated in 25 ml culture bottles in a density of 4 10/ml. the medium was replaced after 3~4 d, and the nonadherent cells were removed. the cells were passaged with trypsin / edta and inoculated in 50 ml culture bottles when the ratio of cells fusion was up to 90%. cultures were maintained in a 37c incubator with 5% co2 ; the fourth generation cells were induced to differentiation. the adipose derived stem cells under subfused status of the fourth generation were used for induction according to dezawa method that induces the bone marrow stromal stem cells (bmscs) to differentiate into schwann - like cells in vitro. on the fifth day after induction, the adscs were digested using 0.25% trypsin and 0.02% edta and dropped in aseptic glass slides that were coated with polylysine after centrifugation and collection. then the cells were incubated in 37c for 2 h, washed by pbs for 5 min, dried and fixed by 4% paraformaldehyde, and stained by s-100 and glial fibrillary acidic protein (gfap). forty - five f344 inbred rats were randomly divided into three groups according to different methods of sciatic nerve defect repair ; there were fifteen rats in each group. after intraperitoneal anesthesia with 10% chloral hydrate solution (0.5 ml/100 g) ; the rats were placed in a prone position and the skin was prepared. a standard longitudinal incision was made in the left gluteal region, and then the tissue between the subcutaneous and muscular layers was dissected. following this, the main stem of left sciatic nerve was isolated at midthigh level and 10 mm nerve was removed under aseptic conditions ; the nerve defect was repaired with different methods : group a, nerve defect was repaired using acellular nerve graft alone ; group b, nerve defect was repaired with acellular nerve graft and schwann cells - like cells that differentiated from adscs : when the ratio of cells fusion was up to 50%, the culture medium was replaced by 10 mol / ml culture medium that labeled by brdu (5-bromo-2-deoxyuridine), a cell proliferation marker, cultures were maintained in a 37c incubator with 5% co2 for 24 h, 200 l schwann cells - like cells that differentiated from adscs were suspended in dulbecco 's modified eagle medium (dmem) with 10% fetal bovine serum in a density of 1 10/ml, and then 10 l cells suspension were point - injected into the 10 mm acellular nerve grafts by microinjector from one end to the other through the central axis of graft 's cavity. after 4 h, the cells - scaffold combinations were placed in plates containing dmem with 10% fetal bovine serum for 48 h at 37c and 5% co2 under saturated humidity for use ; group c, nerve defect was repaired with autogenous nerve that suture in situ. all the grafts were end - to - end anastomosis with the two ends of sciatic nerve defect by 9/0 nontraumatic suture needles and the normal right sciatic nerves were used as control. the sfi was calculated using the method described by reynolds and weiss. at 6 w and 12 w following the surgery, footprints ' record box made by us was used to measure the following variable quantity. the box was 8.5 cm wide and 50 cm long, with one door on the side of the box and a piece of 70 g white paper that is same size as the bottom of the box was placed in the bottom of the box. rats that two hind paws had been dipped in carbon black ink walked from one end to the side door of the box, and three or four footprints of each foot were left on the paper. three variable quantities of the experimental side feet and the normal side feet were measured as follows.print length (pl) : the maximum print distance between heel to toe, the accuracy of length in millimeters and every time the maximum pl was used.toe spread (ts) : the distance between 1st toe and 5th toe, the accuracy of length in millimeters and every time the maximum ts was used.intermediary toe spread (its) : the distance between 2nd toe and 4th toe, the accuracy of length in millimeters and every time the maximum its was used.the sfi was calculated in accordance with the formula described by bain. to work out sfi : (1)sfi=38.3(eplnplnpl)+109.5(etsntsnts) sfi = 0 was used as normal value, sfi = 100 was used as complete nerve transected, and recovery ratio of sciatic nerve function index (sfi%) was worked out by comparing the sfi of experimental side to that of the normal side. print length (pl) : the maximum print distance between heel to toe, the accuracy of length in millimeters and every time the maximum pl was used. toe spread (ts) : the distance between 1st toe and 5th toe, the accuracy of length in millimeters and every time the maximum ts was used. intermediary toe spread (its) : the distance between 2nd toe and 4th toe, the accuracy of length in millimeters and every time the maximum its was used. (2) neural electrophysiology (nep). 6 w and 12 w following the surgery, bl-410 biological function experiment system and related equipment were used to mensurate the motor nerve conduction velocity (mncv) of bilateral sciatic nerve according to foidart - dessalle method and the maximum amplitude of complex action potential (cmap) of bilateral sciatic nerve, so the recovery ratio of them was calculated according to the following formulae : (2)mncv(ms)=distance between two points(m)difference value in latent period of two ends(s),recovery ratio of mncv = the mncv in operated side the mncv in normal control side100%,recovery ratio of cmap = the mean amplitude in operated side at different times the mean amplitude in normal control side at different times 100%. after the neural electrophysiology experiment was finished, the gastrocnemius muscle of experiment and normal legs in all rats were taken out completely, and the wet weight of gastrocnemius muscle was weighed by electronic balance such that precision is 1/10000 grams. the recovery ratio of weight of gastrocnemius muscle was worked out by comparing the weight of gastrocnemius muscle of experimental side to that of the normal side., 3 mm nerve segment in the proximal part of nerve grafts and the parallel segment in the control nerve were fixed by 10% formalin fixation for 24 h ; gradient alcohol dehydration and paraffin embedded, transverse, and longitudinal sections (5 m) of them were cut with a microtome. the tissue slices were deparaffinized with xylene 2 10 min and then rinsed in anhydrous alcohol 2 2 min and immersed in 95%, 80%, and 75% alcohol 1 min, respectively, and then rinsed in pbs 1 min. after staining by harris hematoxylin for 5 min, the slices were rinsed in pbs for 1 min and differentiated with 10 ml / l hydrochloric acid alcohol 20 s. after rinsed in pbs for 1 min and returned to blue with 10 ml / l ammonia for 30 s, then rinsed in pbs for 1 min. after incubation in eosin staining 1 min, the slices were rinsed in pbs 30 s and dehydrated in 75% alcohol 20 s, in 80% alcohol 30 s, and in 95% alcohol 2 1 min. after rinsing in anhydrous alcohol 2 2 min and immersed in xylene 3 2 min, the slices were covered with general clarity gum. the longitudinal tissue slices from proximal part of nerve grafts in group b were deparaffinized with xylene 2 10 min and incubated by 3% h2o2 (30% h2o2 mixed with methyl alcohol in ratio of 1 : 10) for 10 min ; after antigen repaired by microwave heating in citrate buffer solution, then the sealing liquid of 5% bsa was added and the first antigen (rabbit anti - rat antigen of brdu and s-100 protein) was added under 37c for 90 min, rinsed in pbs 2 2 min and the biotin - labeled secondary antibody (goat anti - rabbit antigen) was added that incubated under the room temperature for 20 min ; sabc reagent was added and incubated under the room temperature for 20 min, and 3,3-diaminobenzidine (dab) was used as ingrain agent. myelinated fibers and myelin sheaths of regenerated nerve were observed under a cx31 - 12c04 light microscopy (olympus, japan). 3 mm nerve segment in the middle part of nerve graft and the parallel segment in the control nerve were taken to fix in 4% glutaraldehyde in pbs for 4 h at room temperature, then rinsed in pbs 3 3 min, fixed in osmic acid, rinsed in pbs 3 3 min, and dehydrated in ascending series of alcohol (50%, 70%, 90%, and 100%) ; epon812 embedded, semithin section of 1 m was toluidine blue stained.. 6 w and 12 w following the surgery, 3 mm nerve segments in the distal part of nerve grafts and the parallel segments in the control nerves were taken to fix in 4% glutaraldehyde in pbs for 4 h at room temperature, then rinsed in pbs 3 3 min, fixed in osmic acid, rinsed in pbs 3 3 min, and dehydrated in ascending series of alcohol (50%, 70%, 90%, and 100%) ; epon812 embedded, ultrathin section of 20 nm was uranyl acetate and lead citrate stained ; the regeneration of nerve was observed under transmission electron microscope. (6) recovery ratio of quantity, diameter, and myelin sheath thickness in regenerated myelinated nerve fibers. 6 w and 12 w following the surgery, the toluidine blue staining slices of bilateral nerve segments in each group were observed under light microscope that magnified 1000 times to count the quantity of myelinated nerve fibers in each field of vision and contrast the quantity of experimental side to the quantity of normal side to get the recovery ratio : (3)recovery ratio of the quantity of nerve fiber = nerve fiber quantity of the experimental sidenerve fiber quantity of the normal side 100%. both the diameter and myelin sheath thickness in regenerated myelinated nerve fibers of each group were assessed in a double blind method with moticmed 6.0 digital medical imagine analysis system by pathological technician in our laboratory : the section of bilateral nerve segment in each group was observed under light microscope that magnified 400 times to count the quantity of myelinated nerve fibers in four fields of vision and record the diameter and myelin sheath thickness ; the average was counted and the quantity of experimental side was contrasted to the quantity of normal side to get the recovery ratio : (4)recovery ratio of the diameter of nerve fiber = nerve fiber diameter of the experimental sidenerve fiber diameter of the normal side 100%,recovery ratio of the myelin sheath thickness of nerve fiber = thickness of the experimental sidethickness of the normal side100%. chicago, il, usa) ; the main statistical methods include one - way analysis of variance (anova) which was performed to determine the statistical significance between groups, and t - tests were used to determine whether the averages of the data sets were statistically significant. after staining by s-100 and gfap, the cytoplasm of the positive staining cells was yellow dyed ; the morphology of positive staining cells was consistent with that of living cells observed under inverted microscope (figures 1(a) and 1(b)). 6 w and 12 w following the surgery, the sfi% of groups b and c was superior to that of group a (p 0.05) (table 1, figure 2). 6 w and 12 w following the surgery, the recovery ratio of mncv and cmap of groups b and c was superior to that of group a (p 0.05) (table 1, figure 3). 6 w following the surgery, in he staining slices of three groups, the regenerated myelinated nerve fibers were sparse ; the distribution and diameter of the fibers were irregular, but there were no obvious lymphocyte infiltration (figures 4(a), 4(b), and 4(c)) ; 12 w following the surgery, in he staining slices of three groups, the number of regenerated myelinated nerve fibers in group a was increased ; although the myelin was relatively dense, it was irregularly arranged ; the number of regenerated myelinated nerve fibers in groups b and c was increased, the myelin was densely and regularly arranged, and there was blood capillary hyperplasia and no obvious lymphocyte infiltration (figures 4(d), 4(e), and 4(f)). 6 w following the surgery, in toluidine blue stained slices of three groups, the myelin of regenerated myelinated nerve fibers in group a was sparse, the morphology and diameter in group a were irregular, the myelin of regenerated myelinated nerve fibers in groups b and c was dense, but its morphology and diameter were irregular (figures 4(g), 4(h), and 4(i)) ; 12w following the surgery, in toluidine blue stained slices of three groups, there were large numbers of regenerative and partly myelinated axon in group a and the diameter of them was homogeneous ; there were large numbers of regenerative and partly myelinated axon in groups b and c and the diameter of them was homogeneous and the myelin sheath of them was more thicker than group a (figures 4(j), 4(k), and 4(l)). 6 w and 12 w following the surgery, in stained slices from proximal part of nerve grafts in group b, some blue brdu - labeled schwann cells - like cells ' nucleus and brown s100-labeled myelin sheath were observed under microscope (figures 1(c) and 1(d)). 6 w following the surgery, the arrangement and thickness of regenerated myelin sheath in group a were irregular, the arrangement of regenerated myelin sheath in group b was more regular than group a, but the thickness of myelin sheath in group b were not uniform, and the arrangement of regenerated myelin sheath in group c was more regular than group a and the thickness of myelin sheath in group c was uniform (figures 4(m), 4(n), and 4(o)). 12 w following the surgery in group a, the regenerated myelin sheath was thin and irregular, accompanied with schwann cell proliferation ; in group b, the regenerated myelin sheath was denser and thicker, accompanied with schwann cell proliferation ; in group c, the regenerated myelin sheath was denser and thicker than groups a and b, accompanied with schwann cell proliferation and cytoplasmic organoids such as chondriosome, microtubule, and microfilament inside the nerve (figures 4(p), 4(q), and 4(r)). 6 w and 12 w following the surgery, the recovery ratio of quantity, diameter, and myelin sheath thickness in regenerated myelinated nerve fibers and recovery ratio of wet weight of gastrocnemius muscle of groups b and c were superior to those of group a (p 0.05) (table 2). they have a close relationship with both the origin, development, morphology, function, and the regeneration of the peripheral nervous system. they provide protection and nutrition and a suitable microenvironment to the axon and promote the formation of myelin sheath. the prerequisite of injured nerve regeneration includes protection of the neurons, induction of axon growth, and guidance of the growth cone to identify the corresponding target organs and establish new functional synapses ; schwann cells play a crucial role in the above three steps. owing to the limited source and difficulty in cultivation of schwann cells in vitro and the limited multiplication capacity of mature glial cells, how to acquire enough schwann cells for transplantation has always been a serious challenge. adipose derived stem cells (adscs) are multipotent stem cells originated from adipose tissue ; they possess the capacity to differentiate not only into the traditional mesenchymal cell line [11, 12 ] but also into nonmesenchymal cell types such as skeletal muscle cells, cardiomyocytes, and nerve cells [1318 ]. at the same time, adscs possess the advantage of extensive sources and superficial location of subcutaneous adipose tissue, and abundant cells are easily obtained from waste adipose tissue (about 1 10 stem cell from 10 ml of adipose tissue) without complicated anesthesia and operation and lower incidence of infection to the donor. in addition, the culture conditions of adscs are not strictly required as bmscs, and the adscs possess strong ability in proliferation (average passage time about 60 h) and stable multiplication ratio for 13~15 generation ; furthermore, the proportion of senile and dead cells during the cell proliferation is low, so that adscs are gradually becoming an optimum selection for seed cell of tissue engineering. researches have shown that allograft nerve that is pretreated by cryopreservation, cryodesiccation, freeze thawing, and chemical process can reduce its antigenicity and avoid immunological rejection after transplantation. the application of acellular nerve allograft that is processed by chemical method in repair of the peripheral nerve defect has been reported by many scholars [3, 20 ]. compared with other methods, the components such as cells and myelin which cause immunological rejection during nerve transplantation can be eliminated more thoroughly in acellular nerve allograft that is processed by chemical method, so that the possibility of immunological rejection will be reduced and the histocompatibility will be improved. furthermore, the integrity of basement membrane which guides the regenerated axons to arrive at the target organs and contribute to the nerve regeneration will be reserved. thus, the extracellular matrix of acellular nerve allograft is a suitable scaffold that provides an analogical microenvironment for seed cell adhesion, growth, and differentiation into tissue - engineering peripheral nerve. adscs can be induced and differentiated into schwann cells - like cells in vitro [22, 23 ] ; in this research, the differentiated cell expresses both s-100 and gfap that exist in schwann cells. at the same time, it have been observed that adscs can adhere and grow in the scaffold when they were implanted into the acellular nerve scaffold ; during this period, the cytoactivity of them was similar to the cells in culture media (p > 0.05) ; it means good histocompatibility between cells and acellular nerve scaffold [24, 25 ]. in this research, when the tissue engineered peripheral nerve that is composed of acellular nerve scaffold and differentiated adipose derived stem cells or only acellular nerve scaffold were implanted to bridge the defect of sciatic nerve, there were no apparent lymphocytes infiltration in the regenerated nerve ; it means good histocompatibility between acellular nerve scaffold and allogeneic host rats. 6 w and 12 w following the surgery, there were blue brdu - labeled schwann cells - like cells ' nucleus and brown s100-labeled myelin sheath was observed in nerve grafts of group b ; it means the acellular nerve scaffold provided a suitable living space for cells that were transplanted in vitro ; furthermore, these cells have developed into functioning cells in vivo. this study shows that tissue engineered peripheral nerve can repair the 10 mm defect of sciatic nerve effectively and a large number of myelinated nerve fibers pass through the nerve graft 6 w and 12 w following the surgery ; it means that the tissue engineered peripheral nerve that composed of acellular nerve scaffold and differentiated adipose derived stem cells have successfully restored the innervation of target organs. the amount of regenerated nerve fibers of group b was obviously more than that of group a ; the recovery ratio of sciatic nerve function index, wet weight of gastrocnemius muscle, and neural electrophysiology result were superior to those of group a. these results indicate that the recovery index of neural function agrees with the histological results ; the probable reason lies in that the differentiation of adscs into schwann cells in vitro increases the amount of schwann cells, thus accelerating the migration and early regeneration of axons.	objective. to investigate the effect of tissue engineering nerve on repair of rat sciatic nerve defect. methods. forty - five rats with defective sciatic nerve were randomly divided into three groups. rats in group a were repaired by acellular nerve grafts only. rats in group b were repaired by tissue engineering nerve. in group c, rats were repaired by autogenous nerve grafts. after six and twelve weeks, sciatic nerve functional index (sfi), neural electrophysiology (nep), histological and transmission electron microscope observation, recovery ratio of wet weight of gastrocnemius muscle, regenerated myelinated nerve fibers number, nerve fiber diameter, and thickness of the myelin sheath were measured to assess the effect. results. after six and twelve weeks, the recovery ratio of sfi and wet weight of gastrocnemius muscle, nep, and the result of regenerated myelinated nerve fibers in groups b and c were superior to that of group a (p 0.05). conclusion. the tissue engineering nerve composed of acellular allogenic nerve scaffold and schwann cells - like cells can effectively repair the nerve defect in rats and its effect was similar to that of the autogenous nerve grafts.
natural product phosphonates are in wide use in medicine and agriculture.(1) one member of this class of natural products, phosphinothricin (pt), is an unusual amino acid with a phosphinate side chain (scheme 1). synthetic pt (glufosinate) is the active component of the commercially important herbicides liberty, ignite, and basta, which are used in conjunction with transgenic crops such as corn, soybean, cotton, and canola. the mode of action of pt is due to the unique carbonphosphoruscarbon moiety that mimics the -carboxylate of glutamate thereby inhibiting glutamine synthetase resulting in a toxic buildup of ammonia and glutamine starvation in the plant.(2) recent genetic and biochemical studies identified 2-hydroxyethylphosphonate (2-hep) and hydroxymethylphosphonate (hmp) as intermediates in the pt biosynthetic pathway.(3) during pt biosynthesis, the carboncarbon bond of 2-hep is cleaved to afford hmp and formate by the product of the phpd gene, hydroxyethylphosphonate dioxygenase (hepd, scheme 1). initial characterization has revealed that hepd is a member of the cupin superfamily of proteins and that it only requires molecular oxygen and ferrous iron for activity.(4) 2-hep analogues deuterium - labeled at the c1 or c2 positions showed that the hydrogen atoms at c1 are retained in hmp and that one of the hydrogen atoms at c2 is present in formate. in addition, labeling studies with o2 and h2o demonstrated that hepd is a dioxygenase. the active site of hepd contains a 2-his/1-glu facial triad(5) characteristic of a large class of nonheme iron dependent enzymes.(6) a cocrystal structure, containing 2-hep coordinated to a cd - ion in the active site, demonstrated bidentate metal coordination of the substrate.(4) although hepd lacks significant sequence homology to other previously characterized enzymes, the crystal structure revealed that the active site architecture and tertiary structure of hepd are similar to 2-hydroxypropylphosphonate epoxidase (hppe),(7) an enzyme involved in the biosynthesis of the phosphonate antibiotic fosfomycin.(8) hepd and hppe not only share similar structures but also act on similar substrates, 2-hep and (2s)-hydroxypropylphosphonate ((2s)-hpp), respectively. on the basis of the initial characterization, two mechanisms were proposed for the transformation of 2-hep into formate and hmp (scheme 2). in both mechanisms, catalysis is initiated by bidentate coordination of substrate to the ferrous iron followed by binding of molecular oxygen to form an fe(iii)o2 species, which is postulated to abstract a hydrogen atom from c2 of 2-hep to form fe(iii)ooh (i) and a carbon centered radical. although these initial steps are not uniformly accepted for nonheme iron dependent enzymes, elegant studies by the laboratories of bollinger and krebs have provided spectroscopic and kinetic support for the feasibility of these steps for myo - inositol oxygenase (miox). the proposed mechanistic pathways for hepd then bifurcate. in one mechanism, the ferric hydroperoxide and carbon - based radical proceed to form an alkylhydroperoxide and a ferrous iron center (scheme 2). the peroxy hemiacetal intermediate formed can then undergo a criegee rearrangement to afford o - formyl - hmp (iv). hydrolysis of this intermediate at c1 (necessary to account for observed isotope washout during the transformation(4)) would afford the products. alternatively, if the substrate radical in intermediate i reacts with the terminal oxygen atom of the ferric - hydroperoxide, the substrate is hydroxylated and an fe(iv)=o intermediate (ii) is generated. the hemiacetal in intermediate ii can then undergo a retro - claisen - like carboncarbon bond scission affording formate and a hornerwadsworthemmons - like carbanion (iii) that is stabilized by metal coordination. this electron rich intermediate can then attack the oxygen atom of the electrophilic ferryl species to provide the observed products.(4) initial support for the hydroxylation mechanism came from the observation that hepd oxidizes 2-hpp to 2-oxopropylphosphonate (opp), with the enzyme being inactivated in the process.(4) both proposed mechanisms can account for the oxidation of 2-hpp and the inactivation of hepd, but the mechanisms of enzyme inactivation are different (scheme 3). the hydroperoxylation mechanism predicts that the enzyme is inactivated via oxidation of ferrous iron by hydrogen peroxide produced in the criegee rearrangement whereas in the hydroxylation mechanism the metal is trapped in the inactive fe(iv) state. since hydrogen peroxide was not observed in the previous study, the latter mechanism was favored.(4) to further investigate the mechanism of catalysis, in this study additional substrate analogues, putative catalytic intermediates, and labeled substrates incubation of 2-hep (2 mm) with hepd (10 m) resulted in the expected appearance of a peak in the p nmr spectrum corresponding to hmp. unexpectedly, after full conversion of 2-hep to hmp, the peak corresponding to hmp slowly decreased in intensity with the concomitant appearance of a new peak at = 2.3 ppm that was shown to correspond to phosphate by spiking with authentic material. when hmp (2 mm) was incubated with hepd (10 m) the recorded p nmr spectrum showed appearance of the same new peak (figure 1a). to identify the carbon - containing product, synthetic h2hmp was incubated with hepd, and aliquots of the reaction organic acids were derivatized to the 2-nitrophenylhydrazide and analyzed via lc - ms, demonstrating time - dependent production of h - formate (figure 1b). leaving out any component from the standard assay conditions (hepd, hmp, or fe(ii)) did not result in production of formate. additionally, when 2-hep was incubated for extended periods of time with stoichiometric amounts of hepd, all substrate was consumed and two equivalents of formate were produced, one from conversion of 2-hep to hmp and formate, and one from the subsequent oxidation of hmp to phosphate and formate. hepd catalyzes oxidation of hmp to afford (a) phosphate (pi), as evidenced by p nmr spectroscopy, and (b) h - formate from h2hmp as the carbon containing product in a time dependent fashion as evidenced by lc - ms. ofhmp (iv, scheme 2) is a proposed intermediate on the hydroperoxylation mechanistic pathway. therefore, ofhmp was synthesized and presented as a potential substrate to ferrous hepd, the oxidation state of the enzyme that ofhmp would interact with as an intermediate (scheme 2). ofhmp is not particularly stable and was partially hydrolyzed to hmp and formate during workup of the synthetic procedure. the sample presented to hepd therefore contained both ofhmp and hmp in a 1:1 ratio. a control experiment showed that further hydrolysis is very slow under the hepd assay conditions without hepd. thus, a sample of ofhmp and hmp (1:1) was incubated with hepd and the reaction was monitored by p nmr spectroscopy revealing peaks corresponding to phosphate and ofhmp, and a hmp peak that had strongly decreased in intensity compared to ofhmp (figure s1). the ratio of the intensities of the peaks corresponding to phosphate and ofhmp was 1.0:0.9 indicating that most of the hmp present in the original mixture had been oxidized to phosphate, consistent with the data presented in the previous section. however, the experiment also showed that no enzyme catalyzed hydrolysis of ofhmp had occurred. given that hmp is a substrate for hepd, 1-hydroxyethylphosphonate (1-hep) and 1-hydroxy-2,2,2-trifluoroethylphosphonate (1-hep - cf3) were tested as substrate analogues. under multiple turnover conditions (10 m hepd and 2 mm substrate analogue), (1.0 mm) was then incubated with 0.5 equiv of hepd and, after acidic workup, two peaks were observed in both experiments. one peak corresponded to the starting material and the other peak at = 2.3 ppm corresponded to phosphate. to determine the other products generated from 1-hep, the substrate analogue (0.3 mm) was incubated with hepd (0.1 mm) for 2 h, followed by analysis of organic acids by lc - ms after derivatization as described in the experimental section. a peak was observed in the chromatogram with a retention time and mass consistent with derivatized acetate. the produced acetate was quantified (0.11 mm), closely corresponding to the amount of hepd in the assay. the phosphorus - containing product before acidic workup was then determined by incubating the analogue with hepd and analysis by p nmr spectroscopy (figure 2a). the spectrum showed three peaks ; one for unreacted 1-hep, a small peak for phosphate and an additional peak at = 2.2 ppm. sulphuric acid was then added to the assay, the precipitated enzyme was removed by centrifugation, and another p nmr spectrum was recorded. the spectrum showed a peak for 1-hep and a peak for phosphate suggesting the third peak at = 2.2 ppm was associated with an acid labile intermediate that can be converted to phosphate under acidic conditions. this intermediate was then identified as acetyl phosphate (ap) by spiking with authentic material. because 1-hep was only converted when incubated with high concentrations of hepd, the enzyme is likely inactivated during the conversion of 1-hep to acetylphosphate. indeed, preincubation of hepd (2 m) with acetylphosphate (100 m) inhibited oxidation of its native substrate 2-hep. similarly, incubation of hepd (100 m) with 1 equiv of ap decreased the rate of formate production by 67% compared to an assay without ap. p nmr spectra after incubation of hepd with (a) 1-hep, (b) 1-hep - cf3. the p nmr spectrum for the reaction of 1-hep - cf3 with hepd also showed a peak for the starting material and a peak for phosphate (figure 2b). to determine the identity of any nonphosphorus containing products, 1-hep - cf3 (0.3 mm) was incubated with hepd (0.1 mm) and the f nmr spectrum was recorded. two peaks were observed, with one peak corresponding to unreacted 1-hep - cf3 and a second signal corresponding to trifluoroacetate, as demonstrated with an authentic sample. integration of the peaks in the spectrum showed a ratio of 1:2 for trifluoroacetate:1-hep - cf3. the amount of trifluoroacetate and phosphate formed was approximately equal to the amount of hepd in the reaction, suggesting that hepd was inactivated after converting 1-hep - cf3 to trifluoroacetate and phosphate. however, no reduction of formate production from 2-hep was observed after preincubation of hepd with trifluoroacetate by itself or with trifluoroacetate and phosphate. we previously reported that 2-hpp is accepted as a substrate for hepd and converted to opp.(4) to determine the stereochemistry of this transformation (2s)- and (2r)-hpp were prepared(12) and presented to hepd and a p nmr spectrum was recorded after 2 h. the spectrum showed oxidation for the r but not the s isomer. the stoichiometry of (2r)-hpp consumed to opp produced was determined by incubation of hepd with a 3-fold excess of (2r)-hpp and quantification of the opp generated via lc - ms. reaction of 0.1 mm, 0.25 mm, or 0.5 mm hepd with 0.3 mm, 0.75 mm, and 1.5 mm (2r)-hpp produced opp concentrations of 0.052 0.011 mm, 0.122 0.005 mm and 0.220 0.016 mm, respectively. these three experiments demonstrate stoichiometries of opp produced to hepd of 0.52:1, 0.49:1 and 0.44:1, respectively. in the hydroperoxylation mechanism, we previously showed that one equivalent of h2o2 rapidly inactivates approximately two ferrous hepd molecules,(4) and hence the observed stoichiometries at first glance appear to agree very well with the hydroperoxylation mechanism (i.e., each turnover of hepd results in one opp and 2 oxidized, inactive enzymes). one caveat is that complete conversion of (2r)-hpp to opp is assumed in this model. to probe if (2r)-hpp was cleanly converted to opp, hepd (0.5 mm) was incubated with (2r)-hpp (1.5 mm). edta and dithionite were added to improve signal quality through sharpening of the peaks in the p nmr spectrum (figure 3) that were very broad at the high enzyme concentrations used. the spectrum after 2 h showed peaks corresponding to (2r)-hpp, opp, and phosphate in a 1:0.4:0.33 ratio ; this ratio did not change after the initial enzymatic conversion. since all phosphorus - containing products originated from (2r)-hpp, the concentrations of (2r)-hpp, opp and phosphate are approximately 867, 346, and 286 m, respectively. to account for the presence of phosphate, opp was incubated under identical conditions with stoichiometric amounts of hepd and the p nmr spectrum was recorded, but no conversion of opp to phosphate was observed. then (2r)-hpp (1.5 mm) was incubated with hepd (0.5 mm) for 2 h and the sample was analyzed for organic acids. both acetate and formate (364 and 216 m, respectively) were observed in significantly higher concentrations than in control reactions (62 and 16 m of acetate and formate, respectively). collectively, these results are consistent with partitioning of (2r)-hpp to generate opp, which is unreactive toward further enzymatic oxidation, in addition to acetate and hmp (scheme 4). subsequent oxidation of hmp produces the observed formate and phosphate products, as discussed above. p nmr spectrum after incubation of hepd with (2r)-hpp demonstrating formation of opp as well as inorganic phosphate (pi). the previously proposed mechanisms(4) were restricted by the outcome of studies using either o2 or h2o, which provided complementary evidence that the hydroxyl oxygen in the hmp product was derived in part from molecular oxygen and in part from solvent. a third possibility that was not considered involves partial incorporation of the hydroxyl oxygen from 2-hep into hmp. a possible mechanism for such a process is shown in scheme 5 and in scheme s1 in the supporting information. after generation of the peroxy hemiacetal (v), this species could be converted into a dioxirane intermediate (vi). such a mechanism has precedent in reactions in organic solvents(13) and usually involves an activated oxygen leaving group, a role that might be played by an active site acid in the enzyme (scheme 5). the carbonyloxide resonance structures vii can be drawn for the dioxirane that then illustrate a mechanism for exchange analogous to that proposed for the observed exchange in organic solvents. for hepd, exchange of the hydroxide originating from the peroxy group with solvent and reformation of a peroxy hemiacetal could result in incorporation of oxygen from substrate and/or molecular oxygen (scheme 5), and/or solvent (scheme s1) into the hydroxyl of the hmp product. to probe the feasibility of such a mechanism, the hydroxyl group in 2-hep was synthetically labeled with o,(14) and the labeled substrate analysis of hmp by lc - ms and of formate via derivatization to the tbdms ester and analysis by gcms revealed that the o label was present exclusively in formate and not hmp (figure 4). in combination with the observed 40% wash - in of oxygen derived from solvent into the hmp product,(4) the mechanism in scheme 5 is unlikely (see also scheme s1). blue circles indicate oxygen from substrate, orange circles indicate oxygen from o2, and half filled circles represent oxygens with potential solvent wash - out / wash - in. (a) extracted ion chromatograms for hmp (black line) and o hmp (gray line) from reaction of 2-oh - hep. (b) mass spectrum of o formate (105 m / z), the peak at m / z 103 is spurious formate. other analogues of hep tested as potential substrates of hepd are shown in figure 5. the compounds were incubated with hepd under both catalytic and single turnover conditions and the assays were analyzed via p nmr spectroscopy and lc - ms. both methods showed that none of the tested analogues gave rise to new products when compared to authentic standards. the studies with structural analogues of 2-hep presented here provide new information toward a better understanding of the mechanism of hepd. at present, we do not have direct evidence for the early steps in the proposed mechanistic cycle, but because external reducing equivalents are not required for the overall transformation, and because the substrate does not contain low energy electrons, there appears to be no pathway for formation of more reactive species than a formally ferric - superoxo intermediate. in addition, the results of the current study also strongly suggest the oo bond is not broken prior to hydrogen atom abstraction from substrate. two other nonheme iron dependent enzymes also achieve substrate oxidation without input of exogenous electrons. for myo - inositol oxygenase (miox), bollinger and krebs and co - workers have provided strong spectroscopic and kinetic evidence that a ferric - superoxo species is formed reversibly in the confines of an enzyme active site and that it is capable of abstracting a hydrogen atom from a ch bond that is activated by a geminal hydroxyl group. dft studies on isopenicillin n - synthase (ipns) concluded that the formation of a ferric superoxo form of the enzyme is favorable only because of charge donation from a thiolate ligand from substrate ; similar calculations on phenylalanine hydroxylase, another facial triad, mononuclear nonheme iron dependent enzyme, demonstrated that oxygen binding to the ferrous enzyme was highly unfavorable.(17) in the latter computations, two water molecules occupied the sites that in hepd are occupied by alkoxide and phosphonate ligands of the 2-hep substrate. although the oxygen ligands of 2-hep may not provide the same charge donation as the thiolate ligand of the -(l--aminoadipoyl)-l - cysteinyl - d - valine (acv) substrate of ipns, substrate coordination in hepd, as well as in hppe,(7) may also enhance oxygen binding and activation. with respect to the steps after hydrogen atom abstraction, this study with substrate analogs strongly supports a hydroperoxylation pathway for hepd. this transformation is most readily explained as a criegee - like rearrangement (scheme 6) in which a phosphorus atom migrates. acetylphosphate is shown to be a potent inhibitor of hepd explaining why only a single turnover occurs, with the inhibition likely due to the resemblance of acetylphosphate to hmp - formyl ester. the proposed phosphorus migration has precedent in baeyervilliger oxidation of dialkyl acylphosphonates in organic solvents that have been shown to proceed through a criegee intermediate.(18) the hydroperoxylation mechanism can also explain the observed conversion of hmp into phosphate and formate with formylphosphate a likely intermediate (scheme 6). unlike acetyl phosphate, which has been shown to be stable at neutral ph for months,(19) formylphosphate is unstable and readily hydrolyzes nonenzymatically to phosphate and formate as observed by benkovic and co - workers for the reaction catalyzed by purt gar formyltransferase.(20) hepd is regenerated in its fe(ii) state in this model and, unlike with 1-hep, the enzyme is not inactivated due to the rapid hydrolysis of formylphosphate, accounting for the catalytic turnover of hmp to phosphate and formate. elucidating the details of the mechanism by which the alkylhydroperoxides are formed from a ferric hydroperoxide and after initial hydroperoxylation, criegee - like rearrangement would result in trifluoroacetylphosphate, which is more reactive toward hydrolysis than acetylphosphate and is not detected directly. why hepd is inactivated during this process resulting in a single turnover is not clear as trifluoroacetate is not an inhibitor. it is possible that trifluoroacetyl phosphate remains bound to the iron center after its formation in the active site and that hydrolysis only occurs after protein denaturation associated with product analysis. the results of the detailed investigation of the conversion of (2r)-hpp to opp are also consistent with initial hydroperoxylation followed by a criegee rearrangement. previously, we did not observe hydrogen peroxide production,(4) which appeared to be incompatible with the hydroperoxylation mechanism because stoichiometric conversion of (2r)-hpp to opp should produce 1 equivalent of h2o2. half an equivalent of h2o2 has been shown to inactivate approximately 1 equiv of fe(ii)-hepd,(4) and thus 0.5 equivalents of h2o2 should remain upon oxidation of (2r)-hpp and should have been detected. however, as noted in the supporting information of our previous study, a caveat in this model was that the conversion of (2r)-hpp to opp could not be quantitated at the time. in this study, we were able to analyze the products by p nmr spectroscopy after solving previous problems with peak broadening. the results show that conversion of (2r)-hpp to opp is not quantitative and that (2r)-hpp oxidation partitions between formation of opp and hmp along with acetate (scheme 7). the latter reaction is similar to the physiological reaction, conversion of 2-hep to hmp and formate. presumably, an intermediate in this process is o - acetyl - hydroxymethylphosphonate (viii) that is hydrolyzed to acetate and hmp. the partitioning also explains why h2o2 was not observed in the previous study since only 0.6 equivalents of opp (and hence h2o2) are formed with respect to hepd. this amount is sufficient to completely oxidize the enzyme, but very little h2o2 would remain after hepd oxidation. the partitioning between carbon migration and peroxide elimination suggests that adding an additional methyl group to c2 results in less favorable orbital overlap for a criegee rearrangement such that peroxide elimination competes. the observed conversion of (2r)-hpp to opp is reminiscent of the conversion by hppe of (2r)-hpp, the enantiomer of the physiological substrate, to opp. thus, when a hydrogen atom is available for abstraction at c2, both hepd and hppe carry out the same transformation with (2r)-hpp. on the other hand, unlike hppe, hepd can not be coerced to abstract a hydrogen atom from c1 of (2s)-hpp. we note that the observed oxidation of (2r)-hpp and not (2s)-hpp by hepd is consistent with the active site geometry and bidentate binding mode of 2-hep observed in the cocrystal structure of cd - hepd with 2-hep.(4) unfortunately, attempts to obtain direct evidence for the hydroperoxylation / criegee rearrangement mechanism with 2-hep as substrate have so far been inconclusive. ofhmp, the penultimate intermediate in the hydroperoxylation pathway with 2-hep, was synthesized and presented as a substrate for hepd but enzymatic hydrolysis was not observed. this result may be rationalized by inability of the product to bind to the reactive form of the enzyme, which may only be accessed during turnover. alternative direct support for the hydroperoxylation followed by a criegee rearrangement may be obtained with 2-hep stereospecifically labeled at c1. net inversion of configuration is predicted by this mechanism (retention in the criegee rearrangement step and inversion for subsequent hydrolysis at c1), whereas net retention of configuration is most likely for the hydroxylation mechanism ; experiments to examine these predictions are ongoing. in summary, the studies presented here with substrate analogues provide evidence for a hydroperoxylation mechanism for hepd that is followed by a criegee - like rearrangement. as such, the enzyme has similarities with flavin dependent bayer - villigerases, except that the substrate for hepd is at a lower oxidation level than the carbonyl - containing substrates of these enzymes. the corollary of the hydroperoxylation mechanism of hepd is that the oo bond of molecular oxygen is not broken prior to substrate activation, as has been proposed for the aforementioned nonheme iron enzymes miox and ipns, for a diiron(ii / iii) superoxide model complex,(25) and for the copper - dependent enzymes dopamine monooxygenase, peptidyl glycine -hydroxylating monooxygenase, and galactose oxidase. we note that seto and co - workers in pioneering studies had proposed that phosphonoacetaldehyde was converted to hmp via a baeyervilliger like oxidation to ofhmp followed by nonenzymatic hydrolysis.(31) although the molecular details turn out to be different, the overall biosynthetic logic is remarkably similar. hepd was overexpressed in e. coli as an n - terminal his6-fusion protein and purified via affinity chromatography as previously described.(4) protein concentrations were determined by the method of bradford using bovine serum albumin as the standard. in addition, a theoretical extinction coefficient of 79 995 m cm was calculated using expert protein analysis system (expasy, http://www.expasy.org) and concentrations determined using this value were within 10% of the concentrations determined by the bradford assay. thus, while small deviations from the reaction stoichiometries reported herein are possible, they would not change the interpretation of these studies. all activity assays were performed in hepes buffer (25 mm, ph = 7.5) unless otherwise noted. lc - ms was performed on an agilent 1200 series quad pump system equipped with a diode array detector and a g1956b mass spectrometer with a multimode - electrospray / atmospheric pressure chemical ionization (mm - es+apci) source. the column used for separation was a synergi 4 fusion - rp 80a column (150 4.6 mm, 4 m, phenomenex torrance, ca) using a flow rate of 0.5 ml / min. gc - ms was performed on an agilent 6890n gas chromatograph equipped with an electron impact (ei) ionization source. nmr spectra were recorded on a varian unity 500 or varian unity inova 600 spectrometer. proton and carbon chemical shifts are reported in values relative to an external standard of 0.1% tetramethylsilane in cdcl3 (0.00 ppm). phosphorus shifts are reported in values relative to an external standard of 85% phosphoric acid (0.00 ppm). fluorine shifts are reported in values relative to an external standard of cfcl3 (0.00 ppm). fast atom bombardment (fab) mass spectrometry for characterization of synthetic compounds was performed by the university of illinois mass spectrometry center using a waters 70-se-4f mass spectrometer. 2-hep and hmp were synthesized as previously reported.(4) the following substrate analogues were synthesized according to literature procedures : 2-oh - hep,(14) (2r)- and (2s)-hpp,(12) 3-hydroxypropylphosphonate,(32) 2-hydroxybutylphosphonate,(33) 3-fluoro-2-hydroxypropylphosphonate,(34) 2-fluoroethylphosphonate,(35) phosphonoacetaldehyde,(36) and 1-hydroxyethylphosphonate.(37) ethylphosphonate and aminoethylphosphonate were purchased from sigma - aldrich. n-(3-dimethylaminopropyl)-n-ethylcarbodiimide (edc) was purchased from chem - impex (wood dale, il). all other chemicals were purchased from sigma aldrich at the highest purity and used without further purification. a round - bottom flask equipped with a magnetic stir bar and reflux condenser was charged with dibenzyl hmp(38) (500 mg, 1.7 mmol), which was dissolved in formic acid (3 ml) and heated under reflux while stirring overnight. the solution was allowed to cool to 25 c, and et2o (20 ml) was added. a solution of aqueous naoh (1 m) was added dropwise until a second layer formed. the layers were separated and water was removed from the aqueous (bottom) layer under reduced pressure to afford product as a white solid. ofhmp was relatively stable in buffered hepes solution (25 mm, ph = 7.5). h nmr (500 mhz, d2o) 4.09 (d, j = 8.5 hz, 2h, ch2), 7.99 (s, 1h cho) ; c nmr (125 mhz, d2o) 59.4 (d, j = 156.9 hz), 163.5 ; p nmr (202 mhz, d2o) 13.7. under a nitrogen atmosphere a round - bottom flask equipped with a magnetic stir bar and reflux condenser was charged with commercially available diethyl 1-hydroxy-2,2,2-trifluoroethylphosphonate (1 g, 4.2 mmol, 1 equiv), which was dissolved in dry dcm (10 ml). to the solution was added bromotrimethylsilane (2 ml, 15.1 mmol, 3.6 equiv) and the orange solution was heated under reflux while stirring for 2 h. the solution was allowed to cool to 25 c and solvent was removed under reduced pressure. the resulting residue was taken up in 1:1 h2o : etoh (10 ml) and solvent was removed under reduced pressure to afford product (663 mg, 3.7 mmol, 88%) as a tan oil. h nmr (500 mhz, d2o) 4.09 (m) ; c nmr (125 mhz, d2o) 27.76 (d, j = 8.5), 66.01 (m) ; p nmr (202 mhz, d2o) 11.13 (bs) ; f nmr (215 mhz, d2o) 17.34 (at) ; hrms (fab) calcd for (c2h4f3o4p+h) 180.9878 m / z found 180.9880 m / z. enzymatic assays were quenched by adding h2so4 (30 mm) and the protein was pelleted via microcentrifugation (1 min at 16.1 g). the supernatant was analyzed via lc - ms (positive mode) using aqueous 0.1% formic acid as an isocratic mobile phase and scanning masses of 50500 m / z. hepd was separated from the assay via centrifugal filtration (millipore micron ym-30, 30 kda nominal molecular weight limit). d2o (20% v / v) was added to the flow - through and the p nmr spectrum was recorded on a varian ui600 (frequency for phosphorus : 242 mhz). following a modified literature procedure,(39) to a 100 l sample was added propionic acid as an internal standard (10 l of a 1 mm stock solution in 1:1 pyridine : hcl), followed by edc (10 l of a 0.29 m stock solution), and subsequently nph (10 l of a 0.12 m stock solution in 250 mm aqueous hcl). the orange solution was heated to 60 c in a water bath for 15 min and precipitated protein was pelleted via microcentrifugation (1 min at 16.1 g). the supernatant (20 l) was analyzed via lc - ms using an isocratic mobile phase (50:50 meoh : h2o + 0.1% formic acid) for separation. authentic standards of sodium c - formate, sodium acetate, and propionic acid were also derivatized and analyzed by monitoring the absorbance at 400 nm and by mm - es+apci (negative mode) and found to have retention times of 5.81, 5.93, and 6.93 min, respectively. the observed m / z values for each derivatized compound corresponded to the monodeprotonated hydrazide and were : 181 (c - formate), 194 (acetate), and 208 (propionic acid). solutions of varying concentrations of each of these acids were made in hepes buffer (25 mm, ph = 7.5), derivatized, and analyzed via lc - ms as described previously using single ion monitoring (sim) for the derivatized acid of interest. the area of the peak corresponding to derivatized acid was divided by the area of the derivatized propionic acid peak to afford a response factor, which was plotted against the acid concentration to afford a linear relationship. this equation was used to quantify the organic acid concentration in the enzymatic assays. in a typical assay hepd (10 m) and hmp (2 mm) were added to oxygenated buffer (25 mm hepes, ph 7.5) and incubated at 25 c for 2 h. the sample was then analyzed via p nmr spectroscopy (proton coupled and decoupled). the carbon - containing product was identified by running an assay similar to the one described above except using h2hmp as the substrate and subsequent derivatization and quantification of organic acids as described above. in a typical assay, o - formyl-2-hydroxymethylphosphonate (ofhmp, 2 mm) was incubated with hepd (10 m) for 2 h and samples were analyzed via p nmr spectroscopy. a control sample without hepd was also analyzed in a similar fashion. to determine which enantiomer of hpp is oxidized, hepd (500 m) and either (2s)- or (2r)-hpp (1.5 mm) were incubated in oxygenated hepes buffer (25 mm, ph 7.5) for 2 h at 25 c. the masses for protonated 2-hpp (141) and opp (139) were extracted from the total ion chromatogram (tic) to afford a single peak in each extracted ion chromatogram (eic) with retention times of 6 and 7 min, respectively, that were identical to authentic standards of 2-hpp and opp. to determine the stoichiometry of the oxidation of (2r)-hpp to opp via lc - ms, first a linear relationship between opp concentration and area of the peak in the eic was established by analyzing varying concentrations of synthetic opp in buffer (50, 100, 250, 500, and 1000 m). similar assays as previously described were then carried out with varying concentrations of hepd (100, 250, and 500 m) and (2r)-hpp (3-fold excess over hepd), which were analyzed via lc - ms. to determine the stoichiometry of the oxidation of (2r)-hpp to opp by nmr spectroscopy, (2r)-hpp (1.5 mm) was incubated with hepd (500 m) for 2 h. edta (50 mm) then dithionite (10 mm) and d2o (20% v / v) were added and the p nmr spectrum was recorded. the edta and dithionite were necessary to abrogate the line broadening effect of a high concentration of paramagnetic fe(iii) in the sample. additionally, (2r)-hpp (1.5 mm) was incubated with hepd (500 m) for 2 h and the sample was analyzed for organic acids as described above. to identify the carbon - containing product of 1-hydroxyethylphosphonate, hepd (100 m) was incubated in oxygenated buffer with 1-hep (300 m) for 2 h at 25 c. the organic acids were then derivatized and analyzed via lc - ms as described above. to identify the product of 1-hep - cf3, hepd (100 m) was incubated in oxygenated hepes buffer with 1-hep - cf3 (300 m) for 2 h at 25 c, then d2o (20% v / v) was added and the f nmr spectrum recorded. standards of 1-hep - cf3 and sodium trifluoroacetate showed peaks at 72.5 ppm and 76.0 ppm, respectively. to identify the phosphorus containing product, 1-hydroxy ethylphosphonates (1.5 mm) were incubated with hepd (500 m) for 2 h. edta (50 mm) then dithionite (10 mm) and d2o (20% v / v) were added and the p nmr spectrum was recorded. standards of 1-hep and 1-hep - cf3 under similar conditions had chemical shifts of 19.2 ppm and 7.3 ppm, respectively. phosphate, phosphite, and acetyl phosphate under these conditions had chemical shifts of 2.3 ppm, 4 ppm, and 2.2 ppm respectively. hepd (2 m) and 2-oh - hep (2 mm) were added to oxygenated buffer, incubated at 25 c for 2 h, and then analyzed via lcms as described above. the masses for protonated hmp and oh - hmp (115 and 117, respectively) were extracted to afford a single peak in each eic with a retention time of 5.4 min. additionally, formate was analyzed via gc - ms as previously reported(4) to determine the isotopic composition.	hydroxyethylphosphonate dioxygenase (hepd) catalyzes the o2-dependent cleavage of the carboncarbon bond of 2-hydroxyethylphosphonate (2-hep) to afford hydroxymethylphosphonate (hmp) and formate without input of electrons or use of any organic cofactors. two mechanisms have been proposed to account for this reaction. one involves initial hydroxylation of substrate to an acetal intermediate and its subsequent attack onto an fe(iv)-oxo species. the second mechanism features initial hydroperoxylation of substrate followed by a criegee rearrangement. to distinguish between the two mechanisms, substrate analogues were synthesized and presented to the enzyme. hydroxymethylphosphonate was converted into phosphate and formate, and 1-hydroxyethylphosphonate was converted to acetylphosphate, which is an inhibitor of the enzyme. these results provide strong support for a criegee rearrangement with a phosphorus - based migrating group and require that the oo bond of molecular oxygen is not cleaved prior to substrate activation. (2r)-hydroxypropylphosphonate partitioned between conversion to 2-oxopropylphosphonate and hydroxymethylphosphonate, with the latter in turn converted to phosphate and formate. collectively, these results support a mechanism that proceeds by hydroperoxylation followed by a criegee rearrangement.
malaria is a life - threatening disease, which is responsible for roughly 1 million deaths each year. approximately 40% of the world 's population is exposed to the risk of malaria, particularly those in tropical and subtropical countries. malaria also poses a huge economic burden in countries where the disease is endemic, cutting economic growth rates by as much as 1.3% in countries with high disease rates. previous successes in attempting to eradicate the disease were only relatively short - lived due to increasing resistance of the mosquito to insecticides and of the parasite to established drugs. in many parts of the world, emerging resistance is responsible for a recent increase in malaria mortality, particularly in countries that had previously eliminated its presence. the disease has worldwide implications due to the increase in air travel, with travelers from malaria - free areas of the world especially vulnerable ; therefore, the development of new and more effective antimalarial chemotherapy has never been more important. the plasmodium falciparum parasite, which is the most deadly form of the malaria parasite, has developed resistance to chloroquine in many parts of the world. there are strenuous and continued efforts to identify novel small molecules that either circumvent chloroquine resistance or act on alternative stages of the malaria parasite lifecycle. one target that has received attention is the mitochondrial respiratory chain of p. falciparum. atovaquone (part of combination therapy malarone) targets the cytochrome bc1 complex (complex iii) in the mitochondrial electron transport chain of p. falciparum. the electron transport chain is an attractive chemotherapeutic target in that it differs from the human host in that it lacks a canonical protonmotive nadh : ubiquinone oxidoreductase (complex i) ; rather, it has a single subunit, nonprotonmotive ndh2. using an escherichia coli nadh dehydrogenase knockout strain (ann0222, ndh::tet nuob::npti - sacrb), we have developed a heterologous expression system for pfndh2 facilitating its physiochemical and enzymological characterization. pfndh2 is a metabolic choke point in the respiratory chain of the parasite 's mitochondria and is the focus of the discovery program toward the development of novel therapy for uncomplicated malaria. we have previously described a miniaturized spectrophotometric assay for recombinant pfndh2 (steady state nadh oxidation and ubiquinone reduction monitored at 340 and 283 nm, respectively) with robust assay performance measures. this assay forms the basis of the high - throughput screen (hts) sequential screening program. the objective of this program was to identify novel chemotypes that act as selective inhibitors of pfndh2. upon commencement of the program, there was only one molecule that was known to exhibit pfndh2 activity, 1-hydroxy-2-dodecyl-4-(1h)quinolone (hdq) (figure 1), which has an ic50 value of 70 nm. our discovery program used virtual screening to select a 16050 compound subset of the 750000 compound biofocus library for a high - throughput in vitro screening campaign. the authors describe here the use of chemoinformatics, virtual screening, and computational methods to identify the best subset of compounds from the biofocus database and the screening of these compounds using the pfndh2 hts assay to identify novel chemical hit series, with diverse chemotypes, for subsequent medicinal chemistry development. structure of hdq and the identity of the proposed key moiety in the structure. virtual screening emerged in the 1990s as a way of predicting bioactive compounds using computational methods. there are many examples of successful use of such approaches in the literature for both hit finding and hit - to - lead optimization stages of the drug discovery process. the methods of virtual screening are usually defined as either structure - based or ligand - based. structure - based approaches use knowledge of the 3d structure of the biological target, whereas ligand - based approaches rely on the knowledge of the structure of compounds exhibiting the desired activity. this current work adopts a ligand - based approach as there is no crystal structure of the pfndh2 target and it displays poor homology with any published structure in the pdb. ligand - based virtual screening approaches rely on the complementary area of chemoinformatics, which has been defined as the the application of informatics methods to solve chemical problems. there have been an increasing number of publications that have made use of chemoinformatics in recent years, partly driven by the increasing pressures on the pharmaceutical industry to increase productivity, while decreasing costs. using computational approaches to expedite the identification of candidate molecules that are predicted to possess the desired properties is an efficient approach to discovery. with the incorporation of computational filters for properties synonymous with unfavorable pk / pd profiles, the aim of chemoinformatics is to reduce compound attrition rates at all stages in the discovery process. in this work, our definition of the best set of compounds is a multidimensional challenge. set of compounds is whether a compound is predicted by virtual screening and chemoinformatic methods to possess the desired activity against pfndh2 in the hts assay. the second dimension of this quality metric is that the compounds assayed possess desirable lead / druglike characteristics. over the past few years, there have been many publications concerning the identification of molecular properties of compounds that are common among drugs and drug candidates. this has led to many rules of thumb to guide discovery of molecules that are likely to possess the appropriate absorption, distribution, metabolism, excretion, and toxicity (admet) characteristics and be amenable for further development along the drug discovery pipeline. the third dimension of the metric for best set of compounds is that of optimal sampling of chemical space. in the project, we had the resources to assay approximately 17000 compounds in total ; therefore, we had to explore chemical space in the most efficient way possible to yield the most information - rich set of results that would be the most informative for both the sequential screening stage and the final compound selection phase. in summary, best set of compounds are those that are predicted to be active against the target, possess desirable drug / lead like characteristics, and sample chemical space the most effectively. in this paper, we described the use of chemoinformatics and virtual screening methods to select an optimal set of compounds for hts screening leading to the identification of new chemotypes that display activity against the pfndh2 malarial target. overall, our approach consisted of four fundamental stages : (i) transfer and optimization of assay from in - house to biofocus, (ii) substructure search of quinolin-4-one in biofocus library followed by preliminary hts screening, (iii) chemoinformatic compound selection from biofocus library based on results of preliminary screening, and (iv) hts screening of selected compounds followed by hit confirmation. initial substructure searching of the biofocus library for compounds, which contained the key moiety, the core of hdq (figure 1), revealed 1175 compounds. these compounds underwent screening using the spectrophotometric assay previously developed and validated by us, which had subsequently been transferred to biofocus. duplicate five point dose response curves ranging from 20 m to 78 nm revealed the presence of 54 new active compounds (ic50 70%. the identity of these active compounds and hdq along with the identity of the inactive compounds provided the basis of the virtual screening and compound selection. as the primary goal of this work was to identify novel chemotypes, we used chemoinformatic methods to achieve a scaffold hop, that is, identification of structurally diverse compounds that exhibit the desired biological activity. we applied seven different virtual screening methods in parallel to identify compounds from the biofocus library. indeed, 2d fingerprint searching has been shown to outperform 3d methods in some situations. recently, it has been reported that fingerprints can be used successfully to achieve a scaffold hop. the use of fingerprints is particularly attractive for large scale screening as the calculations are quick (as compared with other methods such as protein : ligand docking), and 3d structures of the molecules do not need to be generated or stored. we applied a range of different fingerprinting methods to navigate chemical space in a variety of different ways. we employed mdl molecular access system (maccs) keys, ecfp2, and fcfp2 to identify compounds similar to any of the 55 actives (54 from substructure screening plus hdq) previously identified. the mdl keys are a set of predefined substructural fragments that have been used in similarity searching due their speed of calculation and comparison and broad experience in application. the publicly available 166 bit key set has found a variety of uses in the drug discovery workflow. extended connectivity fingerprints (ecfps) have been shown to have a number of strengths that make them useful for similarity searching. ecfps are a fingerprint methodology explicitly designed to capture molecular features relevant to molecular activity. they can be quickly calculated, as they are not defined a priori (in contrast with mdl maccs keys) and they can represent novel structural classes. functional class fingerprints (fcfps) are a related fingerprint to ecfps but instead of using a specific atom identifier for the initial atom in the algorithm to generate the fingerprint, fcfps use a more abstract pharmacophoric set of initial atom identifiers based on properties such as hydrogen bond acceptor and donor, negatively and positively ionizable, aromatic, and halogen. a study of a wide variety of similarity coefficients (22 in total) that may be employed in similarity searching supports the use of the popular tanimoto coefficient as compared with the alternatives. there is little literature precedent for the cutoff value that should be used for a given fingerprint and similarity coefficient to identify a compound displaying the desired activity. there is, however, a study that used the daylight fingerprint methodology and taminoto coefficient and suggested that a coefficient of greater than or equal to 0.85 would result in a 30% chance of the compound exhibiting similar biological activity to the query molecule. however, the fingerprints employed in the current study are different to the daylight methodology in the aforementioned study so these analyses may not apply. consequently, we have chosen similarity thresholds to seek to obtain a balance between the numbers of compounds using a threshold of 0.8 for the mdl maccs keys found 8784 compounds, whereas for ecfp2, a tanimoto threshold of 0.6 gave 333 compounds, and fcfp2 with a tanimoto coefficient 0.75 highlighted 435 compounds. interestingly, these threshold values match up extremely well with a paper (published after this work was performed), which indicates that the probability assignment of a particular similarity measure of finding 50% of all possible actives using a given measure for maccs keys should use a value of 0.82, whereas 0.52 should be used for ecfp2 and 0.75 for fcfp2values very similar to the ones we had selected. thus, the combination of these three fingerprint approaches would hopefully maximize the chances of identifying compounds that were sufficiently similar to one of the query compounds to display inhibition of pfndh2. the fourth chemoinformatic method that was used to identify compounds with the desired biological profile was turbo similarity searching. turbo similarity searching has been developed to increase the effectiveness of virtual screening when there is little information available. the approach uses the multiple databases searches using the nearest neighbors resulting from an initial similarity search. the results from these searches are then combined together using group fusion and the molecules ranked by the fusion score. this approach has been shown in simulated virtual screening to show impressive performance in retrieving active molecules. for our work, turbo similarity searching was performed using the 55 active compounds as initial query molecules and identifying the 50 nearest neighbors to each compound using ecfp4 fingerprints and the tanimoto coefficient. these molecules were then used as the queries searching the database utilizing the ecfp4 fingerprints. the top 250 compounds from each nearest neighbor search were summed using the tanimoto coefficient and identified 4891 unique compounds. the concept for these searches was to identify bioisosteres of the key moiety headgroup of hdq [4-(1h)quinolone ] (figure 1), thus employing the principle of isosterism, in that similar molecules usually possess similar properties. thirty - eight scaffold isosteres of the 4-(1h)quinolone headgroup (hdq) were identified using a variety of 2d topological pharmacophores. the pharmacophores used were based on the cahart strategy where a feature refers to two chemical groups separated by a certain 2d path length. atom - based, fragment - based, and pharmacophore - based binary descriptors were investigated using the tanimoto coefficient. the atom - based approach is likely to retrieve very close analogues to the query compound, while fragment and pharmacophore searches were more likely to find more diverse analogues. continuous descriptors were also employed to identify isosteres of the 4-(1h)quinolone headgroup using a modified burden number using the euclidean distance. both binary and continuous approaches were used to search a range of databases (e.g., acl and nci diversity database) using 4-(1h)quinolone as the query. compounds identified by these methods were examined by eye by medicinal chemists before inclusion in the list of scaffold isosteres. the thirty - eight substructures were used to search the biofocus database, and 137693 compounds were found. this number of compounds was too large for this current work, and a simple selection procedure was employed. for those isosteres that retrieved less than 1000 compounds, all were kept, but for searches that highlighted more than 1000 compounds, a maximally diverse selection procedure was used to sample the compounds identified, while retaining the maximum coverage of chemical space possible. to achieve this, we used fcfp4 fingerprints together with diversity selection to achieve a maximum similarity selection. bayesian methods rely on the estimation of probability distributions of numerical representations of compounds based on molecular properties of fingerprints. each descriptor value of a molecule is considered in turn, and the probability of activity is considered to be proportional to the ratio of actives to inactives that share that descriptor value. the overall probability of activity is the product of all of the probabilities. this nave approach assumes statistical independence of descriptors ; however, theoretical results suggest that large deviations from independence can be tolerated. a bayesian model was built using the 1175 molecules screened initially (55 actives the rest inactive) using a variety of physicochemical properties (alogp, mw, number of hydrogen bond donors, number hydrogen bond acceptors, number of rotable bonds, polar surface area) and fingerprints (ecfp2) as the molecular descriptors. the descriptors were binned, and low - information content bins were removed due to a poor normalized estimate. a leave - one - out cross - validation process was employed to build the model in which each sample was left out one at a time and a model built using the results of the samples and that model used to predict the left - out sample. the area under the receiver operator curve for the cross - validation set was 0.881. thus, given an active molecule and an inactive molecule and one used the model to guess which one was the hit, one would be right 88% of the time. using this split a contingency table revealed the number of true positives, true negatives, false positives, and false negatives. the figure of accuracy of 0.924 indicates that the model generated was very good. the performance of this model using the whole data set was assessed through examination of its enrichment performance. in the first 25% of the molecules tested, over 80% of the active molecules were retrieved. application of the bayesian model to the biofocus collection identified 11702 compounds that were predicted to be active. principle component analysis (pca) was used as the seventh method for compound selection. pca is a simple, nonparametric method of extracting relevant information from complex data sets that are often confusing, clouded, or even redundant. pca transforms a number of possibly interdependent or correlated variables into a smaller number of significant, independent, and uncorrelated orthogonal components. a principal component model of the initial 55 active compounds was constructed using 20 physicochemical descriptors (see the experimental section details for a full list). the model constructed explained 88.5% of the overall variance of the active compounds in three principal components. the euclidean distance was used to identify from the biofocus library the 5000 closest compounds in the three - dimensional principle component space to any of the active molecules. thus, we were identifying the nearest neighbors to the active compounds in pca space. the results of the seven virtual screening methods were combined and identified 34356 unique compounds that were predicted by one or more methods to be similar in some way to one or more of the initial set of 55 active compounds. this number of compounds was not able to be screened in the in vitro assay ; hence, we undertook scoring and diversity sampling protocols to select the best subset of 16000 compounds that achieved the optimal coverage of chemical space while biasing the selection such that compounds that had been selected by more than one chemoinformatics approach were more likely to be included in the final 16000 molecular set. the concept that we employed was that of consensus scoring, which can lead to tremendous improvements in virtual screening through the improved quality of the results obtained. ligand - based virtual screening consensus scoring can show improved performance over a single scoring protocol due to the fact that the mean of repeated samplings is closer to the true value than one single measurement. also, different methods agree more on the ranking of actives than inactives, which arises from the fact that different ligand - based virtual screening protocols focus on different aspects of the ligand binding process and thus lead to different false positives. also, it has been suggested that actives are clustered more tightly than inactives ; thus, multiple samplings will recover more actives than inactives. a scoring function was applied to each compound accounting for how often any of the seven virtual screening methods had identified a compound and also took into account key druglike properties (vide infra). the druglike properties that were calculated for each compound were solubility, octanol / water partition coefficient, and molecular weight. scoring functions were applied for these molecular characteristics displayed in table 1 and figure 2., the lower bound was chosen due to the fact that during hit to lead development and onward through the preclinical discovery pipeline, there is, in general, an increase in molecular weight of a potential candidate. the second influence on our choice of these boundaries was the lipinski guidelines for passive absorption of drugs. solubility is a key factor in any drug discovery program, and as such, compound predicted solubility was assessed. these values were selected as previous work has suggested that for a compound showing high permeability and a potency of 0.1 mg / kg, the aqueous solubility needs to be 1 g / ml to be completely absorbed. for example, for a compound with a molecular weight of 400, 5 g / ml corresponds to a log s value of 5.6. the octanol / water partition coefficient is one of the key molecular characteristics for any compound as it plays a key determinant in preclinical admet and the increasing body of evidence that suggests that molecules with optimal lipophilicity might have increased chances of success in development. for example, it has been shown that the promiscuity of a given compound increases dramatically if log p is greater than 3, and other work has suggested that compounds with a log p value of less than 4 (and molecular weight less than 400) have a greatly increased chance of success against a comprehensive set of admet tests. taking these into account, a compound scoring function was derived as displayed in figure 2 and table 1. thus, each compound was assigned a score according to its druglikeness considering its solubility, lipophilicity, and aqueous solubility. each compound was scored using the seven virtual screening methods described above using range - scaled scores. the compounds selected by the turbo similarity search were scored using the tanimoto coefficient of the nearest neighbor identified in the turbo search. molecules predicted to be active via the bayesian model (bayesian score cutoff > 5) were scaled between 0 and 1. the pca distances of the 5000 compounds selected were scaled between 0.5 and 1 with the closest compound scoring 1 and most distant 0.5. these range - scaled virtual screening scores were combined with the physicochemical molecular properties to give a final virtual screening score as defined in eq 1. as we sought to favor selection of compounds that were predicted to be active according to our virtual screening models, the score for molecular weight was multiplied by two to enhance the likelihood of selecting smaller compounds, while the solubility and lipophilicity function were applied unchanged. upon collation of all of the data, there were in total 34356 unique compounds selected, each of which had a virtual screening score calculated. the virtual screening score is our numerical assessment of how good a molecule is in terms of likelihood of possessing the desired profile in terms of activity and admet properties. the form of the virtual screening score assigned to each compound is as follows:1these 34356 compounds were then subjected to a series of filters with hard cut - offs to eliminate compounds that did not possess desirable druglike properties. compounds were discarded if they failed more than one of the following properties : molecular weight > 600, alog p > 6, number of hydrogen bond donors > 6, number of hydrogen bond acceptors > 11, number of rotable bonds > 14, and polar surface area > 150. the reason that we slightly relaxed the published guidelines was that the original publications were based on properties of the majority of compounds that passed certain criteria. thus, by relaxing these guidelines slightly, we hope to maximize our chances of finding novel chemotypes so we did not want to preclude molecules too early. when these cut - offs were applied, there were 32727 compounds that were taken forward. to select 16000 compounds for hts, a procedure was employed to choose the most diverse 16000 compound set from the 32727 compounds. this approach was chosen as we desired to identify new scaffolds active against pfndh2 ; thus, selecting the most diverse subset was considered advantageous over selecting the top 16000 highest scoring compounds. to achieve the diversity selection, bcut descriptors were used, as these have previously been used in diversity selection. all but two compounds were successfully calculated ; these two compounds contained a positively charged sulfur atom and a positively charged phosphorus, both types of atoms unlikely to produce a suitable druglike compound. histograms of the final virtual screening score were examined for the set of 32727 compounds and the 16000 compound set. it is noteworthy that upon compound selection the distribution of virtual screening scores altered to favor compounds with higher virtual screening scores (figure 3). thus, any additional biasing of high - scoring compounds was not considered necessary. compounds in the lower scoring bins were included, as recent work has highlighted the possibility of achieving a successful scaffold hop may come from compounds that have low similarity scores as assessed using molecular fingerprints. thus, low - scoring compounds overall may well still be able to achieve a scaffold hop. comparison of the virtual screening scores : (left) 32727 compounds and (right) 16050 compounds. the effect on this compound selection upon the coverage of chemical space available in the biofocus library was assessed. the diversity of compounds selected was examined using fingerprints with the tanimoto coefficient to compare the coverage of the chemical space within the entire biofocus library. the whole biofocus library of 750000 compounds displayed 37881 clusters (ranging from having 1 member to 2927 members), whereas the 16000 compounds selected gave 5913 clusters (having between 1 and 164 members). thus, 15.6% of the overall diversity within the library was covered by 2.1% of the compounds. three potential false negatives were identified from the initial screen from our previous work. a similarity search using ecfp2 was performed against the biofocus library, and the 50 most similar compounds were added to 16000 compounds to be screened. compounds were screened at a concentration of 20 m generating one data point per compound. the mean and median z factors on day one were 0.77 and 0.76, respectively, and on day two were 0.81 and 0.81. a total of 395 compounds (2.5% of the total screened) showed > 20% inhibition in the primary screen. to best resolve compounds with weak activity from the noise, a runwise multiplicative correction factor available within genedata screener software (assay analyzer module, genedata inc., this correction factor is created by a sophisticated pattern detection algorithm that detects subtle recurring patterns within the data set, and when applied, the median of the distribution of activity is brought in line with zero % inhibition, thereby tightening the data and potentially rescuing false negatives. using the corrected data, 333 compounds showed > 20% inhibition. of these 333 compounds, 24 had not been identified using noncorrected data. to maximize the chances of identifying weakly active compounds, any compounds that showed > 20% inhibition using either the corrected or the noncorrected data were progressed to retesting. this resulted in the progression of 419 compounds (395 + 24) to retest analysis. a total of 469 compounds were tested in triplicate for the ability to inhibit the pfndh2-catalyzed reaction. a total of 419 of these were identified from the primary screen, and a further 50 were included as structurally related to three potential false negatives in the 1175 screen. prior to initiating this phase of the hts, the pharmacology of hdq was reconfirmed to ensure comparable performance between the primary and the hit confirmation screens. these compounds were progressed to potency analysis to ensure capture of all compounds that showed activity in either the primary or the retest stages. the hit calling criteria were set such that if any one of the three percentage inhibition measurements for a given compound was > 30%, the compound was progressed for potency testing. in addition, compounds that showed > 50% inhibition in the primary screen but whose maximum triplicate retest values was 0.9. thus, our suite of chemoinformatics methods has enabled the discovery of novel antimalarial chemotypes as compared with the mass screening campaigns, and the results display extremely promising levels of inhibition for both the target enzyme and the whole cell inhibition. as such, these molecules are very attractive scaffolds on which to base a medicinal chemistry lead development program. consequently we have employed a wide range of ligand - based chemoinformatics methods in the rational selection of 16050 compounds that were predicted to possess activity against pfndh2 and possess favorable admet properties. these compounds were subjected to high - throughput screening triage against the p. falciparum ndh2 enzyme target. hit confirmation and potency determination revealed 48 compounds with ic50 values ranging from 100 nm to 10 m. analysis of these hits revealed several novel distinct chemotypes primed for development as new agents against malaria. to our knowledge, hitherto, hdq and the phenothiazines are the only selective compounds known to inhibit type ii nadh : ubiquinone oxidoreductase homologues from any organism. the hits discovered in this hts therefore represent a significant advancement and should enable chemical biology research into these enzymes from a number of important organisms including plasmodium, mycobacterium, trypanosomes, and yeast. all reagents were prepared in glassware prerinsed with deionized water followed by ethanol (etoh) and finally deionized water unless otherwise stated. with the exception of assay buffer and 1 m kcn, the assay buffer was prepared on the day of the assay and was comprised of 20 mm hepes (free acid, sigma h3375) in h2o, ph 7.4. one molar kcn was prepared in a fume hood using buffer and 10 m hcl to adjust the ph to 7.5. ten millimolar coq (sigma c7956) was prepared by dissolving 10 mg in 4 ml of etoh. this was then further diluted 10-fold in 25% dmso to give 1 mm working solution. one millimolar hdq was prepared fresh every 23 days by diluting a fresh weighing into methanol (meoh) ; this was then further diluted 20-fold in buffer to obtain the 50 m used in the assay (5 m in 0.5% meoh final assay concentration). a 0.1 m concentration of nadh (sigma n8129) was prepared in buffer contained in a light protective eppendorf tube ; the reagent was not used more than 3 h after preparation. a perkin - elmer envision with a 340/25 nm emission filter assay plates were black sided and clear bottomed, and the final well volume was 100 l. because absorbance is dependent on the path length, the reaction was initiated with a minimal volume of coq (2 l), and a 2% change in volume itself was deemed to have negligible effects on the absorbance and was consistent for all wells. control wells that received no coq received 2 l of diluent to maintain the path length and concentrations. the expected absorbance drop corresponding to 100% conversion of coenzyme q from the quinone to quinol form is 0.15 abs units. prior to the reaction, 11.36 mm kcn was prepared in assay buffer. for each 384-well plate to be screened, 83 l of 0.1 m nadh was added to 37.6 ml of 11.36 mm kcn / buffer followed by 108 l of 1:1 membrane (8 mg / ml). the glass container was then swirled to ensure thorough mixing of the assay mixture, and 88 l was added to each well containing 10 l of compound using a matrix multichannel pipet. a pre - read 340 nm absorbance value was then obtained prior to the addition of 2 l of 1 mm coq using a velocity11 bravo to initiate the reaction. the reaction was then mixed (20 l 3 cycles fast speed), and a post - read 340 nm absorbance value was obtained 1 min after reaction initiation. the final assay concentrations were therefore 200 m nadh, 10 mm kcn, 1 g / well membrane, 20 m coq, and 5 m hdq. the assay mixture was only stable for a few minutes (nadh oxidizes when in contact with the membrane) and was therefore prepared fresh for each plate where a 1 min reaction time was used or to support a batch of three plates where 3 min of reaction time was used. because the reaction was not stopped, it was important to keep the timings very tightly controlled a fresh weighing of lyophilized hdq was dissolved in meoh to a concentration of 1 mm. this stock was stored at 20 c and used for a maximum of 3 days. following data collection, the results were analyzed, and ic50 was calculated in graphpad prism (graphpad software, inc. preliminary assaying of the 1175 set of compounds was performed in replicate five - point concentration curves with a 4-fold dilution step in 100% dmso. the 1 l stock concentration curve was diluted 25-fold by the addition of 24 l of buffer to give a top concentration of 200 m in 4% dmso, that is, 20 m final in the assay. plates were formatted such that test compounds were present in columns 322 ; columns 1, 2, 23, and 24 contained 4% dmso with the exception of wells m - p1 and a - d24, which contained 50 m hdq as a positive control for tracking purposes. columns 1 (a l) and 24 (e p) contained the no - coq positive control used for data calculations ; instead of 2 l of 1 mm coq, these wells received 2 l of the carrier (22.5% dmso/10% etoh). the final well contents for phase 2 screen were 20 m top concentration of compound, 20 m coq (or diluent for the 100% inhibition controls), 0.85% dmso, and 0.2% etoh. assaying of the 16000 compounds was performed at 20 m for both the primary and the hit confirmation screens. plates were formatted such that test compounds were present in columns 122, and columns 23 and 24 contained 4% dmso with the exception of wells a - d24, which contained 50 m hdq as a positive control for tracking purposes. column 24 (e - p) contained the positive control used for data calculations ; these wells received 2 l of the carrier (22.5% dmso/10% etoh) instead of 2 l of 1 mm coq. the final well contents for phase 4 screen were approximately 20 m compound, 20 m coq (or diluent for the 100% inhibition controls), 0.85% dmso, and 0.2% etoh. plates were formatted such that test compounds were present in columns 322, and columns 1, 2, 23, and 24 contained 4% dmso with the exception of wells m - p1 and a - d24, which contained 50 m hdq as a positive control for quality control purposes. response curve of hdq, which had a final assay top concentration of 5 m in 0.5% meoh ; the curve was contained in rows o1322 and p1322. columns 1 (a l) and 24 (e p) contained the positive control used for data calculations, and these wells received 2 l of carrier (22.5% dmso/10% etoh) instead of 2 l of 1 mm coq. the final well contents for potency determination were 40 m top concentration of compound, 20 m coq (or diluent for 100% inhibition controls), 1.25% dmso, and 0.2% etoh. data were recorded as absorbance units prior to initiation of the reaction and after reaction completion. the pre- and postreaction absorbance values were imported into genedata screener assay analyzer (genedata inc., switzerland), and having defined the control populations, the % inhibition was calculated for each well. control wells used in the calculations did not receive compound (but were diluent controlled), and % inhibition was calculated using wells that had not received coq as 100% inhibition. five micromolar hdq wells were monitored to ensure that a high % inhibition was being achieved. the option of correcting the data for plate effects using assay analyzer 's runwise multiplicative correction factor (genedata inc.) was investigated, and this data set was taken into account for screen hit calling. response data were processed through genedata screener as described, then calculated, and plotted using xlfit 4.2.1. curve fitting was carried out using a 4-point parameter logistic equation, model 204. all of the methods below were performed in parallel on the biofocus compound collection. the biofocus compound collection of 750000 compounds was searched for compounds that contained the key moiety (figure 1) of hdq that we chose as 1h - quinolin-4-one using pipeline pilot. three types of molecular fingerprints were calculated using pipeline pilot : mdl maccs keys, fcfp2, and ecfp2. the similarity between the 55 active compounds and the biofocus library compounds was assessed using the tanimoto coefficient. using the 55 active compounds, ecfp4 were used as descriptors, and for each search, 250 of the highest ranking compounds were kept using the biofocus database. the descriptors calculated were alog p, molecular_weight, num_atoms, num_bonds, num_hydrogens, num_positiveatoms, num_negativeatoms, num_ringbonds, num_rotatablebonds, num_aromaticbonds, num_bridgebonds, num_rings, num_aromaticrings, num_ringassemblies, num_chains, num_chainassemblies, num_fragments, num_h_acceptors, num_h_donors, and molecular_solubility. the 5000 closest compounds to any of the hits as assessed by euclidean distance in pca were selected from the biofocus database using pipeline pilot. the descriptors calculated were as follows : alog p, molecular_weight, num_h_donors, num_h_acceptors, num_rotatablebonds, ecfp_2, and molecular_polarsurfacearea. the model was developed using leave - one - out cross - validation and applied to the biofocus database with compounds with a score of 5 or above being selected. bioisosteres were identified using powermv using a variety of descriptors, similarity measures, and databases : atom pair / tanimoto, atom pair (cahart)/tanimoto, fragment pair / tanimoto, pharmacophore fingerprints / tanimoto, and weighted burden number / euclidean methods were used against the acl, gene logic, and nci databases within powermv. the bioisosteres identified were used as substructure searches to identify compounds in the biofocus database using pipeline pilot. the scoring functions were implemented in pipeline pilot using the built in algorithms for molecular solubility and log p. bcut descriptors were calculated using the cdk descriptor calculator. a total of 16000 diverse compounds were selected using a protocol in pipeline pilot. ecfp4 fingerprints, using a similarity cut off of 0.7 with the tanimoto coefficient, were used together with clustering to compare the coverage of the chemical space of the 16000 selected compounds within in the entire biofocus library using protocols in pipeline pilot. ic50 values (50% inhibitory concentrations) were calculated by using the four - parameter logistic method (grafit program ; erithacus software, united kingdom). all of the methods below were performed in parallel on the biofocus compound collection. the biofocus compound collection of 750000 compounds was searched for compounds that contained the key moiety (figure 1) of hdq that we chose as 1h - quinolin-4-one using pipeline pilot. three types of molecular fingerprints were calculated using pipeline pilot : mdl maccs keys, fcfp2, and ecfp2. the similarity between the 55 active compounds and the biofocus library compounds was assessed using the tanimoto coefficient. ecfp4 were used as descriptors, and for each search, 250 of the highest ranking compounds were kept using the biofocus database. the descriptors calculated were alog p, molecular_weight, num_atoms, num_bonds, num_hydrogens, num_positiveatoms, num_negativeatoms, num_ringbonds, num_rotatablebonds, num_aromaticbonds, num_bridgebonds, num_rings, num_aromaticrings, num_ringassemblies, num_chains, num_chainassemblies, num_fragments, num_h_acceptors, num_h_donors, and molecular_solubility. the 5000 closest compounds to any of the hits as assessed by euclidean distance in pca were selected from the biofocus database using pipeline pilot. the descriptors calculated were as follows : alog p, molecular_weight, num_h_donors, num_h_acceptors, num_rotatablebonds, ecfp_2, and molecular_polarsurfacearea. the model was developed using leave - one - out cross - validation and applied to the biofocus database with compounds with a score of 5 or above being selected. bioisosteres were identified using powermv using a variety of descriptors, similarity measures, and databases : atom pair / tanimoto, atom pair (cahart)/tanimoto, fragment pair / tanimoto, pharmacophore fingerprints / tanimoto, and weighted burden number / euclidean methods were used against the acl, gene logic, and nci databases within powermv. the bioisosteres identified were used as substructure searches to identify compounds in the biofocus database using pipeline pilot. the scoring functions were implemented in pipeline pilot using the built in algorithms for molecular solubility and log p. bcut descriptors were calculated using the cdk descriptor calculator. a total of 16000 diverse compounds were selected using a protocol in pipeline pilot. ecfp4 fingerprints, using a similarity cut off of 0.7 with the tanimoto coefficient, were used together with clustering to compare the coverage of the chemical space of the 16000 selected compounds within in the entire biofocus library using protocols in pipeline pilot. ic50 values (50% inhibitory concentrations) were calculated by using the four - parameter logistic method (grafit program ; erithacus software, united kingdom).	malaria is responsible for approximately 1 million deaths annually ; thus, continued efforts to discover new antimalarials are required. a hts screen was established to identify novel inhibitors of the parasite 's mitochondrial enzyme nadh : quinone oxidoreductase (pfndh2). on the basis of only one known inhibitor of this enzyme, the challenge was to discover novel inhibitors of pfndh2 with diverse chemical scaffolds. to this end, using a range of ligand - based chemoinformatics methods, 17000 compounds were selected from a commercial library of 750000 compounds. forty - eight compounds were identified with pfndh2 enzyme inhibition ic50 values ranging from 100 nm to 40 m and also displayed exciting whole cell antimalarial activity. these novel inhibitors were identified through sampling 16% of the available chemical space, while only screening 2% of the library. this study confirms the added value of using multiple ligand - based chemoinformatic approaches and has successfully identified novel distinct chemotypes primed for development as new agents against malaria.
progeria is a genetic disorder rarely encountered and is characterized by features of premature aging. it is also known as " hutchinson - gilford progeria syndrome " (1). although signs and symptoms vary in age of onset and severity, they are remarkably consistent overall. children with hgps usually appear normal at birth. characteristic facies, with receding mandible, narrow nasal bridge and pointed nasal tip develop. death occurs as a result of complications of severe atherosclerosis, either cardiac disease (myocardial infarction) or cerebrovascular disease (stroke), generally between ages 6 and 20 yr. we report here a 4-yr - old boy with an apparently typical hutchinson - gilford progeria syndrome with g608 g lmna mutation. a 4-yr - old boy was referred to the department of pediatrics with short stature and sclerodermatous skin on 2 september 2010. he was the first child born to non - consanguinous parents with no significant family history. he was born at full term with birth weight of 3.35 kg by spontaneous virginal delivery. growth retardation, hair loss, and alteration of skin color on the abdominal region began. on physical examination, his length was 88 cm and weight 11.5 kg, both less than 3rd percentile and head circumference was 52 cm (ca. 1). he had generalized indurated and shiny skin associated with decreased subcutaneous fat, especially on the abdomen. his hair was fine and sparse and his scalp veins were easily visible (fig. his anterior fontanelle was still patent (horizontal diameter 1.7 cm, vertical diameter 1.4 cm). he had craniofacial disproportion for his age due to micrognatia, prominent eyes, scant eyelashes and small nose. his bone age was 3 yr. he was neurologically intact with motor and mental development. on serological and hormonal evaluation, an echocardiogram did not show concentric left ventricular hypertrophy nor increased left ventricular pressure but showed calcification of aortic and mitral valves (fig. 2). hypertrophy of internal layer at internal carotid artery suggesting atherosclerosis was found by carotid doppler sonography (fig. 2). he is on low dose aspirin to prevent thromboembolic episodes and on regular follow up. we obtained his dna from white blood cell in peripheral blood and sequencing was performed by such method as belows ; samples were extracted using a mg tissue kit. the pcr reaction was performed with 20 ng of genomic dna as the template in a 30 l reaction mixture by using a ef - taq (solgent, korea) as follows : activation of taq polymerase at 95 for 2 min, 35 cycles of 95 for 1 min, 55-63, and 72 for 1 min each were performed, finishing with a 10 min step at 72. the amplification products were purified with a multiscreen filter plate (millipore corp., bedford, ma, usa). the dna samples containing the extension products were added to hi - di formamide (applied biosystems, foster city, ca). the mixture was incubated at 95 for 5 min, followed by 5 min on ice and then analyzed by abi prism 3730xl dna analyzer (applied biosystems, foster city, ca, usa). gene study showed typical g608 g (ggc- > ggt) point mutation at exon 11 in lmna gene (fig. we planned to carry out gene study for her and his family but could n't for their refusal. after the diagnosis, he regularly visits our clinic for routine lab., echocardiogram and carotid doppler sonography. in addition, with our help, he was enrolled in the progeria research foundation (prf) in usa and is waiting for farnesyltransferase inhibitors (ftis) for clinical trials. progeria was described for the first time in 1886, by hutchinson, and ratified by gilford, in 1904. it occurs sporadically, with an incidence of 1 in 8 million live births and there are approximately 150 cases described in the medical literature. it predominates in males with a ratio of 1.5:1 and greater susceptibility of caucasians can be seen in 97% of cases (3). in korea, this is the first case diagnosed as hutchinson - gilford progeria syndrome by gene study in korea. there is variability in onset and rate of progression of disease among children, although the final phenotype in these patients is remarkably similar, underscoring the identical common mutation that leads downstream to similar pathobiology (10). in this syndrome, the average life span is 13 yr (range 7 - 27 yr), but occasionally can survive till the age of 45 yr. the death is mainly due to cardiovascular complications like myocardial infarction or congestive heart failure. the evidence supports the de novo point mutations in lamin a (lmna) gene as the causative factor has been increasing (11). the most common hgps - associated mutation, gly608gly, causes 150 nucleotides encoded in exon 11 to be spliced out of the final mrna and results in a protein that lacks 50 amino acids. this protein, progerin, retains its c - terminal caax motif but lacks sequences that are required for complete processing and is, therefore, stably farnesylated (12). lamin a is a protein meshwork lining the nucleoplasmic face of the inner nuclear membrane and represents an important determinant of interphase nuclear architecture (13). progerin apparently acts in a dominant - negative manner on the nuclear function of cell types that express lamin a (14). the clinical manifestations are divided into major criteria and signs usually presents itself as follows : the major criteria are a bird - like face (which occurs around 6 months to one year of age), alopecia, prominent veins on the scalp, big eyes, micrognathia, abnormal and slow dentition, pear - shaped chest, short clavicles, bow legs (coxa valga), short upper limbs and prominent articulations, low stature and weight with normal bone age, incomplete sexual maturation, reduction of the adipose tissue and adequate psycho - motor development with normal intelligence. diagnosis is essentially clinical with major criteria appearing during the first and second years of life (15). cutaneous manifestations are earlier to appear followed by skeletal and cardiovascular systems. in our case, cardiovascular systems showed calcification of aortic and mitral valves and hypertrophy of internal layer at internal carotid artery suggesting atherosclerosis. skeletal abnormalities include osteolysis, osteoporosis, dystrophic clavicles, coxa valga, " horse riding " stance, thinning of cranial bones, delayed closure of cranial sutures and anterior fontanelle. prognosis is detrimental to the health of the patient and life expectancy is around 13 yr. the main mortality factors are cardiovascular diseases (75%) like acute myocardial infarction. despite the advances in cardiovascular surgery, the low survival rate remains due to the high capacity of the disease to reproduce the erythematous plaques. low - dose aspirin is recommended as prophylaxis to prevent atherosclerotic changes (15). a vigorous research effort in the pharmaceutical industry has identified and developed a number of small - molecule compounds that potently and selectively inhibit farnesyltransferase (ftase). in vitro studies in mice suggest a possible role for the use of farnesyltransferase inhibitors (ftis) in progeria (15). farnesylation, a posttranslational modification involving the addition of a 15-carbon isoprene moiety, was implicated as a potential anticancer target when it was discovered that the oncoprotein ras, which has been estimated to be involved in up to 30% of all human cancers, required farnesylation for its function. two of these drugs (lonafarnib_sch66336 from schering - plough, kenilworth, nj, and tipifarnib_r115777 from johnson & johnson, new brunswick, nj) have entered phase iii trials and have been well tolerated, including in trials involving children (16). similar to ras, the lamin a precursor is also farnesylated, with farnesylation serving as a required step to insert prelamin a into the nuclear membrane as well as to allow for the two downstream cleavage steps which complete the processing of lamin a (18). for this patient, we are waiting for ftis for clinical trials. with the knowledge that the single c - to - t base change seen in nearly all cases of hgps created a cryptic splice site and, thus, deleted the normal second endoproteolytic cleavage site in the lamin a processing pathway, it was hypothesized that progerin was forced to retain its farnesyl group and, therefore, could not dissociate itself from the nuclear membrane. with other members of the nuclear lamina also potentially becoming trapped in complexes with the mislocalized progerin, a mechanistic connection between this permanently farnesylated state and the striking nuclear blebbing and disrupted nuclear architecture seen in hgps cells was proposed, and the possibility of preventing or reversing this phenotype through ftis was raised. detailed study of hgps and lmna mutations may also advance our understanding of the process of aging. why do lmna mutant cells enter senescence earlier than normal cells ? (19). in summary, we found a new patient with typical hutchinson - gilford progeria syndrome with mutation of the g608 g in the lmna gene. this is the first case diagnosed as hutchinson - gilford progeria syndrome by gene study in korea.	hutchinson - gilford progeria syndrome (hgps) is a rare condition originally described by hutchinson in 1886. death result from cardiac complications in the majority of cases and usually occurs at average age of thirteen years. a 4-yr old boy had typical clinical findings such as short stature, craniofacial disproportion, alopecia, prominent scalp veins and sclerodermatous skin. this abnormal appearance began at age of 1 yr. on serological and hormonal evaluation, all values are within normal range. he was neurologically intact with motor and mental development. an echocardiogram showed calcification of aortic and mitral valves. hypertrophy of internal layer at internal carotid artery suggesting atherosclerosis was found by carotid doppler sonography. he is on low dose aspirin to prevent thromboembolic episodes and on regular follow up. gene study showed typical g608 g (ggc- > ggt) point mutation at exon 11 in lmna gene. this is a rare case of hutchinson - gilford progeria syndrome confirmed by genetic analysis in korea.
henoch - schonlein purpura is one of the most common types of vasculitis in children. henoch - schonlein purpura (hsp) is one of the most common types of vasculitis in children. it is a multisystem disorder that involves various joints and organs, and results from a leukocytoclastic vasculitis of small vessels. the characteristic clinical manifestations include non - thrombocytopenic purpura, arthritis or arthralgia, abdominal pain, gastrointestinal hemorrhage and renal abnormalities. although patients with hsp are in a pro - thrombotic state, thrombosis is a rare complication, with only eight previously reported cases of hsp - associated thrombosis in the literature. however, thrombosis is a potentially life - threatening condition, and clinicians should have a high index of suspicion for high - risk patients. here, we present a single case of hsp accompanied by a superior mesenteric vein (smv) thrombosis. a 14-year - old boy with no significant past medical or family history was admitted to our hospital complaining of abdominal pain for the previous 14 days. he had passed dark red and black stool for 7 days, and had an erythematous rash over the anterior aspect of the lower legs for 2 days with a day of bilateral ankle arthralgia. on general examination, his vital signs were stable and he had a palpable purpuric rash that predominantly affected the anterior aspect of his lower legs [figure 1 ] ; the bilateral ankles were swollen. palpable purpuric rash on the legs the laboratory results were as follows : hemoglobin level : 14.5 g / dl ; leucocyte count : 25.27 10/l with 81% polymorphonuclear leukocytes ; lymphocyte count : 13% ; platelet count : 492/mm. serum electrolytes, blood urea nitrogen and creatinine, liver function tests, urine analysis, erythrocyte sedimentation rate, antinuclear antibody and anticardiolipin antibody levels and the coagulation profile were all within their normal ranges. an abdominal computed tomography (ct) scan showed thickening of the proximal small intestinal wall with a peritoneal effusion. the mesenteric ct venography was reported as a suspected smv thrombosis with edema of the proximal intestinal wall [figure 2 ]. mesenteric ct venography revealed heterogeneous contrast within the superior mesenteric vein with a suspected filling defect within the lumen (arrow). a thickened and blurred intestinal wall (arrowheads) as a result of edema was observed within the affected segments according to the clinical manifestations, laboratory results and radiological findings, the patient was diagnosed with hsp and suspected smv thrombosis. after 7 days, his abdominal pain resolved and a repeated abdominal ct scan revealed that the intestinal wall edema and peritoneal accumulation had improved. on the 10 day of hospitalization, follow - up ct venography revealed homogeneous contrast throughout the smv and no signs of venous thrombosis [figure 3 ]. the pat ient had no abdominal pain, no new rash and no swollen joints. he was discharged from hospital on the 12 day of admission. during the 2-month follow - up period, he had no new complaints. homogenous contrast was observed within the superior mesenteric vein (arrow), and the intestinal wall was even and well - demarcated (arrowheads) venous and arterial thromboses are rare but potentially life - threatening complications in patients with hsp. we conducted a review of the published literature and found eight other patients with hsp - associated thrombosis [table 1 ]. the outcomes were good and most patients had no episode of relapse. reported cases of hsp associated with thrombosis hyperactivation of the coagulation system is a common phenomenon along with the impaired activation of the fibrinolytic system in hsp. after prompt treatment with anti - inflammatories and anticoagulation, the symptoms and signs of hsp improved in our case. so the follow - up ct venography showed no signs of thrombosis in the smv. the seventh reported case showed that a high level of plasma factor viii and homocysteine could be a risk factor for thrombosis. higher levels of homocysteine, which could be induced by endothelial injury associated with vasculitis, can cause hypercoagulability in patients with hsp. furthermore, levels of von willebrand factor (vwf) antigen, a marker of endothelial injury, are also elevated during the acute stage of hsp. factor viii, homocysteine and vwf antigen could be important risk markers that indicate patients at a higher risk of thrombosis. two other reported cases that showed hsp was associated with antiphospholipid syndrome (apa), which can present with thrombosis. antiphospholipid antibodies can produce a procoagulant state by affecting the function of phospholipid binding proteins that are involved in the coagulation cascade. the combined effect of hsp and apa would cause a greater risk of arterial or venous thrombosis. in one further case hsp - associated thrombosis occurred in the context of behet 's disease, another form of vasculitis. it is likely that endothelial dysfunction combined with a hypercoagulable state could contribute to thrombosis. thrombosis is comparatively rare in hsp patients, but physicians should pay close attention to patients at a higher risk of developing thrombosis as a consequence of its potentially life - threatening outcomes. thrombosis is a rare complication, with only eight previously reported cases of hsp - associated thrombosis.	henoch - schonlein purpura (hsp) is one of the most common types of vasculitis in children. the characteristic clinical manifestations include non - thrombocytopenic purpura, arthritis or arthralgia, abdominal pain, gastrointestinal hemorrhage and renal abnormalities. thrombosis has been reported as, a rare complication of hsp. we present the case of a 14-year - old boy who was diagnosed with hsp and suspected superior mesenteric vein thrombosis. we reviewed the relevant literature and found eight similar reported cases. hsp is associated with thrombosis and hsp itself and some risk factors may result in thrombosis. we suggest that physicians should monitor patients with hsp who are at a higher risk of developing thrombosis more closely.
increasing daily physical activity (pa) is a key strategy for preventing or minimizing numerous chronic diseases [1, 2 ]. daily pa consists of all occupational, domestic, and leisure - time activities. while participation in leisure - time activities has remained relatively stable over the years, technological advancements have drastically reduced occupational pa. people spent more time at sedentary occupations or in work - related activities such as passive commuting (e.g., driving / riding in a motorized vehicle), which has a negative impact on total pa. given the benefits of regular pa and the current high prevalence of physical inactivity, people need strategies to increase their level of pa. in 1996, the american college of sports medicine proposed pa guidelines which stated that 30 minutes of moderate - intensity exercise on most days provide some health benefits, notably, a decreased risk of chronic diseases. moderate intensity pa is defined as activity performed at 36 met and corresponds with the equivalent of walking 3 - 4 mph for most healthy adults. because inactive people show measurable health benefits with only small increases in activity levels, these people should be targeted in health - promotion programs. the physical activity level (pal) of an individual is widely used as an indirect measure of physical activity energy expenditure. it can be measured or estimated from the average of 24-hour total energy expenditure (tee) and the basal metabolic rate (bmr) (i.e., pal = tee / bmr). the expression of energy requirements of adults as pals provides a convenient way of controlling for age, sex, weight, and body composition. a meta - analysis of studies that involved a total of 411 men and women from 18 to 64 years of age with a predominantly sedentary western lifestyle showed a mean value for pal of 1.60 (range 1.55 to 1.65) for both men and women. a pal value of 1.75 and higher includes the regular practice of pa at work or in leisure time with an intensity and duration that will reduce the risk of becoming overweight and developing a variety of noncommunicable chronic diseases. research has revealed an association between a person 's physical activity level and his / her lifestyle. according to the 1981 fao / who / uno expert consultation, an active or moderate active lifestyle corresponds with a pal value between 1.70 and 1.99. according to this expert panel, the daily performance of one hour (either continuous or in several bouts during the day) of moderate to vigorous exercise, such as jogging / running, cycling, aerobic dancing, or various sports activities, can raise a person 's average pal from 1.55 (corresponding to the sedentary category) to 1.75 (the moderately active category). physical activity awareness defined as the agreement between self - rated and actual activity level according to current guidelines has rarely been studied as a determinant of healthy behavior change. people are only expected to consider changing their behavior when they become aware that they personally engage in too little pa and are potentially putting their health at risk. one way of raising awareness of individual physical (in)activity levels compared with perceived (in)activity levels is to monitor their physical (in)activity, for instance, by using objective measures such as a pedometer or a multisensor activity monitor. several studies have promoted pedometers as effective tools to increase walking [10, 11 ]. pedometers measure walking through step counts and have been proven to be both reliable and valid [13, 14 ]. most of the research on pedometers has focused on their use as a measurement device for assessing pa and not as a motivational tool. recently, studies examining the effectiveness of pedometers in promoting pa have shown that pa programs consisting of a pedometer, a daily goal defined in steps, and a step diary will increase physical activity levels by 2500 steps on average, compared with a sedentary control group [1618 ]. it therefore has been concluded that pedometers can motivate individuals by monitoring the step count and operate as a tracking device and goal setting tool. although pedometers are easy - to - use motivational instruments, their major drawbacks are that they can not reflect intensity of movement and therefore result in inaccurate energy expenditure estimations. pittsburgh, pa, usa) is a multisensory device that is worn on the upper arm and receives information from a dual - axial accelerometer to measure motion and multiple sensors to measure skin temperature, heat flux, and galvanic skin response. the swa also works with a watch - like display device that gives the user real - time feedback on calories burned, steps taken, and time spent in various intensity zones. time spent in moderate, vigorous, and very vigorous activities corresponds with met values greater than or equal to 3 and less than 6, greater than or equal to 6, and greater than or less than 9, respectively. such a sophisticated accelerometer - based device has advantages over pedometers when energy - related output variables are a desired outcome. when people are given information on the energy expenditure (kilocalories) and the time spent (minutes) of physical activities above a predetermined intensity level as well as the number of steps, they will have a very detailed description of their own physical (in)activity pattern. to our knowledge, no study has so far investigated whether specific feedback on various dimensions of the physical (in)activity behavior leads to a greater increase of the individual 's physical activity level compared with more basic feedback on their number of steps. when people are being measured, they become more self - conscious about their own behavior. it is well documented that promoting pa using simple, attainable behavioral strategies such as self - monitoring, goal setting, and physical (in)activity behavior feedback is effective for interventions. self - monitoring increases awareness of energy expenditure, enhances self - efficacy, allows for individuals to monitor progress and change over time, and thus can be an effective tool for behavioral change. goal setting has shown some promise in promoting dietary and pa behavior change among adults. cullen. developed a four - step goal - setting process which consists of (1) recognizing a need for change, (2) establishing a goal, (3) adopting a goal - directed activity and self - monitoring it, and (4) self - rewarding goal attainment. adding feedback and rewards to the goal - setting process feedback can be described as knowledge of personal status about one 's selected goal and should be provided regularly to adapt or adjust to the required behavior. the simple retargeting of information about the physical (in)activity behavior to the individual can have immediate impact on their exercise behavior. this pilot study examined whether giving activity feedback to obese, sedentary adults with type 2 diabetes would improve their adherence to a home - based walking program. since the authors could not significantly contribute the increase in pa to the feedback condition, they concluded that further studies with larger sample sizes and greater control of experimental conditions were needed to determine the utility of objective activity feedback. the sensewear display is a recent innovation which allows progress monitoring throughout the day and indicates in real time when goals have been met. this technology can help motivate people towards predetermined activity goals allowing them to have a clearer picture of their physical (in)activity pattern. setting specific goals is an important aspect of coaching as the effectiveness of coaching revolves around the nature of the goals established by the individual and the processes by which they are achieved. coaching is a behavioral strategy recently emerging in the literature and works as an effective strategy in achieving lifestyle change. the social interactions provided by a coach may provide useful forms of modeling and social support that can enhance the initial adoption of health behaviors such as pa. understanding the factors that can motivate health - enhancing pa has considerable value given the role of this lifestyle behavior in promoting quality of life. one theoretical perspective that appears useful for understanding motivation and adherence to exercise is the self determination theory. sdt particularly describes the processes through which a person acquires the motivation for initiating new health - related behaviors and maintaining them over time. the theory focuses on the degree to which people 's motivation toward engagement in activities, such as pa, is more or less self - determined (autonomous) or controlled by external or internal pressures. people are autonomously motivated when they engage in an activity or cease an activity for reasons that are freely chosen. in a pa context, people are autonomously motivated if they choose to initiate pa for enjoyment and/or because they think pa is important and will help them attain valued goals and/or because of personal commitment to improving their health or quality of life. research has shown that autonomous motivation leads to greater long - term persistence, for example, maintained change toward healthier behaviors. sdt proposes that humans have three basic psychological needs of autonomy, competence, and relatedness that must be satisfied in order for growth and well - being to be achieved. autonomy relates to the desire to be the regulator of one 's actions, and that behavior is volitional. people perceive themselves to be competent when they feel capable of attaining health outcomes, such as meeting a pa goal. the construct of perceived competence is very similar to the self - efficacy concept [32, 33 ], which has been found to be one of the strongest predictors of pa in adults. relatedness refers to experiencing care and concern from important individuals and feeling connected and understood by others. sdt argues that developing a sense of autonomy and competence is critical to self - regulate and sustain health - promoting behavior. equally important is relatedness, as people are more likely to adopt behaviors promoted by those whom they trust. over the years, the number of social factors that have been found to affect people 's needs and, in turn, motivation has been growing. how other people behave has tremendous impact on the needs being satisfied and, in turn, on motivation being optimal or not. one of the key interpersonal dimensions studied is autonomy support which can be defined as the active support of the person 's capacity to be self - initiating and autonomous. autonomous supportive environments can be established by acknowledging the feelings and perspectives of the individual, by providing sufficient information, by minimizing pressure and control, and by offering freedom of choice. silva. implemented an sdt - based intervention for weight management, facilitating exercise adherence by enhancing the more autonomous forms of behavioral regulation. patrick and canevello used a computerized intervention based on sdt to better understand the psychological mechanisms in regard to pa frequency, intensity, and duration in sedentary young adults. these studies highlight the positive influence that autonomy support can have on facilitating health behavior change as well as associated physical and psychological health benefits. well - designed randomized controlled trials (rcts) could help in understanding what types of interventions promote change in a particular behavior. research shows that individually tailored interventions are more likely to be read, saved, remembered, and discussed, and that goal setting in combination with self - monitoring is more successful [27, 43 ]. we hypothesize that the use of the feedback generated by a sensewear display or a pedometer will increase awareness of employees own physical (in)activity pattern and feelings of competence and results in an increased pal in comparison with a minimal intervention group. for motivational purposes, a simple, low - cost step counter may suffice, and these are more feasible from a cost - efficiency perspective than sophisticated accelerometer - based devices. because the swa display gives continuous feedback about people 's (in)activity behavior and specific activity goals can be set, research is needed to compare the individual 's adherence with a healthy lifestyle when feedback is given by a pedometer or a multisensor activity monitor. this study has the additional purpose to compare the effectiveness of feedback given by a pedometer and a multisensor device. we hypothesize that activity monitors that display specific feedback on several parameters of an individual 's activity pattern, namely, steps, calories, and minutes spent on pa will motivate people to increase their activity level more than monitors who only track step counts. this theory states that the extent that the environment allows one to experience feelings of competence, autonomy, and relatedness will influence the person 's motivation toward a given task. the behavior of a coach has a strong impact on people 's needs being satisfied and, in turn, on their motivation being optimal or not. it can be speculated that if the relation with a coach leads to relatedness satisfaction, the message and values transmitted by the coach may be more readily internalized by the participant. furthermore, to the extent that the coach also supports the client 's autonomy, such internalization will be autonomous in nature, thereby leading to positive and long - lasting pa changes in the participant. our intervention study wants to determine the effectiveness of continuous self - monitoring and real - time feedback from the sensewear armband alone and in combination with a weekly meeting with a personal coach. we hypothesize that the weekly meeting with a coach will help create an autonomous supportive environment and stimulate the feeling of relatedness. we performed a 12-month randomized controlled trial in which we randomly assigned sedentary male (n = 103) and female (n = 124) employees to one of four intervention groups : a minimal intervention group received no feedback during the intervention period (mig ; n = 56) ; a pedometer group received information on their daily step count and received a step diary to write down their daily steps (pg ; n = 57) ; a display group got personalized feedback by means of the swa display and received a diary to write done their additional activities (dg ; n = 57) ; a coaching group also received the display and diary and additionally had weekly meetings with a coach to discuss the progress they had made (coachg ; n = 57). during those meetings, the coach attempted to create an autonomy - supportive environment by encouraging choice and initiation (how would you increase your activities this week ?), providing participants with different options (maybe you could go for a walk during your lunch break or travel to work by bike ?), giving informational positive feedback, and acknowledging that the feeling of competence grows from feedback inherent to task (well done, this week you participated at least more than one hour a day in pa). outcome measures were assessed during a baseline assessment and again at 3, 6, and 12 months. the primary outcome of the study is the level of physical activity (pal). secondary outcome measures include step count, minutes of physical (in)activity (sedentary, light, moderate, vigorous, and very vigorous intensity pa), daily energy expenditure in pa, percentage of participants losing fat percentage, and stages of motivational readiness for pa. all participants were recruited from working places in flanders (belgium) through flyers, emails, pharmacists, and word of mouth. employees (male and female) aged between 19 and 67 years who mentioned not being physically active during the last year, who are interested in knowing how many calories they burn in daily life, and who are motivated wearing the sensewear armband during 6 weeks were recruited. all study participants progressed through the study, beginning with an initial contact in which participants are invited to go to an information session. at this session, potential participants received an explanation regarding the purpose of the study and study expectations. this discussion included the participant responsibilities and potential health benefits and risks related to study participation. all interested participants had to sign an informed consent approved by the medical ethics committee of the ku leuven and were scheduled to take part in a baseline measurement. during baseline measurement, participants completed standardized measurements including height, weight, resting blood pressure, resting heart rate, waist and hip circumference, and measurement of fat percentage. participants received the armband with oral and written instructions for proper wear and were given the opportunity to wear and adjust the armband. they were asked to wear the armband for 7 days to assess baseline physical activity level (bpal). participants were asked to fill in the flemish physical activity computerized questionnaire (fpacq ;) about their self - reported physical (in)activity pattern and were asked to complete some other questionnaires regarding their medical history, sports and activity history, and job status. previous research showed that both saturday and sunday and at least 3 weekdays needed to be monitored to obtain reliable measures of habitual physical (in)activity. only participants with a bpal value lower than 1.71, wearing the armband for more than 95% of the time and had at least 3 days of monitoring from monday through friday and both saturday and sunday measured, were eligible to continue. after successfully completing the baseline measurement and signing the informed consent, eligible participants were randomized into one of the four groups. during the randomization visit, all participants received an evaluation of their baseline measurement. the feedback report also gave information about the benefits of an active lifestyle, the current pa recommendations, how to get active in daily life, and tips for starting pa. our population includes participants with a bpal 1.71 met (act), individuals that dropped out from the intervention trial (do), and the four intervention arms (mig, pg, dg, and coachg). the randomization process achieves a reasonable balance across the four intervention arms at baseline. after exclusion of the active group and the drop - out group, post hoc tests reveal a difference in bpal between the pg and dg of 0.08 met for the total group and 0.11 met for the male group. no difference in bpal exists between the pg and dg for the female group. followup data collection visits occurred at 3, 6, and 12 months after randomization and was collected between october 2010 and july 2012. participants were also asked to fill in the fpacq to assess detailed information on several dimensions of pa and sedentary behavior over a usual week. after each followup measurement, participants received feedback about their physical (in)activity level and a comparison was made with previous measurements. secondary outcome measures include step count, minutes of physical (in)activity (sedentary, light, moderate, vigorous, and very vigorous intensity pa), daily energy expenditure in pa, percent of participants losing fat percentage, and stages of motivational readiness for pa. during each assessment, several measures were obtained including height, weight, hip, and waist circumference, resting blood pressure, resting heart rate, and fat percentage. resting heart rate and resting blood pressure height and weight were assessed without shoes using a portable stadiometer of martin (gpm anthropological instruments, zurich, switzerland) and a digital scale (seca, hamburg, germany). bmi is calculated as body weight / height. the same measuring tape with tension rod the waist was measured at the smallest circumference of the natural waist, just above the belly button. hip circumference was assessed with the measuring tape being placed just above both iliac crests. bioelectrical impedance analysis (bia) was used to obtain a complete analysis of the body composition (percent distribution of body fat). the armband is a pa monitor that is worn on the upper left arm halfway between the acromion and olecranon processes. this device measures physical (in)activity using accelerometry technology augmented by two heat sensors (a thermistor - based skin surface sensor and a proprietary heat flux sensor) and a galvanic skin response sensor. these four internal sensors turn on the monitor (i.e., with skin contact) and estimate armband compliance, daily energy expenditure, step count, sleep efficiency, and the intensity, duration, and frequency of pa bouts. collected pa data all armband data were analyzed by computer - based software (version 6.1) at 1-minute intervals using demographic information (i.e., gender, age, height, and weight at prior assessment) and proprietary algorithms. throughout the study, the dg and coachg group participants used the self - monitoring device to aid behavior change via real - time lifestyle feedback targeting pa. baseline pa occurred over a one - year period (july 2010july 2011) which makes it possible to account for seasonal variation in pa in a predominantly sedentary population. independent researchers have validated the sensewear system, especially with respect to comparing energy expenditure measurements from the armband to estimates from gold - standard laboratory equipment [4750 ]. an extensive review of the literature shows different validation studies where several sensewear models (sensewear, sensewear pro, sensewear pro2, and sensewear pro3) and software algorithms are used. the sensewear armband has been validated as a measure of daily pa with findings suggesting that both minute - by - minutes as well as average energy expenditure can be a valid measurement of free - living activity [51, 52 ]. two recent studies [53, 54 ] discussed the validation of the swa at higher intensity levels and found a significant underestimation of the armband compared to indirect calorimetry for vigorous and very vigorous exercise intensities. differences between the four study arms in pa outcomes all participants ' data will be analyzed according to their group assignment at randomization, regardless of adherence to the intervention. the pa outcomes being studied are daily energy expenditure (dee), active energy expenditure (aee), minutes of pa, physical activity level (pal), and steps. a primary comparison is between the pa outcomes of groups who receive feedback (step group, display group and coaching group) and the group receiving no feedback (minimal intervention group). we hypothesize that getting feedback on the pa pattern will alter the pal compared to having no information. secondly, a comparison will be made on the difference in pa variables between participants who received feedback by means of the swa display (display group) and participants who are only given information on their daily step count using a simple pedometer (step group). since the swa display gives more detailed information on different pa variables (minutes of pa, dee, and steps) in contrast to the pedometer which only gives information on the daily step count, it is expected that people from the display group will have more benefits of the intervention compared to those belonging to the step group. finally, the additional effect of a coach having weekly meetings with the participants will be evaluated. we hypothesize that the power of the interaction of a coach will result in an increase of the pa outcomes compared to subjects only receiving information by means of a technological instrument (display group and step group). differences in pa outcome measures will be examined using analysis of covariance (ancova) models of 12-month change scores. self - reported pa, awareness, and cognitions will be analyzed as secondary outcomes. all analyses take into account specified covariates, including age, gender, bmi, education, percentage of armband wearing time, and baseline values of pa outcome measures. based on our results from a pilot study (n = 52 ; palpre = 1.41 0.11 mets), an a priori power analysis was performed to determine the sample size necessary to detect a significant increase in energy expenditure in the intervention groups. sample size calculations showed that 57 subjects in each group would give 80% power to detect a difference in pal between baseline and posttest at a significance level of p < 0.05. all intervention groups receive a feedback report on the physical activity level, amount of steps taken, and minutes of physical (in)activity. in a personal contact with a coach, the report is discussed. the intervention study was executed by one coach to maximize the reliability of the intervention trial. during the 4-week intervention period, this group (25 male, 31 female) wears the sensewear armband but gets no further feedback. the pedometer group (26 male, 31 female) receives feedback on the daily step count by means of a pedometer (yamax digiwalker, sw200) and wears the sensewear armband for measuring the physical activity level. the yamax sw digiwalker is a waist - mounted device and is the most widely used pedometer in research studies. previous studies comparing 10 or more pedometer models identified it as one of the most accurate and reliable electronic pedometers available. every day participants of the pedometer group write down their amount of steps in a step diary and also mention the reason for walking 10,000 steps a day. after an intervention period of 4 weeks, the pedometer is returned and participants are asked to wear the sensewear armband for one more week without knowing the amount of steps taken every day. the display group (26 male, 31 female) receives a sensewear display which allows participants to concurrently track total calories burned, minutes spent performing pa, and number of steps taken throughout the day. participants wear the sensewear armband and matching sensewear display for a period of 4 weeks. every day participants of the display group write down their amount of calories burned, their amount of steps taken, and their minutes of pa a day in an activity diary. they are asked to mention the reason for achieving or not succeeding in their personal goals. every participant has individualized target goals for total calories, number of steps, and minutes spent performing pa. the individualized energy expenditure goal corresponds with an increase of the individual physical activity level with 0.10 met. individuals are asked to walk 10,000 steps a day and to be physically active for 60 minutes a day. after an intervention period of 4 weeks, the sensewear display is returned and participants are asked to wear the sensewear armband for one more week without knowing the amount of calories burned, amount of steps taken, or amount of minutes spent in pa every day. the coaching group (26 male, 31 female) receives the same intervention as the display group (see above) but additionally has a weekly meeting with a coach to discuss the progress they have made. the session format is as follows : check - in of sensewear data, discussion of results, evaluation of the individual goal setting, summary of current session, and preview of the next session. this intervention study will evaluate the effectiveness of four approaches to enhance pa in daily life over a one - year period in sedentary flemish employees. the focus of this study is to evaluate the efficacy of providing real - time feedback on physical (in)activity patterns. secondly our intervention study will investigate whether feedback on several parameters (including energy expenditure, steps, and minutes of physical (in)activity performed) will increase the physical activity level in comparison with a standard 10,000 step program. our final aim is to evaluate whether a weekly meeting with a personal coach will help create an autonomous supportive environment and stimulate the feeling of relatedness thereby influencing the pa behavior. it should be noted that the participants in this study are volunteers and, as such, may be different (e.g., psychologically or motivationally) from other sedentary individuals.	purpose. the sensewear armband (swa) is a multisensor activity monitor that can be used in daily life to assess an individual 's physical activity level (pal). the primary goal of this study was to analyze the impact of different types of feedback on the pal of flemish employees. methods / design. we recruited 320 sedentary employees (age, 41.0 10.7 years ; bmi, 26.2 4.2 kg / m2) to participate in the 12-month study. participants were randomized into one of four intervention groups after being measured for 7 days and nights by means of the swa : (1) a minimal intervention group received no feedback (mig, n = 56) ; (2) a pedometer group was provided only information on their daily step count (pg, n = 57) ; (3) a display group received feedback on calories burned, steps taken, and minutes of physical activity by means of the swa display (dg, n = 57) ; (4) a coaching group also received the display and had weekly meetings with a personal coach (coachg, n = 57). we hypothesize that participants receiving feedback (sg, dg, and coachg) will have a greater increase in physical activity outcome variables compared to participants of the minimal intervention group.
total daily energy expenditure consists of three factors : resting metabolic rate (rmr), thermic effect of food intake (tef), and physical activity1. in general, rmr is the most important component accounting for 6075% of total daily energy expenditure. tef is defined as the increase in energy expenditure in response to food intake and it accounts for 10% of total daily energy expenditure1. it has been accepted that sympathetic nervous system activity (sna) plays a role in regulation of energy expenditure after food intake, because the thermic response is reduced by -adrenergic blockade2, 3. previous studies have shown that food intake increases energy expenditure, and is accompanied by an increase in whole body sna (for example, skeletal muscle, abdominal tissue, adrenal medulla, and kidneys)2, 4, 5. preganglionic fibers of the sympathetic nervous system exit from the spinal cord between t1 and l2 and synapse with their respective ganglion, at which postganglionic neurons originate and eventually project to their target organs6. the sympathetic nerves originating from t1 to t6 mainly innervate the organs of the head and upper thorax, such as the lungs and heart, while the sympathetic nerves originating below t7 mainly innervate the organs in the lower thorax, such as the kidneys and adrenal glands. furthermore, the sympathetic nerves innervating the adrenal medulla originate between the t5 and t9 segments7. because supraspinal control of sympathetic preganglionic neurons is interrupted in persons with cervical and higher thoracic spinal cord injury (sci), sci often results in autonomic dysfunction as well as motor and sensory deficits in the upper and/or lower extremities. several studies have reported that sna is decreased in subjects with cervical and higher thoracic cord injury as compared to able bodied subjects (ab)8,9,10,11, and this decrease in sna may blunt tef, as reported in elderly persons12. it is evident that subjects with sci have a higher fat mass and a lower lean muscle mass than ab subjects, even though they have a normal body mass index (bmi) value16. therefore, sci patients may have a lower tef due to reduction in lean muscle mass as well as autonomic dysfunction, which would increase their risk of developing obesity, and obesity - related disorders, such as type 2 diabetes, cardiovascular diseases, and dyslipidemia. however, little is known about tef in subjects with higher thoracic sci (hsci) and lower thoracic sci (lsci). if sna plays an important role in the regulation of tef, subjects with hsci would exhibit a greater decrease in tef than lsci and ab subjects. to test this hypothesis, we examined the time courses of the tef among the three groups of subjects (ab, hsci, and lsci) and assessed the relative contribution of the level of spinal cord injury to the tef. seven male subjects with sci and six ab subjects (controls), who were age- and gender - matched, participated in this study. all the scis were of traumatic origin and the level of injury in the subjects with sci was between t5 and t12 (table 1table 1.group averages of physiological characteristicsab (n=6)hsci (n=3)lsci (n=4)age (years)37.2 7.640.0 8.539.8 4.9weight (kg)75.7 9.662.7 11.665.5 7.3height (cm)173.7 7.3173.0 6.1174.8 5.1bmi (kg / m)25.0 2.321.0 4.321.5 ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjects). all the persons with paraplegia were examined clinically and neurologically to classify the extent of spinal cord injury according to the american spinal injury association (asia) impairment scale grade (ais). six individuals were classified with a complete injury (ais a), and one with an incomplete injury (ais b). neurological examinations were performed by an approved physical therapist working in the rehabilitation hospital. the experimental procedures of this study were approved by the ethical committee of the graduate school of integrated arts and sciences, hiroshima university, and the study was performed in accordance with the ethical principles of the declaration of helsinki. all the subjects gave their written, informed consent before participating in the present study. ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjects all experiments were performed between 8:30 a.m. and 12:30 p.m. after an overnight fast of 12 hours. subjects were instructed not to exercise and to refrain from alcohol, caffeine, and smoking for 24 hours preceding the experiments. they were asked to refrain from taking their medication on the day to minimize possible confounding effects on energy expenditure. all the subjects were also instructed to empty their bladders prior to the experiments. bmi was calculated as body weight (kg) divided by height squared (m). each subject sat on their own wheelchair or a prepared chair during the experiment in thermoneutral environment (temperature, 2327 c ; relative humidity, approximately 60%). after 15 min of quiet rest, expiration gas was analyzed with a gas analyzer (ae-300s minato medical science co., ltd, japan) to measure oxygen consumption (vo2) and carbon dioxide production (vco2). at the end of the resting period, a venous blood sample was taken from an antecubital vein to measure plasma catecholamine concentrations. plasma catecholamine concentrations were analyzed by a hplc method (fukuyama medical laboratory co., ltd, japan). heart rate (hr) was measured continuously both at rest and during the postprandial period with a heart rate monitor (polar s610i, japan). energy expenditure was calculated from vo2 and vco2 using the formulas outlined by frayn17. the tef was calculated as the area under the curve above the baseline level for 3 hours after food intake and expressed as the absolute and adjusted values against body weight. the test meal, which was consumed within 10 min by the subjects, consisted of portions of calorie mate block and one calorie mate can (otsuka pharmaceutical co., ltd, japan). the test meal size and the number of blocks were determined using subjects body weights, to achieve the same consumption of 7.9 kcal / kg of body weight18. therefore, total caloric content consumed varied from 435 kcal to 670 kcal, with an energy composition of 4952% carbohydrate, 3640% fat, and 1112% protein. the subjects with sci were divided into the two groups [hsci (t56) and lsci (t912) ] according to the level of spinal cord injury. the physiological characteristics (age, body weight, height, and bmi) were compared among the three groups (ab, hsci, and lsci) by one - way anova and dunnett s post hoc test. if either the normality or the equal variance test failed, the kruskal - wallis test was performed. the differences in the responses of tef, plasma norepinephrine, and hr among the three groups were examined using two - way anova with repeated measures (one factor of time repetition). if the main effect and interaction were significant, the mean values at a given time were compared using dunnett s post hoc test. all statistical analyses were performed using sigmaplot version 12.5 (systat software, san jose, ca, usa). the anthropometric characteristics of the three groups (ab, hsci, and lsci) are shown in table 1. there were no significant differences in age, body weight, height, and bmi among the three groups. table 2table 2.resting energy expenditure, thermic effect of food, and meal size during the tef studyab (n=6)hsci (n=3)lsci (n=4)ree (kcal / min)1.14 0.070.96 0.081.07 0.05postprandial ee (kcal / min)1.51 0.091.15 0.121.34 0.05tef (kcal for 2h)44.5 4.923.2 5.832.0 0.3adjusted tef against body weight0.59 0.050.36 0.06 0.49 0.04tef (% meal)7.4 0.064.6 0.07 6.2 0.04meal size (kcal)602.5 30.5501.7 55.3521.3 ree : resting energy expenditure ; tef : thermic effect of food intake ; ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjectssignificantly lower (p<0.05) than ab shows the average data of the resting energy expenditure (ree, kcal / min), absolute and adjusted tef over 2 hours, and meal size of the three groups. the adjusted tef over 2 hours and tef (% meal) were significantly smaller (p<0.05) in the hsci subjects than in the ab subjects. ree : resting energy expenditure ; tef : thermic effect of food intake ; ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjects significantly lower (p<0.05) than ab the time courses of the average changes in absolute and adjusted tef following food intake were compared among the three groups (table 3table 3.the time courses of absolute tef and adjusted tef in the three groupsabsolute tef (kcal)adjusted tef (kcal / kg)60 min120 min180 min60 min120 min180 minab (n=6)19.1 2.025.4 3.017.8 1.20.25 0.030.33 0.030.24 0.02hsci (n=3)13.0 2.310.2 4.511.7 4.20.21 0.050.15 0.06 0.17 0.05lsci (n=4)13.7 1.018.4 1.114.3 2.30.21 0.010.29 0.030.22 ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjects. because the energy expenditure in one subject with hsci involved an artifact at 180 min, we removed his tef from pooled data at 180 min and did not perform statistical analysis for the absolute and adjusted tef at 180 min. significantly lower (p<0.05) than in ab (two - way anova)). two - way anova of absolute tef indicated a significant main effect of time (p<0.05), but not of group. two - way anova of adjusted tef indicated significant main effects of group and time. post hoc analyses revealed that the adjusted tef at 120 min was significantly smaller in the hsci group than in the ab group, whereas the adjusted tef was the same in both the ab and lsci groups. ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjects. because the energy expenditure in one subject with hsci involved an artifact at 180 min, we removed his tef from pooled data at 180 min and did not perform statistical analysis for the absolute and adjusted tef at 180 min. significantly lower (p<0.05) than in ab (two - way anova) table 4table 4.the time courses of plasma norepinephrine concentration and hr in the three groupsnorepinephrine concentration (ng / ml)hr (bpm)baseline60 min120 min180 minbaseline60 min120 min180 minab (n=6)0.33 0.050.43 0.080.33 0.050.47 0.1165.9 3.370.2 4.2 68.6 2.8 65.9 2.1hsci (n=3)0.38 0.160.46 0.130.45 0.150.43 0.0765.2 2.575.7 7.0 76.2 8.1 70.2 4.2lsci (n=4)0.44 0.020.54 0.050.50 0.020.45 0.0373.3 6.677.3 7.3 76.5 8.0 72.3 6.4data are shown in mean sem. ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjects. significant differences from the resting value (p<0.05, two - way anova) shows the time courses of the postprandial changes in plasma norepinephrine concentration and hr among the three groups. two - way anova of norepinephrine levels indicated no significant main effects of group or time. two - way anova of hr identified a significant main effect of time (p<0.05), but not of group. in all the three groups, hr had increased (p<0.05) at 60 min and 120 min, compared to rest, but had returned to the baseline level at 180 min. ab : able - bodied subjects ; sci : spinal cord injury ; hsci : higher thoracic sci subjects ; lsci : lower thoracic sci subjects. the present study has examined whether the level of spinal cord injury affects the thermic response to food intake. the major findings of this study are that : 1) the adjusted tef at 60 min was the same among the subjects, irrespective of the presence or the absence of sci ; 2) the adjusted tef at 120 min was significantly smaller in the subjects with hsci than ab subjects, but was not different between the lsci and ab subjects. taken together, it is likely that thoracic sci at a lesion level t56 may decrease the thermic response to food intake. the obligatory component is the energy that is required for nutrient digestion, absorption, transport, and storage. it may be mainly modulated by parasympathetic nervous system activity3, 19. the facultative component, which occurs in several tissues especially in skeletal muscles, is the energy spent in excess of the obligatory requirements2,3,4. the energy expenditure in skeletal muscles stimulated by an increase in muscle sna contributes substantially to the whole - body tef in humans20, 21. despite a number of studies of the tef, the time courses of the two components during the postprandial period remains to be established. based on the time courses of the tef measured in this study, two possible conclusions can be drawn from the differences in the adjusted tefs of the three groups (ab, hsci, and lsci). first, the adjusted tef at 60 min was not different among the three groups, suggesting that the tef at 60 min may be mainly attributable to the obligatory component. this conclusion seems reasonable, because these all of the subjects had an intact parasympathetic nervous system. it is additionally supported by a previous finding that the obligatory thermogenesis to food intake is not affected by the sci22. second, the adjusted tef at 120 min was blunted in hsci, compared to ab, suggesting that the tef at 120 min may correspond to the facultative component, which is influenced by sympathetic nervous system. the adjusted tef at 120 min was not significantly different between ab and lsci. thus, it is conceivable that the extent of the facultative component may depend on the level of injury. the decreased sna due to the sympathetic decentralization may affect, at least partly, the facultative component of the subjects with hsci. another possible explanation for the reduction in the facultative component of adjusted tef may be a decrease in the lean muscle mass. several studies have shown that tef is higher in lean subjects than obese subjects, implying that skeletal muscle mass plays a role in increasing energy expenditure after meal consumption13,14,15. furthermore, astrup. suggested that the facultative tef occurs mainly in skeletal muscles, while the contribution of fat tissues to facultative tef is negligible2, 21. based on these findings, it is likely that the amount of lean muscle mass is an important physiological determinant of facultative tef. in sci, body composition drastically changes with a loss of lean muscle mass as well as bone below the level of injury and an increase in the total fat mass23, 24. therefore, it is likely that a decrease in lean muscle mass would result in a reduction in the facultative tef. nevertheless, a significant difference was found in the changes in adjusted tef, in addition, the present tef values were approximately the same as those previously reported for sci25. second, the forearm venous norepinephrine concentration may be an inaccurate measure of the influence of the sympathetic decentralization of hsci and lsci on sna below the level of injury. forearm venous norepinephrine concentration may not reflect whole body sna but suggest regional sna26. karlsson. found that leg norepinephrine levels were significantly lower in sci subjects (c7t4) than those in ab subjects, while arm norepinephrine levels were almost the same27. third, we did not directly measure lean muscle mass, although the amount of lean muscle mass is one of the important physiological determinants of total tef. fourth, we did not measure core body temperature in the subjects with sci. when drum temperature was measured in some ab subjects, drum temperature did not change after food intake, suggesting that food - intake thermogenesis may not affect core body temperature. finally, we did not know whether all the six subjects with ais a had autonomic complete dysfunction. it is likely that thoracic sci at a lesion level of t56 causes a lower thermic response to food intake due to sympathetic decentralization. it is known that measured rmr is lower in persons with tetraplegia and paraplegia than in ab subjects, probably due to decreased sna22. thus, in addition to lower rmr, reduced thermic response to food intake may also be a causative factor in the development of obesity in sci, particular in hsci.	[purpose ] to investigate the influence of the level of spinal cord injury on the thermic effect of food intake (tef) in persons with thoracic spinal cord injury. [subjects and methods ] seven male subjects with spinal cord injury (sci ; age, 40 6 years) and six able - bodied subjects (ab ; age, 37 8 years) volunteered to participate in the present study. the subjects consumed an identical test meal consisting of 7.9 kcal / kg of body weight. energy expenditure and plasma norepinephrine concentrations were measured over a 3-hour period. [results ] the adjusted tef at 60 min was almost the same among the three groups [ab, sci with high thoracic cord (t56) injury (hsci), and sci with low thoracic cord (t912) injury (lsci) ]. although the lsci group had almost the same adjusted tef at 120 min as the ab group, the adjusted tef at 120 min of the hsci group was significantly lower than that of the ab group. the changes in plasma norepinephrine concentration and heart rate in response to food intake were similar among the three groups. [conclusion ] sci at the t56 level results in a lower tef due to sympathetic decentralization.
pediatric obesity is a serious health condition, conferring both immediate and long - term health risks [13 ]. multidisciplinary approaches in diverse sectors, including pediatric primary care, have been proposed to reduce the high prevalence of childhood obesity. multi - disciplinary clinical programs require a considerable investment of time and resources, but limited data exists on long - term weight outcomes of children participating in such programs, and few studies have examined real - world pediatric weight management of different intensity. the purpose of this study was to examine changes in body mass index (bmi) among children who were referred to a multi - disciplinary weight management program. we were particularly interested in learning whether there were differences in weight outcomes among program participants as compared with nonparticipants who continued to be followed by their primary care providers within the group practice over a 2-year period following referral. we designated program participants as the intervention group and non - participants as the comparison group for the purpose of this study, although we recognized that this analysis was based on observational rather than experimental data. the one step ahead (osa) program was developed in 2003 specifically to provide stepped - up care for the growing numbers of children with increasing obesity severity within the boston children 's primary care center (chpcc). the chpcc practice comprises over 80 healthcare providers annually serving more than 14,000 children from mostly economically challenged neighborhoods in boston, ma. approximately 44% of children seen for well - child care are overweight or obese ; 65% are insured through medicaid. in this retrospective observational study, we used the clinically derived osa database to compare bmi z - score changes among program participants (intervention group) versus non - participating children who were followed by primary care providers within the group practice (comparison). the study protocol was approved by the human subjects committee of boston children 's hospital. the study population comprised overweight (bmi 85th and 95th percentile) children aged 218 years who were referred from the chpcc to the osa program between 2003 and 2009. the intervention group comprised children who attended the osa program and had completed at least 2 visits of any type where bmi was measured in the 2-year period following referral. the comparison group comprised referred children who did not keep their osa appointments, but had nonetheless completed at least 2 primary care visits where bmi was measured over the same 2-year period. the osa team includes medical providers, a nurse educator, registered dietitians, a behavioral psychologist, a social worker, and a physical activity coordinator. the goal of the program is to achieve weight maintenance or loss among children as they continue growing in height. the osa program utilizes the social ecological model as a framework for its services and considers individual, interpersonal, community, and societal levels of influences on the child 's behavior change. motivational interviewing [5, 6 ] techniques are used to assess families ' readiness to change, help families set achievable healthful lifestyle goals, and navigate potential obstacles. dieticians provide family - centered nutrition education and teach families practical skills including meal planning, label reading, and culturally appropriate healthful cooking techniques. a physical activity coordinator matches families with free or low - cost neighborhood exercise programs. a behavioral psychologist evaluates families for maladaptive behaviors and provides supportive mental health services including individual and family counseling to bolster self - esteem and resiliency. a medical social worker frequently assists families with acute social support needs including housing, transportation, utilities, and food assistance. in general, visits are scheduled at monthly intervals for at least the first 3 visits and for a total of 6 visits over the course of 12 months ; however, actual visit intervals and total program duration are quite variable due to the highly individualized nature of the program. the osa program staff calls the families of children who do not keep their osa appointments to help them reschedule missed visits and emails referring providers to inform them about the missed visit. approximately 40% of families are reached by phone and the most common reasons given for missing their scheduled osa visits include forgetting about the appointment, transportation issues, and scheduling conflicts with work, school or other competing priorities. many of the families served by the osa clinic struggle with social stressors including unemployment, food, or home insecurity, and may have difficulty affording basic needs such as clothing, electricity, or telephone service. children who were referred but did not keep any osa appointments were seen by their primary care providers for routine well child - care annually or more frequently for problem - focused visits (e.g., for weight related or other issues). chpcc well care visit content is based on the bright - futures guidelines for health supervision, but no practice - wide standards existed at the time of this study for obesity assessment, education or follow - up intervals. chpcc providers manage obese children using general patient education, materials. among 245 referred children who did not attend the osa program, 17.3% had weight monitoring visits in addition to well child - care visits with their primary care providers. at each visit, clinical assistants measured the child 's weight and height. we calculated bmi as weight in kg / height in meters and then used the centers for disease prevention and control (cdc) 2000 growth charts to calculate gender- and age - specific bmi z - score. change in bmi z - score at each postreferral visit was calculated as current bmi z - score minus baseline bmi z - score at referral. the primary outcome was the rate of change in bmi z - score (defined as difference in bmi z - score / time interval) per month during each of 4 time periods within 24 months after referral : referral-6 months, 712 months, 1318 months, and 1924 months. covariates of interest included gender, age at referral, race / ethnicity (black, white, hispanics, and other), language (english, spanish, and other), and baseline bmi z - score at referral. to examine group differences in baseline characteristics, we performed chi - square tests for categorical variables (e.g., gender) and t - tests for continuous variables (e.g., age). because each child in the analytic sample had multiple visits and childhood bmi usually tracks with age, we used mixed effect models to examine the rate of change in bmi z - score after referral. in our sample, an autoregressive correlation structure was chosen for different visits of the same child in the final model, because this structure was associated with a lower akaike information criterion than several other candidate correlation structures. briefly, an auto - regressive correlation structure indicates that two bmi z - scores observed at two closer visits for a particular child tend to be more correlated than two bmi z - scores observed at farther apart visits. specifically, we specified a random effect for the intercept reflecting between - subject variation in baseline bmi z - score at referral, and specified a fixed effect for intervention, time after referral and potential interaction between intervention and time after referral. we used piece - wise linear methods to allow for nonlinear trends of change in bmi z - score. specifically, we first divided the 2 years of followup into the four 6-month periods (i.e., referral-6 months, 712 months, 1318 months, and 1924 months) and then considered a linear trend within each period. accordingly, we fit a series of hierarchical models with main effects of intervention and time ; 2-way interaction between intervention and time ; and 3-way interactions between intervention, time, and the 4 time periods. for the purpose of visualization, we used the smoothing function in microsoft excel to connect the 4 time periods smoothly and then to compare the group - level mean bmi z - score trajectories between the intervention and comparison groups (figure 2). all regression models were adjusted for potential confounders : the child 's gender, age at referral, race / ethnicity, primary language, and bmi z - score at referral. we also tested for potential interactions between intervention group and demographic characteristics by performing stratified analyses by the child 's gender, race / ethnicity, age at referral, and primary language. we conducted all analyses in sas 9.2 (sas institute inc., cary, nc). table 1 shows the characteristics of the multi - disciplinary intervention (osa, n = 338) and comparison (n = 245) groups. the mean (standard deviation or sd) age of patients at the time of referral to the osa program was 8.7 (2.6) years, mean bmi z - score was 2.3 (0.5) units, and the prevalence of obesity was 93.5%. the two groups did not differ by gender, age, race, bmi, or prevalence of obesity. however, children in the intervention group had a slightly higher mean bmi z - score (2.3 versus 2.2), more visits within 2 years after referral (mean number of visits, 5.5 [3.2 ] versus 2.5 [1.2 ]), and were more likely to speak spanish as a primary language (21.0% versus 14.3%). figure 1 shows the distribution of visits for the 2 groups. there were a total of 1,855 visits for the intervention group and 615 visits for the comparison group. for both groups, the visits after referral dispersed between 2 months and 24 months. the mean time for follow - up visits was similar between the two groups (8.4 versus 8.1 months after referral). as shown in table 1, 855 (26%) children in the osa group and 43 (17.6%) children in the comparison group were followed to 2 years (2224 months). the mean follow - up time was slightly longer for the osa group than the comparison group (14.8 (sd, 7.2) versus 13.3 (sd, 7.7) months after referral ; p = 0.01). figure 2 shows change in bmi z - score at 6, 12, 18, and 24 months after referral. for the intervention group, the mean bmi z - score decreased more steeply during the first 6 months and continuously during the 2-year period. in contrast, the mean bmi z - score for the comparison group increased during the first 6-postreferral months then decreased to 18 months, after which it leveled off. table 2 shows the estimated rates of change in bmi z - score (units per month) for the 4 time periods. from 0 to 6 months, bmi z - score decreased for the intervention group at the rate of 0.013 units / month (95% confidence interval or ci, 0.017 to 0.009)) but increased for the comparison group (0.004 units / month (95% ci, 0.005 to 0.013)). the bmi z - score continued to decrease more steeply for the intervention group than the comparison group from 7 to 12 months (0.008 versus 0.005), 13 to 18 months (0.008 versus 0.005), and 19 to 24 months (0.008 versus 0.004). the group difference (interventional versus comparison) in the rate of change in bmi z - score was statistically significant for 06 months (p = 0.001) and 1924 months (p = 0.008) ; it was marginally significant for 1318 months (p = 0.051). among osa participants, there were no significant racial / ethnic differences except non - hispanic black children who had a smaller decrease in bmi z - score than all other groups during the 0 to 6-month period (0.007 versus 0.017, p = 0.009). there were also no significant group - differences in the rate of change in bmi z - score based on gender. among osa participants, children younger than 5 years had significantly greater decreases in bmi z - score than older children during all time periods (0 to 6 months : 0.067 versus 0.005, p = 0.001 ; 7 to 12 months : 0.032 versus 0.003, p = 0.001 ; 13 to 18 months, 0.024 versus 0.004, p = 0.001 ; 19 to 24 months, 0.024 versus 0.004, p value = 0.001). in this study, we found that a group of racial ethnically diverse children attending a multi - disciplinary weight management program experienced reductions in bmi z - score over a 2-year follow - up period. these bmi reductions were of greater magnitude than those of non - participants but were overall modest. among osa program participants, younger children experienced significantly greater reductions in bmi z - score than older children, but we did not observe gender or racial / ethnic differences. our findings add to the scarce evidence on the effectiveness of real - world pediatric weight management among overweight children of diverse races / ethnicities and low family socioeconomic status. the reasons for the modest reduction in bmi z - score seen among osa participants are likely multifactorial. a large proportion of our families have endorsed challenging ongoing psychosocial stressors including limited financial resources to purchase healthful items or enroll children in organized physical activity programs, food or housing insecurity, competing priorities, simultaneous exacerbations of chronic illness in a family member, and difficulty sustaining motivation over time as significant barriers to maintaining a healthy weight. in addition, a number of biological adaptations including changes in the circulating levels of several peripheral hormones involved in the homeostatic regulation of body weight likely contribute to weight gain recidivism. sumithran. found that circulating levels of leptin, peptide yy, cholecystokinin, insulin, ghrelin, gastric inhibitory polypeptide, and pancreatic polypeptide, as well as subjective feelings of hunger, do not revert to the preweight loss levels even one year after initial weight reduction. while the bmi changes we observed were modest, a necessary level (threshold) of pediatric bmi change associated with health benefits among children has not been established. adult studies have shown that even modest weight loss (510%) is associated with cardiovascular benefits. among children, some experts have suggested that even bmi stabilization/ maintenance might be considered to be a successful endpoint, especially given the almost linear increase in bmi after adiposity rebound at age 5 - 6 y experienced by most children. in addition, psychological benefits associated with even modest weight loss (and the lifestyle changes accompanying such weight loss) among children include a sense of mastery and improved self - esteem. while children and their parents choosing to attend our weight management programs might inherently possess higher motivation relative to nonattendees, our findings provide invaluable insight as a reflection of real - world clinical practice as randomization is not always practical in service priority settings. the one step ahead program was developed specifically to meet demands for readily accessible, culturally sensitive, multidisciplinary weight management services for the growing numbers of obese children in our safety - net practice serving families predominantly from low - income, racial ethnically diverse boston neighborhoods. embedded within a busy academic primary care practice of more than 80 pediatricians in cohabitation with several other clinical programs, osa program research capacity is limited by space, scheduling, staffing, and budgetary constraints and subsumed by the impetus to deliver patient - centered care in a medical home practice model. our approach represents a realistic, culturally appropriate weight management intervention targeting a predominantly low - income hispanic or african - american population and may inform many similar programs where randomization may not be feasible, acceptable, or sustainable on a long - term basis. limited evidence has suggested the greater effectiveness of medium- to high - intensity behavioral interventions, compared with low - intensity interventions conducted in primary care settings. the expert committee recommendations for childhood obesity management propose a staged approach to obesity treatment. stage 1, prevention plus, comprises brief counseling regarding key healthful lifestyle behaviors that can be delivered in primary care office settings ; stage 2, structured weight management, delivers similar messages through the added structure of a dietician or other trained professional such as an exercise counselor. stage 3, comprehensive multidisciplinary intervention, is a structured program in behavior modification that includes goal setting and contingency management facilitated by a team approach. stage 4, tertiary care intervention includes the use of medications and bariatric surgery as potential treatment modalities and is reserved for children who are refractory to more conservative treatment at the lower stages. children in the one step ahead program can be considered stage 3 treatment recipients, while those in the comparison group (referred but did participate and were followed by primary care physicians) can be considered stage 1 treatment recipients. the steadier and greater reduction in bmi z - score seen with children enrolled in our stage 3 intervention compared with children in the comparison stage 1 strategy appears to support the premise of higher effectiveness for more intensive approaches. if more intensive treatment more effectively reduces bmi, a staged treatment approach per the expert committee guidelines seems sensible. however, we do not contend that greater decreases in bmi alone result in better outcomes in the pediatric population. it may also be important to account for the impact of nonweight outcomes on child and family well being. in the era of accountable care organizations, for the greater resources necessary per unit increased bmi effect, whether children should be treated with stage 3 and stage 4 interventions at all requires further study to first define and then maximize core health outcomes for the resources expended. careful examination of the bmi z - score trajectory over time can offer additional insights regarding why our intervention works and how to improve it in future. first, the overall decline in bmi z - scores observed over the 2-year study period among intervention participants suggests that weight management may be maintained over time, although the effect size may decrease. this is encouraging given the recidivism of weight gain due to compensatory metabolic processes that resist the maintenance of the altered body weight. the rise in bmi z - scores during the initial 06-month period among comparison children may be related to delayed followup by providers who had referred the patients to osa, only to find later that the families had not participated. secondly, the greatest difference in the change in bmi z - score between intervention (decrease) and comparison (increase) children occurred in the 06 months period. this difference may be related to higher initial self - motivation and vigilance, more intensive intervention within the earlier periods, or higher - impact behavioral changes that represent low - lying fruit, where later improvements may be more incremental and require greater efforts. these findings are consistent with previous work showing greater intervention impact on weight outcomes in the early periods of weight management. interestingly, bmi z - scores for the comparison group also decreased following the initial rise, although being at a lesser rate than for the intervention group, suggesting that the stage 1 strategy by primary care providers in our chpcc is also somewhat effective. therefore, closer followup by primary care providers is needed to ensure that referral or primary provider care occurs. standardized time intervals for followup of obese children could potentially improve outcomes. among children who attended our multidisciplinary program, we found that younger age was associated with better weight outcomes, which is consistent with a growing body of evidence linking earlier intervention with better long - term weight outcomes. for example, in two long - term follow - up studies of randomized trials, brotman. found that children at risk for behavioral problems who received a family intervention to promote effective parenting at age 4 y had lower bmi and improved health behaviors in preadolescence. reinehr. found that younger age (< 8 years) predicted the best long - term weight outcomes among obese children enrolled in a year - long lifestyle intervention. these findings collectively support the premise that early prevention may optimize weight outcomes in high - risk children, with important implications for future childhood obesity interventions. our study is limited by its retrospective observational design, which did not allow for the allocation of subjects in a randomized - controlled fashion to control unmeasured confounders such as self - motivation of changing lifestyle. however, a stratified data analysis by gender, race / ethnicity, and primary language did not yield substantial differences in estimated intervention effects, so it is unlikely that any unobserved allocation imbalances of baseline characteristics could completely explained the significant group differences in bmi z - score we observed. other limitations include selection bias due to eligibility criteria or loss to follow up since families with higher initial self - motivation and vigilance were more likely to accept and/or continue the intervention ; variations in intervention activities, intensity, and length ; and residual confounding by family socioeconomics. finally, the primary - care embedded within a tertiary hospital setting model may limit its generalizability. in this study, a group of racial - ethnically diverse overweight children attending a multidisciplinary weight management program demonstrated sustained but modest bmi z - score reductions over a 2-year period. younger children (< 5 years) had significantly better weight outcomes compared with older children. our findings suggest that multi - disciplinary programs might be considered as a treatment option within the spectrum of pediatric obesity management in health care settings and also that interventions targeting younger children might have greater impact. it is our next step to refine our intervention strategies to further increase their effectiveness. finally, future studies ought to evaluate the promise of early intervention and also consider cost - effectiveness analyses.	objective. to examine body mass index (bmi) changes among pediatric multidisciplinary weight management participants and nonparticipants. design. in this retrospective database analysis, we used multivariable mixed effect models to compare 2-year bmi z - score trajectories among 583 eligible overweight or obese children referred to the one step ahead program at the boston children 's primary care center between 2003 and 2009. results. of the referred children, 338 (58%) attended the program ; 245 (42%) did not participate and were instead followed by their primary care providers within the group practice. the mean bmi z - score of program participants decreased modestly over a 2-year period and was lower than that of nonparticipants. the group - level difference in the rate of change in bmi z - score between participants and nonparticipants was statistically significant for 06 months (p = 0.001) and 1924 months (p = 0.008) ; it was marginally significant for 1318 months (p = 0.051) after referral. younger participants (< 5 years) had better outcomes across all time periods examined. conclusion. children attending a multidisciplinary program experienced greater bmi z - score reductions compared with usual primary care in a real world practice ; younger participants had significantly better outcomes. future research should consider early intervention and cost - effectiveness analyses.
agranulocytosis, diabetic ketoacidosis, gastrointestinal hypomotility, and myocarditis are well - known adverse effects of clozapine, which are sometimes life threatening. here a male patient, 36 years, with elevated creatinine kinase levels (9899 u / l), developed rhabdomyolysis afterafter admission to the emergency department. approximately 24 h earlier he had intoxicated himself with his maintenance oral medication clozapine 125 mg, temazepam 20 mg and lorazepam 1.5 mg. co - medications, and physical and laboratory examinations did not reveal other risk factors for rhabdomyolysis. according to the naranjo probability scale there was a probable relation between clozapine dose and symptoms, that developed approximately 24 h after the auto - intoxication of 125 mg tablets. at day 5 of hospitalization, clozapine and creatinine kinase levels returned to normal and the patient was discharged with no somatic sequelae. elevated creatinine kinase levels in acute clozapine intoxication may be an indicator that rhabdomyolysis may be involved. rhabdomyolysis may occur upon an acute overdose of clozapine.elevated creatinine kinase levels in acute clozapine overdose may be associated with the development of rhabdomyolysis.rhabdomyolysis with elevated clozapine and creatinine kinase levels may be reversible. clozapine is an atypical antipsychotic drug that is used in patients who have not responded adequately to treatment with standard drug treatments for schizophrenia. its use is limited by agranulocytosis, a rare but potentially life - threatening adverse event. a 36-year - old man with a history of schizophrenia was admitted to the emergency department of our hospital because of altered consciousness and disorientation. according to the patient and his accompanying brother, he had intoxicated himself in the previous 24 h with his current maintenance medication, i.e., clozapine 125 mg, temazepam 20 mg, and lorazepam 1.5 mg, all prescribed once daily. he was known for excessive smoking and alcohol ingestion (an estimated intake of 15 units daily). he was tachycardic with a pulse of 145/min, blood pressure of 166/109 mmhg, and a respiration rate of 22/min. serum creatinine kinase (ck) 9899 u / l, aspartate aminotransferase 305 u / l, alanine aminotransferase 59 u / l, and lactate dehydrogenase 417 u / l were elevated. arterial blood gas analysis showed an elevated ph 7.49, po2 3.9 kpa, pco2 18.2 kpa, and bicarbonate 22 mmol / l. urine analyses for amphetamines, cocaine, methadone, opioids, and cannabis were negative. chest x - ray and computed tomography scan of the brain were both normal. the initial treatment consisted of 1 l of normal saline in 1 h, an additional 100 ml of sodium bicarbonate 8.4 %, followed by 4 l of normal saline in the next 6 h, for rhabdomyolysis, thiamine 100 mg intramuscularly for chronic alcohol abuse, and lorazepam 1 mg intravenously for agitation and ethanol withdrawal symptoms. approximately 10 h after arrival at the emergency department, analysis revealed extremely high plasma clozapine concentrations of 3177 g / l (reference values : 200600 g / l), and normal concentrations of temazepam and lorazepam of 0.19 mg / l (reference values : 0.100.80 mg / l) and 0.14 mg / l (reference values : 0.020.25 the clozapine plasma concentration decreased to non - toxic concentrations (153 g / l) 5 days after hospitalization (fig. 1). 1patient clozapine and creatinine kinase (ck) concentrations during 5 days of hospitalization patient clozapine and creatinine kinase (ck) concentrations during 5 days of hospitalization clozapine is an antipsychotic drug with potentially harmful adverse effects. the most frequently reported symptoms in clozapine intoxication are impaired alertness and tachycardia. also known, but scarcely reported, are extremely high ck levels and rhabdomyolysis. another cause of rhabdomyolysis in relation to clozapine is a neuroleptic malignant syndrome, a potentially life - threatening but rare condition occurring in psychiatric patients receiving neuroleptic agents. however, our patient showed no hyperthermia or muscle rigidity and did not meet the diagnostic and statistical manual of mental disorders - fourth edition criteria. furthermore, the co - medication of temazepam and lorazepam is not likely to be associated with rhabdomyolysis because these agents have no clinically relevant interaction with clozapine ; benzodiazepines solely have been described to be related to this side effect. however, in the present case, the immobilization secondary to the clozapine overdose and delirium tremens due to alcohol abstinence can not be excluded as contributing factors to the development or augmentation of rhabdomyolysis. according to the naranjo probability scale, there was a probable relationship, i.e., score 6, between the development of rhabdomyolysis and clozapine overdose in this patient. this score was calculated from the results of previous conclusive reports on the reaction (+ 1), appearance after the drug was given (+ 2), improvement on discontinuation (+ 1), alternative causes (1), toxic concentrations (+ 1), reaction less severe when exposure decreased (+ 1), and confirmation of the adverse event by objective evidence, i.e., manifest rhabdomyolysis and elevated concentrations (+ 1). in conclusion, when ck levels are elevated in patients treated for an overdose with clozapine, rhabdomyolysis should be considered. frank g. a. jansman, heleen a. crommelin, freek j. a. h. van hout, and jan meulenbelt declare that they have no conflict of interest. no financial support was received for the conduct of this study or preparation of this manuscript. a copy of the written consent is available for review by the editor - in - chief of this journal.	contextclozapine is used for decennia for the treatment of schizophrenia. agranulocytosis, diabetic ketoacidosis, gastrointestinal hypomotility, and myocarditis are well - known adverse effects of clozapine, which are sometimes life threatening. here we report a case of rhabdomyolysis upon an acute overdose of clozapine.casea male patient, 36 years, with elevated creatinine kinase levels (9899 u / l), developed rhabdomyolysis afterafter admission to the emergency department. approximately 24 h earlier he had intoxicated himself with his maintenance oral medication clozapine 125 mg, temazepam 20 mg and lorazepam 1.5 mg. co - medications, and physical and laboratory examinations did not reveal other risk factors for rhabdomyolysis. according to the naranjo probability scale there was a probable relation between clozapine dose and symptoms, that developed approximately 24 h after the auto - intoxication of 125 mg tablets. at day 5 of hospitalization, clozapine and creatinine kinase levels returned to normal and the patient was discharged with no somatic sequelae.conclusionselevated creatinine kinase levels in acute clozapine intoxication may be an indicator that rhabdomyolysis may be involved.
graphene, a single layer of sp - bonded carbon, has fabulous electronic, mechanical, and optical properties. owing to its industrial adaptability, epitaxial graphene (eg) formed by annealing of sic bulk crystal is attracting recent attentions [2 - 4 ]. eg, however, face two challenges : the limited diameter of the substrate and the low cost - performance in the current price. to overcome these challenges, we have been investigating the use of sic thin films on si substrates, instead of sic bulk crystals, in the formation of graphene. we have actually succeeded in fabricating a graphene on an epitaxial sic thin film on si substrate by sublimating silicon atoms from the surface of the epitaxial sic thin film. this graphene - on - silicon (gos) method has a potential of forming graphene films on large - scale si wafers. this undoubtedly requires detailed understanding of the graphitization mechanism in gos as a prerequisite. in the case of epitaxial graphene formation on si - face 4h- or 6h - sic(0001) substrates, several groups [2 - 4 ] have reported that graphene (1 1) is formed after the appearance of two sic reconstructions : (3 3)r30 and (63 63)r30 in this order. gos process on si(111) substrates follows this process. to go further into the clarification of the mechanism of graphitization conducted temperature - programmed desorption measurement on molecular hydrogen (h2-tpd) for each of the reconstructed surfaces of 6h - sic(0001). they concluded that the hydrogen adsorption site shifts from si to c after graphitization, but detailed identification of the h2-tpd peaks has not been given yet. in this study, we have conducted tpd using molecular deuterium (d2-tpd) to investigate the surface chemistry involved in the gos process on 3c - sic(111)/si(111). c1s core - level and raman spectroscopies have also been used as complementary means to support the understandings given by d2-tpd. a p - type si(111) wafer (0.4000.600 cm) was cut into pieces to form specimens sized with 7 40 mm. the specimen, after degreased by ultrasonication in acetone and ethanol, was introduced into the uhv chamber (base pressure : ~10 torr) and flash - annealed at 1,473 k (sample a). the epitaxial 3c - sic thin films, ~100 nm in thickness, were grown by exposing the dc - heated si substrate (1,323 k) to a ch3sih3 (mms) gas. the samples were then annealed either at 1,273 k for 10 s (sample b), 1,423 k for 60 min (sample c), or 1,523 k for 30 min (sample d). after annealing, each sample was exposed to a flux of atomic deuterium, made by cracking of d2 molecules (~10 pa) by a hot tungsten filament (1,673 k). d2-tpd spectrum was then obtained by gradually increasing the sample temperature at a rate of 5 k / s. the x - ray source for the c1s core - level spectroscopy is non - monochromatized mg figure 1 compares the d2-tpd spectra for si (sample a), (3 3)r30-reconstructed 3c - sic(111)/si(111) (sample b), (63 63)r30-reconstructed 3c - sic(111)/si(111) (sample c), and (1 1) graphene/3c - sic(111)/si(111) (sample d) surfaces. the spectrum for si(111) (sample a) has two peaks at ~660 and ~780 k, which are ascribable to the deuterium desorption from d2-si and d - si, respectively. the dominance of the latter peak indicates that the surface of the si(111) substrate is largely terminated with monodeuteride. in the spectrum of the (3 3)r30-reconstructed 3c - sic(111)/si(111) surface (sample b), a new predominant peak appears at ~960 k. this peak is attributable to the deuterium desorption from d - si backbonded with carbon atoms (d - si(c)). concomitant with the appearance of the predominant peak of d - si backbonded with carbon atoms, the peaks of d2-si (660 k) and d - si (780 k) backbonded with silicon atoms decrease. the absence of peaks in the region ranging from 1,100 to 1,300 k indicates that no carbon atoms are present in the topmost layer. the surface of the (3 3)r30-reconstructed 3c - sic(111)/si(111) is thus proven to be si - terminated. d2-tpd spectra of sic thin film on si(a), after annealing at 1,273 k(b), 1,423 k(c), 1,523 k(d), respectively raman spectra of sic thin film on si, after annealing at (i) 1,273 k (sample b), (ii) 1,423 k (sample c), (iii) 1,523 k (sample d), respectively on the (63 63)r30-reconstructed 3c - sic(111)/si(111) (sample c), the tpd spectrum consists mainly of dx - si(c). here, x = 1 stands for the peak at 960 k and x = 2 for the peak at 850 k. it has been demonstrated in a previous report that the adsorption of hydrogen atoms onto the (63 63)r30-reconstructed sic surface breaks the bondings between the reconstructed layer and the sic interface, so that the surface carbon atoms in the layer are converted into graphene layer, and the sic interface is terminated with hydrogen. the main peak at 960 k is thus attributable to the deuterium desorption from d - terminated sic interface that results from the breakage of the bonds between the (63 63)r30-reconstructed layer and the underneath sic surface. small features appear in the temperature range of 1,1001,400 k. they are due to desorption of deuterium atoms bonded on sp - bonded carbon atoms by d - exposure. the appearance of these peaks is in agreement with the presence of the (63 63)r30-reconstructed layer because the reconstructed layer mainly consists of sp - bonded atoms, and part of the carbon atoms are covalently bonded with the sic surface. this d2-tpd result is in good agreement with the raman spectrum of the reconstructed layer. the appearance of the broad g band (~1,600 cm) indicates the formation of the cluster of sp - bonded carbon atoms, i.e., nanographene. the appearance of the d band (~1,350 cm) and the absence of the g band (~2,700 cm), however, indicate a low degree of the crystallinity of the sp - bonded network of the carbon atoms. c1s the surface components s1 (~285.2 ev) and s2 (~284.0 ev) appear as well as the component due to the bulk of the sic thin film (~283.0 ev). s1 and s2 are due to the carbon atoms connected with the sic surface and the sp - bonded carbon atoms, respectively, in the (63 63)r30-reconstructed layer. the intensity ratio of s1 and s2 peak is 2, as that of the spectrum of (63 63)r30-reconstructed layer on 6h - sic(0001). thus, the 3c - sic(111)/si(111) surface is proven to become c rich and (63 63)r30 reconstructed by annealing the si - terminated (3 3)r30-reconstructed surface. this change in the surface chemistry of 3c - sic(111)/si(111) is quite similar to that of 6h - sic(0001). cls core - level spectra of sic thin film on si, after annealing at (i) 1,273 k (sample b), (ii) 1,423 k (sample c), (iii) 1,523 k (sample d) annealing, respectively the tpd spectrum of the graphene overlayer on 3c - sic(111)/si(111) (sample d) drastically changes, as demonstrated in fig. two distinct peaks around 1,100 k and 1,300 k are due to desorption of deuterium bonded with sp - bonded carbon atoms in the graphene overlayer, while the peaks due to deuterium desorption from d - si of the sic thin film and si substrate (< 1,000 k) are not observed. the raman spectrum of the graphene overlayer (fig. 2(iii)) displays the g band, in addition to the g and the d bands. the presence of the g band indicates the well - ordered graphene overlayer because the appearance of g band is the consequence of the high degree of the crystallinity of the graphene layer. further, the g band consists of multiple components, as can be seen from the line shape of the g band. the peak due to sp - bonded carbon atoms (~284.3 ev) is dominant, and the component due to the (63 63)r30-reconstructed layer (~285.2 ev) is still observed. it can be thus concluded that the graphene overlayer grows on the (63 63)r30-reconstructed layer as the epitaxy of graphene on 6h - sic(0001). this can explain the disappearance of the peaks (dx - si(c)) that is related with the (63 63)r30-reconstructed layer in the tpd spectrum of sample d, because graphene overlayer blocks adsorption or desorption of deuterium onto the surface. we have probed the epitaxial processes of graphene on 3c - sic(111)/si(111) in situ by d2-tpd spectroscopy, and complemental ex situ spectroscopies, such as raman spectroscopy and c1s core - level spectroscopy. the results obtained in this study indicate that the epitaxy of graphene on 3c - sic(111)/si(111) proceeds in a similar manner to that on hexagonal sic(0001) bulk crystals. the work was supported by crest, the japan science and technology agency (jst), japan. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.	surface chemistry involved in the epitaxy of graphene by sublimating si atoms from the surface of epitaxial 3c - sic(111) thin films on si(111) has been studied. the change in the surface composition during graphene epitaxy is monitored by in situ temperature - programmed desorption spectroscopy using deuterium as a probe (d2-tpd) and complementarily by ex situ raman and c1s core - level spectroscopies. the surface of the 3c - sic(111)/si(111) is si - terminated before the graphitization, and it becomes c - terminated via the formation of c - rich (63 63)r30 reconstruction as the graphitization proceeds, in a similar manner as the epitaxy of graphene on si - terminated 6h - sic(0001) proceeds.
comparative analysis of genomes from distant species provides new insights into gene functions, genome evolution and phylogeny. in particular, the comparative genomics of prokaryotes has revealed previously underappreciated major trends in genome evolution, namely, extensive lineage - specific gene loss and horizontal gene transfer (hgt) [1 - 7 ]. to efficiently extract functional and evolutionary information from multiple genomes, the two principal classes of homologs are orthologs and paralogs [8 - 11 ]. orthologs are defined as homologous genes that evolved via vertical descent from a single ancestral gene in the last common ancestor of the compared species. paralogs are homologous genes, which, at some stage of evolution, have evolved by duplication of an ancestral gene. orthology and paralogy are intimately linked because, if a duplication (or a series of duplications) occurs after the speciation event that separated the compared species, orthology becomes a relationship between sets of paralogs, rather than individual genes (in which case, such genes are called co - orthologs). correct identification of orthologs and paralogs is of central importance for both the functional and evolutionary aspects of comparative genomics. orthologs typically occupy the same functional niche in different organisms ; in contrast, paralogs evolve to functional diversification as they diverge after the duplication [14 - 16 ]. a clear demarcation of orthologs and paralogs is also required for constructing evolutionary scenarios, which include, along with vertical inheritance, lineage - specific gene loss and hgt. in principle, orthologs, including co - orthologs, should be identified by means of phylogenetic analysis of entire families of homologous proteins, which is expected to define orthologous protein sets as clades [17 - 19 ]. however, for genome - wide protein sets, such analysis remains extremely labor - intensive, and error - prone as well. accordingly, procedures have been developed for identifying sets of likely orthologs without explicit referral to phylogenetic analysis. these procedures are based on the notion of a genome - specific best hit (bet), that is, the protein from a target genome that is most similar (typically in terms of similarity scores computed using blast or another sequence - comparison method) to a given protein from the query genome. the assumption central to this approach is that orthologs have a greater similarity to each other than to any other protein from the respective genomes. when multiple genomes are analyzed, pairs of probable orthologs detected on the basis of bets are combined into orthologous clusters represented in all or a subset of the analyzed genomes. this approach, amended with additional procedures for detecting co - orthologous protein sets and for treating multidomain proteins, was implemented in the database of clusters of orthologous groups (cogs) of proteins. the current cog set includes approximately 70% of the proteins encoded in 69 genomes of prokaryotes and unicellular eukaryotes. the cogs have been used for functional annotation of new genomes [26 - 29 ], target selection in structural genomics [30 - 32 ], identification of potential drug targets and genome - wide evolutionary studies [4,13,35 - 38 ]. sonnhammer and co - workers independently developed a similar methodology for identification of co - orthologous protein sets from pairwise genome comparisons and applied it to the sequenced eukaryotic genomes. a central notion introduced in the context of the cog analysis is that of a phyletic pattern, that is, the pattern of representation (presence - absence) of analyzed species in each cog. the cogs show a remarkable scatter of phyletic patterns, with only a small minority represented in all sequenced genomes. a recent quantitative study showed that parsimonious evolutionary scenarios for most cogs involve multiple events of gene loss and hgt. both similarity and complementarity among the phyletic patterns of cogs, in conjunction with other information, such as conservation of gene order, the comparison of phyletic pattern has been formalized in set - theoretical algorithms and systematically applied to the computational and experimental analysis of bacterial flagellar systems, which demonstrated the considerable robustness of this approach. we recently extended the system of orthologous protein clusters to complex, multicellular eukaryotes. here, we examine the phyletic patterns of kogs in connection with known and predicted protein functions. in - depth analysis of some of these kogs resulted in prediction of previously uncharacterized, but apparently essential, conserved eukaryotic protein functions. we also reconstruct the parsimonious scenario of evolution of the crown - group eukaryotes by assigning the loss of genes (kogs) and emergence of new genes to the branches of the phylogenetic tree and explicitly delineate the minimal gene sets for various ancestral forms. to our knowledge, this is the first systematic, genome - wide examination of the sets of orthologous genes in eukaryotes. eukaryotic kogs were constructed on the basis of the comparison of proteins encoded in the genomes of three animals (homo sapiens, the fruit fly drosophila melanogaster and the nematode caenorhabditis elegans), the green plant arabidopsis thaliana (thale cress), two fungi (budding yeast saccharomyces cerevisiae and fission yeast schizosaccharomyces pombe) and the microsporidian encephalitozoon cuniculi. the procedure for kog construction was a modification of the one previously used for cogs and is described in greater detail elsewhere (; see also materials and methods). an important difference stems from the fact that complex eukaryotes encode many more multidomain proteins than prokaryotes and, furthermore, orthologous eukaryotic proteins often differ in domain composition, with additional domains accrued in more complex forms. accordingly, and unlike the original cog construction procedure, probable orthologs with different domain architectures were assigned to one kog and were not split if they shared a common core of domains. in addition to the kogs, which consisted of at least three species, clusters of putative orthologs from two species (twogs) and lineage - specific expansions (lses) of paralogs from each of the analyzed genomes were identified (; figure 1 shows the assignment of the proteins from each of the analyzed eukaryotes to kogs with different numbers of species, twogs and lses. the fraction of proteins assigned to kogs tends to decrease with the increasing genome size, from 81% for s. pombe to 51% for the largest, the human genome. (for reasons that remain unclear, but might be related to its intracellular parasitic lifestyle, e. cuniculi has a relatively small fraction of conserved proteins that belonged to kogs : approximately 60%.) the contribution of lses shows the opposite trend, being the greatest in the largest genomes, that is, human and arabidopsis, and minimal in the microsporidian (figure 1). a notable difference was observed between eukaryotes in terms of their representation in kogs found in different numbers of species. while the three unicellular organisms are represented mainly in the highly conserved seven- or six - species kogs, a much larger fraction of the gene set in animals and arabidopsis is accounted for by lses, and by kogs found in three or four genomes. these include animal - specific genes and genes that are shared by plants and animals but not by fungi and the microsporidian (figure 1). the large number of kogs in the latter group (700 kogs represented in arabidopsis and at least two animal species) is notable and probably results from massive, lineage - specific loss of genes during eukaryotic evolution (see below). the phyletic patterns of kogs reveal both the existence of a conserved eukaryotic gene core and substantial diversity. the ' pan - eukaryotic ' genes, which are represented in each of the seven analyzed genomes, account for around 20% of the kogs, and approximately the same number of kogs include all species except for the microsporidian, an intracellular parasite with a highly degraded genome. among the remaining kogs, a large group includes representatives of the three analyzed animal species (worm, fly and humans) but a substantial fraction (approximately 30%) are kogs with unexpected patterns, for example, one animal, one plant and one fungal species (see and examples in table 1). during the manual curation of the kog set, the kogs with unexpected patterns were scrutinized in an effort to detect potential highly diverged members from one or more of the analyzed genomes. some of these unexpected patterns might indicate that a gene is still missing in the analyzed set of protein sequences from one or more of the species included ; reports of newly discovered genes have appeared since the release of the initial reports on genome sequences of complex eukaryotes, for example, as a result of massive sequencing of human cdnas, exhaustive annotation of the drosophila genome and comparative analysis of closely related yeast genomes. the unexpected phyletic patterns seem, however, largely to reflect the extensive, lineage - specific gene loss that is characteristic of eukaryotic evolution ; on many occasions, this scenario is supported by the presence of orthologs in other eukaryotic lineages and/or in prokaryotes (table 1). however, interesting exceptions to the multiple loss explanation might exist as exemplified by the atp / adp - translocase, which is present in arabidopsis and encephalitozoon and could have evolved via independent hgt from intracellular bacterial parasites (and table 2). common phyletic patterns of genes that otherwise were not suspected to be functionally linked might suggest the existence of such connections and prompt additional analysis leading to concrete functional predictions [42,59 - 61 ]. the pair of kog5324 and kog4246 is a case in point that has not been described previously. the initial observation that these kogs share the same unusual pattern of presence - absence in eukaryotes, and have similar phyletic patterns in prokaryotes, with a ubiquitous presence in archaea, prompted a more detailed examination of the multiple alignments of the respective proteins and the conservation of the (predicted) operon organization in archaea and bacteria (table 2 and data not shown). the combination of clues from these analyses suggests that the two proteins interact in a still uncharacterized pathway of rna processing, which also includes rna 3'-phosphate cyclase (kog3980)) and cytosine - c5-methylase (nol1/nop2 in eukaryotes ; kog1122). the proteins in kog3833 and kog4528 are likely to represent novel enzyme families, possibly a kinase - phosphatase pair (e.v.k. and l. aravind, unpublished data). notably, these predicted new enzymes are present in animals and e. cuniculi but not in arabidopsis or yeasts. in contrast, kog3980 is present in all analyzed eukaryotic genomes except for arabidopsis, whereas kog1122 is pan - eukaryotic. these differences in the phyletic patterns of the components of the predicted pathway are concordant with the patterns in eukaryotes in that. figure 2 shows the distribution of known and predicted functions of eukaryotic proteins among 20 functional categories for the entire set of kogs and, separately, for kogs represented in six or seven species and the animal - specific kogs. compared to the functional breakdown of prokaryotic cogs, the prevalence of signal transduction is notable among eukaryotes. this feature is particularly prominent in animal - specific kogs, whereas the highly conserved set is comparatively enriched in proteins that are involved in translation, transcription, chaperone - like functions, cell cycle control and chromatin dynamics (figure 2). the large number of kogs for which only general functional prediction was feasible, and those whose functions remain unknown, even among the subset that is represented in six or seven eukaryotic species, emphasizes that our current understanding of eukaryotic biology is seriously lacking with even in respect of the functions of highly conserved genes. the distribution of kogs by the number of paralogs in each genome is shown in figure 3. the preponderance of lineage - specific duplication of conserved genes, that is, intra - kog lses, in multicellular eukaryotes is obvious. cases when a single gene in yeast or, particularly, encephalitozoon, has two or more co - orthologs in animals and/or plants are most common in kogs, whereas the reverse situation is rare. these observations support the notion of the major contribution of lse to the evolution of eukaryotic complexity. however, 131 kogs are represented by a single ortholog in all genomes compared (table 2) and a substantial number of kogs have one member from a majority of the genomes (data not shown). recent theoretical modeling of the evolution of paralogous families has suggested that, in general, ancient protein families tend to have multiple paralogs. therefore, whenever a kog has a single member in all or most species, this should be attributed to selection against duplication of this particular gene. a prominent cause of such selection could be the involvement of the respective gene products in essential multisubunit complexes, such that imbalance between subunits leads to deleterious effects. we examined in greater detail the 131 kogs that are represented by a single gene in each of the seven genomes (table 2). as can be envisaged from their presence in diverse eukaryotic taxa, including the ' minimal ' genome of encephalitozoon, and as shown by comparison with the knockout phenotype data (table 2 and see below), these pan - eukaryotic kogs are of particular biological importance. for the great majority of these kogs (113 of the 131), the function has been experimentally determined or confidently predicted to a varying degree of detail using computational methods (table 2). however, around 20 kogs from this set remained uncharacterized at the time of this analysis and, for all but two of these, substantial functional inferences could be drawn through a combination of sequence - profile analysis, structure prediction and genomic - context analysis of prokaryotic homologs (table 2). some of these predicted new functions are variations on well - known themes, such as two predicted pp - loop atpases, which are probably involved in novel, essential rna modifications (kogs 2522 and 2316) or two predicted e3 components of ubiquitin ligases (kogs 0396 and 3800). other predicted functions appear to be completely new, such as proteins in kog3176 and 3303 which are likely to be essential components of eukaryotic replication and/or repair systems. each of these uncharacterized but ubiquitous and largely essential eukaryotic genes is an attractive target for experimental studies. examination of the experimentally characterized and predicted functions of pan - eukaryotic, single - member kogs leads to interesting conclusions. nearly all the functionally characterized kogs in this set consist of proteins that are subunits of known multiprotein complexes (table 2). the most prominent of these are the complexes involved in rrna processing and ribosome assembly, such as the recently discovered rrna processosome and the pre-40s subunit, as well as the spliceosome, and various complexes involved in transcription (table 2). accordingly, this set of kogs is markedly enriched for proteins involved in various forms of rna processing, assembly of ribonucleoprotein (rnp) particles and transcription. kogs in the single - member pan - eukaryotic set include subunits of molecular complexes that are not directly related to rna processing, such as the proteasome, the tcp-1 chaperonin complex and the trapp complex involved in protein trafficking. altogether, more than 80% of the yeast proteins in the pan - eukaryotic, single - member kogs belong to known macromolecular complexes included in the mips database, as compared to around 64% for all yeast proteins in the kogs, which is a moderate but statistically highly significant excess (data not shown). this preponderance of multiprotein complex formation among the single - member pan - eukaryotic kogs is fully compatible with the balance hypothesis. the most unexpected observation regarding the single - member, pan - eukaryotic kogs, is probably that in 14 of these proteins, the only detectable domain was the wd40 repeat (table 2). this is particularly notable because wd40-repeat proteins, which are extremely abundant in eukaryotes and are present in several prokaryotic lineages as well, are not generally known to form well - defined, one - to - one orthologous relationships. the wd40 proteins in the pan - eukaryotic kogs listed in table 2 are exceptions, which is probably due to their unique and essential roles in the assembly of rna - processing complexes. it has recently been demonstrated that, in s. cerevisiae, seven of these proteins are subunits of the 18s rrna processosome, or at least are involved in ribosomal assembly. taking these results together with the unusual phyletic pattern, it seems possible to predict with considerable confidence that those wd40 proteins in the 131-kog set that remain uncharacterized belong to the same or similar rna - processing complexes (table 2). with some notable exceptions, such as the wd40 proteins, the kogs in the single - member, pan - eukaryotic set show remarkable patterns of evolutionary conservation : they are either (nearly) ubiquitous in the three kingdoms of life, for example, rna polymerase subunits, or are universally conserved in eukaryotes and archaea but missing in bacteria, such as most of the proteins implicated in rna processing (table 2). thus, it appears that elaborate molecular machines central to the functioning of the eukaryotic cell have evolved, largely from ancestral archaeo - eukaryotic components, at the onset of eukaryotic evolution, and both loss and duplication of the respective genes have been strongly selected against throughout the rest of eukaryotic evolution. genome - wide analysis of protein evolutionary rates shows a broad range of variation. here, we investigate the variation of evolutionary rates among the ubiquitous kogs represented in all seven analyzed genomes and the connection between the evolutionary rate and protein function in the kog set. the characteristic evolutionary rate of each kog, which included a member(s) from arabidopsis, was determined by measuring the mean evolutionary distance from arabidopsis (the outgroup in the phylogenetic tree ; see below) to the other species. even among the kogs that include all seven species and, accordingly, appear to represent the conserved core of eukaryotic genes, the evolutionary rates differ by a factor of 20 between the fastest- and the slowest - evolving kogs. excluding 5% of the kogs from each tail of the distribution still leaves almost a fourfold difference in evolutionary rates (figure 4a). we then compared the distributions of evolutionary rates for different functional categories of kogs (tables 3,4 and figure 4b). although all the distributions substantially overlapped, there was a statistically highly significant difference between the evolutionary rates for proteins with different functions (tables 3,4 and figure 4b). the slowest - evolving proteins are those involved in translation and rna processing, the fastest - evolving ones are involved in cellular trafficking and transport, whereas components of replication and transcription systems have intermediate evolutionary rates (tables 3,4 and figure 4b). assuming a particular species tree topology, methods of evolutionary parsimony analysis can be used to construct a parsimonious scenario of evolution, that is, mapping of different types of evolutionary events onto the branches of the tree. with prokaryotes, the problem is confounded by the major contributions from both lineage - specific gene loss and hgt to genome evolution, with the relative likelihoods of these events remaining uncertain. the possibility of substantial hgt between major lineages of eukaryotes can apparently be safely disregarded, providing for an unambiguous most parsimonious scenario that includes only gene loss and emergence of new genes as elementary events. some crucial aspects of the phylogenetic tree of the eukaryotic crown group remain a matter of contention. the consensus of many phylogenetic analyses appears to point to an animal - fungal clade and clustering of microsporidia with the fungi. however, a major uncertainty remains with respect to the topology of the animal tree : the majority of studies on protein phylogenies support a coelomate (chordate - arthropod) clade [72 - 74 ], whereas rrna phylogeny and some protein family trees point to the so - called ecdysozoan (arthropod - nematode) clade [75 - 78 ]. we treated the phyletic pattern of each kog as a string of binary characters (1 for the presence of the given species and 0 for its absence in the given kog) and constructed the parsimonious scenarios of gene loss and emergence during evolution of the eukaryotic crown group for both the coelomate and the ecdysozoan topologies of the phylogenetic tree. for the purpose of this reconstruction, the dollo parsimony approach was adopted. under this approach, gene loss is considered irreversible ; thus, a gene (a kog member) can be lost independently in several evolutionary lineages but can not be regained. this assumption is justified by the implausibility of hgt between eukaryotes (the dollo approach is not valid for reconstruction of prokaryotic ancestors). in the resulting parsimonious scenarios, each branch was associated with both gene loss and emergence of new genes, with the exception of the plant branch and the branch leading to the common ancestor of fungi and animals, to which gene losses could not be assigned with the current set of genomes (figure 5a, b). there is little doubt that, once genomes of early - branching eukaryotes are included, gene loss associated with these branches will become apparent. the principal features of the reconstructed scenarios include massive gene loss in the fungal clade, with additional elimination of numerous genes in the microsporidian ; emergence of a large set of new genes at the onset of the animal clade ; and subsequent substantial gene loss in each of the animal lineages, particularly in the nematodes and arthropods (figure 5a, b). the estimated number of genes lost in s. cerevisiae after its divergence from the common ancestor with the other yeast species, s. pombe, closely agreed with a previous estimate produced by a different approach. the switch from the coelomate topology of the animal sub - tree to the ecdysozoan topology resulted in relatively small changes in the distribution of gains and losses : the most notable difference was the greater number of genes lost in the nematode lineage and the smaller number of genes lost in the insect lineage under the ecdysozoan scenario compared to the coelomate scenario (figure 5a, b). the parsimony analysis described above involves explicit reconstruction of the gene sets of ancestral eukaryotic genomes. under the dollo parsimony model, which was used for this analysis, an ancestral gene (kog) set is the union of the kogs that are shared by the respective outgroup and each of the remaining species. thus, the gene set for the common ancestor of the crown group includes all the kogs in which arabidopsis co - occurs with any of the other analyzed species. similarly, the reconstructed gene set for the common ancestor of fungi and animals consists of all kogs in which at least one fungal species co - occurs with at least one animal species. these are conservative reconstructions of ancestral gene sets because, as already indicated, gene losses in the lineages branching off the deepest bifurcation could not be detected. under this conservative approach, 3,413 genes (kogs) were assigned to the last common ancestor of the crown group (figure 5a, b). more realistically, it appears likely that a certain number of ancestral genes have been lost in all, or all but one, of the analyzed lineages during subsequent evolution, such that the gene set of the eukaryotic crown group ancestor might have been close in size to those of modern yeasts. in terms of the functional composition, the reconstructed core gene set of the crown - group ancestor resembled more the highly conserved kogs than the animal - specific kogs (figure 3) in being enriched in housekeeping functions such as translation, transcription and rna processing (data not shown). the functional profiles of the gene sets that were lost in different lineages showed substantial differences (table 5). thus, for example, in the lineage leading to the common ancestor of the animals, the greatest loss among genes assigned to functional categories was seen in amino acid and coenzyme metabolism ; in contrast, in the fly and the nematode, more substantial degradation was observed among transcription factors and proteins with chaperone - like functions. genes for proteins involved in rna processing and translation are, in general, not heavily affected by loss except in the highly degraded parasite e. cuniculi. on many occasions, the switch from the coelomate to the ecdysozoan topology replaces two independent, parallel losses in the insect and nematode clades with a single loss at the base of the ecdysozoan branch, although, on the whole, trees based on gene content support the coelomate topology. in particular, the ecdysozoan topology, unlike the coelomate topology, implies early loss of several genes involved in translation, transcription and repair (table 6). notably, a large fraction of genes lost in each lineage has only a general functional prediction or no prediction at all (table 5). as noticed previously during the analysis of the genes lost in s. cerevisiae after its divergence from the common ancestor with s. pombe, functionally connected genes tend to be co - eliminated during evolution. the present study generalizes this conclusion as many functionally coherent groups of co - eliminated kogs become apparent (table 5). importantly, different branches of the same complex systems tend to be eliminated in parallel in different lineages, for example, largely non - overlapping sets of genes for proteins of the ubiquitin - proteasome - signalosome systems are lost in the fungal - microsporidial lineage and in the nematodes (table 6). it seems likely that elimination of these genes reflects independent trends for simplification of regulatory processes in these lineages. an interesting trend seen in these data is the deterioration of the mitochondrial ribosome, which occurred in several eukaryotic lineages and appears to have been partly parallel (as it occurred independently in fungi - microsporidia and in animals) and partly consecutive : early loss in the ancestral animal line was followed by elimination of additional genes for ribosomal proteins in individual lineages (table 6). c. elegans has one of the shortest mitochondrial rrnas and might have a ' minimal ' mitochondrial ribosome ; the present analysis details the stages leading to this ultimate degradation of the mitochondrial ribosome. an exhaustive analysis of the patterns of gene loss is beyond the scope of this work. it seems clear that it has potential of improving our understanding of eukaryotic evolution and functional predictions through examination of co - eliminated gene groups. the prokaryotic cogs and eukaryotic kogs were identified in separate genome comparisons, although an overlap existed because both sets included the unicellular eukaryotes, namely two yeasts and the microsporidian. to identify the prokaryotic counterparts of the kogs, the sequences of the eukaryotic proteins included in the kogs were compared using the rps - blast program to the position - specific scoring matrices (pssms) constructed for all prokaryotic cogs (see materials and methods for details). the results were checked manually and also by comparing the assignment of proteins from unicellular eukaryotes to each of the orthologous gene sets. altogether, probable orthologous relationships were established between 2,456 eukaryotic kogs and twogs (44% of the total) and 1,516 prokaryotic cogs. a more detailed breakdown of the relationships between eukaryotic and prokaryotic orthologous gene clusters could reveal important evolutionary trends. figure 6a compares the occurrence of prokaryotic counterparts for the entire set of eukaryotic kogs and its subsets conserved at different levels. clearly, the reconstructed gene set of the common ancestor of the crown group and, particularly, the pan - eukaryotic kogs are enriched in ancient kogs (those with prokaryotic counterparts) as compared to the full kog collection. in contrast, among kogs that are inferred to have evolved in individual lineages within the crown group, a significantly lower fraction has detectable prokaryotic counterparts (figure 6a). early evolution of eukaryotes is known to have involved duplication of ancient genes inherited from prokaryotes, and this was apparent in the kogs against cogs comparison. although one - to - one relationships were predominant, in around 30% of cases, two or more eukaryotic kogs corresponded to the same prokaryotic cog (figure 6b). this indicates extensive duplication of ancestral genes at early stages of eukaryotic evolution ; moreover, a substantial fraction of these genes have undergone repeated duplications, resulting in a one - to - many relationship between prokaryotic and eukaryotic orthologs (figure 6b). an in - depth analysis of the relationships between eukaryotic and prokaryotic orthologous gene clusters should include an attempt to decipher their evolutionary history, that is, classification of the c / kogs represented both in eukaryotes and prokaryotes into : those that have been inherited from the last universal common ancestor ; the archaeo - eukaryotic subset ; and those that are shared because of hgt between bacteria and eukaryotes at various stages of eukaryotic evolution. perhaps the principal message to stress here is that, using a fairly sensitive sequence comparison method, prokaryotic homologs could be detected for only some 44% of the eukaryotic kogs, and this fraction increased to around 54% for those genes that could be traced to the last common ancestor of the crown group (figure 6a). this observation emphasizes the major amount of innovation that accompanied the emergence and early evolution of eukaryotes ; even those kogs for which prokaryotic counterparts will be eventually identified through more sensitive sequence and structure comparison apparently experienced rapid evolution during the prokaryote - eukaryote transition. there are 860 kogs with at least one representative from each of the seven analyzed genomes. in accord with the ' knockout rate ' hypothesis, which has been largely supported by recent, genome - wide analysis of gene conservation, it could be expected that these highly conserved genes were essential for the survival of eukaryotic organisms. this appears particularly plausible given the near - minimal eukaryotic gene complement of the microsporidian. the prediction was put to the test using the recently published functional profile of the yeast s. cerevisiae genome, which includes the data on the growth rates of homozygous deletion strains for 96% of the open reading frames (orfs) in the yeast genome. when the phyletic patterns of the kogs were superimposed on the data on gene dispensability (with essential genes operationally defined as those whose deletion had a lethal effect in a rich medium), it was found that 45% of the essential genes were conserved in all seven species and 25% were represented in six species (typically with the exception of e. cuniculi) ; 15% of the essential yeast genes had no orthologs in the other analyzed genomes (figure 7a). in a striking contrast, among non - essential genes, only 16.5% were represented in all compared genomes and 28.5% had no detectable orthologs (figure 7a). the reciprocal comparison is equally illustrative : essential genes composed 18.5% of the entire set of yeast genes but 35% of the genes (kogs) represented in all seven species. this translates into a statistically highly significant dependence between a gene 's (in)dispensability and conservation over long evolutionary distances. the probability of the set of highly conserved genes being so enriched for essential genes as a result of chance was estimated at 0.5) were discarded. as the divergence times for all kogs are presumed to be the same (and equal to the time elapsed since the last common ancestor for the eukaryotic crown group), the mean evolutionary distance in a kog is a measure of the kog 's evolutionary rate. the parsimonious evolutionary scenario, which included gene losses and emergence of kogs mapped to the branches of the eukaryotic phylogenetic tree, was constructed by using the dollop program of the phylip package ; this program is based on the dollo parsimony method, which assumes irreversibility of character loss. for the analysis of domain accretion, conserved domains from the ncbi cdd database were detected in the eukaryotic proteins that belonged to the kogs by using the rps - blast program with an e - value cut - off of 0.001. domains with biased amino acid sequence composition, which tend to produce a high false - positive rate in rps - blast searches, were excluded from the analysis. the protein sets for all eukaryotic species, with the exception of c. elegans and h. sapiens, were from the genome division of the national center for biotechnology information (ncbi). the protein sequences for c. elegans were from the wormpep67 database and the human sequences were from ncbi build 30. briefly, the kog construction protocol included : first, the detection and masking of common, repetitive domains using the rps - blast program and the pssms for the respective domains from the cdd collection ; second, all - against - all comparison of protein sequences from the analyzed genomes using the blastp program, with masking of low sequence complexity regions using the seg program ; third, identification of triangles of mutually consistent bets ; merging triangles of bets with a common side to form preliminary kogs ; forth, adding members of co - orthologous sets missed at previous step using the cognitor procedure ; fifth, manual examination of each candidate kog, aimed at eliminating the false positives incorporated into the kogs by the automatic procedure and inclusion of false negatives that were missed originally ; sixth, assignment of proteins containing promiscuous domains masked at the first step to fuzzy orthologous groups (fogs), named after the respective domains (when a sequence assigned to a kog contained one or more masked domains, the sequences of these domains were restored) ; and finally, examination of the largest preliminary kogs, which included numerous proteins from all or several genomes by using phylogenetic trees, cluster analysis with the blastclust program, comparison of domain architectures, and visual inspection of alignments. as a result, annotation of kogs included critical assessment of the annotations available through genbank, other public databases and the primary literature and additional, in - depth sequence analysis aimed at detection of previously unnoticed homologous relationships. the annotated functions of kogs were classified into 23 categories (see legend to figure 3), which were adapted from the functional classification previously used for cogs by including several specific eukaryotic categories. during kog annotation, proteins that are currently annotated as ' hypothetical ' or ' unknown ', or otherwise had a vague or suspect annotation, were subject to additional sequence analysis, which included iterative sequence similarity searches with the psi - blast program, rps - blast searches for conserved domains, and additional domain architecture analysis using the smart system. to estimate sequence evolution rates, multiple alignments of kogs were constructed using the map program and the pairwise evolutionary distances were calculated with the maximum likelihood method under the pam model by using the protdist program of the phylip package. when a kog included more than one member from the given species, the paralog with the greatest average similarity to proteins from other organisms a. thaliana is the most likely outgroup species for the analyzed set of eukaryotes, distances from the arabidopsis representative to proteins from all other species were averaged to estimate the characteristic evolutionary distance for the given kog. data from kogs with excessive variability of the distances between a. thaliana and other species (standard deviation to mean ratio > 0.5) were discarded. as the divergence times for all kogs are presumed to be the same (and equal to the time elapsed since the last common ancestor for the eukaryotic crown group), the mean evolutionary distance in a kog is a measure of the kog 's evolutionary rate. the parsimonious evolutionary scenario, which included gene losses and emergence of kogs mapped to the branches of the eukaryotic phylogenetic tree, was constructed by using the dollop program of the phylip package ; this program is based on the dollo parsimony method, which assumes irreversibility of character loss. for the analysis of domain accretion, conserved domains from the ncbi cdd database were detected in the eukaryotic proteins that belonged to the kogs by using the rps - blast program with an e - value cut - off of 0.001. domains with biased amino acid sequence composition, which tend to produce a high false - positive rate in rps - blast searches, were excluded from the analysis. we thank roman tatusov for his major contribution to the construction of the kogs, igor garkavtsev for his participation in the initial stages of the kog project, and l. aravind and wei yang for useful discussions and sharing their unpublished observations. assignment of proteins from each of the seven analyzed eukaryotic genomes to kogs with different numbers of species and to lses. 0, proteins without detectable homologs (singletons) ; 1, lses. species abbreviations : ath, arabidopsis thaliana ; cel, caenorhabditis elegans ; dme, drosophila melanogaster ; ecu, encephalitozoon cuniculi ; hsa, homo sapiens ; sce, saccharomyces cerevisisae ; spo, schizosaccharomyces pombe. distribution of the kogs by the number of paralogs in each of the analyzed eukaryotic genomes. designations of functional categories : a, rna processing and modification ; b, chromatin structure and dynamics ; c, energy production and conversion ; d, cell - cycle control and mitosis ; e, amino acid metabolism and transport ; f, nucleotide metabolism and transport ; g, carbohydrate metabolism and transport ; h, coenzyme metabolism ; i, lipid metabolism ; j, translation ; k, transcription ; l, replication and repair ; m, membrane and cell wall structure and biogenesis ; o, post - translational modification, protein turnover, chaperone functions ; p, inorganic ion transport and metabolism ; q, secondary metabolites biosynthesis, transport and catabolism ; t, signal transduction ; u, intracellular trafficking and secretion ; y, nuclear structure ; z, cytoskeleton ; r, general functional prediction only (typically, prediction of biochemical activity), s, function unknown. (a) probability - density function for the distribution of evolutionary rates among the set of kogs including all seven analyzed eukaryotic species. (b) distribution functions for the evolutionary rates in different functional categories of kogs. (a) the coelomate topology of the phylogenetic tree of the eukaryotic crown group. (b) the ecdysozoan topology of the phylogenetic tree of the eukaryotic crown group. the numbers in boxes indicate the inferred number of kogs in the respective ancestral forms. the numbers next to branches indicate the number of gene gains (emergence of kogs) (numerator) and gene (kog) losses (denominator) associated with the respective branches ; a dash indicates that the number of losses for a given branch could not be determined. proteins from each genome that did not belong to kogs as well as lses were counted as gains on the terminal branches. cga, crown group ancestor ; non - cga, kogs not represented in the crown group ancestor ; msp, metazoa - specific kogs. (b) evidence of ancient duplications of eukaryotic genes revealed by the kogs against cogs comparison. the connections between kogs and cogs detected by using rps - blast (see text) were analyzed by single linkage clustering. (a) distribution of essential and non - essential genes among different size classes of kogs and lses in yeast saccharomyces cerevisiae. (b) distribution of essential and non - essential genes among different size classes of kogs and lses in the nematode c. elegans. the number of species in the kogs and lses is color - coded as indicated to the right of each plot. kogs and twogs with unexpected phyletic patterns (examples) abbreviations : a, thale cress a. thaliana ; c, nematode c. elegans ; d, fruit fly d. melanogaster ; e, microsporidian encephalitozoon cuniculi ; h, homo sapiens ; s, budding yeast s. cerevisiae ; p, fission yeast s. pombe ; a letter indicates the presence of the respective species in the given kog and a dash indicates its absence. kogs represented by exactly one ortholog in seven analyzed eukaryotic genomes (examples) abbreviations for the functional categories are as in figure 3. 0, essential gene (lethal knockout) ; 1, non - essential gene (non - lethal knockout) ; x indicates that no data is available for the given gene. evolutionary rates in kogs with different functions : evolutionary rates for different functional categories of kogs only the kogs that included a member(s) from arabidopsis were analyzed ; the evolutionary rates are the average distances between the arabidopsis representative in the given kog and the proteins from other species (see material and methods for details). statistical significance of differences in evolutionary rates between selected functional categories of kogs (t - test) functional profiles of genes lost in different eukaryotic lineages for each of the animals, the numerator indicates the number of genes lost under the coelomate topology of the species tree and the denominator indicates the number of genes lost under the ecdysozoan topology of the tree. groups of functionally linked genes co - eliminated during evolution of different eukaryotic lineages for each of the animals, the numerator indicates the kogs lost under the coelomate topology of the species tree, and the denominator indicates kogs lost under the ecdysozoan topology. domain accretion in complex eukaryotes for a given pair of species the numbers in each cell below the diagonal represent, from top to bottom : the number of kogs in which the average number of detected domains from the cdd collection (cut - off e = 10) in the proteins from the species to the left is greater than that for the species to the right ; the number of kogs with equal average number of domains ; the number of kogs in which the average number of domains is greater for the species to the right (for example, d. melanogaster has a greater number of detected domains than h. sapiens in 470 kogs, the same number in 3,214 kogs, and a smaller number in 805 kogs). the numbers above the diagonal are the statistical significance of the difference, p().	we examined functional and evolutionary patterns in the recently constructed set of 5,873 clusters of predicted orthologs from seven eukaryotic genomes. the analysis reveals a conserved core of largely essential eukaryotic genes as well as major diversification and innovation associated with evolution of eukaryotic genomes.
the term macrolide encompasses a diverse family of unrelated compounds with large macrolactam rings. macrolide rings are comprised of a large macrocycle lactone ring to which one or more deoxy sugars, usually cladinose and desosamine, may be attached. in addition to their antibacterial activity, macrolides have diverse biological effects, including modulation of inflammatory and immune responses without affecting homeostatic immunity [1, 2 ]. macrolides are effective antibiotics that have immunomodulatory effects and inhibit the production of many proinflammatory cytokines such as interleukin 6 (il-6), il-8, and tumor necrosis factor alpha (tnf). many studies have been performed to assess their effectiveness in the treatment of rosacea, psoriasis, pityriasis rosea, alopecia areata, bullous pemphigoid, and pityriasis lichenoides. however, new strategies for the treatment of cutaneous pathologies are directed towards the development of new nonantibiotic macrolides with anti - inflammatory, antiproliferative, and antiangiogenesis properties. the most known and used are inhibitors of the phosphatase calcineurin (pimecrolimus and tacrolimus), which under normal circumstances induce the transcription of il-2. in addition, these drugs inhibit lymphokine production and interleukin release, which lead to a reduced function of effector t - cells. nowadays, novel chemical structures with improved therapeutic anticancer and anti - inflammatory properties by affecting skin disease targets have arose from mammalian rapamycin inhibitors. these agents inhibit the response to il-2 and thus block the activation of t and b lymphocytes [5, 6 ]. recently, new synthetic derivatives of the macrolide azithromycin, namely, csy0073, (8r,9s)-8,9-dihydro-6,9-anhydropseudoerythromycin a (em900), and (8r,9s)-4,13-o - diacetyl-8,9-dihydro-6,9-epoxy-8,9-anhydropseudoerythromycin a (em911) having potent anti - inflammatory properties have been developed. currently, ridaforolimus has been developed but has only been used in vitro thus far. more studies are required to uncover the possible applications of these promising molecules although one of the first possible applications of these compounds is as an antitumor agent. in this paper, we review the clinical use of nonantibiotic macrolides that have become available clinically for chronic inflammatory skin diseases with immune dysfunction. we searched the cochrane central register of controlled trials (central), med - line (pubmed), and embase (2005 to january 2012). we included case series with 5 or more patients, cohort trials, and randomised controlled trials. tacrolimus, pimecrolimus, calcineurin inhibitors, new macrolides, rapamycin, and so forth and atopic dermatitis, psoriasis, and other common dermatitises that have been treated using macrolides. pimecrolimus (sdz asm 981, novartis) is one of the new classes of novel ascomycin immunomodulating macrolactams and was developed for the treatment of inflammatory skin diseases (figure 1). ascomycetes, in the early 1960s, was initially researched for its antifungal properties. however, more than 20 years later, ascomycin was investigated for its structural and immunomodulatory properties. interest in pimecrolimus has been intense because it has significant anti - inflammatory and immunomodulatory activity and because it has low potential for systemic immunosuppression. pimecrolimus binds to fkbp-12 and immunophilin macrophilin-12, also known as fk506 binding protein. like tacrolimus and calcineurin is a ca / calmodulin - dependent protein phosphatase that regulates the translocation of the cytosolic components of nfats. nfats, in turn, regulate the promoter activities of several mediators during mrna transcription. by inhibiting the action of calcineurin, the pimecrolimus - macrophilin complex prevents the dephosphorylation of the cytoplasmic component of nfats. therefore, pimecrolimus blocks the transcription of these cytokines, especially t - helper th1 (il-2-, ifn--) and th2 (il-4-, il-10-) type cytokines (figure 2). pimecrolimus decreases the production of other cytokines, including interleukins il-5, il-10, and tnf, in a dose - dependent manner. pimecrolimus also targets mast cells, which play an important role in anti - inflammatory activities. pimecrolimus inhibits not only the transcription and synthesis of cytokines from mast cells, but also inhibits the release of the preformed mediators serotonin and -hexosaminidase. additionally, pimecrolimus inhibits fc epsilon ri - mediated degranulation and secretion (figure 3). it is important to note that all of these inhibitory processes occur only when pimecrolimus is bound to macrophilin-12. in a study of murine mast cell line cpii, pimecrolimus did not inhibit the transcription of a reporter gene that was under the control of human tnf promoter in the murine dendritic cell line and had no effect on il-8 release from keratinocytes, fibroblasts, and endothelial cells. atopic dermatitis (ad) is a pruritic disease of unknown origin that usually develops in early infancy (an adult - onset variant is recognized) ; it is characterized by pruritus, eczematous lesions, xerosis (dry skin), and lichenification (thickening of the skin and an increase in skin markings). ad may be associated with other atopic (immunoglobulin - e-(ige-) associated) diseases (e.g., acute allergic reaction to foods, asthma, urticaria, and allergic rhinitis). pimecrolimus inhibited cytokines, il-2 and interferon gamma ifn, and th2-type cytokines, il-4 and il-10. in addition, pimecrolimus prevents the release of inflammatory cytokines and mediators from mast cells in vitro after stimulation by antigen / ige. pimecrolimus cream 1% is a good option for treatment of mild to moderate ad in adults and children aged 2 years [4, 10 ]. no novel systemic applications have appeared since 2005. in 2005, however, there was a study of oral pimecrolimus for use in the treatment of moderate to severe ad. this study demonstrated the efficacy and short - term safety of oral pimecrolimus in adults in a double - blind study with a 12-week treatment and 12-week post - treatment phase. psoriasis may develop because of a combination of factors, including genetic predisposition and environmental factors. the immune system is thought to play a major role in the development of this condition. the dry flakes and skin scales are thought to result from the rapid proliferation of skin cells that is triggered by abnormal lymphocytes in the blood. another important application for pimecrolimus is psoriasis treatment, where it acts through blockage of t - cell activation and signal transduction pathways in t cells and through inhibition of the synthesis of inflammatory cytokines, which play a key role in the pathogenesis of psoriasis. oral pimecrolimus was tested in healthy adult outpatients with moderate to severe chronic plaque - type psoriasis (n = 143) who received either an oral placebo or pimecrolimus for 12 weeks. oral pimecrolimus was well tolerated and produced a dose - dependent reduction in psoriasis severity. doses of 20 mg and 30 mg b.d. were the most effective [14, 15 ]. oral lichen planus (olp) is an inflammatory condition that affects the mucous membranes of the mouth. olp may appear as white lacy patches, red swollen tissues, or open sores. olp is a t - cell - mediated chronic inflammatory oral mucosal disease of unknown cause, and lesions contain few b cells or plasma cells and minimal deposits of immunoglobulin or complement. therefore, olp is ideal for studying human t - cell - mediated inflammation and autoimmunity. antigen - specific mechanisms in olp include antigen presentation by basal keratinocytes and antigen - specific lysis of keratinocytes by cd8 + cytotoxic t cells. a combination of these mechanisms may cause t cell accumulation in the superficial lamina propria, basement membrane disruption, intraepithelial t cell migration, and apoptosis of keratinocytes in olp (figure 4) [9, 16 ]. pimecrolimus, as described above, inhibits dephosphorylation of nuclear factor of activated t cells by calcineurin, thus, reducing t - cell cytokine production and inhibiting t - cell activation. the most compelling of these suggests a combination of genetic and immunologic factors that results in autoimmune melanocyte destruction. it was effective in their treatment better than topic corticoids [19, 20 ]. patients in whom the cause of urticaria is unknown are said to have chronic idiopathic urticaria ; however, findings suggest that in 2545% of patients, chronic idiopathic urticaria is not idiopathic but is an autoimmune disease termed as chronic autoimmune urticaria. chronic autoimmune urticaria is dependent not only on the cross - linking of ige receptors (by anti - fc epsilon ria or anti - ige), but also on the activation of complement. cross - linking of ige receptors leads to histamine release via a calcineurin - dependent signal transduction pathway, whereas complement c5a receptors act through g - proteins. histamine release by patient sera or isolated igg can be inhibited by ascomycin but not the c5a. the failure of pimecrolimus to satisfactorily treat chronic autoimmune urticaria may at least in partly result from this. rosacea is a common cutaneous disorder, which occurs most frequently in light - skinned middle - aged individuals. an important reference we found to the use of pimecrolimus for the treatment of rosacea was a study by kim in 26 patients with mild to moderate inflammatory rosacea. alopecia areata (aa) is an autoimmune disease of the hair follicle caused by a t - lymphocytic infiltrate, although its pathogenesis is not yet completely clear. aa results in hair loss and baldness, and may frequently remit and relapse. histologically, the peribulbar infiltration consists mainly of activated cd4 + and cd8 + t - cells. type 1 cytokines, including il-2, ifn - c, and tnf, mediate initiation of the immune response in aa. pimecrolimus prevents calcineurin - mediated dephosphorylation of the nfats, which inhibits the synthesis of th1 and th2 cytokines in t lymphocytes. topical pimecrolimus treatment is as effective as topical corticosteroids for the treatment of aa and frontal fibrosing alopecia, and has fewer side effects than topical corticosteroids [24, 25 ]. this condition is diagnosed by excluding other causes of similar - appearing cutaneous ulcerations, including infection, malignancy, vasculitis, collagen vascular diseases, diabetes, and trauma. pathergy involves development of new ulcerations after trauma or injury to the skin in 30% of patients with existing pg. the pathogenesis of pg is not entirely understood, but defects in cell - mediated immunity, humeral immunity, neutrophil chemotaxis, and monocyte phagocytosis along with diminished lymphokine production have been observed in patients with pg. positive clinical results from treatment of pg with pimecrolimus and tacrolimus are probably due, in part, to a decrease in the release of tfn. tfn release is considered to be very important in the development of the neutrophilic dermatoses. pimecrolimus does not affect the differentiation, maturation, and functions of langerhans cells and does not induce their apoptosis. discoid lupus erythematosus (dle) is a chronic skin condition of sores with inflammation and scarring on the face, ears, and scalp, and at times, on other areas of the body. localized dle typically manifests as skin lesions localized above the neck and mainly involves sites such as the scalp, bridge of nose, cheeks, lower lip, and ears. lesions have elevated levels of il-2, ifn, and tnf mrna, as compared to normal skin. elevated type i ifn (ifn-/) has also been found in these skin lesions. in addition, unlike cyclosporine and tacrolimus, the action of pimecrolimus is more selective for t - cells and mast cells, thus reducing the likelihood of systemic immunosuppression. behet 's disease (bd) was named in 1937 after the turkish dermatologist hulusi behet who first described the triple - symptom complex of recurrent oral aphthous ulcers, genital ulcers, and uveitis. painful genital ulcerations usually develop around the anus, vulva, or scrotum and cause scarring in 75% of the patients. the cause is not well defined, but it is primarily characterized by autoinflammation of the blood vessels. the primary mechanism of the damage is an overactive immune system that seems to target the patient 's own body. in fact, as of now, no one knows why the immune system starts to behave this way in behet 's disease. there does however seem to be a genetic component involved, as first degree relatives of the affected patients are often affected in more than expected proportion for the general population. pimecrolimus is safe and effective for the treatment of bd genital ulcers and accelerates the healing process. graft - versus - host disease (gvhd) is a common complication of an allogeneic tissue transplant. gvhd is commonly associated with stem cell or bone marrow transplant, but the term also applies to other forms of tissue graft. immune cells (white blood cells) in the tissue (the graft) recognize the recipient (the host) as foreign. gvhd can also occur after a blood transfusion if irradiated blood products are not used. in the classical sense, acute gvhd is characterized by selective damage to the liver, skin (rash), mucosa, and the gastrointestinal tract. new research indicates that target organs of gvhd other than those mentioned above include the immune system (the hematopoietic system, e.g., the bone marrow and the thymus) itself, and the lungs in the form of idiopathic pneumonitis. further, chronic gvhd involves the above organs but can also cause damage to the connective tissue and exocrine glands over a long term. t cells present in the graft, either as contaminants or intentionally introduced into the host, attack the tissues of the transplant recipient after perceiving host tissues as antigenically foreign. the t cells produce an excess of cytokines, including tnf- and interferon - gamma (ifn). a wide range of host antigens can initiate gvhd, such as the human leukocyte antigens (hlas). the only study in which the treatment of gvhd was reported was that by schmook. tacrolimus (figure 5) was first isolated in 1984 from a japanese soil fungus. the macrolide antibiotic tacrolimus (fk 506) was discovered as a naturally occurring metabolite of the fungus streptomyces tsukubaensis. at least 4 fkbp are described : 12, 13, 25, and 59. the main effect of tacrolimus appears to result from the inhibition of t - cell function. following the binding of an antigen - presenting cell to a t cell via the t cell receptor, intracytoplasmic levels of calcium rise, leading to calmodulin activation of the phosphorylase enzyme, calcineurin phosphatase. the activation of calcineurin phosphatase leads to the dephosphorylation of a cytoplasmic protein - nfat. once dephosphorylated, nfat translocates into the nucleus where it combines with a nuclear subunit (nfatn). the binding of nfatn enables transcription of proinflammatory cytokines, including il-2, il-4, ifn, and tgf- and upregulation of receptors, such as il-2r (cd25). transcription of these cytokines initiates t - cell activation (figure 2) [9, 33 ]. activated tacrolimus inhibits the action of calcineurin, thus preventing the dephosphorylation of nuclear factors and blocking this path to gene transcription. in stimulated t cells inhibition of il-2 production blocks the activation of t - helper cells, t - regulatory cells (autocrine loop), natural killer cells, and monocytes. in addition to inhibiting il-2 transcription, other calcium - dependent events, including nitric oxide synthase activation (figure 6), cell degranulation, and apoptosis (figure 7) are also inhibited. in stimulated mast cells, tacrolimus decreases histamine release, impairs langerhans ' cell function, and downregulates high - affinity ige receptors. it also decreases the production of chemotactic protein-1 and il-8 in monocytes and affects other cell types, including neutrophils, eosinophils, and endothelial cells. inhibition of calcineurin interferes with superantigen stimulation of t cells and may decrease the production of vascular endothelial growth factor. tacrolimus also inhibits the function of b cells and the production of other cytokines such as il-3, il-4, il-5, ifn, tnf, and granulocyte - macrophage colony stimulating factor (gm - csf). when used to treat ad, tacrolimus inhibits the t lymphocytes, which release the cytokines that trigger the inflammation underlying ad. tacrolimus also affects other cells including langerhans and mast cells. by downregulating t cells, the symptoms of ad begin to fade within a few days of applying a topical ointment that contains tacrolimus.. however, the skin does not act as a reservoir for this drug, as discussed by kim and kono. tacrolimus inhibits the production of many proinflammatory cytokines, such as il-6, il-8, and tnf, perhaps by suppressing the transcription factors nf-b or activator protein-1. however, topical tacrolimus that was applied under occlusion to descaled psoriatic plaques is an effective treatment. there is good evidence that topical tacrolimus is a highly effective treatment for psoriasis of the face and flexures [3739 ]. in our clinical practice, treatment with 0.15 mg / kg b.d. oral tacrolimus for 1 week resulted in a marked reduction in the erythema and scaling of severe psoriasis patients. administration of tacrolimus at a dose of 0.3 mg / kg per day to 7 patients with recalcitrant psoriasis resulted in remission with minor metabolic effects, including minimal elevation of urea, creatinine, and glucose in the blood. more recently, tacrolimus has been used to treat genital lichen sclerosus, a condition in which patches of the skin become thin and wrinkled. thus, the skin tears easily, and bright red or purple bruises are common. sometimes, the skin becomes scarred. tacrolimus blocks the proliferation of t lymphocytes and the release of inflammatory cytokines from these cells. then the skin tears easily, and bright red or purple bruises are common. sometimes, the skin becomes scarred. if the disease is a mild case, there may be no symptoms. tacrolimus ointment 0.1% may also be effective and well tolerated for the treatment of anogenital lichen sclerosus, both in adults and in prepubertal girls. recent reports describe the use of 0.1% tacrolimus in a topical formulation for the management of olp. therefore, there is a need for more effective and safer therapies for symptomatic olp. the activation of il-2 production occurs after antigen, with a major histocompatibility complex type ii antigen, is presented to the t - cell receptor - cd3 complex. antigen presentation results in the release of calmodulin, which binds and activates the protein calcineurin that is involved in the dephosphorylation of nfat. tacrolimus and the intracellular immunophilin protein known as the fk - binding protein form a complex that binds to and inactivates the protein calcineurin. as a result, the t - cell receptor - mediated induction of il-2 production is inhibited, resulting in suppression of t - cell - dependent immune functions [43, 44 ]. contact dermatitis is a condition in which the skin becomes red, sore, or inflamed after direct contact with a substance. tacrolimus has good anti - inflammatory effects and penetrates well through inflamed skin. in a human study, topical tacrolimus (at concentrations of 0%, 0.01%, 0.1%, and 1%) in ethanol biopsies of the test patches showed no inflammation on the dncb - challenged skin sites that were pretreated with fk 506, while there was intense dermatitis ethanol - only. the ability to suppress reactions in previously sensitized patients is important because contact dermatitis patients do not present until after primary sensitization. the ability to treat such sensitized individuals is crucial because many antigens, such as nickel, are ubiquitous and complete avoidance is often impossible. topical tacrolimus also suppresses irritant reactions in animal models, suggesting that topical tacrolimus may also be useful for primary irritant contact dermatitis. this may be applicable to the treatment of chronic hand dermatitis and occupational irritant dermatitis (in which allergic contact often coexists). the efficacy and safety of 0.1% tacrolimus ointment in vitiligo were compared favourably to that of 0.05% fluticasone propionate cream for the treatment of segmental vitiligo in a randomized controlled trial. even diseases that are not considered to be classic t - cell - mediated inflammatory processes have been considered as targets for tacrolimus therapy. goldman noted that the anti - inflammatory properties of topical tacrolimus that unlike steroids, tacrolimus may not have intrinsic rosacea - promoting properties. he treated the patients who had steroid - induced rosacea and were previously unable to taper off and discontinue the use of steroid therapy. the eruptions were controlled in all 3 patients, and they were able to successfully taper off tacrolimus therapy and switch to a long - term regimen of topical antibiotics [47, 48 ]. while aa is another candidate disease for tacrolimus therapy, some authors have expressed reservations regarding its use for this purpose, as aa generally responds poorly to treatment. thiers published a report of the failure of 0.3% tacrolimus ointment to treat aa in a 9-year - old. steroid intralesionals in combination with topically applied tacrolimus yield better results than topical tacrolimus alone [50, 51 ]. in 5075% of patients, pg is associated with inflammatory bowel disease, rheumatoid arthritis, chronic autoimmune hepatitis, or haematological solid tumours. tacrolimus ointment (0.1%) was applied to dle lesions twice daily and the erythematous plaques readily diminished after 48 weeks. cutaneous le is a broad term, which includes a variety of lesions that may appear in the absence of the systemic manifestations of systemic lupus erythematosus [52, 53 ]. in an open - label study of tacrolimus (0.1 mg / kg) administered for 1 year with dosage adjustment showed that serum c3 level, and anti - ds dna antibody titre improved with tacrolimus treatment. the mean titre of anti - ds dna antibodies provides a representative indicator of immunological parameters reflecting disease activity. therefore, a t cell blockade is considered a reasonable therapeutic target for cutaneous and systemic le [54, 55 ]. tacrolimus can therefore be considered both effective and safe for treating mild manifestations of le, including skin dermatosis, in systemic le patients. however, for severe active conditions, its efficacy is limited at current dose settings and usage. crohn 's disease (cd), also known as regional enteritis, is a type of inflammatory bowel disease that may affect any part of the gastrointestinal tract from the mouth to anus and causes a wide variety of symptoms. cd is caused by interactions between environmental, immunological, and bacterial factors in genetically susceptible individuals. this results in a chronic inflammatory disorder, in which the immune system of the body attacks the gastrointestinal tract possibly directed at microbial antigens. one type of skin manifestation, erythema nodosum, presents as red nodules usually appearing on the shins. erythema nodosum is due to inflammation of the underlying subcutaneous tissue and is characterized by septal panniculitis. a new view is that cd results from an impaired innate immunity, in that impaired cytokine secretion by macrophages contributes to impaired innate immunity and leads to a sustained microbial - induced inflammatory response in the colon, where the bacterial load is high. despite the poor quality of the majority of trials examining the role of tacrolimus in cd, there is some evidence suggesting that tacrolimus may be of some benefit in this disease. although systemic immunosuppressants are generally believed to increase the rate of cancer development, one study has shown that in female cd-1 mice there was a dose - related inhibition of 7,12-dimethylbenz[a]anthracene-(dmba-) initiated and 12-tetradecanoylphorbol-13-acetate-(tpa-) promoted skin papillomas when 0.1 mol tacrolimus was applied topically. this antineoplastic effect may be unrelated to the suppression of t - cell functions and might occur after endogenous protein phosphorylation by tpa. this study was contradicted by a later study of the occurrence of de novo neoplasms in organ transplant recipients. cutaneous t cell lymphoma (ctcl) is a class of non - hodgkin 's lymphoma, which is a type of cancer of the immune system. the malignant t cells in the body initially migrate to the skin, which result in the development of various lesions. these lesions change shape as the disease progresses, typically beginning as what appears to be a rash, which can be very itchy, and eventually forming plaques and tumors before metastasizing to other parts of the body. ctcls are a heterogeneous group of lymphoproliferative disorders caused by clonally derived skin - invasive t cells. few studies have reported the efficacy of topical tacrolimus for the treatment of ctcls [5961 ]. topical application of 0.3% tacrolimus in isotonic solution or cream is a promising treatment modality for pathology ocular in bd. pulmonary and intestinal lesions evanesced and skin lesions improved after the oral administration of fk506 at a dose of 0.1 - 0.2 mg / kg for 8 weeks [63, 64 ]. in a case of refractory gvhd, the patient responded to a combination of oral tacrolimus, psoralen, and uv - a therapy. this suggests that systemic tacrolimus may benefit recipients of solid organ or bone marrow transplants with gvhd that is refractory to cyclosporine, high - dose systemic steroids, and antithymocyte globulin. the initial intravenous fk506 dose of 0.04 mg / kg per day and should be maintained for 7 days post - transplant. after day 7, intravenous fk506 doses should be decreased if serum creatinine is elevated to approximately 0.03 mg / kg per day. suggested that tacrolimus and mycophenolate mofetil is a good option for prophylaxis in hla - matched nonmyeloablative transplants. the most common lesions are erythema nodosum, plaques, maculopapular eruptions, and subcutaneous nodules. the current working hypothesis is that in genetically susceptible individuals, sarcoidosis is caused through an alteration in immune response after exposure to environmental, occupational, or infectious agents. granulomatous inflammation is characterized primarily by accumulation of monocytes, macrophages, and activated t lymphocytes with increased production of key inflammatory mediators, tnf-, ifn, and il-12, characteristic of a th1-polarized response (t - helper lymphocyte-1 response). sarcoidosis has contrasting effects on inflammatory processes ; it is characterized by increased macrophage and cd4 helper t - cell activation, which results in accelerated inflammation ; however, immune response to antigen challenges such as tuberculin is suppressed. regulatory t lymphocytes in the periphery of sarcoid granulomas appear to suppress il-2 secretion, which is hypothesized to cause a state of anergy, by preventing antigen - specific memory responses. topical tacrolimus has proved effective for the treatment of cutaneous sarcoidosis. in the recent years, tacrolimus has been used to suppress the inflammation associated with diverse autoimmune or granulomatous diseases. as described by alijotas - reig, 7 patients with severe and refractory late - onset inflammatory reactions, including large panniculitis, which complicate silicone gel injections were evaluated. after an average of 18 months after tacrolimus administration (in increasing doses, up to 0.08 to 0.1 mg / kg of body weight, 2 times per day), 5 patients experienced mild, sparse bouts of inflammatory processes, including nodules, plaques, and panniculitis. long - lasting implants of any type that interact with commensal or infectious microorganisms, trauma, or localized or generalized inflammatory processes could theoretically induce autoimmune disorders or granulomata. these events may occur because of epigenetic alterations in dna expression in genetically susceptible hosts. an excellent candidate for pathologic mischief on the face is propionibacterium acnes that under certain circumstances can act as an opportunistic pathogen, which stimulates the production of tnf- and polysaccharides [71, 72 ]. rapamycin acts through the inhibition of mammalian target of rapamycin (mtor), a molecule that is activated via phosphoinositide 3-kinase (pi3k) and controls downstream proteins involved in the cell cycle. after binding with tacrolimus binding protein (fk - bp) immunophilin, the rapamycin complex inhibits the stimulatory effect of mtor on cell cycle protein translation, arresting the g1 to s transition (figure 9) [8, 73 ]. this inhibitory effect can be partly explained because of a reduction of the phosphorylation of eif-4e binding protein 1 (4e - bp1), a repressor of cap - mediated translation in mammalian cells. since 1999, rapamycin has been broadly used in human skin transplantation because it carries a low risk of renal dysfunction and reduces the risk of allograft rejection in comparison with other [7577 ]. rapamycin may potentially be used as an antiangiogenic agent to inhibit, for example, growth of pathological blood vessels in combination with laser treatment. the application of a laser to an area of skin provokes the shutdown of major capillary vessels and results in the induction of a severely hypoxic microenvironment. this can cause overexpression of hypoxia - inducible factor-1 alpha (hif1) and promote the secretion of angiogenesis - stimulating factors like platelet - derived growth factor (pdgf) and vascular endothelial growth factor (vegf). rapamycin may prevent vascular reperfusion by acting as an inhibitor of this mtor - hif1-vegf pathway and through the inhibition of the pi3k - p70s6 kinase pathway in endothelial cells stimulated by vegf [81, 82 ]. there are some side effects to take into account, such as mild cholangitis and delays in wound closure [75, 83 ]. these side effects may result from the multiple effects rapamycin may exert upon mtor inhibition in the epithelial and stromal tissues of the wound area. this includes the important role of mtor in the wound healing process downstream from phosphatidylinositol 3 kinase (pi3k) and phosphatase and tensin homolog (pten). a randomized, double blind, left - right comparative, dose - ranging clinical trial was carried out to determine the efficacy and safety of rapamycin applied to skin for the treatment of psoriasis. the trial showed that rapamycin was able to penetrate human skin and exerted beneficial effects. everolimus (rad001) is a rapamycin derivative (figure 10) with potent immunosuppressive effects, antiproliferative properties, and anticancer effects in many preclinical and clinical studies. in addition, everolimus has shown in vivo antitumor activity with a significant cytostatic activity in a variety of preclinical models of haematological and solid tumours. it has been reported that everolimus, while and effective treatment for psoriasis, became ineffective in 2 cases of severe atopic dermatitis when it was combined with prednisone or cyclosporine a. temsirolimus (cci-779, torisel, wyeth) is another rapamycin derivative (figure 11) and has properties that are similar to everolimus. it has been used for the treatment of metastatic renal cell carcinoma and mantle cell lymphoma. rapamycin, everolimus, and temsirolimus all prevent tumour cell proliferation and angiogenesis through inhibition of the hif1/vegf pathway [8991 ]. a new synthetic azythromycin - derivative - macrolide, called csy0073, has anti - inflammatory and immune - modulatory effects, but no antibiotic effects. csy0073 exerts counterregulatory activity on nuclear factor kappa b (nf-b), activator protein-1 (ap-1) and extracellular signal - regulated kinase 1/2 (erk1/2) signalling. the anti - inflammatory activity of csy0073 was demonstrated in rodent models of intestinal inflammation and hold potential as a treatment of inflammation - driven immune dysfunction. csy0073 may reduce the colonic expression of cytokines involved in the development and maintenance of colon inflammation, such as tumour necrosis factor (tnf), interleukin 2 (il-2), and interferon (ifn). this is consistent with studies of other macrolides that indicate that these compounds penetrate the cell membrane of macrophages and accumulate in subcellular compartments. initial results indicate that treatment with csy0073 attenuates the development of several signs of arthritis. recently, 2 new potential macrolides with anti - inflammatory and immunomodulatory characteristics were discovered. these compounds, (8r,9s)-8,9-dihydro-6,9-anhydropseudoerythromycin a (em900) and (8r,9s)-4,13-o - diacetyl-8,9-dihydro-6,9-epoxy-8,9-anhydropseudoerythromycin a (em911), are derivatives of erythromycin a. em900 and em911 have so far only been used in vitro. another newly developed molecule is ridaforolimus (also known as deforolimus, ap23473, mk-8669, merck), a rapamycin analogue (figure 12), which has broad inhibitory effects on the cell growth, proliferation, division, metabolism, and angiogenesis of a broad panel of cell lines. in vitro and in vivo studies inhibitory effects on vegf, endothelial cell growth (egf), hif-1, and glucose metabolism were also observed. in particular, ridaforolimus was found to arrest cell growth without evidence of cell death or apoptosis, accumulating cells in the g1 phase of the cell cycle. this was due, in part, to a blockade of 4e - bp1/eif4e signalling [97, 98 ]. new uses are being developed for older macrolides, such as pimecrolimus and tacrolimus, due to their interesting anti - inflammatory properties. these drugs work through the inhibition of the calcineurin promotion of several cytokines, such as interleukins, interferons, and tnf. this approach is opening a broad field of skin disease treatments that have minimal side effects (table 1). on the other hand, newer macrolides (rapamycin, everolimus, and temsirolimus) work through the downregulation of the mtor pathway. these newer macrolides arrest the g1 to s transition, an important early event in the control of mammalian cell growth and proliferation. there are many examples of successful applications for these compounds in cancer diseases and organ transplantation. there were a variety of responses to these compounds, and some of them were not at all positive.	background. inflammation - driven immune dysfunction supports the development of several chronic human disorders including skin diseases. nonantibiotic macrolides have anti - inflammatory and/or immunomodulatory activity that suggests the exploitation of these in the treatment of skin diseases characterized by inflammatory disorders. materials and methods. we performed an extensive review of the nonantibiotic macrolide literature published between 2005 and 2012, including cross - references of any retrieved articles. we also included some data from our own experience. results. calcineurin antagonists such as tacrolimus and ascomycins (e.g., pimecrolimus) act by inhibiting the activation of the nuclear factor for activated t cells (nfat). there are new applications for these macrolides that have been available for several years and have been applied to skin and hair disorders such as atopic dermatitis, oral lichen planus, vitiligo, chronic autoimmune urticaria, rosacea, alopecia areata, pyoderma gangrenosum, behcet 's disease, neutrophilic dermatosis, and lupus erythematosus. we also reviewed new macrolides, like rapamycin, everolimus, and temsirolimus. in addition to the literature review, we report a novel class of nonantibiotic 14-member macrocycle with anti - inflammatory and immunomodulatory effects. conclusions. this paper summarizes the most important clinical studies and case reports dealing with the potential benefits of nonantibiotic macrolides which have opened new avenues in the development of anti - inflammatory strategies in the treatment of cutaneous disorders.
colorectal cancer (crc) develops either sporadically (85% of the cases), as part of a hereditary cancer syndrome (10%), or as a background of inflammatory bowel disease. the incidence of crc in iran has been significantly increased since 1970 [2, 3 ]. according to iran national cancer registry (incr) report, approximately 51,000 new cases of cancers with mortality rate of 35,000 are identified every year. regard, crc is considered as the fourth most common cancer in iranian population [4, 5 ]. regard, crc is the fourth most common cancer in iranian male and the second in female [4, 69 ]. two distinct pathways have been identified as main players in crc : the microsatellite instability (msi) and the chromosomal instability (cin)/microsatellite stable (mss) pathway. findings of these two pathways have led to the paradigm of crc as a genetically heterogeneous disease. msi pathway in hereditary and sporadic colorectal cancer occurs through two different mechanisms. in hereditary nonpolyposis colorectal cancer (hnpcc) the cause is a germline mutation in one of the dna mismatch repair genes (mlh1, msh2, msh6, and pms2), while msi in sporadic colorectal cancer is predominantly due to hypermethylation of the mlh1 promoter and sometimes sporadic mutations. the dna mismatch repair system works as a spell checker that identifies and then corrects mismatched base pairs in the dna. defects in the mismatch repair mechanisms lead to msi status [1, 11, 12 ]. currently, tumor stage is the most important predictor of prognosis for crc patients. implications of msi in colorectal cancer continue to increase and many studies have evaluated the role of msi test in clinical management [1012 ]. investigation of msi status in crc is warranted for three reasons : (a) as a potential screening tool for hnpcc, (b) as a potential predictive factor of chemotherapy response, and finally (c) as a prognostic marker. the prognostic significance of msi for patients with colorectal cancer is a subject of controversy. based on the number of markers displaying msi per tumor, three groups of tumors are defined : those with 3040% of the markers showing instability (msi - h) ; those with less than 3040% of the markers showing instability (msi - l), and those showing no instability (mss). some investigations reported that patients with msi - h tumors have a better prognosis than those with msi - l or mss tumors [15, 16 ], whereas others reported that msi in colorectal cancer was not an independent prognostic factor or had no prognostic significance in colorectal cancer [17, 18 ]. the biologic defect producing the low msi (msi - l) phenotype in colorectal cancer is poorly recognized ; since there is no obvious biologic differentiation between msi - l and microsatellite stable (mss) colorectal cancer, these two phenotypes are generally merged when analyzed against the well - defined high msi (msi - h) phenotype. recently, there is controversy in the definition of msi - l because most tumors could be classified as msi - l if an adequate number of markers are studied. several studies have demonstrated the prevalence of msi among crc patients in iran [2023 ]. however, information about the survival or mortality rate is unknown. in the present study, we evaluated the possible prognostic significance of msi in colorectal cancer patients by determining the relationship between msi status (msi - h, msi - l, and mss) and prognosis in 158 patients who underwent resection for primary colorectal cancer. in this study 158 consecutive crc patients referred to gastroenterology and liver diseases research center, shahid beheshti university of medical sciences, tehran, iran, from 2004 to 2010. the patients, who underwent surgical resection of adenocarcinoma of the colon or rectum and their characteristic and clinical data were available, were retrospectively included in this study. clinical information was recorded prospectively and registered in a database ; this information included (i) age, sex, and personal and family medical history and (ii) tumor location, tumor differentiation, and tnm stage. ethical approval for the study was obtained from the institutional review boards of the relevant centers. serial sections (5 m) from formalin - fixed paraffin - embedded matched normal and tumor tissues were routinely stained, and representative normal and tumor regions were identified by microscopic examination. genomic dna from each tumor and from corresponding normal tissue was purified using the qiaamp tissue kit (qiagen gmbh, germany). yield and purity of products were determined by electrophoresis on 0.8% agarose gel and spectrophotometry absorbance at 260 nm. determination of msi status was carried out using five mononucleotide repeat microsatellite targets (bat25, bat26, nr21, nr24, and nr27) using standard pcr techniques. pcr products were denatured by electrophoresis on 5% denaturing polyacrylamide gels and were analyzed by an abi 3130xl automated sequencer (applied biosystems, usa). tumor samples that exhibited different allele peaks than the corresponding normal sample(s) were classified as msi for that particular marker. msi - h is defined when at least two of the five standard markers show instability in tumor dna. msi - l is defined when one msi marker shows instability and others were microsatellite stable (mss) when there was no instability detected on tumors. the tnm (tumor, lymph nodes, and metastasis) staging system was applied to determine the severity of disease and the local or distant extent of disease spread. the tnm staging system of the american joint committee on cancer (ajcc) is the preferred and standard staging system for crc. since the significance of msi - l in crc is poorly understood, phenotype of msi was originally grouped into three levels including msi - high, msi - low, and ms - stable. statistical analysis was performed using the spss software program for windows, release 13.0.0 (spss inc., comparison of variables was performed using pearson 's chi - square test, fisher 's exact test, or the mann - whitney u test, depending on the nature of the data. colorectal cancer (crc) overall survival was computed since the date of cancer diagnosis up to the date of death or end of follow - up (february, 2014). patients who died due to causes which were unrelated to colorectal cancer were censored at the time of death and were excluded from the analyses. for survival analyses, the following variables were assessed : age, sex, location of the tumor (colon versus rectum), tumor - node - metastasis stage, and grade of differentiation (well / moderate versus poor), use of adjuvant therapy, age of diagnosis, family history and msi. overall survival analyses were done through a cox proportional hazard function for both univariate and multivariate analyses and kaplan - meier (log - rank test) curves were plotted. we identified 158 consecutive patients with colorectal cancer of whom pathological results and follow - up data were available. the clinicopathological features of patients enrolled in this study is present at table 1. of 158 samples analyzed, the subjects were subdivided into three groups by msi testing : thirty - five (22.2%) tumors were msi - h, 21 msi - l (13.3%) and 102 mss (64.55%). among 35 msi - h tumors, instability of two markers was detected in 15 tumors (42.8%), 12 tumors (34.2%) had instability in three markers and 5 tumors (14.3%) had instability in four markers and 3 tumors (8.6%) were instable in all five mononucleotide markers. nr24 was the most instable marker (33 tumor) among msi - h patients, however in 21 msi - low patients, the most instable marker was nr24 detected in 9 cases followed by bat 25 (6 case), nr21 (3 case) and bat26 (3 case). the mean period of follow - up was 60.2 24.5 months and the median period of follow - up were 53 months (range 2120). of 158 patients, 70 cases had family history of crc and 88 did not have any history of crc or other gastrointestinal cancers. according to our findings 29 patients had metastatic in the time of diagnosis and 129 were negative for metastatic status. patients in the mss group were found to be older than patients in the msi - l and msi - h groups (mean ages 53.16 years, 49.6 years and 50.32 years resp.). interestingly, the high incidence of msi - h (24/35, 68.6%) were presented in male gender and there was statistically significant relationship between msi status and gender (p = 0.019). we found that msi - h colorectal cancer were located predominantly in proximal colon sites versus rectal sites (p = 0.030), associated with poorer differentiation (p = 0.003), have a family history for gi cancer (p < 0.001), and showed less frequent systemic metastasis (p = 0.050) than msi - l and mss colorectal cancer. distribution of tumor stages i iv differed among patients with msi - h, msi - l and mss tumors (p = 0.028). msi - h distribution in stage iii, ii and i were 60.0%, 31.4% and 8.6% respectively. none of the 7 tumors with iv stage were shown to be msi - h. we found no significant differences among patients with msi - h, msi - l and mss tumors for t status, m status, vital status or adjuvant therapy, however the distribution of lymph node metastasis and age of diagnosis in msi - h crcs was statistically different with msi - l and mss tumors. to assess the effect of msi status on survival, we used a cox regression model for univariate and multivariate analysis. among the prognostic variables for overall survival entered into univariate and multivariate analysis, all characteristic such as diagnostic age, tumor stage, adjuvant therapy, msi status, tumor stage, and family history overall survival curves relative to msi status was obtained for all colorectal cancer patients presented in figure 1. we did not observe clear influence of msi status on overall survival in all colorectal cancer patients (p = 0.426). we also obtained kaplan - meier curves of overall survival in patients according to msi status, stratified based on tumor location and tnm stages (figures 2 and 3). based on our results, in crc patients with stage i, msi status is not considered as a valuable prognostic markers, long rank p = 0.742. whereas in crc patients with stage ii, msi - l showed significantly poorer survival compared with patients who had msi - h or mss tumors, long rank p = 0.048, (figure 2(a)). this indicates that msi - l was clearly a marker of poorer prognosis in stage ii colorectal cancers. however, we did not observe any significant association between overall survival of patients in advanced stages iii / iv with msi status, long rank p = 0.430, (figure 2(b)). kaplan - meier curves of overall survival in patients according to msi status stratified based on tumor location including colon and rectum are presented in figures 3(a) and 3(b) respectively. according to our findings, patients with ms - l colon tumors, show significantly poorer survival compared with patients who had msi - h or mss tumors, long rank p = 0.028. but we did not observe the similar results in rectal tumors, long rank p = 0.180. several epidemiological studies in iran demonstrated that in comparison to western populations, the incidence of crc is significantly higher in young iranian patients and it has been reported that approximately 20% of all crc cases occur in patients less than 40 years, whereas, this rate is extremely lower in western countries with 2 to 8% [2530 ]. in addition to this high distribution of crc prevalence in younger population of iran in previous studies, in one study azadeh. even reported a considerably higher proportion of 43% crc incidence in patients less than 50 years old in iranian population. although genetic factors have been proposed as one of the main risk factors contributed to this early onset of crc in iran, however, some studies indicated that this might be due to the high proportion of young population in iran [6, 25 ]. in the present study we identified 35 msi - h (22%), 21 msi - l (13%), and 102 mss (64%) tumors. msi - h tumors were predominantly located in the colon than rectum (p = 0.03) and were associated with poorer differentiation (p = 0.003) and tumor, lymph nodes, and metastasis (tnm) stage ii / iii of tumors (p = 0.02) while msi - l tumors were more frequent in patients aged younger than 50 years when diagnosed with colorectal cancer. the incidence of msi observed in 158 colorectal cancer patients in the present study was similar to some previous reports from iran [2023 ], but it was also higher than other reports from other ethnic groups (520%) [1517 ]. documented a high incidence of msi (45%) in crc patients from african americans population. the incidence of msi - l reported in this study was higher than another study in iran. in this study we used 5 mononucleotide markers to evaluate msi status. probably different sample sizes and different threshold markers were applied to assign msi in each previous study, indicating this variety. in present study crc patients with stage ii msi - l showed significantly poorer survival compared with patients who had msi - h or mss tumors (p = 0.04). this indicates that msi - l was clearly a marker of poorer prognosis in stage ii colorectal cancers. our results documented distinct clinicopathologic characteristics of msi - h, msi - l, and mss colorectal cancers. in line with other reports, most of the tumors in msi - h were located in colon, poorly differentiated and frequent in stage iii. high incidence of msi - h in proximal located tumors in the colon was reported in many papers [32, 33 ]. however, brim. have documented higher frequency of msi - h tumors in distal colon in omani patients. the high incidence of msi - h (24/35, 68.6%) was presented in male gender and there was statistically significant relationship between msi status and gender (p = 0.01). in crc patients with stage ii, msi - l cases showed significantly poorer survival compared with patients who had msi - h or mss tumors (p = 0.04). in contrast to several papers showing msi is more common in women than in men [16, 17, 35 ] ; we found a significant association between msi status and male gender. the high prevalence of msi - h in male was reported previously, but they did not find any significant association [15, 20 ]. this observation is in contrast to several other studies that showed the highest frequency of msi in stage ii [1517, 20 ]. similar to our finding, many other studies showed that the presence of distant metastases at the time of diagnosis (stage iv) is rare in the msi subgroup of crc [15, 20 ]. in addition, a relatively high frequency of patients diagnosed in age less than 50 was noted ; we identified msi - l tumors predominantly in this group age. the frequency rate of msi - l in patients with age less than 40 was reported in a previous study in iran, suggesting that this genetic pathway may play an important role in crc development in iranian patients between 40 and 50 years old. it has been reported that msi - h colorectal tumors differ from msi - l or mss tumors in several pathological features [3638 ] and msi - l differ from mss tumors, but the biological background of this feature is unknown [19, 3943 ]. it was shown that mlh1 and msh2 genes do not seem to be contributed to etiology of msi - l. studies which indicated the k - ras mutations, o - methylguanine dna methyltransferase (mgmt) promoter methylation, loss of mgmt gene expression, germline mutation of hmsh6, and a low level of allele loss near apc are associated with the msi - l phenotype [19, 3943 ]. whereas several studies and two current meta - analyses suggested better prognosis and outcome for patients with msi - h tumors [4447 ], other studies could not confirm these findings [48, 49 ]. in line with the latter studies we observed no significant difference in overall survival between patients with mss, msi - l, and msi - h tumors. in many prognostic studies, the msi - l phenotype has not been considered as a separate category ; this might be due to a lack of clear single marker for identification of this group of tumors. our study has shown that msi - l is associated with poorer survival in colorectal patients with stage ii tumors. many papers suggested that msi status influences the prognosis of crc only in specific stages [16, 19, 33, 35, 45 ]. two recent studies documented poor prognosis of msi - l in stage iii colon cancer [19, 50 ]. showed that msi - l characterizes a distinct subgroup of stage iii colon cancer patients including the msi - l subset of proximal colon cancer who have a poorer clinical outcome. nevertheless, there is now clear evidence that msi - l tumors are a discrete molecular group on basis of gene expression data. together, these data suggest that msi - l cancer may arise from a distinct carcinogenic pathway as compared to mss and msi - h crc. though the biological basis of the good prognosis of patients with msi - h is somewhat determined, the poor prognosis effect of msi - l in colon cancer is unknown. it has been reported that the high mutational load in msi - h tumors elicited a robust host immune response. msi - l and mss have a high frequency of mutation of the p53 suppressor gene, explaining aggressive biological characteristics [37, 54 ]. few studies have evaluated the effect of msi status on rectal cancer survival [44, 55 ]. we assessed msi status in relation to survival of individuals diagnosed with primary rectal cancer and primary colon cancer. we found poorer prognosis for msi - l patients who had colon tumors and also poorer prognosis for msi - h patients with rectum tumors, though this latter finding was not statically significant. in conclusion, this is the first study in iran to demonstrate the prognostic role of msi in crc patients. it seems that the clinical prognostic role of msi status is dependent on stage and location of the tumor. further studies with larger sample sizes are required to assess more precisely the impact of msi - l on clinical outcome.	the influence of microsatellite instability (msi) on the prognosis of colorectal cancer (crc) requires more investigation. we assessed the role of msi status in survival of individuals diagnosed with primary colorectal cancer. in this retrospective cross - sectional study the msi status was determined in 158 formalin - fixed paraffin - embedded tumors and their matched normal tissues from patients who underwent curative surgery. cox proportional hazard modeling was performed to assess the clinical prognostic significance. in this study we found that msi - h tumors were predominantly located in the colon versus rectum (p = 0.03), associated with poorer differentiation (p = 0.003) and tnm stage ii / iii of tumors (p = 0.02). in crc patients with stage ii, msi - l cases showed significantly poorer survival compared with patients who had msi - h or mss tumors (p = 0.04). this study indicates that msi - l tumors correlate with poorer clinical outcome in patients with stage ii tumors (p = 0.04) or in tumors located in the colon (p = 0.02). msi - l characterizes a distinct subgroup of crc patients who have a poorer outcome. this study suggests that msi status in crc, as a clinical prognostic marker, is dependent on other factors, such as tumor stage and location.
prostate cancer is one of the most commonly diagnosed malignancies in men [1, 2 ]. in the usa and several western european countries, the incidence rates of pca have exceeded the remaining malignant neoplasms in males [3, 4 ]. there were 9,273 new pca diagnoses recorded nationwide, according to the national polish cancer register statistics from 2010. the diagnosis of pca is based on transrectal ultrasound guided multiple core prostate biopsy results in view of raised serum prostate specific antigen (psa) levels and/or abnormal digital rectal examination (dre), and/or the presence of trus confirmed hypoechogenic foci within the marginal zone of the prostate gland, all of which are suggestive of malignancy. the clinical stage of pca is evaluated from the dre and trusbx results. the histological grade of the disease is given a score on the 10point gleason scale, which has been widely used since 1966 [6, 7 ]. the gleason score (gl.s.) is a sum of two individual numbers, representing the two predominant (out of five possible) histological pca grades. additionally, there has been a sharp increase of early stage and low grade neoplasms diagnosed in younger men. these trends closely reflect the frequency of psa testing, as well as advances in trusbx techniques. as a result the combination of psa 6, pca extracapsular extension (pt > 2) and the seminal vesicle invasion occurred respectively in 42.4%, 47.5% and 5% initially classed as low grade pca patients. the influence of intra and interobserver variability, in preoperative histological diagnosis of pca, on the decision making process regarding active surveillance, has not yet been reported in the literature. in our study, as in other reports, a proportion of the trusbx and surgical specimens re examined by the same pathologist was reported differently from the initial reports [26, 27 ]. to better assess the possible impact of intraobserver variability on the decision for active surveillance, two reports by same pathologist were compared. had the decision about active surveillance been made on the re examined trusbx histology, 3 patients would not have been offered it due to a high total pca percentage within the prostate biopsy specimen. in six reviewed reports the interobserver variability in histology reporting has also been observed by several research groups previously [2830 ]. in our study, in two out of eight cases (25%) active surveillance would not have been indicated if the decision was made based on the trusbx report reviewed by the second pathologist. moreover, six out of eight surgical specimens reviewed by the second pathologist were also less favourably reported. undoubtedly, trusbx and postoperative histology reports vary due to the sheer volume of the specimens being analysed. however, we have also noticed a marked intra and interobserver variability in pre and postoperactive histological evaluation of pca. the observed differences in initial and subsequent assessments may result from the variation in the criteria for interpretation, the actual interpretation of the criteria, and expertise in interpreting the criteria [3133 ]. one should, therefore, always be aware of prostate cancer understaging and undergrading by trusbx when deciding whether active surveillance is in patient 's best interest. the concept of active surveillance prior to radical treatment in patients with prostate cancer refers back to whitmore 's cornerstone questions : is cure possible ? this also reflects the trend to tailor pca management to an individual patient 's needs. there is a large body of evidence which supports that in selected cases active surveillance is oncologically safe [36, 37 ]. we recommend, however, maintaining cautious monitoring of all pca patients under active surveillance. moreover, the decision about active surveillance should, ideally, be made after at least two pathologists have jointly reviewed and agreed on the trusbx histology results. our study has several methodological strengths, which are : (i) clearly defined inclusion criteria for active surveillance ; (ii) a second, blinded histological evaluation by the same pathologist (intraobserver variability), as well as a second, blinded histological evaluation by a different pathologist (interobserver variability) ; (iii) histological reporting in accordance with the isup (international society of urological pathology) 2005 guidelines. the study was limited, however, by a small number of patients, partly retrospective study design, and the 6 to 8core prostate biopsy. our study has several methodological strengths, which are : (i) clearly defined inclusion criteria for active surveillance ; (ii) a second, blinded histological evaluation by the same pathologist (intraobserver variability), as well as a second, blinded histological evaluation by a different pathologist (interobserver variability) ; (iii) histological reporting in accordance with the isup (international society of urological pathology) 2005 guidelines. the study was limited, however, by a small number of patients, partly retrospective study design, and the 6 to 8core prostate biopsy. the decision about active surveillance prior to radical prostatectomy, offered to low risk prostate cancer patients, should be made with full awareness of the limitations associated with prostate biopsy. our study has identified significant intra and interobserver variability where pca histology reports differed, and were often undergraded. therefore, the decision about active surveillance of low risk prostate cancer patients should be made carefully, taking into account all available clinical and histological data, and after at least two pathologists have jointly reviewed and agreed on the trusbx histology results. further prospective studies with a larger number of patients need to identify the most adequate histological approach for an optimal selection of candidates suitable for active surveillance.	introductionactive surveillance (as) is always associated with a degree of uncertainty, whether or not prostate biopsy (trusbx) results indeed can be relied on for evaluation of cancer stage and histological grade, as the most commonly observed limitations of trusbx are undergrading, understaging and underestimating true prostate cancer (pca) volume. we evaluated prostate cancer characteristics in men who could have been offered active surveillance based on clinical features and trusbx results, and compared them with the same patient 's histology results following their radical prostatectomy (rp). moreover, we assessed the level of consistency in reporting trusbx and rp specimens by the same pathologist on two separate occasions, as well as by another independent pathologist.material and methodsall patients who underwent rp between 2005 and 2008 had their medical records reviewed retrospectively. all histological specimens were prospectively re evaluated by the same pathologist, as well as by a second to assess for intra and interobserver variability, respectively.resultseight out of a total of 124 patients who underwent rp could have been offered as on the basis of initial microscopic reports. however, there was significant intra and interobserver variability. the differences in the histological grade of the specimens obtained from trusbx and rp, reported by the same pathologist and by the second pathologist were apparent in 6 and 4 cases, and in 7 and 6 patients, respectively.conclusionswe recommend that the decision about as should be made after at least two pathologists have jointly reviewed and agreed on the trusbx histology results.
vitiligo is a generalized autoimmune disease manifesting acquired white patches due to loss of melanocytes. it is the most prevalent pigmentary disorder with an incidence rate between 0.1 and 2% showing multifactorial etiology and polygenic inheritance. autoimmune disorders, genetic factors, autotoxic metabolites of melanin synthesis, accumulation of neurochemical substances, biochemical imbalance with defective free radical defense, deficiency in melanocyte growth factors, and an intrinsic defect of structure and function of melanocytes have been proposed to be involved in its pathogenesis. vitiligo is frequently associated with various organ - specific autoimmune diseases, such as, hashimato 's thyroiditis, addison 's disease, diabetes mellitus type 1, and pernicious anemia. the aim of this study is to determine the prevalence of thyroid diseases in children with vitiligo and compare it with the literature. the study was conducted retrospectively in children with nonsegmental vitiligo, who applied to the pediatric dermatology clinic between april 2008 and january 2010. the patients thyroid function tests and thyroid autoantibody results were enrolled without considering the extent of the vitiligo lesions. free triiodothyronine (ft3) (reference range : 2.53 - 5.22 g / ml), free thyroxine (st4) (reference range : 0.90 - 1.67 ng / dl) thyroid stimulating hormone (tsh) (reference range : 0.66 - 4.14 lu / ml), thyroglobulin antibody (tgab) (positive titration > 115 iu / ml), and thyroid peroxidase antibody (tpoab) (positive titration > 34 iu / ml) (roche diagnostics gmbh, mannheim, germany) levels were interpreted. descriptive statistics were used to evaluate the findings and the t test was used to compare the rates (spss version 16.0, chicago, il, usa). a total of 79 pediatric patients with vitiligo whose ages ranged between two and fifteen were enrolled in the study. twenty - nine (36.7%) patients were male and 50 (63.3%) patients were female (female : male = 1.7:1). nineteen (24.0%) patients were between the ages of two and five, (45.5%) patients were between the ages of six and ten, and 24 (30.3%) patients were between the ages of 11 and 15 [table 1 ]. age distribution of pediatric patients with vitiligo abnormalities of thyroid function tests and thyroid autoantibodies were found in a total of 20 (25.3%) patients ; eight males (40.0%) and 12 (60.0%) females. the abnormality of thyroid autoantibodies was found in a total of nine (11.3%) patients ; three (33.3%) males and six (66.7%) females. tgab positivity was present in eight (10.1%) patients and tpoab positivity was present in five (6.3%) patients. the positivity of these two antibodies together was present in a total of four (5.1%) patients. of the 20 patients in whom thyroid function tests and/or thyroid antibodies were abnormal, ten (12.6%) had a high tsh level and normal ft3 and ft4 levels and were evaluated as subclinical hypothyroidism. one (1.2%) patient had both low tsh and ft4 levels and was evaluated as hypothyroidism. one (1.2%) patient had low ft4 and high tsh levels with tpoab positivity and was evaluated as hypothyroidism and autoimmune thyroiditis. five (6.3%) patients had only autoantibody positivity (three patients with both tgab and tpoab positivity and two patients with only tgab positivity) and were evaluated as euthyroidism and autoimmune thyroiditis. three (3.7%) patients had high tsh levels with autoantibody positivity (one patient with both tgab and tpoab positivity and two patients with only tgab positivity) and were evaluated as subclinical hypothyroidism and autoimmune thyroiditis. consequently, subclinical hypothyroidism was the most frequent diagnosis established in 13 (16.4%) of the 79 pediatric patients with vitiligo [table 2 ]. laboratory findings and clinical diagnoses of pediatric vitiligo patients in whom abnormal thyroid function tests and/or thyroid antibodies were detected statistically, there was no significant difference between male and female patients when they were compared for thyroid function tests and thyroid antibody abnormalities (p = 0.728). also, there was no significant difference between male and female patients when they were statistically compared for autoimmune thyroiditis (p = 0.826). it is more predominant in younger ages and approximately 50% of the cases have the onset of their disease prior to the age of 14 years. vitiligo affects both the sexes equally, but women more frequently visit the doctor due to cosmetic reasons. in this study of children with vitiligo a female preponderance (female : male = 1.7:1) was present. vitiligo has been reported to start between 8 and 12 years of age in 51% of the children. this study showed that 45.5% of the children with vitiligo were between 6 and 10 years of age. autoimmunity is one hypothesis forwarded to explain nonsegmental vitiligo. a specific cytotoxic t - cell reaction, either of primary origin or resulting from damage to melanocytes by other mechanisms has been suggested to be responsible for destroying the pigment cells. a genetic predisposition to immune dysregulation can lead to aberrant t - cell reactivities that destroy melanocytes. alternatively, autoreactive antimelanocyte t - cells can arise in response to a challenge to the immune system. involvement of the immune system in the pathogenesis is evidenced by the effectiveness of immunomodulatory agents, such as, corticosteroids and calcineurin inhibitors. on the other hand, segmental vitiligo is explained by the neural theory, which proposes that some chemical released from the peripheral nerve endings causes a decreased production of melanin. vitiligo is epidemiologically associated with other autoimmune diseases suggesting that predisposition to other autoimmune diseases involves a shared genetic component. particularly, an increased frequency of clinical as well as subclinical thyroid disease appears to be increased in frequency in patients with vitiligo. increased prevalence of autoimmune disorders in association with vitiligo and detection of various autoantibodies, including anti - thyroid and anti - melanocyte antibodies, in the serum of vitiligo patients and alteration of t - cell population showing decreased t - helper cells, are in favor of this autoimmune theory. vitiligo frequently precedes the thyroid involvement ; thus screening vitiligo patients for thyroid function and thyroid antibody seems plausible. autoimmune thyroid diseases accompany vitiligo, from which hypothyroidism is one of the most common disorder. in pediatric patients with vitiligo iacovelli., reported a figure of 10.7% in children with nonsegmental vitiligo, especially in females, all of whom had thyroid dysfunction. hashimato 's thyroiditis was reported to be the most common autoimmune disease seen in patients with vitiligo. in a study of children and adolescents with vitiligo, hashimato 's thyroiditis was found to be two - and - a - half times and hypothyroidism ten times more frequent than in a healthy age - and - sex - matched population and 24.1% of these 54 patients with vitiligo had autoimmune thyroiditis as compared to 9.6% of school - aged children from an iodine - replete area of greece. yang., reported that 11.8% of 363 pediatric vitiligo patients had abnormal levels of thyroid parameters. the thyroid abnormality prevalence of 25.3% determined in our study is compatible with the literature attracting attention to the association of thyroid disease and vitiligo in childhood. also, of the 20 patients in whom a thyroid abnormality was determined, 13 (16.4%) had subclinical hypothyroidism and nine (11.3%) had thyroid autoantibody positivity. dave., showed that the frequency of thyroid disorders were 57.1% in adult patients with vitiligo in comparison to 10% in people without vitiligo. manighalam., conducted a study on 30 patients with vitiligo, and they found hyperthyroidism and hypothyroidism in 10 and 6.6%, respectively. another study reported that an antithyroid antibody was detected in 18.1% of the patients with vitiligo in comparison to 7.3% in the control group, with more prevalence in females. subclinical hypothyroidism is characterized by an elevated serum tsh level associated with a normal total or free t4 and t3 values. subclinical hypothyroidism is a laboratory diagnosis with no significant findings or symptoms associated with thyroid dysfunction in patients. long - term follow up has demonstrated the development of overt hypothyroidism at a rate of 5 - 20% per year, especially in autoimmune thyroiditis. when we consider that the prevalence of subclinical hypothyroidism is < 2% in the pediatric age group, the rate found in our study was higher. this retrospective study of prevalence attracts attention to the association of vitiligo with thyroid abnormalities. as the risk of developing overt hypothyroidism is high in patients with subclinical hypothyroidism, we suggest that thyroid function tests and thyroid autoantibodies be analyzed in children with vitiligo.	although the exact pathogenic processes involved in vitiligo are still unknown, its association with autoimmune disorders and endocrine dysfunction has been reported. one of its associations is with thyroid diseases. the purpose of this retrospective study was to determine the prevalence of thyroid function tests and thyroid autoantibody abnormalities in children diagnosed with vitiligo and compare the results with the literature. the laboratory documents of thyroid function tests (ft3, ft4, and tsh) and thyroid autoantibodies (tgab and tpoab) belonging to the pediatric vitiligo patients were studied retrospectively. thyroid function tests and thyroid autoantibody abnormalities were detected in 20 (25.3%) of the pediatric vitiligo patients. thirteen (16.4%) patients were evaluated as subclinical hypothyroidism, two (2.5%) were evaluated as hypothyroidism, and five (6.3%) were evaluated as euthyroidism. thyroid autoantibodies were found to be positive in nine (11.3%) patients. previously reported prevalence of thyroid disease in children with vitiligo ranged from 10.7 to 24.1%, and the prevalence of 25.3% determined in this study was compatible with the literature. also, the high rate of subclinical hypothyroidism determined in these patients attracted attention to the probable development of overt hypothyroidism in a long term. thus, our results suggest that thyroid function tests and thyroid autoantibodies should be analyzed in children with vitiligo.
nowadays, society emphasizes the importance of an attractive physical appearance and especially facial beauty. patients are requiring more frequently dental treatments, orthodontic and orthognatic surgical treatments and of course, plastic - surgical treatments for enhancing and optimizing their facial appearance. social interactions are considered to be influenced by facial looks and certain features are described to play a bigger role than others in interpersonal decisions. perception has been defined as the process by which patterns of environmental stimuli are organized and interpreted ; it can be influenced by a variety of physical, physiological, and social factors. scientific literature includes studies in which facial attractiveness was assessed by showing to panels of judges graphical representations of facial appearances (drawings, silhouettes or photographs) and a rating of such representations was required. some articles present assessments of facial profile attractiveness in cases with antero - posterior skeletal discrepancies, while others assessed the attractiveness of cases with vertical discrepancies. only few studies have inquired upon the attractiveness of cases presenting vertical and symmetry discrepancies. some investigations compared the perception of profile attractiveness between lay people and professionals, others between different categories of clinicians, while many of the studies addressed certain races and ethnic groups. a large proportion of the literature emphasizes the importance of the presence of certain relationships such as the golden ratio between different facial proportions as a measure for facial aesthetics in the general public. ricketts was among the first few orthodontists to use the golden ratio to assess the composition of facial hard and soft tissues. proffit and fields stated that the vertical height of the mid - face, from the supraorbital ridges to the base of the nose, should equal the height of the lower face, and in the lower face, the mouth should be about one third of the way between the base of the nose and the chin. high correlations with attractiveness ratings suggest that symmetry along the vertical axis is generally considered a pleasant facial feature. in addition, the averageness, or prototypicality, of a face has been found to be an important determinant to attractiveness judgments, even when keeping symmetry constant. because of the importance shown to the golden proportions in assessing facial aesthetics, the relationship between the two needs to be thoroughly investigated. because there are many factors influencing the perception of beauty such as personal variations, cultural differences, ethnicity, we considered several questions related with perception, such as : how important is specific training in the assessment of attractiveness, are there are differences in perceptions between male and female observers ? are there deviations from symmetry or proportion which are perceived by observers as increasing appearance attractiveness, questions to which we wanted to find answers through our study. in order to test the hypothesis, a 5-item multiple choice - answer illustrated questionnaire was developed and administered to 236 students from our university. a panel consisting of five orthodontists was formed in order to search a public image of a beautiful person to be used for the questionnaire. after multiple measurements of symmetry and proportions on several selected photographs, one image of a woman that was found to possess a maximum score in aesthetic measurements was selected (fig. starting from this selected image, multiple digitally morphed photographs were obtained for the questionnaire. images were enhanced using the adobe photoshop cs 3 software and its extension one mask pro 4.1 in order to simulate different asymmetries or disproportions from the ideals that it possessed. the obtained images were grouped in three sets containing four and five modified photos together with the original image in order to test the power of discrimination of minor asymmetries and disproportions in the perception of the tested persons. images were grouped according to the type of modification that the original photograph suffered as it follows : the first set contained images where the proportion between the vertical facial third was modified : in each of the pictures one of the thirds of the face was increased by 10% from the original picture.the second set of images suffered modifications / deviations of the elements from the mid - saggital line, whereas the third set of images suffered modifications of the horizontal lines, landmarks in symmetry assessment. the first set contained images where the proportion between the vertical facial third was modified : in each of the pictures one of the thirds of the face was increased by 10% from the original picture. the second set of images suffered modifications / deviations of the elements from the mid - saggital line, whereas the third set of images suffered modifications of the horizontal lines, landmarks in symmetry assessment. to the questions associated with the pictures, two supplemental questions (without connection with the photos) regarding the element of the face which they consider as the most important in facial aesthetics assessment and the resulted questionnaire contained as it follows as it follows : personal data information : initials....................................................................... gender....................................................................... year of study.............................................................. q13. which of the following pictures you consider to have the most aesthetic appearance?question repeated three times, once for each set of imagesq4. which element from the face you consider to be the most important in assessing facial aesthetics ? the eyesthe nosethe lipsthe teethq5. which of the following conditions you consider to be essential in order to have facial aesthetics ? equality between the three vertical thirds of the face;proportionality between facial elements;facial symmetry;harmonious composition between facial elements. which element from the face you consider to be the most important in assessing facial aesthetics ? the eyesthe nosethe lipsthe teeth q5. which of the following conditions you consider to be essential in order to have facial aesthetics ? equality between the three vertical thirds of the face;proportionality between facial elements;facial symmetry;harmonious composition between facial elements. equality between the three vertical thirds of the face ; proportionality between facial elements ; harmonious composition between facial elements. the questionnaire was administered to 236 students from the faculty of dentistry of the university of medicine and pharmacy iuliu hatieganu, cluj - napoca, romania. the questions were projected as a slide - show in an amphitheatre and the subjects chose the answers according to their opinion and marked them on a chart, together with the personal data required. the images were projected without a legend, so the subjects did not know what the difference between images was. the application of the questionnaire was done in several sequences for students from different years of study. we considered the students from junior years to be inexperienced and with less professional knowledge than students from sophomore years who have been trained in facial aesthetic assessment. simple descriptive statistics were used to interpret the data gathered, using microsoft excel software, from microsoft office 7 package for windows. analyzing the group of subjects we observed that from 236 questioned persons, 111 were males and 125 were women. in regard with their previous experience, 94 subjects were experienced in aesthetic assessment (students in 5 and 6 year at the faculty of dental medicine), and 142 subjects were considered to be inexperienced (students in 1 and 2 year at the faculty of dental medicine, faculty of dental technicians). a panel consisting of five orthodontists was formed in order to search a public image of a beautiful person to be used for the questionnaire. after multiple measurements of symmetry and proportions on several selected photographs, one image of a woman that was found to possess a maximum score in aesthetic measurements starting from this selected image, multiple digitally morphed photographs were obtained for the questionnaire. images were enhanced using the adobe photoshop cs 3 software and its extension one mask pro 4.1 in order to simulate different asymmetries or disproportions from the ideals that it possessed. the obtained images were grouped in three sets containing four and five modified photos together with the original image in order to test the power of discrimination of minor asymmetries and disproportions in the perception of the tested persons. images were grouped according to the type of modification that the original photograph suffered as it follows : the first set contained images where the proportion between the vertical facial third was modified : in each of the pictures one of the thirds of the face was increased by 10% from the original picture.the second set of images suffered modifications / deviations of the elements from the mid - saggital line, whereas the third set of images suffered modifications of the horizontal lines, landmarks in symmetry assessment. the first set contained images where the proportion between the vertical facial third was modified : in each of the pictures one of the thirds of the face was increased by 10% from the original picture. the second set of images suffered modifications / deviations of the elements from the mid - saggital line, whereas the third set of images suffered modifications of the horizontal lines, landmarks in symmetry assessment. to the questions associated with the pictures, two supplemental questions (without connection with the photos) regarding the element of the face which they consider as the most important in facial aesthetics assessment and the resulted questionnaire contained as it follows as it follows : personal data information : initials....................................................................... gender....................................................................... year of study.............................................................. q13. which of the following pictures you consider to have the most aesthetic appearance?question repeated three times, once for each set of imagesq4. which element from the face you consider to be the most important in assessing facial aesthetics ? the eyesthe nosethe lipsthe teethq5. which of the following conditions you consider to be essential in order to have facial aesthetics ? equality between the three vertical thirds of the face;proportionality between facial elements;facial symmetry;harmonious composition between facial elements. initials....................................................................... gender....................................................................... year of study.............................................................. q13. which of the following pictures you consider to have the most aesthetic appearance ? which element from the face you consider to be the most important in assessing facial aesthetics ? the eyesthe nosethe lipsthe teeth q5. which of the following conditions you consider to be essential in order to have facial aesthetics ? equality between the three vertical thirds of the face;proportionality between facial elements;facial symmetry;harmonious composition between facial elements. equality between the three vertical thirds of the face ; proportionality between facial elements ; harmonious composition between facial elements. the questionnaire was administered to 236 students from the faculty of dentistry of the university of medicine and pharmacy iuliu hatieganu, cluj - napoca, romania. the questions were projected as a slide - show in an amphitheatre and the subjects chose the answers according to their opinion and marked them on a chart, together with the personal data required. the images were projected without a legend, so the subjects did not know what the difference between images was. the application of the questionnaire was done in several sequences for students from different years of study. we considered the students from junior years to be inexperienced and with less professional knowledge than students from sophomore years who have been trained in facial aesthetic assessment. simple descriptive statistics were used to interpret the data gathered, using microsoft excel software, from microsoft office 7 package for windows. analyzing the group of subjects we observed that from 236 questioned persons, 111 were males and 125 were women. in regard with their previous experience, 94 subjects were experienced in aesthetic assessment (students in 5 and 6 year at the faculty of dental medicine), and 142 subjects were considered to be inexperienced (students in 1 and 2 year at the faculty of dental medicine, faculty of dental technicians). assessing the most pleasant appearance, focused on the first set of images, 38.98% of the subjects found that an increased upper third of the face was desirable, 29.24% of subjects appreciated the picture in which all three thirds are equal, as the situation which is the most favorable, 22.46% opted for an increased middle third while only 9.32% considered an increased lower third to be more attractive (fig 5). relating to the appraisal of the most pleasant appearance 31.91% of the experienced group found the situation with equality between thirds as the most appreciated, 27.66% of them appreciated the image where upper third was increased as the situation which is the most favorable, 21.28% opted for an increased middle third and 19.15% considered that a lower third increased was more attractive (fig. 5). on the side of the inexperienced subjects, 46.48% chose in favor of a dominant upper third, 27.46 percent opted for the equality, 23.2% chose the increased middle third whereas only 2.82 percent were of the opinion that increased lowest third was more attractive. during the assessment of the most pleasant appearance, focused on the first set of images, male subjects chose in proportion of 36.04% the increased upper third followed by an increased middle third, a situation of vertical equilibrium and a least desirable the situation with increased lower third (fig. for the second set of images relating to the assessment of the most pleasant appearance, 26.27% of the subjects found most pleasing the image of reference, without deviation from symmetry, and the lowest percentage of votes was obtained by the image with a deviated menton - 15.68%. the experienced group had fewer difficulties in finding the image of reference as the most attractive and with fewer votes for the image with a deviated filtrum. the inexperienced group had difficulties in observing differences between images and giving similar percentages for all of the photos. based on the second set of images, 22.52% of male subjects chose the image where a deviation of the corner of the mouth was present, with similar percentages for the deviated filtrum, menton deviation, but disconsidered the image with nasal pyramid deviation 16.22% (fig. the group of girls identified in 31.20% proportion the reference image, without change in the symmetry, 22.40% preferred the image where the pyramid nasal was diverted, a percentage of 18.40% opted for the image to the offset filtrum and 12.00% showed satisfaction with the image in which the menton deflects (fig. 56.36% of subjects identified the reference image as being the most attractive, 34.32% appreciated the picture in which the subnasale line is diverted, while the least appreciated was the image with canting of the interlabial line (fig. the answers for question 4 identified the most important item in assessing the facial attractiveness of a person : 39.41% considered the eyes as being the most relevant, 30.08% of the total sample chose the teeth, 23.31% were of the opinion that lips are the most important, and 7.20% of the interviewed have mentioned that the nose is the component which defines facial attractiveness. from the situations described in question number 5 regarding the primecondition required for facial aesthetics, 36.62% the subjects found facial symmetry important, 35.21% opted for facial harmonious composition, 19.72% agreed that there should be equality between facial thirds, and 8.45% considered important the proportionality between elements. to question number 5, related to the main requirement to be fulfilled when making reference to facial attractiveness, 36.04% of the male subjects considered facial symmetry important, 34.23% were in favor of a harmonious composition of facial elements, 17.12% opted for the equality between facial thirds, and 12.61% chose to support proportionality between facial elements. for the women, a rate of 52.80% chose in favor of a harmonious compositions of the elements, 29.60% considered that the facial symmetry is the most important, 12.00% opted for equality between facial thirds, and 5.60% pointed to significant proportionality between facial elements. within the limits of our study, due to a small number of questioned subjects and a low degree of discrimination between images caused by very mild modifications, the following conclusions may be drawn : a dominant upper third of the face is considered to be more attractive than equality between thirds or other disproportion ratios by most people, and only some professionals are able to discriminate small differences - a dominant lower third seems to be the least desirable situation without significant differences between experienced and non experienced evaluators, or between genders.slight deviations of the elements of the mid - sagital line are not too visible ; therefore even professionals had difficulties in identifying them.the most displeasing deviation from symmetry, between those shown in the second set of image was the deviation of the corner of the mouth.by analyzing closely, the options in this group depended on the degree of experience. for this reason we can state that the perception of aesthetics for male subjects is influenced significantly by the degree of knowledge in this field.the eyes are considered to be the most important element linked to the attractiveness of a person s face, this assertion is proved by the options of all groups concernedthe nose seems to have the smallest value in defining facial attractiveness for the questioned subjects.the primary requirement which must be met in relation to facial attractiveness is, in the opinion of a majority, facial symmetry, followed closely by the harmonious composition of the elements of the face. however, the inexperienced population considered in a higher proportion the facial symmetry.male sex opinions noted in the questionnaire are not much different from those of female sex, but, as said before, the degree of experience in facial aesthetic assessment puts more emphasis on the premium categories. a dominant upper third of the face is considered to be more attractive than equality between thirds or other disproportion ratios by most people, and only some professionals are able to discriminate small differences- a dominant lower third seems to be the least desirable situation without significant differences between experienced and non experienced evaluators, or between genders. slight deviations of the elements of the mid - sagital line are not too visible ; therefore even professionals had difficulties in identifying them. the most displeasing deviation from symmetry, between those shown in the second set of image was the deviation of the corner of the mouth. by analyzing closely, the options in this group depended on the degree of experience. for this reason we can state that the perception of aesthetics for male subjects is influenced significantly by the degree of knowledge in this field. the eyes are considered to be the most important element linked to the attractiveness of a person s face, this assertion is proved by the options of all groups concerned the nose seems to have the smallest value in defining facial attractiveness for the questioned subjects. the primary requirement which must be met in relation to facial attractiveness is, in the opinion of a majority, facial symmetry, followed closely by the harmonious composition of the elements of the face. male sex opinions noted in the questionnaire are not much different from those of female sex, but, as said before, the degree of experience in facial aesthetic assessment puts more emphasis on the premium categories.	introduction.an attractive facial appearance is considered nowadays to be a decisive factor in establishing successful interactions between humans. in relation to this topic, scientific literature states that some of the facial features have more impact then others, and important authors revealed that certain proportions between different anthropometrical landmarks are mandatory for an attractive facial appearance.aim.our study aims to assess if certain facial features count differently in people s opinion while assessing facial attractiveness in correlation with factors such as age, gender, specific training and culture.material and methods.a 5-item multiple choice illustrated questionnaire was presented to 236 dental students. the photoshop cs3 software was used in order to obtain the sets of images for the illustrated questions. the original image was handpicked from the internet by a panel of young dentists from a series of 15 pictures of people considered to have attractive faces. for each of the questions, the images presented were simulating deviations from the ideally symmetric and proportionate face. the sets of images consisted in multiple variations of deviations mixed with the original photo. junior and sophomore year students from our dental medical school, having different nationalities were required to participate in our questionnaire. simple descriptive statistics were used to interpret the data.results.assessing the results obtained from the questionnaire it was observed that a majority of students considered as unattractive the overdevelopment of the lower third, while the initial image with perfect symmetry and proportion was considered as the most attractive by only 38.9% of the subjects. likewise, regarding the symmetry 36.86% considered unattractive the canting of the inter - commissural line. the interviewed subjects considered that for a face to be attractive it needs to have harmonious proportions between the different facial elements.conclusions.considering an evaluation of facial attractiveness it is important to keep in mind that such assessment is subjective and influenced by multiple factors, among which the most important are cultural background and specific training.
a large amount of scientific research is directed towards anterior cruciate ligament (acl) injuries. however, recent epidemiological studies have demonstrated a continued high incidence of acl injuries despite the implementation of intervention programs. as these injuries remain a significant problem, research directed at rehabilitation is needed. an injured athlete is under pressure to return to competition as soon as possible and there is significant interest among sports medicine professionals in identifying an adequate indicator of safe return to activity [12, 17, 29, 30 ]. between 43 and 92 % of athletes return to their sports within 612 months following acl reconstruction. another important fact to note is the unacceptably high re - injury rate of reconstructed acls. in addition to clinical examinations such as lysholm s score and the cincinnati knee ligament rating scale, functional performance tests are commonly used to predict athlete s abilities to participate in sports. some clinicians use isolated functional tests, such as hop tests [5, 15, 26, 27 ], but these tests have been criticized for not being suitable for the evaluation of sufficient functional capability in acl - reconstructed patients. muscle strength tests were used to identify differences between injured and non - injured legs. the results showed that the patients reported poor results with respect to knee function during activities and a high fear of re - injury despite sufficient muscle strength capacity in both legs [2, 4, 25 ]. this observation demonstrated that muscle strength tests are not sensitive enough to distinguish between the functional differences between injured and non - injured legs and time since - surgery criteria next to single functional test, there are a few studies that examined test batteries in acl - reconstructed patients as a measure of function [9, 10, 22 ], but they did not provide information necessary for determining readiness for return to sport. most of these tests in a clinical setting were applied as an outcome measure based on scores obtained from the acl - reconstructed patient. in order to classify whether the test result can be considered as a functionally average outcome, there is no study that provides data of functional measurements in a healthy population as a reference. furthermore, most of these studies were conducted at least 1 year postoperatively ; investigations performed during the early rehabilitation period (36 months) are missing. evaluations of progress over time, which are necessary to guarantee a confident postoperative return to training and competition within an appropriate time frame, are still a major concern. there is a need to identify complex, persistent functional deficits related to the initial acl reconstruction. to our knowledge, there is only one test battery that combines various subtests to broadly address sport - specific requirements. the large - scale setting design and lab - based materials in this study may limit a regular application. to support decision - making, we therefore developed and evaluated a standardized test protocol combining various subtests (power, speed, agility, coordination, unilateral cutting and side - to - side movements) that require no sophisticated equipment and can be used multiple times within the rehabilitation period. we classified test results into five different performance categories and established potential limb asymmetries in a healthy population. we hypothesized that the test battery represents the basis for a clinical setting by objectively determine the right time point for a safe return to sport post acl reconstruction. we further hypothesized that healthy individuals did not exhibit relevant limb asymmetries independent of the test requirements, age and gender. test results from an acl - reconstructed patient should be at least classified as a functionally good outcome to support a safe return to sports and to decrease the likelihood of re - injury by returning to sport too quickly. for reliability testing, data from twenty eight (thirteen female, fifteen male) healthy subjects (age 24.1 2.5 years) were obtained for each test. exclusion criteria included previous knee, hip or ankle injuries as well as current pain somewhere of the musculoskeletal system. before testing, each subject completed a 15-min warm - up at a submaximal level on a bike cycle, followed by 5 min of individual dynamic stretching and jumping. the order of the test stations were similar to the subsequent recommendations of the present test battery, starting with tl - st and ol - st on a mft challenge disc, followed by all jumping test with the myotester (tl - cmj, ol - cmj, tl - py), the ol - sy and finally the tl - qft. after a rest of 3 min, the test was performed until three successful and valid trials were made. to ensure adequate recovery between tests, each subject got 5 min of rest between the test stations. test procedure and equipment were the same as used for the evaluation of normative data. the test leader of each station was the same between test and re - test. there was a 5-day interval between the tests, and subjects were asked to avoid strenuous physical activity 3 days before testing. over the 2-year period of data collection, the participants were not engaged in competitive sports and had no experience with activities similar to the exercises used in the test battery. prior to testing, the procedure, including possible risks and benefits, was explained to the subjects. they (or, if under 18 years of age, their legal guardians) were asked to read and sign the informed consent document. we only included subjects who performed all tests in the specified order. in total, data from 434 subjects were included in the study. for each subject, age, height, weight, body mass index (bmi) and the dominant leg based on the study by coren. who used similar survey items to determine a person s dominant leg, we asked the following question : which leg do you use to push a ball as strongly as possible ? based to the result, each participant had to perform the following two tests, in which the first leg used was defined as the dominant leg.climb a stairwalkerparticipants were prodded into action by us giving them a slight pushtable 1descriptive characteristics of healthy subjects in all age groupsage (years)height (m)weight (kg)bmi (index)dominant leg (%) children (1014 years) male (n = 57)10.9 (0.7)1.47 (0.06)39.8 (8.8)18.4 (3.4)98-right female (n = 50)11.7 (0.7)1.52 (0.08)43.3 (9.5)18.8 (4.0)96-rightyouth (1519 years) male (n = 57)16.2 (0.8)1.77 (0.07)67.8 (10.8)21.6 (3.1)96-right female (n = 70)16.1 (1.1)1.67 (0.06)59.8 (9.8)21.4 (3.5)97-rightyoung adults (2029 years) male (n = 51)24.8 (2.6)1.79 (0.06)74.8 (6.3)23.3 (1.7)85-right female (n = 51)23.6 (2.5)1.65 (0.06)59.5 (7.1)20.9 (1.9)69-rightadults (3050 years) male (n = 51)38.2 (7.3)1.79 (0.05)77.3 (7.2)24.1 (1.8)86-right female (n = 47)37.5 (6.1)1.69 (0.06)61.3 (7.0)21.5 (2.1)75-rightall values are expressed as means (sd) participants were prodded into action by us giving them a slight push descriptive characteristics of healthy subjects in all age groups all values are expressed as means (sd) before testing, the subjects completed a warm - up consisting of 10 min of stationary cycling (female 1.5 w / kg, male 2.0 w / kg). the test battery included seven different tests conducted in a systematic order. for each test, two practice trials, followed by three approved trials, were performed. table 2 provides an overview of the test descriptions and variables measured. for the one - leg tests, all procedures were reviewed and approved (id - number 022014) by the board of ethical questions in science of the university of innsbruck.table 2description of the test batterytestdescriptionstability test to assess postural control, tests were performed on an mft challenge disc (tst trendsport, grosshflein, austria) connected to a pc. while balancing on the disc, coordi software provides instant feedback about the position of the disc. to avoid the influence of different shoe types, all trials were performed without shoes. subjects were instructed to stand in the centre with their arms at their sides variable level of stability [index ] two - leg stability test (tl - st) subjects had to stand with both legs on the disc while maintaining their balance for 30 s. data collection was immediately stopped in the case of a loss of balance one - leg stability test (ol - st) based on the two - leg test results, the test was performed with one leg. the subject was not allowed to stabilize the raised leg against the plate or standing legjumping test all jump tests were performed using myotest (myotest s.a., the subjects carried a belt around their hips, and the myotester was placed above the greater trochanter of the hip. before jumping, the subjects had to stand in an upright and still position variables jump height (cm), power (w / kg), ground contact time (ms), reactivity (mm / ms) two - leg countermovement jump (tl - cmj) a sound signal from the myotester announced the start of the jump. from an upright position, the subjects quickly bent their knees and then immediately jumped upward, attempting to maximize their height. during this hop, arms were placed on the hips one - leg countermovement jump (ol - cmj) this was similar to the two - leg test, but this test was performed with one leg plyometric jump (tl - pj) the subject had to perform three consecutive two - leg jumps, focusing on a maximum jump height and a fast ground contact time. arms could be used to assist with the jump speedy jump (ol - sy) the speedy basic jump set (tst trendsport, grosshflein, austria) was used to create the jump coordination path (right panel). the subjects performed one - footed jumps through the course of red (forward backward forward jumps) and blue (sideway jumps) hurdles, completing 16 jumps. this had to be performed as quickly as possible by jumping on one leg without a rest between the hurdles. twisting of the hip was not allowed, and the test was immediately stopped when the raised leg touched the ground or the subject had direct contact with the speedy basic jump hurdles. time was measured using two stopwatches beginning as soon as the subject started to jump and ending when he / she reached the finish line with one leg. the mean value was recorded for each jump variables time (s) quick feet test (tl - qft) again, the speedy basic jump set (tst trendsport, grosshflein, austria) was used for the quick feet test as displayed in the picture. the subject had to step in and out with one foot after the other until 15 repetitions were completed. arms could be used to maintain balance, and stepping on the speedy pole was not allowed variables time (s) description of the test battery to assess the test retest reliability, measurements from the first testing day were correlated with measurements from the same tester s second testing day. test retest reliability was determined using the intraclass correlation coefficient (icc 1/1) in the one - way random effects model. this correlation value reflects the percentage of variance between the day - to - day measurements. to enable an objective evaluation, half of the standard deviation was both added to the mean value (good, very good) and subtracted from it (weak, very weak). in total, seven categories were generated for each test based on gender and age. in addition, we calculated the lower limb symmetry index (lsi) for the one - leg stability test and countermovement jump to determine whether there was a side - to - side difference between the dominant- and non - dominant legs. the lsi is defined as the ratio of the dominant leg score and the contralateral leg score expressed as a percentage (dominant / non - dominant 100 = lsi) [8, 24 ]. for the one - leg tests, we also defined specificity, expressed as the number of subjects classified as having a normal lsi divided by the total number of subjects. according to previous studies, for reliability testing, data from twenty eight (thirteen female, fifteen male) healthy subjects (age 24.1 2.5 years) were obtained for each test. exclusion criteria included previous knee, hip or ankle injuries as well as current pain somewhere of the musculoskeletal system. before testing, each subject completed a 15-min warm - up at a submaximal level on a bike cycle, followed by 5 min of individual dynamic stretching and jumping. the order of the test stations were similar to the subsequent recommendations of the present test battery, starting with tl - st and ol - st on a mft challenge disc, followed by all jumping test with the myotester (tl - cmj, ol - cmj, tl - py), the ol - sy and finally the tl - qft. after a rest of 3 min, the test was performed until three successful and valid trials were made. to ensure adequate recovery between tests, each subject got 5 min of rest between the test stations. test procedure and equipment were the same as used for the evaluation of normative data. the test leader of each station was the same between test and re - test. there was a 5-day interval between the tests, and subjects were asked to avoid strenuous physical activity 3 days before testing. over the 2-year period of data collection, more than 450 subjects were randomly selected to participate in this study. the participants were not engaged in competitive sports and had no experience with activities similar to the exercises used in the test battery. prior to testing, the procedure, including possible risks and benefits, was explained to the subjects. they (or, if under 18 years of age, their legal guardians) were asked to read and sign the informed consent document. exclusion criteria included previous knee, hip or ankle injuries. additionally, none of the subjects exhibited evidence of acute pain. we only included subjects who performed all tests in the specified order. in total, for each subject, age, height, weight, body mass index (bmi) and the dominant leg were recorded (table 1). based on the study by coren. who used similar survey items to determine a person s dominant leg, we asked the following question : which leg do you use to push a ball as strongly as possible ? based to the result, each participant had to perform the following two tests, in which the first leg used was defined as the dominant leg.climb a stairwalkerparticipants were prodded into action by us giving them a slight pushtable 1descriptive characteristics of healthy subjects in all age groupsage (years)height (m)weight (kg)bmi (index)dominant leg (%) children (1014 years) male (n = 57)10.9 (0.7)1.47 (0.06)39.8 (8.8)18.4 (3.4)98-right female (n = 50)11.7 (0.7)1.52 (0.08)43.3 (9.5)18.8 (4.0)96-rightyouth (1519 years) male (n = 57)16.2 (0.8)1.77 (0.07)67.8 (10.8)21.6 (3.1)96-right female (n = 70)16.1 (1.1)1.67 (0.06)59.8 (9.8)21.4 (3.5)97-rightyoung adults (2029 years) male (n = 51)24.8 (2.6)1.79 (0.06)74.8 (6.3)23.3 (1.7)85-right female (n = 51)23.6 (2.5)1.65 (0.06)59.5 (7.1)20.9 (1.9)69-rightadults (3050 years) male (n = 51)38.2 (7.3)1.79 (0.05)77.3 (7.2)24.1 (1.8)86-right female (n = 47)37.5 (6.1)1.69 (0.06)61.3 (7.0)21.5 (2.1)75-rightall values are expressed as means (sd) participants were prodded into action by us giving them a slight push descriptive characteristics of healthy subjects in all age groups all values are expressed as means (sd) before testing, the subjects completed a warm - up consisting of 10 min of stationary cycling (female 1.5 w / kg, male 2.0 w / kg). the test battery included seven different tests conducted in a systematic order. for each test, two practice trials, followed by three approved trials, were performed. table 2 provides an overview of the test descriptions and variables measured. for the one - leg tests, all procedures were reviewed and approved (id - number 022014) by the board of ethical questions in science of the university of innsbruck.table 2description of the test batterytestdescriptionstability test to assess postural control, tests were performed on an mft challenge disc (tst trendsport, grosshflein, austria) connected to a pc. while balancing on the disc, coordi software provides instant feedback about the position of the disc. to avoid the influence of different shoe types, subjects were instructed to stand in the centre with their arms at their sides variable level of stability [index ] two - leg stability test (tl - st) subjects had to stand with both legs on the disc while maintaining their balance for 30 s. data collection was immediately stopped in the case of a loss of balance one - leg stability test (ol - st) based on the two - leg test results, the test was performed with one leg. the subject was not allowed to stabilize the raised leg against the plate or standing legjumping test all jump tests were performed using myotest (myotest s.a., sion, switzerland) equipment. the subjects carried a belt around their hips, and the myotester was placed above the greater trochanter of the hip. before jumping, the subjects had to stand in an upright and still position variables jump height (cm), power (w / kg), ground contact time (ms), reactivity (mm / ms) two - leg countermovement jump (tl - cmj) a sound signal from the myotester announced the start of the jump. from an upright position, the subjects quickly bent their knees and then immediately jumped upward, attempting to maximize their height. during this hop, arms were placed on the hips one - leg countermovement jump (ol - cmj) this was similar to the two - leg test, but this test was performed with one leg plyometric jump (tl - pj) the subject had to perform three consecutive two - leg jumps, focusing on a maximum jump height and a fast ground contact time. arms could be used to assist with the jump speedy jump (ol - sy) the speedy basic jump set (tst trendsport, grosshflein, austria) was used to create the jump coordination path (right panel). the subjects performed one - footed jumps through the course of red (forward backward forward jumps) and blue (sideway jumps) hurdles, completing 16 jumps. this had to be performed as quickly as possible by jumping on one leg without a rest between the hurdles. twisting of the hip was not allowed, and the test was immediately stopped when the raised leg touched the ground or the subject had direct contact with the speedy basic jump hurdles. time was measured using two stopwatches beginning as soon as the subject started to jump and ending when he / she reached the finish line with one leg. the mean value was recorded for each jump variables time (s) quick feet test (tl - qft) again, the speedy basic jump set (tst trendsport, grosshflein, austria) was used for the quick feet test as displayed in the picture. the subject had to step in and out with one foot after the other until 15 repetitions were completed. arms could be used to maintain balance, and stepping on the speedy pole was not allowed variables time (s) description of the test battery to assess the test retest reliability, measurements from the first testing day were correlated with measurements from the same tester s second testing day. test retest reliability was determined using the intraclass correlation coefficient (icc 1/1) in the one - way random effects model. this correlation value reflects the percentage of variance between the day - to - day measurements. to enable an objective evaluation, normative data from healthy subjects were established for each test. to generate these data, the mean values in each category were calculated and were defined as average. to establish further categories, half of the standard deviation was both added to the mean value (good, very good) and subtracted from it (weak, very weak). in total, seven categories were generated for each test based on gender and age. in addition, we calculated the lower limb symmetry index (lsi) for the one - leg stability test and countermovement jump to determine whether there was a side - to - side difference between the dominant- and non - dominant legs. the lsi is defined as the ratio of the dominant leg score and the contralateral leg score expressed as a percentage (dominant / non - dominant 100 = lsi) [8, 24 ]. for the one - leg tests, we also defined specificity, expressed as the number of subjects classified as having a normal lsi divided by the total number of subjects. according to previous studies, to assess the test retest reliability, measurements from the first testing day were correlated with measurements from the same tester s second testing day. test retest reliability was determined using the intraclass correlation coefficient (icc 1/1) in the one - way random effects model. this correlation value reflects the percentage of variance between the day - to - day measurements. to enable an objective evaluation, normative data from healthy subjects were established for each test. to generate these data, the mean values in each category were calculated and were defined as average. to establish further categories, half of the standard deviation was both added to the mean value (good, very good) and subtracted from it (weak, very weak). in total, seven categories were generated for each test based on gender and age. in addition, we calculated the lower limb symmetry index (lsi) for the one - leg stability test and countermovement jump to determine whether there was a side - to - side difference between the dominant- and non - dominant legs. the lsi is defined as the ratio of the dominant leg score and the contralateral leg score expressed as a percentage (dominant / non - dominant 100 = lsi) [8, 24 ]. for the one - leg tests, we also defined specificity, expressed as the number of subjects classified as having a normal lsi divided by the total number of subjects. according to previous studies, table 1 presents the descriptive characteristics and the number of participants in all age groups. the right leg was found to be the dominant leg for most of the participants. the icc indicated a high reproducibility for the tl - cmj and a moderate reproducibility for the tl - st. table 3 presents the icc values for all the functional tests.table 3icc values of the functional testsfunctional testunitlegtestretesticctl - stlevel2.60 (0.47)2.49 (0.36)0.688ol - stleveldoml2.51 (0.50)2.27 (0.49)0.763n - doml2.40 (0.45)2.31 (0.46)0.819tl - cmjheight (m)38.1 (0.7)37.6 (0.6)0.921power (w / kg)45.7 (7.8)47.2 (7.7)0.889ol - cmjheight (m)doml23.6 (4.5)23.9 (4.1)0.897power (w / kg)doml36.2 (8.1)36.0 (7.8)0.822height (m)n - doml20.2 (5.2)21.1 (4.9)0.778power (w / kg)n - doml32.8 (7.8)33.5 (8.5)0.814tl - pyindex2.0 (0.4)1.9 (0.5)0.838ol - stime (s)doml6.3 (0.8)6.1 (0.7)0.792n - doml6.4 (0.9)6.3 (0.9)0.825tl - qtime (s)8.7 (1.3)8.4 (1.0)0.803values are expressed as means (sd) icc values of the functional tests values are expressed as means (sd) for the data analyses, the subjects were categorized into the following 4 different groups according to their age : children (1014 years), youth (1519 years), young adults (2029 years) and adults (3050 years). the establishment of the functional test values allowed for the creation of five normative categories. for each test, normative data were defined according to age group and gender. as an example, table 4 represents the five categories of normative data for the one - leg stability test. for all one - leg tests, all categories were colour - coordinated to facilitate classification as very good (dark green), good (light green), average (yellow), weak (orange) and very weak (red). results for the ol - st revealed a score of 98 % in male children, indicating a better performance (less time) for the non - dominant leg. in the female young adult and male adult groups, no differences could be found between the dominant and non - dominant legs (lsi 100 %). only female adults showed better performance in the dominant leg compared with the non - dominant leg, with an lsi of 107 %. similar results, with small performance differences between the two legs, were reported for the ol - st, where the lsi ranged from 101 to 104 %. in contrast, high values of the lsi were found for the ol - cmj, indicating a better performance of the dominant leg (better jump height). female children (118 %) and male adults (124 %), specifically, exhibited large side - to - side differences.table 4examples of normative values for the one - leg stability test for the five categoriesnormdatanormdatafemale ; non - dominant legfemale ; dominant leglevel (index)descriptionlevel (index)description1.74very good1.76very good1.752.05good1.772.00good2.062.90average2.012.72average3.003.30weak2.732.96weak3.31very weak2.97very weaknormdatanormdatamale ; non - dominant legfemale ; dominant leglevel (index)descriptionlevel (index)description1.98very good2.00very good1.992.31good2.012.30good2.323.09average2.313.19average3.303.62weak3.203.49weak3.63very weak3.50very weakfig. 1limb symmetry index of all one - leg tests examples of normative values for the one - leg stability test for the five categories limb symmetry index of all one - leg tests table 5 shows the specificity of the three one - leg tests. the one - leg countermovement jump had the lowest specificity in all age groups, ranging from 40 % (male adults) to 63 % (male children). independent of gender and age, the one - leg stability test showed a mean specificity ranging from 66 % (male adults) to 78 % (male children). the test reached a specificity of greater than 90 % in female and male children, as well as in female and male young adults.table 5specificity results for all one - leg testsage categorygenderspecificity (%) ol - stol - cmjol - sychildrenfemale714193male786395youthfemale685388male675990young adultsfemale765192male744793adultsfemale714586male664087 specificity results for all one - leg tests the icc indicated a high reproducibility for the tl - cmj and a moderate reproducibility for the tl - st. table 3 presents the icc values for all the functional tests.table 3icc values of the functional testsfunctional testunitlegtestretesticctl - stlevel2.60 (0.47)2.49 (0.36)0.688ol - stleveldoml2.51 (0.50)2.27 (0.49)0.763n - doml2.40 (0.45)2.31 (0.46)0.819tl - cmjheight (m)38.1 (0.7)37.6 (0.6)0.921power (w / kg)45.7 (7.8)47.2 (7.7)0.889ol - cmjheight (m)doml23.6 (4.5)23.9 (4.1)0.897power (w / kg)doml36.2 (8.1)36.0 (7.8)0.822height (m)n - doml20.2 (5.2)21.1 (4.9)0.778power (w / kg)n - doml32.8 (7.8)33.5 (8.5)0.814tl - pyindex2.0 (0.4)1.9 (0.5)0.838ol - stime (s)doml6.3 (0.8)6.1 (0.7)0.792n - doml6.4 (0.9)6.3 (0.9)0.825tl - qtime (s)8.7 (1.3)8.4 (1.0)0.803values are expressed as means (sd) icc values of the functional tests values are expressed as means (sd) for the data analyses, the subjects were categorized into the following 4 different groups according to their age : children (1014 years), youth (1519 years), young adults (2029 years) and adults (3050 years). the establishment of the functional test values allowed for the creation of five normative categories. for each test, normative data were defined according to age group and gender. as an example, table 4 represents the five categories of normative data for the one - leg stability test. for all one - leg tests, all categories were colour - coordinated to facilitate classification as very good (dark green), good (light green), average (yellow), weak (orange) and very weak (red). results for the ol - st revealed a score of 98 % in male children, indicating a better performance (less time) for the non - dominant leg. in the female young adult and male adult groups, no differences could be found between the dominant and non - dominant legs (lsi 100 %). only female adults showed better performance in the dominant leg compared with the non - dominant leg, with an lsi of 107 %. similar results, with small performance differences between the two legs, were reported for the ol - st, where the lsi ranged from 101 to 104 %. in contrast, high values of the lsi were found for the ol - cmj, indicating a better performance of the dominant leg (better jump height). female children (118 %) and male adults (124 %), specifically, exhibited large side - to - side differences.table 4examples of normative values for the one - leg stability test for the five categoriesnormdatanormdatafemale ; non - dominant legfemale ; dominant leglevel (index)descriptionlevel (index)description1.74very good1.76very good1.752.05good1.772.00good2.062.90average2.012.72average3.003.30weak2.732.96weak3.31very weak2.97very weaknormdatanormdatamale ; non - dominant legfemale ; dominant leglevel (index)descriptionlevel (index)description1.98very good2.00very good1.992.31good2.012.30good2.323.09average2.313.19average3.303.62weak3.203.49weak3.63very weak3.50very weakfig. 1limb symmetry index of all one - leg tests examples of normative values for the one - leg stability test for the five categories limb symmetry index of all one - leg tests table 5 shows the specificity of the three one - leg tests. the one - leg countermovement jump had the lowest specificity in all age groups, ranging from 40 % (male adults) to 63 % (male children). independent of gender and age, the one - leg stability test showed a mean specificity ranging from 66 % (male adults) to 78 % (male children). the test reached a specificity of greater than 90 % in female and male children, as well as in female and male young adults.table 5specificity results for all one - leg testsage categorygenderspecificity (%) ol - stol - cmjol - sychildrenfemale714193male786395youthfemale685388male675990young adultsfemale765192male744793adultsfemale714586male664087 specificity results for all one - leg tests the most important finding of the present study was the evidence of limb asymmetries of more than 10 % in healthy individuals during hop performance. in one - leg hop testing, the lsi has been suggested as an indicator of normal or abnormal side - to - side differences. the european board of sports rehabilitation recommends hop performance differences of 10 % between the injured and non - injured legs for competitive sports ; however, to date, evidence - based data that can be used to distinguish between normal and abnormal performances are limited. in the present study, one maximum one - leg hop test (ol - cmj) and one endurance hop test (ol - sy) were used to increase the opportunity to detect differences in hop performances between legs. the present study demonstrated an lsi of up to 124 % for the ol - cmj in healthy male adults. there are conflicting results regarding the functional differences between dominant and non - dominant legs. kimura. reported no equivalent muscular output between the right and left legs in vertical jumps. in contrast, a study by abrams. demonstrated an lsi of > 90 % in healthy subjects. the subjects were allowed to use their hands, while subjects in the present study had to keep their hands on their hips. if subjects are restricted from using additional centrifugal mass, the examination of the isolated jump power is dominant, which may explain the higher side - to - side differences. to further investigate the lsi for the one - leg tests, we calculated its specificity, which indicated the probability that the one - leg tests would reveal a normal lsi for healthy subjects. specificities for the ol - cmj ranged from 41 to 63 % and were lower than those derived from the one - leg stability test (6678 %) and the one - leg speedy test (8695 %). these findings are similar to those in the study of barber., where the specificity ranged from 48 to 90 %, and many of the healthy subjects performed the vertical jump outside of the normal lsi. according to the literature, jump performance seems to be an important outcome factor for a safe return to sport following injury.. stated that patients with good hop performances were more likely to return to sport compared with those with poor performances. we also generated normative data for the two - leg plyometric jump to assess the bounce quality and intermuscular coordination of both legs. the plyometric jump demands a consecutive output of instantaneous force production, which is often required in sports. a new test, this test required knee joint stability in multiple planes and directions. in addition, a dynamic balance ability and coordination of the whole body is required to maintain balance. interestingly, when the hop test demanded an increased endurance and more complex task, the difference in the lsi between the dominant and non - dominant legs decreased to 101104 %. in addition, the specificity of this test showed more acceptable values, between 86 and 95 %, and was higher than that of the other one - leg tests. the importance of quick movements in a fatigued state has been emphasized in relation to the prevention of acl injuries. therefore, we administered the quick feet test as the last test in the battery. in addition to speed, the test also requires a high degree of concentration to avoid mistakes. furthermore, neuromuscular control and good coordination have also been documented to decrease the likelihood of knee injuries. despite the importance of coordination and balance in knee injury prevention, the results of one - leg stability tests have not yet been correlated with return to sport. the stability test on the mft challenge disc requires balance and coordination in both two- and one - legged performance. the comparison between the dominant and non - dominant legs revealed an lsi of 98 %, indicating a poor performance in the assumed dominant leg. the selection of the dominant leg in this study was based on the subjective dominance of fundamental movements. however, the definition of the dominant leg is not clear. according to kimura and asaeda as well as miyaguchi and demura, the ball kicking movement showed marked right - leg dominance. in the present study, the right leg was declared as the dominant leg for most of the participants. however, with regard to return to sport, it needs to be considered that both legs are used equally in some sports (e.g. running, alpine skiing, swimming) and that other sports require a specific leg (e.g. jumping events in track and field, ball games). in practice, functional movement tests within a test battery were utilized as an outcome measure or a measurement of function. myer. tested functional deficits in athletes following acl rupture compared with a healthy control group. the low number of participants in the acl group (18) may limit the results. stated that none of the clinicians utilized functional performance tests as a measure of readiness to return to sport. the present study collected information from more than 400 healthy subjects that allows for the creation of normative data. these data serve as a basis for the classification of the potential of the knee during the rehabilitation process and, therefore, evidence for use in decision - making regarding an unrestricted return to activity. to represent age- and population - based acl injuries, we tested active subjects to generate normative data because most acl ruptures appear in athletic individuals who want to become active again. the present test battery can now be used in the day - by - day clinical work to draw conclusions regarding its ability to assist in decision - making regarding returning to sport. based on the normative data, the test results of an acl - reconstructed patient within the rehabilitation period can now be objectively evaluated. only an at least functionally good outcome in each subtest should be reached to minimize the risk of a re - ruptures of the acl. however, there is often a large discrepancy between clinical outcomes and the rate of successful return to high - level sport. therefore, more demanding criteria and functional tests need to be established to determine sport - specific return - to - sport outcomes in high - level competitive athletes. overall, it must be considered that the test battery facilitates the attainment of information regarding the actual functional status of the knee ; however, in addition to physical parameters, the psychological status of an athlete who experienced an acl injury is of great importance for guaranteeing a successful return to sport. thus, in addition to the functional test battery, psychological outcome measures must be added to ensure that participants in sports are physically and psychologically capable of returning to sport. the present study features normative data from seven functional performance tests and, thus, aids in the return - to - sport timeline by identifying functional deficits of the knee in clinical work. at this point, it needs to be considered that limb asymmetries of more than 10 % were evident in healthy subjects within the one - leg hop testing. this aspect will be discussed in the second part of the study, where the clinical utility of the test battery will be explained. it can be concluded that all tests are simple to administer, and the application of quick on - field tests that do not require sophisticated and expensive devices simplifies testing during the rehabilitation period.	purposereturn to activity remains the most common concern following an injury. to facilitate the decision regarding a patient s return to sport, we developed a standardized and easy - to - use test battery to enable an objective evaluation of knee function.methodsthe test battery consisted of seven functional tests : the two - leg stability test, one - leg stability test (ol - st), two - leg countermovement jump (cmj), one - leg cmj (ol - cmj), plyometric jumps, speedy test and quick feet test. for each test, the reliability was determined based on the intraclass correlation coefficient. for all one - leg tests, the limb symmetry index (lsi) was calculated. resultsall tests showed a moderate - to - high reliability. normative data from 434 participants were included in the analysis. the subjects were categorized according to age as follows : children (1014 years), youth (1519 years), young adults (2029 years) and adults (3050 years). the establishment of the functional test values allowed the classification into five normative categories. the lsi for the ol - st (98 %) indicated a better performance of the non - dominant leg. in contrast, high lsi values were found for the ol - cmj (124 %), indicating a better performance of the dominant leg.conclusioneach test was found to be reliable and simple to perform. the better performance of the non - dominant leg in stability tasks must be considered when interpreting side - to - side differences. the established norm data from healthy individuals of each test battery represents an important basis for a clinical setting. test results from an acl - reconstructed patient should be at least classified as a functionally average outcome to support a safe return to sports.level of evidenceiv.
mu - opioid receptor (mor) agonists, such as morphine, are the gold standard in the treatment of moderate to severe pain, however, their therapeutic use is often limited due to serious side effects including tolerance, dependence, respiratory depression, and constipation. numerous studies have shown promise for ameliorating mor - related side effects through simultaneous action at -opioid receptors (dor). dor agonists have been shown to reduce the development of mor agonist tolerance and dependence, presumably due to the ability of dor agonists to potentiate mor mediated analgesia. dor agonists have also been shown to block -opioid receptor (kor) mediated antinociception which has possible implications in reversing kor related addictive behaviors. strong evidence has also accumulated for the potential of dor antagonists as agents to mitigate mor - mediated side effects. recently, there have been multiple reports on the utility and application of mixed - efficacy compounds that simultaneously produce mor activation while acting as dor antagonists. while the mechanism remains unclear, this profile has been shown to elicit the desired analgesia of a mor agonist but with reduced risk of tolerance and dependence in a number of preclinical models of analgesia. we have previously described a series of peptidomimetics in which key opioid pharmacophore elements were transferred from a peptide scaffold to a tetrahydroquinoline (thq) core, a smaller, more drug - like scaffold. expanding upon this initial report, we modified the thq core in an effort to increase metabolic stability in two ways : through n - acetylation of the thq nitrogen and through replacement the thq core with a tetrahydronaphthalene (thn) core. through these modifications, we found that n - acetylation of the thq core of the mixed - efficacy mor agonist / dor antagonist peptidomimetics improves dor affinity, which results in an overall better balance of affinities at mor and dor and provides selectivity over the -opioid receptor (kor). although the optimal balance of mor affinity and dor affinity is unknown, we reasoned that similar high affinity profiles at both mor and dor was a reasonable goal, as this would ensure that both mor and dor character would be similarly represented. in the same report, we proposed that an additional polar contact between the carbonyl of the n - acetyl moiety and tyr of dor in transmembrane 3 (tm3) helix is responsible for this increase in dor affinity. analogues in the present structure activity relationship (sar) campaign were therefore designed (1) to include a carbonyl moiety in order to maintain the high dor affinity seen in the initial analogue series and (2) to incorporate various aliphatic, cyclic, aromatic, and heteroatom - containing functionalities (figure 1) to probe the effect of such modifications on the binding affinity and efficacy profiles not only at dor but also at mor and kor. peptidomimetic scaffold and n - substitutions ; previously published in ref (8), previously published in ref (9). analogues 4a and 4b have been previously reported and are included here to serve as standards of comparison for the additional benzyl pendant n - substituted series. the majority of the remaining peptidomimetics (4c4j) reported herein were prepared in four steps starting from the dihydroquinolinone 1, which was prepared as previously reported (scheme 1). compound 1 was subjected to acylation using either an acid anhydride or acyl chloride to form intermediates 2c32j. it should be noted that the low yield for the synthesis of 2d was due to the use of pyridine, which was originally included to help catalyze the reaction. however, we found that running the reactions in neat anhydride at temperatures between 90 and 120 c led to better product conversion, and for the remainder of syntheses, we excluded pyridine in this reaction step. next, intermediates 2c2j were treated with (r)-t - butanesulfinamide and ti(oet)4 to yield imines in situ, which were reduced with nabh4 to form the desired r - stereochemistry of intermediates 3c3j. the ellman auxiliary was cleaved using concentrated hydrochloric acid, forming hydrochloride salts, which were then coupled to di - boc protected 2,6-dimethyl - l - tyrosine (di - boc - dmt) and subsequently deprotected using trifluoroacetic acid (tfa) to yield analogues 4c4j. as we have previously shown, the ellman chemistry employed here produces the desired (r)-stereocenter with high enantiomeric excess, as evidenced in the current syntheses by the absence of nmr - detectable disateromer after coupling to diboc - dmt. (a) neat acid anhydride (excess), 100 c, 24 h (for compunds 2c, 2d) ; (b) acid chloride (eq), dcm, (for 2e j) ; (c) (r)-t - butanesulfinamide (23 equiv), thf, ti(oet)4 (46 equiv), 0 c, then reflux at 75 c ; (d) nabh4 (6 equiv), thf, 50 c to rt, then meoh, rt ; (e) hcl (6 equiv), dioxane, rt ; (f) diboc - dmt (1.05 equiv), pybop (1 equiv), 6cl - hobt (1 equiv), dipea (10 equiv), dmf, rt ; (g) 1:1 tfa : dcm (excess). note : not all crude final product was purified ; as such a yield was not calculated. the synthesis of the remaining analogues 4k4 m began by protecting the nitrogen in 1 with a tert - butyloxycarbonyl (boc) group forming 5 (scheme 2), as previously described. intermediate 5 was treated with (r)-t - butanesulfinamide and ti(oet)4 to yield an imine in situ, which was reduced with nabh4 to give the desired r - stereochemistry of intermediate 6. to ensure both the cleavage of the ellman auxiliary and the removal of the boc group, 6 was treated first with tfa then with conc hcl in dioxane to ultimately yield the hydrochloride salt 7. intermediate 7 was coupled to diboc - dmt, forming 8. from this intermediate, 8, the syntheses of 4k, 4l, and 4 m diverged. the synthesis of 4k was completed by first performing a finkelstein reaction on 2-chloroacetamide to form 2-iodoacetamide, which was cannulated into a solution containing 8 and n, n - diisopropylethylamine (dipea) to give 9k. intermediate 9k was treated with tfa to remove the boc groups, yielding 4k. to complete the syntheses of 4l and 4 m, ethyl 2-bromoacetate was added to intermediate 8 in the presence of potassium carbonate (k2co3) to give 9l. intermediate 9l was then treated with tfa to remove boc groups and afford compound 4l. compound 4 m was completed by first saponification of the ester of 9l with lithium hydroxide, which was subsequently treated with tfa to remove the boc groups and yield compound 4 m. (a) boc2o (1.22 equiv), dmap (0.1 equiv), dipea (1.22 equiv), dcm, 60 c ; (b) (r)-t - butanesulfinamide (23 equiv), thf, ti(oet)4 (46 equiv), 0 c, then reflux at 75 c ; (c)nabh4 (6 equiv), thf, 50 c to rt, then meoh, rt ; (d) 1:1 tfa : dcm (excess) ; (e) hcl (6 equiv), dioxane, rt ; (f) diboc - dmt (1.05 equiv), pybop (1 equiv), 6cl - hobt (1 equiv), dipea (10 equiv), dmf, rt ; (g) nal (2 equiv), 2-chloroacetamide (2 equiv), then dipea (1.5 equiv) ; (h) ethyl 2-bromoacetate (10 equiv), k2co3 (2 equiv), ch3cn, 24 h ; (i) lioh (excess), etoh, 60 c, 2.5 h ; (j) 3 n hcl (excess), rt. therefore, only 1.6 mg of 95% pure product was isolated, which was sufficient for opioid receptor binding and efficacy assays. analogues 15a and 15b have been previously reported and are included here to serve as standards of comparison for the additional 2-methylnaphthyl pendant n - substituted series. synthesis of the n - acylated peptidomimetics containing the 2-methylnaphthyl pendant began by forming intermediate 10, which was synthesized as previously described. intermediate 10 was subjected to suzuki cross - coupling to incorporate the 2-methylnaphthyl moiety and yield 11. intermediate 11 was treated with tfa to remove the boc group, forming 12. intermediate 12 was treated with propionic anhydride to yield 13c, butyric anhydride to yield 13d, or methylchloroformate to yield 13e. intermediates 13c13e were treated with (r)-t - butanesulfinamide and ti(oet)4 to form a chiral imine in situ, which was reduced with nabh4 to form the desired r - stereochemistry for intermediate 14c14e. the ellman auxiliary was cleaved using concentrated hcl forming primary amines, which were then coupled to diboc - dmt and deprotected to yield compound 15c15e (scheme 3). (f) 2-naphthalenylboronic acid, pd(dppf)cl2, k2co3, 3:1 acetone : h2o ; (g) 1:1 tfa : dcm ; (h) neat acid anhydride, reflux, 24 h (for 15c and 15d) ; (i) mecoocl, dcm, rt, 16 h (for 15e) ; (j) (r)-t - butanesulfinamide, thf, ti(oet)4, 0 c, then reflux at 75 c ; (k) nabh4, thf, 50 c to rt, 3 h, then meoh, rt ; (l) hcl, dioxane, rt, 3 h ; (m) diboc - dmt, pybop, 6cl - hobt, dipea, dmf, rt. not all of the crude compound was purified, so yield was not calculated or appears low. analogues 4c4 m and 15c15e were evaluated in in vitro mor, dor, and kor binding and efficacy assays, as previously described (tables 1 and 2). binding affinities (ki (nm)) were obtained by competitive displacement of radiolabeled [h]diprenorphine in membrane preparations from c6 cells stably expressing mor (c6-mor) or dor (c6-dor) or cho cells stably expressing kor (cho - kor), as previously described (table 1). efficacy data were obtained using agonist - induced stimulation of [s]gtps binding to g protein in the same cell preparations as previously mentioned. efficacy data are represented as percent maximal stimulation relative to standard agonist (damgo at mor, dpdpe at dor, and u69593 at kor), and potency (ec50 (nm)) values are calculated as the concentration of drug required to produce half - maximal stimulation (table 1). briefly, all analogues in both the benzyl and 2-methylnaphthyl series maintained high affinity binding and efficacy at mor. additionally, as predicted, all analogues across both series maintained high binding affinity at dor, relative to the unsubstituted analogues 4a and 15a, excluding 4 m, which displayed reduced affinity across all three receptors. interestingly, most of the n - substituted analogues in the benzyl pendant series produced increased dor efficacy (table 1), creating varying degrees of mor agonist / dor agonist ligands in the in vitro assays, while all analogues in the n - substituted 2-methylnaphthyl series displayed minimal or no efficacy at dor, maintaining the mor agonist / dor antagonist profile (table 2). lastly, while all analogues maintained selectivity for mor and dor over kor, kor affinity for many of the n - substituted analogues in the benzyl series increased relative to 4a (table 1). binding affinities (ki (nm)) were obtained by competitive displacement of radiolabeled [h]diprenorphine in membrane preparations. efficacy is represented as percent maximal stimulation relative to standard agonist damgo (mor), dpdpe (dor), or u69,593 (kor) at 10 m. potency (ec50 (nm)) is calculated from the percent maximal stimulation as the concentration of drug required to produce half the maximal stimulation all values are expressed as the mean with sem in parentheses for n = 3 independent assays in duplicate, unless otherwise noted. dns : does not stimulate. published in ref (8). published in ref (9). binding affinities (ki (nm)) were obtained by competitive displacement of radiolabeled [h]diprenorphine in membrane preparations. efficacy is represented as percent maximal stimulation relative to standard agonist damgo (mor), dpdpe (dor), or u69,593 (kor) at 10 m. potency (ec50 (nm)) is calculated from the percent maximal stimulation as the concentration of drug required to produce half the maximal stimulation all values are expressed as the mean with sem in parentheses for n = 3 independent assays in duplicate, unless otherwise noted. dns : does not stimulate. published in ref (8). published in ref (9). although the benzyl pendant n - substituted series displayed varying degrees of stimulation at dor, all analogues still exhibited both high affinity and efficacy at mor ; consequently, we elected to test select analogues (4e4k) for in vivo efficacy in the wwtw assay using a cumulative dosing procedure. additionally, because all new compounds in the 2-methylnaphthyl pendant series displayed the desired mor agonist / dor antagonist profile, compounds 15c15e were also tested for in vivo efficacy in the same assay. briefly, withdrawal latencies were determined by placing a mouse into a cylindrical plastic restrainer and immersing 23 cm of the tail tip into a water bath maintained at 50 c. the latency to withdrawal or to rapidly flick the tail back and forth was recorded with a maximum cutoff time of 20 s to prevent tissue damage. acute antinociceptive effects were determined using a cumulative dosing procedure, as previously described. each animal received an intraperitoneal (ip) injection of saline, and then 30 min later, the baseline withdrawal latencies were recorded. following baseline determinations, three increasing doses (1, 2.2, and 6.8 mg / kg) of a peptidomimetic (dissolved in either deionized water or 1:1:8 solution of ethanol : alkumuls : deionized water, as was the case for 15c15e) were given ip at 30 min intervals to provide final doses of 1, 3.2, and 10 mg / kg. thirty minutes after each injection, the tail withdrawal latency was measured as described above. to determine the duration of antinociceptive action, the tail - withdrawal test was performed at varying times following administration of a peptidomimetic (10 mg / kg, ip). of all compounds tested in vivo, only two of the novel n - substituted analogues tested displayed in vivo efficacy after ip administration (figure 2a). analogue 4f produced partial antinociception with an 11 s latency to tail flick at the 10 mg / kg dosage following ip administration, while 4h produced full antinociception, reaching the 20 s latency to tail flick cutoff time point at the same dosage. because 4h displayed full antinociception, we performed a time course assay to determine the duration of antinociceptive action. as can be seen in figure 2b, 4h has a similar duration of action to that of 4a, producing maximal antinociception for approximately 1 h following a 10 mg / kg ip dose. (a) cumulative antinociceptive dose response curves of select benzyl pendant analogues (n = 3 for all analogues) in the mouse wwtw assay following ip administration. plotted as average sem., p < 0.0001 for 4a and 4h for the 10 mg / kg dose when compared to baseline, p (b) time course of antinociception of 4a and 4h (n = 3) in the mouse wwtw assay following ip administration of 10 mg / kg. plotted as average sem. all new analogues across both series sets, excluding 4 m, maintained high binding affinity at mor and exhibited an increased dor binding affinity when compared to the unsubstituted parent compounds 4a and 15a, presumably due to the carbonyl moiety incorporated into each of the n - substitutions, as had been previously observed for 15b. the only exception to this trend, 4 m, contains a carboxylic acid moiety and displayed significantly decreased affinity across all three opioid receptors. the poor binding affinity of 4 m could be potentially due to electrostatic repulsion between its carboxylic acid moiety and a conserved negatively charged residue in tm5 (asp in dor, asp in kor, and glu in mor), which may also be complemented by acidic glu in kor. on the basis of these initial in vitro results and previously reported computational modeling, it appears that a carbonyl - containing moiety is beneficial in maintaining higher binding affinity at dor while a negatively charged species is not well tolerated. an additional trend seen in the benzyl series is that increasing the n - acyl chain length or overall bulk increases dor stimulation, with the exception of 4j, which contains a benzoyl moiety and produces no stimulation at dor. as seen in table 1, the unsubstituted compound 4a shows very weak stimulation at dor (16% maximal stimulation) while the n - acetyl analogue 4b increased maximal stimulation at dor to 26% and the n - propionyl (4c) and n - butyryl (4d) analogues further increased dor stimulation to between 40 and 60%. analogues 4e4 g contain branched or cyclic n - substitutions, and in the case of 4f (containing a cyclopropanecarbonyl moiety) and 4 g (containing a cyclobutanecarbonyl moiety), dor stimulation increased to 69% and 58%, respectively. the computational model of 4 g in the active conformation of dor (figure 3a) demonstrates the presence of a hydrophobic cavity in the ligand binding pocket formed by residues from extracellular loop 2 (leu and phe) and tm5 (thr and val), which is preserved in mor and kor. it can be seen that the cyclobutanecarbonyl moiety extends into this cavity forming favorable hydrophobic interactions. these interactions may contribute to the improved binding affinity of compounds 4c4f toward the active receptor conformation and to their increased efficacy at dor. as also seen in figure 3a, compound 4j has a benzoyl moiety which appears to be too bulky to fit this cavity in the active receptor conformation although it can be easily accommodated in the slightly enlarged ligand pocket of the inactive receptor state. (a) structure of 4 g (teal) and 4j (magenta) bound in the active conformation of dor with the area of the binding pocket occupied by the acyl chain circled (black). (b) structure of 4k (green) bound in the active conformation of kor with a potential polar contact between e and the terminal amide of the ligand which could be responsible for the increased kor affinity and efficacy. similarly, hydrophobic interactions with the nonpolar cavity may also contribute to the improved binding affinity toward kor of compounds 4c, 4f, 4 g, and 4j with long or bulky nonpolar n - substitutions (ki values ranging from 8 to 56 nm, as compared to ki = 68 nm of 4a), which act as partial agonists. however, this can not explain the observed activity of 4k, which has a polar amide group as an n - substitution. compound 4k not only displays increased affinity at kor (4.3 vs 68 nm for 4a) but also exhibits significant kor stimulation (49%). the docking of 4k into the model of the active conformation of kor (figure 3b) suggests that formation of a hydrogen bond between n - substituted amide of 4k and glu from tm6 of kor may be the reason for the improved binding and agonist properties of this compound. while analogues 4c and 4e g all represent a subset of analogues with a mor agonist / dor agonist in vitro profile, 4 g displayed balanced binding affinities (ki = 0.23 nm at mor and 0.15 nm at dor), low nanomolar potency (ec50 = 2.1 nm at mor and 5.1 nm at dor), and high efficacy at both mor and dor (94% and 58%, respectively), along with weak binding and no efficacy at kor. while this profile was not our initial focus, several reports have shown that coadministration of a dor agonist with a mor agonist can increase both the potency and efficacy of the mor agonist. these findings suggest ligands producing a mixed - efficacy mor agonist / dor agonist profile could allow for the effective management of pain with a decrease in side effects seen with the administration of only a mor agonist. indeed, this has been observed with mmp-2200, a mor agonist / dor agonist peptide ligand that produces in vivo activity in mice with reduced side effects. additionally, we have previously shown that 15b, with a 2-methylnaphthyl pendant and an acetyl n - substitution produces in vivo antinociception for greater than 3 h in the wwtw assay. thus, we hypothesized that compounds containing a 2-methylnaphthyl pendant with carbonyl - containing n - substitutions could produce similar, or longer lasting, in vivo activity when compared to 15b. we synthesized a modest set of 2-methylnaphthyl analogues and found that as the acyl chain length increases, the balanced - affinity mor agonist / dor antagonist profile seen with 15b remains essentially constant, while kor affinity slightly decreases, indicating that increased chain length helps provide mor and dor selectivity over kor (table 2). the high affinity binding and lack of stimulation at dor corroborates our previous findings that additional hydrophobic bulk in the pendant region of our peptidomimetic series increases affinity to dor in the inactive conformation while being incompatible with the smaller dor active state binding site. this trend suggests that the differences in dor efficacy between most of the compounds in the benzyl series (1670%) and the 2-methylnaphthyl series (015%) is due to differences in bulk between these two pendant moieties. while the in vitro profile of the 2-methylnaphthyl analogues is very promising in that all analogues are high affinity, potent mor agonists and high affinity dor antagonists, none of the novel analogues in this series (15c15e) produced antinociception in the wwtw assay. finally, as we have seen with other peptidomimetic series, in vivo activity is not predictable from in vitro profiles and physiochemical parameters. this fact remains true for this series of n - substituted analogues where 4h is the only analogue to emerge that produces full antinociception in the wwtw assay at a 10 mg / kg dose. 4h is a mixed - efficacy peptidomimetic with nearly balanced affinities at mor and dor (ki = 0.19 and 0.51 nm, respectively) and produces potent (ec50 = 0.78), full stimulation at mor (95%), and moderately potent (ec50 = 14 nm) stimulation at dor (40%) and selectivity for mor and dor over kor. further, 4h produces in vivo activity for 1 h, a similar duration of action to 4a. planned pharmacokinetic and metabolic stability testing of key members of our series are expected to shed light on the as yet unexplained differences in in vivo activity. in conclusion, we have expanded our opioid peptidomimetic library by incorporating various n - substitutions on our previously published, unsubstituted peptidomimetics 4a and 15a after observing that n - acetylation of the thq nitrogen in 4a and 15a to give 4b and 15b increases dor affinity. all of the n - substitutions in the present study contain a carbonyl moiety, which appears to be beneficial in maintaining high dor affinity, an important factor in the development of bifunctional mor / dor ligands. through this synthetic campaign, we have also discovered that an increased acyl chain length or additional bulk increases dor stimulation within the benzyl pendant series while increasing acyl chain length on the 2-methylnaphthyl series did not increase dor stimulation, suggesting that pendant moieties play an important role in anchoring the ligand to dor in the inactive conformation. analogue 4h, which displays high efficacy at mor and moderate efficacy at dor and produces full in vivo antinociception in the wwtw assay at a 10 mg / kg dose, may serve as a lead in the development of bifunctional mor / dor agonists. all reagents and solvents were obtained from commercial sources and used without additional purification. suzuki couplings were performed on a discover s - class (cem) microwave in a closed vessel with maximum power input of 300 w and temperature set at 110 c for 1060 min under the standard method from their synergy software. flash column chromatography was carried out using p60 silica gel (230400 mesh) either manually or with a biotage isolera instrument. before flash column chromatograph was performed, crude mixtures were analyzed using thin - layer chromatography using 2:3 ea : hex, 1:1 ea : hex, and/or 3:2 ea : hex. the rf values of products and impurities were calculated then copied into either the linear gradient or stepwise gradient wizard on the biotage isolera instrument. the tlc wizard then determined the optimal purification technique which was used to purify crude mixtures. purification of final compounds was performed using a waters semipreparative hplc with a vydac protein and peptide c18 reverse phase column, using a linear gradient of 0% solvent b (0.1% tfa in acetonitrile) in solvent a (0.1% tfa in water) to 100% solvent b in solvent a at a rate 1% per minute and monitoring uv absorbance at 230 nm. purity of synthesized compounds was determined on a waters alliance 2690 analytical hplc instrument and a vydac protein and peptide c18 reverse phase column, using a linear gradient of 0% solvent b in solvent a to 45%, 70%, or 90% solvent b in solvent a in 45, 70, or 90 min, respectively, and uv absorbance at 230 nm (gradient a). purities of the final compounds used for testing were 95%, unless otherwise stated, as determined by hplc. h nmr and c nmr data were obtained on either a 400 or 500 mhz varian spectrometer using cdcl3 or cd3od solvents. the identity of each compound was verified by mass spectrometry using an agilent 6130 lc ms mass spectrometer in positive mode. to a flame - dried round - bottom flask under ar the reaction vessel was placed back under vacuum for 5 min then excess acid anhydride (propionic or butyric) was added via syringe and the solution stirred for 5 min. the round - bottom flask was flooded with ar, equipped with a condenser, and placed in oil bath at 90120 c. the reaction stirred at reflux for 1220 h under ar and was monitored by tlc. once the reaction was complete, the solvent was removed under reduced pressure, yielding a crude yellow oil which was purified using silica gel chromatograph to obtain the pure product. to a flame - dried round - bottom flask with stir bar under to a round - bottom flask already containing dried, desiccated n - substituted dihydroquinolinone intermediate (1.0 equiv) was added (r)-2-methylpropane-2-sulfinamide (3.0 equiv), then the round - bottom flask was placed under vacuum for 10 min. meanwhile, a reflux condenser was flame - dried under vacuum and then flooded with ar. next, anhyd thf (20 ml) was added to the reaction vessel containing starting reagents via syringe. the reaction solution allowed to stir under vacuum for 5 min and then was flooded with ar. the round - bottom flask was placed in ice bath and allowed to equilibrate. once addition was complete, the reaction vessel was taken out of the ice bath and placed in an oil bath at 7075 c, equipped with condenser, and stirred for 1648 h under ar. once sufficient conversion to the tert - butanesulfinyl imine was observed, the reaction vessel was taken out of the oil bath and cooled to ambient temperature. meanwhile, an additional round - bottom flask containing a stir bar was flame - dried under vacuum, then flooded with ar, then nabh4 was added quickly, and then reaction vessel was placed back under vacuum for 5 min. minimal anhyd thf was added (5 ml), and the vessel allowed to stir under vacuum for 5 min, then was flooded with ar. the round - bottom flask was placed in dry ice / xylenes bath and allowed to equilibrate. contents from the round - bottom flask containing the imine intermediate were transferred to round - bottom flask containing nabh4 via cannula. once contents completely added, the reaction was taken out of dry ice / xylenes bath and allowed to warm to room temperature. the reaction stirred at ambient temperature for 23 h. once the reaction was complete, meoh was added to quench. the residue was resuspended in dcm, solid remained, and the remaining solid was removed by filtration through a cotton plug and the mother liquor was concentrated and purified using silica gel chromatography to yield pure sulfinamide. to a round - bottom flask already containing sulfinamide intermediate was added 1520 ml of dioxane followed by conc hcl (6.0 equiv). the reaction stirred at rt for up to 3 h. solvent was removed under reduced pressure to yield slightly yellow, clear residue. if a white solid precipitated (the hcl salt of the amine) : solid was removed via filtration as product without any further purification necessary. if a white solid did not precipitate, but residue remains as film on flask : residue washed with fresh et2o (3 5 ml) and dried without any further purification necessary. the (r)-amine intermediate (1.0 equiv) and diboc - dmt (1.01.05 equiv) and the coupling reagents pybop (1.0 equiv) or hatu (1.0 equiv), hobt - cl (1.0 equiv), were dissolved in dmf (1015 ml) followed by the addition of the and dipea (10.0 equiv). after concentration under reduced pressure, the crude residue was dissolved in a 1:1 mixture of dcm and tfa (10 ml) and stirred for 1 h. the mixture was concentrated and purified by semipreparative hplc, then lyophilized to yield the final compound. 2c was synthesized according to a modified general procedure a using 1 (110 mg, 0.47 mmol, 1.0 equiv) and excess propionic anhydride. after reaction was complete, reaction mixture was cooled to rt, then transferred to a separatory funnel, and ea and nahco3 were added and the layers separated. the aqueous layer was extracted with ea, and the combined organic layers washed with brine then dried over mgso4 and purified using silica gel chromatography to yield the title compound 2c as a clear, colorless oil (120 mg, 85%). h nmr (500 mhz, cdcl3) 7.86 (d, j = 0.9, 1h), 7.39 (br s, 1h), 7.35 (dd, j = 8.2, 2.2, 1h), 7.29 (t, j = 7.4, 2h), 7.237.16 (m, 3h), 4.20 (t, j = 6.2, 2h), 3.98 (s, 2h), 2.75 (t, j = 6.2, 2h), 2.58 (q, j = 7.4, 2h), 1.20 (t, j = 7.4, 3h). c nmr (126 mhz, cdcl3) 194.27, 173.03, 142.21, 140.13, 138.78, 134.63, 128.90, 128.71, 127.62, 126.49, 126.11, 124.44, 43.88, 41.29, 39.62, 27.98, 9.91. 2d was synthesized according to a modified general procedure a using 1 (0.18 g, 0.78 mmol, 1.0 equiv) and excess butyric anhydride (5 ml) and pyridine (4 ml). after reaction was complete (24 h), the reaction was quenched with h2o. dcm was added, and the aqueous layer was extracted with dcm. combined organic extracts were washed with 2 m naoh and dried with mgso4. solvents were filtered and removed under reduced pressure, and the crude residue was purified via silica gel chromatography to yield the title compound 2d as an oil (0.029 g, 12%). h nmr (400 mhz, cdcl3) 7.87 (t, j = 1.3, 1h), 7.397.34 (m, 2h), 7.337.25 (m, 2h), 7.257.16 (m, 3h), 4.21 (t, j = 6.2, 2h), 3.99 (s, 2h), 2.76 (t, j = 6.2, 2h), 2.54 (t, j = 8.0, 2h), 1.791.66 (m, 2h), 0.95 (t, j = 7.4, 3h). c nmr (101 mhz, cdcl3) 194.37, 172.35, 142.31, 140.18, 138.87, 134.71, 128.99, 128.80, 127.77, 126.58, 126.18, 124.55, 43.97, 41.38, 39.82, 36.57, 19.25, 13.94. 2e was synthesized according to general procedure b starting from 1 (100 mg, 0.42 mmol, 1.0 equiv) to yield the title compound 2e as a clear, colorless oil (105 mg, 80.8%). h nmr (500 mhz, cdcl3) 7.87 (d, j = 2.0 hz, 1h), 7.377.25 (m, 4h), 7.257.17 (m, 3h), 4.21 (t, j = 6.3 hz, 2h), 3.99 (s, 2h), 3.14 (hept, j = 6.7 hz, 1h), 2.75 (t, j = 6.2 hz, 2h), 1.18 (d, j = 6.7 hz, 6h). c nmr (126 mhz, cdcl3) 194.33, 176.97, 142.29, 140.05, 138.84, 134.59, 128.90, 128.87, 128.68, 127.64, 126.46, 126.15, 124.22, 43.90, 41.25, 39.79, 31.13, 19.88. 2f was synthesized following a modified general procedure b starting with 1 (0.15 g, 0.65 mmol, 1.0 equiv) and also using et3n (0.18 ml, 1.29 mmol, 2.0 equiv). the reaction stirred for 3 h, after which time satd nahco3 was added. solvents were filtered and removed under reduced pressure, and crude residue was purified via silica gel chromatography to yield the title compound 2f as a colorless oil (0.15 g, 78%). h nmr (500 mhz, cdcl3) 7.88 (d, j = 2.2, 1h), 7.46 (d, j = 8.3, 1h), 7.35 (dd, j = 8.4, 2.2, 1h), 7.317.26 (m, 2h), 7.227.17 (m, 3h), 4.26 (t, j = 6.3, 2h), 3.98 (s, 2h), 2.76 (t, j = 6.3, 2h), 2.061.96 (m, 1h), 1.211.15 (m, 2h), 0.910.82 (m, 2h). c nmr (126 mhz, cdcl3) 194.41, 173.00, 142.45, 140.13, 138.53, 134.49, 128.89, 128.71, 127.74, 126.49, 125.85, 124.09, 43.53, 41.28, 39.70, 13.74, 9.77. 2 g was synthesized following general procdure b starting with 1 (0.15 g, 0.62 mmol, 1.0 equiv). the reaction stirred for 3 h, after which time satd nahco3 was added. solvents were filtered and removed under reduced pressure, and crude residue was purified via silica gel chromatography to yield the title compound 2 g as a white solid (0.20 g, 99%). h nmr (500 mhz, cdcl3) 7.85 (d, j = 1.3, 1h), 7.487.37 (br s, 1h), 7.35 (dd, j = 8.2, 2.2, 1h), 7.29 (t, j = 7.5, 2h), 7.247.13 (m, 3h), 4.12 (t, j = 6.2, 2h), 3.98 (s, 2h), 3.52 (p, j = 8.4, 1h), 2.72 (t, j = 6.2, 2h), 2.43 (dq, j = 11.8, 9.2, 2h), 2.13 (q, j = 9.9, 2h), 2.021.88 (m, 2h). c nmr (126 mhz, cdcl3) 194.09, 174.02, 142.14, 140.14, 138.52, 134.63, 128.85, 128.64, 127.49, 126.41, 125.75, 123.84, 43.78, 41.24, 39.57, 37.95, 25.72, 17.83. 2h was synthesized following general procedure b starting from the 1 (150 mg, 0.63 mmol, 1.0 equiv) to yield the title compound 2h as a clear, colorless oil (111 mg, 59.4%). h nmr (500 mhz, cdcl3) 7.86 (d, j = 2.1 hz, 1h), 7.71 (d, j = 8.6 hz, 1h), 7.34 (dd, j = 8.6, 2.2 hz, 1h), 7.29 (t, j = 7.5 hz, 2h), 7.237.16 (m, 3h), 4.18 (t, j = 6.3 hz, 2h), 3.97 (s, 2h), 3.84 (s, 3h), 2.76 (t, j = 6.3 hz, 2h). c nmr (126 mhz, cdcl3) 193.79, 154.23, 141.74, 140.24, 137.32, 134.79, 128.74, 128.51, 127.13, 126.25, 124.79, 123.58, 53.30, 44.40, 41.09, 38.81. 2i was synthesized following general procedure b starting from the 1 (150 mg, 0.63 mmol, 1.0 equiv) to yield the title compound 2i as a white solid (176 mg, 89.8%). h nmr (500 mhz, cdcl3) 7.87 (d, j = 2.2 hz, 1h), 7.37 (dd, j = 8.4, 2.2 hz, 1h), 7.28 (t, j = 7.6 hz, 2h), 7.237.15 (m, 3h), 4.26 (s, 2h), 4.17 (t, j = 6.3 hz, 2h), 3.98 (s, 2h), 3.45 (s, 3h), 2.78 (t, j = 6.2 hz, 2h). c nmr (126 mhz, cdcl3) 193.62, 168.07, 141.25, 139.91, 139.02, 134.72, 128.77, 128.58, 128.55, 127.56, 126.37, 125.78, 123.66, 76.74, 71.84, 59.24, 43.95, 41.17, 39.41. 2j was synthesized following general procedure b starting from the 1 (100 mg, 0.42 mmol, 1.0 equiv) to yield the title compound 2j as a clear, slightly yellow oil (139 mg, 96.5%). h nmr (500 mhz, cdcl3) 7.78 (d, j = 2.1 hz, 1h), 7.427.34 (m, 3h), 7.317.25 (m, 2h), 7.227.17 (m, 2h), 7.147.10 (m, 1h), 7.087.04 (m, 2h), 7.01 (dd, j = 8.5, 2.2 hz, 1h), 6.81 (d, j = 8.4 hz, 1h), 4.21 (t, j = 6.3 hz, 2h), 3.85 (s, 2h), 2.77 (t, j = 6.3 hz, 2h). c nmr (126 mhz, cdcl3) 193.73, 170.04, 142.60, 139.99, 138.06, 135.06, 134.31, 130.99, 128.78, 128.58, 128.47, 128.39, 127.38, 126.36, 124.82, 124.63, 45.30, 41.10, 39.50. 3c was synthesized following general procedure c using 2c (120 mg, 0.40 mmol, 1.0 equiv), (r)-2-methylpropane-2-sulfinamide (150 mg, 1.2 mmol, 3.0 equiv), and ti(oet)4 (0.63 ml, 2.4 mmol, 6.0 equiv) to form the (r)-tert - butanesulfinyl imine intermediate in situ. once sufficient ketone was converted into imine intermediate (after 17 h), the reaction mixture was transferred via cannula to a round - bottom flask containing nabh4 (90 mg, 2.4 mmol, 6.0 equiv) and 20 ml of thf in a xylenes dry ice bath ; after addition, the solution was stirred at room temperature for 3 h before being quenched with meoh. once resultant solid was removed, crude residue was purified using silica gel chromatography to yield the title compound 3c as a clear, colorless oil (120 mg, 78%). h nmr (500 mhz, cdcl3) 7.69 (d, j = 8.2 hz, 1h), 7.297.21 (m, 2h), 7.207.15 (qd, j = 6.5, 5.4, 1.6 hz, 4h), 7.06 (dd, j = 8.5, 2.3 hz, 1h), 4.52 (q, j = 3.4 hz, 1h), 3.973.87 (m, 3h), 3.57 (tdd, j = 12.9, 4.2, 1.7 hz, 1h), 3.32 (bs, 1h), 2.202.13 (m, 1h), 1.991.90 (m, 1h), 1.50 (s, 9h), 1.19 (s, 9h). c nmr (126 mhz, cdcl3) 153.43, 140.77, 136.51, 136.42, 128.88, 128.71, 128.55, 128.47, 128.34, 125.97, 123.89, 80.97, 55.52, 50.36, 41.08, 40.00, 29.41, 28.22, 22.48. 3d was synthesized following general procedure c using 2d (0.029 g, 0.094 mmol, 1.0 equiv) to yield the title compound 3d as a colorless oil (0.010 g, 26%). h nmr (400 mhz, cdcl3) 7.337.27 (m, 2h), 7.247.18 (m, 3h), 7.10 (dd, j = 8.3, 2.1, 1h), 4.53 (t, j = 4.6, 1h), 3.95 (s, 2h), 3.943.85 (m, 1h), 3.803.68 (m, 1h), 3.34 (br s, 1h), 2.512.41 (m, 2h), 2.272.15 (m, 1h), 2.081.97 (m, 1h), 1.741.63 (m, 2h), 1.20 (s, 9h), 0.92 (t, j = 7.4, 3h). 3e was synthesized following general procedure c using 2e (105 mg, 0.34 mmol, 1.0 equiv) to yield the title compound 3e as a clear, colorless oil (70 mg, 50%). h nmr (500 mhz, cdcl3) 7.347.26 (m, 3h), 7.247.19 (m, 3h), 7.10 (dd, j = 8.2, 2.2 hz, 1h), 4.53 (q, j = 3.9 hz, 1h), 3.96 (s, 2h), 3.943.89 (m, 1h), 3.753.67 (m, 1h), 3.30 (bs, 1h), 3.12 (p, j = 6.9 hz, 1h), 2.242.15 (m, 1h), 2.081.98 (m, 1h), 1.231.16 (s, 9h), 1.13 (dd, j = 9.0, 6.7 hz, 6h). c nmr (126 mhz, cdcl3) 177.35, 140.53, 138.70, 136.67, 128.92, 128.67, 128.58, 128.54, 126.28, 124.60, 55.76, 51.04, 41.37, 40.00, 31.09, 30.96, 22.55, 20.03, 20.01. 3f was synthesized following general procedure c using 2f (0.16 g, 0.51 mmol, 1.0 equiv) to yield the title compound 3f as a colorless oil (0.12 g, 55%). h nmr (400 mhz, cdcl3) 7.36 (d, j = 8.2, 1h), 7.327.26 (m, 3h), 7.237.18 (m, 3h), 7.09 (dd, j = 8.3, 2.0, 1h), 4.55 (q, j = 4.3, 1h), 4.013.93 (m, 3h), 3.75 (ddd, j = 12.9, 9.3, 5.6, 1h), 3.33 (d, j = 3.6, 1h), 2.23 (dq, j = 14.9, 5.1, 1h), 2.101.89 (m, 3h), 1.20 (s, 9h), 1.141.08 (m, 2h), 0.78 (dd, j = 7.9, 2.5, 2h). c nmr (101 mhz, cdcl3) 173.36, 140.65, 138.53, 136.83, 131.83, 128.98, 128.71, 128.58, 128.51, 126.36, 124.97, 55.85, 51.18, 41.47, 39.85, 30.74, 22.61, 13.65, 9.28. 3 g was synthesized following general procedure c using 2 g (0.20 g, 0.62 mmol, 1.0 equiv) to yield the title compound 3 g as a colorless oil (0.16 g, 60%). h nmr (500 mhz, cdcl3) 7.317.25 (m, 2h), 7.237.17 (m, 2h), 7.09 (dd, j = 8.3, 2.1, 1h), 4.51 (q, j = 4.3, 1h), 3.95 (s, 2h), 3.863.77 (m, 1h), 3.743.63 (m, 1h), 3.503.39(m, 2h), 2.442.30 (m 2h), 2.19 (dq, j = 14.3, 4.9, 1h), 2.121.97 (m, 3h), 1.971.82 (m, 2h), 1.21 (s, 9h). c nmr (126 mhz, cdcl3) 174.44, 140.63, 138.39, 136.58, 128.89, 128.73, 128.56, 128.50, 126.23, 124.20, 55.77, 50.96, 41.37, 39.90, 38.22, 30.72, 25.80, 22.60, 17.84. 3h was synthesized following general procedure c using 2h (111 mg, 0.376 mmol, 1.0 equiv) to yield the title compound 3h as a clear, colorless oil (124 mg, 82.1%). h nmr (500 mhz, cdcl3) 7.73 (d, j = 8.7 hz, 1h), 7.27 (t, j = 7.8 hz, 2h), 7.237.16 (m, 4h), 7.117.06 (m, 1h), 4.54 (q, j = 3.6 hz, 1h), 4.01 (dt, j = 13.0, 4.6 hz, 1h), 3.93 (s, 2h), 3.78 (d, j = 1.0 hz, 3h), 3.64 (ddd, j = 12.9, 11.1, 3.8 hz, 1h), 3.26 (d, j = 2.7 hz, 1h), 2.242.14 (m, 1h), 2.031.94 (m, 1h), 1.20 (d, j = 1.0 hz, 9h). c nmr (126 mhz, cdcl3) 154.94, 140.75, 137.11, 136.11, 129.11, 128.79, 128.77, 128.57, 128.44, 126.09, 126.08, 123.68, 55.59, 52.94, 50.24, 41.15, 40.23, 29.43, 22.51. 3i was synthesized following general procedure c using 2i (176 mg, 0.60 mmol, 1.0 equiv) to yield the title compound 3i as a clear, colorless oil (148 mg, 62.7%). h nmr (500 mhz, cdcl3) 7.307.24 (m, 3h), 7.18 (d, j = 7.6 hz, 3h), 7.09 (dd, j = 8.3, 2.0 hz, 1h), 4.52 (q, j = 4.3 hz, 1h), 4.17 (s, 2h), 3.93 (s, 2h), 3.79 (d, j = 40.2 hz, 11h), 3.44 (d, j = 3.6 hz, 1h), 3.39 (s, 3h), 2.20 (dq, j = 14.5, 4.9 hz, 1h), 2.04 (qd, j = 9.2, 8.7, 5.0 hz, 1h), 1.20 (s, 35h), 1.17 (s, 10h). c nmr (126 mhz, cdcl3) 168.45, 140.40, 135.69, 128.97, 128.82, 128.68, 128.50, 128.46, 128.21, 126.20, 126.14, 123.95, 71.69, 59.16, 55.72, 55.22, 50.80, 41.38, 41.29, 39.90, 30.47, 29.60, 22.52, 22.21, 22.07. 3j was synthesized following general procedure c using 2j (139 mg, 0.41 mmol, 1.0 equiv) to yield the title compound 3j as an off - white solid (127 mg, 69.8%). h nmr (500 mhz, cdcl3) 7.31 (td, j = 8.0, 1.4 hz, 3h), 7.277.15 (m, 5h), 7.147.09 (m, 1h), 7.097.04 (m, 2h), 6.78 (t, j = 9.0 hz, 2h), 4.54 (q, j = 3.9 hz, 1h), 3.93 (dt, j = 12.5, 5.1 hz, 1h), 3.82 (s, 2h), 3.783.68 (m, 1h), 3.32 (d, j = 3.1 hz, 1h), 2.20 (dq, j = 14.0, 4.7 hz, 1h), 2.02 (ddt, j = 14.5, 9.9, 5.0 hz, 1h), 1.13 (d, j = 1.5 hz, 11h). c nmr (126 mhz, cdcl3) 170.22, 140.50, 138.06, 136.69, 135.96, 130.33, 129.87, 128.79, 128.68, 128.46, 128.34, 128.32, 128.23, 126.15, 125.31, 60.32, 55.72, 50.61, 41.47, 41.19, 30.24, 22.53, 20.99, 14.15. 4c was synthesized following general procedure d using 3c (120 mg, 0.31 mmol, 1.0 equiv) and conc hcl (0.1 ml, 1.0 mmol, 6.0 equiv). after removing solvent, after washing the solid 3 with fresh et2o, the remaining et2o was decanted off, yielding a white solid amine hydrochloride salt (27 mg). the (r)-amine intermediate (27 mg, 0.082 mmol, 1.0 equiv) and diboc - dmt (33 mg, 0.082 mmol, 1.0 equiv) and the coupling reagents hatu (31 mg, 0.082 mmol, 1.0 equiv) and hobt - cl (14 mg, 0.082 mmol, 1.0 equiv) were dissolved in dmf (1015 ml), followed by the addition of the and dipea (14 ml, 0.82 mmol, 10.0 equiv). after concentration under reduced pressure, the crude residue was dissolved in a 1:1 mixture of dcm and tfa (10 ml) and stirred for 1 h. the mixture was concentrated and purified by semipreparative hplc to yield the title compound as a white solid. note that not all crude product was purified, so a yield was not calculated. h nmr (500 mhz, cd3od) 8.15 (d, j = 8.2, 1h), 7.42 (br s, 1h), 7.277.19 (m, 2h), 7.187.11 (m, 4h), 7.05 (dd, j = 8.4, 2.1, 1h), 6.51 (s, 2h), 4.964.91 (m, 1h), 3.91 (s, 2h), 3.86 (dd, j = 11.5, 5.0, 1h), 3.78 (br s, 1h), 3.26 (dd, j = 13.6, 11.5, 1h), 3.183.10 (m, 1h), 3.03 (dd, j = 13.7, 5.1, 1h), 2.582.39 (m, 2h), 2.27 (s, 6h), 1.901.80 (m, 1h), 1.481.39 (m, 1h), 1.11 (t, j = 7.4, 3h). 4d was synthesized following general procedure d using 3d (10 mg, 0.024 mmol, 1.0 equiv) with the coupling reagent pybop to yield the tfa salt of the title compound, 4d, as a white solid. h nmr (500 mhz, cd3od) 7.39 (br s, 1h), 7.277.20 (m, 2h), 7.187.11 (m, 4h), 7.06 (dd, j = 8.4, 2.1, 1h), 6.50 (s, 2h), 4.93 (t, j = 6.5, 1h), 3.91 (s, 2h), 3.883.75 (m, 2h), 3.25 (dd, j = 13.6, 11.5, 1h), 3.153.11 (m, 1h), 3.02 (dd, j = 13.7, 5.1, 1h), 2.542.39 (m, 2h), 2.27 (s, 6h), 1.911.81 (m, 1h), 1.691.58 (m, 2h), 1.441.40 (m, 1h), 0.93 (t, j = 7.2, 3h). 4e was synthesized following general procedure d using 3e (70 mg, 0.17 mmol, 1.0 equiv) with the coupling reagent pybop to yield the tfa salt of the title compound, 4e, as a white solid (42 mg, 40.7%). h nmr (500 mhz, cd3od) 8.18 (d, j = 8.2 hz, 0h), 7.19 (dt, j = 35.4, 7.7 hz, 6h), 7.04 (d, j = 8.3 hz, 3h), 6.51 (s, 2h), 3.92 (d, j = 14.2 hz, 3h), 3.26 (t, j = 12.6 hz, 1h), 3.12 (ddt, j = 41.3, 13.4, 5.3 hz, 4h), 2.27 (s, 7h), 1.86 (dq, j = 12.6, 6.2 hz, 1h), 1.37 (dd, j = 12.8, 6.4 hz, 1h), 1.12 (d, j = 6.6 hz, 5h), 1.05 (d, j = 6.9 hz, 3h). c nmr (126 mhz, cd3od) 179.32, 169.29, 162.72, 157.37, 142.26, 140.05, 137.53, 129.77, 129.45, 129.20, 127.13, 125.65, 123.29, 116.40, 53.46, 46.89, 42.12, 32.38, 31.92, 31.83, 20.44, 20.17, 19.90. esi - ms 500.3 [m + h ] and 522.3 [m + na ]. 4f was synthesized following general procedure d using 3f (120 mg, 0.28 mmol, 1.0 equiv) with the coupling reagent pybop to yield the tfa salt of the title compound, 4f, as a white solid. note that not all crude product was purified, so a yield was not calculated. h nmr (500 mhz, cd3od) 7.39 (d, j = 8.3, 1h), 7.267.20 (m, 2h), 7.197.12 (m, 4h), 7.07 (dd, j = 8.4, 2.1, 1h), 6.50 (s, 2h), 4.96 (t, j = 6.3, 1h), 3.92 (s, 2h), 3.913.80 (m, 2h), 3.293.20 (m, 2h), 3.072.99 (m, 1h), 2.28 (s, 6h), 1.981.92 (m, 1h), 1.891.81 (m, 1h), 1.471.38 (m, 1h), 1.071.01 (m, 1h), 0.990.92 (m, 1h), 0.910.79 (m, 2h). 4 g was synthesized following general procedure d using 3 g (160 mg, 0.37 mmol, 1.0 equiv) with the coupling reagent pybop to yield the tfa salt of the title compound, 4 g, as a white solid. note that not all crude product was purified, so a yield was not calculated. h nmr (500 mhz, cd3od) 7.39 (br s, 1h), 7.267.21 (m, 2h), 7.187.11 (m, 4h), 7.05 (dd, j = 8.3, 2.1, 1h), 6.50 (s, 2h), 4.984.89 (m, 1h), 3.91 (s, 2h), 3.85 (dd, j = 11.5, 5.1, 1h), 3.68 (br s, 1h), 3.50 (p, j = 8.5, 1h), 3.25 (dd, j = 13.6, 11.6, 1h), 3.123.01 (m, 2h), 2.351.94 (m, 11h), 1.891.77 (m, 2h), 1.431.32 (m, 1h). 4h was synthesized following general procedure d using 3h (124 mg, 0.31 mmol, 1.0 equiv) and the coupling reagent pybop to yield the tfa salt of the title compound, 4h, as a white solid (50 mg, 69.5%). h nmr (400 mhz, cd3od) 7.65 (d, j = 8.6 hz, 1h), 7.267.20 (m, 2h), 7.177.12 (m, 3h), 7.07 (d, j = 2.2 hz, 1h), 7.03 (dd, j = 8.8, 1.9 hz, 1h), 6.50 (s, 2h), 4.97 (t, j = 5.2 hz, 1h), 3.87 (s, 2h), 3.863.81 (m, 1h), 3.75 (d, j = 1.4 hz, 4h), 3.25 (ddd, j = 13.1, 11.5, 1.4 hz, 1h), 3.16 (tdd, j = 6.7, 3.8, 1.4 hz, 12h), 3.052.94 (m, 2h), 2.27 (d, j = 1.4 hz, 7h), 1.901.82 (m, 12h), 1.77 (tt, j = 9.7, 4.8 hz, 1h), 1.541.45 (m, 1h). esi - ms 488.3 [m + h ] and 510.3 [m + na ]. 4i was synthesized following general procedure d using 3i (148 mg, 0.36 mmol, 1.0 equiv) and the coupling reagent pybop to yield the tfa salt of the title compound, 4i, as a white solid. note that not all crude product was purified, so a yield was not calculated. h nmr (400 mhz, cd3od) 7.23 (t, j = 7.8 hz, 2h), 7.14 (dd, j = 9.3, 2.6 hz, 4h), 7.07 (dd, j = 8.4, 1.9 hz, 1h), 6.51 (s, 2h), 4.96 (t, j = 5.7 hz, 1h), 4.25 (dd, j = 14.6, 1.1 hz, 1h), 4.14 (d, j = 14.5 hz, 1h), 3.90 (s, 2h), 3.84 (dd, j = 11.5, 5.0 hz, 1h), 3.40 (s, 3h), 3.25 (t, j = 12.6 hz, 1h), 3.15 (tdd, j = 6.7, 3.7, 1.2 hz, 7h), 3.02 (dd, j = 13.7, 5.0 hz, 1h), 2.27 (s, 6h), 1.881.81 (m, 8h), 1.48 (s, 1h). esi - ms 502.3 [m + h ] and 524.3 [m + na ]. 4j was synthesized following general procedure d using 3j (182 mg, 0.41 mmol, 1.0 equiv) and the coupling reagent pybop to yield the tfa salt of the title compound, 4j, as a white solid. note that not all crude product was purified, so a yield was not calculated. h nmr (400 mhz, cd3od) 7.477.42 (m, 1h), 7.37 (d, j = 6.8 hz, 4h), 7.257.20 (m, 2h), 7.15 (d, j = 7.6 hz, 1h), 7.11 (d, j = 7.6 hz, 2h), 6.876.76 (m, 2h), 6.49 (s, 2h), 5.04 (t, j = 6.0 hz, 1h), 3.923.81 (m, 4h), 3.25 (d, j = 12.3 hz, 1h), 3.06 (dd, j = 13.8, 5.1 hz, 1h), 2.28 (s, 6h), 1.94 (t, j = 10.4 hz, 1h), 1.48 (dd, j = 13.0, 6.3 hz, 1h). c nmr (126 mhz, cd3od) 172.42, 169.14, 157.49, 142.26, 140.04, 139.67, 137.75, 137.19, 131.74, 130.37, 129.71, 129.50, 129.45, 129.39, 128.99, 127.15, 126.27, 123.18, 116.45, 53.53, 49.00, 46.85, 42.06, 31.98, 31.42, 20.44. esi - ms 534.3 [m + h ] and 556.2 [m + na ]. after removal of solvent under reduced pressure, the crude product was purified by semipreparative hplc and lyophilized to yield the tfa salt of title compound, 9k, as a white powder (2 mg, 18%). h nmr (500 mhz, cd3od) 8.33 (d, j = 7.8 hz, 1h), 7.19 (t, j = 7.4 hz, 2h), 7.147.07 (m, 3h), 6.92 (d, j = 8.5 hz, 1h), 6.86 (s, 1h), 6.46 (s, 2h), 6.38 (d, j = 8.5 hz, 1h), 3.91 (d, j = 17.8 hz, 1h), 3.80 (dd, j = 11.8, 5.1 hz, 1h), 3.76 (s, 2h), 3.663.59 (m, 1h), 3.25 (t, j = 12.4 hz, 1h), 3.00 (dd, j = 13.6, 5.1 hz, 1h), 2.86 (d, j = 12.1 hz, 1h), 2.38 (t, j = 12.1 hz, 1h), 1.81 (t, j = 13.1 hz, 1h), 1.52 (d, j = 13.4 hz, 1h), 1.29 (s, 1h). c nmr (126 mhz, cd3od) 175.88, 157.43, 144.84, 140.04, 131.51, 131.21, 130.86, 129.63, 129.29, 126.85, 123.21, 121.80, 116.48, 112.92, 66.62, 55.53, 53.45, 49.00, 47.37, 47.27, 46.62, 41.77, 31.89, 28.93, 20.46. esi - ms = 487.3.3 [m + h ] and 509.3 [m + na ]. 4l was synthesized by treating crude 9l with 3 n hcl to remove the remaining boc - groups and yield the crude product which was purified by semipreparative hplc and lyophilized to yield the title compound as the tfa salt of 4l, as a white powder (44 mg, 41.1%). h nmr (500 mhz, cd3od) 8.17 (d, j = 7.6 hz, 1h), 7.227.17 (m, 2h), 7.147.07 (m, 3h), 6.926.85 (m, 2h), 6.43 (s, 2h), 6.39 (d, j = 8.4 hz, 1h), 4.87 (s, 6h), 4.24 (s, 0h), 4.234.15 (m, 2h), 3.81 (q, j = 5.3 hz, 1h), 3.76 (d, j = 8.6 hz, 2h), 3.31 (s, 2h), 3.25 (dd, j = 13.5, 11.8 hz, 1h), 3.00 (dd, j = 13.6, 5.0 hz, 1h), 2.85 (dt, j = 11.8, 4.1 hz, 1h), 2.42 (td, j = 12.3, 3.2 hz, 1h), 2.27 (s, 6h), 1.75 (tt, j = 12.8, 4.1 hz, 1h), 1.57 (dq, j = 13.3, 3.5 hz, 1h), 1.29 (td, j = 7.1, 1.0 hz, 3h). c nmr (126 mhz, cd3od) 173.03, 168.05, 157.42, 144.44, 143.28, 140.00, 131.60, 131.03, 130.84, 129.64, 129.29, 126.84, 123.20, 121.53, 116.47, 112.40, 62.35, 53.49, 53.20, 49.51, 49.34, 49.17, 49.00, 48.83, 48.66, 48.49, 47.56, 46.18, 41.75, 31.87, 28.78, 20.48, 14.51. esi - ms 516.3 [m + h ] and 538.3 [m + na ]. 4 m was formed by treating the crude residue of 9 m with 1:1 tfa : dcm to form crude product which was purified by semipreparative hplc and lyophilized to yield the tfa salt of the title compound, 4 m (1.6 mg, 2.2%). note that purification was difficult and not all crude product was purified, so a yield was not calculated. esi - ms 488.3 [m + h ] and 510.3 [m + na ]. no h or c nmr data acquired. instead, formation of final product 4 m verified by mass spectrometry. 6 was synthesized following general procedure c using 5 (1.1 g, 4.8 mmol, 1.0 equiv), (r)-2-methylpropane-2-sulfinamide (175 mg, 1.44 mmol, 3.0 equiv), and ti(oet)4 (0.604 ml, 2.88 mmol, 6.0 equiv) to form the (r)-tert - butanesulfinyl imine intermediate in situ. once sufficient ketone was converted into imine intermediate (after 48 h), the reaction mixture was transferred via cannula to a round - bottom flask containing nabh4 (109 mg, 2.44 mmol, 6.0 equiv) and 20 ml of thf in a xylenes dry ice bath ; after addition, the solution was stirred at room temperature for 3 h before being quenched with meoh. once resultant solid was removed, crude residue was purified using silica gel chromatography to yield the title compound 6 as a clear, colorless oil (175 mg, 82.2%). h nmr (500 mhz, cdcl3) 7.69 (d, j = 8.2 hz, 1h), 7.297.21 (m, 2h), 7.207.15 (qd, j = 6.5, 5.4, 1.6 hz, 4h), 7.06 (dd, j = 8.5, 2.3 hz, 1h), 4.52 (q, j = 3.4 hz, 1h), 3.973.87 (m, 3h), 3.57 (tdd, j = 12.9, 4.2, 1.7 hz, 1h), 3.32 (bs, 1h), 2.202.13 (m, 1h), 1.991.90 (m, 1h), 1.50 (s, 9h), 1.19 (s, 9h). c nmr (126 mhz, cdcl3) 153.43, 140.77, 136.51, 136.42, 128.88, 128.71, 128.55, 128.47, 128.34, 125.97, 123.89, 80.97, 55.52, 50.36, 41.08, 40.00, 29.41, 28.22, 22.48. 7 was synthesized by first treating 6 (400 mg, 0.904 mml, 1.0 equiv) with excess 1:1 tfa : dcm. next, the ellman auxiliary was cleaved using conc hcl (0.133 ml, 5.43 mmol, 6.0 equiv). after removing solvent, after washing the solid 3 with fresh et2o, the remaining et2o was decanted off, yielding the title 7 compound as tan solid (110 mg, 44.4% from 7). h nmr (500 mhz, cd3od) 7.68 (d, j = 1.8 hz, 1h), 7.44 (dd, j = 8.3, 1.8 hz, 1h), 7.37 (d, j = 8.3 hz, 1h), 7.317.24 (m, 4h), 7.227.17 (m, 1h), 4.77 (t, j = 6.0 hz, 1h), 4.06 (s, 2h), 3.73 (ddd, j = 12.4, 9.0, 3.1 hz, 1h), 3.65 (ddd, j = 13.0, 7.8, 3.3 hz, 1h), 2.61 (dddd, j14.8, 9.0, 5.7, 3.3 hz, 1h), 2.38 (dddd, j = 14.8, 7.8, 6.4, 3.1 hz, 1h). 8 was synthesized following a modified version of general procedure d using 7 (110 mg, 0.40 mmol, 1.0 equiv). after coupling to diboc - dmt, residue was not deprotected with tfa. instead, the crude residue was purified by semipreparative hplc and lyophilized to yield the title compound 8 (287 mg, quant). esi - ms 630.3 [m + h ] and esi - ms 652.3 [m + na ]. first acetone was degassed for 30 min, then flooded with ar for an additional 30 min. to a flame - dried round - bottom flask equipped with a stir bar with ar atmosphere was added sodium iodide (25 mg, 0.16 mmol, 2.0 equiv) and 2-chloroacetamide (15 mg, 0.16 mmol, 2.0 equiv), which was then placed back under vacuum. next, 10 ml of degassed acetone was added to the reaction vessel via cannula and reaction stirred for 10 min. meanwhile, to another flame - dried round - bottom flask equipped with a stirbar was added 8, degassed acetone, followed by dipea (0.021 ml, 0.12 mmol, 1.5 equiv), and the solution stirred for 10 min. next, the contents of the round - bottom flask containing the sodium iodide and 2- chloroacetamide was transferred to the flask containing 8 via cannula. the reaction stirred stirred at room temp for 24 h. the next day, the solvent was removed under reduced pressure to yield the crude product (13 mg) that was taken ahead to next step (formation of 4k) without further purification, isolation, or characterization. esi - ms 687.3 [m + h ] and esi - ms 709.3 [m + na ]. no h or c nmr data acquired. to synthesize 91, 8 (214 mg, 0.34 mmol, 1.0 equiv) and k2co3 (94 mg, 0.68 mmol, 2.0 equiv) were placed in a round - bottom flask and the atmosphere was evacuated then the reaction vessel was flooded with ar. next, bromo ethyl acetate (0.377 ml, 3.4 mmol, 10 equiv) was added to the reaction vessel, which was equipped with a condenser and placed in an 80 c oil bath. after 6 h, after 24 h, the solvent was removed under reduced pressure and crude residue was resuspended in dcm and di h2o and the layers separated. the organic layer was washed with 5% citric acid solution (1 20 ml) and then with brine (1 20 ml) and dried over mgso4 to yield the crude residue of 91. esi - ms 716.3 [m + h ] and esi - ms 738.3 [m + na ]. the residue was carried forward (to synthesize 4l and 4 m) without further purification, isolation, or characterization. 9 m was synthesized by treating crude 9l (107 mg, 0.15 mmol, 1.0 equiv) with lioh (excess) in etoh at 60 c for 2.5 h. reaction was monitored for loss of starting material by analytical hplc (gradient a) : starting material retention time = 72.4). the residue was carried forward (4 m) without further purification, isolation, or characterization. 11 was synthesized by first degassing a solution of 3:1 acetone : di h2o for 1 h, then ar was bubbled through solution for 1 h to ensure removal and displacement of ambient oxygen. intermediate 10 (1.0 equiv), 2-naphthylboronic acid (2.0 equiv), k2co3 (3.0 equiv), and pd(dppf)cl2 (0.1 equiv) were added to a microwave tube, and the tube was placed under vacuum for 15 min, then flooded with ar. roughly 12 ml of the 3:1 acetone : di h2o solution was added to a tube via syringe, then the tube was placed in microwave for 3060 min with a maximum power of 300 w and a maximum temperature of 100 c with the powermax option enabled. once the microwave reaction was complete, reaction mixture was filtered through a pad of celite to remove palladium and solvents were removed under reduced pressure to yield a crude brown residue which was purified using silica gel chromatography to obtain the title compound 11 as an off - white solid. h nmr (500 mhz, cdcl3) 7.90 (d, j = 2.2 hz, 1h), 7.817.73 (m, 3h), 7.69 (d, j = 8.7 hz, 1h), 7.63 (s, 1h), 7.497.40 (m, 2h), 7.35 (dt, j = 8.6, 1.8 hz, 1h), 7.30 (dt, j = 8.4, 1.5 hz, 1h), 4.164.10 (m, 4h), 2.782.71 (m, 2h), 1.54 (d, j = 1.3 hz, 9h). c nmr (126 mhz, cdcl3) 194.26, 152.75, 142.47, 137.89, 136.72, 134.71, 133.58, 132.13, 128.24, 127.61, 127.54, 127.35, 127.31, 127.25, 127.08, 126.78, 126.05, 125.46, 124.82, 123.87, 82.12, 44.28, 41.33, 38.99, 28.29. 12 was synthesized by deprotecting 11 with a 1:1 mixture of tfa : dcm. after stirring at rt for 1 h, solvent was removed under reduced pressure to yield the crude final product, which was then purified using silica gel chromatography to yield the title compound 12 as a yellow solid. note that not all crude product was purified, so a yield was not calculated. h nmr (500 mhz, cdcl3) 7.847.72 (m, 4h), 7.62 (s, 1h), 7.497.38 (m, 2h), 7.337.24 (m, 1h), 7.16 (ddd, j = 8.3, 4.8, 1.9 hz, 1h), 6.65 (ddd, j = 15.4, 8.3, 2.4 hz, 1h), 4.03 (s, 1h), 3.593.53 (m, 2h), 2.772.66 (m, 2h), 2.25 (s, 1h). c nmr (126 mhz, cdcl3) 193.66, 138.64, 136.34, 136.11, 133.56, 132.05, 130.95, 128.11, 127.58, 127.51, 127.40, 127.36, 127.20, 126.87, 125.95, 125.31, 119.67, 119.42, 116.41, 116.22, 42.57, 42.41, 41.14, 38.08. 13c was synthesized according to general procedure a using 12 (150 mg, 0.52 mmol, 1.0 equiv) and excess propionic anhydride. once complete, excess anhydride was removed and the crude residue was purified using silica gel chromatography to yield the title compound 13c as a clear, pale - orange oil (156 mg, 87.2%). h nmr (500 mhz, cdcl3) 7.91 (s, 1h), 7.817.73 (m, 3h), 7.63 (s, 1h), 7.477.32 (m, 4h), 7.28 (dd, j = 8.4, 1.9 hz, 1h), 4.224.15 (m, 2h), 4.12 (s, 2h), 2.74 (td, j = 6.3, 1.9 hz, 2h), 2.612.52 (m, 2h), 1.21 (t, 3h). c nmr (126 mhz, cdcl3) 194.08, 172.83, 142.08, 138.43, 137.45, 134.74, 134.52, 133.42, 132.01, 128.23, 127.51, 127.49, 127.41, 127.17, 127.03, 126.03, 125.92, 125.45, 124.30, 123.97, 43.69, 41.27, 39.43, 27.80, 9.71. 13d was synthesized according to general procedure a using 12 (155 mg, 0.54 mmol, 1.0 equiv) and excess butyric anhydride. once complete, excess anhydride was removed and the crude residue was purified using silica gel chromatography to yield the title compound 13d as a clear, slightly dark - red oil (112 mg, 58.0%). h nmr (500 mhz, cdcl3) 7.94 (s, 1h), 7.857.76 (m, 3h), 7.66 (s, 1h), 7.517.39 (m, 4h), 7.32 (d, j = 8.5 hz, 1h), 4.20 (t, j = 6.3 hz, 2h), 4.15 (s, 2h), 2.76 (t, j = 5.9 hz, 2h), 2.602.49 (m, 2h), 1.75 (h, j = 7.7 hz, 2h), 0.97 (t, j = 7.6 hz, 3h). c nmr (126 mhz, cdcl3) 194.00, 171.99, 142.10, 138.38, 137.42, 134.69, 134.47, 133.42, 132.01, 128.21, 127.49, 127.47, 127.39, 127.16, 127.02, 126.00, 125.90, 125.42, 124.32, 124.00, 43.71, 41.25, 39.50, 36.28, 18.94, 13.66. 13e was synthesized according to general procedure b using 12 (150 mg, 0.52 mmol, 1.0 equiv) and methylchloroformate (0.200 ml, 2.3 mmol, 2.3 equiv). the reaction stirred overnight ; once complete, solvent was removed and the crude residue was purified using silica gel chromatography to yield the title compound 109 as a clear oil (65 mg, 36.1%). additionally, not all product was purified as the rf values for the starting material and product were similar and separation was difficult. h nmr (500 mhz, cdcl3) 7.92 (d, j = 2.2 hz, 1h), 7.827.74 (m, 3h), 7.72 (d, j = 8.6 hz, 1h), 7.64 (s, 1h), 7.487.41 (m, 2h), 7.38 (dd, j = 8.6, 2.3 hz, 1h), 7.30 (dd, j = 8.4, 1.8 hz, 1h), 4.18 (t, j = 6.3 hz, 2h), 4.13 (s, 2h), 3.84 (s, 3h), 2.77 (t, j = 6.3 hz, 2h). c nmr (126 mhz, cdcl3) 193.81, 154.23, 141.81, 137.73, 137.18, 134.88, 133.49, 132.05, 128.21, 127.55, 127.47, 127.26, 127.23, 127.03, 126.01, 125.42, 124.81, 123.63, 53.32, 44.39, 41.26, 38.81. 14c was synthesized according to general procedure c using 13c (156 mg, 0.45 mmol, 1.0 equiv), (r)-2-methylpropane-2-sulfinamide (165 mg, 1.36 mmol, 3.0 equiv), and ti(oet)4 (0.57 ml, 2.7 mmol, 6.0 equiv) to form the (r)-tert - butanesulfinyl imine intermediate in situ. once sufficient ketone was converted into imine intermediate (after 48 h), the reaction mixture was transferred via cannula to a round - bottom flask containing nabh4 (103 mg, 2.7 mmol, 6.0 equiv) and 20 ml of thf in a xylenes dry ice bath, after addition, the solution was stirred at room temperature for 3 h before being quenched with meoh. once resultant solid was removed, crude residue was purified using silica gel chromatography to yield the title compound 14c as a clear, colorless oil (148 mg, 72.5%). no h or c nmr data acquired. instead, product taken ahead to next reaction (formation of 15c) without any further isolation, purification, or characterization. 14d was synthesized according to general procedure c using 13d (112 mg, 0.31 mmol, 1.0 equiv), (r)-2-methylpropane-2-sulfinamide (114 mg, 0.94 mmol, 3.0 equiv), and ti(oet)4 (0.39 ml, 1.9 mmol, 6.0 equiv) to form the (r)-tert - butanesulfinyl imine intermediate in situ. once sufficient ketone was converted into imine intermediate (after 48 h), the reaction mixture was transferred via cannula to a round - bottom flask containing nabh4 (71 mg, 1.9 mmol, 6.0 equiv) and 20 ml of thf in a xylenes a dry ice bath ; after addition, the solution was stirred at room temperature for 3 h before being quenched with meoh. once resultant solid was removed, crude residue was purified using silica gel chromatography to yield the title compound 14d as a clear, colorless oil (54 mg, 37.2%). h nmr (500 mhz, cdcl3) 7.78 (q, j = 7.7 hz, 3h), 7.66 (s, 1h), 7.44 (pd, j = 7.1, 3.4 hz, 2h), 7.33 (dd, j = 6.4, 2.1 hz, 2h), 7.14 (dt, j = 8.2, 2.0 hz, 1h), 4.52 (t, j = 4.4 hz, 1h), 4.11 (s, 2h), 3.89 (dt, j = 12.2, 5.5 hz, 1h), 3.74 (ddd, j = 13.6, 9.8, 6.2 hz, 1h), 3.32 (d, j = 3.3 hz, 1h), 2.522.39 (m, 2h), 2.20 (dh, j = 15.3, 7.4, 5.6 hz, 1h), 2.04 (dq, j = 12.7, 4.6, 3.9 hz, 1h), 1.741.61 (m, 2h), 1.17 (d, j = 1.9 hz, 9h), 0.91 (t, j = 7.5 hz, 3h). c nmr (126 mhz, cdcl3) 187.72, 172.68, 138.03, 136.64, 133.57, 132.10, 128.79, 128.72, 128.57, 128.21, 127.58, 127.52, 127.46, 127.10, 126.03, 125.43, 124.85, 124.60, 55.73, 50.96, 41.52, 39.95, 36.69, 30.68, 22.51, 19.14, 13.88. 14e was synthesized according to general procedure c using 13e (65 mg, 0.19 mmol, 1.0 equiv), (r)-2-methylpropane-2-sulfinamide (68 mg, 0.57 mmol, 3.0 equiv), and ti(oet)4 (0.24 ml, 1.1 mmol, 6.0 equiv) to form the (r)-tert - butanesulfinyl imine intermediate in situ. once sufficient ketone was converted into imine intermediate (after 48 h), the reaction mixture was transferred via cannula to a round - bottom flask containing nabh4 (43 mg, 1.1 mmol, 6.0 equiv) and 20 ml of thf in a xylenes dry ice bath, after addition, the solution was stirred at room temperature for 3 h before being quenched with meoh. once resultant solid was removed, crude residue was purified using silica gel chromatography to yield the title compound 14e as a clear, colorless oil (34 mg, 40.0%). h nmr (500 mhz, cdcl3) 7.817.71 (m, 4h), 7.64 (d, j = 5.2 hz, 1h), 7.487.39 (m, 2h), 7.347.26 (m, 2h), 7.13 (ddd, j = 8.5, 6.0, 2.2 hz, 1h), 4.55 (h, j = 3.7 hz, 1h), 4.09 (s, 2h), 4.053.96 (m, 1h), 3.78 (s, 3h), 3.693.59 (m, 1h), 3.33 (q, j = 2.7 hz, 1h), 2.18 (ddt, j = 12.8, 10.4, 4.3 hz, 1h), 2.061.93 (m, 1h), 1.18 (s, 9h). c nmr (126 mhz, cdcl3) 154.94, 138.25, 136.95, 136.16, 133.53, 132.02, 129.23, 128.84, 128.65, 128.08, 127.52, 127.48, 127.43, 126.96, 125.92, 125.30, 123.70, 55.60, 52.95, 50.35, 41.33, 40.28, 29.49, 22.49. 15c was synthesized following general procedure d using 14c (148 mg, 0.33 mmol, 1.0 equiv) and conc hcl (6 drops). after removing solvent, after washing the solid 3 with fresh et2o, the remaining et2o was decanted off, yielding a white solid amine hydrochloride salt (126 mg). the synthesis was completed by following general procedure f with newly formed (r) amine intermediate (60 mg, 0.16 mmol, 1.0 equiv) to yield crude product which was purified by semipreparative hplc and lyophilized to yield the title compound 15c as a tfa salt (15 mg, 14.7%). note that not all crude product was purified. h nmr (500 mhz, cdcl3) 7.76 (ddd, j = 21.9, 8.2, 3.1 hz, 3h), 7.60 (d, j = 3.2 hz, 1h), 7.477.37 (m, 2h), 7.28 (dt, j = 8.6, 2.2 hz, 1h), 7.19 (d, j = 3.5 hz, 1h), 7.157.09 (m, 1h), 6.51 (d, j = 3.4 hz, 2h), 4.93 (p, j = 5.2 hz, 1h), 4.08 (d, j = 3.4 hz, 2h), 3.86 (dt, j = 11.2, 4.3 hz, 1h), 3.78 (s, 1h), 3.24 (td, j = 12.6, 11.2, 3.5 hz, 1h), 3.15 (s, 1h), 3.03 (dt, j = 13.9, 4.5 hz, 1h), 2.582.41 (m, 2h), 2.26 (d, j = 3.6 hz, 6h), 1.85 (dtd, j = 13.5, 8.7, 4.7 hz, 1h), 1.45 (s, 1h), 1.11 (td, j = 7.1, 3.2 hz, 3h). c nmr (126 mhz, cd3od) 175.85, 169.20, 157.47, 140.07, 139.86, 137.62, 135.07, 133.59, 129.47, 129.07, 128.58, 128.46, 128.38, 127.87, 127.09, 126.46, 125.87, 123.24, 116.45, 53.49, 47.11, 42.27, 31.95, 31.29, 28.92, 20.42, 10.06. esi - ms 536.3 [m + h ] and 558.3 [m + na ]. 15d was synthesized following general procedure d using 14d (34 mg, 0.076 mmol, 1.0 equiv) and conc hcl (3 drops). after removing solvent, after washing the solid 3 with fresh et2o, the remaining et2o was decanted off, yielding a white solid amine hydrochloride salt (46 mg). the synthesis was completed by following general procedure f with newly formed (r) amine intermediate (46 mg, 0.12 mmol, 1.0 equiv) to yield crude product which was purified by semipreparative hplc and lyophilized to yield the title compound 15d as a tfa salt (12 mg, 15.6%). note that not all crude product was purified. esi - ms 550.3 [m + h ] and 572.3 [m + na ]. 15e was synthesized following general procedure d using 14e (34 mg, 0.076 mmol, 1.0 equiv) and conc hcl (3 drops). after removing solvent, after washing the solid 3 with fresh et2o, the remaining et2o was decanted off, yielding a white solid amine hydrochloride salt (19 mg). the synthesis was completed by following general procedure f with newly formed (r) amine intermediate (19 mg, 0.0.16 mmol, 1.0 equiv) to yield crude product which was purified by semipreparative hplc and lyophilized to yield the title compound 15e as a tfa salt (13 mg, 40.6%). h nmr (500 mhz, cd3od) 7.78 (d, j = 7.9 hz, 1h), 7.73 (dd, j = 8.3, 2.9 hz, 2h), 7.67 (d, j = 8.5 hz, 1h), 7.59 (s, 1h), 7.42 (dt, j = 8.9, 6.2 hz, 2h), 7.27 (dt, j = 8.4, 1.7 hz, 1h), 7.12 (s, 1h), 7.09 (dt, j = 8.6, 1.8 hz, 1h), 6.50 (s, 2h), 4.96 (t, j = 5.1 hz, 1h), 4.04 (s, 2h), 3.873.80 (m, 1h), 3.75 (d, j = 1.5 hz, 4h), 3.283.19 (m, 1h), 3.00 (dt, j = 12.6, 8.3 hz, 2h), 2.26 (d, j = 1.5 hz, 7h), 1.78 (ddt, j = 14.7, 9.9, 4.7 hz, 1h), 1.50 (ddd, j = 13.4, 8.6, 4.8 hz, 1h). c nmr (126 mhz, cd3od) 168.96, 157.48, 156.61, 139.99, 138.03, 137.48, 135.07, 133.57, 130.31, 129.72, 129.02, 128.78, 128.57, 128.46, 128.39, 127.80, 127.05, 126.41, 124.63, 123.19, 116.43, 111.40, 53.54, 53.41, 47.06, 42.32, 42.14, 31.92, 30.30, 20.44. esi - ms 538.3 [m + h ] and 560.3 [m + na ]. all tissue culture reagents were purchased from gibco life sciences (grand island, ny, u.s.). c6-rat glioma cells stably transfected with a rat (c6-mor) or rat (c6-dor) opioid receptor and chinese hamster ovary (cho) cells stably expressing a human (cho - kor) opioid receptor were used for all in vitro assays. cells were grown to confluence at 37 c in 5% co2 in dulbecco s modified eagle medium (dmem) containing 10% fetal bovine serum and 5% penicillin / streptomycin. membranes were prepared by washing confluent cells three times with ice - cold phosphate buffered saline (0.9% nacl, 0.61 mm na2hpo4, 0.38 mm kh2po4, ph 7.4). cells were detached from the plates by incubation in warm harvesting buffer (20 mm hepes, 150 mm nacl, 0.68 mm edta, ph 7.4) and pelleted by centrifugation at 1600 rpm for 3 min. the cell pellet was suspended in ice - cold 50 mm tris - hcl buffer, ph 7.4, and homogenized with a tissue tearor (biospec products, inc., bartlesville, ok, u.s.) for 20 s. the homogenate was centrifuged at 15000 rpm for 20 min at 4 c. the pellet was rehomogenized in 50 mm tris - hcl with a tissue tearor for 10 s, followed by recentrifugation. the final pellet was resuspended in 50 mm tris - hcl and frozen in aliquots at 80 c. protein concentration was determined via a bca protein assay (thermo scientific pierce, waltham, ma, u.s.) using bovine serum albumin as the standard. radiolabeled compounds were purchased from perkinelmer (waltham, ma, u.s.). opioid ligand binding assays were performed by competitive displacement of 0.2 nm [h]diprenorphine (250 ci, 1.85 tbq / mmol) by the peptidomimetic from membrane preparations containing opioid receptors as described above. the assay mixture, containing membranes (20 g protein / tube) in 50 mm tris - hcl buffer (ph 7.4), [h]diprenorphine, and various concentrations of test peptidomimetic, was incubated at room temperature for 1 h to allow binding to reach equilibrium. the samples were rapidly filtered through whatman gf / c filters using a brandel harvester (brandel, gaithersburg, md, u.s.) and washed five times with 50 mm tris - hcl buffer. bound radioactivity on dried filters was determined by liquid scintillation counting, after saturation with ecolume liquid scintillation cocktail, in a wallac 1450 microbeta (perkinelmer, waltham, ma, u.s.). the results presented are the mean standard error (se\m) from at least three separate assays performed in duplicate. ki (nm) values were calculated using nonlinear regression analysis to fit a logistic equation to the competition data using graphpad prism, version 6.0c, for mac os x (graphpad software inc., la jolla, ca). agonist stimulation of [s]guanosine 5-o-[-thio]triphosphate ([5s]gtps, 1250 ci, 46.2 tbq / mmol) binding to g - protein was measured as described previously. briefly, membranes (1020 g of protein / tube) were incubated 1 h at 25 c in gtps buffer (50 mm tris - hcl, 100 mm nacl, 5 mm mgcl2, ph 7.4) containing 0.1 nm [s]gtps, 30 m guanosine diphosphate (gdp), and varying concentrations of test peptidomimetic. g - protein activation following receptor stimulation of [s]gtps (% stimulation) with peptidomimetic was compared with 10 m of the standard compounds [d - ala2,n - mephe4,gly - ol]enkephalin (damgo) at mor, d - pen2,5-enkephalin (dpdpe) at dor, or u69,593 at kor. the reaction was terminated by vacuum filtration of gf / c filters that were washed 10 times with gtps buffer. bound radioactivity was measured as described above. the results are presented as the mean standard error (sem) from at least three separate assays performed in duplicate ; potency (ec50 (nm)) and % stimulation were determined using nonlinear regression analysis with graphpad prism, as above. adult male c57bl/6 mice weighing between 20 and 30 g at 816 weeks old purchased from harlan (indianapolis, in). mice were group - housed and had free access to food and water at all times. experiments were conducted in the housing room, which was maintained on a 12 h light / dark cycle (with lights on at 0700) ; experiments were conducted during the light cycle. each mouse was used only once. studies were performed in accordance with the university of michigan committee on the use and care of animals and the guide for the care and use of laboratory animals (national research council, 2011 publication). three - dimensional (3d) models of opioid receptors in the inactive conformation were produced as previously described using x - ray structures of the mouse mor (pdb i d : 4dkl), the human dor (pdb i d : 4n6h), and the human kor (pdb i d : 4djh) as structural templates. the recently obtained crystal structure of mouse mor in the active conformation (pdb i d : 5c1 m) was used as a template for homology modeling of active conformations of dor and kor. structures of receptor loops in the active state were kept similar to those in the crystal structures of corresponding receptors in the inactive state. n - termini of dor (residues 3345) and kor (residues 4557) were modeled using the structure of mor n - terminus in the active conformation with a few adjustments that transformed the central bulge (residues 5357) into the extended conformation of the polypeptide chain. such modifications increased the size of the binding pocket and allowed docking of relatively bulky tetra- and pentapeptides and peptidomimetics without hindrances with the n - terminus. structures of peptidomimetic ligands were generated using the 3d - builder application of quanta (accelrys, inc.), followed by conformational search included in the program package. ligand conformations that demonstrated the best superposition of aromatic substituents of the thq core with the pharmacophore elements (tyr and phe) of receptor - bound conformations of cyclic tetrapeptides were selected and minimized with charmm implemented in quanta (adopted - basis newton raphson method, 100 steps, = 10). low energy conformations (within 2 kcal / mol) were manually positioned inside the receptor binding cavity to reproduce the binding modes of cyclic tetrapeptides. the docking pose of each ligand was subsequently refined using the solid docking module of quanta. the receptor ligand complexes were then minimized with charmm (adopted - basis newton raphson method, 30 steps, = 10). models of opioid ligand	n - acetylation of the tetrahydroquinoline (thq) core of a series of -opioid receptor (mor) agonist/-opioid receptor (dor) antagonist ligands increases dor affinity, resulting in ligands with balanced mor and dor affinities. we report a series of n - substituted thq analogues that incorporate various carbonyl - containing moieties to maintain dor affinity and define the steric and electronic requirements of the binding pocket across the opioid receptors. 4h produced in vivo antinociception (ip) for 1 h at 10 mg / kg.
it is characterized by acute and mostly intense abdominal pain accompanied by peritonism and potentially meteorism, nausea, vomiting and in severe and advanced cases shock. in most cases abdominal pathologies cause this acute condition including but not limited to appendicitis, cholecystitis, pancreatitis, mesenteric ischemia, ileus and perforations of hollow organs,. however, also extra - abdominal diseases can present with symptoms of an acute abdomen such as testicular torsion, myocardial infarction or diabetic ketoacidosis. due to the fact that an acute abdomen is always potentially life - threatening, prompt action is required to obtain the diagnosis and to immediately initiate adequate therapy. diagnostically, in addition to clinical examination and analysis of serum parameters, imaging such as sonography, computed tomography (ct) and magnetic resonance imaging (mri) are foremost in leading to the correct diagnosis. however, as mentioned above, the causes for acute abdominal symptoms are versatile and at times are found in medical areas other than gastroenterology itself. in this study we report on an interesting and unique case in which a psychiatric condition was the underlying disease leading to an acute abdominal picture which required immediate surgical intervention. a 28-year - old woman presented in our surgical emergency unit with a sudden onset of progressive abdominal discomfort and pain. routine laboratory analysis did not show any pathologies, including normal hemoglobin, leucocytes, c - reactive protein (crp) as well as serum electrolytes. because of the acute and dramatic clinical presentation we immediately performed a computed tomography of the abdomen. this revealed a massively distended stomach with a cranio - caudal extension of 35 cm reaching the lesser pelvis, however, without evidence for perforation (figure 1 (fig. a stomach tube was placed, which, however, did not drain any significant amount of stomach content. we performed a gastrotomy of the gastric antrum and recovered (over the period of one hour) a large amount of cementitiously clotted and undigested food scraps from the stomach. the stomach tube as well as the intrabdominal drainage could be removed within the first days after surgery. a gradual reintroduction of liquids was well tolerated. on the sixth postoperative day we performed a radiological imaging of the stomach using contrast medium which revealed a re - tonised stomach of a normal size without evidence for any stenosis (figure 2 (fig. subsequently, the patient was allowed to normal food intake, which was well tolerated as well. the postoperatively initiated evaluation of the patient by a psychiatrist revealed that she had been suffering from an eating disorder since her childhood. temporarily, her body mass index (bmi) had dropped to 11 kg / m. at consultation in our clinic however, the patient reported on daily binge eatings caused by conflicts at her workplace. this had also occurred on the day of hospital admission, however on this day, the routinely self - induced vomiting after the binge attack failed. in a good status of health here, we report on an unusual case in which a binge attack in a young woman suffering from an eating disorder caused a massive dilatation of her stomach. this dilation was not reversible either by self - induced vomiting or by drainage using a stomach tube. some other authors have reported on cases in which eating disorders such as anorexia nervosa or bulimia nervosa lead to acute gastric dilatation,,,. in line with the higher incidence of eating disorder in young females, mostly women in the age between 14 and 30 years were affected. in some cases, the so - called superior mesenteric artery syndrome has been suggested to cause or at least promote gastric dilatation in patients with eating disorders,. for this syndrome it has been proposed that malnutrition leads to the shrinkage of a fad pad localized between the aorta and outlet of the superior mesenteric artery. this, in turn, may cause compression of the duodenum thereby promoting gastric dilatation, in particular in cases when eating binges occur. in the reported case of this study, immediate imaging revealed the diagnosis and emergency explorative laparotomy and gastrotomy allowed for full recovery of the patient without complications or any residuals. this prompt and direct action including emergency laparotomy appears to be justified and essential, given the fact that some authors have reported severe complications such as gastric perforation and/or necrosis in patients with similar conditions,. furthermore, in some cases extended surgical approaches such as partial gastrectomy or even gastric resection were required. the fact that some patients did not recover and, unfortunately, passed away, confirms the severity of this condition as well as the importance of adequate diagnosis and immediate (surgical) therapy.	the clinical picture of an acute abdomen is frequently encountered in emergency medicine. in most cases abdominal pathologies underlie this condition, however, also extra - abdominal diseases may present or cause an acute abdomen. the fact that this condition is potentially life - threatening highlights the importance of instant action. here, we report on the case of a young woman that presented with an acute abdomen in our clinic. imaging revealed a massively distended stomach reaching the lesser pelvis. initially, the etiology for the gastric dilatation remained unsolved. on the same day we performed an explorative laparotomy in which massive amounts of clotted, undigested food was recovered via a gastrotomy. postoperatively, upon psychiatric consultation, an eating disorder with daily eating binges could be revealed as being the cause for the acute and dramatic gastric dilatation. the patient fully recovered from surgery and psychiatric co - treatment was initiated. this unique case report demonstrates how a psychiatric condition may lead to an acute abdomen, however, it also emphasizes the importance of prompt diagnosis and adequate therapy to avoid complications and allowing for full recovery.
deposited data can be found in the gene expression omnibus (geo) database : http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse57560. gse57560 correlation of gene expression with bladder capacity in interstitial cystitis / bladder pain syndrome. a flow diagram outlining of the experimental design for this study can be found in fig. 1. experimental biopsy tissue was collected either during cystoscopy or at surgery (for patients who were undergoing cystectomy for end stage disease) under general anesthesia from patients diagnosed with interstitial cystitis / bladder pain syndrome (ic / bps),,,,. cystoscopy patients first underwent hydrodistention at 100 ml of h2o for a period of 5 min. study biopsies were taken post hydrodistention from the posterior bladder wall using a cold - cup technique and a portion of each biopsy specimen was sent for normal clinical analysis by the wake forest medical center pathology department (following standard hospital protocol). the remaining sample was immediately submerged in 200 l of rnalater and stored at 20 c until processing. for patients undergoing cystectomy, an amount of tissue similar to that which would be collected at biopsy was harvested from the posterior bladder through a single scalpel incision and submerged in 200 l of rnalater and stored at 20 c in a similar fashion. bladder capacity data and cystoscopic findings for these subjects were retrieved from the patient 's last cystoscopy recording in the medical record and included in this analysis (table 1). for the purposes of this study, low bladder capacity was defined as 10.0 pmol cy3/g crna) was fragmented at 60 c for 30 min in a reaction volume of 250 ml containing 1 agilent fragmentation buffer and 2 agilent blocking agent following the manufacturer 's instructions. on completion of the fragmentation reaction, 250 ml of 2 agilent hybridization buffer was added to the fragmentation mixture and hybridized to sureprint human gene expression v2 microarrays (agilent technologies) containing 60-mers for 50,599 biological features for 17 h at 65 c in a rotating agilent hybridization oven. after hybridization, microarrays were washed 1 min at room temperature with ge wash buffer 1 (agilent) and 1 min with 37 c ge wash buffer 2 (agilent), then dried immediately by brief centrifugation. slides were scanned immediately after washing on the agilent dna microarray scanner (g2505b) using one color scan setting for 1 44 k array slides (scan area 61 21.6 mm, scan resolution 10 m, dye channel is set to green and green pmt is set to 100%). the scanned images were analyzed with feature extraction software 9.1 (agilent) using default parameters (protocol ge1-v1_91 and grid : 012391_d_20060331) to obtain background subtracted and spatially de - trended processed signal intensities. the anonymized clinical data were deposited in the gene expression omnibus database (geo http://www.ncbi.nlm.nih.gov/geo/ under accession number gse57560). following log transformation of the processed signal intensity data, principle component analysis (pca) and unsupervised hierarchical clustering were performed (qlucore omics explorer) to determine the similarity among samples within and between groups (fig. 2). further statistical analyses to measure differentially expressed transcripts (dets) unique to each phenotype were then performed by applying student 's t - test (change 1.5 ; p 0.05) for the pair - wise comparison (genesifter analysis edition 4.0) using benjamini and hochberg fdr correction. the list of dets generated from the pair - wise comparison (e.g. low bladder capacity versus normal bladder capacity) with an adjusted p 0.05 was imported into ingenuity pathway analysis software for gene ontology and pathway analysis. a flow diagram outlining of the experimental design for this study can be found in fig. 1. experimental biopsy tissue was collected either during cystoscopy or at surgery (for patients who were undergoing cystectomy for end stage disease) under general anesthesia from patients diagnosed with interstitial cystitis / bladder pain syndrome (ic / bps),,,,. cystoscopy patients first underwent hydrodistention at 100 ml of h2o for a period of 5 min. study biopsies were taken post hydrodistention from the posterior bladder wall using a cold - cup technique and a portion of each biopsy specimen was sent for normal clinical analysis by the wake forest medical center pathology department (following standard hospital protocol). the remaining sample was immediately submerged in 200 l of rnalater and stored at 20 c until processing. for patients undergoing cystectomy, an amount of tissue similar to that which would be collected at biopsy was harvested from the posterior bladder through a single scalpel incision and submerged in 200 l of rnalater and stored at 20 c in a similar fashion. bladder capacity data and cystoscopic findings for these subjects were retrieved from the patient 's last cystoscopy recording in the medical record and included in this analysis (table 1). for the purposes of this study, low bladder capacity was defined as 10.0 pmol cy3/g crna) was fragmented at 60 c for 30 min in a reaction volume of 250 ml containing 1 agilent fragmentation buffer and 2 agilent blocking agent following the manufacturer 's instructions. on completion of the fragmentation reaction, 250 ml of 2 agilent hybridization buffer was added to the fragmentation mixture and hybridized to sureprint human gene expression v2 microarrays (agilent technologies) containing 60-mers for 50,599 biological features for 17 h at 65 c in a rotating agilent hybridization oven. after hybridization, microarrays were washed 1 min at room temperature with ge wash buffer 1 (agilent) and 1 min with 37 c ge wash buffer 2 (agilent), then dried immediately by brief centrifugation. slides were scanned immediately after washing on the agilent dna microarray scanner (g2505b) using one color scan setting for 1 44 k array slides (scan area 61 21.6 mm, scan resolution 10 m, dye channel is set to green and green pmt is set to 100%). the scanned images were analyzed with feature extraction software 9.1 (agilent) using default parameters (protocol ge1-v1_91 and grid : 012391_d_20060331) to obtain background subtracted and spatially de - trended processed signal intensities. the anonymized clinical data were deposited in the gene expression omnibus database (geo http://www.ncbi.nlm.nih.gov/geo/ under accession number gse57560). following log transformation of the processed signal intensity data, principle component analysis (pca) and unsupervised hierarchical clustering were performed (qlucore omics explorer) to determine the similarity among samples within and between groups (fig. 2). further statistical analyses to measure differentially expressed transcripts (dets) unique to each phenotype were then performed by applying student 's t - test (change 1.5 ; p 0.05) for the pair - wise comparison (genesifter analysis edition 4.0) using benjamini and hochberg fdr correction. the list of dets generated from the pair - wise comparison (e.g. low bladder capacity versus normal bladder capacity) with an adjusted p 0.05 was imported into ingenuity pathway analysis software for gene ontology and pathway analysis. we demonstrate that low capacity and normal capacity ic / bps bladders have significantly different molecular characteristics, and this difference may reflect a fundamental difference in disease processes. meanwhile, ic / bps patients with normal bladder capacity exhibit similar molecular profiles to control subjects. given the promising results of this pilot study we are conducting further research into the correlation between molecular and clinical findings and the development of an ic / bps biomarker.	interstitial cystitis and bladder pain syndrome (ic / bps) are terms used to describe a heterogeneous chronic pelvic and bladder pain disorder. despite its significant prevalence, the disease etiology is not well understood and providing diagnosis and treatment can be challenging. in our study, published recently in the journal of urology (colaco., 2014), we describe the use of microarrays as a tool to characterize ic / bps and to determine if there are clinical factors that correlate with gene expression. this data - in - brief article describes the methodology for that study, including data analysis, in further detail. deposited data can be found in the gene expression omnibus (geo) database : gse57560.
epidemiological studies have documented a high impact and the profound effect that the disorder can have on an individual s quality of life. although migraine is a highly prevalent and disabling condition, it is underdiagnosed and undertreated [3, 4 ]. recent advances have been made in the management of migraine, but pharmacologic treatment options are still far from optimum, leaving many patients without pain - free treatments or with unpleasant side effects [5, 6 ]. nowadays, antiepileptic drugs (aeds) are increasingly used in migraine treatment [7, 8 ] ; in general, these agents are considered both effective in reducing attack frequency and reasonably well tolerated, although few robust trials are available for aeds other than divalproex sodium and topiramate [9, 10 ]. these are favored by level 1 evidence and clinical experiences as first - line preventive drugs for migraine [10, 11 ]. recently, other different aeds such as pregabalin are emerging in the prophylaxis of migraine [12, 13 ]. pregabalin is currently recommended for the treatment of partial seizures, pain associated with post - herpetic neuralgia, diabetic neuropathy, fibromyalgia and spinal cord damage, as well as in the treatment of generalized anxiety disorder [1416 ]. pregabalin, through binding to the alpha2-delta subunits of hyperexcited, voltage - gated calcium channels, reduces the calcium influx at neurons terminals and subsequently reduces the synaptic release of several excitatory neurotransmitters such as glutamate, noradrenaline and substance p. therefore, pregabalin restores the hyperexcited calcium channels to a normal state. pregabalin mechanism of action is coherent with the available data concerning glutamatergic mechanism in migraine physiopathology. the primary aim of this study was to evaluate the effectiveness of pregabalin in reducing migraine frequency ; secondarily, we aimed to investigate the safety and the tolerability of pregabalin. outpatients with a diagnosis of migraine according to international headache criteria (ichd ii), and regularly attending the neurological headache centre of s. andrea hospital in rome were considered during a period of 6 months. those patients eligible for prophylactic treatment (i.e., patients with 4 attacks per month) were asked to participate to this independent, uncontrolled, open - label, observational, prospective study. the exclusion criteria included an age younger than 18 years, medical or neurological disorders capable of causing headache, pregnancy, breast - feeding, and rescue medications overuse. an informed consent was obtained from each participant. following a 6-month period of wash - out after the last assumption of preventive agents, each eligible patient started pregabalin on a 75 mg / day dosage, which was titrated up to a maximum of 300 mg / day with a 75 mg increase per week, as tolerated. patients were allowed to use acute pain medications during the evaluation period, including triptans, non - steroidal anti - inflammatory drugs, and antiemetics, but not other preventive therapies. they were allowed to take only 15 acute pain medications per months to avoid medication overuse. clinical data and the frequency of migraine (measured as days with headache per month) were collected for a 3-month period before starting the therapy, and after 1 and 3 months of pregabalin treatment, by means of patient diaries or during the 1-month scheduled interviews. the occurrence of side effects or adverse events were also recorded at first and third month of pregabalin intake. to evaluate the efficacy of pregabalin all values are expressed as a mean standard deviation (sd), or interval, as appropriate. statistical differences over time in days with headache per month were analyzed using the univariate analysis of the variance (anova) for repeated measures. response rate in terms of proportion of patients with a 50% frequency reduction was also presented. all p values less than 0.05 (two - sided) were considered as significant. statistical analyses were carried out by using a pc version of the statistical package for social sciences 16.0 (spss, chicago, il, usa). to evaluate the efficacy of pregabalin, we performed an intention - to - treat analysis. all values are expressed as a mean standard deviation (sd), or interval, as appropriate. statistical differences over time in days with headache per month were analyzed using the univariate analysis of the variance (anova) for repeated measures. response rate in terms of proportion of patients with a 50% frequency reduction was also presented. all p values less than 0.05 (two - sided) were considered as significant. statistical analyses were carried out by using a pc version of the statistical package for social sciences 16.0 (spss, chicago, il, usa). forty - seven patients (10 males, 37 females) were included in the present study. the mean age at the study enrolment was 48.0 15.8 years (interval 2083 years). according to the ichd - ii criteria, 21 patients (45%) had a diagnosis of migraine without aura and 26 patients (55%) had a chronic migraine (i.e., patients with 15 days with headache per month) without overuse of symptomatic drugs. seven (15%) patients (six chronic and one episodic migraneurs) had a psychiatric comorbidity according to dsm - iv criteria (three affected by depression, four affected by anxiety). only seven patients (15%) had never used prophylactic treatment, while forty (85%) tried at least one drug for migraine prophylaxis (see table 1) before starting the pregabalin therapy. the migraine preventive medication class most commonly used was tricyclic antidepressants (38 patients, 95%), followed by anticonvulsants (34 patients, 85%), calcium - channel blockers (18 patients, 45%) and -blockers (10 patients, 25%).table 1migraine prophylactic drugs used before pregabalinmedication classdrugsno. of patients%antiepilepticstopiramate2050gabapentin2460valproic acid410-blockerspropanolol1025calcium - channel blockersflunarizine1537.5cinnarizine410antidepressantsamitriptyline3895 migraine prophylactic drugs used before pregabalin all patients started the pregabalin therapy at a dosage of 75 mg / day. the majority of patients (n = 33) had a dose increase within the first month of therapy : 30 patients achieved a daily dose of 150 mg, one patient 225 mg, and two patients 300 mg. these different dosages were achieved according to the pregabalin tolerability and the compliance of the patients the majority of patients did not reach the maximum daily dosage (300 mg) also because of the concerns regarding the potential side effects, or satisfactory response to lower dosages. eleven patients (23%) discontinued the pregabalin therapy after a mean time of 1.2 0.4 months because of lack of effectiveness (seven), occurrence of side effects (three) and economic reasons (one). a total of six patients (13%), all with a previous exposure to prophylactic drugs, reported one or more side effects during the intake of pregabalin ; three of them had tolerable and transient side effects (see also table 2). there was no relationship between the patientsdosage of pregabalin, or the time of titration, and the occurrence of side effects (data not shown).table 2side effects reported by patients treated with pregabalin (n = 6)sexagediagnosiscomorbid psychiatric disordersmaximum dosageside effectsf51migraine without auran75drowsinessblurred visionf78chronic migrainey150drowsinessconfusionf51chronic migrainen150drowsinessm51chronic migrainey150dizzinessf37migraine without auran150drowsinessfatiguef59chronic migrainen150drowsinessabdominal painall these six patients had previous exposure to prophylactic drugs side effects reported by patients treated with pregabalin (n = 6) all these six patients had previous exposure to prophylactic drugs a significant reduction in frequency (p < 0.001) was observed after 1 and 3 months of treatment compared to the baseline (32 and 31%, respectively) (fig. 1). when compared to the baseline value, 12 (26%) patients had a reduction equal or more than 50% in number of days with headache per month. overall, 28 patients (60%) had at least a 1/4 attack frequency decrease (table 3).fig. 1mean number of days with headache per month, with relative 95% confidence intervals, at different time point for the whole study population. p value < 0.001 (anova)table 3reduction in number of days with headache per month when compared to baseline valuepercentage of reductionpatients, n (%) 5012 (26)492516 (34)<2519 (40) mean number of days with headache per month, with relative 95% confidence intervals, at different time point for the whole study population. p value < 0.001 (anova) reduction in number of days with headache per month when compared to baseline value the significant reduction of attack frequency per month was similar (about 33%) between episodic (from 6.8 3.0 to 4.8 3.5) and chronic migraineurs (from 27.6 5.2 to 18.7 9.7). furthermore, the level of response to pregabalin was not influenced by sex, age, previous use of prophylactic drug, or comorbid psychiatric disorders (data not shown), but a greater reduction in days with headache per month was observed in the 33 patients who reached a daily dose of at least 150 mg (fig. 2). we did not observe any significant reduction in migraine frequency at first month in patients receiving a daily dose of 75 mg. on the contrary, patients treated with a dose 150 mg / day had beneficial effect even at first month, which was sustained at the end of the third month of therapy.fig. 2reduction of mean number of days with headache per month with respect to the increase in the dose at the 1-month visit. p < 0.001 for patients who increased (n = 33) and p = 0.08 for those who did not increase (n = 14) the pregabalin dose within the first month of treatment (anova) reduction of mean number of days with headache per month with respect to the increase in the dose at the 1-month visit. p < 0.001 for patients who increased (n = 33) and p = 0.08 for those who did not increase (n = 14) the pregabalin dose within the first month of treatment (anova) we found a significant reduction in mean days with headache per month when compared to baseline after 1 and 3 months of therapy. roughly, the one quarter of our study population had a response rate equal or more than 50% in terms of reduction of number of days with headache per month with respect to the baseline values. these findings are consistent with the modest, but clinically relevant improvement in attack frequency observed in another study of 30 chronic migraine subjects. we observed a more relevant and faster reduction of attack frequency in patients who reached a daily dose of 150 mg even in the first month. on the contrary, when the titration was slower, we found a delay in achieving a significant reduction in attack frequency, which was reached only at the third month of pregabalin therapy. our results also suggest that pregabalin is safe (no serious adverse events occurred in our population) and generally well tolerated. in our sample the dose or titration of pregabalin did not seem to be related to the occurrence of side effects, which occurred in only six (13%) patients assuming 150 mg / day. reported that pregabalin is well tolerated, but 33.3% of patients exhibited dose - dependant side effects, especially after dosage adjustment ; however, only two patients withdrew because of treatment - related adverse effects. aeds such as gabapentin and pregabalin may be better preventive therapies for old patients than the other therapeutic options, because of their low adverse effects on cardiovascular system and on mood disorders, such as anxiety and depression, that are very common in elderly. this explains the mean age range (2083 years) of the sample studied higher than that of trials about other preventive therapies. being an observational study, our findings suffer from some limitations, including an uncontrolled and open - label design and the small sample size. moreover, there was no evaluation of indirect measures regarding the efficacy of pregabalin, such as quantification of headache severity, or the number of rescue medications intake during the follow - up. despite limitations due to a small sample size and an uncontrolled, open - label design, the present study suggests that pregabalin may represent an efficacious and safe anti - migraine agent in both episodic and chronic migraine patients.	migraine is a common neurological disorder and epidemiological studies have documented its high social and economic impact. unfortunately, preventive treatment is often insufficient to substantially reduce migraine frequency or it is not well tolerated. antiepileptic drugs are increasingly used in migraine prevention. however, data on efficacy and tolerability of pregabalin in patients with migraine are still lacking. our aim was to evaluate efficacy and tolerability of pregabalin in patients with migraine. we recruited 47 patients who started pregabalin at 75 mg / day, which was titrated to 300 mg / day as tolerated. a total of six patients (13%) reported one or more side effects during the intake of pregabalin ; however, three of them discontinued pregabalin, because side effects were intolerable and persistent. statistically significant reduction in migraine frequency compared to baseline (p < 0.001) was evident after 1 and 3 months of treatment. a greater frequency reduction was observed in those patients who increased the dosage within the first month of therapy. our data suggest that pregabalin may be well tolerated and may represent an alternative preventive treatment in migraneurs. limitations of the present study were a small sample size and an uncontrolled, open - label design ; further randomized case control studies are warranted to confirm our findings.
jadb : assigned (as a medical student) to patient during hospitalization and participated in review of the literature, drafting, and editing of case report. jan : attending assigned to patient during hospitalization and performed editing of case report and final approval. sjs : provided nephrology consult during hospitalization and performed editing of case report and final approval.	key clinical messagesubcutaneous fat necrosis (sfn) in infants producing severe hypercalcemia is a lifethreatening emergency. pathophysiology may include enhanced gastrointestinal calcium absorption and bone resorption. we treated an infant with sfn and serum calcium of 15 mg / dl with prednisolone and lowdose zoledronic acid. serum calcium promptly normalized without rebound hypocalcemia, and redosing of zoledronic acid was not necessary.
it is reported that about 11000 patients are admitted to hospitals due to cervical spinal injury annually15) and around 75% of them require intubation and mechanical ventilation due to respiratory problems21). tracheostomy is required in 11 - 35% of patients with cervical spinal cord injury to maintain airway and to manage pulmonary complications and pulmonary hygiene1,2,13) and in 10% of icu patients for long - term mechanical ventilation (longer than 24 hours)8). patients with cervical spinal cord injury tend to require mechanical ventilation more often and for a longer period of time to manage frequently occurred respiratory problems and to effectively provide oxygen. this tendency is more prominent in patients with the upper spinal cord injury or severe spinal cord injury. the american consensus conference on artificial airways states that tracheostomy is preferred if mechanical ventilation is required longer than 21 days18). it improves pulmonary toilet and reduces the length of the breathing pathway and airway resistance. consequently, it reduces effort to breath and weaning of mechanical ventilation becomes easier and less problematic, reducing the length of time on mechanical ventilation. this study aimed to determine the optimal timing of tracheostomy and to evaluate the subsequent beneficial effects by comparing early tracheostomy (1 - 10 days) and late tracheostomy (> 10 days) in patients with spinal cord injury. this is a retrospective study conducted at neurosurgery department between august, 2003 and march, 2012. among a total of 254 patients with spinal cord injury, 21 patients who required tracheostomy and mechanical ventilation were selected. patients with traumatic cervical spinal cord injury were only included in this study and patients with degenerative spinal disease, spinal tumors, inflammatory disease such as myelitis were excluded from this study. spinal surgery was performed if required and the subjects were classified into two groups according the timing of tracheostomy. in most previous studies, early tracheostomy was defined as performed within 7 days and late tracheostomy as any time after the first week14). in this study, we defined early tracheostomy as performed within 10 days and late tracheostomy as more than 10 days. there were 10 patients in the early tracheostomy group and 11 patients in the late tracheostomy group. the severity of spinal cord injury was determined according to the classification of american spinal injury association (asia). the location of the injury, the total period of icu stay, the length of time on mechanical ventilation, the period of icu stay after tracheotomy, the period of hospital stay and tracheostomy complications of each group were compared to analyze the advantages and disadvantages of early tracheostomy and late tracheostomy (table 1). data was analyzed using fisher 's exact, mann - whitney u - test and binary logistic regression analysis. there were 10 patients in the early tracheostomy group and 11 patients in the late tracheostomy group. early tracheostomy was performed after 6.73.97 days and late tracheostomy was performed after 245.66 days. the mean age of the subjects was 50 years (18 - 88 years). there were 19 male and 2 female patients and the majority of them were between 40 years and 70 years old. there was no statistically significant difference in the demographic characteristics between the groups (p=0.328). the injury occurred at the cervical 1 - 2nd level in a patient, cervical 3 - 5th level in 16 patients and cervical 6 - 7th level in 4 patients. the severity of the injury was determined according to asia classification ; 8 patients were grade a ; 3 patients were grade b ; 9 patients were grade c ; 1 patient was grade d. there were no statistically significant differences in the location and the severity of the injury between the groups (p=0.781, 0.301) (table 2). among dependent variables, the total icu stay was significantly reduced in the early tracheostomy group comparing with the late tracheostomy group and the reduction was statistically significant (20.8 day vs. 38.0 day, p=0.010). the total length of time on mechanical ventilation was also significantly reduced in the early tracheostomy group comparing with the late tracheostomy group and the reduction was statistically significant (5.2 day vs. 29.2 day, p=0.009). this shows that there were correlation between early tracheostomy (within 10 days) and the length of time on mechanical ventilation and icu stay [odds ratio (or 1.134 ]. the length of icu stay after tracheostomy was shorter in the early tracheostomy group comparing with the late tracheostomy group (6 days vs. 15 days) but without statistical significance (p=0.597), and there was no statistically significant difference in the total length of hospital stay (p=0.291) (table 3). with respect to post - tracheostomy complications, the incidence of pneumonia was 40% in the early tracheostomy group and 82% in the late tracheostomy group but the difference was statistically not significant (p=0.283) (table 4). tracheal stenosis was reported in a case of late tracheostomy but the difference between the group was statistically not significant (p=0.999) (fig. endotracheal or nasotracheal intubation is often performed when patients with cervical spinal cord injury present with respiratory problems. however, the optimal time to perform tracheostomy after intubation remains controversial. previous studies, both animal experiments and clinical trials, reported that prolonged endotracheal intubation (longer than 7 days) resulted in severe laryngeal trauma4,19,22). in addition, activity is restricted in endotracheally or nasotracheally intubated patients due to ventilator tubing, which may compromise the emotional recovery of the patients. tracheostomy is required in 11 - 35% of patients with cervical spinal cord injury for the management of pulmonary complications and pulmonary hygiene21). in case of cervical spinal cord injury, motor innervation to the chest muscle involved in inspiration and expiration the diaphragm is innervated by the phrenic nerve which is formed from the cervical nerves c3, c4, and c517). therefore, injuries at these levels reduce motor impulses via the phrenic nerve and impair diaphragmatic function. spinal cord injury above the level of c5 also reduces the tidal volume and compromises the ability to clear respiratory secretions. in these patients spinal cord injury above the level of c5 is reported to the independent predictor for immediate mechanical ventilation5). tracheostomy reduces the length of breathing circuits, improves pulmonary toilet and reduces airway resistance. as a result, breathing and weaning of mechanical ventilation become easier and it is reported that early tracheostomy reduces the incidence of pneumonia in traumatic spinal cord injury12). however, tracheostomy is an invasive procedure causing fractures of cartilaginous rings, posterior tracheal wall injury, hemorrhage, pneumothorax, subcutaneous emphysema, mediastinitis, wound infection10) and the colonization around the tracheostomy. in a study analyzing 152 patients who underwent early tracheostomy within 7 days after spinal cord injury, javier romero.20) reported that early tracheostomy was advantageous reducing the length of time on mechanical ventilation, the length of icu stay and complications such as tracheal granulomas and concentric tracheal stenosis. nonetheless, early tracheostomy failed to reduce the risk of pneumonia related to mechanical ventilation and mortality. we retrospectively analyzed cases of prolonged intubation related to the use of steroids or anti - inflammatory agents due to various factors (medication, severe wound, hemorrhage) and cases of prolonged intubation due to pulmonary complications although extubation was attempted several times. the results showed that early tracheostomy performed within 10 days after intubation was still advantageous. although the 10-day - period is not absolutely long enough, we retrospectively reviewed the patients with spinal cord injury. in case of the patients whose tracheostomy was delayed due to the patient 's condition or situation, we reviewed the dates that fit into 10 days and checked statistically. statistically, there were some beneficial effects from tracheostomy performed within 10 days, even if we have small number of patients. although several previous studies reported that beneficial effects came out within 7 days, comparable advantages are still expected even if tracheostomy is slightly delayed due to the unavoidable reasons according to the results (< 10 days) of this study. this study demonstrated that early tracheostomy performed within 10 days after intubation significantly reduced the total icu stay (20.8 day vs. 38.0 day, p=0.010) and the length of time on mechanical ventilation (5.2 day vs. 29.2 day, p=0.009). the icu stay after tracheostomy was reduced more than a week (6 day vs. 15 day). a previous study conducted with patient who underwent anterior cervical spine fixation reported that there were no complications related to early tracheostomy performed within 6 - 10 days such as wound infection, and the need for tracheostomy increased 3 times more in patients with spinal cord injury comparing to patients without spinal cord injury16). in our study, all patients underwent spinal surgery, and tracheostomy was determined afterwards depending on the clinical condition of the subjects. surgical outcomes of the patients who had early tracheostomy (within 10 days) were satisfactory. another study conducted with patients with severe traumatic head injury also reported that early tracheostomy (< 7 days) reduced the length of time on mechanical ventilation, the incidence of pneumonia and the length of icu stay3). a recent meta - analysis reported that early tracheostomy reduced the length of time on mechanical ventilation and icu stay but there was no significant difference in the incidence of pneumonia and mortality10). furthermore, tracheostomy after anterior cervical discectomy and fusion did not increase the postoperative infection rate. we dichotomized between the early (1 - 10 days) and the late (after 10 days) tracheostomy group. complications that can occur after tracheostomy are pneumonia, cartilaginous ring fracture, pneumothorax, subcutaneous emphysema, tracheal stenosis and infection9). in our study, pneumonia was the most prevalent complication and the incidence of pneumonia was reduced more than 2 times in the early tracheostomy group comparing to the late tracheostomy group (40% vs. 82%), but there was no statistical significance (p=0.283). a case of tracheal stenosis was reported in the late tracheostomy group and the management of the patients in the late tracheostomy group was more challenging than the patients in the early tracheostomy group. despite some variations, this study was a single - center retrospective study and selection bias might have possibly occurred during the selection of the subjects. despite of these limitations, we believe that early tracheostomy performed within at least 10 days is beneficial to patients with spinal cord injury. we suggest early tracheostomy (within at least 10 days) since it has beneficial effects on the management of patients with cervical spinal cord injury requiring long - term mechanical ventilation by facilitating mechanical ventilation and reducing the length of icu stay and complications related to intubation.	objectivethis study aimed to determine the optimal time for tracheostomy by evaluating the benefits and safety of early versus late tracheostomy in spinal cord injury (sci) patients.methodswe retrospectively reviewed a total of 254 patients with spinal cord injury. of them, we selected 21 spinal cord injury patients who required tracheostomy due to long - term mechanical ventilation and analyzed their medical records. the patients were categorized into two groups. early tracheostomy was performed day 1 - 10 from intubation in 10 patients and the late tracheostomy was performed after day 10 in 11 cases. we also evaluated the duration of mechanical ventilation, stay in the icu and complications related to tracheostomy, the injury level of and clinical severity. all data was analyzed using spss 18.0/win.resultsthe early tracheostomy offered clear advantages for shortening the total icu stay (20.8 day vs. 38.0 day, p=0.010). there was also statistically significant reduction in the total length of time on mechanical ventilation (5.2 day vs. 29.2 day, p=0.009). however, the reductions in the incidence of pneumonia (40% vs. 82%) and the length of icu stay post to tracheostomy (6 day vs. 15 day) were found to be statistically not significant. there were also no statistically significant differences in the injury level and clinical severity between the groups.conclusionwe concluded that the early tracheostomy (at least 10 days) is beneficial for sci patients who are likely to require prolonged mechanical ventilation.
hepatocyte nuclear factor 4a (hnf4a) is an orphan member of the nuclear receptor family of transcription factors (1). it is expressed primarily in the liver, gut, kidney and pancreas and has important role during embryonic life in pancreatic development and maintaining of cell function (2). indeed, knockout studies found that hnf4a/ mice revealed impaired gastrulation and died around day e9 (3). the hnf4a protein consists of five functional domains : an n - terminal activation function (af-1, also referred to as a / b domain), two zinc fingers responsible for dna binding (c domain), a potential ligand binding domain (e domain) and the f domain (1). hnf4a gene (ensg00000101076) has many transcripts. the enst00000316099 transcript is considered the canonical transcript that codes the isoform hnf4-alpha-1 with 474 amino - acids (p41235 - 1). mutations in hnf4a gene are responsible of mody-1 (maturity - onset diabetes of the young type 1) (omim#125850) and neonatal hyperinsulinism hypoglycemia (5, 6). to date, about 103 hnf4a inactivating mutations were reported in 173 mody families (7). some hnf4a variants were found to be associated with type 2 diabetes (t2d) (8). t2d is a chronic disorder of glucose metabolism, characterized by a state of hyperglycemia due to defective insulin secretion, peripheral insulin resistance and increased hepatic glucose production (9). genetic and environmental factors, contribute to the appearance of t2d (10). whereas, mody is a dominantly inherited form of early - onset type 2 diabetes (t2d), generally diagnosed in childhood, adolescence or young adulthood (11). it is a rare monogenic disease caused by primary defects of insulin secretion with a lack of auto - antibodies against the pancreatic cells and is rarely associated with obesity (11). the nm_000457.4 : c.1387a > g or hnf4a - p.i463v mutation (rs147638455 or cm993900), also known as p.i431v and p.i453v depending on the corresponding gene s isoform, was previously found in a caucasian and a tunisian families suspected of mody (12, 13). but, it remains unclear whether this variant is a mutation responsible for mody-1 or a polymorphism. in the case of a molecular diagnosis of mody-1, finding hnf4a - p.i463v would be confusing : should we consider it as a mutation ? in this report, we present a simple and easy protocol to screen hnf4a - p.i463v variant. we also assessed its frequency in tunisian north - african population and discussed its probable effect. two hundred anonymous unrelated healthy controls were recruited in 2013 from the blood transfusion center of sousse (tunisia). they were examined by the physician of the center and were found not diabetic and did not present any other disease. the study was carried out after taking informed written consent from all individuals and after approval of the ethics committee of farhat hached university hospital. first, hnf4a exon 10 including exon - intron boundaries was amplified by pcr using the following primers f : 5 ttt act ccc aca aag gct gg 3 and r : 5 atc acc agg tgc tct ctt ag 3. pcr was performed in a 50 l volume containing 50 ng of genomic dna, 20 pmol of each primer and 1 u of recombinant dna polymerase (invitrogen, carlsbad, ca, usa). fifteen l of pcr product were mixed with 2l bsa, 2l buffer, 5.75 l sterilized water and digested by 2.5 u of foki restriction enzyme (takara bio inc, otsu, shiga, japan).the digested pcr products were then separated on 2.5% agarose gel. thus, the wild fragment (266 bp) is cut into 164 bp and102 bp fragments. finally, in case of mutation detection, direct sequencing was used to confirm it. the p.i463v substitution was studied in - silico to predict the putative effect on protein function. we performed in - silico analysis using two different types of software : polyphen2 (http://genetics.bwh.harvard.edu/pph2/index.shtml) and mutation t@sting (http://www.mutationtaster.org/). these bioinformatics tools enable high - throughput prediction of the potential impact of residue changes and large - scale polymorphism analyses. polyphen and mutation t@sting predict possible impact of an amino acid substitution on the structure and function of a human protein using straight forward physical and comparative considerations (14, 15). two hundred anonymous unrelated healthy controls were recruited in 2013 from the blood transfusion center of sousse (tunisia). they were examined by the physician of the center and were found not diabetic and did not present any other disease. the study was carried out after taking informed written consent from all individuals and after approval of the ethics committee of farhat hached university hospital. first, hnf4a exon 10 including exon - intron boundaries was amplified by pcr using the following primers f : 5 ttt act ccc aca aag gct gg 3 and r : 5 atc acc agg tgc tct ctt ag 3. pcr was performed in a 50 l volume containing 50 ng of genomic dna, 20 pmol of each primer and 1 u of recombinant dna polymerase (invitrogen, carlsbad, ca, usa). fifteen l of pcr product were mixed with 2l bsa, 2l buffer, 5.75 l sterilized water and digested by 2.5 u of foki restriction enzyme (takara bio inc, otsu, shiga, japan).the digested pcr products were then separated on 2.5% agarose gel. thus, the wild fragment (266 bp) is cut into 164 bp and102 bp fragments. finally, in case of mutation detection, direct sequencing was used to confirm it. the p.i463v substitution was studied in - silico to predict the putative effect on protein function. we performed in - silico analysis using two different types of software : polyphen2 (http://genetics.bwh.harvard.edu/pph2/index.shtml) and mutation t@sting (http://www.mutationtaster.org/). these bioinformatics tools enable high - throughput prediction of the potential impact of residue changes and large - scale polymorphism analyses. polyphen and mutation t@sting predict possible impact of an amino acid substitution on the structure and function of a human protein using straight forward physical and comparative considerations (14, 15). the assessment of hnf4a - p.i463v variant in 200 healthy tunisian people by rlfp - pcr method found that 3 controls (1.5%) were carriers of this mutation. hnf4a - p.i463v variant detected after sequencing and enzymatic digestion by foki restriction enzyme a : gel electrophoresis of hnf4a exon 10 (266 bp) before digestion by foki restriction enzyme in 9 controls. b : gel electrophoresis of hnf4a exon 10 after digestion by foki restriction enzyme into 2 fragments (164 and 102 bp) in 7 controls. c : chromatograph of a part of hnf4a exon 10 sequence showing the c.1387a > g / p.i463v mutation the tunisian population of this study is in hardy - weinberg equilibrium (table 1). the frequency of hnf4a - p.i463v is rare in the other populations. indeed, this variant is more frequent in the tunisian population than the european and african american populations. rs147638455 frequency in different populations exome sequencing project, csagilent (dbsnp 138), : the tunisian population is in hardy - weinberg equilibrium (p=0.91 > 0.05) polyphen2 predicted that this nucleotide change is a polymorphism with a score of 0.144 [01 ]. while, the mutation t@sting software indicated that this variant could be responsible of a probably affected protein. the assessment of hnf4a - p.i463v variant in 200 healthy tunisian people by rlfp - pcr method found that 3 controls (1.5%) were carriers of this mutation. hnf4a - p.i463v variant detected after sequencing and enzymatic digestion by foki restriction enzyme a : gel electrophoresis of hnf4a exon 10 (266 bp) before digestion by foki restriction enzyme in 9 controls. b : gel electrophoresis of hnf4a exon 10 after digestion by foki restriction enzyme into 2 fragments (164 and 102 bp) in 7 controls. c : chromatograph of a part of hnf4a exon 10 sequence showing the c.1387a > g / p.i463v mutation the tunisian population of this study is in hardy - weinberg equilibrium (table 1). indeed, this variant is more frequent in the tunisian population than the european and african american populations. rs147638455 frequency in different populations exome sequencing project, csagilent (dbsnp 138), : the tunisian population is in hardy - weinberg equilibrium (p=0.91 > 0.05) polyphen2 predicted that this nucleotide change is a polymorphism with a score of 0.144 [01 ]. while, the mutation t@sting software indicated that this variant could be responsible of a probably affected protein. performing a molecular diagnosis of monogenic diabetes is not an easy task because of its clinical and genetic heterogeneity (16). some genetic variants could also be problematic such as hnf4a - p.i463v. in an earlier study, we found that hnf4a - p.i463v cosegregated with diabetes phenotype in a tunisian family (fig. 2 and table 2). it was present in three patients from this family and was absent in two other non - affected relatives (13). contrariwise, this variant did nt show a perfect cosegregation in a caucasian family (12). hitherto, there is not enough information in the literature about hnf4a - p.i463v variant (rs147638455). it is not clear whether it is a mutation directly causing mody-1 or just a non - synonymous polymorphism with low effect. the clinical characteristics of the reported hnf4a - p.i463v carriers na : not applicable, nf : not found, oha = oral hypoglycemic agents, ins : insulin the diabetic caucasian and tunisian families having hnf4a - p.i463v variant filled and open symbols represent diabetic subjects and normal glucose tolerance individuals, respectively. below the numbers, it is the genotype at codon i463v : n, normal allele (isoleucine) ; m, mutant allele (valine). below the genotype is the diagnostic age of diabetes for affected members and age at examination, followed by the treatment for diabetes (oha : oral hypoglycemic agents and ins : insulin). hnf4a - p.i463v a variant with interesting characteristics this variant occurs in a conserved region across species (phylop score = 4.56 [14.1 ; 6.4 ]) and is localized in the f domain of hnf4a (fig. 3). this domain plays a role in the protein transactivation activity (17). isoleucine amino - acid in position 463 is conserved across species a portion of hnf4a exon 10 amino - acid sequence is compared between various species. the human isoleucine at codon 463 and isoleucine of other species are framed in a red box. the species are annotated in bold and the ncbi accession numbers in blue hnf4a - p.i463v variant could not be responsible for mody-1 using a simple protocol of screening for hnf4a - p.i463v variant (rs147638455), we detected it in three healthy controls out of 200 tunisian unrelated healthy individuals (400 chromosomes). indeed, it is an unexpected high carrier frequency (1.5%) in this sample compared with the other populations (table 1). the healthy controls carriers of rs147638455 in our population are aged 20, 26 and 37 years (table 2). even if we omit the 20 year - old control individual, the rs147638455 frequency would remain high for a mutation (1%). in other ethnic populations, rs14763845 was rarely found in healthy individuals (table 1). if we suppose that this variant is responsible for mody-1, which is a rare monogenic disease, tunisian frequency, argues against this hypothesis. on the other hand, the in silico analysis using mutation t@ster and polyphen2 showed conflicting results. in parallel, physicochemical difference between isoleucine and valine amino - acids is small (grantham distance = 29 [0215 ]). in addition to the absence of a cosegregation of hnf4a - p.i463v variant in the caucasian family, the tunisian family suspected of mody had a mean age of diabetes diagnosis of 38 10.58 years old (13) (table 2 and fig. otherwise, a previous study showed that patients with mutations in hnf4a exons 9 and 10 developed diabetes later than those with mutations in exons 28 did(4). so, mutations in exons 9 and 10 could not be responsible for mody-1 (1). speculations about the effect of this variant and its implication in type 2 diabetes hnf4a - p.i463v could act in an interactive polymorphisms network leading to t2d. at that time, the relatively young age of our healthy carriers (20, 26 and 37 years old) does not definitely mean that they will not present t2d later. a similar missense mutation in the f domain (hnf4a - p.v393i localized in exon 9) was found in a french diabetic family diagnosed at the age of 45 years. hnf4a - p.v393i was associated with a marked reduction of transactivation activity responsible for impaired insulin secretion and co - segregated with diabetes (18). it is of note that some non diabetic individuals aged between 30 and 40 year - old were carriers of hnf4a - p.v393i (18). indeed, most of the patients that carry hnf4a - p.i463v variant are over 30 years (table 2) association and functional studies should be carried out, to assess the exact effect of hnf4a - p.i463v variant. meantime, we recommend to do not consider hnf4a - p.i463v as a mutation in case of molecular diagnostic of mody. this recommendation is based on the high frequency of this variant in the tunisian population, its presence in healthy persons and the conflicting results of the in silico analysis. we can speculate that hnf4a - p.i463v is a polymorphism with possible role in t2d and not a causal mutation implicated directly in mody-1. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.	background : hnf4a - p.i463vvariant, reported previously in two distinct families suspected of mody-1, is assessed in this report to determine whether it is a mutation or a polymorphism (frequency > 1%).methods:200 tunisian healthy people were screened for the presence of hnf4a - p.i463v variant, using rflp - pcr technique and sequencing. then, the frequency of this variant was estimated in the tunisian population and compared to other populations registered in genetic databases. we also performed in - silico analysis using polyphen2 and mutation t@sting softwares to assess the probable effect of hnf4a - p.i463v variant.results:hnf4a-p.i463v had a rare frequency in different populations and was found in 3 control subjects (1.5%) of the studied population. polyphen2 predicted that it is a polymorphism, whereas mutation t@sting suggested a probably affected mutant protein.conclusion:hnf4a-p.i463v has a relatively high frequency (> 1%) in our control cohort. it is also present in different ethnicities and in- silico analysis showed conflicting results. for these reasons, hnf4a - p.i463v should not be considered as a mutation responsible for mody-1.
the field of assisted reproductive technology (art) is advancing day by day with newer laboratory techniques being discovered. the area of cryopreservation is one of them. till date, it has been possible to freeze sperms and embryos for many years, but successful pregnancies from oocytes have been elusive with only few hundred live births worldwide. oocyte cryopreservation has gained more attention in art, especially because synchronization between recipient and donor need not be compulsory in the donor oocyte programme, other indications being pre - chemotherapy preservation of fertility, premature ovarian failure, and postponement of childbearing function. the success rates in oocyte cryopreservation have been cited as low and are debatable, with literature review of 21 studies in peer - reviewed journals revealing a mean survival rate of 47%, fertilization rate of 52.5% and mean pregnancy rate / thawed oocyte being 1.521.8%. the patient was a 29 year old, with a previous bad obstetric history and an abnormal karyotype (46xx, t[3:9 ] [p21.3;p24 ], t [7:10 ] [p22;q22.1 ]), which necessitated the use of donor oocytes for the present conception. the reason for the use of frozen oocytes sourced from egg - sharing and egg - donation patients was the non - availability of compatible fresh donors and insistence of the couple to continue the treatment cycle. the couple was then counseled about the use of frozen thawed oocytes and the expected low success rate for this cycle after obtaining informed consent. freezing was initiated 12 h post - retrieval, after denuding the cumulus with hyaluronidase and confirming metaphase - ii maturity status. cook 's oocyte freezing media (cook medical, queensland, australia) was used after warming the required quantity to room temperature, the active cryoprotectants being propanediol in increasing concentrations from 0.75 to 1.5 mol / l (solutions 1 and 2 for 7min and 30 s, respectively) and then transferred to solution 3 containing 1.5 mol / l propanediol and 0.2 mol / l sucrose [figure 1 ] for 5 min. the oocytes were loaded into pre - labeled straws (cryo - bio systems, rocket medical plc, washington, england), plugged and placed into the cryochamber (planer kryo 360, planer products ltd, burnsville, usa). the initial chamber temperature at + 20c was slowly cooled to 8c at the rate of 2c / min. seeding was manually performed at 8c. after a hold time of 10min at 8c, the straws were cooled slowly to 30c at a rate of 0.3c / min and then rapidly to 150c at a rate of 50c / min. after 10 min of stabilization, the oocytes were subjected to cryopreservation for 6 months. because a suitable fresh donor was unavailable for this particular patient, we were able to use the cryopreserved oocytes for this couple. the endometrium was prepared with incremental doses of estrogen (estradiol valerate 2 mg ; german remedies, mumbai, india) commencing from day 2 or day 3 of the cycle to a maximum of 8mg / day with initiation of micronised progesterone 400 mg thrice a day, from the day before thawing. the optimum endometrium for transfer was considered to be 10 mm, which was observed in mid - cycle. we decided to thaw at least 10 oocytes in order to enhance the chances of achieving enough good - grade embryos for transfer, success having evaded us earlier. for the thawing process, the straws containing the oocytes were removed from the liquid nitrogen, air dried for 30s, and then immersed in a water bath at 30c for 40s. the oocytes were first passed through solutions 12 containing cryobuffer supplemented with decreasing concentration of propanediol (1.00.5mol / l) and increasing concentration of sucrose (0.20.3mol / l) for 5 min at room temperature, respectively. the oocytes were then transferred to solution 3 (0.3 mol / l sucrose) for 10 min at room temperature followed by 37c on a warmer plate. a survival check carried out under the inverted microscope revealed eight oocytes that survived the thawing process [figure 2 ]. oocytes with intact zona, clear perivitelline space, and visible polar body were considered as normal and were further cultured in the cleavage media (quinn 's, sage in vitro fertilization, trumbull ct, usa) at 37c and 5% co2 for 2 h before injection. subsequently, the oocytes were injected with frozen thawed and prepared sample of husband 's sperms. intracytoplasmic sperm injection [figures 3 and 4][49 ] was the preferred method for fertilization, owing to an expected zona hardening following oocyte cryopreservation. the injected oocytes were further cultured in cleavage media in a trigas incubator until pronucleus check 1618h later. iii) [figures 5 and 6 ] were observed and transferred on day 2 using a labotect catheter (labotect gmbh, gottinggen, germany). the assessment of embryo grading was performed as described by veeck l. why five and not the recommended three embryos ? well, considering our previous experience of inadequate embryos for transfer following thawing and negative result for pregnancy, we decided to transfer at least five of this crop, which, as we mentioned, did not have the conventional cleavage or grade as expected (i.e., four cells, grade i once the serum -hcg was positive, an ultrasound on the 38 day revealed a single intrauterine gestational sac. since then she progressed uneventfully, with early fetal screening tests being normal until the 5 month, when she was diagnosed with mild pregnancy - induced hypertension and was treated with anti - hypertensives. during her level-2 scan at 22 weeks, where the fetal screening was normal, a shortened cervix of 1.5 cm was imaged, suggestive of cervical incompetence. since then, she was admitted with us for careful surveillance of both the mother and the baby. she did moderate physical activities and her blood pressure was well controlled with anti - hypertensives. she delivered a healthy male baby weighing 2.54 kg [figure 7 ]. both the mother and the baby were discharged uneventfully. a general follow - up at 3 months showed normal development for age [figure 8 ]. we started oocyte freezing in the month of november 2005 and since then have frozen more than 100 oocytes [table 1 ]. the only media available were the irvine scientific vitrification media and cook media and there was a learning curve to be able to successfully freeze and retrieve oocytes. however, in the initial phase of vitrification with irvine scientific media, close to 10 oocytes of different patient were frozen at the germinal vesicle and metaphase i, with three maturing to metaphase ii in in vitro maturation, but no fertilization. subsequent reports of series of pregnancies and live births have confirmed that mature oocyte cryopreservation is now a viable option in appropriate circumstances. other recent reports show that several babies have been born using oocyte cryopreservation and similar freezing and thawing procedures (slow freezing and rapid thawing). there is still ongoing research with regard to the optimum media and preference of freezing techniques like slow freeze or vitrification, the latter showing promising results. in our experience, the slow freeze method seemed to offer better retrieval rates (74%) and fertilization rates (62%), although vitrification, according to the literature review, seems to offer comparable or even better clinical outcomes. oocyte freezing can be welcomed as an emerging and useful technique, especially in donor programmes and in young women with cancer for fertility preservation options. worldwide, there have been only few hundred babies born through this technique owing to the sensitive morphology and cryokinetics of the oocyte. while we still conduct comparative research between the two freezing methods, namely slow freezing and vitrification, this little bundle of joy signals yet another landmark achievement for our country while serving as a ray of hope to many young women in need of oocyte freezing technology.	we report the first pregnancy and birth in india after the transfer of embryos generated from frozen thawed oocytes. a 29-year - old woman with previous bad obstetric history and an abnormal karyotype, necessitating donor oocyte programme. embryos were generated by microinjection of frozen thawed sperms into thawed human oocytes (intracytoplasmic sperm injection). this resulted in an healthy male baby with a birth weight of 2.54 kg which was born by cesarean section at 3536 weeks of gestation with normal follow - up. thus oocyte cryopreservation can be performed with reproducible success leading to a viable offspring.
their mean age was 21.20 years (standard deviation [sd ] = 1.46 ; range 1824 years of age). the study followed the tenets of the declaration of helsinki and informed consent was obtained from all subjects after an explanation of the nature and possible consequences of the study. all subjects had best - corrected visual acuity of at least 6/6 in each eye at both 6 m and 40 cm. subjects were excluded from the study if they demonstrated any of the following : (i) strabismus at 6 m or 40 cm (as assessed by the cover test) ; (ii) pu accommodative amplitude below the normal range as quantified by hofstetter 's equations ; (iii) lag of accommodation (assessed using monocular estimate method retinoscopy at 40 cm) outside the range of + 0.25 to + 0.75 d ; (iv) monocular accommodative facility 1.75 d ; (vi) any history of ocular trauma, ocular disease, refractive surgery, or aphakia. the order of testing, i.e. whether the 33 or 40 cm distance was tested first, was alternated across subjects. all testing was performed on the subject 's dominant eye (as determined by the hole in the card test) while the nondominant eye was occluded. for testing at 40 cm, subjects viewed the middle letter within a row of 20/30 letters (corresponding to a visual acuity of 40/60 or a decimal equivalent of 0.67). using lenses mounted in a trial frame, ml power was added in 0.25 d steps on top of the subjective refractive correction until the letter first became slightly blurry and could not be cleared by the subject. subjects were allowed up to 510 s for each lens presentation to clear the letters. at the first noticeable blur point, the subjects were asked to try with maximal accommodation expended and clear the print to sure reaching to the end point. the near acuity chart was positioned on a reading stand perpendicular to the line of sight of the subject with a luminance of approximately 50 cd / m. the same procedure was used for testing at 33 cm, except a row of 20/25 letters was used (corresponding to a visual acuity of 33/50 or a decimal equivalent of 0.67). thus, the target selected subtended an angle of 7.5 min of arc at both 33 and 40 cm, respectively. the aa was calculated as the amount of ml power added before the subject reported the first slight sustained blur, plus the dioptric value of the test distance (2.50 d or 3.00 d). to determine the repeatability of the procedure, these measurements were repeated for both target distances after a time interval of at least 24 h but not more than 48 h after the first measurement. for pu amplitudes, the same 20/30 row of letters was placed at a distance of about 75 cm and was moved slowly toward subject. subjects were requested to keep the target as clear as possible to get to the point of first sustained blur. the distance between target and the spectacle plane was measured with a millimeter ruler and converted to diopters. altman method was used to assess the agreement between the viewing distances taking into account of the replicates. the limits of agreement were determined as the mean difference 1.96 times the sd of the differences (sd), calculated by means of a mixed model with the interactions between subjects and distance and between subjects and replicates as random factors, owing to the fact that the replicates are nonexchangeable within each method ; in the above mixed model, have been included subject and distance as factor with distance as a fixed factor. furthermore, the 95% confidence intervals of the upper and lower limits of agreement were calculated as the limits of agreement 1.96 the standard error. for this purpose, the standard error of these limits was calculated from the formula 3sd / n, where n is the sample size and sd is the standard deviation of the differences. the presence of a proportional error has been assessed by testing the pearson 's correlation coefficient between the differences on the first replicates of the two distances and their mean ; in addition, the same analysis has been carried out on the last replicates and on the difference between the means of the replicates and their mean. intraclass correlation coefficients together with their 95% confidence intervals (cis) have been calculated for the two measurements (first and second) at each distance to evaluate the repeatability for each method that, in addition, has been quantified by the usual formula of 2 2sd where sd is the sum of the variance of the replicates at each distance and of the interaction subject by replicates. the mean spherical equivalent refractive error for the dominant eye was 1.56 d (sd = 1.12 ; range = plano to 3.00). the mean (sd) for the pu technique was 10.70 d (1.01) in all subjects and separately in females and males were 10.80 d (1.04) and 10.56 d (0.96), respectively (p = 0.21). mean values of aa measured using the ml technique, the limits of agreement, and the confidence limits at the two working distances are presented in table 1. mean values of the accommodative amplitude using minus lens method (d), the limits of agreement and confidence limits at the two working distances tested (n=240) the agreement band is 2.72 (from 2.72 to 0.19) that is about the 29% of the mean of the two replicates at the two considered distances and consequently, it has to be considered too wide for claiming between the agreement of the measurement at 33 and 40 cm. in addition, the presence of a proportional measurement error turned out to be not statistically significant (p = 0.5093 first measurement, p = 0.2994, second measurement, and p = 0.9735, mean of the measurements). the aa measured with the target at 33 cm was significantly (p < 0.001) higher than that measured with the target at 40 cm, by on average 1.17 d [fig. 1 ]. altman plot showing the difference between the measurements of amplitude of accommodation at the two test distances as a function of the mean finding (n = 240, two measurements for each subjects). the mean difference is shown by the solid horizontal line, while the 95% limits of agreement are indicated by the dashed horizontal lines the mean and sd of accommodative amplitude measured by the pu method were 10.70 1.01 d (95% ci : 10.5110.88). the mean difference of the pu amplitude with the ml amplitude measured at 33 cm and 40 cm was 0.67 1.55 d (95% ci : 0.390.95) and 1.84 1.51 d (95% ci : 1.502.11), respectively. table 2 shows mean, sd, mean difference, and the repeatability of the repeated measurements of accommodative amplitudes at the two distances. repeatability between the repeated measurements of the amplitude of accommodation with the minus lens method at 40 and 33 cm (n=120) the mean differences between the two trials were different for the two viewing distances (0.24 d for distance 33 cm and 0.16 d for 40 cm) and the coefficient of repeatability (cor) was higher for the 33 cm (1.24 d) when compared with the 40 cm test distance (0.99 d). a significant correlation was observed between the first and second readings at both distances 33 cm (r = 0.77 ; p < 0.001) and 40 cm (r = 0.86 ; p < 0.001) as expected. the results of the present study demonstrated a significantly higher mean ml aa when tested at 33 cm, compared with the value obtained at 40 cm (mean difference = 1.17 d). it seems likely that a large proportion of this difference is due to a greater proximally induced accommodative response at the closer viewing distance (note : the term proximally induced accommodation is chosen since this is likely to include both proximal accommodation and proximal vergence driving convergence accommodation). in addition, the repeatability of the measurements was superior at the farther distance, with a cor of 1.24 d and 0.99 d being recorded at 33 and 40 cm, respectively. the mean aa results found in this study were similar to previous studies using the ml procedure at 40 cm and at 33 cm, while the cors determined in this study at either distance were generally smaller compared to previous reports. if the goal of the aa procedure is to achieve maximum accommodation, then using a closer viewing distance is preferable. given that greater proximally induced accommodation will become manifest at even shorter distances, one might speculate that even closer viewing distances are preferable. when working at more proximal distances, the target will subtend a larger angle at the eye, and given the reduced blur sensitivity with larger targets, an increased aa may simply reflect the failure of the subject to perceive target blur resulting in a delayed endpoint rather than increased accommodation. an additional factor to consider it is well established that the pupil diameter decreases concurrent with an increase in accommodation. however, phillips. showed minimal change in pupil size when accommodation was stimulated with blur - driven accommodation alone. they suggested that cues such as target size and/or proximity may be a more significant stimulus. accordingly, one might speculate that testing at a closer viewing distance may result in a smaller pupil diameter (and therefore larger depth of focus) when compared with a longer distance. such an increase in depth of focus would delay the perception of blur, thereby resulting in a higher measurement of aa. it should also be noted that all subjective methods for assessing the aa overestimate the maximum accommodation as a result of the depth of focus of the eye, when compared with objective techniques that measure the actual change in response, such as the use of an autorefractor or dynamic retinoscopy. in confirming this results, anderson and stuebing investigated the differences between objective measures of aa as compared to subjective aa measures (pu or mls) and mentioned that the objective measured amplitude is substantially less than the subjective pu technique. wold. suggested that while subjective measurements of the aa are not adequate for assessing the change in the optical power of the eye, they may provide a useful assessment of near reading ability. for example, a common clinical procedure to determine a near addition lens is to calculate the difference between the required stimulus (in diopters) and 50% of the subjective amplitude. it is also worth considering why 40 cm (16 inches) has been widely chosen as the standard near test distance and whether this is still appropriate given modern near - vision demands. while this value is often quoted as a typical near viewing distance for adults, wittenberg and grolman examined the accommodative demand for a range of 23 occupations and reported mean values ranging from 1.50 to 4.63 d, with an overall range between 1.38 and 6.50 d (equivalent to viewing distances between 15 and 72 cm). further, an examination of children between 6.4 and 10.75 years of age found mean habitual reading and writing distances of 27.2 and 27.7 cm, respectively. in addition, the use of modern technology such as smartphones has also changed viewing conditions. a recent study showed that the mean viewing distance when reading an internet web page on a smartphone was 32.2 cm, with a range from 19.0 to 60.0 cm. accordingly, the use of 40 cm as a near test distance for all subjects may no longer be appropriate that is in contrast with the current study which indicate better repeatability of the measurements at 40 cm. these results indicate that although testing the ml aa at 33 cm produces a higher response, greater test repeatability was observed with testing at 40 cm. however, it is unclear whether the larger amplitude reflects a larger increase in accommodation or a decrease in the ability to perceive the first slight sustained blur. further studies to evaluate the optimal distance for performing this standard clinical procedure would be valuable. hence, it will be a good idea to include various distances, and this way to evaluate the effect of different parameters, such as blur sensitivity and proximal accommodation, to determine that which factor (s) has (have) the most effect on the measurement of the aa with this method.	purpose : the purpose of this study was to compare the mean findings and the repeatability of the minus lens (ml) amplitude of accommodation (aa) at 33 cm and 40 cm.materials and methods : aa was measured from the dominant eye of 120 fully corrected subjects using the ml procedure when viewing the target at both 33 and 40 cm. each measurement was repeated between 24 and 48 hours after the first trial.results:mean aa when tested at 33 cm and 40 cm was 10.20 diopter (d) (standard deviation [sd ] = 1.24) and 8.85 d (sd = 1.23), respectively (p < 0.001). the limits of agreement of the measured amplitude calculated with taking into account of the replicates at 33 and 40 cm were 0.19 (95% confidence interval [ci ] : 0.34 to 0.04) and 2.53 (95% ci : 2.38 to 2.68), respectively. the repeatability of testing at the two distances 33 and 40 cm was 1.24 and 0.99, respectively. in addition, the retest reliability of measured amplitude using the intraclass correlation coefficient was 0.87 (95% ci : 0.7890.920) at 33 cm and 0.91 (95% ci : 0.8720.945) at 40 cm.conclusion:there is no agreement in the obtained amplitude at the two measurement distances. testing the ml aa at 40 cm may be superior given that a lower repeatability coefficient was observed. however, it is unclear whether the larger amplitude measured at 33 cm reflects a larger increase in accommodation (greater proximity effect) or a decrease in the ability to perceive the first slight sustained blur.
individuals affected by multimorbidity report multiple barriers to self - care, including the compound effects of medications, difficulties in coordinating multiple medications, the total burden of medications, and financial challenges. 15) to treatment, further reducing the benefits of therapies, which are only partially effective. for example, depressed individuals with diabetes are 1.5-fold less likely to persist with pharmacotherapy for diabetes after 12 months of follow - up than nondepressed individuals. although the effect of comorbidity on persistence with ms disease - modifying therapies is unknown, depression is associated with reduced adherence to disease - modifying therapy (odds ratio 0.55 ; 0.420.74). fourth, comorbidity may affect the effectiveness, safety, and tolerability of treatment, although evidence for these issues is limited in ms. in a secondary analysis of longitudinal data from a randomized controlled trial of a teleconference - delivered fatigue management intervention for ms, comorbid diabetes or arthritis modified the response to the intervention. individuals with diabetes improved more slowly after intervention than those without diabetes, while individuals with arthritis improved more rapidly than those without arthritis but they had difficulty sustaining improvements. finally, comorbidity may increase the risk of drug drug and drug disease interactions. individuals with comorbidities frequently are underrepresented in clinical trials. therefore, trial findings may not apply to a typical clinic population with comorbidities. boyd. reviewed clinical trials identified using cochrane reviews for diabetes, heart failure, chronic obstructive pulmonary disease, and stroke. these trials frequently excluded individuals with comorbidities, ranging from 0% to 44% of diabetes trials, 0% to 42% of heart failure trials, 0% to 55% of chronic obstructive pulmonary disease trials, and 0% to 39% of stroke trials. moreover, only 43.5% (70/161) of the trials reported the prevalence of any comorbidity among participants. only 3.1% (5/161) of trials used comorbidity as a subgroup variable. a review of randomized trials published in the 5 highest - impact general medical journals and specialized journals that focused on the most prevalent chronic conditions found that multimorbidity affected participant eligibility in 95% of trials. individuals with multimorbidity were excluded in 63% of the trials examined ; this did not change from 1995 to 2010. only 2.1% of trials explicitly included individuals with multimorbidity. a systematic review of 26 trials or prospective observational studies in cardiovascular disease focused on comorbidity measurement. the comorbidities assessed varied across studies and were assessed using varied data sources with 35% not reporting the data source. the situation is similar in ms where most pharmacologic trials exclude individuals with severe comorbidities or substance use disorders. we reviewed the published results of 9 sentinel placebo - controlled trials of disease - modifying therapies approved for ms in the united states (table 1). five of 9 trials (55.6%) excluded individuals with various comorbidities. in 4 of those 5 trials, the description of the exclusions for comorbidities was vague, making it unclear how they were operationalized. uniformly, the way in which comorbidity was assessed for the purposes of eligibility was not reported. none of the trials described the comorbidity status of participants at enrollment. furthermore, none considered the presence of comorbidity as a subgroup variable for a priori or post hoc analyses. consideration of comorbidities in phase iii placebo - controlled sentinel trials of disease - modifying therapies in ms although we did not review all clinical trials of nonpharmacologic interventions for managing symptoms of ms, an ongoing systematic review of comorbidity measurement in randomized trials of rehabilitation interventions suggests that comorbidities are only considered in relation to exclusion criteria and are rarely reported when participant characteristics are described (m. finlayson, personal communication, 2015). randomized patients with ms to a weekly yoga class, weekly exercise class using a stationary bicycle, or a waiting - list control group. participants with insulin - dependent diabetes ; symptomatic lung disease ; uncontrolled hypertension ; liver or kidney failure ; alcoholism / drug abuse ; symptoms or signs of congestive heart failure, ischemic heart disease, or symptomatic valvular disease ; or corrected visual acuity worse than 20/50 binocularly were excluded. a controlled trial of physiotherapy as intervention to improve mobility in ms excluded individuals with other major general medical or surgical disorders. while exclusion of participants with comorbidities is intended to ensure participant safety, the consequence is that we lack knowledge about the safety, tolerability, and efficacy of the studied regimens in persons with ms who have common comorbidities. limited data suggest that safety and tolerability of disease - modifying therapies are affected by comorbidity. an observational study found that individuals with migraine have more difficulty tolerating interferon- because of worsening headache profiles. the risk of fingolimod - associated macular edema is higher among individuals with comorbid diabetes. these issues are particularly important for future trials in progressive ms, in which the target population is likely to be older and, therefore, more likely to have comorbidity. excluding individuals with comorbidities in these trials slows accrual and produces a study population that is even more divergent from clinical populations than trials conducted in relapsing - remitting ms. explanatory trials test the efficacy of an intervention, that is, the effects under ideal conditions. an effort is made to enhance the internal validity of the trial by achieving a more homogeneous study population with well - specified inclusion and exclusion criteria, and by controlling all aspects of the intervention and comparator. in contrast, pragmatic trials test the effectiveness of an intervention, that is, the effects in real - world clinical settings where populations are more heterogeneous and differ from those in explanatory trials. therefore, pragmatic trials produce findings that are potentially more generalizable and applicable to clinical practice. clinical trials in ms to date largely have been explanatory in nature. comparison of explanatory and pragmatic clinical trials although this classification suggests trials fall into distinct groups, explanatory and pragmatic trials really exist on a continuum, and several aspects or domains of a trial 's design may influence where it falls in the continuum. these may include eligibility criteria, the flexibility of the experimental and comparison interventions, required investigator expertise, choice of outcomes, intensity of follow - up and ascertainment of outcomes, and measures to ensure and assess adherence to the interventions by the participants and practitioners. the pragmatic explanatory continuum index summary (precis) tool and its subsequent revision (precis-2) were developed to assist trialists in considering these factors when designing their trials with the goal of matching designs to the intended uses of the trial results. the tool could also be used to evaluate existing trials (for a more detailed description of precis-2, see appendix e-1 on the neurology web site at neurology.org). pragmatic trials face challenges. because the intervention(s) is not as tightly controlled, it may not be as well delivered, reducing its benefit. increased heterogeneity and the dilution of the intervention 's effect require larger sample sizes (discussed further in ref. 40) and longer follow - up time, increasing costs and the risk of attrition. although a pragmatic trial may be performed in multiple clinical settings, we can not assume that the findings from one clinical setting translate to other clinical settings. nonetheless, relaxing criteria regarding age and comorbidity status could enroll a population more similar to that seen in clinic settings. all clinical trials need safety monitoring. typically, large randomized, multisite studies such as those used to evaluate disease - modifying therapies establish a data safety monitoring committee, which reviews trial conduct and accumulating data and advises the study sponsor regarding the ongoing safety of the trial participants. when participants experience treatment emergent adverse events including comorbidities such as hypertension, the data safety monitoring committee must decide whether the observed events are occurring at a rate greater than expected and whether they are treatment - related (i.e., a true safety signal) or not. understanding how adverse events may affect, the observed event rates can simply be compared between intervention groups, that is, using data internal to the trial. however, for rare (i.e., with a low event rate), serious adverse events such as cancers, the use of external comparators is needed. such assessments require a good understanding of the expected age- and sex - specific incidence of comorbidities in the (untreated) ms population as these may differ from the rates reported for the general population. however, a recent systematic review identified very few studies evaluating the incidence of comorbidity in ms, with even fewer being population - based. the most commonly studied conditions were cancer and epilepsy ; however, the time period over which incidence was being studied was often unclear, the definition of the conditions varied across studies, and age- and sex - specific estimates were not generally reported. thus, the information necessary to assess the significance of rare but clinically important adverse events is largely lacking. often it is not until a drug is released to the market that it is used in a significant number (if any) of individuals with comorbidities, and this is when adverse effects specific to individuals with comorbidity may be detected. however, postapproval, safety is not monitored as systematically at the individual or group level as in clinical trials. although the strategies used for postmarketing surveillance vary somewhat across nations, the challenges faced are similar. postmarketing surveillance may involve one or more components including passive reporting of adverse drug reactions, active pharmacovigilance, phase iv studies, and the use of research networks to evaluate specific adverse events of interest. passive reporting systems underreport adverse drug reactions by as much as 98% as compared to systematic monitoring, and phase iv studies may not be completed as requested. specific efforts are required to assess the safety of new therapies in individuals with ms and comorbidities in the postmarketing phase. consideration of whether to include or exclude participants with comorbidity in a clinical trial illustrates a potential conflict in ethical principles inherent in clinical trials. because the lifetime prevalence of comorbidity in patients with ms is substantial, expanding the age of enrolled participants and including those with comorbidities are ways to make the study population more typical. however, such individuals may have decreased likelihood of benefiting (i.e., violation of the ethical principle of beneficence) and an elevated risk of adverse effects (i.e., violation of the principle of nonmaleficence). there also may be concern that inclusion of participants with comorbidity may complicate interpretation of the trial if, for example, they adhere less well to assigned treatment or differentially discontinue treatment or trial participation prematurely. these considerations are potentially in conflict with the principle of autonomy that states that unless the safety concerns are more than hypothetical, informed patients should have the opportunity to participate. moreover, the external validity (generalizability) of the study is reduced if the trial population does not represent the clinical population in whom the therapy will be used. from an ethical perspective, the principle of justice suggests that particular individuals should not bear a disproportionate burden of research participation, nor should they be unfairly excluded from the potential benefits of participation. thus, excluding individuals with ms from clinical trials solely on the basis of age or comorbidity status requires careful consideration of the reasons and ramifications. the workshop produced several recommendations to address knowledge gaps regarding the incidence of comorbidity that may interfere with the ability to assess safety in monitored trials, and the limited generalizability of clinical trials to clinical settings where the ms population commonly has comorbid conditions. these are described generally below and summarized in table 3 in more detail for the most common comorbidity, psychiatric comorbidity. addressing psychiatric comorbidity in clinical trials for multiple sclerosis comorbidities prioritized for future incidence studies were depression, anxiety, autoimmune disease, diabetes, cancer, hypertension, and migraine, based on several considerations. first, they may affect clinician - assessed, patient - reported, and imaging outcomes in ms, and health care utilization. fourth, they may be identified as adverse events in clinical trials ; cancer and autoimmune disease were of particular interest in this regard. discussants also noted the importance of considering health behaviors such as smoking and obesity, as they are associated with the risk of developing comorbidities and may have independent effects on efficacy and safety. specifically, we propose changes to eligibility criteria for clinical trials of pharmacologic and nonpharmacologic therapies. first, relax age restrictions. such decisions are a tradeoff between homogeneity of the population and the strength of the signal being sought, safety, and generalizability of the findings to clinical practice. we suggest that, in the absence of strong a priori safety concerns, individuals with the most common comorbidities in the ms population, including depression, anxiety, hypertension, hyperlipidemia, and chronic lung disease, be considered for inclusion in trials. furthermore, individuals with a history of cancer should also be considered as potential participants in some settings. these changes will be particularly important in trials in progressive ms, as these individuals will be older and will have a greater burden of comorbidity. examples of pragmatic trials with relaxed eligibility criteria for age or comorbidity the description of clinical trial populations at baseline should include the prevalence of common comorbidities and whether they were currently treated (concomitant medications). these characteristics should also be updated and reported for the trial population as of the last study visit. also, blood pressure, body mass index, waist hip ratio, and current symptoms of depression and anxiety should be reported. to facilitate comparison of findings across clinical trials, we propose that, at a minimum, the presence or absence of the following diagnoses be reported : depression, anxiety, hypertension, hyperlipidemia, chronic lung disease (including asthma and chronic obstructive pulmonary disease), diabetes, autoimmune thyroid disease, migraine, and prior cancers. ideally, these conditions would be verified by review of medical records and would not be based solely on self - report at the time of trial enrollment. for the measurement of current symptoms of depression and anxiety, it would be helpful if a single tool was used consistently in trials. further evaluation of the responsiveness of available tools in the ms population would assist in identifying the best instrument. a systematic review of the psychometric properties of depression scales is ongoing and may provide guidance. based on observational studies showing that comorbidity and health behaviors affect clinician - assessed, patient - reported, and imaging outcomes in ms, it is likely that efficacy, safety, and tolerability differ by comorbidity status. this issue needs to be assessed to ensure that individuals with ms are not offered ineffective treatments while incurring risks. the initial focus of such subgroup analyses should focus on common, readily measured comorbidities such as hypertension, diabetes, smoking status, and obesity. phase iv studies should aim to enroll individuals with comorbidities and evaluate whether their risk of adverse events differs from that reported in phase iii trials. research networks with access to large databases should be used to conduct studies to specifically assess the risk of significant adverse events in individuals with comorbidities who use new therapies. the use of registries of all individuals using a novel therapy also may be helpful. comorbidities prioritized for future incidence studies were depression, anxiety, autoimmune disease, diabetes, cancer, hypertension, and migraine, based on several considerations. first, they may affect clinician - assessed, patient - reported, and imaging outcomes in ms, and health care utilization. fourth, they may be identified as adverse events in clinical trials ; cancer and autoimmune disease were of particular interest in this regard. discussants also noted the importance of considering health behaviors such as smoking and obesity, as they are associated with the risk of developing comorbidities and may have independent effects on efficacy and safety. specifically, we propose changes to eligibility criteria for clinical trials of pharmacologic and nonpharmacologic therapies. first, relax age restrictions. such decisions are a tradeoff between homogeneity of the population and the strength of the signal being sought, safety, and generalizability of the findings to clinical practice. we suggest that, in the absence of strong a priori safety concerns, individuals with the most common comorbidities in the ms population, including depression, anxiety, hypertension, hyperlipidemia, and chronic lung disease, be considered for inclusion in trials. furthermore, individuals with a history of cancer should also be considered as potential participants in some settings. these changes will be particularly important in trials in progressive ms, as these individuals will be older and will have a greater burden of comorbidity. the description of clinical trial populations at baseline should include the prevalence of common comorbidities and whether they were currently treated (concomitant medications). these characteristics should also be updated and reported for the trial population as of the last study visit. also, blood pressure, body mass index, waist hip ratio, and current symptoms of depression and anxiety should be reported. to facilitate comparison of findings across clinical trials, we propose that, at a minimum, the presence or absence of the following diagnoses be reported : depression, anxiety, hypertension, hyperlipidemia, chronic lung disease (including asthma and chronic obstructive pulmonary disease), diabetes, autoimmune thyroid disease, migraine, and prior cancers. ideally, these conditions would be verified by review of medical records and would not be based solely on self - report at the time of trial enrollment. for the measurement of current symptoms of depression and anxiety, it would be helpful if a single tool was used consistently in trials. further evaluation of the responsiveness of available tools in the ms population would assist in identifying the best instrument. a systematic review of the psychometric properties of depression scales is ongoing and may provide guidance. based on observational studies showing that comorbidity and health behaviors affect clinician - assessed, patient - reported, and imaging outcomes in ms, it is likely that efficacy, safety, and tolerability differ by comorbidity status. this issue needs to be assessed to ensure that individuals with ms are not offered ineffective treatments while incurring risks. the initial focus of such subgroup analyses should focus on common, readily measured comorbidities such as hypertension, diabetes, smoking status, and obesity. phase iv studies should aim to enroll individuals with comorbidities and evaluate whether their risk of adverse events differs from that reported in phase iii trials. research networks with access to large databases should be used to conduct studies to specifically assess the risk of significant adverse events in individuals with comorbidities who use new therapies. the use of registries of all individuals using a novel therapy also may be helpful. comorbidity is common in the ms population and affects safety and benefit of pharmacologic and nonpharmacologic therapies, including those being tested in clinical trials. the eligibility criteria used in trials that restrict participants based on comorbidities are a tradeoff between homogeneity of the population and the strength of the signal being sought, safety, and generalizability of the findings. the proposed recommendations are intended to allow clinical trials to better inform use of ms therapies in clinical practice. the corresponding author (r.a.m.) takes responsibility for the integrity of the data and the accuracy of the data analysis. funded in part by the national multiple sclerosis society (us), ectrims, a don paty career development award from the ms society of canada (to r.a.m.), and a manitoba research chair from research manitoba (to r.a.m.). the funding source(s) had no role in the study design, collection, analysis, or interpretation of the data, or in the decision to submit the article for publication. the international conference on comorbidity in multiple sclerosis was organized under the auspices of the international advisory committee on clinical trials in multiple sclerosis. the conference and the activities of the committee were funded by the european committee for treatment and research in multiple sclerosis and the us national multiple sclerosis society. r. marrie receives research funding from the canadian institutes of health research, public health agency of canada, manitoba health research council, health sciences centre foundation, multiple sclerosis society of canada, multiple sclerosis scientific foundation, and rx & d health research foundation, and has conducted clinical trials funded by bayer inc. and sanofi - aventis. a. miller has received research support from novartis, genentech, genzyme, sanofi - aventis, biogen idec, roche, and mallinckrodt (questcor), personal consulting fees from genzyme / sanofi - aventis, biogen idec, glaxosmithkline, emd serono (merck serono), mallinckrodt, novartis, acorda, accordant health services, teva, roche, alkermes, genentech, and caremark (accordant health care), and speaker honoraria from biogen idec (unbranded disease awareness programs only). m. sormani received consultation fees from biogen, novartis, merck serono, teva, genzyme, roche, and synthon. a. thompson has received honoraria / support for travel for consultancy from biogen idec, medday, eisai, and novartis, and for teaching from excemed, novartis, and teva. he receives an honorarium from sage publications as editor in chief of multiple sclerosis journal. e. waubant receives research funding from the nih, the nmss, and the race to erase ms. she has received honorarium or travel support from actrims, ectrims, and the aan. m. trojano has served on scientific advisory boards for biogen idec, novartis, and genzyme ; has received speaker honoraria from biogen idec, sanofi - aventis, merck serono, teva, novartis, and almirall ; has received research grants for her institution from biogen idec, merck serono, and novartis. s. reingold reports personal consulting fees from the national multiple sclerosis society (nmss) and the european committee for treatment and research in multiple sclerosis (ectrims), during the conduct of this work, and personal consulting fees from bayer healthcare, biogen idec, coronado biosciences inc., the cleveland clinic foundation, eli lilly and company, from emd serono and merck serono, genentech, f. hoffmann - la roche, ironwood pharmaceuticals inc.,, novartis pharmaceuticals corporation, observatoire franais de la sclrosis en plaques, opexa therapeutics, sanofi - aventis, sk biopharmaceuticals, synthon pharmaceuticals inc., teva pharmaceutical industries, and fondation pour l'aide la recherche sur la sclrosis en plaques, for activities outside of this work. j. cohen reports personal compensation for consulting from emd serono, genentech, genzyme, innate immunotherapeutics, novartis, and vaccinex. cohen receives research support paid to his institution from biogen idec, consortium of ms centers, us department of defense, genzyme, us nih, national ms society, novartis, receptos, synthon, teva, and vaccinex.	objective : we aimed to provide recommendations for addressing comorbidity in clinical trial design and conduct in multiple sclerosis (ms).methods : we held an international workshop, informed by a systematic review of the incidence and prevalence of comorbidity in ms and an international survey about research priorities for studying comorbidity including their relation to clinical trials in ms.results:we recommend establishing age- and sex - specific incidence estimates for comorbidities in the ms population, including those that commonly raise concern in clinical trials of immunomodulatory agents ; shifting phase iii clinical trials of new therapies from explanatory to more pragmatic trials ; describing comorbidity status of the enrolled population in publications reporting clinical trials ; evaluating treatment response, tolerability, and safety in clinical trials according to comorbidity status ; and considering comorbidity status in the design of pharmacovigilance strategies.conclusion:our recommendations will help address knowledge gaps regarding comorbidity that interfere with the ability to interpret safety in monitored trials and will enhance the generalizability of findings from clinical trials to real world settings where the ms population commonly has comorbid conditions.
peritonitis is one of the most common factors responsible for morbidity and mortality in patients on continuous ambulatory peritoneal dialysis (capd). approximately 48% of peritonitis episodes have a fungal etiology, candida species accounting for 75%. the reported incidence of mortality in bacterial peritonitis is approximately 0.63% and that in fungal peritonitis is 1244%. so, it is imperative that fungal peritonitis is diagnosed rapidly and appropriate treatment given so that the survival rates are improved. paecilomyces species are saprophytic fungi and are uncommon pathogens that can produce serious infections in immunocompromised patients and occasionally in immunocompetent hosts. reddy. reported a case of fungal peritonitis caused by paecilomyces puntonii from india. we report a case of fungal peritonitis caused by paecilomyces varioti, which is not reported from india till date to the best of our knowledge. a 51-year - old man was on capd had 2 episodes of culture negatibe peritonitis over the period of 2 years. first episode 2 months after the initiation of capd was treated with empirical antibiotics (vancomycin and amikacin) by intraperitoneal route ; second episode 6 months prior to current admission and was treated with the same antibiotics. he again presented with complaints of diffuse abdominal pain and high grade fever with cloudy pd effluent. his pd effluent cell count was 3000 cells / mm with 80% polymorphs, gram stain and afb stain were negative, aerobic cultures did not grow any organism. fungal cultures by sabouraud dextrose agar medium had grown filamentous fungi after 48 hours and microscopically it showed chains of single celled phialoconidia produced in basipetal succession from a phialide. phialides are swollen at their bases, gradually tapering towards their apices and formed a brush - like penicillus confirming the diagnosis of p. varioti [figure 1 ]. accordingly capd catheter was removed, he was initiated on hemodialysis mode amphotericin b was started at 1 mg / kg / day. he was treated for a period of 4 weeks with a cumulative dose of 1.5 g of amphotericin. capd catheter reinsertion was done successfully, he is currently on pd and is doing well. microscopic morphology of paecilomyces varioti showing chains of single celled phialoconidia produced in basipetal succession from a phialide. phialides are swollen at their bases, gradually tapering towards their apices and may form a brush - like penicillus in recent years, unusual and nonpathogenic fungi like paecilomyces have been increasingly reported as etiologic agents of fungal peritonitis. paecilomyces are common saprophytic fungi found in soil, silage, and water. they are not usually associated with human infection. however, some species such as p. varioti, p. marquandii and p. lilacinus are emerging as causative agents of hyalohyphomycosis in the immunocompromised host. p. varioti have been reported to cause pyelonephritis, endophthalmitis, hairy - cell leukemia, cerebrospinal shunt infection, and prosthetic valve endocarditis. the most important risk factors for fungal peritonitis are prolonged use of antibiotics and previous bacterial peritonitis episodes. a study by goldie. reported that 65% of fungal peritonitis patients had received broad - spectrum antibiotics within the preceding month, 74% within 3 months, and 87% within 6 months. our patient presented with fungal peritonitis 6 months after empirical antibiotic therapy for suspected bacterial peritonitis. several case series reported increased dialysate eosinophils. in other reported cases as well as in our patient, no eosinophilia was found in the dialysate. the conventional antifungal regimens include fluconazole, amphotericin b, and flucytosine alone or in combination, based on fungal sensitivities. p. varioti is usually very sensitive to amphotericin b. we used intravenous amphotericin b for our patient who responded dramatically with cumulative dose of 1.5 g. it can be easily treated with common antifungal agents like amphotericin b which can facilitate catheter reinsertion.	peritonitis is one of the most common and important complications in patients on continuous ambulatory peritoneal dialysis (capd). fungal peritonitis isreported in 48% of peritonitis episodes. fungal peritonitis due to paecilomyces species is not common. we report a case of capd peritonitis due to p. varioti. we immediately removed the capd catheter and iv amphotericin was administered for 4 weeks along with temporary hemodialytic support followed by successful catheter reinsertion.
intussusception is a relatively common disease in children, but it is a relatively rare disease in adults, and leading points in adults are different from those in children. in patients showing bowel obstruction, the cause has been reported to be intussusception in 1% of the patients, and cases with sigmoidorectal intussusception are not common. lipoma, adenoma, polyps, meckel 's diverticulum have been reported to be causes. among malignant tumors, nonetheless, cases caused by the subtype of adenocarcinoma, a mucinous adenocarcinoma, showing relatively poor prognosis are very rare [2 - 4 ]. in adult intussusception, the principle is surgical resection of the invaginated intestine and the causative lesion. nevertheless, surgery may be modified depending on the disease history of the patient and surgical findings [1, 2, 5, 6 ]. in most reports, treatment of sigmoidorectal intussusception after the reduction of intussusception by a laparotomy has been reported. however, it is true that cases of successful laparoscopic treatments are rare. the clinical symptoms and physical examination findings of patients are diverse. however, due to masses invaginated to the lower rectum, sigmoidorectal intussusception may be misdiagnosed as rectal cancer in the lower part based on a digital rectum examination ; thus, for effective treatment, intussusceptions must be diagnoses accurately prior to surgery. in addition, in the treatment of lower rectal cancer, despite remarkable improvements of laparoscopic techniques, complications in the urogenital system caused by injury of the autonomic system have been reported. in the past, it was difficult to diagnose the disease because of its low incidence. recently, it could be accurately diagnosed through the use of ultrasonography and abdominal computed tomography. we experienced a case in which the sigmoidorectal intussusception could be reduced to the proximal sigmoid colon through the anus in a patient admitted for the chief complaints of recurring pain in the abdomen from several months ago, hematochezia, and constipation. lower rectal cancer was suspected at an outpatient clinic, but a mucinous adenocarcinoma was diagnosed by using pathologic examination. a 79-year - old female patient visited the outpatient clinic with the chief complaints of hematochezia associated with diarrhea from several month ago, tenesmus, and pain in the lower abdomen for colonoscopic examination. because of insufficient bowel preparation and the abdominal pain of the patient becoming severe, abdominal computed tomography was performed, malignant tumors were suspected, and the patient was admitted to our hospital. in the past history and family history, no special findings were detected. at the time of admission, the blood pressure was 100/80 mmhg, the temperature was 37.6, and in cardiopulmonary auscultation, no special findings were detected, and in the abdominal area, mild tenderness was detected. a movable mass associated with hemorrhage other than the above, no special findings were detected. in the general peripheral blood test, leucocytes were 5,000/l, hemoglobin was 7.5 g / dl, and platelets were 248,000/l. in serum biochemistry tests, iu / l, alp was 215 iu / l, total bilirubin was 0.38 mg / dl, -gtp was 6 iu / l, total protein was 6.6 g / dl, albumin was 3.6 g / dl, bun was 15.2 mg / dl, creatinine was 0.52 mg / dl, prothrombin time was 12.1 seconds (inr, 1.16), hbs ag was negative, anti - hbs ab was positive, anti - hcv ab was positive, and cea (ria) was elevated to 82.1 ng / ml. in plain abdominal radiography, the retention of a large amount of feces could be detected. in anoscopic examination, the rectal inner wall was observed to be occluded by a mass in an area approximately 3 cm above the anal verge and to be covered with dark blood. continuous hemorrhage from the surface was detected, and the mass was palpated to be relatively movable (fig. 1). in abdominal computed tomography, an irregularly shaped mass in the sigmoid colon approximately 5 3.8 3.9 cm in size and associated with the intussusception from the mass to the rectum, was detected. in addition, along the invaginated mesentery, about 2 lymph nodes showing contrast enhancement were observed (fig. the patient was placed in the modified lithotomy position, the trendelenberg position, and bent with the right side downward. a 12-mm trocar was inserted into the vicinity of the umbilicus, a 12-mm trocar was inserted into the right lower abdomen, a 5-mm trocar was inserted into the right upper abdomen, and an 11-mm trocar was inserted into the left lower abdomen. the sigmoid colon and the rectum were examined, and an intussusception of the sigmoid colon to the inside of the lower rectum was detected. laparoscopic reduction of the invaginated colon was attempted using a laparoscopic grasper, but failed. hence, a dilator for end - to - end anastomosis (eea ; 28 mm) was inserted through the anus of patient, the mass was pushed up carefully, simultaneously reduction using a laparoscopic grasper was attempted, and the invaginated area could be readily reduced to the abdominal cavity. the reduced area of mass did not show necrotic findings, and except for mild hemorrhage in the vicinity of the appendiceal epiploica of the sigmoid colon, normal findings were shown (fig. the reduced mass was restored to the proximal sigmoid colon, and the infer mesenteric vessels were ligated. subsequently, a laparoscopic anterior resection and primary anastomosis were performed, and surgery was completed. histological examination was diagnosed a mucinous adenocarcimoma, and metastasis was detected in 10 lymph nodes (fig. infiltration by the adenocarcinoma and secretion of mucus could be observed ; thus, it was diagnosed as a mucinous adenocarcinoma (fig. three days after surgery, movement of the intestine of the patient was recovered, and diet was initiated. the patient had slight diarrhea symptoms, but recovered without other complications, and is presently under follow - up observation at our outpatient clinic. intussusception was described by barbette of amsterdam in 1674 for the first time, and in the early 1700s, velse performed surgery for adult intussusception successfully. afterward, in 1871, sir jonathan hutchinson performed surgery on infants for the first time. intussusception is caused by the invagination of lesions, as well as the adjacent intestinal wall, to the inside of the distal bowel due to the peristalic movement of the intestine. the mesocolon and blood vessels are invaginated together and block the supply of blood flow, resulting in ischemic necrosis of the intestinal wall. adult intussusception is generally caused by underlying diseases ; on the other hand, in children, it develops without cause in most cases. according to several reports, adult colonic intussusception is caused by malignant tumors in 64% to 87% of patients and by benign tumors in 29% to 33% of patients [5, 6, 9, 10 ]. approximately 38% of intussusceptions have been reported to develope in the small intestine, 6% of intussusceptions are ileo - cecal types and ileo - colic types, and approximately 50% of intussusceptions develop in the colon. among colonic intussusceptions, approximately 70% develop in the right colon, and intussusceptions in the left colon and the sigmoid colon are rare. approximately 65% of colonic intussusceptions are reported to be associated with malignant tumors ; hence, attention should always be paid to that possibility during diagnosis and surgery. it has been reported that in regard to the most common causes of colonic intussusception, benign tumors are lipomas, leiomyomas, adenomatous polyps, endometriosis that developed in the appendix, and the anastomosis area of previous surgery, and malignant tumors are adenocarcinomas, lymphomas, lymphosarcomas, and leiomyosarcomas. in addition, although rare, intussusception caused by a lymphangioma in the abdominal cavity has been reported. in korea, similarly, several studies on intussusception have been reported ; nonetheless, it is true that reports on sigmoidorectal intussusception are rare, and most are reports on benign adenomatous polyps [11, 12 ]. in korea, intussusception cases caused by mucinous adenocarcinomas and treated by using a laparoscopic procedure have not been reported yet. in addition, the incidence of the subtype of adenocarcinoma, the mucinous adenocarcinoma, has been reported to be relatively rare, to occur preferentially in young age groups, and at the time of diagnosis, to have progressed locally in many cases, and different from an adenocarcinoma, it is developed in the proximal colon, and its prognosis is poor [13, 14 ]. the subjective symptoms of patient are generally very diverse and are, thus, vague in many cases ; hence, the preoperative diagnostic rate is 20 - 25%, and prior to surgery, it may be diagnosed as ileus, abdominal masses, gastrointestinal hemorrhage, etc. the most common symptom is abdominal pain, and rather than acute pain, it is regular and intermittent abdominal pain for a long time. azar and berger reported that nausea, vomiting, abdominal pain and hematochezia manifested during bowel obstruction are common. in addition, it may be manifested as weight loss, fever, constipation, diarrhea, abdominal masses, etc., and only repeated intermittent abdominal pain may be presented for several years in some cases. on physical examination, abdominal masses are palpated in 24 - 42% of the cases, and in most cases, they are mobile and can be palpated when it is painful [5, 15 ]. laboratory findings are normal or nonspecific in most cases, and anemia and a slightly increased number of leucocytes may be detected. since sigmoidorectal intussusception is very rare, it is difficult to diagnosis only by physical examination, and if it is invaginated to the lower rectum and associated with continuous hemorrhage as was our case, it may be readily misdiagnosed as lower rectal cancer. it is difficult to diagnose intussusception clinically in many cases, and it is diagnosed primarily by using radiological tests. in plain abdominal radiography, findings of ileus and soft tissue density may be suspected to be an intussusception ; nonetheless, such findings are not specific, and colonic intussusception can be diagnosed by specific findings, such as the filling defect within a barium study, an occlusion, a coil - spring shape, etc., but the entero - enteric type can not be diagnosed. as the applications of abdominal ultrasonography and abdominal computed tomography become generalized, intussusception can be diagnosed more readily. in abdominal computed tomography, if target signs or doughnut signs are shown on a cross section of the intussusception, and pseudo - kidney signs are shown on transverse sections, it can be diagnosed. in abdominal computed tomography, it can be diagnosed by concentric rings associated with low contrast lesions or by the enlargement of small intestine segments [15, 17 ]. recently, if the cause is a tumor as in our case, whether malignant or not and whether metastasis can be determined or not, and abdominal computed tomography has recently been reported to be the most useful method for the diagnosis of adult intussusception. in other reports, presurgical diagnoses were made by using ct in most cases [1, 3, 6 ]. for the treatment of intussusception, even now, constant treatment trends have not been established ; nonetheless, when a causative lesion is present and the possibility of malignant tumors is high, the treatments of choice is to perform surgery. it is controversial whether the invaginated intestine should be reduced prior to resection. in small bowel and right ascending colon intussusception cases, first, manual reduction is performed ; the causative lesion is then assessed and treated. cases in the small bowel develops complications and thus can not be restored or transverse colon and descending colon intussusceptions are resected directly without resection because benign lesions are abundant in small intestine cases and the incidence of malignancy is high in the left colon. in addition, for cases in which perforation due to the excess manipulation during reduction or the dissemination of malignant cells is a worry, resection in a wide area should be performed [6, 16 ]. recently, with the improvement of laparoscopic surgery, cases in which a laparoscopic anterior resection was performed after the reduction of the sigmoidorectal intussusception through the anus have been reported ; nonetheless, successful laparoscopic treatments of intussusceptions caused by malignant tumors have been rarely reported, and studies on the treatment outcomes of laparotomic surgery for intussusceptions and its prognosis have not been reported. if surgery is performed after the reduction of the invaginated area caused by malignant tumors, because of the possibility of necrosis of the mucosa during the reduction procedure, the dissemination of malignant cells due to perforation, and the venous embolism of malignant cells, prior reduction of herniation has not been accepted in most studies [1, 18 ]. with the recent remarkable improvement in laparoscopic surgery, cases with intussusceptions cause by malignant tumors in the lower rectum treated by laparoscopic reduction first, followed by successful surgery, have been reported, although they are rare [11, 19, 20 ]. furthermore, different from pediatric cases showing very specific symptoms or syndrome, the diagnosis of an adult sigmoidorectal intussusception caused by malignant tumors may be difficult, and on the digital rectal examination, it may be misdiagnosed as lower rectal cancer. surgical treatments are a laparotomy, laparoscopic surgery, or a resection through the anus. it is thought that sigmoidorectal intussusception cases that might be misdiagnosed as lower rectal cancer as in our case may be treated by successful reduction of the intussusception by using an end - to - end anastomosis dilator and laparoscopy through the anus. however, the possibility of dissemination of malignant tumor cells caused by excessive manipulation and venous thrombi should be well understood and avoided. based on the advantages of laparoscopic surgery, its cosmetic aspect, shortening of the hospitalization period, and early return to normal life, surgery on the lower rectal area could be avoided injury to the autonomic nervous system therefore case for sigmoidorectal intussusception caused by tumors, the procedure of reduction first, followed by laparoscopic surgery may be considered. in summary, we experienced the case of a patient admitted for the chief complaints of diarrhea and hematochezia. first, we reduced the sigmoidorectal intussusception which was caused by a mucinous adenocarcinoma that had developed in the sigmoid colon.	intussusception is a rare cause of intestinal obstruction in adult patients, but is common in children. in fact, it accounts for an estimated 1% of all cases of bowel obstruction in adults, although adult intussusception of the large intestine is rare. sigmoidorectal intussusception, however, is a rare variety with few cases reported in the literature. a mucinous adenocarcinoma, a subtype of adenocarcinoma, is characterized by extracellular mucin production and accounts for between 5% and 15% of the neoplasms of the colon and rectum. despite the general consensus supporting surgical resections for adult intussuceptions, controversy remains over whether intussuceptions should be reduced before resection. most cases of colon intussusception should not be reduced before resection because they most likely represent a primary adenocarcinoma. however, prior reduction followed by a resection can be considered for the sigmoidorectal intussusception to avoid inadvertent low rectal cancer sugery. we experienced one case of sigmoidorectal intussusception caused by a mucinous adenocarcinoma of the sigmoid colon in a 79-year - old woman. abdominal computed tomography demonstrated a sigmoidorectal intussusception. after the end - to - end anastomosis - dilator - assisted reduction, the patient underwent a laparoscopic oncological anterior resection under the impression that a sigmoidorectal intussusception existed. we report a successful laparoscopic anterior resection in a patient with an intussusception caused by a sigmoid malignant tumor.
in the eukaryotic genome, protein kinases comprise one of the largest families of proteins (manning., 2002a) and together with their counteracting protein phosphatases, they regulate a common post - translational modification observed in intracellular signaling. activation of protein kinases and phosphatases typically occurs in response to extracellular stimuli as well as to intracellular stresses, and the resulting changes in the phosphorylation state of proteins lead to specific cellular responses (cohen, 2000 ; moorhead., 2009 ; pidoux and tasken, 2009). eukaryotic kinases themselves often require activation by phosphorylation (nolen., 2004) and are distinguished by their target residue specificities, which for the purposes of this review are either serine / threonine or tyrosine residues (olsen., 2006 ; changes in the phosphorylation state have a broad impact on the cell, altering many processes such as the subcellular localization of proteins, the activity, or substrate specificity of enzymes, as well as specific protein protein interactions. furthermore, signals can be amplified within the cell by a cascade of substrate phosphorylation events, while fine - tuning and temporal control can be modulated by opposing phosphatases. this interplay allows spatial and temporal separation of intracellular signaling (cohen, 2000 ; moorhead., 2009 ; pidoux and tasken, 2009 ; scott and pawson, 2009). cellular processes that rely on phosphorylation have been extensively described in prokaryotes and eukaryotes and include transcription, translation, transport and energy flux, cell cycle, phagocytosis, and the innate immune response to pathogens (manning., 2002a, b ; ryan and shapiro, 2003 ; lindmo and stenmark, 2006 ; back., a proper balance between the unphosphorylated and the phosphorylated state of proteins, tight regulation of protein kinases, and phosphatases is of crucial importance for the cell and imbalance often results in aberrant signaling leading to disease (manning., 2002b). interference with the host phosphorylation machinery is a common strategy used by pathogens to promote growth and survival in host tissues. for instance, the gastric pathogen helicobacter pylori directs host cell cytoskeletal rearrangements by delivery of the caga protein into host cells (covacci., 1993 ; following translocation into the cell, caga is phosphorylated by src host tyrosine kinases and subsequently induces changes in cell morphology due to cytoskeleton rearrangement (segal., 1996 ; stein., src kinases along with the host focal adhesion kinase are activated as a result of the interaction of the bacterial cagl protein with the integrin 51 receptor (kwok., 2007). therefore, h. pylori proteins can both activate and serve as substrates for host kinases. many intracellular pathogens exploit the host phosphorylation machinery by interfering with phosphoinositide (pi) metabolism and thereby target a major signaling pathway controlling membrane trafficking, actin rearrangement, and cell survival (toker and cantley, 1997 ; de matteis and godi, 2004 ; krauss and haucke, 2007 ; duronio, 2008 ; weber., 2009a). phosphatidylinositol 3-kinases (pi3ks) play a major role in signal transduction during phagocytosis and therefore in the uptake of many pathogens (ireton., 1996 ; toker and cantley, 1997 ; lindmo and stenmark, 2006 ; weber., 2009a) listeria monocytogenes is one such pathogen that is internalized in a pi3k - dependent fashion, as 3-phosphorylated phosphatidylinositol phosphates are required for cytoskeletal rearrangements involved in this process (ireton., 1996 ; mostowy and cossart, 2009). mycobacterium tuberculosis controls pi metabolism in a different fashion, forcing entry into a replication compartment that has a low phosphatidylinositol-3-phosphate [pi(3)p ] content. this association appears to be linked with evasion of the lysosomal network, as pi(3)p is a key component of early endosomes that mature into endolysosomes (lindmo and stenmark, 2006 ; philips, 2008). one of the strategies utilized by mycobacteria to keep the pi(3)p content low in the membrane surrounding the replication compartment involves the secretion of pi, protein, and lipid phosphatases (vergne., 2005 ; beresford., 2007). m. tuberculosis proteins, therefore directly target phosphorylation events associated with host pi metabolism. similar to m. tuberculosis, the intracellular pathogen legionella pneumophila resides and replicates within a specialized vacuole in the host cytosol (horwitz, 1983a, b ; horwitz and maxfield, 1984). the proper formation of this replication vacuole relies on the icm / dot type iv secretion system (marra., 1992 ; berger., 1994 ; segal., 1998 ; vogel., 1998). up to 200 bacterial proteins are translocated into the cytosol, targeting a variety of host pathways contributing to efficient intracellular growth of l. pneumophila (burstein., 2009. characterized translocated proteins are known to target er golgi membrane trafficking (murata., 2006 ; ingmundson., 2007 ; machner and isberg, 2007), modulate host cell survival (laguna., 2006 ; banga., 2007), or inhibit the eukaryotic translation elongation complex (de felipe., 2005 ; in this review we discuss selected host phosphorylation pathways that are targeted by l. pneumophila during interactions with host cells. the strategies used by the microorganism include translocation of kinases that directly manipulate host cell phosphorylation, but also include indirect effects that result in alteration of host cell signaling in response to formation of the l. pneumophila replication vacuole. while m. tuberculosis has both kinases and phosphatases that directly impact host signal transduction controlled by phosphorylation (walburger., 2004 ; vergne., 2005 ; beresford., 2007), of the close to 200 known and putative icm / dot translocated substrates (burstein., 2009 ; huang., 2010) none show sequence similarity to known phosphatases or tyrosine kinases. four translocated proteins, legk1, legk2, legk3, and legk4 contain domains that show homology to eukaryotic ser / thr kinases (de felipe., 2005, 2008 ; legk1 and legk2 are the best characterized. as is the case with the majority of translocated substrates, legk1 is dispensible for intracellular growth in bone marrow - derived macrophages isolated from a / j mice and in the environmental host acanthamoeba castellanii (de felipe., 2005 ; losick., legk1 exhibits kinase activity in vitro and it has been proposed that it interferes with the host innate immune system by directly activating the nf-b pathway, because ectopic expression of the protein in mammalian cells results in activation of an nf-b - dependent promoter (ge., 2009 ; losick., the kinase activity is necessary for this activation, as a point mutation in the atp binding domain or a catalytic residue abolishes nf-b activity (ge., 2009 ; losick., nf-b activation by legk1 occurs through direct phosphorylation of a component in the signaling cascade, the inhibitor ib, resulting in degradation of the inhibitor and release of nf-b into the host cell nucleus (ge., whether or not legk1-mediated phosphorylation of ib plays a role in nf-b activation during macrophage challenge by l. pneumophila is unclear, as a legk1 deletion mutant is able to efficiently activate an nf-b regulated promoter (losick., 2010). the role of legk1 during growth within the natural host ameba is similarly unclear, as there are no known nf-b orthologs in any sequenced amebal species. as is true with legk1 (ge., 2009), legk2 exhibits protein kinase activity in vitro, however its specific host target is not known (hervet., 2011). in the amebal host a. castellanii, legk2 activity plays some role in the recruitment of the er marker calnexin and is required during early time points of intracellular replication, as a legk2 deletion mutant displays a delayed onset of growth (hervet., 2011). legk3 has been studied in the context of nf-b activation and the mitogen - activated protein kinase (mapk) pathway, but failed to show an impact on either (shin., 2008 ; ge., 2009). regarding their expression during bacterial growth in broth as well as during infection of a. castellanii, the legk homologs share a similar pattern. in post - exponential phase the expression of legk1 - 4 is slightly reduced in the l. pneumophila lens isolate (hervet., 2011) and during host cell infection, expression levels of all four genes do not significantly change (bruggemann., 2006b). compared to other pathogens, such as pathogenic yersinia species, which have well characterized kinases and phosphatases that have impact on the disease process (viboud and bliska, 2005 ; ribet and cossart, 2010), less is known about l. pneumophila proteins that directly change the phosphorylation state of host targets during infection. as will be illustrated below, l. pneumophila appears to modulate host cell phosphorylation pathways indirectly, via processes associated with the uptake and replication of l. pneumophila. to obtain a comprehensive understanding of which host cell pathways are necessary for intracellular growth of l. pneumophila, the global transcriptional host cell response has been investigated by several groups, using mouse bone marrow - derived macrophages, human macrophage - like cell lines and amebae (farbrother., 2006 ; losick and isberg, 2006 ; abu - zant., 2007 ; shin., 2008 ; li., 2009 ; fontana these data were complemented by chemical genetics to identify host factors that are essential for the early steps of infection and for icm / dot - dependent protein translocation into a macrophage cell line (charpentier., 2009). the latter approach provided substantial knowledge of the host factors necessary for phagocytosis of l. pneumophila and icm / dot substrate translocation including pi3ks (see below). in the natural host amebae, besides inducing a stress response, major transcriptional changes occurred at various time points of l. pneumophila challenge, including increased transcription of aminoacyl - trna synthetases and decreased expression of ribosomal protein genes (farbrother., 2006 ; li., 2009). in human macrophage - like cells, encounter with l. pneumophila also resulted in increased transcription of stress response genes, however, the most striking transcriptional response in mammalian cells was demonstrated to be the upregulated expression of genes encoding components of the innate immune system (losick and isberg, 2006 ; shin., 2008). in human macrophage - like cells these included genes regulated by nf-b, genes encoding anti - apoptotic proteins as well as dual specificity phosphatases (dusps) known to be negative regulators of the mapk pathway (losick and isberg, 2006). the transcriptional profile of murine bone marrow - derived macrophages also showed enhanced transcription of dusp genes (shin. these transcriptional responses were specific to virulent l. pneumophila, since they were dependent on the presence of a functional icm / dot system. the transcriptional analyses as well as the application of chemical genetics indicate that the host cell response to l. pneumophila involves differential regulation of a variety of signaling cascades that are controlled by phosphorylation and dephosphorylation. the following sections will focus on different stages of the infection cycle and the impact of host kinases and phosphatases on these pathways (figure 1). the host phosphorylation system is targeted during different stages of l. pneumophila encounter with host cells. (a) the initial contact and subsequent uptake into the host cell is thought to be dependent on pi3ks and respective downstream signaling in macrophages (tachado., 2008 ; (b) alterations in pi levels at the vacuole contribute to differential protein recruitment and could interfere with endocytic trafficking to vacuole (weber., 2006, 2009b ; ragaz., 2008 ; brombacher., (c) after contact with cells of higher eukaryotes, the nf-b pathway is activated, which alters cytokine production, host cell survival, and intracellular replication of l. pneumophila (losick and isberg, 2006 ; abu - zant. (d) the mapk signaling pathway is also modulated during infection and proper regulation is necessary for l. pneumophila replication in amebae and cytokine production in macrophages (welsh., 2004 ; losick and isberg, 2006 ; shin., 2008 ; li., 2009). each cycle of infection starts with uptake of l. pneumophila into the host cell by phagocytosis. uptake into human alveolar macrophages under non - opsonized conditions has been documented to occur by coiling phagocytosis (horwitz, 1984 ; charpentier., 2009). the mechanism of phagocytosis of l. pneumophila, however, has been a point of dispute for some time, with the role of pi3ks being a particular focus of controversy. as mentioned above, pathogens may be taken up in a pi3k - dependent manner (weber., 2009a). activation of pi3k leads to downstream signaling events that involve synthesis of pi(3,4,5)p3, which is likely to be followed by recruitment of guanidine nucleotide exchange factors that activate rho family gtpases involved in regulation of actin rearrangements (lindmo and stenmark, 2006). the role of pi3ks during phagocytosis of l. pneumophila appears to differ between host systems, bacterial strains, and the experimental setup used (see below). initially, it was postulated that uptake of virulent l. pneumophila jr32 (philadelphia-1) into u937 human macrophage - like cells does not depend on pi3ks (khelef., 2001). phagocytosis of l. pneumophila having an intact icm / dot system was not blocked by the pi3k inhibitor wortmannin, and this failure to inhibit uptake was independent of the opsonization conditions used. when actin polymerization was visualized at l. pneumophila entry sites, there appeared to be no affect of inhibitors of pi3k function. however, a mutant having an inactivated icm / dot system was taken up in a pi3k - dependent manner indicating that the presence of a functional protein translocation system targets l. pneumophila into a unique uptake pathway (khelef., 2001). in the ameba dictyostelium discoideum, inhibition of pi3ks by wortmannin and ly294002 reduced the uptake of l. pneumophila (weber. i pi3ks appeared to have a positive influence on intracellular replication (weber. deletion of genes encoding pi3ks, as well as chemical inhibition of their activities, changes the morphology of the replication vacuole and it was postulated that this structure might stimulate intracellular replication (weber., 2006). the absence of pi3ks could result in an altered composition of pis at the legionella - containing vacuole (lcv) causing changes in host protein recruitment. also, improved intracellular replication could be due to enhanced bypass of the endocytic pathway, which requires pi3k activity, and may compete for sequestration of the microorganism into a compartment that is restrictive for intracellular growth (lindmo and stenmark, 2006 ; weber., 2006). besides pi3ks, another enzyme involved in pi metabolism, the inositol polyphosphate-5-phosphatase dd5p4, influences l. pneumophila infection in d. discoideum. host cells lacking dd5p4 showed a defect in uptake, but once internalized, the bacteria showed improved intracellular replication, which is similar to the phenotype observed for loss of pi3k (weber., 2006, 2009b). dd5p4 is recruited to the lcv in a icm / dot - dependent manner and is catalytically active, which putatively leads to conversion from pi(4,5)p2 to pi(4)p (weber., 2009b). pi(4)p is considered a lipid marker for the lcv, that serves as an anchor for icm / dot substrates and is detectable at the lcv dependent on the presence of an intact icm / dot system (weber., 2006 ;, pi(4)p is also found at the lcv in infected raw264.7 murine macrophage cells indicating that intracellular replication within ameba and mammalian cells has similar lipid requirements (weber. furthermore, the human homolog of dd5p4, ocrl1, which plays a role in trafficking from endosomes to the trans - golgi network (lowe, 2005), could also be detected at the lcv and likely functions similarly to dd5p4 during intracellular replication (weber., 2009b). therefore, targeting of pi metabolism seems to occur at different stages of the infectious cycle following uptake and contributes to proper establishment of the lcv (figure 2). (1) depending on the model system, uptake into the host cell may require pi3k signaling (khelef., 2001 ; weber., 2006 ; tachado., 2008 ; charpentier., 2009 ; (2) to properly establish the lcv, l. pneumophila interferes with host vesicle trafficking. changes in the composition of pis at the lcv might contribute to altered trafficking (weber. (3) changes in the pi levels at the vacuole may help l. pneumophila to avoid the endocytic pathway (lindmo and stenmark, 2006 ; weber. (4) throughout intracellular growth, pis at the lcv likely provide scaffolding for both l. pneumophila translocated proteins and host proteins (weber., 2006, 2009b ; ragaz., 2008 ; brombacher., the notion that pi3ks do not play a major role in uptake of l. pneumophila was challenged by a study using the j744a.1 murine macrophage cell line (tachado., 2008). in the j744a.1 murine macrophage cell line, phagocytosis of l. pneumophila aa100 (wadsworth) was reduced more severely by the pi3k inhibitors wortmannin and ly294002 than had been reported with other cell lines (khelef. in addition, cells expressing a dominant - negative mutant of pi3k were also depressed for uptake of the wild type l. pneumophila strain. consistent with a role for pi3k during uptake, a downstream signal of pi3k activation, protein kinase b, was activated after challenge with l. pneumophila. induction of the pi3k pathway could only be observed after contact with l. pneumophila expressing an intact icm / dot system (tachado., 2008). one explanation for the conflicting results is that the j744a.1 cell line supports lower levels of l. pneumophila growth than other cell lines. perhaps in cells in which there is luxurious intracellular growth of the bacterium, uptake is independent of pi3ks. however, we have observed that wortmannin inhibits uptake of l. pneumophila into permissive mouse macrophages and it has been reported that uptake of l. pneumophila is reduced after treatment of d. discoideum with pi3k inhibitors (weber., 2006 ; peracino.,. there may be subtle differences in cytoskeletal regulatory circuits that determine whether pi3k is involved in uptake in different cell types. a chemical genetics screen to find host cell functions required for icm / dot - dependent substrate translocation also supports the model that pi3ks are involved in phagocytosis, at least in the j744a.1 cell line (charpentier. phagocytosis was found to be a crucial prerequisite for icm / dot - promoted protein translocation (charpentier., 2009). inhibitors of either actin polymerization or pi3k reduced both icm / dot - dependent protein translocation and bacterial uptake. taken together these data indicate that signaling through pi3k plays an important role during phagocytosis in these models. other novel targets identified by the chemical genetics screen pointed to the importance of tyrosine phosphatases for phagocytosis of l. pneumophila (charpentier., 2009). the functionally redundant receptor protein tyrosine phosphate phosphatases cd45 and cd148 together with other, as yet unidentified, tyrosine phosphatases were shown to modulate uptake. uptake of l. pneumophila into bone marrow - derived macrophages isolated from mice lacking cd45 and cd148 was drastically impaired compared to wild type macrophages, without affecting bacterial adhesion to cells. a more severe reduction in uptake relative to the mutant macrophages was observed in the presence of the cd45 inhibitor rwj-60475, indicating that additional phosphatases may be involved. these results hint at a novel role of tyrosine phosphate phosphatases in phagocytosis of l. pneumophila. this is particularly interesting in light of the fact that there have been few convincing demonstrations that tyrosine phosphatases stimulate phagocytosis, other than the report that the tyrosine phosphatase shp-1 stimulates neisseria uptake (hauck., 1999). generally, tyrosine phosphatase activity has been connected to interference with uptake, as exemplified by the yersinia yoph tyrosine phosphatase (adkins., 2007). after phagocytosis, l. pneumophila resides within a membrane - bound compartment in the host cytosol. one way to prevent cell death involves direct interference of pro - death pathways by icm / dot translocated substrates (laguna. a second mechanism of preventing host cell death during infection is to exploit proteins that are under the control of the mammalian transcription factor nf-b, which acts as a positive regulator of genes encoding anti - apoptotic proteins (karin and lin, 2002). nf-b homo- and heterodimers are master regulators of the mammalian innate immune response that control the expression of almost 400 genes (karin and lin, 2002 ; ahn and aggarwal, 2005 ; hayden and ghosh, 2008). nf-b activation can result from sensing of pathogen associated molecular patterns (pamps ; for example flagellin or peptidoglycan) by pattern recognition receptors (prrs) that include the membrane - bound toll - like receptors (tlrs) and intracellular nod - like receptors (nlrs ; fritz. activation of these receptors triggers a signaling cascade that results in nuclear translocation of nf-b subunits (hayden and ghosh, 2008). signaling downstream from nlrs involves rip2 kinase whereas tlr signaling is mediated via the adaptor proteins myd88 and trif (shaw. both pathways lead to activation of ib kinases (ikks) by phosphorylation. once activated, ikk phosphorylates ib family members, resulting in degradation of these inhibitory proteins that are bound to the canonical nf-b subunits in the cell cytoplasm (hayden and ghosh, 2008). degradation of ib frees the nf-b subunits to be translocated into the nucleus (hayden and ghosh, 2008). the nf-b pathway is manipulated by different pathogens such as h. pylori and rickettsia rickettsii as well as by l. pneumophila (clifton., 1998 ; brandt., 2005). challenge of host cells with l. pneumophila results in increased icm / dot - dependent transcription of nf-b subunits as well as nf-b regulated genes including pro - inflammatory cytokines and antagonists of apoptosis (losick and isberg, 2006 ; abu - zant. besides the engagement of prrs with pamps, direct targeting of the pathway by icm / dot translocated substrates, such as legk1 has been proposed, as pointed out above (ge., 2009). nf-b activation by l. pneumophila is probably more complex than can be explained by the action of a single effector, and likely occurs via the synergistic interaction of prr signaling in combination with icm / dot - dependent components (losick and isberg, 2006 ; shin., 2008 ; bartfeld., prr signaling and icm / dot activation of nf-b appear to have different temporal courses of action, with prr signaling occurring with more rapid kinetics than observed for icm / dot activation of the pathway (bartfeld., 2009). it is unclear, however, if icm / dot activation of nf-b ever occurs totally independently of prr signaling. in macrophages from mice lacking tlr signaling via myd88 and nod signaling via rip2, there appears to be little icm / dot - dependent signaling (shin., 2008), although the presence of either prr pathway is sufficient to support icm / dot - dependent nf-b activation. this argues that although neither the type of bacterial ligand nor its site of encounter within the host cell are important for signaling, there is a requirement for the host cell to sense a pamp for there to exist a strong icm / dot - dependent response. in the human alveolar epithelial cell line short - term activation, measured by nf-b nuclear translocation, depends on tlr5 and myd88 (bartfeld., 2009). this is followed by a tlr - independent long - term activation for which a functional icm / dot system is required. in concert with the data on synergy, these cells still retain nod signaling, which could facilitate the icm / dot - dependent response. during long - term activation, ib is degraded and anti - apoptotic genes are expressed (bartfeld., 2009). induction of anti - apoptotic genes appears to be the common theme in different host cell types (losick and isberg, 2006 ; abu - zant., 2007). the importance of host cell survival to maintain efficient intracellular replication was demonstrated in a / j bone marrow - derived macrophages. however, the presence of nf-b enhanced cell survival and was necessary for efficient replication (losick and isberg, 2006). furthermore, one of the nf-b regulated antagonists of apoptosis had a direct positive influence on host cell survival. in bone marrow macrophages derived from mice lacking plasminogen activator inhibitor-2 (pai-2), there was increased cell death in response to l. pneumophila challenge (losick and isberg, 2006). in bone marrow - derived macrophages from a / j mice, l. pneumophila activates nf-b via at least two pathways depending on the multiplicity of infection. at low dose infections, there is little nuclear translocation of nf-b in the absence of icm / dot, indicating that prr recognition is not sufficient to give a robust signal (losick and isberg, 2006). for these low dose infections, nf-b nuclear translocation is still observed in the absence of myd88 and trif, but relies on icm / dot (losick and isberg, 2006 ; losick., 2010), and presumably nod signaling, based on the work from the roy lab (shin., 2008). at an elevated multiplicity of infection, however, myd88-dependent nf-b activation can be observed in the absence of icm / dot (losick and isberg, 2006). the data on nod signaling adds complexity to formulating models on nf-b signaling, but the basic message is consistent with the idea that as long as at least one prr signaling pathway is intact, an icm / dot - dependent signal can be detected. it is clear that in bone marrow - derived macrophages capable of tlr signaling, icm / dot - dependent activation of nf-b occurs in the absence of nod1 or rip2, even under conditions of low multiplicity challenge with l. pneumophila (losick and isberg, 2006 ; losick., 2010). however, in hek293 t cells, which do not express tlrs that efficiently engage l. pneumophila, knockdown of nod1 reduces nf-b activation (losick., 2010). these results complement results indicating that icm / dot - dependent nf-b activation in the absence of myd88 is only seen when rip2 is present (shin., 2008). therefore, crosstalk between icm / dot translocated substrates and pamp signaling must exist, but the source of the pamp or the site in the cell that pamp signaling is initiated do not appear to be critical (losick., tlr engagement acts together with icm / dot in cells lacking rip2 signaling, while similarly, nod signaling collaborates with icm / dot in cells that lack the tlr pathway. this indicates that in the case of collaboration with icm / dot, the nlr, and tlr pathways could be redundant. the significant impact of icm / dot on the activation of nf-b led to two investigations to identify translocated substrates that could directly induce activation of this protein. nf-b can be stimulated as a response to many different cellular insults, with er stress and disruption of the actin cytoskeleton being two important examples (nemeth., 2004 ; ahn and aggarwal, 2005 ; schroder, 2008). using similar approaches, two laboratories have identified icm / dot translocated substrates that are able to induce an nf-b reporter when ectopically expressed in hek293 t cells. as described above, legk1 was one of these substrates (ge., 2009). in addition, there were a number of activators that showed modest activation of the reporter (ge. 2010) as well as another strong inducer, the translocated substrate lnab (losick., 2010). when bacteria are grown into post - exponential phase, lnab was shown to be required to fully activate the nf-b reporter after challenge of hek293 t cells with l. pneumophila (losick., 2010). this suggests that this domain of lnab interacts with a protein in the signaling cascade upstream of nf-b or it may contribute to a cellular activity that increases nf-b signaling. however, the role of lnab in a cellular process leading directly or indirectly to nf-b activation is not known (losick., 2010). although there is no evidence that legk1 induces nf-b after l. pneumophila challenge (losick., 2010), as described above, in vitro experiments demonstrate a direct interaction with the signaling cascade upstream of nf-b (ge., 2009), and its pathway of activation could be very different from that observed with lnab. besides lnab and legk1, five icm / dot translocated inhibitors of host translation exhibited nf-b inducing activity accompanied by a distinctive transcriptional response including il23a and csf2 induction (fontana., 2011). it is possible that many icm / dot translocated substrates may lead to activation of the nf-b pathway via a stress response rather than directly modulating the activity of proteins that regulate the nuclear translocation of this protein. the l. pneumophila proteins lgt1, lgt2, lgt3, sidi, and sidl are known to cause an inhibition of host translation. this interferes with the synthesis of the unstable ib inhibitory protein, which releases cytoplasmic nf-b, allowing subsequent translocation into the nucleus (hayden and ghosh, 2008 ; fontana., 2011). this inhibition of host protein synthesis caused by icm / dot substrates appears to be a key to causing sustained activation of nf-b that can synergize with either tlr or rip2-dependent signaling, as a l. pneumophila mutant lacking several translocated substrates that act as protein synthesis inhibitors is defective for nf-b activation (fontana. in addition to prr mediated activation, icm / dot translocated substrates induce nf-b by multiple mechanisms. during induction of the nf-b pathway, the inhibitor ib is phosphorylated by ikk and degraded, leading to nuclear translocation of the transcription factor (hayden and ghosh, 2008). five dot / icm translocated substrates are known to target this pathway by inhibiting host translation (fontana., 2011). this inhibition of translation interferes with the synthesis of the unstable inhibitor ib and frees nf-b subunits to translocate into the nucleus (hayden and ghosh, 2008 ; fontana., 2011). the ser / thr kinase legk1 has the ability to act directly on the nf-b pathway by phosphorylating ib (ge., 2009), resulting in its degradation. the translocated protein lnab activates nf-b by an as yet unknown mechanism (losick., 2010). in addition to the nf-b pathway, which is only found in multicellular eukaryotes, the map kinase pathway is a second component of the innate immune system that is targeted during l. pneumophila infection (welsh., 2004 ; losick and isberg, 2006 ; the natural amebal hosts employ the map kinase pathway, so there is good reason to believe that selective pressures for effective interaction with map kinases must have taken place to facilitate intracellular replication of the bacterium. mapks regulate diverse cellular processes such as gene expression, cytoskeletal integrity, cell death, mitosis, and the induction of inflammatory mediators (johnson and lapadat, 2002 ; jeffrey., 2007 ; pullikuth and catling, 2007 ; huang., 2009). a cascade of sequentially active kinases, mapkkks and mapkks, activate mapks by threonine and tyrosine phosphorylation (johnson and lapadat, 2002 ; huang., 2009). activated mapks in turn phosphorylate specific substrates such as transcription factors, other kinases, or cytoskeletal proteins (johnson and lapadat, 2002). the four best characterized families of mapks found in higher eukaryotes, erk, jnk, p38, and erk5 respond to various stimuli, and are activated by specific mapkkks, resulting in both signal and target - specific responses (johnson and lapadat, 2002 ; huang., 2009). mapk signaling can be induced by activation of tlrs or nlrs as well as other stress response signals (johnson and lapadat, 2002 ; huang., 2009). linkage of nlrs to mapks occurs via rip2 and card9 while tlr signaling to mapks is myd88-dependent (hsu., 2007 ; liu. in order to ensure a proper balance of activation, mapks are regulated on a variety of levels including elaborate feedback loops and spatial separation of signaling (jeffrey., 2007). after activation by the map kinase relay, inactivation occurs by dephosphorylation of thr and tyr residues of mapks by dusps (lang., 2006 ; jeffrey. dusp family members are under tight control both at the transcriptional level and by post - translational modifications (patterson., 2009) and in order to ensure specific targeting of mapks, they differ in their expression pattern and cellular localization (lang., 2006 ; jeffrey., 2007). despite these differences, a common feature of many dusps is their transcriptional activation downstream from mapk signaling, providing important feedback control of mapk activation. in addition to transcriptional control, dusp protein stability is influenced by mapks (jeffrey., 2007). unlike the nf-b pathway, mapks are also found in lower eukaryotes such as yeast and ameba (molina., 2010). d. discoideum contains two enzymes similar to the mammalian erk family (gaskins., 1994 ; segall., 1995). in d. discoideum, erk-1 is phosphorylated shortly after l. pneumophila challenge with either a wild type or a icm / dot - deficient mutant (li., 2009). inactivation of erk-1 most likely relies on the tyrosine kinase / dual specificity phosphatase dupa, as there is constitutive activation of the mapk in strains lacking dupa. the correct temporal regulation of erk-1 activation has a significant impact on intracellular growth and host gene expression. in a mutant lacking dupa, intracellular replication of l. pneumophila is impaired, and this accompanied by hyperphosphorylation of erk-1 relative to wild type amebae (li., 2009). the resulting transcriptional response in cells having hyperactivated erk-1 included over 500 misregulated genes that were also impacted in wild type amebae after challenge with l. pneumophila. interestingly, these genes include those encoding proteins hypothesized to play a role in the amebal response to pathogens (li., 2009). as in amebae, mapk activation was also observed as a response to infection in murine bone marrow - derived macrophages (shin., 2008). here, erk is activated independently of icm / dot and in the absence of the tlr signaling. activation of p38 and sapk / jnk follows a different pattern from mammalian erk and is composed of an initial myd88-dependent, icm / dot - independent component, as well as a delayed prolonged myd88-independent component that relies on icm / dot. the kinetic data are reminiscent of mapk activation in amebae, in that p38 and sapk / jnk activation peaks at 1-h post infection and continues for 4 h. the high and sustained mapk activity in response to l. pneumophila is necessary for increased cytokine production and requires myd88-dependent, icm / dot - independent and myd88-independent, icm / dot - dependent signaling. as icm / dot is required to fully activate mapk signaling it was proposed that translocated substrates may play a role in this process. this idea was supported by data showing that the pore forming activity of the type iv secretion system alone is not sufficient to activate p38 and sapk / jnk (shin., 2008). signaling through p38 and sapk / jnk may involve icm / dot substrates that directly target the mapk pathway or substrates that exhibit inducing activity by acting on a different host process and thereby indirectly activate mapks (figure 4). however, the most likely icm / dot substrates containing ser / thr kinase domains, legk1, legk2, and legk3, could be excluded as direct p38 activators (shin., 2008). as described for nf-b induction (fontana., 2011), icm / dot translocated substrates that inhibit host protein synthesis could also explain the icm / dot - dependent mechanism of mapk activation mapks are activated by sequentially induced kinases and in turn phosphorylate cellular and nuclear proteins such as transcription factors (johnson and lapadat, 2002 ; huang., 2009). inactivation of mapks results from dephosphorylation by dual specificity phosphatases (dusps ; lang., 2006 ; jeffrey., 2007) dusps are regulated on many levels to ensure proper signaling through mapks, and mapks themselves can control dusps at the level of transcription and protein stability (jeffrey., 2007). during l. pneumophila challenge of host cells, induction of the mapk signaling pathway occurs through prr signaling as well as by icm / dot - dependent activity in macrophages, and via unidentified sensors in amebae (shin., 2008 ; li., 2009). whether icm / dot translocated substrates target kinases upstream of mapk, or, whether interference with protein synthesis is sufficient to alter mapk activity, is unknown (shin., 2008). as observed with dupa in amebae, dusps also play a role during infection in mammalian cells. an icm / dot - dependent increase in transcription of dusp genes was observed in the human macrophage - like u937 cell line (losick and isberg, 2006). in mouse bone marrow - derived macrophages, it was shown that icm / dot - dependent induction of dusp1 transcription did not require myd88 or rip2 kinase (shin., 2008). since dusp transcription is upregulated by mapks, this increase might be due to enhanced mapk activity during infection. however, an increase of dusp protein levels that would be expected to accompany increased transcription of the gene could not be observed, perhaps because of the presence of the l. pneumophila translocated substrates that interfere with protein synthesis in the host cell. mitogen - activated protein kinase activation appears to be a common response to l. pneumophila infection in lower and higher eukaryotes. even though a direct participation of l. pneumophila proteins in mapk activation seems likely, so far no icm / dot substrate was shown to act directly on the mapk pathway. concerning the function of dusps in regulating mapks during infection, the requirement of dusps to ensure proper balance of mapk signaling is obvious from results in d. discoideum, as misregulation of erk-1 interferes with intracellular growth of the bacterium (li., 2009). the role of dusps in mammalian cells is not clear, however, especially since the induction of gene expression does not appear reflected in increased protein levels of dusps. in fact, the icm / dot - dependent induction of dusp transcription may be the result of mapk activation caused by interference of host protein synthesis by l. pneumophila, so both transcriptional induction, and the lack of a translational response, are promoted by the same translocated substrates. dusp expression is no longer elevated as a response to l. pneumophila infection in the absence of the five icm / dot translocated inhibitors of host translation, lgt1, lgt2, lgt3, sidi, and sidl. each cycle of infection starts with uptake of l. pneumophila into the host cell by phagocytosis. uptake into human alveolar macrophages under non - opsonized conditions has been documented to occur by coiling phagocytosis (horwitz, 1984 ; charpentier., 2009). the mechanism of phagocytosis of l. pneumophila, however, has been a point of dispute for some time, with the role of pi3ks being a particular focus of controversy. as mentioned above, pathogens may be taken up in a pi3k - dependent manner (weber., 2009a). activation of pi3k leads to downstream signaling events that involve synthesis of pi(3,4,5)p3, which is likely to be followed by recruitment of guanidine nucleotide exchange factors that activate rho family gtpases involved in regulation of actin rearrangements (lindmo and stenmark, 2006). the role of pi3ks during phagocytosis of l. pneumophila appears to differ between host systems, bacterial strains, and the experimental setup used (see below). initially, it was postulated that uptake of virulent l. pneumophila jr32 (philadelphia-1) into u937 human macrophage - like cells does not depend on pi3ks (khelef., 2001). phagocytosis of l. pneumophila having an intact icm / dot system was not blocked by the pi3k inhibitor wortmannin, and this failure to inhibit uptake was independent of the opsonization conditions used. when actin polymerization was visualized at l. pneumophila entry sites, there appeared to be no affect of inhibitors of pi3k function. however, a mutant having an inactivated icm / dot system was taken up in a pi3k - dependent manner indicating that the presence of a functional protein translocation system targets l. pneumophila into a unique uptake pathway (khelef., 2001). in the ameba dictyostelium discoideum, inhibition of pi3ks by wortmannin and in spite of this reduction in uptake, deletion of class i pi3ks appeared to have a positive influence on intracellular replication (weber. deletion of genes encoding pi3ks, as well as chemical inhibition of their activities, changes the morphology of the replication vacuole and it was postulated that this structure might stimulate intracellular replication (weber., 2006). the absence of pi3ks could result in an altered composition of pis at the legionella - containing vacuole (lcv) causing changes in host protein recruitment. also, improved intracellular replication could be due to enhanced bypass of the endocytic pathway, which requires pi3k activity, and may compete for sequestration of the microorganism into a compartment that is restrictive for intracellular growth (lindmo and stenmark, 2006 ; weber. besides pi3ks, another enzyme involved in pi metabolism, the inositol polyphosphate-5-phosphatase dd5p4, influences l. pneumophila infection in d. discoideum. host cells lacking dd5p4 showed a defect in uptake, but once internalized, the bacteria showed improved intracellular replication, which is similar to the phenotype observed for loss of pi3k (weber., 2006, 2009b). dd5p4 is recruited to the lcv in a icm / dot - dependent manner and is catalytically active, which putatively leads to conversion from pi(4,5)p2 to pi(4)p (weber., 2009b). pi(4)p is considered a lipid marker for the lcv, that serves as an anchor for icm / dot substrates and is detectable at the lcv dependent on the presence of an intact icm / dot system (weber., 2006 ; ragaz., 2008 ; brombacher.,, pi(4)p is also found at the lcv in infected raw264.7 murine macrophage cells indicating that intracellular replication within ameba and mammalian cells has similar lipid requirements (weber., 2006). furthermore, the human homolog of dd5p4, ocrl1, which plays a role in trafficking from endosomes to the trans - golgi network (lowe, 2005), could also be detected at the lcv and likely functions similarly to dd5p4 during intracellular replication (weber., 2009b). therefore, targeting of pi metabolism seems to occur at different stages of the infectious cycle following uptake and contributes to proper establishment of the lcv (figure 2). (1) depending on the model system, uptake into the host cell may require pi3k signaling (khelef. (2) to properly establish the lcv, l. pneumophila interferes with host vesicle trafficking. changes in the composition of pis at the lcv might contribute to altered trafficking (weber. (3) changes in the pi levels at the vacuole may help l. pneumophila to avoid the endocytic pathway (lindmo and stenmark, 2006 ; weber. (4) throughout intracellular growth, pis at the lcv likely provide scaffolding for both l. pneumophila translocated proteins and host proteins (weber., 2006, 2009b ; ragaz., 2008 ; brombacher., the notion that pi3ks do not play a major role in uptake of l. pneumophila was challenged by a study using the j744a.1 murine macrophage cell line (tachado., 2008). in the j744a.1 murine macrophage cell line, phagocytosis of l. pneumophila aa100 (wadsworth) was reduced more severely by the pi3k inhibitors wortmannin and ly294002 than had been reported with other cell lines (khelef., 2001 ; weber., 2006 ; in addition, cells expressing a dominant - negative mutant of pi3k were also depressed for uptake of the wild type l. pneumophila strain. consistent with a role for pi3k during uptake, a downstream signal of pi3k activation, protein kinase b, was activated after challenge with l. pneumophila. induction of the pi3k pathway could only be observed after contact with l. pneumophila expressing an intact icm / dot system (tachado., 2008). one explanation for the conflicting results is that the j744a.1 cell line supports lower levels of l. pneumophila growth than other cell lines. perhaps in cells in which there is luxurious intracellular growth of the bacterium, uptake is independent of pi3ks. however, we have observed that wortmannin inhibits uptake of l. pneumophila into permissive mouse macrophages and it has been reported that uptake of l. pneumophila is reduced after treatment of d. discoideum with pi3k inhibitors (weber., 2006 ; peracino.,. there may be subtle differences in cytoskeletal regulatory circuits that determine whether pi3k is involved in uptake in different cell types. a chemical genetics screen to find host cell functions required for icm / dot - dependent substrate translocation also supports the model that pi3ks are involved in phagocytosis, at least in the j744a.1 cell line (charpentier., 2009). in this study, phagocytosis was found to be a crucial prerequisite for icm / dot - promoted protein translocation (charpentier., 2009). inhibitors of either actin polymerization or pi3k reduced both icm / dot - dependent protein translocation and bacterial uptake. taken together these data indicate that signaling through pi3k plays an important role during phagocytosis in these models. other novel targets identified by the chemical genetics screen pointed to the importance of tyrosine phosphatases for phagocytosis of l. pneumophila (charpentier., 2009). the functionally redundant receptor protein tyrosine phosphate phosphatases cd45 and cd148 together with other, as yet unidentified, tyrosine phosphatases were shown to modulate uptake. uptake of l. pneumophila into bone marrow - derived macrophages isolated from mice lacking cd45 and cd148 was drastically impaired compared to wild type macrophages, without affecting bacterial adhesion to cells. a more severe reduction in uptake relative to the mutant macrophages was observed in the presence of the cd45 inhibitor rwj-60475, indicating that additional phosphatases may be involved. these results hint at a novel role of tyrosine phosphate phosphatases in phagocytosis of l. pneumophila. this is particularly interesting in light of the fact that there have been few convincing demonstrations that tyrosine phosphatases stimulate phagocytosis, other than the report that the tyrosine phosphatase shp-1 stimulates neisseria uptake (hauck., 1999). generally, tyrosine phosphatase activity has been connected to interference with uptake, as exemplified by the yersinia yoph tyrosine phosphatase (adkins., 2007). after phagocytosis, l. pneumophila resides within a membrane - bound compartment in the host cytosol. consequently, survival of the host cell is necessary for successful replication. one way to prevent cell death involves direct interference of pro - death pathways by icm / dot translocated substrates (laguna., 2006 ; a second mechanism of preventing host cell death during infection is to exploit proteins that are under the control of the mammalian transcription factor nf-b, which acts as a positive regulator of genes encoding anti - apoptotic proteins (karin and lin, 2002). nf-b homo- and heterodimers are master regulators of the mammalian innate immune response that control the expression of almost 400 genes (karin and lin, 2002 ; ahn and aggarwal, 2005 ; hayden and ghosh, 2008). nf-b activation can result from sensing of pathogen associated molecular patterns (pamps ; for example flagellin or peptidoglycan) by pattern recognition receptors (prrs) that include the membrane - bound toll - like receptors (tlrs) and intracellular nod - like receptors (nlrs ; fritz. activation of these receptors triggers a signaling cascade that results in nuclear translocation of nf-b subunits (hayden and ghosh, 2008). signaling downstream from nlrs involves rip2 kinase whereas tlr signaling is mediated via the adaptor proteins myd88 and trif (shaw., 2008 ; kawai and akira, 2010). both pathways lead to activation of ib kinases (ikks) by phosphorylation. once activated, ikk phosphorylates ib family members, resulting in degradation of these inhibitory proteins that are bound to the canonical nf-b subunits in the cell cytoplasm (hayden and ghosh, 2008). degradation of ib frees the nf-b subunits to be translocated into the nucleus (hayden and ghosh, 2008). the nf-b pathway is manipulated by different pathogens such as h. pylori and rickettsia rickettsii as well as by l. pneumophila (clifton., 1998 ; brandt., 2005). challenge of host cells with l. pneumophila results in increased icm / dot - dependent transcription of nf-b subunits as well as nf-b regulated genes including pro - inflammatory cytokines and antagonists of apoptosis (losick and isberg, 2006 ; abu - zant. besides the engagement of prrs with pamps, direct targeting of the pathway by icm / dot translocated substrates, such as legk1 has been proposed, as pointed out above (ge., 2009). nf-b activation by l. pneumophila is probably more complex than can be explained by the action of a single effector, and likely occurs via the synergistic interaction of prr signaling in combination with icm / dot - dependent components (losick and isberg, 2006 ; shin., 2008 ; bartfeld., prr signaling and icm / dot activation of nf-b appear to have different temporal courses of action, with prr signaling occurring with more rapid kinetics than observed for icm / dot activation of the pathway (bartfeld., 2009). it is unclear, however, if icm / dot activation of nf-b ever occurs totally independently of prr signaling. in macrophages from mice lacking tlr signaling via myd88 and nod signaling via rip2, there appears to be little icm / dot - dependent signaling (shin., 2008), although the presence of either prr pathway is sufficient to support icm / dot - dependent nf-b activation. this argues that although neither the type of bacterial ligand nor its site of encounter within the host cell are important for signaling, there is a requirement for the host cell to sense a pamp for there to exist a strong icm / dot - dependent response. in the human alveolar epithelial cell line short - term activation, measured by nf-b nuclear translocation, depends on tlr5 and myd88 (bartfeld., 2009). this is followed by a tlr - independent long - term activation for which a functional icm / dot system is required. in concert with the data on synergy, these cells still retain nod signaling, which could facilitate the icm / dot - dependent response. during long - term activation, ib is degraded and anti - apoptotic genes are expressed (bartfeld., 2009). induction of anti - apoptotic genes appears to be the common theme in different host cell types (losick and isberg, 2006 ; abu - zant., 2007). the importance of host cell survival to maintain efficient intracellular replication was demonstrated in a / j bone marrow - derived macrophages. however, the presence of nf-b enhanced cell survival and was necessary for efficient replication (losick and isberg, 2006). furthermore, one of the nf-b regulated antagonists of apoptosis had a direct positive influence on host cell survival. in bone marrow macrophages derived from mice lacking plasminogen activator inhibitor-2 (pai-2), there was increased cell death in response to l. pneumophila challenge (losick and isberg, 2006). in bone marrow - derived macrophages from a / j mice, l. pneumophila activates nf-b via at least two pathways depending on the multiplicity of infection. at low dose infections, there is little nuclear translocation of nf-b in the absence of icm / dot, indicating that prr recognition is not sufficient to give a robust signal (losick and isberg, 2006). for these low dose infections, nf-b nuclear translocation is still observed in the absence of myd88 and trif, but relies on icm / dot (losick and isberg, 2006 ; losick., 2010), and presumably nod signaling, based on the work from the roy lab (shin., 2008). at an elevated multiplicity of infection, however, myd88-dependent nf-b activation can be observed in the absence of icm / dot (losick and isberg, 2006). the data on nod signaling adds complexity to formulating models on nf-b signaling, but the basic message is consistent with the idea that as long as at least one prr signaling pathway is intact, an icm / dot - dependent signal can be detected. it is clear that in bone marrow - derived macrophages capable of tlr signaling, icm / dot - dependent activation of nf-b occurs in the absence of nod1 or rip2, even under conditions of low multiplicity challenge with l. pneumophila (losick and isberg, 2006 ; losick., 2010). however, in hek293 t cells, which do not express tlrs that efficiently engage l. pneumophila, knockdown of nod1 reduces nf-b activation (losick., 2010). these results complement results indicating that icm / dot - dependent nf-b activation in the absence of myd88 is only seen when rip2 is present (shin., 2008). therefore, crosstalk between icm / dot translocated substrates and pamp signaling must exist, but the source of the pamp or the site in the cell that pamp signaling is initiated do not appear to be critical (losick., 2010). tlr engagement acts together with icm / dot in cells lacking rip2 signaling, while similarly, nod signaling collaborates with icm / dot in cells that lack the tlr pathway. this indicates that in the case of collaboration with icm / dot, the nlr, and tlr pathways could be redundant. the significant impact of icm / dot on the activation of nf-b led to two investigations to identify translocated substrates that could directly induce activation of this protein. nf-b can be stimulated as a response to many different cellular insults, with er stress and disruption of the actin cytoskeleton being two important examples (nemeth., 2004 ; ahn and aggarwal, 2005 ; schroder, 2008). using similar approaches, two laboratories have identified icm / dot translocated substrates that are able to induce an nf-b reporter when ectopically expressed in hek293 t cells. as described above, legk1 was one of these substrates (ge., 2009). in addition, there were a number of activators that showed modest activation of the reporter (ge. 2010) as well as another strong inducer, the translocated substrate lnab (losick., 2010). when bacteria are grown into post - exponential phase, lnab was shown to be required to fully activate the nf-b reporter after challenge of hek293 t cells with l. pneumophila (losick., 2010). this suggests that this domain of lnab interacts with a protein in the signaling cascade upstream of nf-b or it may contribute to a cellular activity that increases nf-b signaling. however, the role of lnab in a cellular process leading directly or indirectly to nf-b activation is not known (losick., 2010). although there is no evidence that legk1 induces nf-b after l. pneumophila challenge (losick., 2010), as described above, in vitro experiments demonstrate a direct interaction with the signaling cascade upstream of nf-b (ge., 2009), and its pathway of activation could be very different from that observed with lnab. besides lnab and legk1, five icm / dot translocated inhibitors of host translation exhibited nf-b inducing activity accompanied by a distinctive transcriptional response including il23a and csf2 induction (fontana., 2011). it is possible that many icm / dot translocated substrates may lead to activation of the nf-b pathway via a stress response rather than directly modulating the activity of proteins that regulate the nuclear translocation of this protein. the l. pneumophila proteins lgt1, lgt2, lgt3, sidi, and sidl are known to cause an inhibition of host translation. this interferes with the synthesis of the unstable ib inhibitory protein, which releases cytoplasmic nf-b, allowing subsequent translocation into the nucleus (hayden and ghosh, 2008 ; fontana., 2011). this inhibition of host protein synthesis caused by icm / dot substrates appears to be a key to causing sustained activation of nf-b that can synergize with either tlr or rip2-dependent signaling, as a l. pneumophila mutant lacking several translocated substrates that act as protein synthesis inhibitors is defective for nf-b activation (fontana. in addition to prr mediated activation, icm / dot translocated substrates induce nf-b by multiple mechanisms. during induction of the nf-b pathway, the inhibitor ib is phosphorylated by ikk and degraded, leading to nuclear translocation of the transcription factor (hayden and ghosh, 2008). five dot / icm translocated substrates are known to target this pathway by inhibiting host translation (fontana., 2011). this inhibition of translation interferes with the synthesis of the unstable inhibitor ib and frees nf-b subunits to translocate into the nucleus (hayden and ghosh, 2008 ; fontana., 2011). the ser / thr kinase legk1 has the ability to act directly on the nf-b pathway by phosphorylating ib (ge., 2009), resulting in its degradation. the translocated protein lnab activates nf-b by an as yet unknown mechanism (losick., 2010). in addition to the nf-b pathway, which is only found in multicellular eukaryotes, the map kinase pathway is a second component of the innate immune system that is targeted during l. pneumophila infection (welsh., 2004 ; losick and isberg, 2006 ; shin., 2008 ; li., 2009) the natural amebal hosts employ the map kinase pathway, so there is good reason to believe that selective pressures for effective interaction with map kinases must have taken place to facilitate intracellular replication of the bacterium. mapks regulate diverse cellular processes such as gene expression, cytoskeletal integrity, cell death, mitosis, and the induction of inflammatory mediators (johnson and lapadat, 2002 ; jeffrey., 2007 ; pullikuth and catling, 2007 ; huang., 2009). a cascade of sequentially active kinases, mapkkks and mapkks, activate mapks by threonine and tyrosine phosphorylation (johnson and lapadat, 2002 ; huang., 2009). activated mapks in turn phosphorylate specific substrates such as transcription factors, other kinases, or cytoskeletal proteins (johnson and lapadat, 2002). the four best characterized families of mapks found in higher eukaryotes, erk, jnk, p38, and erk5 respond to various stimuli, and are activated by specific mapkkks, resulting in both signal and target - specific responses (johnson and lapadat, 2002 ; huang., 2009). mapk signaling can be induced by activation of tlrs or nlrs as well as other stress response signals (johnson and lapadat, 2002 ; huang., 2009). linkage of nlrs to mapks occurs via rip2 and card9 while tlr signaling to mapks is myd88-dependent (hsu., 2007 ; liu. in order to ensure a proper balance of activation, mapks are regulated on a variety of levels including elaborate feedback loops and spatial separation of signaling (jeffrey., 2007). after activation by the map kinase relay, inactivation occurs by dephosphorylation of thr and tyr residues of mapks by dusps (lang., 2006 ; jeffrey., 2007). dusp family members are under tight control both at the transcriptional level and by post - translational modifications (patterson., 2009) and in order to ensure specific targeting of mapks, they differ in their expression pattern and cellular localization (lang., 2006 ; jeffrey. despite these differences, a common feature of many dusps is their transcriptional activation downstream from mapk signaling, providing important feedback control of mapk activation. in addition to transcriptional control, dusp protein stability is influenced by mapks (jeffrey., 2007). unlike the nf-b pathway, mapks are also found in lower eukaryotes such as yeast and ameba (molina., 2010). d. discoideum contains two enzymes similar to the mammalian erk family (gaskins., erk-1 is phosphorylated shortly after l. pneumophila challenge with either a wild type or a icm / dot - deficient mutant (li., 2009). inactivation of erk-1 most likely relies on the tyrosine kinase / dual specificity phosphatase dupa, as there is constitutive activation of the mapk in strains lacking dupa. the correct temporal regulation of erk-1 activation has a significant impact on intracellular growth and host gene expression. in a mutant lacking dupa, intracellular replication of l. pneumophila is impaired, and this accompanied by hyperphosphorylation of erk-1 relative to wild type amebae (li., 2009). the resulting transcriptional response in cells having hyperactivated erk-1 included over 500 misregulated genes that were also impacted in wild type amebae after challenge with l. pneumophila. interestingly, these genes include those encoding proteins hypothesized to play a role in the amebal response to pathogens (li., 2009). as in amebae, mapk activation was also observed as a response to infection in murine bone marrow - derived macrophages (shin., 2008). here, erk is activated independently of icm / dot and in the absence of the tlr signaling. activation of p38 and sapk / jnk follows a different pattern from mammalian erk and is composed of an initial myd88-dependent, icm / dot - independent component, as well as a delayed prolonged myd88-independent component that relies on icm / dot. the kinetic data are reminiscent of mapk activation in amebae, in that p38 and sapk / jnk activation peaks at 1-h post infection and continues for 4 h. the high and sustained mapk activity in response to l. pneumophila is necessary for increased cytokine production and requires myd88-dependent, icm / dot - independent and myd88-independent, icm / dot - dependent signaling. as icm / dot is required to fully activate mapk signaling it was proposed that translocated substrates may play a role in this process. this idea was supported by data showing that the pore forming activity of the type iv secretion system alone is not sufficient to activate p38 and sapk / jnk (shin., signaling through p38 and sapk / jnk may involve icm / dot substrates that directly target the mapk pathway or substrates that exhibit inducing activity by acting on a different host process and thereby indirectly activate mapks (figure 4). however, the most likely icm / dot substrates containing ser / thr kinase domains, legk1, legk2, and legk3, could be excluded as direct p38 activators (shin., 2008). as described for nf-b induction (fontana., 2011), icm / dot translocated substrates that inhibit host protein synthesis could also explain the icm / dot - dependent mechanism of mapk activation mapks are activated by sequentially induced kinases and in turn phosphorylate cellular and nuclear proteins such as transcription factors (johnson and lapadat, 2002 ; huang., 2009). inactivation of mapks results from dephosphorylation by dual specificity phosphatases (dusps ; lang., 2006 ; jeffrey., 2007) dusps are regulated on many levels to ensure proper signaling through mapks, and mapks themselves can control dusps at the level of transcription and protein stability (jeffrey., 2007). during l. pneumophila challenge of host cells, induction of the mapk signaling pathway occurs through prr signaling as well as by icm / dot - dependent activity in macrophages, and via unidentified sensors in amebae (shin., 2008 ; li., 2009). whether icm / dot translocated substrates target kinases upstream of mapk, or, whether interference with protein synthesis is sufficient to alter mapk activity, is unknown (shin., 2008). as observed with dupa in amebae, dusps also play a role during infection in mammalian cells. an icm / dot - dependent increase in transcription of dusp genes was observed in the human macrophage - like u937 cell line (losick and isberg, 2006). in mouse bone marrow - derived macrophages, it was shown that icm / dot - dependent induction of dusp1 transcription did not require myd88 or rip2 kinase (shin., 2008). since dusp transcription is upregulated by mapks, this increase might be due to enhanced mapk activity during infection. however, an increase of dusp protein levels that would be expected to accompany increased transcription of the gene could not be observed, perhaps because of the presence of the l. pneumophila translocated substrates that interfere with protein synthesis in the host cell. mitogen - activated protein kinase activation appears to be a common response to l. pneumophila infection in lower and higher eukaryotes. even though a direct participation of l. pneumophila proteins in mapk activation seems likely, so far no icm / dot substrate was shown to act directly on the mapk pathway. concerning the function of dusps in regulating mapks during infection, the requirement of dusps to ensure proper balance of mapk signaling is obvious from results in d. discoideum, as misregulation of erk-1 interferes with intracellular growth of the bacterium (li., 2009). the role of dusps in mammalian cells is not clear, however, especially since the induction of gene expression does not appear reflected in increased protein levels of dusps. in fact, the icm / dot - dependent induction of dusp transcription may be the result of mapk activation caused by interference of host protein synthesis by l. pneumophila, so both transcriptional induction, and the lack of a translational response, are promoted by the same translocated substrates. dusp expression is no longer elevated as a response to l. pneumophila infection in the absence of the five icm / dot translocated inhibitors of host translation, lgt1, lgt2, lgt3, sidi, and sidl. legionella pneumophila is known to interfere with many host cell processes such as the ubiquitination machinery (kubori., 2008, 2010 ; ivanov and roy, 2009 ; ensminger and isberg, 2010 ; price., 2010), host translation (de felipe., 2005 ; belyi., 2006, 2008), or vesicle trafficking (murata. here we have presented a selected overview of targeted host cell pathways that mediate signal transduction through changes in the phosphorylation state of proteins and lipids. as phosphorylation and dephosphorylation are among the most common modifications in cell signaling, l. pneumophila exploits host phosphorylation at all stages of infection. targeting of the host phosphorylation machinery may involve direct modification of host factors by l. pneumophila proteins that act as kinases or phosphatases as well as sensing of cellular processes during infection that indirectly change the phosphorylation state of host proteins. in the case of pi metabolism, the importance of controlling flux and recruitment of this important lipid during intracellular replication in amebae was clearly demonstrated (weber., 2006, 2009b ; ragaz., 2008 ; brombacher., 2009 ; peracino., 2010), whereas the role of pi3ks during uptake of l. pneumophila is not yet resolved and differs depending on the model system (khelef., 2001 ; weber., 2006 ; tachado., 2008 ; charpentier., 2009 ; peracino., the requirement of icm / dot translocation for nf-b and mapk activation implies that translocated substrates contribute to these regulatory changes in host cells. besides the inducing activity of inhibitors of host translation, no other mechanism for this activation has been proposed based on in vivo studies, so in the future it will be very interesting to determine what other factors induce these pathways apart from prr signaling. with the emerging knowledge on the function of icm / dot translocated substrates, details regarding the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	phosphorylation is one of the most frequent modifications in intracellular signaling and is implicated in many processes ranging from transcriptional control to signal transduction in innate immunity. many pathogens modulate host cell phosphorylation pathways to promote growth and establish an infectious disease. the intracellular pathogen legionella pneumophila targets and exploits the host phosphorylation system throughout the infection cycle as part of its strategy to establish an environment beneficial for replication. key to this manipulation is the l. pneumophila icm / dot type iv secretion system, which translocates bacterial proteins into the host cytosol that can act directly on phosphorylation cascades. this review will focus on the different stages of l. pneumophila infection, in which host kinases and phosphatases contribute to infection of the host cell and promote intracellular survival of the pathogen. this includes the involvement of phosphatidylinositol 3-kinases during phagocytosis as well as the role of phosphoinositide metabolism during the establishment of the replication vacuole. furthermore, l. pneumophila infection modulates the nf-b and mitogen - activated protein kinase pathways, two signaling pathways that are central to the host innate immune response and involved in regulation of host cell survival. therefore, l. pneumophila infection manipulates host cell signal transduction by phosphorylation at multiple levels.
freshwater eels, genus anguilla, consist of 19 species and subspecies, and inhabit from tropical to temperate areas all over the world, except for the coastal lines of the south atlantic and eastern pacific oceans (ege 1939 ; watanabe. all anguillid species have catadromous life histories, in which spawning occurs in the sea, and eggs and larvae (called leptocephali) are transported by warm ocean currents to coastal recruitment areas. when they reach there, after several years in their growth habitats in freshwater rivers, estuaries and lakes, they start downstream migration and go back to their natal spawning areas in the ocean for reproduction (tesch 2003 ; tsukamoto 2009). the eel migration, which for some species spans thousands of kilometres, has been a great mystery until recently, when the spawning area of the japanese eel (anguilla japonica) was pinpointed near the western mariana ridge (tsukamoto 2006 ; tsukamoto. this unique ecology of eels has instigated many scientific questions, and thus intensive research has been conducted to reveal their biology. apart from this biological particularity, eels have also received much economical attention because they are one of the most commercially important aquatic species in asia, europe, the united states and new zealand. the global production in 2009 was approximately 284,000 tons, of which 97 % is derived from aquaculture (fao fisheries and aquaculture information and statistics service). since there is no artificial eel seed for aquaculture, eel resource is currently fully dependent on the natural population : glass eels annually recruiting to continental areas from their spawning ground. however, glass eel catch has been drastically declining over the last four decades (dekker. in fact, the population of the european eel a. anguilla has collapsed to the point where it is now listed as a critically endangered species (iucn 2008). strict stock management is implemented at the european union level, which includes not only regulation of glass eel catches but also adult eel fishing (ices 2010). accordingly, there is an urgent need for success in artificial reproduction to compensate for the shortage of the eel stock. artificial reproduction of eels has been attempted since the 1930s. based on the first experiments in the european eel (fontaine 1936 ; fontaine. 1964), artificial sexual maturation of eels is induced in a. anguilla, a. rostrata, a. japonica, a. dieffenbachii and a. australis by repetitive injections of gonadotropic hormone (human chorionic gonadotropin) and pituitary homogenate (ohta. 1997 ; lokman and young 2000 ; lokman. nonetheless, for a large - scale production for glass eels, the current technique is not feasible. even in the japanese eel, for which artificial reproduction is the most successful among the congeners, maturation, gametogenesis and spawning have never occurred spontaneously, and the mortality is still high (kagawa. in other species, eggs and larvae have been artificially produced, but have not reached further development, as no suitable food for larvae has been discovered and rearing conditions including temperature, salinity and light regime have to be optimized (palstra. 2005 ; oliveira and hable 2010). considering a rapid population decline, other approaches are definitely needed to facilitate eel reproduction. as a result of recent remarkable advances in computational and sequencing technology, i.e., next generation sequencing (ngs), genomic - scale data have become more easily available and accessible for many aquatic organisms, even non - model species. for instance, numerous numbers of studies have been carried out based on the draft genome of zebrafish danio rerio to investigate the mechanisms of various biological features including early embryogenesis, spermatogenesis, oogenesis, and even human disease (e.g., zeng and gong 2002 ; newman. the draft genome of the european eel has been recently determined using illumina technology (henkel. 2012) and transcriptomic data based on ngs has been emerging (coppe. in addition to its value in studies of fundamental biology, genomics can provide a wealth of information on, for instance, maturation, development, responses to rearing conditions, and so on, making it a powerful tool for aquaculture. here, we review the current status of eel genomics, mainly focusing on the aspects relevant to aquaculture research. we first examine the traditional approaches to scan genomes such as amplified fragment length polymorphisms (aflp) and physical linkage maps. we then review the draft genome of the european eel that has been recently reported by henkel. (2012) with some additional analyses, which will be the basis of future eel genomic studies and aquaculture, and consider genome - wide gene expression profiling as a possible application of the eel genome sequence. traditionally, various regulatory mechanisms have been investigated using classical molecular biological methods such as molecular cloning, recombinant protein purification and laboratory observations, and the amount of genetic variation between and within taxa has been examined using molecular markers like mitochondrial dna and microsatellites. in recent years, genome scanning approaches such as aflp and single nucleotide polymorphisms (snp) discovery have been used to obtain genetic variations at a genomic level. in eels, ishikawa. (2004) and gagnaire. (2011) used this technique to survey the genetic structure of the giant mottled eel a. marmorata, and described the footprint of natural selection and the detailed genetic connectivity between populations. these genome scan studies clearly show their much higher resolution powers to detect subtle genetic variations and signals of evolution compared to classical molecular markers. albert. (2006) used the same method to determine the status of hybrids of the european and american eels, which occur naturally only in iceland (avise. this study revealed the existence of further hybrid generations of f1 there, suggesting that hybrids can reproduce successfully (albert. this finding serves a warning to eel aquaculture, because live stocks have been traded, for example the glass eels of the european species were imported into japan, and the presence of the introduced anguillid species in japanese natural waters has been reported (tabeta. furthermore, it is possible to induce interspecific hybridization in other species than the european and american eels (okamura. 2011), even though it is not known whether those artificial hybrids are fertile. genome scanning methods are therefore potentially more appropriate to evaluate genetic contamination, i.e., genetic health of aquaculture stocks and natural populations in eels. recently, nomura. (2011) constructed a physical linkage map of the japanese eel using aflp and microsatellite markers. genetic linkage maps are quite useful for aquaculture since they enable the analysis of quantitative traits loci (qtl) that determine commercially important traits such as spawning time and behaviour (rainbow trout, leder. 2010), body growth and sex determination (rainbow trout, wringe. 2010 ; arctic charr, kttner. 2011 ; gilthead sea bream, loukovitis. 2011), hatch timing (coho salmon, mcclelland and naish 2010), embryonic development rate (rainbow trout, robison. 2001), thermal tolerance (rainbow trout, perry. 2005), disease resistance (rainbow trout, baerwald. 2011 ; atlantic salmon, houston. compared with those species, qtl mapping of eel species has not made progress so far due to the unavailability of f2 and backcrossed animals. the genetic linkage map by nomura. (2011) will be the basis of future qtl studies of eels to discover the crucial traits for eel aquaculture like developmental and growth rate, timing of metamorphosis, quality of eggs and sperm, fertilization rate, mortality, immune sensitivity and tolerance to virus infections and diseases, quality of fish meat, and so on. other new methods using ngs such as reduced - representation sequencing and restriction site associated dna sequencing (rad - seq) have been also developed, and effectively applied in genome - wide snp identification and linkage map construction (see andolfatto., rad - seq from one single illumina lane successfully discovered about 3,000 snps in rainbow and westslope cutthroat trout, showing the feasibility of this method for non - model species in a cost - efficient manner (hohenlohe. although genome scan studies in eels are at this moment still few in number, these techniques will facilitate the production of useful information for qtl mapping and phylogeography, and also various biomarkers such as broodstock selection. in fish, as in other taxa, full genomic sequencing was first performed in model species such as zebrafish, medaka, and fugu (aparicio. 2011). moreover, 63 genome projects are currently ongoing in fish such as coelacanth and atlantic salmon (see also davidson. 2010) according to the database (gold ; http://genomesonline.org, as of february 20, 2012). those genomes have been widely used as a reference for studies of other fishes, e.g., bacterial artificial chromosome (bac) end sequence analysis of rainbow trout, gilthead sea bream and common carp, which are also commercial species (genet. although the published genomes of those species have already contributed to major progress in fish biology, the genome information is relatively limited in relation to the highest species diversity of fishes among vertebrates and their economical importance. in 2012, henkel. (2012) employed illumina sequencing technology and determined the draft genome of the european eel (www.eelgenome.org). this is the first report of the entire genome sequence of the genus anguilla and the order anguilliformes. the assembled genome consists of contigs with a typical scaffolds length (n50) of 1.7 kbp. the majority of contigs was further arranged into 186,000 genomic scaffolds with an n50 of 77.6 kbp, yielding a final assembly of 923 mbp. it turns out that 179 mbp of contigs were not included in larger scaffolds because of their small sizes or highly repetitive sequences. these numbers agree well with the genome size (1.1 gbp) estimated based on flow cytometry (henkel. (2012) investigated the hox gene complement in the genome of the european eel and found that the eel genome contains the almost complete duplicate set of hox genes established at the teleost specific genome duplication (approximately 300 million years ago), whereas many of these hox genes have been lost in the higher fish groups during evolution. this finding was consistent with a previous study that described hox genes of the japanese eel (guo. 2010), and thus the authors concluded that the eel genome retains primitive traits in comparison with other teleosts. because of this novel genome organization and the rather basal phylogenetic position of eels among teleosts (miya. 2003 ; inoue. 2004), this study suggests that the eel genome can be a useful source for comparative genomics studies. (2012) resulted in about 46,000 predicted genes in the european eel genome. in this work, we show the result of the gene ontology (go) analysis using 16,402 genes (35.7 %) of the european eel, which were provisionally annotated by blast2go (conesa. 2005). using a web - based go analysis tool categorizer (hu. 2008), all 186,116 go terms found in those 16,402 genes were first assigned to the main three go domains (biological process [go:0008150 ], molecular function [go:0003674 ] and cellular component [go:0005575 ]), and then further go category distributions were investigated in each of the three categories based on go slim2 terms, which is the simplified version of the whole go terms (hu.. the first assignment to the three root categories found more than 60 % of the terms in biological process, 25.8 % in molecular function, and 10.1 % in cellular component (fig. 1). a total of 111 go terms (1.1 %) were not assigned to any of the three categories, which could be due to unsynchronized go databases. subsequent analysis in each of the main three domains showed high proportion of metabolism [go:0008152 ] and development [go:0007275 ] in biological process, catalytic activity [go:0003824 ] and binding [go:0005488 ] in molecular function, and cell [go:0005623 ] and intracellular [go:0005622 ] in cellular component, and again found some unassigned go terms (12.8 % in biological process, 1.0 % in molecular function and 4.0 % in cellular component) (fig. 1). since the limited availability of reliable in silico annotation in the first draft genome of the european eel prevents the comparison of go term distribution with other fish species, the characterization of the eel genome and its functional analyses will be the subjects of future studies.fig. 1gene ontology category distribution in each of the three main go domains (biological process [bp ], molecular function [mf ] and cellular component [cc ]) of the european eel. 10,242 out of a total of 186,116 go terms that were significantly provisionally annotated by henkel. (2012) were first assigned to the three ancestral categories (bp, mf, cc), and subsequent analysis was performed in each category. the percentage indicated just below the three domain names presents the proportions of terms assigned to a category relative to the total go terms. top 20 fractions are shown in percentage in the graph for each category gene ontology category distribution in each of the three main go domains (biological process [bp ], molecular function [mf ] and cellular component [cc ]) of the european eel. 10,242 out of a total of 186,116 go terms that were significantly provisionally annotated by henkel. (2012) were first assigned to the three ancestral categories (bp, mf, cc), and subsequent analysis was performed in each category. the percentage indicated just below the three domain names presents the proportions of terms assigned to a category relative to the total go terms. top 20 fractions are shown in percentage in the graph for each category additionally another genome sequencing project of eels is in progress at this moment, the japanese eel (henkel. submitted). this will make a big step in eel genomics, because it will allow comparative genomics studies of eels, which will provide various kinds of useful information in aquaculture and other biological fields. for instance, genetic diversity is one of the serious issues in aquaculture and conservation, since it tends to decrease in populations whose effective population sizes are small like the ones in aquaculture. loss of genetic diversity has been reported in commercial hatcheries and endangered natural broodstocks of barramundi, arctic charr, brook charr and atlantic salmon (primmer. 1999 ; frost. 2010), and only few studies have examined the temporal change in genetic diversity in eels (han. however, their assessments of genetic diversity were based on several microsatellite loci, which are not necessarily representing the actual genetic diversity of a population, while genome information should give a whole picture of genetic diversity. phenotypic changes are genetically regulated, specifically, by switching on / off genes associated with sets of qtl as mentioned above. accordingly, to capture the background mechanisms of biological phenomena and responses to various stimuli, gene expression needs to be investigated on a genome - wide scale. for this purpose, expressed sequence tags (est) have been employed in many fish species like atlantic salmon, gilthead sea bream, european seabass and senegalese sole (cerd. 2008 ; koop. 2008 ; cepeda. 2011 ; louro. 2011), which provides rich genetic sources for future genomic scale studies like microarrays. in contrast, est has not been a very common tool in eels and the study by miyahara. they generated 196 est from a cdna library of spleen of the japanese eel, 46 % of which showed no homology to known genes, and found that six identified est among the rest (54 %) were similar to those of the japanese flounder in their previous study, suggesting that the constructed est can be useful for comparative gene expression studies in fish spleen (miyahara. another popular gene expression profiling approach is cdna microarrays. since the catadromous life history of eels requires adaptations to different water environments, i.e., seawater and freshwater, the mechanisms of osmoregulation have been investigated from various aspects such as specific hormones and their receptors (kozaka. 2003 ; wilson. 2004 ; yuge. 2006), membrane lipids (hansen and grosell 2004) and morphological changes of chloride cells (seo. 2009). (2007a, b) constructed a microarray comprising 6,144 cdnas from brain, gill, intestine, and kidney libraries and identified 229 differentially expressed clones between groups that were acclimatized in freshwater and seawater. subsequent sequencing analysis attributed 95 out of 229 to known genes related to detoxification, energy metabolism and respiration, cell protection and immune system, signal transduction, etc. major findings of these microarray studies were the identification of a number of genes that were already known to be involved in osmoregulation, but also the discovery of many other genes that were not previously found to be associated with ion or water transport (kalujnaia. i.e., the ngs, complete sets of transcripts in a population of cells / tissues (transcriptome) can be accurately determined and quantified. the first rna - seq was reported for wild - caught glass eels (coppe. they analyzed a normalized cdna library obtained from a pooled sample of 18 glass eel heads using 454 flx titanium sequencing, and ended up with more than 300,000 reads that were assembled in nearly 20,000 contigs, about 36 % of which were similar to known protein / nucleotide sequences (coppe., more than 50 % of these could be mapped to a go term of biological process. the sequencing technology and strategy employed in their study precluded reliable quantification of the obtained transcript contigs, and the lack of comparative samples has limited biological interpretations of the result in their study. however, the data can provide a rich resource for the discovery of new genes and the identification of biomolecular markers. for instance, it has been well described that sexual maturation of eels is associated with a variety of changes such as internal hormone levels (dufour. 2007), body coloration (sinha and jones 1975 ; pankhurst 1982 ; haro 2003 ; okamura. 2005 ; van ginneken. 2007), degeneration of the digestive tract (pankhurst 1982), and morphology and number of chloride cells in the gill (seo. 2009). if differentially expressed genes corresponding to those phenotypic changes are identified by transcriptome analyses, they can be molecular probes for maturation stages and will help understand the whole genetic mechanism of maturation in eels. likewise, the same methodology will be applicable for other biological features of eels. genomics is still at a very early stage where the basic data are being accumulated, but have not yet been applied for other functional studies like proteomics. however, the draft genome sequence of the european eel is now available, and that of the japanese eel will be disclosed very soon (henkel. those genome data can be also useful to improve transcriptome data analysis, as henkel. (2012) showed by identifying the hox genes using the embryonic transcriptome of a. australis. moreover, the costs of quantitative rna - seq have come down rapidly and thus it is now replacing the less versatile cdna microarrays. consequently, it is becoming feasible to study the gene expression patterns and regulatory mechanisms of specific phenomena like maturation and development. in summary, we now have more choices and approaches to observe genetic backgrounds and mechanisms of various phenotypic traits than ever before. however, this does not necessarily mean that those high - throughput techniques based on ngs are always the better choice ; this fully depends on the research objectives. as the field of eel genomics matures, it will improve aquaculture techniques by modifying protocols based on information obtained from transcriptome analyses and functional genomics, and open up perspectives on fundamental biological questions in eel research.	freshwater eels (genus anguilla), especially the species inhabiting the temperate areas such as the european, american and japanese eels, are important aquaculture species. although artificial reproduction has been attempted since the 1930s and large numbers of studies have been conducted, it has not yet fully succeeded. problems in eel artificial breeding are highly diverse, for instance, lack of basic information about reproduction in nature, no appropriate food for larvae, high mortality, and high individual variation in adults in response to maturation induction. over the last decade, genomic data have been obtained for a variety of aquatic organisms. recent technological advances in sequencing and computation now enable the accumulation of genomic information even for non - model species. the draft genome of the european eel anguilla anguilla has been recently determined using illumina technology and transcriptomic data based on next generation sequencing have been emerging. extensive genomic information will facilitate many aspects of the artificial reproduction of eels. here, we review the progress in genome - wide studies of eels, including additional analysis of the european eel genome data, and discuss future directions and implications of genomic data for aquaculture.
people with intellectual disabilities (i d) have a wide range of needs and most exhibit behavioral problems. around 7 - 15% of people with i d have severely challenging behavioral problems. the nature and severity of these behavioral problems vary with the degree of i d. in children with i d, the social environment in which they live and interact also shapes their behavior. having a child with i d is stressful for families and the child 's behavioral problems can create additional stress and frustration for parents and caretakers. furthermore, behavioral problems also impede the child 's learning in a number of settings, including at school and at home. many children with i d in rural communities are isolated from their peers and are therefore deprived of interaction and play because of their behavioral issues. this isolation limits their opportunities to learn through observation and interaction with other children, as reported in a previous study in india. due to a lack of awareness and knowledge, such behavioral problems are mistakenly considered manifestations of mental illness. however, in people with i d, behavioral problems do increase the likelihood of mental illness and can lead to serious life - threatening situations if not treated. managing behavioral problems is a major concern in the comprehensive rehabilitation of people with i d. children with i d that attend schools receive some form of behavioral management, irrespective of the nature of school (special or regular). in rural india, where the majority of children with i d do not attend school, there is no institutional support in place to help children with their behavioral problems. in addition, the outreach activities performed by rehabilitation institutions in rural communities are poor. insufficient awareness, misinformation, malpractice and social issues negatively affect the management of behavioral problems in children with i d in rural communities. in the absence of institutional support, parents apply various methods of handling such behavioral problems. three approaches are prominent in rural communities : first, parents often ignore the behavior. according to the principles of behavior modification, children 's undesired behaviors get stronger and more when behavior management involves inconsistent or inadequate reinforcement. there is an unmet need for studies that focus on behavioral interventions for children with i d that live in low- and middle - income countries. for example, we do not yet know which i d benefit more from behavioral intervention or if there is any relationship between a child 's intelligence quotient (iq) (a child who has i d) and their behavioral improvement after an intervention. there are limited resources available for people with i d who live in poor rural areas in india because most of the government rehabilitation institutions in india are in cities and they do not often reach out to the people in poor rural areas. rural populations in india are primarily served by non - governmental organizations (ngos) that are not well - equipped because of little financial support from the government and infrastructures that are inadequate for serving most of india 's population (68.84%), which is located in rural areas. most of these ngos are adapting a community - based rehabilitation (cbr) approach because it is cost - effective, feasible and empowers people with disabilities and the communities in which they reside. a cbr approach allows people with i d to receive comprehensive rehabilitation in their own environment. due to the lack of government rehabilitation institutions, ashagram trust (agt), an ngo started in 1983, successfully implemented a cbr program for rehabilitating chronically and severely mentally ill people in the barwani district of madhya pradesh, which is one of the poorest districts in india. the population of this district is made up of tribal (68%) and non - tribal (32%) groups. the rural population is mostly tribal and is severely deprived of health care, education and other government programs. only 8.3% of the people in this district receive safely piped drinking water, whereas only 4.3% have access to a toilet. the majority of the tribal population lives in small villages that are not well connected to cities because of poor or non - existent roads and limited transportation. the similarly impoverished tribal districts of khargoon, dhar and jhabua surround barwani and these populations were also provided access to medical and rehabilitation services through the clinic and rehabilitation center located at the agt campus in barwani. do gender, age, population type, socioeconomic status, category of i d, interventional settings and associated conditions affect the outcome of behavioral intervention in children with id?does improvement take place across all domains of behavioral problems in children with i d who have received behavioral intervention ? do gender, age, population type, socioeconomic status, category of i d, interventional settings and associated conditions affect the outcome of behavioral intervention in children with i d ? does improvement take place across all domains of behavioral problems in children with i d who have received behavioral intervention ? do gender, age, population type, socioeconomic status, category of i d, interventional settings and associated conditions affect the outcome of behavioral intervention in children with id?does improvement take place across all domains of behavioral problems in children with i d who have received behavioral intervention ? do gender, age, population type, socioeconomic status, category of i d, interventional settings and associated conditions affect the outcome of behavioral intervention in children with i d ? does improvement take place across all domains of behavioral problems in children with i d who have received behavioral intervention ? children with i d from 3 to 18 years of age (9.57 3.57) and iq (43.83 15.62) received behavioral intervention by agt. while taking case histories, often parents reported that children were stubborn, did not listen, cried all the time, bit people, fought, etc., the behavioral assessment scale for indian children with mental retardation (basic - mr) was administered on every child who was described as having a behavioral problem. the basic - mr lists 75 behavioral problems in 10 domains based on their nature. peshawaria and venkatesan at the national institute for mentally handicapped, in india, developed this tool. in most settings, this tool is applicable for evaluating and treating behavioral problems in persons with i d. a decline in score is considered to be an improvement in behavior (reduced behavioral problems). participants behavioral progress was monitored and recorded periodically, at least every month by cbr workers and every 3 months by professionals. behavioral interventions were performed in two settings : a cbr setting and a clinical setting, both described in detail below. children in the cbr group received medication for attention deficit hyperactivity disorder, epilepsy and mental illness, but they were not given any psychotropic medications for their behavioral problems. behavioral outcomes were measured on each child using the basic - mr after 1 year of intervention was completed. consequently, most parents did not have information about their child 's i d condition. because of their behavioral problems and issues functioning in day - to - day life, the children in the study were not enrolled in school. many children were also isolated within their own families, which resulted in neglect and in some cases even being beaten and chained. children may have benefited if they were allowed to play with other children in community and participate in social activities, but most were shunned because of stigma : many people in the community believe that children with i d can transfer their disabilities to other children. some of the children 's behavioral problems may have resolved if they were placed in schools. most of children with i d who participated in the study had not subsequently received any kind of rehabilitation service. many of the study participants had been treated in private or government hospitals for medical needs, but they had not been provided information on their i d. in the cbr setting, 262 children with i d were served. out of this group of these 211 children, 128 were excluded from the study because they had the least severe form of i d (borderline), incomplete information in their file, poor parental support, frequent absence from the community, insignificant behavioral problems, or they had died. children with borderline i d were excluded because their problems were mild and their parents viewed their problems either as an adjustment or as a result of academics. for this group of children, thus, the level of intervention for children with borderline i d was different than the rest of children with i d. behavioral intervention in a clinical setting was provided for a total of 95 children with i d (from 2005 to 2007). out of these 95 children, 64 had some form of behavioral problem and 43 of these 64 children were excluded for similar reasons to those described above the breakdown of study participants can be seen in figure 1. the cbr project was implemented by the barwani - based ngo agt from 2000 to 2010. this project aimed to provide rehabilitation services to people with all types of disabilities in a community setting. conversely, the clinic was operated on the agt campus twice per week exclusively for populations who were not supported by any of the agt projects. a specialist in mental retardation (rl) and his colleague (sb) served in the clinic once per week ; rl and sb were employed by agt but financially supported through action aid. in both the cbr and clinical setting, written or oral (because of poor literacy) informed consent was obtained from every child and parent in order to anonymously use data obtained in the study for research purposes. the populations treated in both settings were similar in characteristics and demographics, but the mode of behavioral intervention was different between settings. two professionals specializing in i d collectively provided behavioral intervention in both treatment settings (one professional is author of this paper). the behavioral interventions were divided between both professionals and these professionals often substituted for each other. agt was responsible for providing behavioral intervention to children with i d in the cbr setting. interventions were designed by professionals but were carried out by cbr workers (cbrws) and parents in the home and at non - formal education (nfe) centers. every month children received 1 - 2 1-h sessions of intervention by cbrws and at least 1 1-h session by a therapist, either at home or in a camp setting. nfes were operated by the project in certain villages in order to teach basic academic skills and motivate disabled and non - disabled children to return to or join school. a variety of community awareness activities were arranged, such as street plays, community meetings, parent meetings, musical nights, visits to other rehabilitation centers and distributions of informational material. parents of children with i d were given a 1-week training course at the agt campus to teach them how to handle and manage their children 's behavioral problems. children with i d were linked to various schemes to receive their disability (social security), school pension and employment opportunity in national rural employment guarantee scheme. the cbr program only served participants from 63 villages in the barwani district. in the clinical setting, interventions were offered by professionals and also explained by cbr workers. parents were provided information on various behavioral intervention schemes and were encouraged to practice them. in the clinical setting, the community from with the participant hailed follow - up of participants in the clinical setting involved parents bringing the children back to the clinic when it was convenient. however, children were asked to come back every 6 weeks for follow - up. on average, every child received a session of approximately h by professionals and cbr workers every 2 months. participants who underwent clinical intervention came from the districts of dhar, jhabua, kargoon and khandwa. all children were administered at least two diagnostic tests : the developmental screening test (dst) and the vinland social maturity scale (vsms), where dst can be used to determine the development quotient (dq) and vsms can be used to find the social quotient (sq). the average of dq and sq was taken to be the iq used for diagnosis and icd-10 classification. this is the standard practice for obtaining iq scores at the national institute for mentally handicapped in secunderabad, india. other intelligences tests, such as the indian adaptation of the stanford binet kamat test, malin 's intelligence scale for indian children and bhatia battery, were used as needed. behavioral problems reported by parents were recorded in the study participants ' case files and behavioral goals were chosen during parental consultations. a behavior modification plan was prepared after conducting the functional behavior assessment, which provides a clinical function of behavior. in behavior modification, the function is considered to be the cause of the behavior and it is necessary to address the function of the behavior in order to address it. these techniques were selected on the basis of the participant 's specific behavioral problem, its function, the severity of the problem and the ability of parents to carry out and conform to the technique. approximately 3 - 4 techniques were applied to each study participant at a time and the techniques used varied on a case - by - case basis. the behavioral techniques used are follows : (a) restructuring the environment we tried to prevent the behavior from occurring by changing the setting ; (b) extinction the regulating function of behavior was removed on the occurrence of the behavior ; (c) token economy tokens, such as a star or cards, were given to participants, when they exhibited desired behavior, which could be redeemed for edible items at local shop ; (d) over correction for example, if an item was thrown by a child, the child was instructed to bring the item back and fix the damage or disturbance that occurred as a result of the undesired behavior ; (e) response cost earned privileges, such as tokens, were withhold if the participant exhibited the behavior ; (f) differential reinforcement for incompatible / alternate behavior behaviors that prevented the occurrence of the problem behavior were encouraged ; (g) differential reinforcement for low - frequency behavior positive behaviors that did not occur often were rewarded ; (h) differential reinforcement for other any positive behavior in place of an undesired behavior was rewarded ; (i) physical restraining the child was physically restrained to stop the undesired behavior ; (j) time out the child was removed from the location where the unacceptable behavior was displayed. in addition to being exposed to behavioral interventions, study participants also underwent training on personal care skills, given a daily schedule to follow and were involved in household activities wherever possible. statistical package for social science software (spss version 21, manufacturer - ibm) was used for analyses. the baseline scores were compared with the post - intervention scores of each behavioral domain using wilcoxon matched - pairs signed - rank test. the was used to determine differences between different age intervals, genders, population types, poverty levels, severity of i d, number of disabilities and interventional setting. non - parametric tests were preferred over parametric tests because of non - homogeneity, skewedness and kurtosis (> 0) of the data. consequently, most parents did not have information about their child 's i d condition. because of their behavioral problems and issues functioning in day - to - day life, the children in the study were not enrolled in school. many children were also isolated within their own families, which resulted in neglect and in some cases even being beaten and chained. children may have benefited if they were allowed to play with other children in community and participate in social activities, but most were shunned because of stigma : many people in the community believe that children with i d can transfer their disabilities to other children. some of the children 's behavioral problems may have resolved if they were placed in schools. most of children with i d who participated in the study had not subsequently received any kind of rehabilitation service. many of the study participants had been treated in private or government hospitals for medical needs, but they had not been provided information on their i d. in the cbr setting, 262 children with i d were served. out of this group of these 211 children, 128 were excluded from the study because they had the least severe form of i d (borderline), incomplete information in their file, poor parental support, frequent absence from the community, insignificant behavioral problems, or they had died. children with borderline i d were excluded because their problems were mild and their parents viewed their problems either as an adjustment or as a result of academics. thus, the level of intervention for children with borderline i d was different than the rest of children with i d. behavioral intervention in a clinical setting was provided for a total of 95 children with i d (from 2005 to 2007). out of these 95 children, 64 had some form of behavioral problem and 43 of these 64 children were excluded for similar reasons to those described above the breakdown of study participants can be seen in figure 1. in the cbr setting, 262 children with i d were served. out of this group, 211 had some form of behavioral problem. of these 211 children, 128 were excluded from the study because they had the least severe form of i d (borderline), incomplete information in their file, poor parental support, frequent absence from the community, insignificant behavioral problems, or they had died. children with borderline i d were excluded because their problems were mild and their parents viewed their problems either as an adjustment or as a result of academics. for this group of children thus, the level of intervention for children with borderline i d was different than the rest of children with i d. behavioral intervention in a clinical setting was provided for a total of 95 children with i d (from 2005 to 2007). out of these 95 children, 64 had some form of behavioral problem and 43 of these 64 children were excluded for similar reasons to those described above the breakdown of study participants can be seen in figure 1. the cbr project was implemented by the barwani - based ngo agt from 2000 to 2010. action aid india financially supported the project. this project aimed to provide rehabilitation services to people with all types of disabilities in a community setting. conversely, the clinic was operated on the agt campus twice per week exclusively for populations who were not supported by any of the agt projects. a specialist in mental retardation (rl) and his colleague (sb) served in the clinic once per week ; rl and sb were employed by agt but financially supported through action aid. in both the cbr and clinical setting, written or oral (because of poor literacy) informed consent was obtained from every child and parent in order to anonymously use data obtained in the study for research purposes. the populations treated in both settings were similar in characteristics and demographics, but the mode of behavioral intervention was different between settings. two professionals specializing in i d collectively provided behavioral intervention in both treatment settings (one professional is author of this paper). the behavioral interventions were divided between both professionals and these professionals often substituted for each other. agt was responsible for providing behavioral intervention to children with i d in the cbr setting. interventions were designed by professionals but were carried out by cbr workers (cbrws) and parents in the home and at non - formal education (nfe) centers. every month children received 1 - 2 1-h sessions of intervention by cbrws and at least 1 1-h session by a therapist, either at home or in a camp setting. nfes were operated by the project in certain villages in order to teach basic academic skills and motivate disabled and non - disabled children to return to or join school. a variety of community awareness activities were arranged, such as street plays, community meetings, parent meetings, musical nights, visits to other rehabilitation centers and distributions of informational material. parents of children with i d were given a 1-week training course at the agt campus to teach them how to handle and manage their children 's behavioral problems. children with i d were linked to various schemes to receive their disability (social security), school pension and employment opportunity in national rural employment guarantee scheme. the cbr program only served participants from 63 villages in the barwani district. in the clinical setting, interventions were offered by professionals and also explained by cbr workers. parents were provided information on various behavioral intervention schemes and were encouraged to practice them. in the clinical setting, the community from with the participant hailed was not involved in any community awareness activities. follow - up of participants in the clinical setting involved parents bringing the children back to the clinic when it was convenient. however, children were asked to come back every 6 weeks for follow - up. on average, every child received a session of approximately h by professionals and cbr workers every 2 months. participants who underwent clinical intervention came from the districts of dhar, jhabua, kargoon and khandwa. agt was responsible for providing behavioral intervention to children with i d in the cbr setting. interventions were designed by professionals but were carried out by cbr workers (cbrws) and parents in the home and at non - formal education (nfe) centers. every month children received 1 - 2 1-h sessions of intervention by cbrws and at least 1 1-h session by a therapist, either at home or in a camp setting. nfes were operated by the project in certain villages in order to teach basic academic skills and motivate disabled and non - disabled children to return to or join school. a variety of community awareness activities were arranged, such as street plays, community meetings, parent meetings, musical nights, visits to other rehabilitation centers and distributions of informational material. parents of children with i d were given a 1-week training course at the agt campus to teach them how to handle and manage their children 's behavioral problems. children with i d were linked to various schemes to receive their disability (social security), school pension and employment opportunity in national rural employment guarantee scheme. in the clinical setting, interventions were offered by professionals and also explained by cbr workers. some behavior modification techniques used in the interventions parents were provided information on various behavioral intervention schemes and were encouraged to practice them. in the clinical setting, the community from with the participant hailed follow - up of participants in the clinical setting involved parents bringing the children back to the clinic when it was convenient. however, children were asked to come back every 6 weeks for follow - up. on average, every child received a session of approximately h by professionals and cbr workers every 2 months. participants who underwent clinical intervention came from the districts of dhar, jhabua, kargoon and khandwa. all children were administered at least two diagnostic tests : the developmental screening test (dst) and the vinland social maturity scale (vsms), where dst can be used to determine the development quotient (dq) and vsms can be used to find the social quotient (sq). the average of dq and sq was taken to be the iq used for diagnosis and icd-10 classification. this is the standard practice for obtaining iq scores at the national institute for mentally handicapped in secunderabad, india. other intelligences tests, such as the indian adaptation of the stanford binet kamat test, malin 's intelligence scale for indian children and bhatia battery, were used as needed. behavioral problems reported by parents were recorded in the study participants ' case files and behavioral goals were chosen during parental consultations. a behavior modification plan was prepared after conducting the functional behavior assessment, which provides a clinical function of behavior. in behavior modification, the function is considered to be the cause of the behavior and it is necessary to address the function of the behavior in order to address it. these techniques were selected on the basis of the participant 's specific behavioral problem, its function, the severity of the problem and the ability of parents to carry out and conform to the technique. approximately 3 - 4 techniques were applied to each study participant at a time and the techniques used varied on a case - by - case basis. the behavioral techniques used are follows : (a) restructuring the environment we tried to prevent the behavior from occurring by changing the setting ; (b) extinction the regulating function of behavior was removed on the occurrence of the behavior ; (c) token economy tokens, such as a star or cards, were given to participants, when they exhibited desired behavior, which could be redeemed for edible items at local shop ; (d) over correction for example, if an item was thrown by a child, the child was instructed to bring the item back and fix the damage or disturbance that occurred as a result of the undesired behavior ; (e) response cost earned privileges, such as tokens, were withhold if the participant exhibited the behavior ; (f) differential reinforcement for incompatible / alternate behavior behaviors that prevented the occurrence of the problem behavior were encouraged ; (g) differential reinforcement for low - frequency behavior positive behaviors that did not occur often were rewarded ; (h) differential reinforcement for other any positive behavior in place of an undesired behavior was rewarded ; (i) physical restraining the child was physically restrained to stop the undesired behavior ; (j) time out the child was removed from the location where the unacceptable behavior was displayed. in addition to being exposed to behavioral interventions, study participants also underwent training on personal care skills, given a daily schedule to follow and were involved in household activities wherever possible. statistical package for social science software (spss version 21, manufacturer - ibm) was used for analyses. the baseline scores were compared with the post - intervention scores of each behavioral domain using wilcoxon matched - pairs signed - rank test. the was used to determine differences between different age intervals, genders, population types, poverty levels, severity of i d, number of disabilities and interventional setting. non - parametric tests were preferred over parametric tests because of non - homogeneity, skewedness and kurtosis (> 0) of the data. table 1 categorizes the study participants using variety characteristics and shows statistical differences between groups. we found that the majority of the study participants were impoverished, highlighted by the fact that only 8.7% of children in the study came from a family with middle socio - economic status, while all others either very poor (55.8%) or poor (35.6%). families that were considered very poor did not have any source of income other than seasonal manual work, while poor families also depended on seasonal manual work but had a few cattle. categorizing participants by the severity of their i d showed that 31 children (29.8%) had mild i d, 46 (44.2%) had moderate i d, 18 (17.3%) had severe i d and 9 (8.7%) had profound i d respectively. the presence of an additional disability along with i d, such as cerebral palsy, epilepsy, mental illness, or down syndrome was present in 39 children (37.5%). although their primary disability was intellectual, children with such additional disabilities were considered to have multiple disabilities. it is also important to note that the majority of study participants (79.8%) received behavioral intervention in a cbr setting, while only 22.2% underwent intervention in a clinic [table 1 ]. characteristics of study participants and (n=104) the baseline and post - intervention scores (overall scores and scores separated by domain) were compared using wilcoxon matched - pairs signed - rank test. post - intervention scores for each domains and the overall final basic - mr score were significantly lower than corresponding baseline scores (p 0.001), representing statistically significant behavioral improvements across the board [table 2 ]. wilcoxon matched - pairs signed - rank test - participants baseline and post - intervention scores of the basic - mr (median of differences between baseline and post - intervention equals zero) the number of behavioral problems ranged from 2 to 16. parents of children in the clinical group had a 75% follow - up rate, while children in the cbr group achieved a follow - up rate of almost 100%. however, in many cases (approximately 20%) parents were not able to perform the follow - up tasks. in those cases cbrws spent more time and connected those children with village volunteers (not paid by the project) and nfe teachers to help families with the tasks. approximately 15% of children were found to be sleeping close to livestock, such as goats and chicken. behavioral intervention was found to be effective in both interventional settings : in the cbr and in the clinic. however, improvements varied according to the level of i d, the presence of additional disabilities (multiple disabilities group). the age of participants did not affect behavioral outcomes in this study, which is inconsistent with some studies and consistent with others. the improvement level was found to be different depending on the severity of i d, which can be attributed to the different behaviors that are associated with different severities of i d. while the needs of indian parents have been fount not to vary with the severity of their child 's i d, in this study we observed, in both the cbr and clinical setting, that parents having children with mild and moderate i d were more concerned about their behavioral problems. this concern was likely one reason that these particular parents focused more on their child 's behavioral management than parents having children with severe and profound i d. less dramatic behavioral improvements occurred in children with severe and profound i d and in children who had multiple disabilities. one reason for this finding may relate to the nature of their behavioral problems ; these children exhibit more self - injurious behaviors and they tend to have higher chances of genetic disorders or medical conditions. it is possible that their undesired behavior may arise from the pain they are experiencing from such medical or genetic conditions. in addition, many children with severe and profound i d were living in much poorer and unhygienic conditions than children who had moderate and mild i d. such unhygienic conditions may have affected the development of skin infections and resulted in tissue damage and self - injurious behavior. in parent meetings and trainings, we observed that parents having children with severe or profound i d were somewhat withdrawn and less hopeful about the prognosis of their child 's condition compared with other parents. they were more concerned about their child 's personal needs, such as helping with eating, toileting, brushing and dressing, sitting, standing, walking and talking. such parents were more immediately concerned with their child 's basic survival, which is related to how well the child can take care of his or her basic personal needs independently. children with profound and severe i d who are unable of taking care of their personal needs have shortened life spans. baseline and post - intervention basic - mr scores across all behavior domains of the scale declined significantly. behavioral intervention was found to be clinically significant for reducing the frequency, magnitude and duration of poor behaviors. these findings are consistent with several studies that have demonstrated the positive effects of behavioral intervention. intervention in the cbr setting was effective and would be consistent with a large - scale community - based study in a developed county focusing on children with developmental disabilities. most studies of this nature are conducted with small sample sizes, mostly involve a single subject and apply few behavioral modification techniques. our study had a large sample size and included longitudinal research that employed a range of behavior modification techniques. in addition, the study included a remote, impoverished and highly uneducated population but was able to involve parents, families and community members. parental involvement was the key element of success in this program. in both settings, other than behavioral management, we encouraged parents to acquire behavioral skills, change their negative attitudes toward their children and develop better adjustment and coping abilities. psycho education and involvement of parents in the delivery of behavioral management has been suggested previously. there was limited data from participants in the clinical setting ; these participants had significantly different characteristics than those in the cbr setting. in addition, in cbr behavioral interventions, parents and cbr workers along with professionals were involved in implementing and monitoring progress of the behavioral intervention, while in the clinical setting, parents were only provided with information about how to perform behavioral interventions. other possible confounding factors associated with the cbr setting may have been the relocation of key cbr workers within the cbr area, frequent migration of families, sickness of participants, myths, misbeliefs, cultural practices, parental attitudes, parental cooperation and (to some extent) the language barrier between professionals and parents. furthermore, because of the many activities and interactions between parents and the professionals or cbr workers built close, trusting relationships. improvement did not occur equally between children who had additional disabilities versus those who did not have any additional disabilities (beyond i d). improvements were also equal between children who received intervention in the cbr setting and those who received it in the clinic. the findings of this study are relevant to various rehabilitation and educational settings where people with i d get help managing behavioral problems and undergo educational placement.	background : management of behavioral problems in children with intellectual disabilities (i d) is a great concern in resource - poor areas in india. this study attempted to analyze the efficacy of behavioral intervention provided in resource - poor settings.objective:this study was aimed to examine the outcome of behavioral management provided to children with i d in a poor rural region in india.materials and methods : we analyzed data from 104 children between 3 and 18 years old who received interventions for behavioral problems in a clinical or a community setting. the behavioral assessment scale for indian children with mental retardation (basic - mr) was used to quantify the study subjects behavioral problems before and after we applied behavioral management techniques (baseline and post - intervention, respectively). the baseline and post - intervention scores were analyzed using the following statistical techniques : wilcoxon matched - pairs signed - rank test for the efficacy of intervention ; 2 for group differences.results:the study demonstrated behavioral improvements across all behavior domains (p < 0.05). levels of improvement varied for children with different severities of i d (p = 0.001), between children who did and did not have multiple disabilities (p = 0.011).conclusion : the outcome of this behavioral management study suggests that behavioral intervention can be effectively provided to children with i d in poor areas.
endometrial cancer is the most common gynaecologic malignancy in developed countries with an estimated incidence of 49,560 new cases for 2013 and an estimated mortality of 8190 deaths for the same year in the u.s.. european cancer observatory (eco) a project developed by the international agency for research on cancer (iarc) in partnership with the european network of cancer registries (encr) reports for europe an incidence of 98,919 new cases and a mortality of 23,723 deaths for the year 2012. the incidence is believed to grow in parallel with the increasing incidence of risk factors such as obesity, diabetes, use of tamoxifen for breast cancer, prolonged oestrogen replacement therapy leading to late - onset menopause, as well as a higher life expectancy in both developed and developing countries. in general, endometrial cancer has a good prognosis, with a 5-year survival rate of 97.4% in stage i patients, which is linked with early diagnosis in patients showing alarming symptoms post - menopausal vaginal bleeding. the staging proposed by figo in 1998 and modified in 2009, uses morpho - pathological factors (tumor grading, myometrial invasion, cervical stroma invasion, lymph node status, the intraperitoneal presence of disease), thus assigning surgery an important role in endometrial cancer staging, in addition to its therapeutic role. endometrial cancer surgery comprises total histerectomy and bilateral adnexectomy, procedures performed in the peritoneum and omentum peritoneal biopsies, partial or total omentectomy, procedures performed in the retroperitoneum lymph node biopsies, selective pelvic lymphadenectomy, paraaortic lymphadenectomy. even though the figo staging system advocates lymphadenectomy, it does not mention the indications, the type and the extent of lymphadenectomy, thus raising controversy, as evidenced in numerous studies [59 ]. the present study aims at evaluating the clinical and histopathological factors that are predictive for the lymphatic dissemination of endometrial cancer. the study is an analytical retrospective study of patients treated surgically for endometrial adenocarcinoma in the oncological institute prof. dr. ion chiricu cluj - napoca (iocn) between january 2008 and december 2012. the following data were analysed : malignity register of iocn, drg register of iocn and patient observation sheets, with the assessment of traditional prognostic factors histological type, tumor grading (g), t parameter (myometrial invasion, cervical stromal invasion), intraperitoneal dissemination of disease but also lymphovascular space invasion (lvsi) and age at the time of diagnosis. after the descriptive indicators were calculated, the statistical tests student and chi - square were applied. during the 5-year period of the study, 1227 new cases of endometrial cancer were registered in the territorial malignity register of iocn and treated in various departments of our institute. of these, 870 patients underwent surgery in the various departments of iocn (cases reported in drg register). cases presenting histological proof of sarcoma following the histopathological examination, cases of synchronous malignancies, uterine metastases of other tumors, tumor recurrence, cases that underwent neoadjuvant radiotherapy or cases featuring incomplete data were excluded from the study. all 709 patients underwent simple total or radical histerectomy with bilateral adnexectomy, to which peritoneal staging procedures were added a total of 206 pelvic and/or paraaortic lymphadenectomies were performed, with the average number of excised lymph nodes amounting to 15.6. the average age was 60 years, ranging between 35 and 83 years ; 80% of patients were older than 55 years. endometrioid adenocarcinoma histology was present in 85% of cases, the remaining 15% including other epithelial non - endometrioid histological types clear - cell carcinoma, papillary serous carcinoma, adenoscuamos carcinoma, mucinous carcinoma, mixed adenocarcinoma. in most cases (77.5%), the disease was confined to the uterine body t1a / t1b. lymphovascular space invasion (lvsi) was detected in 22.7% of cases, whereas the extrauterine, intraperitoneal disease was present only in 8.4% of cases. the presence of each risk factor was statistically significantly associated with lymph node metastasis (p0.81). it also confirmed the negative influence of epithelial non - endometrioid histological types (neeh) on these adverse prognostic factors, the lymph node invasion rate in these cases reaching 10.5% (table iii). the patients age at the time of diagnosis was analysed as an independent factor affecting lymphatic dissemination : 5% lymph node involvement rate was detected in patients over 55 years, compared to 1.5% in younger patients. an age above 55 years was also statistically significantly (p<0.05) associated with the presence of the negative predictors covered in the study (table iv). the review of special literature reveals the high diversity of indications, practices and beliefs of doctors regarding lymphadenectomy. the stance towards lymphadenectomy varies from being absent to being performed as a routine procedure in all surgically treated patients. the controversies arising are related to multiple areas such as role and indications of lymphadenectomy, preoperative patient evaluation and classification into risk groups for lymph node involvement, intraoperative assessment, type of surgery, extent of lymphadenectomy, its associated morbidity and cost - effectiveness of the procedure. the first major study in this respect - gog (gynaecologic oncology group) protocol 33 was published in 1987 and mentioned a global nodal involvement rate of 9% for pelvic lymph nodes, and 5% for paraaortic lymph nodes respectively. the risk group stratification made by the authors at that time indicates different figures, that vary from 0 for low - risk patients (gi, no myometrial invasion) to 18% metastatic pelvic lymph nodes and 15% metastatic paraaortic lymph nodes in high - risk patients (deep myometrial invasion, intraperitoneal disease). gog-33 led in 1998 to the modification of figo staging into surgical staging recommending lymphadenectomy. subsequently, numerous authors supported lymphadenectomy in patients with endometrial cancer, claiming therapeutic benefits related to overall survival, disease - specific survival, as exact staging was found to impact clinical management through identification of adequate therapy and avoidance of overtreatment of certain cases, but also due to favourable cost - effectiveness reports [1125 ]. recently, two multicentre randomized trials - astec (a study in the treatment of endometrial cancer) and an italian trial managed by benedetti panici have concluded that lymphadectomy does not engender benefits in the sense of enhancing the survival rate in patients with endometrial cancer [2627 ]. others, however, have called into question the two trials, dismissing them as biased with regard to the heterogeneity of patient cohorts, institutions involved, surgical procedures performed and adjuvant therapies administered [2830 ]. the present study evaluates the negative prognostic histopathological factors used for classifying into risk groups patients with incipient endometrial cancer that are eligible for surgery, and demonstrates the correlation between these factors and the presence of lymph node invasion. most clinical guides such as the romanian society for obstetrics and gynaecology guide, use the classical histopathological factors tumor grading (g), t parameter (myometrial invasion, cervical stromal invasion), intraperitoneal dissemination of the disease. some specialised clinics use in the risk group stratification protocols also the patients age a parameter that is investigated also in the present study and statistically significantly correlated with the presence of other negative prognostic factors analysed in the study.(31) the 55-years threshold was chosen on account of the high incidence of the disease above this age, notably 80% in the analysed patient lot. thus, the mayo clinic proves a very low lymphatic dissemination risk for tumors below 2 cm in diameter, even defining a parameter ptd (primary tumour diameter) that is generally used in this institution. in our study, the imaging results were difficult to interpret due to a variety of sources and especially because in most cases, the imaging investigations were performed after the diagnostic curettage that reduced the initial dimensions of the tumors. the surgical tactics in endometrial cancer is based on preoperative awareness of risk factors (histological type, differentiation degree, useful imaging investigations, age), but intraoperative evaluation is just as essential. the classical interaoperative evaluation comprises the exhaustive exploration of the peritoneal cavity by inspection and palpation, the palpation of retroperitoneal lymph node areas, the post - resection dissection of the uterus and visual evaluation of tumor size and myometrial or cervical stromal invasion. these procedures were studied by different authors who reported false negative result rates between 26 and 36% for lymph node site palpation. the increased rate of false negative results may be explained to a great extent by small size lymph node metastases, a fact demonstrated in 1993 by girardi., who report that 37% of lymph nodes presenting malignancies are smaller than 2 mm. currently, frozen - section examination is accepted for an adequate intraoperative evaluation, and various institutions set up efforts in order to perfect this investigation. claim that compared to frozen - section examination the final histopathological analysis modifies the clinical management of the patient in 18% of cases, in 2011 mariani. set forth that the frozen - section examination was modified by the final histopathological analysis in a way that would affect surgical approach in only 1.4% of cases, study the decision of performing a lymphadenectomy as well as its extent were established by the surgeon, based on preoperatively known risk factors and intraoperative classical evaluation, but also by taking into account idiosyncrasies, in particular with regard to associated morbidities. the study is however limited, in that it does not employ sophisticated frozen - section examination techniques for establishing intraoperatively the degree of myometrial invasion, cervical stromal invasion, the presence of small - size lymph node metastases or the histological type and the degree of cell differentiation in the entire tumor mass. the correspondence between the data on global lymph node invasion obtained from the study and from literature, the correlation between the presence of histopathological and clinical risk factors and lymphatic metastasis, as well as the strong statistical significance of these correlations demonstrate that the decision to perform lymphadenectomy was taken sensibly, to the full benefit of the patients. the histopathological and clinical risk factors evaluated in the study (histological type, degree of cell differentiation, miometrial invasion, t figo parameter, lymphovascular space invasion, intraperitoneal disease and age were statistically significantly associated with lymphatic dissemination in endometrial cancer. pelvic and/or paraaortic lymphadenectomy is justified in cases of increased lymph node invasion risk, with decision to be made on a case by case basis, in order to avoid surgical overtreatment of incipient cases and the morbidities associated with extensive surgery, respectively to avoid undertreatment of advanced cases for which the therapeutic benefit of this surgical procedure is evident. we recommend that the national therapy guideline for endometrial cancer be adapted according to figo 2009 staging and to include additional factors like lymphovascular space invasion and age for the risk group stratification of patients with endometrial cancer. we recommend the treatment of endometrial cancer in specialised centres where preoperative and intraoperative risk factors evaluation is available and can be performed by a surgeon or gynaecologist - oncologist with experience in extensive peritoneal and retroperitoneal surgery.	introductionendometrial cancer is the most common gynecologic malignancy in developed countries. the adequate surgical staging proposed by figo (international federation for gynaecology and obstetrics) advocates lymphadenectomy ; however, it does not establish the indications, the type and the extent of lymphadenectomy, thus generating multiple controversies.methodsretrospective, analytical study of patients treated surgically for endometrial adenocarcinoma in the oncological institute prof. dr. ion chiricu cluj - napoca (iocn) between january 2008 and december 2012 709 cases eligible for the study.results206 pelvic and/or paraaortic lymphadenectomies were performed, the average number of excised lymph nodes being 15.6. overall in 4.4% of patients the lymph nodes were affected by metastases. the presence of each risk factor analysed was statistically significantly associated with lymph node metastasis (p<0.05). age above 55 years was statistically significantly associated (p<0.05) with the presence of negative prognostic factors in the study.conclusionsthe analysed histopathological and clinical prognostic factors were statistically significantly associated with lymphatic dissemination in endometrial cancer. we recommend treating endometrial cancer in tertiary centres by surgeons or gynaecologists - oncologists with experience in extensive peritoneal and retroperitoneal surgery.
	agastachis herba is one of the well - known medicinal herbs in korean traditional medicine. this study was taken up to examine the beneficial effects of agastachis herba on a mice model of asthma. balb / c mice were sensitized and challenged with ovalbumin to produce a murine model of asthma. methanol extracts of agastachis herba were orally administered to the ovalbumin - induced asthmatic mice. the effects of methanol extract of agastachis herba on airway hyper responsiveness, immune cell distributions in bronchoalveolar lavage fluid, ovalbumin - specific immunoglobulin e in serum, and histopathological changes were evaluated. mice treated with the methanol extract of agastachis herba showed reduction of airway hyper responsiveness as well as inhibited immune cell infiltration in bronchoalveolar region. also ovalbumin - specific immunoglobulin e levels in bronchoalveolar lavage fluid significantly decreased in extract treated mice. histopathological findings showed significant beneficial changes in inflammatory cell infiltration.
fragaria vesca l. is a well - known and valuable plant species ; however, its cultivation is still much poorly spread. currently grown cultivars of fragaria vesca are derived from a wild species, which can be found in woods and grasslands in europe, western asia, north america, and temperate areas in chile. their widespread temperate growing range, self - compatibility, and long history of cultivation, coupled with selection for favorable recessive traits such as day neutrality, nonrunnering, and yellow - fruited forms, offer extensive genotypic diversity. despite high price, wild strawberries fruits are a product that is highly appreciated by consumers. their natural aspect, color, nutritional values, and high natural antioxidant compounds content are their most attractive characteristics. a high percentage of these fruits are sold as a frozen product, which is used in the manufacturing of cakes, ice creams, or milk desserts [1, 4 ]. there are an increasing demand for fresh berries and, consequently, a need to increase their distribution ratio and shelf life. is unusual in what is called the fruit actually originates from the expansion of the flower base (the receptacle) as a pseudocarp, with the real one seeded fruits (achenes) on the epidermal layer [57 ]. wild strawberry fruits ripen during 3 - 4 weeks after flowers develop, although the period greatly depends on the weather conditions. many epidemiological studies have shown that a higher consumption of fruit and vegetables is associated with the prevention of chronic diseases such as diabetes, heart disease, and certain cancers. apart from essential nutrients, fruit and vegetables also contain a variety of different phytochemicals that can act as antioxidants, prevent oxidation, and also exhibit other bioactive physiological properties. different antioxidants, such as flavonoids, phenolic acids, carotenoids, and ascorbic acid, have been proposed to act anticarcinogenically [813 ]. red, spherical, sweet taste fruits (fragariae fructus) with unforgettable flavor are one of the raw materials achieved from wild strawberry. according to much of the research done, wild strawberry fruits have high antioxidant activity, which has been linked to their content of phenolic compounds [4, 14 ]. small fruit breeding programs are currently used to acquire new cultivars improved for specific agronomic (yield and size), qualitative (firmness, sugars content, and acidity), and sensorial (colour and aroma) characteristics, all combined to increased disease resistance and plant adaptability. nowadays, besides all these parameters, it is necessary to look for the specific bioactive components well known for their effect on human health. flavonoids and phenolic acids are the most common phenolic compounds in small fruits with strong antioxidant capacity [13, 1618 ]. taking this into account, the following study was carried out to make chemical analyses aim at evaluating the contents of flavonoids, free phenolic acids, tannins, anthocyanins, and antioxidant activity (%) by means of dpph radical neutralization ability in fresh and air - dried fruits of three wild strawberry cultivars. the aim of these studies was to identify cultivars which were characterized by the highest content of investigated biologically active substances and the highest ability to free radicals elimination. the results from the performed experiments will also have practical application during the breeding program preparation in order to obtain new cultivars of this species. baron von solemacher, yellow wonder, and regina originating from agrotechnical experiments carried out at department of vegetable and medicinal plants, university of life sciences, lublin (poland, 5123 n, 2256 e). seeds of tested cultivar were sown manually on march 5th, 2010, into boxes filled with a substrate (peat substrate) and covered with thin sand layer. after emergence and forming 2 - 3 true leaves, the seedlings were transferred into boxes at 5 3.5 cm spacing. plants were set into their permanent place on june 20th, 2010, in plots of 7.5 m area (2.0 3.75 m) at 40 25 cm spacing (14 plants per row, i.e., 9.3 plantsm) in three replicates. the agrotechnical experiment was carried out on dusty soil characterized by good abundance in nutrients and neutral reaction. soil under wild strawberry cultivation was prepared according to commonly accepted recommendations applying manure (40 kgha) for the forecrop (onion). phosphorus, potassium, and magnesium fertilizers were used before seedling planting at the following amounts : 80 kgha p2o5 ; 100 kgha k2o. starter rate (n30 kgha) was applied, when the seedling was taken the roots. the fruit harvest was carried out at the full of fruiting stage in years 20112013. directly after the harvest, part of material was subject to laboratory analyses as raw, while another part was dried out. the drying process was performed in a drying facility at 40c till the moment of a constant air - dried fruit weight achievement. raw material was subject to determinations of dry matter (%) by means of drier method, weight loss after drying - moisture (%) content flavonoids (mgg), sum of phenolic acids (mgg), tannins (%), anthocyanins (mg100 g), and antioxidant capacity (%) as an ability to neutralize the dpph radicals. biochemical analysis was performed in laboratory for vegetable and herbal material quality at the department of vegetable and medicinal plants, university of life sciences, lublin. aliquots of about 1 g (0.0001 g accuracy) of raw and ground fruits were weighed. the drying process was repeated till the constant weight of samples (difference between two subsequent weighings should not be greater than 0.5 mg). the difference of weights before and after drying was the water loss, and then the result was recalculated onto the percentage of dry matter. the loss after drying was determined by means of gravimetric method according to polish pharmacopoeia vii. samples of 1 g of three cultivars of ground wild strawberry fruits were weighed in vessels. samples were then placed in a drier at 105c and dried for 2 hours ; after that they were cooled to ambient temperature in desiccator over silica gel and weighed again. the drying was repeated until the constant weight (difference between two subsequent weighings should not be greater than 0.5 mg). the difference of weights before and after drying was the water loss (moisture content) ; all determinations were made in 3 replicates. total flavonoids were estimated according to the spectrophotometric method of christ and mller after their extraction, as recommended by the european pharmacopoeia. for this purpose, 2.0 g of crushed fruit was added to a round - bottomed flask ; 20 ml of acetone, 2 ml of hcl (281 gl), and 1 ml of methenamine (5 gl) were then added and the mixture was maintained for 30 min under reflux on a water bath. the hydrolysate was filtered through cotton wool into a volumetric flask of 100 ml, then placed in a flask together with the cotton pellet and 20 ml of acetone, and refluxed for 10 min. next, 20 ml of solution was dispensed into a separatory funnel with 20 ml of water and extracted with ethyl acetate in 15 ml portions 3 times with 10 ml. the combined organic layers were washed twice with 40 ml of water, filtered into a volumetric flask of 50 ml, and supplemented with ethyl acetate. to determine flavonoid content, 2 samples were prepared : to 10 ml of the stock solution 2 ml of a solution of aluminum chloride (20 gl) was added, supplemented with a mixture (1 : 19) of acetic acid (1.02 kgl) and methanol (25 ml). to prepare the comparative solution, stock was supplemented with 10 ml of a mixture (1 : 19) of acetic acid (1.02 kgl) and methanol (25 ml). after 45 min, the absorbance of the solutions was read at = 425 nm on hitachi u-2900 spectrophotometer using the reference solution for comparison. the total content of flavonoids (mgg) was expressed as quercetin qe equivalent according to the following formula:(1)x = kam, where x are total flavonoids (mgg) ; a is the absorbance of the solution being studied ; k is the convection factor for quercetin and equal to 8.750 ; m is the sample with the raw material (g) which was the amount of fresh and dry material. total phenolic acids estimation was carried out according to arnov method, which corresponds to the recommendations of the european pharmacopoeia. to 5.0 g of homogenized raw material placed in a round - bottomed flask 20 ml of methanol was added and the mixture was heated for 30 min at 70c in a water bath at reflux. the hydrolysate was filtered through a hard filter paper into an erlenmeyer flask of 100 ml. the filtered medium was returned to the round - bottomed flask with 20 ml of methanol and heated at reflux for 30 min. the combined filtrates were taken to the tube with 1 ml of blueberry extract, 1 ml of 0.5 n hydrochloric acid, 1 ml of arnov reagent, and 1 ml of 1 n sodium hydroxide, made up to 10 ml with distilled water. the total phenolic acid content, expressed as acid equivalent weight of caffeic acid (cae) in the fruit, was calculated from the equation obtained from the calibration curve of caffeic acid (y = 1.7321x + 0.0227 ; r2 = 0.9992). samples of raw material (1.0 g) were extracted with 50 ml hcl (1 moldm) and heated in water bath for 1 hour. the obtained extract was hydrolyzed with 20 ml n - butanol, and then two portions of 10 ml n - butanol were added as a solution. the percentage of anthocyanins, as delphinidin chloride, was calculated from the expression(2)p = avfm, where p are total anthocyanins (mg100 g) ; a is absorbance at 533 nm ; v is value of butanol phase (50 ml) ; f is coefficient for delphinidin chloride (2,6) ; m is mass of sample to be examined (mg). antioxidant activity (%) was evaluated on a base of the ability to neutralize the dpph radicals by means of spectrophotometry according to chen and ho : to do this, water extracts were prepared from fruits ; extracts were then evaporated till dried and lyophilized. the absorbance measurements were made at = 517 nm wavelength using spectrophotometer hitachi u-2900. all reagents and solvents were of analytical grade chemicals from merck (darmstadt, germany) or sigma chemical co. (st. louis, mo, usa) and poch (gliwice, poland). achieved results from laboratory experiments were statistically processed by means of variance analysis method and tukey 's confidence intervals at 5% confidence level. determinations related to the chemical composition of three wild strawberry cultivars fruits here presented were preceded with the evaluation of general physicochemical parameters, that is, dry matter content in raw fruits and weight loss after drying - moisture content in dried fruits. data presented in table 2 indicate that dry matter content in raw fruits ranged from 27.95% to 37.73%. among compared cultivars, baron von solemacher fruits were characterized by the highest concentration of the component (36.37%, on average), while yellow wonder contained the lowest level of the parameter (28.22%). considering the water content in dried material, fruits of studied wild strawberry cultivars slightly differed from each other and statistical analysis did not reveal any significant differences. regardless of the cultivar, moisture content of air - dried fruits oscillated around 11.10%, on average (table 2). among compared cultivars, baron von solemacher fruits were characterized by the highest concentration of the component (36.37%, on average), while yellow wonder contained the lowest level of the parameter (28.22%). considering the water content in dried material, fruits of studied wild strawberry cultivars slightly differed from each other and statistical analysis did not reveal any significant differences. regardless of the cultivar, moisture content of air - dried fruits oscillated around 11.10%, on average (table 2). different levels of flavonoids in raw and dried fruits of three wild strawberry cultivars are presented in figure 1 and table 3. 0.593 mgg (raw material) and 1.245 mgg (dried material). on the other hand, (0.471 and 1.178 mgg, resp., for raw and dried material). significant differences in flavonoids contents over the years of study for both analyzed types of material were observed. the dried fruits of all studied genotypes were characterized by over twice as high flavonoids amounts as compared to raw fruits. were the best sources of these compounds 2.840 mgg in raw and 4.987 mgg in dried material (table 3 and figure 2). fresh fruits of yellow wonder cv. contained almost twice as low phenolic acids as regina cv. fruits. however, mean values recorded for dried fruits of all analyzed genotypes slightly differed and statistical analysis confirmed that the differences were significant. changes in tannins contents for all studied wild strawberry fruits were similar as those for flavonoids. raw fruits contained 2.76% of tannins, on average, while dried ones contained 5.31% (table 3 and figure 3). significant influence of all examined factors on tannins contents in studied materials was found on a base of determinations performed. anthocyanins were another group of substances analyzed in wild strawberry fruits (table 3 and figure 4). fruits of regina cv. were the best source of anthocyanins as similar as phenolic acids. from 144.12 mg100 g to 177.07 mg100 g were recorded in raw fruits of this cultivar, whereas dried fruits contained from 398.54 mg100 g to 460.40 mg100 g. among compared cultivars, the yellow wonder cv. appeared to be the worst since it contained only from 80.97 mg100 g to 99.00 mg100 g (raw material) and from 192.52 mg100 g to 236.90 mg100 g (dried material) of anthocyanins. significant differences in the ability to neutralize the free dpph (diphenylpicrylhydrazyl) radical by extracts made of examined wild strawberry fruits were recorded (table 4). extracts prepared from dried fruits revealed definitely highest ability (23.93%) as compared to raw material (13.11%). when comparing studied cultivars, the highest neutralizing capacity was shown by extracts made of regina cv. the free radicals were worse reduced by extracts prepared from fruits of yellow wonder cv. and baron von solemacher cv. fragaria vesca has traditionally been a popular delicious fruit for its flavor, taste, fresh use, freezing, and processing. morphological, biometric, and agronomical characteristics have been widely used to describe wild strawberry cultivars. in recent years, cultivated berries have become very attractive for consumers because of potentially beneficial phytochemicals contained in these fruits. the importance of flavonoids and other phenolics has been suggested to play a preventive role in the development of cancer and heart disease. considerable data suggests that higher content of flavonoids, phenolic acids, tannins, and anthocyanins in berry fruits contributes to their higher antioxidant activity [17, 25 ]. following substances should be counted as the most important bioactive components of wild strawberry : phenolic acids (ellagic, p - coumaric, gallic acids), flavonoids (flavonols, quercetin, and kaempferol), proanthocyanidins, and anthocyanins (pelargonidin, cyanidin) [2628 ]. due to these compounds, the fruits have anticarcinogenic, antioxidant, anticoagulant, immunomodulating, anti - inflammatory, blood pressure, and cholesterol regulating features [29, 30 ]. measuring such parameters is wildly used to evaluate the potential health benefits of breeding material or various agronomic factors. however, little is known on the phenolic profiles and antioxidant potential of wild strawberry in important local cultivars. in this paper the differences in the concentrations of secondary compounds determine the nutritional importance of the analyzed cultivars. furthermore, they provide information on the marketing potential of the 3 cultivars and present an important chemical insight into the popular cultivars grown in this region. secondary metabolites content in berry fruits varies among species and cultivars, but it can also be affected by growth conditions including environmental factors and cultivation techniques [10, 11, 3134 ]. it has been shown that higher growing temperatures (day and night) increase the flavonols and anthocyanins contents in strawberries. authors of the present study, on a base of performed research, proved differentiated contents of biologically active substances : flavonoids, phenolic acids, tannins, and anthocyanins in raw and dried fruits depending on wild strawberry cultivar. furthermore, they analyzed the antioxidant ability of extracts made of studied materials by means of neutralizing the free dpph radical. mean content of flavonoids and tannins in fresh fruits of baron von solemacher cv. raw fruits of regina cv. were characterized by the highest average concentrations of phenolic acids and anthocyanins : 4.987 mgg and 444.25 mg100 g, respectively. according to antal., the quantity of anthocyanins in raw berries ranges from 30 mg100 g (fragaria moschata) to 165 mg100 g (vaccinium myrtillus). huang. found higher contents of anthocyanins in berry fruits, which correspond with values achieved in the present study for raw fruits of examined wild strawberry genotypes. in opinion of olsson., the amount of phenolic substances as well as antioxidant activity was different within fragaria x ananassa duch. evaluated fresh fruits and found that strawberries had total phenolics of 3.680 mgkg fresh weight. as it follows from performed analyses, mean content of phenolic acids for fresh wild strawberry fruits was at the level of 2.314 mgg. the differences in polyphenol content of strawberry fruit from the literature may be due to the different conditions during the growth of plants (climatic conditions, temperature, precipitation, and soil conditions), the length of the growing season, and harvest date. they may also be caused by using various analytical procedures or methods identifying the active ingredients by scientists in various centers. identification of chromatographic methods usually has a lower content of active substances, because its task is to determine the minimum content and separation and identification of individual compounds in the raw material. commonly used spectrophotometric procedures are based on similar assumptions, so after taking into account differences methods are comparable to those applied in this paper. during the three years of the research, the highest contents of analyzed biologically active substances were recorded in 2013, while the lowest were recorded in 2012. in a previous investigation, we found that fresh wild strawberry fruits possess high amounts of bioactive compounds. however, fresh fruits are not available all year round, being harvested in poland only in june september. therefore, it is important to find a proper substitute that could be used when fresh berries are not available. it was decided to prepare dried fruits, to determine the contents of some important bioactive compounds and their antioxidant potential therein, and to compare them with the same parameters in fresh fruits. dried fruits have a greater nutrient density, greater fiber content, increased shelf life, and significantly greater phenol antioxidant content compared to fresh fruits. the quality of the antioxidants in the processed dried fruit is the same as in the corresponding fresh fruit. data presented in tables 24 indicate diverse contents of biologically active compounds in raw and dried materials depending on the cultivar. the highest mean concentrations of analyzed substances in air - dried fruits were similar as for fresh ones. dried fruits of analyzed genotypes were characterized by over twice as high quantities of biologically active substances and antioxidant activity as fresh fruits. results from the present study are a confirmation of the results achieved by vinson. as a conclusion, our results clearly demonstrate that considerable variation exists in the phenolic compounds among wild strawberry genotypes. the obtained results allowed the identification of cultivars which were characterized by the highest content of investigated biologically active substances and the highest ability to free radicals elimination. the results from the performed experiments also have practical application during the breeding program preparation in order to obtain new cultivars of this species. therefore, dried fruits are good source of important bioactive compounds and more dried fruits should be recommended to be added to the diet by dieticians and nutritionists.	chemical analyses carried out in 20112013 aimed at evaluating the contents of flavonoids, free phenolic acids, tannins, anthocyanins, and antioxidant activity (%) by means of dpph radical neutralization ability in fresh and air - dried fruits of three wild strawberry cultivars. examinations revealed differences in contents of biologically active substances determined in raw versus dried material depending on the cultivar. mean concentrations of flavonoids and tannins were highest in raw fruits of baron von solemacher cv., which amounted to 1.244 mgg1 and 6.09%, respectively. fresh fruits of regina cv. were characterized by the highest average content of phenolic acids and anthocyanins : 4.987 mgg1 and 0.636 mg100 g1. the pattern of mean contents of biologically active substances analyzed in air - dried fruits was similar. significant differences in abilities to neutralize the dpph radical to diphenylpicrylhydrazine by extracts made of examined wild strawberry fruits were also indicated.
the administration of bolus insulin before each meal is important to maintain postprandial blood glucose levels as close to normal as possible. rapidacting insulin analogs have a more rapid onset of action than regular insulin, providing improved postprandial glycemic control in multiple daily insulin injection (mdi) regimens1. premeal insulin dosage was titrated to control target blood glucose levels before each meal and at bedtime. even when premeal and bedtime blood glucose levels are within target range, postprandial hypoglycemia is often observed in patients with premeal rapidacting insulin. the purpose of the present study was to evaluate suitable premeal bolus insulin for type 2 diabetes. a total of 56 inpatients who met the inclusion and exclusion criteria were consecutively selected in osaka university medical hospital, in osaka, japan, from may 2005 to may 2007. the diabetic meals consisting of 2530 kcal / ideal bodyweight kg, 5060% carbohydrate, 1520% protein and 2025% fat were prepared by dietitians. all meals were consumed within 20 min without any additional food unless required to treat hypoglycemia. all patients were switched to premeal mdi using rapidacting insulin, either insulin lispro or aspart. selfmonitoring of blood glucose was carried out before, and 2 h after meals and bedtime throughout the study. premeal insulin dosage was titrated to adjust premeal and bedtime blood glucose levels to 81120 mg / dl (table 1). after each premeal and bedtime, blood glucose levels were equally adjusted ; when postmeal blood glucose level was more than 30 mg / dl lower than just before the premeal level for at least three occasions, premeal rapidacting insulin was changed to regular insulin just before a meal at the same dosage. body mass index (bmi), glycated hemoglobin (hba1c), urinary cpeptide excretion and diabetic microvascular complications were examined at the beginning of the study. sevenpoint blood glucose testing and the incidence of hypoglycemia were collected for 3 days at the end of the hospitalization. hba1c was expressed as a national glycohemoglobin standardization program (ngsp) equivalent value ; that is, hba1c (ngsp equivalent value) (%) = hba1c (japan diabetes society value) (%) + 0.4%2. microalbuminuria was defined as a urinary albumin / creatinine excretion ratio more than 30 mg / gcr. when blood glucose level before lunch, supper or at bedtime was elevated, bolus insulin dosage before breakfast, lunch or supper was titrated, respectively ; and when fasting blood glucose level was elevated, basal insulin dosage at bedtime was titrated. the present study was carried out in accordance with the declaration of helsinki and with approval from the ethical committee for human studies at osaka university graduate school of medicine. multivariate logistic regression analysis was used with statview 5.0 software (sas institute, cary, nc, usa). the characteristics of the study participants were as follows : sex (male / female) 41/15, age 60.5 12.8 years, bmi 25.2 5.2 kg / m, duration of diabetes 14.4 7.3 years, hba1c 9.3 2.0%, urinary cpeptide excretion 48.7 38.0 g / day. among 56 patients, premeal rapidacting insulin was used throughout the period in 41 patients (rapid group), and it was changed to regular insulin in 15 patients (regular group). the prevalence of basal insulin (table 2) and the averages of blood glucose levels (figure 1) were comparable between the rapid group and the regular group. the prevalence rate of premeal hypoglycemia was comparable in these groups (regular 3.0 6.6 vs 0.8 2.9%, not significant). the prevalence rate of postmeal hypoglycemia was significantly higher in the regular group than in the rapid group (5.5 8.4 vs 0.5 2.4%, p the numbers of patients in the regular group were two out of two for bmi 18, four out of seven for bmi > 18 and 20, three out of eight for bmi > 20 and 22, four out of nine for bmi > 22 and 24, and one out of 30 for bmi > 24. in the regular group, age tended to be higher (p = 0.07) and urinary cpeptide immunoreactivity tended to be lower (p = 0.08) than the rapid group. there were no significant differences in the prevalence of microalbuminuria, autonomic neuropathy and retinopathy between these two groups. sevenpoint blood glucose profiles in the rapidacting insulin group (rapid group) and regular insulin group (regular group). b0, before breakfast ; b2, 2 h after breakfast ; bs, before sleep ; l0, before lunch ; l2, 2 h after lunch ; s0, before supper ; s2, 2 h after supper. data shown as mean sd (range). unpaired ttest for parametric data test for betweengroup differences in numbers. bmi, body mass index ; cpr, cpeptide immunoreactivity ; ns, not significant. multivariate logistic regression analysis was carried out with regular insulin use as a dependent variable, and age, bmi, the prevalence of autonomic neuropathy and urinary cpeptide excretion as independent variables (table 3). bmi was only an independent predictor of regular insulin use (standardized odds ratio 0.649, p < 0.005), showing that regular insulin is suitable in lean type 2 diabetic patients. diabetes is increasing dramatically in asia, and asian people develop diabetes with a lesser degree of obesity4. timeaction profiles of currently available subcutaneous insulin products are attenuated and delayed in obese patients5. although timeaction profiles of rapidacting insulin in lean type 2 diabetes has not been determined, skinfold thickness was reported to cause insulin malabsorption7. in addition, thinner subcutaneous fat tissue at the injection site was associated with enhanced subcutaneous insulin absorption8. rapidacting insulin enables us to achieve tighter postprandial glycemic control in the mdi regimen9 ; however, we showed that 15 out of 56 japanese type 2 diabetic patients changed from premeal rapidacting to regular insulin to avoid postprandial hypoglycemia. regular insulin is usually injected 30 min before a meal ; however, it was injected just before meals in the regular group in the present study, and the sevenpoint blood glucose profile was comparable with that of the rapid group. if regular insulin was injected 30 min before a meal, the peak of insulin effect might be close to rapidacting insulin. a slower glucose lowering effect was preferable to achieve a good glycemic profile for patients with postprandial hypoglycemia. the multivariate logistic regression analysis showed that low bmi was an independent factor accounting for the use of regular insulin. therefore, we assume that rapid absorption of insulin in lean patients explains, at least in part, the reason why regular insulin is suitable for lean diabetic patients. aging and autonomic neuropathy have been reported to be inversely related with gastric emptying10. age tended to be higher in the regular group than in the rapid group (p = 0.07), but was not an independent factor accounting for the use of regular insulin. therefore, slow gastric emptying was not a determinant for the usefulness of regular insulin in the present study. postmeal hypoglycemia was not frequent in both groups, but was significantly higher in the regular group than in the rapid group. urinary cpeptide secretion tended to be higher in the rapid group than in the regular group ; however, it did not account for postmeal hypoglycemia according to the multivariate analysis (data not shown). in the regular group, 2h postmeal blood glucose declined by an average of 65.9 37.8 mg / dl from the premeal blood glucose in 3 days before switching the insulin from rapid to regular insulin, whereas it increased by 1.2 64.0 mg / dl in the final 3 days with regular insulin. therefore, if we continued rapidacting insulin in the regular group, the incidence of hypoglycemia could become more frequent to achieve the target level of premeal glucose. in conclusion, it is likely that regular insulin, rather than rapidacting insulin, is a suitable choice for mealtime bolus insulin in lean type 2 diabetic patients.	abstractthe aim of the present study was to compare the usefulness of premeal rapidacting and regular insulin in type 2 diabetes patients. a total of 56 type 2 diabetic patients were investigated during hospitalization. premeal rapidacting insulin was applied instead of other medications. premeal insulin was titrated to adjust premeal and bedtime blood glucose levels to 81120 mg / dl. premeal rapidacting insulin was changed to regular insulin just before a meal at the same dosage if the postmeal blood glucose level was lower than the premeal blood glucose level. a total of 15 patients changed to regular insulin, and 41 patients continued rapidacting insulin. the blood glucose level was comparable between these two groups. body mass index was significantly lower in the patients using regular insulin. according to the multivariate logistic regression analysis, low body mass index was an independent variable accounting for the usefulness of regular insulin. regular insulin, rather than rapidacting insulin, is a suitable choice for premeal insulin in lean type 2 diabetic patients.
many lines of evidence suggest that serotonin transporter (sert) plays an important role in the pathophysiology of major depressive disorder (mdd) and the therapeutic actions of sert - targeted antidepressants (owens and nemeroff, 1994 ; mann, 2013) that exert their function by blocking the sert, thereby increasing serotonin (5-hydroxytryptamine [5-ht ]) levels in the synapses of serotonergic projection terminals. the involvement of sert gene (solute carrier family 6 (neurotransmitter transporter), member 4 [slc6a4 ]) variants such as 5-hydroxytryptamine transporter - linked polymorphic region [5-httlpr ] and stin2 variable number tandem repeat in antidepressant efficacy has been widely investigated. however, the results are controversial and inconsistent across different ethnic populations (ng., 2013). furthermore, two meta - analysis studies reported a non - significant correlation between slc6a4 variants and antidepressant efficacy (kato and serretti, 2010 ; niitsu., 2013). epigenetic evidence in peripheral leukocytes has shown a higher methylation rate of the slc6a4 gene in drug - free patients with mdd, which may be associated with better therapeutic responses to antidepressants (domschke., 2014 ; okada., 2014). however, dna methylation in peripheral blood cells may not be a reflection of that in the brain. hence, in vivo imaging studies are necessary to examine the differences in sert expression relative to the response to antidepressants. the majority of sert imaging studies have shown that patients with mdd have reduced sert binding in a major depressive episode (mde ; newberg., 2005, 2012 ; parsey., 2013 ; gryglewski., 2014) ; however, there are some inconsistent reports of unaltered (meyer., 2004a ; miller., 2013) or elevated sert binding (reivich., 2004 ; cannon., 2007. moreover, there are no differences in sert binding in an euthymic state (lehto., 2008 ; hsieh., 2010 these findings suggest that a decrease in sert binding occurs during the transition from a healthy state to a mde, which then reverses during the transition from a mde to the remitted (euthymic) state. therefore, sert binding could be a state marker for patients with mdd, and dynamic changes in sert binding might be associated with pathophysiology of mdd and its treatment response. previous studies that examined the antidepressant occupancy of sert and its relationship to treatment response have reliably shown an 80% striatal occupancy of the sert after a 4-week treatment with selective serotonin reuptake inhibitors (ssris ; meyer. nonetheless, these findings can not explain the individual differences observed in antidepressant efficacy and treatment dropout rate. in addition, association studies of pretreatment brain sert availability and treatment response have yielded diverse results (kugaya., 2004 ; miller., 2008 ; lanzenberger., 2012), although this may be due to the difference in radioligands and treatment durations used. moreover, these studies merely analyzed patients who had completed the treatment course ; they did not compare sert binding in patients with mdd who withdrew from treatment or in healthy controls. (2004) first used single - photon emission computed tomography (spect) and the radioligand [(123)i]beta - cit (2beta - carbomethoxy-3beta-(4-iodophenyl)tropane) ([i]--cit) to investigate the association between sert binding and therapeutic efficacy. they found that a higher pretreatment sert density in the diencephalon, including the thalamus and hypothalamus, correlated with a better response after a 4-week ssri treatment. this result suggested that higher pretreatment availability and greater ssri occupancy of the sert might predict better treatment response. a later study that used positron emission tomography (pet) with the radioligand rel-(6r,10bs)-6-[4-(methylsulfanyl)phenyl]-1,2,3,5,6,10b - hexahydropyrrolo[2,1-]isoquinoline ([c](+)mcn5652 ; miller., 2008) suggested that lower pretreatment sert binding in depressed patients relative to healthy controls predict 1 year non - remitters. however, this finding was obtained in patients who were treated with a mixture of medications, including monoamine oxidase inhibitors, bupropion, lithium, and/or thyroid hormone supplementation, which may have consequently confounded the results (miller., the major drawback of these studies is the use of nonselective sert radioligands, such as [i]--cit and [c](+)mcn5652. for example, [i]--cit has near equal affinity for the sert and dopamine transporters (meyer, 2007) and the mixed binding of the sert and dopamine transporters may mask the true levels of sert binding. although [c](+)mcn5652 has higher selectivity for sert compared with the other monoamine transporters, it has a low ratio of specific binding relative to free and nonspecific binding (brust., 2006). a recent pet study that used the sert - selective radioligand [(11c ] 3-amino-4-(2-dimethylaminomethyl - phenylsulfanyl)benzonitrile ([c]dasb) reported no association between pretreatment sert binding levels and the 3-week ssri treatment response in patients with mdd (lanzenberger., 2012). hence, it remained to be elucidated whether the levels of sert in drug - nave patients are associated with treatment response and premature withdrawal from antidepressant treatment. the sert binding in axon - projecting areas can be modulated by the tonic firing of serotonergic neurons through 5-hydroxytryptamine (serotonin) receptor 1a [5-ht1a ] autoreceptors. this has been suggested as a potential mechanism of antidepressant action (lanzenberger., 2012). therefore, a biomarker to predict sert - targeted antidepressant efficacy should not be limited to regional sert binding, but should also measure the interplay of sert binding in terminal - projection regions and midbrain raphe nuclei. in the present study, we used pet with the sert - selective radioligand n, n - dimethyl-2-(2-amino-4-[f]fluorophenylthio)benzylamine (4-[f]-adam) to measure in vivo sert binding in the human brain (shiue., 2003 ; huang., 2010 ; huang., 2013). after completing the pet scan, patients with mdd were administered a sert - targeted antidepressant and a 6-week naturalistic follow - up. the study aimed to examine whether pretreatment regional sert binding or terminal projection region / midbrain sert binding ratios correlated with an early reduction in depressive symptoms. secondly, it aimed to investigate whether the pretreatment levels of regional sert binding or sert binding ratios predicted responders, nonresponders, and dropout patients. we used the chinese version of the modified schedule of affective disorder and the schizophrenia - lifetime (sads - l) to screen psychiatric conditions in all participants (endicott and spitzer, 1978 ; huang., 2004). the inclusion criteria for patients with mdd were as follows : (1) age between 20 to 65 years ; (2) meeting mdd according to the diagnostic and statistical manual of mental disorders, fourth edition, text revision (dsm - iv - tr) ; (3) a score of 18 on the 21-item hamilton depression rating scale (hdrs) as is indicative of moderate to severe mdd (hamilton, 1960). the exclusion criteria for patients with mdd were as follows : (1) patients diagnosed with other comorbid axis i and/or axis ii disorders, with the exception of patients with nicotine dependence ; (2) hdrs score of thalamus > striatum > pfc. across the four rois, bpnd was significantly different according to the diagnosis of current mdd (f = 11.357, df = 1,76, p = 0.001). a post hoc analysis demonstrated significantly lower bpnd values in the midbrain (t = -3.480, df = 1,152, uncorrected p 0.05). within the completed treatment group (n = 21), we observed that sert binding in the thalamus (spearman s coefficiency = 0.518, p = 0.016) and striatum (spearman s coefficiency = 0.438, p = 0.047) positively correlated with a reduction in hdrs scores at week 3 (figure 3, supplemental table 2) but not at the other weeks. we calculated the sert binding ratio by dividing the sert bpnd in the terminal projection area by the sert bpnd in the midbrain. the projecting areas / midbrain sert bpnd ratios did not show any correlations with reductions in hdrs scores (supplemental table 2). correlation between the reduction of hamilton depression rating scale (hdrs) score at early stage (week 3) and pretreatment levels of serotonin transporter (sert) binding potential (bp) in the thalamus and striatum (n = 21). the sert bpnd did not differ among responders, nonresponders, and dropout patients across the four rois. however, sert binding in the thalamus and striatum was significantly lower in dropout patients compared to healthy controls (z = -3.35, p = 0.001 for thalamus ; z = -2.87, p = 0.004 for striatum). by coding the healthy controls, responders, nonresponders, and dropout patients as an ordinal variable in the order of 0, 1, 2, and 3, respectively, sert binding negatively correlated with the ordinal variable in the thalamus (= -0.417, p thalamus > striatum > pfc. across the four rois, bpnd was significantly different according to the diagnosis of current mdd (f = 11.357, df = 1,76, p = 0.001). a post hoc analysis demonstrated significantly lower bpnd values in the midbrain (t = -3.480, df = 1,152, uncorrected p 0.05). within the completed treatment group (n = 21), we observed that sert binding in the thalamus (spearman s coefficiency = 0.518, p = 0.016) and striatum (spearman s coefficiency = 0.438, p = 0.047) positively correlated with a reduction in hdrs scores at week 3 (figure 3, supplemental table 2) but not at the other weeks. we calculated the sert binding ratio by dividing the sert bpnd in the terminal projection area by the sert bpnd in the midbrain. the projecting areas / midbrain sert bpnd ratios did not show any correlations with reductions in hdrs scores (supplemental table 2). correlation between the reduction of hamilton depression rating scale (hdrs) score at early stage (week 3) and pretreatment levels of serotonin transporter (sert) binding potential (bp) in the thalamus and striatum (n = 21). the sert bpnd did not differ among responders, nonresponders, and dropout patients across the four rois. however, sert binding in the thalamus and striatum was significantly lower in dropout patients compared to healthy controls (z = -3.35, p = 0.001 for thalamus ; z = -2.87, p = 0.004 for striatum). by coding the healthy controls, responders, nonresponders, and dropout patients as an ordinal variable in the order of 0, 1, 2, and 3, respectively, sert binding negatively correlated with the ordinal variable in the thalamus (= -0.417, p < 0.001) and striatum (= -0.307, p = 0.005, figure 2). this indicated a trend association in reduced sert availability from healthy control to responder to nonresponders to dropout patients. furthermore, we compared the projecting areas / midbrain sert bpnd ratios among responders, nonresponders, and dropout patients, and found that there were significant differences in thalamus / midbrain and striatum / midbrain sert bpnd ratios (figure 4). a post hoc test revealed that responders had a higher striatum / midbrain sert binding ratio compared with nonresponders (z = -1.99, p = 0.047). because sert bpnd and sert bpnd ratios did not differ between nonresponders and dropout patients, we combined these two groups into the other group (n = 27). in comparison with the other group, responders had higher thalamus / midbrain, striatum / midbrain, and pfc / midbrain binding ratios (all p - values < 0.05). after bonferroni corrections for multiple testing, the significance remained in the thalamus / midbrain sert binding ratio between the responder group and the other group. moreover, the pfc / midbrain binding ratio was higher in the responders than in the healthy controls (z = -2.74, p = 0.006). there were no differences in the sert bpnd ratios among the healthy controls, nonresponders, and dropout patients. the box - and - whisker plot of pretreatment serotonin transporter (sert) binding ratios in the terminal projection regions relative to the midbrain raphe nuclei among healthy controls (n = 39), responders (n = 12), nonresponders (n = 9), and dropout subjects (n = 18) with major depressive disorder (mdd). the short horizontal bar within the box indicates the median value of sert binding ratios (p < 0.05, p < 0.01 compared to responders). the interquartile range (iqr), which is the length of the box, can be used as a measure of how spread - out the values are. small, medium, and large effect sizes were defined respectively as 0.2 hedges g < 0.5, 0.5 hedges g < 0.8, and hedges g 0.8. mb, midbrain ; pfc, prefrontal cortex ; st, striatum ; th, thalamus. the roc curve and the auc are presented in figure 5a and b. the auc for the logistic regression models for each projection area / midbrain sert bpnd ratios is presented in table 2. the striatum / midbrain sert bpnd ratio predicted responders versus nonresponders (auc = 0.76, p = 0.047, table 2, figure 5a). we found that the thalamus / midbrain sert bpnd ratio can distinguish the responder group from the other group (auc = 0.78. both the striatum / midbrain (auc = 0.75, p = 0.014) and pfc / midbrain (auc = 0.73, p = 0.026) sert bpnd ratios predicted the responders versus the other group. the predictive power of sert bpnd ratios was fair because all the auc values were greater than 0.7. prediction of (a) responders versus nonresponders ; (b) responders versus other group (combined nonresponders and dropout subjects) using receiver operator characteristic (roc) curves and the area under the curve (auc) based on serotonin transporter (sert) binding ratios (p < 0.05, p < 0.01). bp, binding potential ; mb, midbrain ; pfc, prefrontal cortex ; st, striatum ; th, thalamus. predictive ability of serotonin transporter (sert) non - displaceable binding potential (bpnd) ratios to distinguish responders from nonresponders or other group. the cutoff point of sert bp ratios as the predictor by plotting the proportion of true positive result (sensitivity) versus the proportion of false - positive results (1-specificity). the area under the curve (auc) indicates area under the receiver operator characteristic (roc) curves (p < 0.05, p < 0.01). mb, midbrain ; pfc, prefrontal cortex ; st, striatum ; th, thalamus. our naturalistic cohort study of 4-[f]-adam pet imaging in antidepressant - nave patients with mdd demonstrated that greater pretreatment levels of sert binding in the thalamus and striatum are associated with a greater reduction in hdrs scores at the 3-week stage of treatment. our findings regarding the prediction of early improvement in depressive symptoms was in accordance with those of a previous study that used spect with the nonspecific sert radioligand [i]--cit (kugaya., 2004). they showed that higher levels of sert binding in the diencephalon, including the thalamus and hypothalamus, predict a better 4-week treatment response to ssris. however, our findings were inconsistent with those of a study that used pet with the sert - selective radioligand [c]dasb (lanzenberger., 2012) and that revealed no association between any regional sert binding and reduction in hdrs scores at week 3. although we found that the sert bpnd was lower in the midbrain, thalamus, and striatum in patients with mdd compared with healthy controls, similar to the findings of previous reports (newberg., 2005, 2012 ; parsey., 2006b ; reimold., 2008 ; nye., 2013 ; gryglewski., 2014), we did not find any differences in sert bpnd across the four rois between responders and nonresponders. this suggested that pretreatment sert availability might contribute to the initial change in hdrs scores in the first 3 weeks ; nevertheless, the final therapeutic efficacy may be regulated by another mechanism., 2004 ; lanzenberger., 2012), the differences among responders, nonresponders, and healthy controls could not be investigated. to the best of our knowledge, this is the first study to explore whether regional sert binding and sert binding ratios differ between healthy controls and depressed subgroups that were categorized by their outcomes to antidepressant treatment, including responders, nonresponders, and dropout patients. in the present study, we observed a trend towards reduced sert availability, in order, from healthy controls to responders to nonresponders to dropout patients. furthermore, the sert bpnd ratios between the terminal projection regions and the midbrain in healthy controls were nearly equal to those in nonresponders and dropout patients (figure 4). this finding indicated that both nonresponders and dropout patients demonstrated a proportionate decrease in sert bpnd in the terminal projection regions and midbrain compared with controls. in contrast, responders showed a pronounced decline in sert bpnd in the midbrain raphe nuclei and a disproportionally smaller decline in sert bpnd in serotonergic terminal projection regions compared to controls. therefore, greater sert bpnd ratios in the projection regions (e.g. thalamus and striatum) relative to the midbrain might predict better treatment outcomes to sert - targeted antidepressants at week 6. this concept was partially in accordance with the findings of an earlier pet imaging study by lanzenberger. (2012) that showed that higher sert binding in the projection regions (amygdala and habenula) relative to the median raphe nuclei was beneficial for ssri therapeutic efficacy and that these sert binding ratios positively correlated with a reduction in hdrs scores at week 3. we found that higher sert binding ratios (thalamus / midbrain and striatum / midbrain) might predict sert - targeted antidepressant efficacy at week 6. the inconsistent results at the various response times (week 3 versus week 6) might be due to differences in the antidepressants used, because antidepressants have different efficacies and response times (cipriani., 2009). previous studies that defined 3 or 4 weeks as the treatment endpoints might have underestimated the number of responders (kugaya., 2004 ; lanzenberger., 2012). therefore, our study analyzed antidepressant - nave depressed patients and followed them for 6 weeks, which might be a more complete treatment course. it was unclear why a disproportionate reduction of sert bpnd between the projection regions and the midbrain raphe nuclei was associated with better clinical response after 6 weeks of antidepressant therapy in drug - nave patients with mdd. first, the down - regulation of sert in the serotonergic cell bodies and axon terminals takes longer than 46 weeks after administration of an antidepressant (mirza. higher pretreatment levels of sert binding in projection regions (e.g. thalamus and striatum) may lead to greater occupancy by the antidepressant (kugaya., 2004 ; baldinger., 2014), thereby rapidly enhancing 5-ht levels in the thalamus and striatum, which could ameliorate depressive symptoms at an early stage. lower pretreatment levels of sert bpnd in the midbrain might be a compensatory response to the fewer numbers of serotonergic axons and neurons in major depression in order to overcome the lower levels of 5-ht (arango. the responders showed the lowest sert binding in the midbrain and a smaller decline in sert binding in projection regions, which suggested that responders had a superior compensatory response and neuronal plasticity in response to lower serotonin neurotransmission among patients with major depression (celada. second, higher pretreatment levels of sert bpnd in the thalamus or striatum could be moderated by inhibitory gamma - aminobutyric acid or excitatory glutaminergic inputs from the cortex and suppressed by 5-ht1a autoreceptors in order to regulate the serotonergic neuron firing rate. after initiating sert - targeted antidepressants (artigas, 2013), the serotonergic tonic firing rate would be suppressed through 5-ht1a autoreceptors in the midbrain raphe nuclei (celada., 2001), which would consequently activate serotonergic neurons and promote 5-ht neurotransmission in terminal areas (descarries and riad, 2012). therefore, the unequal reduction in the sert density in terminal projection regions relative to the midbrain might be involved in therapeutic efficacy in mdd, and could aid in predicting the treatment outcomes of patients with mdd. third, microrna expression are down - regulated in the terminal projection regions in patients with depression and suicide (smalheiser., 2012 ; serafini., 2014) and up - regulated after the administration of antidepressants (baudry., 2010 these findings suggest that microrna might modulate the level of sert and 5-ht1a receptor in response to antidepressant treatment. the 53.8% complete - treatment rate in our study was in line with previous studies showing that approximately 55% of the patients with depression maintained their complete antidepressant therapy during the first month, whereas the other patients prematurely discontinued medication (brown. adherence to the antidepressant is essential for therapeutic efficacy in patients with mdd (demyttenaere, 1998 ; pampallona., 2002). however, earlier studies investigating adherence to antidepressants have focused on personal insight, education level, and concerns about the antidepressant side effects without assessing the biological factors in dropout patients (pampallona., 2002 ; vergouwen., our results showed that sert bpnd ratios did not differ between dropout patients and nonresponders, but a trend of greater decline in regional sert binding was noted in dropout patients compared to nonresponders. this implied that the withdrawal from antidepressant in patients with major depression might not only be due to poor insight into the illness and medication but also because of a poor response to antidepressants, similar to nonresponders. furthermore, a significant difference in the sert bpnd ratios was observed between dropout patients and responders. therefore, the sert bpnd ratios between the terminal projection regions and the midbrain raphe nuclei might be a potential biomarker for prediction of responders versus nonresponders and dropouts. because the predictive power of the sert bpnd ratios was fair (75%78%, table 2), this biological evidence may help clinicians to more closely monitor those patients who have low thalamus / midbrain and striatum / midbrain sert bpnd ratios while they are on antidepressant therapy. finally, the basal ganglia, including the striatum, are strongly interconnected with the cortex, thalamus, brain stem, and other brain areas. among these, the corticobasal ganglia pathway plays a crucial role in the neuropathology of mood disorders (marchand., 2012) and reward prediction (tanaka., 2004), and could contribute to the response and decision of antidepressant adherence. serotonin levels have been suggested to modulate cerebral glucose metabolism in patients with major depression (smith., 2002, 2009 ; regional sert density can affect 5-ht levels in order to modulate glucose uptake in the subcortical and cortical regions, thus influencing the response and adherent behaviors of patients to antidepressants (kennedy. as we previously mentioned, the higher projection region / midbrain bpnd ratios distinguished responders from nonresponders and dropout patients, and the disproportional reduction in sert binding between terminal projection regions and the midbrain might be involved in the treatment outcome through the regulation of cerebral glucose metabolism. although nicotine can inhibit 5-ht reuptake and stimulate 5-ht release in platelets (rausch., 1989), which potentially increases sert levels, previous imaging studies did not show a significant association between cigarette smoking and sert availability (staley., 2001 ; ruhe., 2009 ; erritzoe., 2010 ; ho., consistent with these studies, we did not find any associations between cigarette smoking and sert binding. first, we did not measure the plasma levels of the antidepressant or sert occupancy by the antidepressant during the 6-week treatment course. the association between sert occupancy by the antidepressant and antidepressant concentration could not be further analyzed. however, previous studies had shown that pretreatment sert binding levels positively correlated with antidepressant occupancy (baldinger., 2014). hence, our result based on pretreatment sert availability was able to predict the response to sert - targeted antidepressants. second, we recruited patients with mdd and treated them with common sert - targeted antidepressants, including ssris, such as paroxetine, and serotonin - norepinephrine reuptake inhibitors (snris), such as venlafaxine and duloxetine. the different antidepressants that we used in the present study may have had different affinities to norepinephrine transporter (net). an antidepressant with a higher net / sert affinity ratio, such as duloxetine, might have a higher blockade of net compared with other snris and ssris. thus, our prediction based on sert binding might merely explain the sert effect and not the net effect. we could not rule out the effect of net in the present study (owens., 2008 ; nogami., 2013), because pretreatment levels of net binding and net occupancy by the antidepressants might also contribute to therapeutic efficacy. third, the dosage may also confound the outcome of antidepressant treatment. however, both ssris and snris at their minimal standard therapeutic dosages show around 80% occupancy of the sert (meyer., 2001, 2004b), and higher dosages would result in a plateau effect of sert occupancy. even though the doses of the sert - targeted antidepressants varied, the sert occupancy by the antidepressants should be consistent with those in previous studies. in contrast, the occupancy of net by snris had a dose - dependent effect (owens., 2008), and dosage of snris may influence the therapeutic efficacy. nevertheless, we did not observe any dosage differences among different types of antidepressants between responders and nonresponders. fourth, our small sample size (n = 78) was insufficient to explore the association of slc6a4 variant effects with each group s sert bpnd. however, previous postmortem (mann., 2000) and in vivo imaging studies (parsey., 2006a ; ho., 2013) have shown no significant differences in 5-httlpr and stin2 variable number tandem repeat polymorphisms on sert binding. therefore, in vivo sert availability might account for treatment response more than slc6a4 variants in patients with mdd. nevertheless, the effects of other genes or epigenetic modulations on sert binding in the brain should be considered. fourth, psychosocial problems and personality traits may also contribute to treatment response (kaneda., 2011) ; however, we did not discuss this in the present study. taken together, our study provides new insight into pretreatment sert availability and its association with treatment outcomes in patients with major depression. the disproportionate reduction in sert binding in the projection area and in the midbrain raphe nuclei may be attributed to a response to antidepressants, whereas a proportionate reduction in sert density may be associated with nonresponse and nonadherence to antidepressants. these findings may help clinicians to predict which patients may be nonresponsive or reluctant to adhere to sert - targeted antidepressants treatment. for such patients, the use of other treatment strategies, including augmentation, use of antidepressants with other mechanisms of action, or psychotherapy, is recommended. correlation between the reduction of hdrs score at each week and pretreatment regional sert binding and sert binding ratios.	background : many lines of evidence suggest the role of serotonin transporter (sert)-mediated reuptake of serotonin in the pathophysiology and treatment of major depressive disorder (mdd). this study aimed to examine whether the pretreatment of sert binding potential or sert binding ratio between terminal projection regions relative to the midbrain raphe nuclei was associated with treatment outcomes to sert - targeted antidepressants.methods:we recruited 39 antidepressant - nave patients with mdd and 39 heathy controls. positron emission tomography with n, n - dimethyl-2-(2-amino-4-[18f]fluorophenylthio)benzylamine (4-[18f]-adam) was used to measure in vivo sert availability prior to antidepressant treatment. the 21-item hamilton depression rating scale (hdrs) was use to assess the severity of depression from baseline to week 6. all the patients with mdd had hdrs scores of 18 or more.results:pretreatment sert binding in the thalamus and striatum positively correlated with an early reduction in hdrs scores at week 3. nonresponders and dropout patients showed a proportionate reduction in sert binding in the terminal projection regions and midbrain compared to healthy controls. in contrast, a disproportionate reduction in sert binding in the terminal projection regions relative to midbrain was observed in responders.conclusions:the results of this study suggested that a disproportionate reduction in sert binding between terminal projection regions and midbrain may predict better treatment outcomes in patients with mdd.
angiokeratoma is a rare cutaneous vascular disorder of the papillary dermis that is characterized by one or more dilated vessels in the upper part of the dermis. in the majority of cases, it is also associated with epidermal reactions such as acanthosis and/or hyperkeratosis1. this disorder can be classified into five types : (1) a generalized systemic form (angiokeratoma corporis diffusum of fabry) ; (2) a bilateral form occurring on the dorsal surfaces of the fingers and toes (angiokeratoma of mibelli) ; (3) a localized scrotal form (angiokeratoma of fordyce) ; (4) a solitary papular angiokeratoma ; and (5) a multiple papular and plaque - like form (angiokeratoma circumscriptum)2,3. although the clinical characteristics are different, common histological features include hyperkeratosis of the epidermis and dilated vascular spaces with or without organizing thrombi in the papillary dermis of cutaneous lesions4,5. among the five types of angiokeratomas, most of the cases of angiokeratoma in the oral cavity have presented in conjunction with generalized systemic conditions (fabry disease and fucosidosis). isolated oral angiokeratoma unrelated to any systemic disease or cutaneous lesion has been rarely reported. to the best of our knowledge, only ten cases of isolated angiokeratoma in the oral cavity have been reported in the literature3,4,5,6,7,8,9,10,11,12.(table 1) the majority of reported oral angiokeratoma cases occurred on the tongue, but one case involved the buccal mucosa. in this report, we describe an additional case of angiokeratoma circumscriptum in the oral cavity that involved the buccal mucosa without accompanying systemic disease or skin lesion. to characterize this unusual oral lesion, the surgical specimen was analyzed by immunohistochemistry for the expression of vascular endothelial growth factor (vegf) and its two receptors, vegfr-1 and vegfr-2. an 18-year - old female patient was referred for an evaluation of a dark - colored, painless, elevated lesion in the oral cavity. clinically, a 52-cm - sized, multi - lobular, irregular, raised lesion was observed on the right side of the buccal mucosa.(fig. a) the lesion was firm, did not bleed on manipulation, and was not accompanied by mucosal ulceration. she had first recognized a small lesion on her cheek mucosa about three years prior, which had gradually increased in size. magnetic resonance imaging showed an ill - defined, heterogeneously enhanced lesion on the right side of the buccal mucosa.(fig. c) a punch biopsy of the lesion showed epithelial hyperkeratosis, acanthosis, papillomatosis, and large dilated cystic lesions containing erythrocytes under the epithelial tissue.(fig. b) these characteristics were consistent with angiokeratoma. under general anesthesia, the cheek lesion was completely excised, and the surgical defect was primarily closed with a cheek advancement flap.(fig. b) the patient was followed for more than three years without any evidence of recurrence. to confirm the angiogenic characteristics of the tumor, the specimen was immunostained for vegf and two of its receptors (vegfr-1 and vegfr-2). for immunohistochemical analysis, the tumor specimen was embedded in a paraffin block, cut into 4-m sections, and mounted on glass slides. after hydration, immunohistochemical staining was performed using an automated immunostainer (benchmark xt ; ventana medical systems inc., tucson, az, usa), and detection was performed using the ultraview universal dab kit (ventana medical systems inc.) according to the manufacturer 's protocol. briefly, sections were deparaffinized using an ez prep solution (ventana medical systems inc.) and then treated with cc1 standard (ethylenediaminetetraacetic acid [edta ], ph 8.4) for 60 minutes at 100 for antigen retrieval. next, the slides were treated at 37 for 4 minutes with ultraview universal dab inhibitor (3% h2o2) to block endogenous peroxidase activity. slides were then incubated at 37 first with each primary antibody for 32 minutes and then with the secondary antibody (universal hrp multimer ; ventana medical systems inc.) for 8 minutes. finally slides were treated with dab+h2o2 substrate for 8 minutes, and nuclei were counterstained in hematoxylin ii and bluing reagent at 37. immunostained sections were photographed under a nikon eclipse ti - u microscope (nikon instruments inc., tokyo, japan), and the proportion of positive staining was calculated for both endothelial and stromal cells in the lesion. the primary antibodies used and the results of the immunohistochemical staining are summarized in table 2. immunostaining revealed that the stromal cells in the lesion and endothelial cells lining the pathologically dilated vessels expressed vegf and its two receptors (vegfr-1 and vegfr-2).(fig. 4) among both stromal and endothelial cells in the lesion, the percentage of positive - staining cells was higher for vegfr-2 than that for vegfr-1. interestingly, some endothelial cells showed co - expression of vegf and both of its receptors (arrows), whereas others co - expressed only vegf and vegf-2 (arrowhead). proportions of the cells staining positive for each of vegf, vegfr-1, and vegfr-2 are shown in table 2. the first case of angiokeratoma was reported by mibelli in 1890, and the manifestation of the disorder found on fingers and toes is now known as angiokeratoma of mibelli13. angiokeratoma circumscriptum was first described in 1915 by fabry as a localized lesion on a lower extremity13,14. it typically occurs unilaterally on the lower legs or feet, but it has also been observed on the thighs, buttocks, or elsewhere. the lesions are deep red to blue - black in color and are usually elevated, warty, purplish and compressible papules13. in most cases, angiokeratoma circumscriptum is present at birth, but in some cases, it develops during childhood or adulthood4,7. oral mucosal involvement is most commonly detected as a component of angiokeratoma corporis diffusum (fabry disease and fucosidosis). in addition to the present case, a review of the literature revealed ten cases of isolated angiokeratoma that occurred in the oral cavity.(table 1) of those, four cases were solitary angiokeratoma and six were angiokeratoma circumscriptum. except for one case of solitary angiokeratoma that involved the buccal mucosa6, the remaining nine occurred on the tongue (pathologically, six were angiokeratoma circumscriptum and three were solitary angiokeratoma)3,4,5,7,8,9,10,11,12. to our knowledge, the present report is the second case published on isolated oral angiokeratoma confined to the buccal mucosa and the first case report on angiokeratoma circumscriptum involving the buccal mucosa. the histopathological features of angiokeratoma in the oral cavity are similar to those in skin lesions, which are hyperkeratosis, acanthosis, papillomatosis of the squamous epithelium, and dilated subepithelial blood vessels with thrombosis5. it has been thought that altered hemodynamics, such as local injury to papillary capillaries, cause telangiectatic lesions in the papillary dermis with overlying reactive hyperkeratosis and acanthosis of the epidermis3,4. interestingly, matrix metalloproteinase-9 (mmp-9) has been identified in the epidermis, particularly in hyperkeratotic lesions of angiokeratoma circumscriptum, by immunohistochemistry15. the expression of mmp-9 may be related to the hyperkeratotic changes in angiokeratoma3,15. in the surgical specimen analyzed in the present study, vegf and its two receptors (vegfr-1 and vegfr-2) were expressed in the endothelial cells of dilated vessels. vegf has been characterized as a heparin - binding angiogenic growth factor that plays a critical role in angiogenesis and vasculogenesis during tumor growth and tissue regeneration16,17. of the several vegf receptors, vegfr-1 is primarily involved in cell migration and vascular maintenance rather than cell proliferation, whereas vegfr-2 participates directly in regulating cell mitosis and proliferation ; however, their precise roles have not been completely elucidated16. in the specimen analyzed in the present study, immunostaining intensity was stronger and the proportion of positive cells was higher for vegfr-2 than for vegfr-1, indicating enhanced cell proliferation of endothelial cells. additionally, the coexpression of vegf and both of its receptors or only vegf-2 was detected in some of the endothelial cells lining the pathologically dilated vessels. the coexpression of vegf and vegfrs by the endothelial cells in the lesion indicates that vegf is an autocrine growth factor for these cells17. these results suggest that endothelial cells in the pathologically dilated vessels possess vegf autocrine growth activity involved in vasculogenesis and maintenance in the angiokeratoma lesion.	angiokeratoma is a benign cutaneous lesion of the capillaries, presenting as dilated vessels in the upper part of the dermis. although this disorder is classified into various types and has been occasionally reported in the skin of the scrotum or extremities, the involvement of the oral cavity mucosa has been rarely reported. the present study reports a case of angiokeratoma circumscriptum in the buccal mucosa. the expression of vascular endothelial growth factor (vegf) and both of its receptors (vegfr-1 and vegfr-2) was demonstrated by immunohistochemistry in the endothelial cells lining the dilated vessels. the expression of vegfr-2 was higher than that of vegfr-1 in the endothelial cells in the lesion, indicating an increased rate of endothelial cell proliferation within the lesion. interestingly, some of the endothelial cells co - expressed vegf and its two receptors. these results suggest that endothelial cells in the pathologically dilated vessels possess vegf autocrine growth activity involved in vasculogenesis and maintenance in angiokeratoma lesions. to our knowledge, this is the second report published on isolated oral angiokeratoma confined to the buccal mucosa and the first case report on angiokeratoma circumscriptum involving the buccal mucosa.
this was considered an incidental radiographic finding and is known as chilaiditi 's sign. however, this rare radiographic finding may be symptomatic and is then more correctly known as chilaiditi 's syndrome. it is exceptionally rare for this condition to cause bowel obstruction or require surgical correction. furthermore, colonic volvulus causing bowel obstruction in an adult with chilaiditi 's syndrome has been reported only eleven times in the world literature. we describe the twelfth such case and believe this is the first reported case associated with adult malrotation. a previously fit and well 18-year - old man presented as an emergency with severe central colicky abdominal pain and vomiting. the severe pain settled quickly but he continued to have intermittent discomfort and vomiting. he had previously undergone repair of gastroschisis as a neonate and he reported that he had malrotation of his intestines. on clinical examination, his abdomen was mildly tender without guarding or rigidity and his full blood count, electrolytes and amylase level were normal. an erect chest radiograph revealed the presence of gas under the right hemidiaphragm suggesting the possibility of chilaiditi 's syndrome. subsequent ct scanning demonstrated volvulus of the colon corresponding to the splenic flexure overlying the liver but no evidence of ischaemia (figs. 1 and 2). laparotomy was undertaken and the patient was found to have extensive adhesions from his previous gastroschisis repair. having freed some of the upper abdominal adhesions it became apparent that the splenic flexure which had undergone volvulus in the right subdiaphragmatic space was trapped by the taut inferior aspect of the falciform ligament. the ligament had to be divided to free the herniated colon and only then was it possible to untwist the volvulus. during the dissection, the colon became very distended and it was unclear as to the exact lie of the intestines. therefore, the remainder of the abdominal adhesions were freed until the colon was fully mobilized and the anatomy became clear. the small intestines were confirmed to be on the right side of the abdomen with the caecum in the left iliac fossa. having freed all adhesions the caecum was placed in the right iliac fossa restoring normal colonic anatomy. due to massive colonic distention it was not possible to return the colon to the abdominal cavity in order to close the abdominal wall. therefore, an appendicectomy was performed with a tube caecostomy placed via the appendix stump to decompress the colon. the caecostomy tube was a size 24 foley catheter and was secured with 20 ml of saline in the balloon and a pursestring suture of 3/0 polydioxanone. successful colonic decompression resulted, fixing the caecum in the correct position and enabling abdominal closure. postoperatively, he developed an ileus for a few days and a ct scan was undertaken to confirm that there was no evidence of intestinal ischaemia or abscess around the caecostomy tube. he subsequently made an uneventful recovery and the caecostomy tube was removed after ten days. he was reviewed at six weeks and six months postoperatively and was found to be asymptomatic on both occasions. this is only the twelfth reported case of chilaiditi 's syndrome with colonic volvulus and is the first reported case with intestinal malrotation. two of these cases were reported in foreign languages and one case was in a child. the initial presentation was nonspecific and it was not immediately apparent that he would require surgery. ct scanning confirmed the presence of a closed loop obstruction due to splenic flexure volvulus beneath the falciform ligament along with the presence of intestinal malrotation. in the absence of colonic volvulus, chilaiditi 's syndrome may be successfully treated by conservative means including intravenous fluid hydration. however, the presence of volvulus necessitated laparotomy during which the herniated colon was found to be trapped beneath the falciform ligament. falciform ligament hernias have previously been described and may contain small or large bowel though usually through a defect in the ligament. this case was unusual in that the hepatodiaphragmatic interposition contained splenic flexure as opposed to transverse colon or sigmoid colon. this was a consequence of the intestines rotating only 90 deg during foetal development placing the caecum in the left iliac fossa to the left of the small intestine enabling the splenic flexure to gain access to the right subdiaphragmatic space. this degree of rotation is termed nonrotation of the intestines as opposed to incomplete rotation and is technically a misnomer. having freed the volvulus, the distended colon could not be returned to the peritoneal cavity. a decision was taken to free all adhesions, identify the anatomy fully and undertake anatomical correction of the malrotation. this enabled decompression of the colon via a caecostomy tube in the right iliac fossa. in children, after full colonic mobilization it was a simple matter to place the caecum in the right iliac fossa restoring the normal colonic configuration. furthermore, this manoeuvre ensured that the colon would be prevented from recurrent herniation into the subdiaphragmatic space. in nine of the previously reported cases of chilaiditi 's syndrome with colonic volvulus, treatment was by partial colonic resection three of these patients underwent stoma formation and there was one mortality from anastomotic leak following primary anastomosis. in this case, we judged that in the absence of ischaemia, colonic resection would have been excessive and unnecessary. in summary, we describe a rare and challenging case of colonic volvulus in an adult with chilaiditi 's syndrome. extensive adhesions from a previous gastroschisis repair and the presence of malrotation added to the complexity of the case. there can be no consensus from the literature as to how to manage such a rare problem. however, we suggest that reduction of the volvulus, anatomical correction of the malrotation and fixation of the caecum by tube caecostomy is an acceptable alternative to colonic resection in the absence of intestinal ischaemia. written informed consent was obtained from the patient for publication of this case report and accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal on request. anwen williams : assisting surgeon and subsequently writing of the case and reviewing the literature. alan woodward : lead surgeon and editing the paper.key learning pointsct is essential in diagnosis and management of our case.colonic resection stoma formation is unnecessary in absence of ischaemia.anatomical correction of the malrotation is acceptable in adults. ct is essential in diagnosis and management of our case.colonic resection stoma formation is unnecessary in absence of ischaemia.anatomical correction of the malrotation is acceptable in adults.	introductionchilaiditi 's syndrome (symptomatic hepatodiaphragmatic interposition of the colon) is an exceptionally rare cause of bowel obstruction and may present difficulty in diagnosis and management. this is the first reported case of colonic volvulus occurring in chilaiditi 's syndrome in association with intestinal malrotation and this case study describes its successful management.presentation of casean 18 year old male presented as an emergency with vague abdominal pain and a past history of gastroschisis repair with intestinal malrotation. ct scanning showed a closed loop obstruction due to a volvulus of the colon herniating under the falciform ligament. the patient was successfully treated by surgical reduction of the hernia, anatomical correction of the malrotation and caecopexy with a tube caecostomy. at six month follow up the patient was well and asymptomatic.discussionin nine of the previously reported cases of chilaiditi 's syndrome with colonic volvulus, treatment was by partial colonic resection of which a third underwent stoma formation. one patient died as a consequence of anastomotic leak following primary anastomosis. we therefore suggest an alternative approach to management.conclusionchilaiditi's syndrome with colonic volvulus in association with intestinal malrotation has not previously been described. as there is no consensus in the literature as to how to manage such a case we suggest that reduction of the volvulus, anatomical correction of the malrotation and fixation of the caecum by tube caecostomy results in a successful outcome. this approach avoids the need for colonic resection and possible stoma formation.
there is a tendency to claim that our imaginations are limited in addressing the age - old question, are we alone in the universe ? that life - forms elsewhere, if indeed they exist at all, would have characteristics outside our own limited biochemical repertoire is a popular trope of science fiction. a good example of the hypothesis that the parameter space for the structure of life is wide is a collection of hypothetical organisms on other planets in our solar system as depicted in the atlas of our universe (gallant, 1986). one such organism, the oucher - pouchers, live on venus and are essentially bags of gas. they bounce around on the surface of the planet, propelling themselves from one location to the next. the surface is hot (460c), and so each time they bounce onto the rocks, they let out an excruciated noise that sounds like ouch. they gather their bioessential elements from rocks (sometimes feasting on the rare remains of old soviet landers), and they have biochemical systems adapted to making a living on venus in the absence of liquid water. the underlying hypothesis behind these creatures is that biochemistry will simply adapt to any planetary conditions it encounters. however, from the subatomic to the macroscopic scale, life on earth exhibits general characteristics that one can argue are universal. this hypothesis that the architecture of life at all scales is limited is the one i suggest here. for example, it predicts that venus is lifeless because there is no liquid water on the surface to act as a solvent for biochemistry. spacecraft observations, albeit limited (e.g., figure 1) are currently consistent with this prediction, at least with respect to potentially observable multicellular life. this is one datum point, and a countervailing argument could be that venus is an end - member example of a completely uninhabitable environment. however, i suggest that if it is an end member, it is part of a data set that shows the limited range of potentialities for life. the observations of other planetary bodies in our solar system (one of which, mars, is less extreme than venus and yet does not appear to have present - day multicellular life either) do not currently refute this view. the surface of venus appears dead to multicellular life (e.g., as imaged by venera 13 and 14 in 1982), as we would predict based on the requirements of terrestrial life. there is as yet no evidence for organisms using entirely novel biochemistries adapted to this environment. one of the most fundamental processes that life must be able to carry out is the acquisition of free energy from the environment to repair, grow, and reproduce in other words, to maintain itself out of equilibrium with entropic processes that would tend to dismantle it. on earth, to acquire energy, cells move electrons through a membrane from an electron donor or free electrons to an electron acceptor, in the process pumping protons (or in some cases, na ions ; skulachev, 1991) across a membrane to generate the motive force that is used to produce the energy - containing molecule adenosine triphosphate (mitchell, 1961). it is not inconceivable that electrons might be replaced by something else, but the use of electron donors and acceptors links energy production in life to a variety of widely available compounds from organic carbon to minerals in the planetary crust, such as iron and sulfur. under the process of environmental selection, there is an enormous adaptability to be had in using electrons to drive proton (or other) gradients. life - forms that can use electron donors and acceptors as the basis of energy acquisition are likely to persist and proliferate on rocky planets in a wide diversity of habitats. the use of starlight (bryant and frigaard, 2006) to drive biochemistry (phototrophy) is also likely to be a universally successful way to gather energy (a process that itself involves energizing electrons), although many electron donors and acceptors provide independence from the need for starlight (hoehler and jrgensen, 2013). one could reasonably hypothesize that the use of the free energy available in subatomic particles (electrons) has a universal logic about it on account of the wide availability of electrons in the universe. at the atomic level, the element used for assembling most compounds in terrestrial life (carbon) and much of the biochemistry that comes from it are probably universal (pace, 2001). carbon is versatile in building chains and rings and generating millions of permutations of compounds from which one can build life (cockell, 2015). science fiction writers have speculated about another element in group 14 of the periodic table however, they forget that experiments in silicon chemistry have been occurring on the earth since it formed. a problem is that silicon, when brought into combination with oxygen, which is also a cosmically common element, has a tendency to form a huge variety of silicates (liebau, 1985) that make rocks. if you have visited a good geology museum, you will know that there is a quite dizzying array of silicate minerals that in a crude way reflect the vast number of carbon compounds. our planet and others show that silicon is the stuff of planetary geological diversity, not biochemical diversity. a large variety of carbon compounds have been found in the interstellar medium (mcbride., 2013). the monomers of the four major classes of biological macromolecules amino acids, components of lipids, nucleobases, and individual sugars have been found in carbon - rich meteorites (sephton, 2002 ; martins., 2008), formed in the protoplanetary disk from which our solar system emerged (marty., 2013). although it would be inviting trouble to completely rule out some specific chemical conditions in or on a planet somewhere in the universe that might produce life that uses a different element, biochemical and, more recently, astrochemical information show that the use of carbon compounds to build living matter seems unsurprising. the solvent used for carrying out cellular reactions water like carbon, is abundant across the known universe (mottl., 2007). when rocky planets form around stars, they, like earth, have a tendency to condense large quantities of liquid water. this solvent has many of the characteristics useful for doing chemical reactions (it dissolves polar and small nonpolar compounds), it has a broad temperature range as a liquid that corresponds to the temperature conditions within, and in some cases on, planetary surfaces, and it is universally available. suggested alternatives such as ammonia can not be completely ruled out, but the chemical characteristics of water and the more recent confirmation of its vast cosmic abundance make its use in life again perhaps unsurprising and probably common, maybe ubiquitous, if life exists elsewhere. the molecules that are responsible for implementing the processes occurring in life, such as energy acquisition, can probably be constructed in a variety of ways. for example, the information storage system might be assembled alternately from the one we know on earth, even using the same building blocks. a genetic code that has a three - base codon but only uses three nucleobases would still, with 27 combinations, allow for 20 amino acids and start and stop codons, albeit with less degeneracy than our code. the replacement of nucleobases in natural dna with alternatives has allowed for the artificial creation of cells with different genetic codes (malyshev., 2014), although in this case, the sugar phosphate backbone and the fundamental way in which this code is read are maintained. for proteins, in principle, there seems no reason why some of the 20 primary amino acids in life might not be replaced by some of the very large number of alternatives that exist in nature, such as in meteorites (> 60 amino acids have been found in certain carbonaceous meteorites). it would be naive to suggest that the detailed molecular arrangements in biomolecules must be universal and in this we might find variety however, for reactions to be carried out in enzymes, there are biophysically optimal arrangements of charges in active sites that allow for electrons to be transferred and chemical reactions to be carried out. like the extraordinary diversity of chassis that surround the otherwise globally similar internal combustion engine, biochemistry allows for variety, but at its core, it is constrained by the functions it must perform. at the next hierarchical level of biology, the cell, we might suggest that compartmentalization through cellular structures is fundamental. a membrane concentrates solutes and macromolecules sufficiently to bring them into contact with each other and allow reactions within a controlled chemical environmental (martin and russell, 2003). a semipermeable structure to hold in molecules but allow communication with the outside environment seems a universal solution to the problem of chemical dilution. cell compartmentalization allows for constancy in the biochemical environment in otherwise physically and chemically diverse environments. it is therefore successful with respect to the capacity for cells to colonize a large number of environments across and within a planet. viruses, a potential noncellular alternative, have no cellular structure, but they are generally biologically inert until they can be activated within the milieu of a fluid. moving from the cell to higher levels of organization, there remains a universal logic. how can individual cells cooperate to be more successful in reproducing and thus resulting in a planet harboring life over geological timescales ? either the cells interact as free - living organisms like many of the multicellular traits in bacteria (shapiro, 1998), or they cooperate to such a degree that they differentiate (merely a form of division of labor), leading to that branch of life we call multi - cellular (but which is distinguished from the multicellular behaviors of microorganisms by true cellular differentiation). the form into which these multicellular organisms are molded by evolution is limited by physics. to exist in the ocean, flying organisms range from a 0.15-mm - sized fairyfly, the smallest winged insect, to the 20-m wingspan of the extinct pterodactyl, quetzalcoatlus. however, convergent evolution (conway - morris, 2005), driven by physical requirements, limits the true scope of the unlimited possibilities at the macroscopic scale beloved of science fiction writers. at the scale of the populations of organisms, the organization of biology follows simple rules. this is the process of darwinian evolution (darwin, 1859), and although one can argue about the minutiae of microevolutionary and macroevolutionary biology, the basic idea that the environment selects successful organisms, which then go on to reproduce, resulting in evolution in response to changing planetary conditions, would seem to be applicable to any planet with life - forms that have finite lifespans living in environments that change. as some of these organisms get isolated or separated, different environments in which they live will cause speciation. the long - term result of this emerging complexity as a biosphere develops is the linnaean system of hierarchy, in which a given organism has relatives that can be identified in larger groupings with common ancestors. on earth, this hierarchy can be quantified using phylogenetic trees (delsuc., 2005) an example is horizontal gene transfer, which blurs the clarity of the vertical transmission of information from one generation to the next. however, emerging complexity leading to hierarchies of organisms that share common ancestors is likely to be a universal characteristic of life. we can expect phylogenetic trees (or their alien equivalent, whatever the biochemical nature of information storage) to exist on other planets. even the behavior of populations of organisms is likely to be guided by principles that can be applied universally. the developing branch of physics called active matter investigates the interactions of particles (or organisms, as is the case here) under nonequilibrium conditions. it is increasingly being applied to cellular and organismal systems when bacteria swarm or starlings flock, for instance. models can predict optimal bird flocking behaviors that fit with observation (chazelle, 2014). if we could ever observe the murmurations of flying creatures in the skies of an alien world, the patterns they exhibit would probably be similar, or at least governed by the same rules, that we will have elaborated for the behavior of populations of organisms on earth. the processes carried out by, and the general features of, life on earth are probably universal. the movement of subatomic particles to generate energy through to the taxonomic hierarchies of life seem to be the product of the constraints of physics, biochemistry, emergent complexity, and the astrophysical abundances of compounds. alien biospheres, if they exist, are likely, across the hierarchy of biological architecture, from the subatomic to the population level, to mirror much of the fundamental features of terrestrial biology.	is the hypothesis correct that if life exists elsewhere in the universe, it would have forms and structures unlike anything we could imagine ? from the subatomic level in cellular energy acquisition to the assembly and even behavior of organisms at the scale of populations, life on earth exhibits characteristics that suggest it is a universal norm for life at all levels of hierarchy. these patterns emerge from physical and biochemical limitations. their potentially universal nature is supported by recent data on the astrophysical abundance and availability of carbon compounds and water. within these constraints, biochemical and biological variation is certainly possible, but it is limited. if life exists elsewhere, life on earth, rather than being a contingent product of one specific experiment in biological evolution, is likely to reflect common patterns for the assembly of living matter.
from 1984 to 2006, 105 patients received operations for congenital hyperinsulinism at hpital necker enfants malades and were followed over the long term (table 1). the first symptoms occurred in 87 neonates (3 syndromic or hyperammonemic hyperinsulinisms and atypical histological forms of hyperinsulinism were not included in the study. in most patients, the distinction between diffuse and focal hyperinsulinism was based on transhepatic portal catheterization (11,15) or on results of a positron emission tomography scan with [f]fluoro - l - dopa (13). characteristics of 105 children who underwent near - total or partial elective pancreatectomy for congenital hyperinsulinism surgery was indicated in all patients with a focal form and in those with a diffused form of congenital hyperinsulinism that resisted medical treatments where resection was always identical. for the children who required a second surgery (persistent hypoglycemia), the evaluation of follow - up started from the second intervention. during surgery, biopsies were taken in various areas of the pancreas and analyzed extemporaneously to confirm the form, localize the focal lesion, and determine the extent of the pancreatectomy (8,18,19). for focal lesions, surgery was limited to the head of the pancreas in 13 patients, the body in 6, and the tail in 5 ; the head and body of the pancreas in 4 patients, the head and tail in 4, and the body and tail in 4 ; and two - thirds of the pancreas in 3 (not specified in 3 cases). if a sample was taken, pancreatic dna was extracted to search for the specific loss of allele in the 11p15 region in the focal lesion. when samples were available, mutations of the abcc8, kcnj11, and the glucokinase genes were searched for on blood leukocytes of the patients and their parents, using pcr and direct sequencing (table 1). glucose metabolism and insulin secretion were evaluated immediately after surgery and then periodically for a mean duration of 6.3 2.1 years (range 119) in the diffuse forms and 2.6 4.1 years (017) in the focal forms. the following tests were used : hba1c, plasma glucose, insulin and c - peptide concentrations over 24 h (before and after each meal and at 0 and 4 h ; 168 24-h cycles in 49 children with diffuse and 67 cycles in 39 children with focal congenital hyperinsulinism), oral glucose tolerance test (ogtt) (77 tests in 23 children with diffuse and 50 in 27 children with focal congenital hyperinsulinism), and intravenous glucose tolerance test (ivgtt) (41 tests in 15 children with diffuse and 21 in 11 children with focal congenital hyperinsulinism). hyperglycemia was defined as an abnormal ogtt (world health organization criteria), a plasma glucose level > 11 mmol / l during the 24-h cycle, or hba1c insulin treatment was generally initiated based on two main criteria : permanent hyperglycemia (pre- and postprandial) and elevated hba1c (> 7%). plasma glucose was measured by a glucose oxidase technique and plasma insulin by radioimmunoassay (bi - insulin irma ciis - bio international ; gif - sur - yvette, france). hba1c was determined by high - pressure liquid chromatography (tosoh bioscience a1c 2.2) (national glycohemoglobin standardization program : normal values 4.25.6%). insulin secretion indices were computed as the ratios of area under the curve (auc)insulin to aucglucose and of insulin300 min to glucose30 min during ogtt and as the sum of insulin levels at 1 and 3 during ivgtt (20).. homeostasis model assessment (homa) indices of -cell function and insulin sensitivity were computed from baseline fasting levels of glucose and insulin and expressed as percentage of average values found in young fit subjects (22). the evolution of hypoglycemia and hyperglycemia or initiation of insulin treatment was estimated using kaplan given the small variations in the age of surgery, it was considered more appropriate to present these results in relation to age rather than time after surgery. average values of glycemic control, glucose tolerance, insulin secretion, and insulin sensitivity throughout the follow - up were compared between children with focal or diffuse forms of congenital hyperinsulinism. to take into account that a different number of tests was performed in different individuals and in order to use all the available data to maximize results, we compared data between groups as standard least squares computed in mixed regression models with random effects, including as covariables sex, the duration of follow - up when the parameter was measured, and the subject identification number. statistics were performed with jmp software (sas institute, inc., cary, nc). the evolution of hypoglycemia and hyperglycemia or initiation of insulin treatment was estimated using kaplan meier analysis. given the small variations in the age of surgery, it was considered more appropriate to present these results in relation to age rather than time after surgery. average values of glycemic control, glucose tolerance, insulin secretion, and insulin sensitivity throughout the follow - up were compared between children with focal or diffuse forms of congenital hyperinsulinism. to take into account that a different number of tests was performed in different individuals and in order to use all the available data to maximize results, we compared data between groups as standard least squares computed in mixed regression models with random effects, including as covariables sex, the duration of follow - up when the parameter was measured, and the subject identification number. statistics were performed with jmp software (sas institute, inc., cary, nc). among 47 children who underwent operations for focal congenital hyperinsulinism, none received any antidiabetes treatment. four children presented persisting but asymptomatic hypoglycemias (three neonatal and one infant form) during the 24-h cycles immediately after surgery. in only one case, asymptomatic hypoglycemias were also found at the age of 4 years, but this patient showed no abnormalities at 3 or 5 years of age. as for hyperglycemia, minor and transitory anomalies were found. a child had a plasma glucose of 8.8 mmol / l at 120 min of the ogtt at age 4 years, but the ogtt was normal at age 6 years. mmol / l at 30 or 60 min of ogtts postoperatively and at 2, 4, and 10 years of age, but they showed normal 24-h glucose cycles and no abnormalities at all other ages. in these five patients, hba1c remained in normal range for the whole duration of the follow - up. of 58 children who underwent near - total pancreatectomy for diffuse congenital hyperinsulinism, 59% were still suffering from hypoglycemias immediately after surgery (after first surgery, 48 children ; after second surgery, 10 children). however, hypoglycemias did not have the severity of those before surgery and they occurred principally in the preprandial periods, especially at the end of the night. they could be controlled by dietetic adjustments (raw corn starch at bedtime in 16 children) and medical treatments (in 15 patients : diazoxide in 10, octreotide in 6, oral steroids in 11, and nifedipine in 2 and diazoxide - octreotide, diazoxide - steroids, octreotide - steroids, or diazoxide - nifedipine in 23 patients each). the incidence of hypoglycemia decreased slowly, in some cases persisting until 5 years of age (fig. 1). cumulative incidence of hypoglycemia (), hyperglycemia (), association hypohyperglycemia (), and insulin therapy () in 58 patients pancreatectomized for diffuse congenital hyperinsulinism. patients with both hypo- and hyperglycemia are a subset of both hypo- and hyperglycemia groups. a very peculiar and unusual situation was observed in 19 patients who presented fasting persisting hypoglycemia (value 11 mmol / l on the 24-h cycle or impaired glucose tolerance or diabetes at the ogtt). this association, in 35% of the children after surgery, could persist until 5 years of age (fig. one - half of the patients (53%) with diffuse congenital hyperinsulinism presented with hyperglycemia in the days after surgery. the incidence of hyperglycemia increased regularly with age, reaching 100% at the age of 13 years (fig. the incidence of insulin therapy increased from 19% postoperatively to 42% at 8 years and then more rapidly to reach 91% at 14 years of age. however, it does not depict the great variability of the postoperative progression toward definitive need for insulin in the 33 treated patients. insulin therapy was started immediately after surgery and definitively (follow - up 5.4 3.8 years [range 0.511 ]) in eight children. it was initiated after a delay, between 5 months after surgery and 14.8 years of age (age 8.4 4.2 years), and definitively in 13 patients (fig. 2). for the last 12 patients, the evolution was more erratic. five patients required insulin immediately after surgery but for a short period of time (116 days) ; four of these five children remained hyperglycemic but untreated (follow - up 5.5 4.1 years [111 ]), while the last one did not show any abnormality in glucose tolerance up to 6 years of age. four patients received insulin immediately after surgery for a longer period of time, 221 months (fig. 2), but it had to be interrupted for recurrent hypoglycemia ; the first three remained hyperglycemic but untreated until 13 years of age, while the fourth again received insulin when 9 years old. for the last three patients, insulin was started several months after surgery, but it had to be stopped after 811 months for recurrent hypoglycemia ; one child remained untreated until 7.9 years of age, while two were again treated with insulin before 6 years of age. illustration of changes over time of insulin requirements in 20 of the 33 patients pancreatectomized for diffuse congenital hyperinsulinism. the other patients are not presented : eight with insulin immediately after surgery and definitively, with no insulin treatment (including five who received insulin immediately after surgery for 116 days). dark bars, time of insulin therapy ; gray bars, time of follow - up, with hyperglycemia but without insulin. plasma insulin was significantly higher in the diffuse than in the focal forms, and this was associated with slightly lower plasma glucose values. by contrast, all indices of glucose - stimulated insulin secretion were significantly lower, which was associated with postprandial (or postglucose) hyperglycemia in the diffuse forms. indices of insulin sensitivity did not differ between the two forms (table 2). insulin secretion and sensitivity in children who underwent near - total or partial elective pancreatectomy for congenital hyperinsulinism comparisons were made between results of the ogtt, the 24-h glucose cycle, and hba1c in the evaluation of the metabolic status in diffuse hyperinsulinism, when at least two tests were performed on the same day : 72 pairs with ogtt and hba1c, 95 with the 24-h cycle and hba1c, and 56 with ogtt and the 24-h cycle. when the ogtt was normal, the other tests were also normal in most cases. when the ogtt showed criteria of diabetes, hyperglycemia was also found during the 24-h cycle in 81% of the patients and an hba1c > 5.6% in 58% of the patients. with criteria of impaired glucose tolerance at the ogtt, hyperglycemia was found in 18% and an hba1c > 5.6% in 36% of the patients. when the 24-h cycle showed hyperglycemia, hba1c was > 5.6% in 56% of the patients. relative to that of the ogtt, the sensitivity of the 24-h glucose cycle was greater than that of hba1c (81 vs. 58%, respectively) for diabetes criteria, but it was very low with both tests (18 and 36%) for impaired glucose tolerance. the specificity varied from 69% (hba1c) to 80% (24-h cycle) for diabetes and from 79 to 75% for impaired glucose tolerance. among 47 children who underwent operations for focal congenital hyperinsulinism, none received any antidiabetes treatment. four children presented persisting but asymptomatic hypoglycemias (three neonatal and one infant form) during the 24-h cycles immediately after surgery. in only one case, asymptomatic hypoglycemias were also found at the age of 4 years, but this patient showed no abnormalities at 3 or 5 years of age. as for hyperglycemia, minor and transitory anomalies were found. a child had a plasma glucose of 8.8 mmol / l at 120 min of the ogtt at age 4 years, but the ogtt was normal at age 6 years. mmol / l at 30 or 60 min of ogtts postoperatively and at 2, 4, and 10 years of age, but they showed normal 24-h glucose cycles and no abnormalities at all other ages. in these five patients, hba1c remained in normal range for the whole duration of the follow - up. of 58 children who underwent near - total pancreatectomy for diffuse congenital hyperinsulinism, 59% were still suffering from hypoglycemias immediately after surgery (after first surgery, 48 children ; after second surgery, 10 children). however, hypoglycemias did not have the severity of those before surgery and they occurred principally in the preprandial periods, especially at the end of the night. they could be controlled by dietetic adjustments (raw corn starch at bedtime in 16 children) and medical treatments (in 15 patients : diazoxide in 10, octreotide in 6, oral steroids in 11, and nifedipine in 2 and diazoxide - octreotide, diazoxide - steroids, octreotide - steroids, or diazoxide - nifedipine in 23 patients each). the incidence of hypoglycemia decreased slowly, in some cases persisting until 5 years of age (fig. 1). cumulative incidence of hypoglycemia (), hyperglycemia (), association hypohyperglycemia (), and insulin therapy () in 58 patients pancreatectomized for diffuse congenital hyperinsulinism. patients with both hypo- and hyperglycemia are a subset of both hypo- and hyperglycemia groups. a very peculiar and unusual situation was observed in 19 patients who presented fasting persisting hypoglycemia (value 11 mmol / l on the 24-h cycle or impaired glucose tolerance or diabetes at the ogtt). this association, in 35% of the children after surgery, could persist until 5 years of age (fig. one - half of the patients (53%) with diffuse congenital hyperinsulinism presented with hyperglycemia in the days after surgery. the incidence of hyperglycemia increased regularly with age, reaching 100% at the age of 13 years (fig. the incidence of insulin therapy increased from 19% postoperatively to 42% at 8 years and then more rapidly to reach 91% at 14 years of age. however, it does not depict the great variability of the postoperative progression toward definitive need for insulin in the 33 treated patients. insulin therapy was started immediately after surgery and definitively (follow - up 5.4 3.8 years [range 0.511 ]) in eight children. it was initiated after a delay, between 5 months after surgery and 14.8 years of age (age 8.4 4.2 years), and definitively in 13 patients (fig. 2). for the last 12 patients, the evolution was more erratic. five patients required insulin immediately after surgery but for a short period of time (116 days) ; four of these five children remained hyperglycemic but untreated (follow - up 5.5 4.1 years [111 ]), while the last one did not show any abnormality in glucose tolerance up to 6 years of age. four patients received insulin immediately after surgery for a longer period of time, 221 months (fig. 2), but it had to be interrupted for recurrent hypoglycemia ; the first three remained hyperglycemic but untreated until 13 years of age, while the fourth again received insulin when 9 years old. for the last three patients, insulin was started several months after surgery, but it had to be stopped after 811 months for recurrent hypoglycemia ; one child remained untreated until 7.9 years of age, while two were again treated with insulin before 6 years of age. illustration of changes over time of insulin requirements in 20 of the 33 patients pancreatectomized for diffuse congenital hyperinsulinism. the other patients are not presented : eight with insulin immediately after surgery and definitively, with no insulin treatment (including five who received insulin immediately after surgery for 116 days). dark bars, time of insulin therapy ; gray bars, time of follow - up, with hyperglycemia but without insulin. in the fasting state, plasma insulin was significantly higher in the diffuse than in the focal forms, and this was associated with slightly lower plasma glucose values. by contrast, all indices of glucose - stimulated insulin secretion were significantly lower, which was associated with postprandial (or postglucose) hyperglycemia in the diffuse forms. indices of insulin sensitivity did not differ between the two forms (table 2). insulin secretion and sensitivity in children who underwent near - total or partial elective pancreatectomy for congenital hyperinsulinism comparisons were made between results of the ogtt, the 24-h glucose cycle, and hba1c in the evaluation of the metabolic status in diffuse hyperinsulinism, when at least two tests were performed on the same day : 72 pairs with ogtt and hba1c, 95 with the 24-h cycle and hba1c, and 56 with ogtt and the 24-h cycle. when the ogtt was normal, the other tests were also normal in most cases. when the ogtt showed criteria of diabetes, hyperglycemia was also found during the 24-h cycle in 81% of the patients and an hba1c > 5.6% in 58% of the patients. with criteria of impaired glucose tolerance at the ogtt, hyperglycemia was found in 18% and an hba1c > 5.6% in 36% of the patients. when the 24-h cycle showed hyperglycemia, hba1c was > 5.6% in 56% of the patients. relative to that of the ogtt, the sensitivity of the 24-h glucose cycle was greater than that of hba1c (81 vs. 58%, respectively) for diabetes criteria, but it was very low with both tests (18 and 36%) for impaired glucose tolerance. the specificity varied from 69% (hba1c) to 80% (24-h cycle) for diabetes and from 79 to 75% for impaired glucose tolerance. the aim of this work was to extend the description of the metabolic evolution of patients who were pancreatectomized for congenital hyperinsulinism. we previously reported the general evolution of 52 neonatal forms of congenital hyperinsulinism after near - total or partial elective pancreatectomy (15). the greater number of patients followed for a longer period of time after surgical treatment based on well - identified lesions makes these updated results of interest. the present results illustrate the dramatic contrast in metabolic outcome between the two forms of congenital hyperinsulinism. the follow - up of 47 focal forms of hyperinsulinism strongly confirms that the children who underwent partial elective pancreatectomy were cured of hypoglycemia. our previous results and those of other teams led to a 2000 european consensus on the management of persistent congenital hyperinsulinism, which recommended a conservative surgical attitude in the focal forms (1). the development of the positron emission tomography scan with [f]fluoro - l - dopa (23), a less invasive alternative to the transhepatic pancreatic catheterization, should help to generalize these recommendations and prevent patients from undergoing an unnecessary extended pancreatectomy leading to a progression toward insulin - dependent diabetes. however, one must keep in mind that the existence of rare multifocal and complex focal forms (23) of hyperinsulinism justifies the systematic and regular evaluation of the surgery - treated patients until complete disappearance of hypoglycemia. even in the present series, two patients required a second surgery because all the hypersecreting hyperplasia had not been resected. in contrast, although the rare and mild hyperglycemia observed during follow - up in some patients did not show any predictive value of later deterioration of the metabolic status, the ablation of a limited but significant part of the pancreas could add to later aggravating factors, such as pregnancy, obesity, or aging, and confer on these subjects a risk of developing long - term anomalies in glucose tolerance. a regular and long - term follow - up, with periodic evaluation of glucose tolerance, is thus strongly recommended for these patients. for the 58 operated diffuse forms, the cumulative incidence of hyperglycemia was 100% at 13 years of age and the incidence of insulin therapy reached 91% a year later. as opposed to this inevitable evolution, the very slow progression toward insulin - requiring diabetes is astonishing, such as the case of one 19-year - old patient, who was free of insulin with normal hba1c and ogtt after a 95% pancreatectomy in the first months of life. indeed, this study clearly shows that postoperative evolution is unpredictable and sometimes complex, with a recurrence of both hypo- and hyperglycemia. these characteristics are noteworthy, as they may seem unexpected in view of the extent of the pancreatic resection, but also unusual compared with what is known of the development of any other type of diabetes. whatever the variability of this evolution, the final result is insulin therapy that was started before puberty in more than one - half of the cases. these results thus confirm previous reports in the literature, with 3340% of recurrent hypoglycemia risk, and the risk of being treated with insulin was estimated to be between 14 and 69% in studies enrolling enough patients to appreciate the incidence of this complication (4,5,16). however, they allow a nice detailed description of this evolution based on a clear definition of the histological form of the disease. such unpredictable evolution toward diabetes seems to reflect the persistent abnormal function of the pancreatic residual tissue and, indeed, renders even more complex the postoperative metabolic evaluation of the patients. pancreatic endocrine function of these patients, using metabolic tests, has previously been evaluated in one study, showing the altered but variable insulin response to an ivgtt and its poor correlation with later evolution (24). results in our patients illustrate that in some cases, the dramatic reduction of -cell mass can not compensate for the excessive insulin secretion of the remaining cells. remarkably, dysfunction of the residual pancreatic tissue associates in most cases an excessive fasting secretion as a sequel of the -cells dysfunction and an expected lower insulin secretory capacity in response to glucose as a sequel of the extended resection. this clearly explains the very novel association of fasting hypoglycemia and postprandial hyperglycemia observed in a number of these patients in the early years after surgery. some authors have suggested that mutation of the atp - dependent k channels could increase -cell apoptosis (25). however, the few data available report a lower incidence of diabetes in adulthood in diffuse congenital hyperinsulinism medically treated than that reported here. if involution of the -cells in the remaining tissue of the patients could contribute to the progressive decline of insulin secretion and the development of diabetes, the removal of 95% of the pancreas is the most probable cause of developing diabetes. these results also have implications for the various tests used to follow the patients (1). the 24-h glucose cycle is necessary to screen for hypoglycemia and must thus be used in all focal and diffuse forms as long as there is no certainty that there is no more risk of hypoglycemia. this is generally the case during the first months in the focal forms the time to make sure that there is not a rare complex or multifocal form. this can last up to 5 years in the diffuse forms at an annual or biannual rate. for hyperglycemia, the ogtt remains the most sensitive test to detect early impairment of glucose tolerance and should be done every year starting the year after surgery. during ogtt, plasma insulin and glucose measurements at 30 and 60 min of the ogtt are not informative and can be omitted, as they have shown little impact for the detection of impaired glucose tolerance. ivgtt is not recommended during the follow - up, as it does not provide any pertinent supplemental information. hba1c is of less interest for screening but becomes important when the patients reach the state of diabetes for the decision to start insulin therapy. in conclusion, hypoglycemia due to focal forms of congenital hyperinsulinism is cured after partial elective pancreatectomy, but the dramatic outcome of the diffuse forms illustrates the urgent need for progress in medical treatment to reduce the surgical indications and prevent these patients from a high risk of insulin - dependent diabetes in childhood and adolescence.	objectiveto describe the long - term metabolic outcome of children with congenital hyperinsulinism after near - total or partial elective pancreatectomy.research design and methodspatients (n = 105 : 58 diffuse and 47 focal congenital hyperinsulinism) received operations between 1984 and 2006. follow - up consisted of periodic measurements of pre- and postprandial plasma glucose over 24 h, ogtt, and ivgtt. cumulative incidence of hypo- or hyperglycemia / insulin treatment was estimated by kaplan - meier analysis.resultsafter near - total pancreatectomy, 59% of children with diffuse congenital hyperinsulinism still presented mild or asymptomatic hypoglycemia that responded to medical treatments and disappeared within 5 years. one - third of the patients had both preprandial hypoglycemia and postprandial hyperglycemia. hyperglycemia was found in 53% of the patients immediately after surgery ; its incidence increased regularly to 100% at 13 years. the cumulative incidence of insulin - treated patients was 42% at 8 years and reached 91% at 14 years, but the progression to insulin dependence was very variable among the patients. plasma insulin responses to ivgtt and ogtt correlated well with glycemic alterations. in focal congenital hyperinsulinism, hypoglycemia or hyperglycemia were rare, mild, and transient.conclusionspatients with focal congenital hyperinsulinism are cured of hypoglycemia after limited surgery, while the outcome of diffuse congenital hyperinsulinism is very variable after near - total pancreatectomy. the incidence of insulin - dependent diabetes is very high in early adolescence.
the malaria parasites are maintained as a source of reservoir in these conditions and help in transmission in the community. it is not only helpful in decreasing the morbidity and mortality but also prevents the transmission. microscopy of peripheral blood smear and rapid diagnostic tests (rdt) detecting malarial antigen remain the main stay for malaria diagnosis. although these diagnostic modalities are quite popular in endemic countries, they have their own limitations. microscopic examination of peripheral blood smears stained with giemsa needs expertise. in addition, parasitemia below levels of microscopic detection will be falsely diagnosed as negative and continue as potential sources of disease transmission. similarly, performance level of an rdt can be affected due to varying antigen concentrations in blood and parasitemia levels due to multiple host and parasite factors. detection of plasmodium nucleic acid by pcr offers the advantage of high analytical sensitivity in terms of detecting 1 plasmodium falciparum or 3 plasmodium vivax parasites per ml of blood when conventional methods will be negative. however, the usage of pcr requires higher infrastructural support and economic restraints can be a hindrance in its implementation in routine usage in resource - limited settings. currently, the role of hemozoin (hz) pigment in malaria diagnosis is gaining attention. these pigments are released during rupture of infected erythrocytes and malaria parasites and phagocytized by the leukocytes during their life cycle. hz pigments can be easily detected under a microscope because of their typical morphology. despite the presence of various sensitive methods like quantitative buffy coat assay (qbc) and pcr for malaria diagnosis, the available literatures on hz pigment mostly use flow cytometer for its detection on routine basis. here, in this study, it was aimed to look for the role of hz pigment in the diagnosis of low parasitemic malarial conditions. we also tried to compare the performance of diagnostic methods like qbc and pcr for the detection of hz pigment in such conditions. ethical clearance was not required for this study as all the samples were routinely sent to the parasitology laboratory of microbiology department, and all the tests were performed for all the samples. all the samples were positive by immunochromatographic test (ict) detecting the ldh antigen and negative by microscopic examination of the peripheral (thin) smear by giemsa stain. these cases were defined as low parasitemic conditions as no malaria parasites were detected by microscopic examinations after 3 independent observations and positive by ict (advantage mal card, j mitra & co pvt. qbc capillary tubes were examined for presence of malaria parasites and hz pigment by all the examiners. dna was extracted from blood (50 l) using qiagen dna isolation kit following manufacturer s instructions. for nested pcr, the species - specific nucleotide sequences of 18s rrna genes of p. falciparum, and p. vivax were amplified as described previously, with slight modifications. for each 20-l reaction mixture for nest 1 amplification, 5 l of dna template (corresponding to approximately 0.25 to 0.5 l of blood) was added to reaction mixture containing 10 pmoles of each primer (rplu 1 tcaaagaataagccatgcaagtga and rplu2 taaccctgttgttgccttaaactcc), 4 mm mgcl2, pcr buffer (50 mm, kcl, 10 mm tris - hcl), 200 mm of each deoxynucleoside triphosphate, and 1.25 units of taq dna polymerase. for nest 2 assay, 1 l of nest 1 pcr product was used with 10 pmoles of respective primers in given pcr conditions. p. vivax viv f 5cgcttctagcttaatccacataactgatac3 ; vivr 5acttccaagccgaagcaaagaaagtccta-3 and p. falciparum fal f 5ttaaactggtttgggaaaaccaaatatatt-3 ; fal r acacaatgaactcaatcatgactacccgtc. dna was extracted from blood (50 l) using qiagen dna isolation kit following manufacturer s instructions. for nested pcr, the species - specific nucleotide sequences of 18s rrna genes of p. falciparum, and p. vivax were amplified as described previously, with slight modifications. for each 20-l reaction mixture for nest 1 amplification, 5 l of dna template (corresponding to approximately 0.25 to 0.5 l of blood) was added to reaction mixture containing 10 pmoles of each primer (rplu 1 tcaaagaataagccatgcaagtga and rplu2 taaccctgttgttgccttaaactcc), 4 mm mgcl2, pcr buffer (50 mm, kcl, 10 mm tris - hcl), 200 mm of each deoxynucleoside triphosphate, and 1.25 units of taq dna polymerase. for nest 2 assay, 1 l of nest 1 pcr product was used with 10 pmoles of respective primers in given pcr conditions. twenty - three out of 30 samples were detected positive for p. vivax, 4 were p. falciparum, and 3 were mixed infection showing test bands for both p. vivax and p. falciparum. twenty - five (83%) out of 30 samples were found positive by qbc either for malaria parasite or hz pigment or both in comparison to 21/30 (70%) by nested pcr. considering pcr as the gold standard for malaria diagnosis, 70% (21out of 30 samples) were considered as true positive (table 1). qbc assay was performed using fluorescent dye (acridine orange)-coated microcentrifuge capillary tube, where the blood cells are layered as per their specific gravity. the lighter cells remained towards the periphery of the capillary tube where as the heavier cells were positioned towards the cap (fig. 1). in the buffy coat area, the malarial parasites (with or without hz pigments) were found. leucocytes (e.g. neutrophils, monocytes, and macrophages) containing hz pigments were also found in this zone. according to the qbc observation, our study group was categorized into 3 different subgroups (blood samples containing both malaria parasites and hz pigment, samples showing only hz pigment, and samples without malaria parasites and hz pigment). the majority of the samples (18/25) positive by qbc showed only hz pigment. seven samples were positive for both malaria parasites and hz pigment, and 5 samples were negative for both. all the samples positive for both malaria parasites and hz pigment by qbc were found positive by nested pcr. monocytes and macrophages were the commonest leukocytes containing pigments followed by neutrophils (table 1). twenty - one out of 30 samples (70%) were found positive by nested pcr. band size 120 bp was positive for p. vivax and 220 bp for p. falciparum. all the samples with p. vivax, p. falciparum, and mixed infections were correctly identified by pcr (fig. all the samples containing malaria parasites and hz pigment were positive by pcr in comparison to only 61% of the samples containing only hz pigments positive by pcr. qbc assay was performed using fluorescent dye (acridine orange)-coated microcentrifuge capillary tube, where the blood cells are layered as per their specific gravity. the lighter cells remained towards the periphery of the capillary tube where as the heavier cells were positioned towards the cap (fig. 1). in the buffy coat area, the malarial parasites (with or without hz pigments) were found. leucocytes (e.g. neutrophils, monocytes, and macrophages) containing hz pigments were also found in this zone. according to the qbc observation, our study group was categorized into 3 different subgroups (blood samples containing both malaria parasites and hz pigment, samples showing only hz pigment, and samples without malaria parasites and hz pigment). the majority of the samples (18/25) positive by qbc showed only hz pigment. seven samples were positive for both malaria parasites and hz pigment, and 5 samples were negative for both. all the samples positive for both malaria parasites and hz pigment by qbc were found positive by nested pcr. monocytes and macrophages were the commonest leukocytes containing pigments followed by neutrophils (table 1). twenty - one out of 30 samples (70%) were found positive by nested pcr. band size 120 bp was positive for p. vivax and 220 bp for p. falciparum. all the samples with p. vivax, p. falciparum, and mixed infections were correctly identified by pcr (fig. all the samples containing malaria parasites and hz pigment were positive by pcr in comparison to only 61% of the samples containing only hz pigments positive by pcr. correct diagnosis of such conditions is highly essential as they are the mainstay of malaria transmission in community. pigment remains to be the pathognomonic biomarker of malaria pathogenesis. during the intraerythrocytic cycle, plasmodium synthesizes hz pigment by detoxifying the hemoglobin of rbcs. these pigments are formed in all parasitic stages after the early trophozoite stage and persist till the end. during the pathogenesis, the parasites (alone / within the rbc) rupture to release hz pigment into the peripheral circulation. various phagocytic cells such as monocytes, macrophages, and the phagocytic cells are unable to digest these pigments, as they are acid resistant. they persist within the phagocytic cell till the cells circulate in the blood (life span ranges from 72 - 296 hr) and finally get deposited within reticuloendothelial cells and various organs. detection of hemozoin pigment within the phagocytic cell in blood always indicates a recent malarial infection. as a pilot project, we undertook the study to test our hypothesis that detection of hemozoin pigment by qbc of peripheral blood is an alternative diagnostic modality for malaria with low parasitemia by including cases which were diagnosed as positive by rdt but were negative by microscopy of thin smear of peripheral blood. in our study, the majority of samples (defined as low parasitemic) contained only hz pigments without presence of any malarial parasite. all the above samples were negative by giemsa stain and only 70% of total samples were detected by pcr. considering pcr as a gold standard for malarial diagnosis, hz pigment detection shows a sensitivity of 85% (18/21) and a specificity of 22% (2/9). (table 2) hence, it proves that hz pigment has a certain role in the diagnosis of low parasitemic conditions. the decreased specificity could be as a result of remaining hz particle after the treatment. qbc is a better tool for detection of hz pigment in comparison to pcr. in the present study, hence, these samples were unlikely to be positive for malaria by a thick smear since the sensitivity of qbc and thick smears for parasite detection are almost similar. moreover, the focus of our study was detection of intracellular hz pigment in qbc particularly in the lymphocyte - monocyte layer of the buffy coat. since hz pigment is concentrated in the lympho - monolayer in qbc it is a more sensitive method of pigment detection than the thick smear. we also found that the overall positivity of qbc was 83% in comparison to 70% by nested pcr. some of the patients had received antimalarials outside the hospital before the start of investigations. it may be linear or non - linear, coarse or fine, and does not require any chemical stain for its detection. hz - based sensitive tools are highly desirable for the detection of low parasitemic conditions. qbc is a rapid, cost - effective, and highly sensitive tool for hz pigment detection. qbc is a much sensitive and specific technique in comparison to others because of 2 reasons. firstly, the sample is centrifuged in a very high revolution speed so that all the parasites, infected rbcs, and wbcs are concentrated in the buffy coat region. hence, a very low number of parasites can also be detected and increases its sensitivity. secondly, the tube is coated with fluorescent dye (acridine orange), which increases the level of detection in comparison to conventional microscopy. in addition to the detection of malaria parasites and hz pigment, we can characterize the pigment morphology. neutrophils containing hz pigment have already been proved as a marker for severe malaria and can be easily detected by the qbc assay as shown in fig., we found that 6 out of 30 samples were positive for neutrophils containing hz pigment, and 3 out of 5 were having various complications. samples with neutrophils containing pigment can be alerted from the beginning, and adequate care can be taken to reduce the morbidity and mortality. other advantages using qbc assay include semi - quantitative detection of packed cell volume or hemoglobin level. this assay can also detect other hemoparasites (such as babesia, microfilaria, trypanosome, and donovan bodies of leishmania donovani). molecular methods are proven to have highest sensitivity and specificity among all the diagnostic modalities available for malaria. however, in the current study, few cases were found positive by ict and qbc but negative by pcr. in a retrospective data analysis, many of these patients were found to receive 1 or 2 doses of antimalarials prior to the sampling. moreover, few samples exhibited only hz pigments in qbc, and positive by both ict and pcr. hence, the detection of hz pigments in low parasitemic conditions can be an adjunct for malarial diagnosis. the limitation of this study was that we did not examine the role of hz pigment detection by qbc in samples which were both negative by microscopy and rdts. this was a pilot study by which we wanted to validate the utility of qbc for hz detection for which we needed a substantial number of samples, which were negative for parasitic forms by microscopy. the majority of such samples received during the study period were rdt positive, and hence we used such samples to see whether hz detection by qbc serves any purpose. it not only signifies the recent malarial infection but also puts light on severity of the disease. in the present study, we found that qbc is a rapid, highly sensitive, and cost - effective method to detect hz pigment in comparison to pcr in low parasitemic conditions.	low parasitemic condition in malaria remains a diagnostic challenge ; as the available diagnostic methods failed to detect. currently, hemozoin (hz) pigment is gaining attention in the diagnosis of malaria. the major drawback is ease of detection of hz in routine practice. a pilot study was conducted to evaluate the role of hz pigment and to compare the performance of quantitative buffy coat assay (qbc) and pcr in such conditions. clinically suspected cases of malaria were examined by both giemsa stain and immunochromatographic test (ict). samples positive by ict and negative by giemsa stain were further examined by nested pcr targeting 18s rrna and qbc for the presence of malaria parasites and pigments. thirty blood samples fulfilled the inclusion criteria out of which 23 were plasmodium vivax (pv), 4 plasmodium falciparum (pf), and 3 mixed (pv and pf) by immunochromatographic test. twenty - one out of 30 (70%) were positive by nested pcr in comparison to 25/30 (83%) by qbc. samples containing both malaria parasites and hz pigment by qbc completely showed concordance with the pcr result. however, 61% of total samples containing only hz pigment were observed positive by pcr. hz pigment remains an important tool for malaria diagnosis. identification of leukocytes containing pigments by qbc not only indicates recent malarial infections but also puts light on severity of the disease. qbc assay is a rapid, highly sensitive, and cost - effective method to detect malaria parasites and hz pigment especially in low parasitemic conditions.
it is estimated the global health expenditure on diabetes is approximately $ 673billion ; indeed in the usa alone the cost is approximately $ 320 billion. of this cost, however, only 12% is spent on directly managing the diabetes itself, with the majority of the expenditure being on the complications of the disease. cardiovascular disease is the most common cause of death and disability among people with diabetes ; the diagnosis conferring a twofold excess risk of cardiovascular disease, independent of the usually accompanying adverse lipid and weight profile. therefore, reducing the cardiovascular risk of people with diabetes has been at the forefront of diabetes research with the intention of improving the health and wellbeing of the population whilst simultaneously reducing the global financial burden of the disease. at the core of cardiovascular protection, good blood pressure control, weight reduction, improved physical activity and appropriate statin usage have been demonstrated to substantially reduce event rate. diabetes is diagnosed and characterized by hyperglycemia, and thus for many years, strict glycemic control was thought to be key to improving cardiovascular events. whereas tight glycemic control unequivocally improves microvascular outcomes, the benefit has not been consistently demonstrated in the macrovasculature [57 ]. multiple explanations have been presented for this lack of benefit, or in the case of the accord study (clinicaltrials.gov identifier, nct00000620) the apparent harm. many have suggested the predominantly insulinocentric approach to the management of glucose may have contributed to the lack of benefit as these therapies are associated with significant weight gain and risk of hypoglycemia. although unlikely to account for the complete lack of benefit seen in these studies it is generally accepted that these recognized complications of treatment mitigate the benefit of good glycemic control. indeed, the 2.7-fold excess cardiovascular mortality reported in the systematic review and meta - analysis of observational studies was in part attributed to these complications of treatment. as such, it was hoped the advent of incretin - based therapies, designed to support physiological regulation of glycemia without precipitating hypoglycemia or weight gain, would provide an alternative treatment strategy with cardioprotective benefits. early phase 2 and 3 studies provided promising results, however, as yet, these benefits have failed to be demonstrated. this review will explore the pre - clinical and early clinical data and compare it with the subsequent larger clinical trials to propose potential explanations for the disconnect between the physiological benefits presented in early work and the lack of apparent benefit demonstrated in large - scale cardiovascular safety studies. this article is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by any of the authors. the pathophysiology of diabetes includes attenuated pancreatic and cell function resulting in inappropriate glucagon release and diminished insulin production, cellular insulin resistance in the muscles, liver, brain and adipose tissues, increased renal glucose reabsorption and impairments of the incretin system. the two peptides, glucose - dependent insulinotropic polypeptide (gip) and glucagon - like polypeptide 1 (glp-1) account for as much as 90% of the incretin effect first described by jean labarre in 1930. they are responsible for as much as half of the glucose - dependent insulin release after food ingestion in addition to suppressing glucagon release. further, in health they have been attributed with several preparatory responses to nutrition, including suppressing hepatic gluconeogenesis, promoting satiety and inhibiting gastric emptying. people with diabetes have reduced incretin production and enhanced degradation by the enzyme di - peptidyl peptidase-4 (dpp-4). research into these pathophysiological deficits has resulted in the successful development and use of therapies either increasing endogenous glp-1 by inhibiting its breakdown by dpp-4 or administering synthetic glp-1 receptor agonists. the latter class of drugs is further subdivided into agents based on exendin-4, originally isolated from the gila monster of the southwestern united states, which has approximately 5053% homology with human native glp-1 making it resistant to dpp-4 degradation, but interacts with the glp-1 receptor, or the synthetic glp-1 analogs which share up to 97% homology with endogenous glp-1, but have been engineered to resist dpp-4 breakdown. these agents stimulate appropriate insulin secretion, suppress inappropriate glucagon release and thus regulate glucose with a low risk of hypoglycemia. there is substantial interest, however, in the non - glycemic effects these agents had. in vitro studies exploring the effect of glp-1 on endothelial function demonstrate that there are vascular benefits which are not mediated through improvements in hyperglycemia, weight loss or the accompanying blood pressure reduction. exendin-4 stimulates proliferation of endothelial cells, a critical step in endothelial repair, arterial healing, and angiogenesis, by a glp-1 receptor - dependent mechanism. the endothelial dysfunction that characterizes premature atherosclerosis is attenuated in human umbilical vein endothelial cells (huvecs) exposed to the glp-1 analog liraglutide similarly through glp-1 receptor - dependent mechanisms. liraglutide also shows marked anti - oxidative, anti - inflammatory, and anti - apoptotic effects on huvecs exposed to tumor necrosis factor alpha (tnf), and attenuates the accompanying endothelial cell dysfunction. additionally, liraglutide reduced hyperglycemia - induced endoplasmic reticulum stress in huvecs via mitochondrial fusion processes, thereby reducing apoptosis. interestingly this effect may be a direct mitochondrial effect rather than a glp-1 receptor - mediated effect. exenatide, however, failed to protect rat femoral arterial ring endothelial cells from triglyceride - induced cellular dysfunction. in the animal models glp-1 also appears to have favorable effects on vascular function, independent of its glucose lowering effects. glp-1 administration mediates endothelial - dependent relaxation in the rat pulmonary artery [21, 22 ], which was attenuated in the presence of a nitric oxide synthase antagonist suggesting the involvement of nitric oxide (no) in mediating its vascular effects. this is supported by observations that glp-1 promotes no - dependent relaxation of mouse mesenteric arteries. the glp-1 vascular effect appears to vary by vascular bed, causing endothelial - independent relaxation, via the glp-1 receptor, in femoral arteries but having no impact on rat aorta isolates. glp-1 is also protective against ischemia reperfusion injury in isolated rat hearts [23, 2528 ] and has renoprotective (reducing proteinuria and microalbuminuria) effects, in addition to the cardioprotective effects in dahl salt - sensitive hypertensive rats. whether these effects are mediated directly via the glp-1 receptor is unclear, as the vasodilatory effects have been observed to be both dependent and independent of the glp-1 receptor. in the latter of these studies, glp-1(9 - 36), which is the product from the degradation of glp-1 by dpp-4, mediated relaxation of mouse mesenteric arteries. thus, it is clearly evident that glp-1 acts as a vasodilator in animal models potentially having cardioprotective properties, although whether this is dependent on glp-1 receptor or another mechanism remains to be elucidated. acute administration of glp-1 increased flow - mediated dilatation (endothelial dependent) in type 2 diabetic male subjects with coronary artery disease but had no significant effect on young healthy, lean male subjects in whom no existing failure of endogenous glp-1 activity would be anticipated. in a broader general population sample aged 1850 years, glp-1 did improve forearm blood flow by approximately 30% and augmented endothelial - dependent forearm blood flow response to acetylcholine by up to 40%. conversely, endothelial - independent function was not influenced by the acute administration of glp-1 in either diabetic or healthy individuals suggesting glp-1 improves function rather than structure [30, 31 ]. glp-1 infusions were also shown to improve regional and global left ventricular function when administered within 6 h of an acute myocardial infarction and improve systolic function after successful primary angioplasty in those with severe left ventricular dysfunction. observations from early clinical trials suggested these benefits would extend into improvements in cardiovascular outcomes. a meta - analysis of the glp-1 receptor agonist use demonstrated a reduction in blood pressure of 3.6/1.4 mmhg, weight of 2.9 kg and total cholesterol of 0.1 mmol / l. a retrospective analysis of obese people with type 2 diabetes suggested an improvement in both blood pressure and c - reactive protein with the exendin-4-based glp-1 receptor agonist, exenatide. a meta - analysis of the prospective liraglutide effect and action in diabetes (lead) studies, the registration program for the glp-1 analog, liraglutide, demonstrated improvements in lipid profile, b - type natriuretic peptide, high - sensitivity c - reactive protein and plasminogen activator inhibitor-1 all of which these benefits have also been demonstrated with exenatide and the dpp-4 inhibitor sitagliptin, suggesting this is a class effect [36, 37 ]. reductions in postprandial triglycerides and apob48, again both tightly associated with cardiovascular risk, have been demonstrated with both the dpp-4 inhibitor, vildagliptin, and the glp-1 analog, liraglutide. during pre - clinical investigation of incretin therapies, most trials record and adjudicate cardiovascular events. although differing in protocols, the standardized recording and reporting of major adverse cardiac events (mace) allows for meaningful meta - analyses. in a meta - analysis of 25 trials lasting > 6 months and reporting at least one cardiovascular event, glp-1 receptor agonists demonstrated a significant 49% reduction in mace (p < 0.03) compared to placebo and a trend towards a 22% improvement versus active comparator. this failed to reach statistical significance due to the small numbers of events, short - term nature of the studies and the low - risk nature of the participants. a similar benefit was seen in dpp-4 inhibitor trials, although with 70 trials to analyze, the 29% reduction in mace was highly significant. again this analysis was limited by the relatively short duration of the studies and the relatively pure and healthy populations that were studied in these regulatory trials. since the concern over rosiglitazone potentially increasing cardiovascular events (subsequently refuted), licensing with the food and drug administration (fda), however, requires a priori cardiovascular outcome trials (cvots) to demonstrate cardiovascular safety in anti - glycemic agents. as such there are currently in excess of 100,000 people with diabetes worldwide participating in cvots using incretin - based therapies. to date, four of the trials have reported the trial to evaluate cardiovascular outcomes after treatment with sitagliptin (tecos, clinicaltrials.gov identifier, nct00790205), saxagliptin and cardiovascular outcomes in patients with type 2 diabetes (savor - timi 53, clinicaltrials.gov identifier, nct01107886) and the examination of cardiovascular outcomes with alogliptin versus standard of care (examine clinicaltrials.gov identifier, nct00968708), using dpp-4 inhibitors, and the evaluation of lixisenatide in acute coronary syndrome (elixa, clinicaltrials.gov identifier, nct01147250) using lixisenatide. whilst meeting all of the safety requirements of the fda, many have felt disappointment regarding the lack of benefit achieved in these trials. the tecos study randomized 14,671 people with diabetes and established cardiovascular disease to receive sitagliptin or placebo. after a median of 3.0 years, there was no difference in the composite of cardiovascular outcome namely cardiovascular death, nonfatal myocardial infarction, nonfatal stroke, or hospitalization for unstable angina, with a hazard ratio (hr) of 0.98 (95% confidence interval [ci ] 0.881.09). the examine study explored the effect of alogliptin in people with type 2 diabetes post - myocardial infarction or acute coronary syndrome for a median of 18 months and demonstrated a similar hr of 0.96 (95% upper limit of confidence interval 1.16) compared to placebo. savor - timi demonstrated an hr of exactly 1.0 (95% ci 0.891.12) when comparing saxagliptin with placebo in 16,492 people at risk of or with a history of cardiovascular events for a median 2.1 years. the elixa study differed from the dpp-4-based studies, in that it was originally designed to demonstrate the superiority of the exendin-4-based glp-1 receptor agonist, lixisenatide, over placebo after acute coronary syndrome. the 6068 participants recruited after acute coronary syndromes took either lixisenatide or placebo for a median of 25 months. again, there was no difference in cardiovascular events (hr 1.02, 95% ci 0.891.17) although this still met the fda s requirements for demonstrating cardiovascular safety. of these studies, the result that generated most attention was the post hoc analysis of the non - adjudicated outcome for admissions due to heart failure in the savor - timi study. in the first 6 months of the study there was an increase of 0.7% in hospitalization due to heart failure, which amounted to a 27% relative risk increase. despite the fact these were non - adjudicated outcomes in patients with pre - existing heart failure, the highly significant increase in events raised considerable concerns. as a result, existing studies were required to perform an analysis of heart failure admissions. the examine study showed a similar trend of 19% increase in admissions, although due to small numbers this did not reach significance. tecos, reassuringly, showed no increase in heart failure signal with an hr of 1.0 (95% ci 0.831.20). the first simply suggests that the treatment of hyperglycemia reduces the osmotic diuresis effect of glucose, thereby increasing the symptoms of pre - existing heart failure. others have hypothesized that this is simple statistical chance, although the similar trend in examine would appear to refute this. other potential mechanisms include the potential for drug interactions, notably with angiotensin - converting enzyme (ace)-inhibitors or diuretics, which are more likely with saxagliptin which does interact with the cyp3a4/a5 inhibitors of the cytochrome p450 pathway. an alternative explanation is found in the other metabolites of dpp-4 ; b - type natriuretic peptide (bnp), neuropeptide y (npy), peptide yy (pyy), substance p and stromal cell - derived factor 1 alpha (sdf-1). these are all cardioactive substrates that influence vascular function. in isolation and in animal models increasing these by inhibition of dpp-4 should result in improved function ; however, it is unknown whether interaction between and the relative balance of such factors paradoxically diminish function. further, long - term dpp-4 inhibition may upregulate alternative compensatory degradation mechanisms, such as neutral endopeptidases. this is analogous to the increased chymase activity in long - term ace - inhibitor use that sees angiotensin 2 levels rise to pre - treatment levels within 12 months. neutral endopeptidases preferentially degrade bnp, thereby reducing the cardioprotective natriuretic effect in those with heart failure. the neutral effect of sitagliptin in tecos there has been much deliberation as to why the potential benefit promised in the pre - clinical and early clinical work has not been realized in the definitive randomized controlled trials. one hypothesis explores the possibility that this may be simply due to the duration of the studies. indeed, if the heart protection study (hps) or the scandinavian simvastatin survival study (4s) had been censored at 18 months or 2 years they would have not demonstrated any benefit from simvastatin [48, 49 ], yet statin therapy is widely accepted as a core element of cardiovascular risk reduction. if this is the case, studies such as the liraglutide effect and action in diabetes : evaluation of cardiovascular outcome results (leader, clinicaltrials.gov identifier, nct01179048) and the cardiovascular outcome trial of linagliptin versus glimepiride in type 2 diabetes (carolina, clinicaltrials.gov identifier, nct01243424) trials that have a study minimum duration of 3.5 years (the point at which the hps curves were clearly diverged) should show benefit. the reduction in cardiovascular events suggested by the early meta - analyses, however, was present in studies with a mean duration of 44.1 weeks. another significant difference between the regulatory studies that contributed to the meta - analyses and the subsequent cardiovascular outcome trials is the duration of diabetes in those studied. complex multi - morbid patients, such as those enrolled in tecos, examine, savor - timi and elixa are rarely used in these studies to minimize inter - participant variability and maximize the ability to detect differences. event driven cardiovascular outcome trials, however, prefer high - risk patients to maximize the event rate and increase study power. this necessitates a longer duration of diabetes and multi - morbidity driven polypharmacy. to date, the only trial to demonstrate cardiovascular benefit from glycemic control is the ukpds (clinicaltrials.gov identifier, nct01099865), which took newly diagnosed people with diabetes. the subsequent glycemic control trials, accord, advance (clinicaltrials.gov number, nct00145925) and vadt (clinicaltrials.gov identifier, nct00032487) failed to demonstrate benefit [6, 7, 52, 53 ]. the failure to achieve benefit in these studies has been attributed to existing bad legacy effect from the preceding 812 years of poor glycemic control. until recently it was felt that this legacy effect was purely an incremental accumulation of vascular damage, rather than an ongoing process. recent work has demonstrated early adverse glycemic exposure triggers acute changes in protein expression, notably p66 in the mitochondria. this adaptor protein functions as a redox enzyme within the mitochondria responsible for reactive oxygen species generation and subsequent cellular apoptosis, vascular inflammation and endothelial dysfunction. gene silencing of p66 blunts persistent endothelial dysfunction and oxidative stress in the vasculature of diabetic mice. thus, the epigenetic changes in the sirt-1 and p53 genes may perpetuate the original hyperglycemic effects. interestingly metformin has been demonstrated to reverse the effects of sirt-1, in keeping with the observed benefit in ukpds whereby metformin was substantially superior to sulphonylurea and insulin - based therapy. if the failure of benefit in the existing trials is attributable to this, the vildagliptin efficacy in combination with metformin for early treatment of type 2 diabetes (verify, clinicaltrials.gov identifier, nct01528254), which is taking newly diagnosed people with diabetes and randomizing them to receive either immediate dpp-4 combination with metformin or metformin alone, may demonstrate a benefit. unfortunately, the primary endpoint of this study ; time to initial treatment failure rate and rate of loss in glycemic control over time, may result in the study being terminated before being able to demonstrate a cardiovascular benefit. finally, these complex multi - morbid patients are characterized by polypharmacy, whereas regulatory trials are usually performed with as few concomitant prescriptions as possible. it is known that glibenclamide, and to a lesser extent glimepiride, attenuates the vascular benefit of glp-1. this is most likely mediated through effects on mitochondrial atp - sensitive potassium (katpase) channels. these katpase channels are also responsible for myocardial ischaemic preconditioning, and their inhibition by sulphonylurea use has been attributed, at least in part, to the historic poorer prognosis after myocardial infarction of those with diabetes. this interaction between sulphonylurea and glp-1 is well established, however, is not accounted for in any of the existing studies with the exception of carolina, comparing dpp-4 inhibitor to sulphonylurea. the possibility of other interactions in clinical practice attenuating the endothelial benefits of glp-1 is possible, if not probable given the multiple mechanisms of action on the endothelium of many cardioprotective drugs used post - myocardial infarction. incretin - based therapies have demonstrated endothelial benefit in people with diabetes. to date, these have failed to translate into cardiovascular benefit in outcome trials. potentially this may be due to the short duration of trials, the complex multi - morbid patients participating in these trails, a failure to tackle diabetes prior to an epigenetic bad glycemic legacy, or potential interactions with concomitant medications. this not withstanding, the profile of incretin - based drugs providing good glycemic control, with low risk of hypoglycemia and weight neutrality or benefit render them a suitable option after metformin, compared to alternatives associated with higher rates of hypoglycemia and weight gain, both of which have been demonstrated to adversely impact cardiovascular outcomes. future work, exploring cardiovascular outcomes over longer time frames, such as the leader trial, earlier in diabetes such as verify, or in the absence of potential interacting therapies such as carolina may demonstrate benefits and help elucidate the ideal candidate for incretin - based intervention.	poorly controlled diabetes is characterized by premature cardiovascular mortality and morbidity. the mechanisms linking hyperglycemia with accelerated atherosclerotic disease have not been fully elucidated ; however, are thought to be mediated through vascular inflammation, oxidative stress and endothelial dysfunction. the advent of incretin - based therapy, whether by increasing endogenous glucagon - like peptide (glp)-1 and glucose - dependent inhibitory polypeptide by inhibition of their breakdown using di - peptidyl peptidase 4 inhibitors, or augmenting glp-1 activity using either exendin-4-based drugs or synthetic glp-1 analogs promised not just improvements in glycemic control, but improvements in endothelial function, lipid profiles and markers of vascular inflammation. as such, it was anticipated they would demonstrate cardiovascular benefit in those with diabetes, indeed early meta - analyses suggested cardiovascular events would be reduced. to date, however, this benefit has failed to materialize, indeed the cardiovascular outcome trials, whilst meeting their primary endpoint of cardiovascular safety, have failed to demonstrate any improvements in stroke or myocardial infarction. this review will explore the data and attempt to answer the question : what went wrong ?
during the last 50 years nearly 1000 drugs have been identified as possible causes of hepatic injury, termed drug - induced hepatotoxicity, especially adriamycin (adr). cancer is one of the most of common causes of death in the world, and the prevalence of adr - induced hepatotoxicity, therefore, is increasing. while adr is the most effective drug in cancer tissue, it has, unfortunately, some adverse effects in noncancerous tissue, including liver, heart, kidney, brain, immune system, and testis. one reason may be that the liver is the primary involved in detoxification of exogenous and endogenous toxins, especially toxic chemicals, probably resulting in hepatotoxicity. another reason is that reactive oxygen species (ros) are related toinvolved in adverse effects in normal liver tissue. multiple studies have reported that adr s toxic effects could relate to generating oxidative stress in the normal liver ; therefore, some antioxidants (e.g., selenium, vitamin e, and nac) can decrease adr - induced liver damage. also, it has been well documented that adr drastically increases lipid oxidation and mitochondrial ros content, and decreases liver antioxidant enzymes and mitochondrial function. other factors contributing to organ toxicity include adr generation of the inflammatory cascade, and, eventually, programmed cellular death (apoptosis). to enhance the therapeutic effects and decrease the toxic adverse effects of adr, it is essential to identify and characterize the mechanisms by which these effects occur in the liver. adr s hepatotoxicity has been shown to be associated with oxidative stress linked to redox - cycling of the drug. the mechanism of generation of oxidative stress induced by adr in liver tissue has not been completely defined. one is that the adr redox - cycling may be triggered by 1-electron reduction with the formation of adr radical. the reaction is catalyzed by various enzymes (e.g., nadph - cytochrome p450 reductases, nos, nadph oxidase, and catalase). although reoxygenation is needed to convert it from its radical to its nonradical form, the superoxide radical is simultaneously manufactured. moreover, those enzymes caused in adr radical production have been shown to be highly concentrated in hepatocytes. adr radicals delocalized fe adr from ferritin and generate h2o2, eventually causing oxidant injury in the liver. the renin - angiotensin system is frequently activated in patients with chronic liver diseases, such as cirrhosis (which contributes to fibrosis progression), hepatocellular carcinoma [810 ], and liver inflammation. angiotensin ii (ang - ii) is an important effector peptide of this system. ang - ii has some crucial physiological functions, such as cell contraction, cell growth / hypertrophy, apoptosis, differentiation, and secretion of inflammatory cytokines. ang - ii actions are mainly mediated by its 2 sub - receptors the ang - ii type 1 receptor (at-1) and the ang - ii type 2 receptor (at-2). these 2 subunits mediate the effects of ang - ii on various organs, and at-2 (mostly in fetal cells) is less common than at-1. increased systemic ang - ii was reported to augment and promote inflammation and oxidative stress. in target cells, ang - ii induces free radical formation and oxidative stress, stimulating redox - sensitive intracellular pathways. in addition to systemic the ras, virtually every organ system in the human body has been shown to possess a local ang signaling system in peripheral tissues (e.g., liver, vasculature, kidneys, adrenal glands, heart, and immune cells. the systemic ras is activated in patients with cirrhosis and the local ras is induced in fibrotic livers and activated hepatic stellate cells (hscs). it has been shown that ang - ii might modulate mitochondrial membrane potential and transcription of respiratory chain subunits, and may stimulate the production of ros in mitochondria, thus leading to mitochondrial failure in cardiac, renal, and vascular smooth muscle cells. mitochondrial failure probably causes the massive production of ros. according to current understanding of adr and ras, adr might crosstalk with the local ras in liver tissue to amplify its adverse effects. the hypothesis in the present study, therefore, was that adr cooperates with the local ras in the liver tissue to generate free radical formation, resulting in oxidative stress and attenuating mitochondrial function. hence, the aim of the study was to investigate the potential prophylactic effects of attenuated angiotensin - ii production in the liver against mitochondrial dysfunction in rats with adr - induced oxidative stress. all experimental procedures were carried out in strict accordance with the animal experimentation local ethics committee of the erciyes university. thirty - five male sprague - dawley rats were randomly divided into 5 treatment groups as shown figure 1 : control (n=7), adr (n=7), cap (captopril + adr, n=7), al (aliskiren + adr, n=7), and cap + al (captopril + aliskiren + adr, n=7). adr (adriamycin hcl, adriblastina vial 10 mg, pharmacia) was administered in 4 equal injections (each intraperitoneal injection containing 4 mg / kg in saline, every other day, to reach a total dose of 16 mg / kg) during 7 days. on the same day the control group received the same volume of physiological saline. captopril was intragastrically administered (10 mg / kg, every day for 7 days). aliskiren was intragastrically administered (50 mg / kg, every day for 7 days ; figure 1). after the last drug treatment, liver tissues were collected, and then kept at 80 c until use ; cytosol and mitochondria were separated by centrifugation for use in later biochemical assays. the fluorescent mitochondrial - specific cationic dye 5,5,6,6-tetrachloro-1,1,3,3-tetraethyl benzimidazolylcarbocyanine iodide (jc-1) was used for assessment of mmp according to the manufacturer s protocol. to measure atp content and adr - toxicity in the liver, the kit is based upon the bioluminescence of atp that is present in all metabolically active cells. total antioxidant status (tas) of the liver s cytosol and mitochondria were measured according to manufacturer s protocol based on colorimetric measurement (rel assay kit, turkey). the results are expressed in mmol trolox equiv./l. total oxidant status (tos) of the liver s cytosol and mitochondria were measured using a rel assay kit (rel assay kit, turkey), based on colorimetric measurement. the tos - to - tas ratio was used as the oxidative stress index (osi). the osi value was calculated as follows : osi = (tos)/(tas) (mol / l/ mol trolox equivalent / l). comparison among different groups were made using multiple analyzes of variance (anova), followed by a post hoc protected tukey test p<0.05 was considered to be significant. all experimental procedures were carried out in strict accordance with the animal experimentation local ethics committee of the erciyes university. thirty - five male sprague - dawley rats were randomly divided into 5 treatment groups as shown figure 1 : control (n=7), adr (n=7), cap (captopril + adr, n=7), al (aliskiren + adr, n=7), and cap + al (captopril + aliskiren + adr, n=7). adr (adriamycin hcl, adriblastina vial 10 mg, pharmacia) was administered in 4 equal injections (each intraperitoneal injection containing 4 mg / kg in saline, every other day, to reach a total dose of 16 mg / kg) during 7 days. on the same day the control group received the same volume of physiological saline. captopril was intragastrically administered (10 mg / kg, every day for 7 days). aliskiren was intragastrically administered (50 mg / kg, every day for 7 days ; figure 1). after the last drug treatment, liver tissues were collected, and then kept at 80 c until use ; cytosol and mitochondria were separated by centrifugation for use in later biochemical assays. the fluorescent mitochondrial - specific cationic dye 5,5,6,6-tetrachloro-1,1,3,3-tetraethyl benzimidazolylcarbocyanine iodide (jc-1) was used for assessment of mmp according to the manufacturer s protocol. to measure atp content and adr - toxicity in the liver, a bioluminescent kit was used according to the manufacturer s protocol. the kit is based upon the bioluminescence of atp that is present in all metabolically active cells. total antioxidant status (tas) of the liver s cytosol and mitochondria were measured according to manufacturer s protocol based on colorimetric measurement (rel assay kit, turkey). the results are expressed in mmol trolox equiv./l. total oxidant status (tos) of the liver s cytosol and mitochondria were measured using a rel assay kit (rel assay kit, turkey), based on colorimetric measurement. the tos - to - tas ratio was used as the oxidative stress index (osi). the osi value was calculated as follows : osi = (tos)/(tas) (mol / l/ mol trolox total antioxidant status (tas) of the liver s cytosol and mitochondria were measured according to manufacturer s protocol based on colorimetric measurement (rel assay kit, turkey). total oxidant status (tos) of the liver s cytosol and mitochondria were measured using a rel assay kit (rel assay kit, turkey), based on colorimetric measurement. the tos - to - tas ratio was used as the oxidative stress index (osi). the osi value was calculated as follows : osi = (tos)/(tas) (mol / l/ mol trolox comparison among different groups were made using multiple analyzes of variance (anova), followed by a post hoc protected tukey test p<0.05 was considered to be significant. adr - induced toxicity is well known to be associated with increased oxidative stress, resulting from increased levels of reactive oxygen species and decreased levels of antioxidants. they were measured as the type of mitochondria and cytosol from liver tissue in the present study. mitochondrial and cytosolic tos were significantly increased by adr compared to cont (p<0.05 ; figure 2a, 2b). the inhibition of ang - ii in the liver was restored to mitochondrial at cap and cytosolic tos at cap and cap + al, (p<0.05 ; figure 2a, 2b). the elevation of tos in mitochondria and cytosol could be related to ang - ii production in liver tissue. adr decreases tas in mitochondria and cytosol, but not significantly compared to the control group. the inhibition of ang - ii tended to increase of all groups, but not significantly (figure 3a, 3b). the level of oxidative stress was calculated by using the ratio of tos to tas in mitochondria and cytosol. osi in mitochondria and cytosol were significantly elevated in the adr group (p<0.05 vs. cont ; figure 4a, 4b). however, the inhibition of local ang - ii production by renin and/or ace inhibitors led to a significant decrease in mitochondrial osi at cap and cap + al groups and cytosolic osi at all groups, resulting from decreasing tos (p<0.05 vs. adr group, figure 4a, 4b). mmp was estimated via the ratio of red to green fluorescence by using a special mitochondrial cationic dye (jc-1) to demonstrate adr s toxicity in mitochondria. adr caused sharp dissipation of mmp (p<0.05 vs. adr group ; figure 5). in parallel, adr s effect on mmp significantly decreased atp production (p<0.05 vs adr group ; figure 6). however, attenuation of local ang - ii production by renin and/or ace inhibitors significantly increased atp production in liver mitochondria (p<0.05 ; figure 6). these data demonstrate that angiotensin - ii might be able to cooperate with adr to derive oxidative, stress causing reduced mitochondrial membrane potential, resulting in minimizing atp production in liver tissue. adr - induced toxicity is well known to be associated with increased oxidative stress, resulting from increased levels of reactive oxygen species and decreased levels of antioxidants. they were measured as the type of mitochondria and cytosol from liver tissue in the present study. mitochondrial and cytosolic tos were significantly increased by adr compared to cont (p<0.05 ; figure 2a, 2b). the inhibition of ang - ii in the liver was restored to mitochondrial at cap and cytosolic tos at cap and cap + al, (p<0.05 ; figure 2a, 2b). the elevation of tos in mitochondria and cytosol could be related to ang - ii production in liver tissue. adr decreases tas in mitochondria and cytosol, but not significantly compared to the control group. the inhibition of ang - ii tended to increase of all groups, but not significantly (figure 3a, 3b). the level of oxidative stress was calculated by using the ratio of tos to tas in mitochondria and cytosol. osi in mitochondria and cytosol were significantly elevated in the adr group (p<0.05 vs. cont ; figure 4a, 4b). however, the inhibition of local ang - ii production by renin and/or ace inhibitors led to a significant decrease in mitochondrial osi at cap and cap + al groups and cytosolic osi at all groups, resulting from decreasing tos (p<0.05 vs. adr group, figure 4a, 4b). mmp was estimated via the ratio of red to green fluorescence by using a special mitochondrial cationic dye (jc-1) to demonstrate adr s toxicity in mitochondria. adr caused sharp dissipation of mmp (p<0.05 vs. adr group ; figure 5). in parallel, adr s effect on mmp significantly decreased atp production (p<0.05 vs adr group ; figure 6). however, attenuation of local ang - ii production by renin and/or ace inhibitors significantly increased atp production in liver mitochondria (p<0.05 ; figure 6). these data demonstrate that angiotensin - ii might be able to cooperate with adr to derive oxidative, stress causing reduced mitochondrial membrane potential, resulting in minimizing atp production in liver tissue. because both adr and ang - ii play important roles in oxidative stress related to some liver pathologies, we hypothesized that adr may cause liver damage via local ang - ii production. several lines of evidence from our current study support this hypothesis : inhibition of ang - ii production attenuates several markers of adr - induced liver injury and decreases tos, resulting in decreased oxidative stress and increased mmp and atp in rats exposed to adr. these results suggest that ang - ii cooperates with adr s hepatotoxicity in rats, confirming the potential health benefit of inhibition of ang - ii in vivo against oxidative stress induced by adr. it is clear that adr causes irreversible liver damage, triggering apoptotic processes in normal liver tissue. adr - mediated hepatotoxicity has been shown to include focal damage in hepatocytes, vascular damage, and steatosis. thus, its hepatotoxicity was ascribed to subcellular hepatic alterations, including polymorphic mitochondria and cytoplasmic vacuolization. various compounds (most of them antioxidants, such as vitamin e, erdosteine, cystathionine, ator, and catechin in adr - induced hepatotoxicity) have been reported to prevent liver injury induced by oxidative stress. recent studies have been focused on better understanding oxidative stress mediated by adr s toxicity and the outcome of adverse effects in heart, liver, and kidney. during the adr redox - cycling process, adr gains an electron and is reduced into adr radical - catalyzed by several endogenous enzymes, including p-450. so, it was not so surprisingly that the liver has more p-450 enzyme than other tissues due to its detoxification activity. then, adr shifts to its original form by re - oxygenation, generating reactive oxygen radicals. eventually, these radicals promote oxidative stress through altering the redox status of essential proteins. in agreement with this, a previous study reported a significant increase in mda levels, which is a good indicator of oxidative damage. the same study also showed significant attenuation of some antioxidant levels (e.g., sod, gsh, and gsh - px) in rat liver treated with adr. another study reported that adr increased ros concentration and oxidative stress biomarkers, as well as decreasing antioxidant enzyme activities and mitochondrial function in the liver. as shown figures 24, all results are consistent with the current study s results. redox cycling occurs in the cytoplasm, endoplasmic reticulum, and (especially) in mitochondria. the compartmentalization of these kinds of subcellular oxidative stress is important for cell functions, especially because mitochondrial oxidative stress can destroy mitochondrial function. we separately measured oxidative stress (osi, tos, and tas) in cytosol and mitochondria compartments in the present study, because oxidant radicals may freely cross intracellular membranes ; therefore, subcellular compartmentalization of antioxidants may significantly modulate the harmful activity of ros in subcellular compartments. therefore, the level of mitochondrial oxidative stress is probably more important than the oxidative stress in all other cell organelles. according to this assumption therefore, the deficiency of mitochondrial antioxidant defense might increase the release of oxidant from the mitochondrial matrix, which can consequently oxidize some cytoplasmic proteins and cell signaling, as well as membrane pumps proteins. moreover, the disruption of the mitochondrial membrane potential also is important in regulating necrosis and apoptosis. our results show that the mitochondria are the dominant source of oxidative stress - induced by adr in the liver. mitochondrial dysfunction associated with adr - related toxicities might cause the observed change in activities of typical markers of oxidative status in damaged liver tissue. consequently, as an important source of ros production, mitochondria could also be a primary target susceptible to ros attacks. the defects in the mitochondrial structural design would lead to the adaptation of mitochondrial metabolism, resulting in decreased activity of mitochondrial enzymes in the liver exposed to adr, hence becoming a principal contributor to intrinsic cell dysfunction. free radicals also stimulate the pro - apoptotic protein (e.g., bax), resulting in loss of hepatocyte. the other reason hepatocytes are reduced by adr is associated with redox alteration, causing irreversible liver toxicity and its changes are reported to be important in regulating hepatocyte division. the changing of redox potential may be common attributing for cells division the fact that ros have been suggested to modulate the cell cycle in many cell lines. loss of hepatocytes probably leads to even worse liver toxicity of adr, although it has been repored that some aspect of angiotensin signaling inhibition could be involved in alleviating adriamycin - induced cardiomyopathy and renopathy. alterations in ras have frequently been implicated in the pathophysiology of various diseases involving the heart, lung, kidney, and liver [10,2931 ]. ang - ii, an essential member of the ras, handles both physiologic and pathophysiologic effects of ras. it is associated with liver fibrogenesis, cirrhosis, portal hypertension, and hepatic ischemia / reperfusion injury. ang - ii leads to apoptosis, tumor vessel growth, tumor invasion and metastasis, and immunosuppression, leading to the development of tumors. in the other words furthermore, recent studies have reported that at-1 overexpression may be associated with hepatocellular, non - small cell lung, gastric, breast, ovarian, bladder, pancreatic, and prostate cancers. evidence shows that ang - ii plays a role in liver inflammation in humans and rodents (11). the importance of ras has been shown in development of hepatic fibrosis, and the benefits of modulation of ace gene expression have been reported. cap, an angiotensin - converting enzyme blocker, was able to attenuate growth in a murine model of colorectal cancer liver metastases. this so - called local or tissue ras has various roles, such as the promotion of inflammation and fibrosis. a recent study reported that local ras is present in the liver, heart, kidney, lacrimal gland, and lung. each kind of ras expresses itself not only in the fibrotic liver, but also in liver parenchymal cells, including hepatocytes. this local angiotensin is implicated in fibrotic pathogenesis in the liver. also, activated at-1 expresses on the surface of hscs and assembles into the hepatic fibrotic area. local or tissue ras might be highly related to systemic ras under pathophysiologic situations, or independent of the circulation system. renin and ace inhibitors to prevent the local ras, for evaluation of the relationship between adr s hepatotoxic actions and ang - ii. however, there are limited studies on neurohormonal activation of adr on tissues. to the best of our knowledge, there is no published data on the association of adr and ang - ii in liver mitochondrial dysfunction. hence, it is not easy to explain the physiologic relevance or the underlying mechanism of the present observations ; these deserve attention in future studies. however, previous research has suggested that increased intracellular ang - ii in diabetic rat heart was associated with enhanced cardiac myocyte apoptosis, fibrosis, and oxidative stress. the latter conditions were alleviated better by a renin inhibitor, which blocks the intracellular ras, compared to ang - ii receptors and ace inhibitors. the renin inhibitor, aliskiren, was reported to enter the cell and inhibit the intracellular production of angiotensin ii. the above findings suggest similar partitioning of aliskiren in the heart, which might have resulted in sufficiently high intracellular levels of aliskiren to inhibit rat renin in our studies. it is reported that a renin inhibitor prevents both intracellular and extracellular ang - ii synthesis. consistent with our previous study, we observed that aliskiren had some effective impacts on preventing oxidative stress in kidney - exposed to adr s toxicity. the same study also reported attenuated progression of hepatic fibrosis by inhibition of activated hepatic stellate and kupffer cells and by reducing oxidative stress in the al group. additionally, ang - ii synthesis by cardiac fibroblasts, extracellular as well as intracellular, is catalyzed by ace. thus, ace inhibitors can prevent ang - ii synthesis by cardiac fibroblasts, and ang - ii receptor inhibitors can block autocrine / paracrine effects of extracellular ang - ii. another study has been shown that inhibition of locally produced ang - ii could decrease inflammation and fibrosis in kidney, lung, and liver tissues. because ace and at-1 plays a key role in liver fibrosis, ras was reported to be highly expressed in activated human hepatic stellate cells. moreover, an at-1 antagonist, losartan, also reduces the extent of liver damage. interference of ang - ii in adriamycin hepatotoxicity is associated with stimulating ros production in hepatocytes, mainly via at-1 and mitochondria - derived pathway because losartan can inhibit ang - ii - stimulated ros generation. these results are in line with our findings in the present study that attenuation of ang - ii production in the liver can modulate ros production, arising from attenuation of mitochondrial dysfunction in liver exposed to adr. according to our current results, ang - ii cooperates with adr to produce more oxidant, causing its hepatotoxicity (figure 2) but not attenuation of antioxidants (figure 3). the first is that crosstalk between adr and ang - ii might be based more on oxidant production than changing of antioxidant. most hepatic damage by ang - ii is known to be related to elevated oxidants. since the liver plays an important role in pro - oxidants, detoxification is known to have the highest content of antioxidants, a decline antioxidant levels in the liver tissue may need enormous oxidant production to significant alternation of oxidant. thirdly, our study investigated acute hepatotoxicity induced by adr and determined that time is an important factor in adr s cytotoxicity. more time may be needed to change the highest content of antioxidants in liver tissue, consistant with our results that antioxidant level was not significantly decreased in any experimental groups. moreover, the role of the ras in this experimental model suggests that intrahepatic ras is markedly upregulated, and ras inhibition attenuates adr s hepatotoxicity. moreover, it is possible to have an interaction between the systemic and intrahepatic ras. therefore, the present study used ace and renin inhibitors to block ras, especially local ones. since insufficient work has been done on mitochondria to clarify this issue, the full of molecular mechanisms underlying the link between adr and ang - ii are still unclear. however, angii has been shown to alter mmp and to stimulate ros production. this overproduction of mitochondrial ros by ang - ii has been implicated in renal toxicity of adr and also neurodegenerative diseases, ischemia - reperfusion injury, atherosclerosis, and aging. therefore, if ang - ii production could be inhibited, the mitochondrial dysfunction might be restored. the rising evidence of the beneficial effect of ang - ii inhibition suggests that a parallel intra - mitochondrial ras might be capable of angii synthesis to modulate ros activity. because of more exposure to a high rate of oxidative damage, mitochondria must be destroyed and replaced. a previous study suggested that mitochondria might have their functional ras, leading to the intra - mitochondrial generation of an - ii. it has been shown to alter mitochondrial number or traffic to the surface of rodent mitochondria as well. an intracellular ras system might have a role as a local amplifier of ras signaling for attenuating a certain amount of systemic ang - ii. ang - ii has been suggested to have some role in development of mitochondrial failure, resulting in overloading ca, depolarization of mmp, and reducing atp production in liver and kidney exposed to adriamycin toxicity. the present study provides a novel mechanism of adr hepatotoxicity in which adr might crosstalk with local ras, especially mitochondria, in the rat the liver. therefore, our current research strongly suggests that protecting against adr s adverse effect on liver tissue can pharmacologically antagonize local angiotensin - ii pathological effects, including oxidative stress, decreasing mitochondrial membrane potential and atp production. further studies are necessary to test the beneficial effect of ang - ii inhibition on adr s hepatotoxicity and the other cytotoxicity in animal and human studies.	backgroundadriamycin (adr) is a drug used clinically for anticancer treatment ; however, it causes adverse effects in the liver. the mechanism by which these adverse effects occur remains unclear, impeding efforts to enhance the therapeutic effects of adr. its hepatotoxicity might be related to increasing reactive oxygen species (ros) and mitochondrial dysfunction. the interaction between adr and the local renin - angiotensin system (ras) in the liver is unclear. adr might activate the ras. angiotensin - ii (ang - ii) leads to ros production and mitochondrial dysfunction. in the present study we investigated whether adr s hepatotoxicity interacts with local ras in causing oxidative stress resulting from mitochondrial dysfunction in the rat liver.material/methodsrats were divided into 5 groups : control, adr, co - treated adr with captopril, co - treated adr with aliskiren, and co - treated adr with both captopril and aliskiren. mitochondria and cytosol were separated from the liver, then biochemical measurements were made from them. mitochondrial membrane potential (mmp) and atp levels were evaluated.resultsadr remarkably decreased mmp and atp in liver mitochondria (p<0.05). co - administration with adr and aliskiren and captopril improved the dissipation of mmp (p<0.05). the decreased atp level was restored by treatment with inhibitors of ace and renin.conclusionsangiotensin-ii may contribute to hepatotoxicity of in the adr via mitochondrial oxidative production, resulting in the attenuation of mmp and atp production.
lewandowsky and lutz dysplasia or epidermodysplasia verruciformis (ev) is an extremely rare genetic disorder first documented by felix lewandowsky and william lutz in 1922. it begins in childhood and is characterized by generalized infections with human papilloma virus (hpv), frequent association with cutaneous carcinomas and abnormalities of cell - mediated immunity. here we compare clinical and histopathologic features of two cases of ev in a family, with 7 years of follow up, and discuss differential clinical and histopathologic evolutions of lesions in detail. investigations included routine hemogram, biochemical examination, chest x - ray, skin scrapping for koh examination and biopsy examination of skin lesions from multiple sites at different times in both the cases. two brothers [figures 1 and 2 ], first presented at 16 and 18 years of age, respectively, came with a history of multiple, discreet, hypopigmented lesions all over the body since 8 years of age. photograph of elder sibling showing hypopigmented lesions all over the body, along with hyperpigmented, black colored plaques over chest, abdomen, arms. scars of previous operations are seen over chest wall and right nasolabial fold photograph of younger sibling showing hypopigmented lesions all over the body and two scaly erythematous lesions over the chest wall pedigree chart showing the diseased individuals on examination, multiple discreet and confluent hypopigmented plaques were present, some were slight erythematous with surface scaling and polycyclic borders over upper torso. some on dorsa of the hands were slightly elevated. in addition, the elder brother also showed a scaly pigmented nodular lesion of approximately 1 cm in diameter on the chest wall over the sternum. biopsy from the lesions showed hyperkeratosis, hypergranulosis, irregular acanthosis, vacuolated cells in upper stratum malphigi and enlarged cells with gray blue cytoplasm. some nuclei appeared large, round, and empty owing to marginal distribution of the chromatin. histopathologic appearance of skin biopsy displaying typical lesion of ev showing swollen keratinocytes with gray blue cytoplasm (h and e, 40) both were advised to avoid sunlight and to visit regularly for any change or if new lesions appear. subsequently, 3 years later, the elder brother again presented to the department. on examination, in addition, there were hyperpigmented, black colored plaques over chest, back, abdomen, nose, right nasolabial fold and right cheek. over the right scrotum, multiple angiomatous papules arranged in a linear pattern, suggestive of angiokeratoma of fordyce were seen [figure 5 ]. photograph of elder sibling showing angiokeratoma of fordyce with ev koh smears from axilla were positive for fungal elements. histopathological examination revealed variable morphology ranging from seborrheic keratosis, actinic keratosis [figure 6 ], bowen 's disease (back), moderately differentiated squamous cell carcinoma (chest wall) and basi - squamous carcinoma with seborrheic differentiation (on face). microphotograph of actinic keratosis showing epidermal hyperplasia with hyperkeratosis and atypical keratinocytes confined to lower aspect of epidermis (h and e, 40) younger brother presented 5 years after initial presentation with two notable scaly erythematous lesions of 1 and 0.5 cm over the chest wall. biopsy from larger lesion revealed features of seborrheic keratosis. after 3 years, the elder brother again presented with multiple small flat and raised erythematous and hyperpigmented lesions. one enlarged nodular lesion over the chest wall near the site of previous scar was excised, which on histopathology showed features of bowen 's disease [figure 7 ]. both the patients are presently under regular follow up. microphotograph of bowen 's disease where dysplastic keratinocytes are involving the entire thickness of epidermis (h and e, 100) the grandfather who also had similar disease died early without any biopsy examination. ev is an inherited disorder in which there are widespread and persistent infections with hpv, defect in cell - mediated immunity and propensity for malignant transformation. although most common form of ev is sporadic, there have been few reports of familial ev. a total of 12 reports of ev in indian patients have been published so far,[313 ] out of which only three were of familial cases. largest number of cases includes 14 members of a family reported from india. herein, we report three more cases of ev in a family of 18 individuals spread among three generations. about 20 hpv types have been characterized in these lesions and patients are usually infected with more than one genotype. but many of the ev patients show an abnormal susceptibility to specific group of hpvs only, including the oncogenic hpv type 5 (hpv5). infection results in pathognomonic pityriasis versicolor - like lesions, red plaques, and flat wart - like lesions. a specific cytopathic effect is linked to the high level of viral replication in differentiating keratinocytes. although most patients of ev have impaired cell - mediated immunity, it is still not known whether impairment of immune response is primary or secondary to massive hpv infection. it has been thought that basic immunologic defect might be the inability to recognize ev specific hpvs in such patients. the persistence of hpv infection is possibly the result of an immunogenetic defect which determines the generation of several cytokines capable of downregulating cell - mediated immunity. malignant transformation of lesions occurs on sun - exposed areas in 2530% of the patients at a relatively young age (third or fourth decade). syn - carcinogenic role of hpv5 and ultraviolet rays is supported by frequent mutations of p53 gene in premalignant and malignant ev tumors. both of our patients are farmers by profession and prone to sun exposure. however, propensity for malignant transformation was more in elder brother. while the younger brother required three biopsy examinations and only showed features of seborrhoic keratosis, the elder brother needed more than seven biopsy examinations from lesions over face and chest wall showing features of seborrhoic keratosis, actinic keratosis, bowen 's disease, squamous cell carcinoma and basisquamous carcinoma. associated diseases reported in ev are nf-1, thymoma, hansen 's disease, herpes simplex labialis and eccrine poroma, celiac disease and porokerotosis of mibelli and systemic lupus erythematosus. in the present study, one of the patients had ev with angiokeratoma of fordyce, tinea cruris and asthma. it has been stated that ev patients are not prone to bacterial, fungal, or viral infections with the exception of hpvs associated with plane warts. however, padmawathy. reported a case of ev with hansen 's disease and herpes simplex labialis. it is therefore concluded that the disease progression is variable among individuals of the same family. proclivity for malignant transformation is due to syn - carcinogenic affect of ultraviolet rays and hpv infection, which in turn depends on individual genetic susceptibility. may be associated with other skin lesions or infections such as angiokeratoma of fordyce and tinea cruris, as in the present case.	lewandowsky and lutz dysplasia, also known as epidermodysplasia verruciformis (ev), is an inherited disorder in which there is widespread and persistent infection with human papilloma virus, defect in cell - mediated immunity and propensity for malignant transformation. differential clinical and histopathologic evolutions of lesions in two cases of familial ev are compared and discussed in detail. cases were followed up for 7 years. detailed history, clinical features and investigations, including skin biopsy from different sites at different times, were examined. generalized pityriasis versicolor like hypopigmented lesions in both the cases, together with variable pigmented nodular actinic keratosis like lesions on sun - exposed areas, were present. multiple skin biopsies done from various sites on different occasions revealed features typical of ev along with lesions, i.e., actinic keratosis, bowen 's disease, basal and squamous cell carcinoma, in the elder sibling. however, skin biopsy of the other sibling showed features of ev and seborrheic keratosis only till date. this study reveals that the disease progression is variable among two individuals of the same family. malignant lesions were seen only on sun - exposed areas and may be associated with other skin lesions or infections such as angiokeratoma of fordyce and tinea cruris, as seen in this report.
	although the toxicity of lead was recognized centuries ago, concern was restricted to overt symptoms : colic, encephalopathy, anemia, or renal disease. two major reasons for lack of progress in restricting toxicity were that interest was limited to occupational exposures and there was lack of awareness of specific biochemical or metabolic effects. identification of subclinical effects has been possible the last 15 or 20 years because of the development of sensitive measures to detect cognitive and behavioral changes that are not apparent clinically and because of methods to measure the reduced activity of heme enzymes. this progress was driven by basic and clinical research that resulted in a better understanding of cellular toxicology. the new awareness prompted the lowering of acceptable occupational exposures, as measured by blood lead from 80 to 40 to 60 micrograms / dl range, and the establishment of maximum recommended exposures in children to a blood lead level of 25 micrograms / dl. lowering the lead content in gasoline has been accomplished by a nearly 50% decrease in average blood levels of persons in the united states (nhanes ii data). current research implicates lead as a contributing etiologic factor in a number of common diseases affecting large portions of the population such as subtle cognitive and neurological deficits, hypertension, congenital malformations, immunotoxicity, and deficits in growth and development. for each of these disorders there may be multiple etiologic factors ; the scientific challenge is to develop sensitive methodology to detect the specific role of lead. other potential subtle health effects include the influence of small amounts of lead on cell proliferation and lead as a cofactor in carcinogenesis.(abstract truncated at 250 words)imagesfigure 1.
jainism is one of the oldest religions of india, dating back to the 6 century bce. maharashtra has the maximum number of jains (1.3%), followed by rajasthan (1.2%), delhi (1.1%), and gujarat (1%). in south india, karnataka has 0.72% jains and tamil nadu has 0.12%. in spite of the small numbers, their present - day contribution to trade and culture is remarkable ; their contribution to the welfare of the marginalized society by way of munificent charities, especially for the founding and upkeep of educational and health - care institutions, is well - known. some of the important chronological events in jain history could be mentioned : founder of the jain religion vardhamana mahavira 's life spanned from 540 to 468 bce. probably, the earlier ones are mythical. after attaining omniscience (kaivalya) in his 42 year, he preached his religion all over the country for 32 yearsduring 322298 bce, chandragupta maurya accompanied by bhadrabahu, the eighth master after the passing away of mahavira, migrated to shravanabelagola in karnataka. here, both of them undertook sallekhana (death by ritual starvation) facing north (the direction from which the tirthankaras preached). the meaning of sallekhana can be translated as thinning of the passions and the body and lying on the sacred dharbai (kusha) grassa contingent of monks was sent to madurai to spread jainism under the leadership of bhutabali (6690 ce). they took abode in the caves of the eight hills surrounding maduraiestablishment of dravida sangam in madurai by vajranandi in 470 ce, to continue the work of the earlier teachersthe rapid spread of jainism in ancient tamil nadu was especially due to the royal patronage of the pallava king mahendravarman i of kancheepuram (600630 ce) and the pandya king kun - pandyan (the hunchbacked pandyan) of madurai (670710 ce). the profusion of the jain and buddhist monks wandering the precincts of the tamil land is mentioned painfully by the great saivite nayanmars, appar, and sambandar in their thevaram poems. after the royal conversion of pandyan to saivism by sambandar (after curing his intolerable abdominal pain with the sacred ash), the unsuccessful defeated jains were put to the stakes. founder of the jain religion vardhamana mahavira 's life spanned from 540 to 468 bce. probably, the earlier ones are mythical. after attaining omniscience (kaivalya) in his 42 year, he preached his religion all over the country for 32 years during 322298 bce, chandragupta maurya accompanied by bhadrabahu, the eighth master after the passing away of mahavira, migrated to shravanabelagola in karnataka. here, both of them undertook sallekhana (death by ritual starvation) facing north (the direction from which the tirthankaras preached). the meaning of sallekhana can be translated as thinning of the passions and the body and lying on the sacred dharbai (kusha) grass a contingent of monks was sent to madurai to spread jainism under the leadership of bhutabali (6690 ce). they took abode in the caves of the eight hills surrounding madurai establishment of dravida sangam in madurai by vajranandi in 470 ce, to continue the work of the earlier teachers the rapid spread of jainism in ancient tamil nadu was especially due to the royal patronage of the pallava king mahendravarman i of kancheepuram (600630 ce) and the pandya king kun - pandyan (the hunchbacked pandyan) of madurai (670710 ce). the profusion of the jain and buddhist monks wandering the precincts of the tamil land is mentioned painfully by the great saivite nayanmars, appar, and sambandar in their thevaram poems. after the royal conversion of pandyan to saivism by sambandar (after curing his intolerable abdominal pain with the sacred ash), the unsuccessful defeated jains were put to the stakes. jainism gives the following five doctrines for its followers : ahisa (nonviolence)satya (truth)asteya (not stealing)brahmacharya (chastity for laypeople and celibacy for jain monks and nuns)aparigraha (nonpossessiveness). asteya (not stealing) brahmacharya (chastity for laypeople and celibacy for jain monks and nuns) aparigraha (nonpossessiveness). accordingly, it also extols the three jewels (triratna) : right knowledge, faith, and action. this has made some scholars opine that saint thiruvalluvar is a jain. giving education, shelter, food, and curing illnesses are considered important and these qualities are reflected in the jain tradition of encouraging education, medical, and protective dwellings for the common humanity. since the founding of the religion, jainism has given prominence to sallekhana, death by ritual fasting facing north, as exemplified in the deaths of bhadrabahu and chandragupta maurya. the criteria which must be met to qualify for this practice are : intolerable personal problemsold ageincurable disease. intolerable personal problems during this period, the subject should not desire for a better status in the next birth or a place in the heavenly abode but meditate only on arugan (the jain god). there is also reference to this procedure in the 2 century ce sangam literature sirupanchamoolam. the popular view among western cultures about jainism (and buddhism) is that they are pessimistic in their outlook and fundamental philosophy. the mention of jainism / buddhism brings to the western mind, thoughts of monks and nuns clad in robes, leading austere lives characterized by asceticism, undertaking extreme penances, shunning the pleasures of the worldly life, and turning away from it., the practice of sallekhana logically appears to be a suicide equivalent. however, the aim of this current article is to try to correct this misunderstanding of the fundamental spirit and basic tenet of these eastern religions. these religions prescribe certain morals, ethics, and values which are very general desirable human virtues which are applicable to people of all walks of life, which include the maximum proportion of the population constituted by householders. whereas, the more severe forms of asceticism, tough rituals, and so on were reserved only for the monks and nuns who formed a significant minority. now coming to the accusation that sallekhana is equivalent to suicide, we must note that the practice was not sanctioned easily to all and sundry. the person who desired to undertake this fasting unto death would be interrogated by learned men whom he would have to convince regarding his religious and self - transcendent motive for pursuing the same. definitely, they would not have allowed any person to take his / her own life for any reason which they found clearly unworthy of the ritual. this controversy whether this religious form of starvation is related to suicide is debated since the time of the early jain teachers. the early buddhist tamil epic kundalakesi (the date and the author are unknown and the work is available only in parts ; scholars date it to the sometime in the first millennium ce) equates this practice to suicide. however, this idea is refuted forcibly in the tamil jain literature of the same period, neelakesi, as to how the stalwarts of ahimsa, i.e., the jains could approve death by suicide. (silappadikaram), by the jain prince - turned - jaina ascetic, ilango adigal, refers to this ritual fasting by the jain nun, kaundi adigal. the nun provided companionship to the unfortunate kovalan and his wife kannagi in their arduous journey from puhar (the chola capital) to the fateful city of madurai, where kovalan was unjustly executed, which infuriated kannagi leading her to burn the city. the above - mentioned deaths by starvation are also seen in the well - known hindu epics, mahabharata and ramayana. kings and warriors who have failed in their duty punish themselves for their sin and welcome death as an expiation. such starvation deaths are referred to as vadakirutthal (literally facing north) and become quite prevalent during the sangam age, probably copied from the jain culture. instances of death by fasting in the puranaanooru it is of relevance to mention here that though sallekhana and vadakirutthal are similar in many respects, vadakirutthal should be considered as a form of suicide and very different from sallekhana. the present - day thinking on sallekhana needs to be considered here in more detail which should be brought to the knowledge of current - day psychiatrists. now, we can proceed to pay attention to the research done in this regard by the present - day jurists, jain philosophers, and scholars. this is extensively discussed by the karnataka jurist justice tukol in his masterly survey of this jain traditional practice. justice tukol, in his seminal writing on sallekhana : sallekhana is not suicide, has advanced his views regarding how this religious fasting is not equivalent to suicide of laypeople. he has listed this behavior from ancient times by the great religious teachers, both men and women. katherina poggendorf - kakar calls this practice as a celebration of death, a process of liberating the soul by fasting oneself to death. she describes that the practice is highly respected in the jain tradition and is prevalent not only among jain ascetics but also among its laity. regarding the current - day prevalence of this practice in india, the author mentions that numbers around 200600 jains in india are fasting to death each year reported in indian newspaper articles, encyclopedias, and the internet. similar views are expressed in recent jain tradition - related articles by hotta kazuyoshi and kokila. since the founding of the religion, jainism has given prominence to sallekhana, death by ritual fasting facing north, as exemplified in the deaths of bhadrabahu and chandragupta maurya. the criteria which must be met to qualify for this practice are : intolerable personal problemsold ageincurable disease. intolerable personal problems during this period, the subject should not desire for a better status in the next birth or a place in the heavenly abode but meditate only on arugan (the jain god). there is also reference to this procedure in the 2 century ce sangam literature sirupanchamoolam. the popular view among western cultures about jainism (and buddhism) is that they are pessimistic in their outlook and fundamental philosophy. the mention of jainism / buddhism brings to the western mind, thoughts of monks and nuns clad in robes, leading austere lives characterized by asceticism, undertaking extreme penances, shunning the pleasures of the worldly life, and turning away from it. however, the aim of this current article is to try to correct this misunderstanding of the fundamental spirit and basic tenet of these eastern religions. these religions prescribe certain morals, ethics, and values which are very general desirable human virtues which are applicable to people of all walks of life, which include the maximum proportion of the population constituted by householders. whereas, the more severe forms of asceticism, tough rituals, and so on were reserved only for the monks and nuns who formed a significant minority. now coming to the accusation that sallekhana is equivalent to suicide, we must note that the practice was not sanctioned easily to all and sundry. the person who desired to undertake this fasting unto death would be interrogated by learned men whom he would have to convince regarding his religious and self - transcendent motive for pursuing the same. definitely, they would not have allowed any person to take his / her own life for any reason which they found clearly unworthy of the ritual. this controversy whether this religious form of starvation is related to suicide is debated since the time of the early jain teachers. the early buddhist tamil epic kundalakesi (the date and the author are unknown and the work is available only in parts ; scholars date it to the sometime in the first millennium ce) equates this practice to suicide. however, this idea is refuted forcibly in the tamil jain literature of the same period, neelakesi, as to how the stalwarts of ahimsa, i.e., the jains could approve death by suicide. (silappadikaram), by the jain prince - turned - jaina ascetic, ilango adigal, refers to this ritual fasting by the jain nun, kaundi adigal. the nun provided companionship to the unfortunate kovalan and his wife kannagi in their arduous journey from puhar (the chola capital) to the fateful city of madurai, where kovalan was unjustly executed, which infuriated kannagi leading her to burn the city. the above - mentioned deaths by starvation are also seen in the well - known hindu epics, mahabharata and ramayana. kings and warriors who have failed in their duty punish themselves for their sin and welcome death as an expiation. such starvation deaths are referred to as vadakirutthal (literally facing north) and become quite prevalent during the sangam age, probably copied from the jain culture. instances of death by fasting in the puranaanooru it is of relevance to mention here that though sallekhana and vadakirutthal are similar in many respects, vadakirutthal should be considered as a form of suicide and very different from sallekhana. the present - day thinking on sallekhana needs to be considered here in more detail which should be brought to the knowledge of current - day psychiatrists. now, we can proceed to pay attention to the research done in this regard by the present - day jurists, jain philosophers, and scholars. this is extensively discussed by the karnataka jurist justice tukol in his masterly survey of this jain traditional practice. justice tukol, in his seminal writing on sallekhana : sallekhana is not suicide, has advanced his views regarding how this religious fasting is not equivalent to suicide of laypeople. he has listed this behavior from ancient times by the great religious teachers, both men and women. katherina poggendorf - kakar calls this practice as a celebration of death, a process of liberating the soul by fasting oneself to death. she describes that the practice is highly respected in the jain tradition and is prevalent not only among jain ascetics but also among its laity. regarding the current - day prevalence of this practice in india, the author mentions that numbers around 200600 jains in india are fasting to death each year reported in indian newspaper articles, encyclopedias, and the internet. similar views are expressed in recent jain tradition - related articles by hotta kazuyoshi and kokila. sallekhana has been in news in recent times. on august 10, 2015, the rajasthan high court had passed the judgment that sallekhana or santhara is illegal and equal to suicide, and had directed that firs be filed against individuals undertaking this ritual death. however, this judgment was challenged in the supreme court, following which the apex court stayed this judgment on the 31 of the same month, stating that the equating of this practice to suicide and banning it was unconstitutional. following this, an octogenarian jain woman from bikaner announced that she was undertaking the ritual fast and gave up her life., it was not very long before an 83-year old jain woman from tiruvannamalai district ended her life by this procedure. hence, in conclusion, in the context of the present day, we need not agree with durkheim when he says buddhism and jainism are pessimistic religions. it is also a matter which concerns us that some of the material on sallekhana has not been discussed by the present - day indian psychiatrists including suicidologists. the origins of this astute shunning of the eating of animals by these peoples can be found in the times of origin of this religion. these people feared that the rampant mass killing of livestock would lead to severe reduction in their numbers leading to serious problems in continuing agricultural and animal husbandry which was the backbone of their civilization. another notable aspect is the descriptions available regarding transgender individuals, transvestism, and related subjects in those times. there is a description of a pedi koothu, i.e., a dramatic performance by a hermaphrodite, in the classic text, silappadikaram. it was an epic written by the tamil jain poet ilango, who was a close friend of sathanar (the tamil buddhist poet who wrote the epic manimekalai). this koothu is performed by the great dancer madhavi, in the city of puhar, in front of her lover kovalan. the origins of this astute shunning of the eating of animals by these peoples can be found in the times of origin of this religion. these people feared that the rampant mass killing of livestock would lead to severe reduction in their numbers leading to serious problems in continuing agricultural and animal husbandry which was the backbone of their civilization. another notable aspect is the descriptions available regarding transgender individuals, transvestism, and related subjects in those times. there is a description of a pedi koothu, i.e., a dramatic performance by a hermaphrodite, in the classic text, silappadikaram. it was an epic written by the tamil jain poet ilango, who was a close friend of sathanar (the tamil buddhist poet who wrote the epic manimekalai). this koothu is performed by the great dancer madhavi, in the city of puhar, in front of her lover kovalan. chennai : poompuhar pathippagam ; 2010kaumaareeswari sirupanchamoolam (book in tamil by kaari asaan, c. 2 century ce) saradha pathippagam. chennai : poompuhar pathippagam ; 2010 kaumaareeswari sirupanchamoolam (book in tamil by kaari asaan, c. 2 century ce) saradha pathippagam.	jainism is one of the oldest religions of india. since the founding of the religion, jainism has given prominence to sallekhana, death by ritual fasting facing north, as exemplified in the deaths of bhadrabahu and chandragupta maurya. the controversy whether this religious form of starvation is related to suicide is debated since the time of the early jain teachers. history is replete with instances where kings and warriors who have failed in their duty punish themselves for their sin and welcome death as expiation. such starvation deaths are referred to as vadakirutthal (literally, facing north) and become quite prevalent during the sangam age, probably copied from the jain culture. the present - day thinking on sallekhana needs to be considered here in more detail which should be brought to the knowledge of current - day psychiatrists. these ideas are relevant to psychiatric counseling of the ordinary people and would be very useful if included in the armamentarium of the mental health professionals.
the concept of the fetal genome is no longer that of a static framework inherited from paternal and maternal sources but a malleable scaffold constantly adapting to stimuli. this is most evident in studies involving fetal programming due to the effects of nutritional variation and glucocorticoid exposure. here, we examined the resulting fetal molecular preconditioning due to antenatal steroid therapy using a protein - restriction mouse model. this model was first designed in a previous study as a novel approach to evaluate postnatal adaptive responses due to varied prenatal nutritional conditions and the addition of stress or steroids. molecular evidence revealed that prenatal programming secondary to maternal protein restriction rendered an inherent susceptibility to neural compromise in neonates and any further addition of antenatal steroids may be detrimental to these already injury - prone offspring. thus, an examination of underlying molecular mechanisms in the fetus was warranted to elucidate the effects seen postnatally. understanding any subtle changes in the fetus induced by these factors and their correlation with phenotypic outcomes in the adult would facilitate early detection of either well - being or disease. current biomolecular techniques such as microarray analysis have allowed the investigation of global gene expression and subsequently, the parallel data mining of gene transcripts of interest as well as the discovery of new gene involvement. moreover, gene expression profiles through clustering of significant genes have shown promising potential as diagnostic panels. all these have led to the rapid identification of biomarkers for disease conditions and their associated regulatory pathways. using these advancements, a panoramic view of genetic movement in utero female c57bl/6n mice about 6 weeks old provided by the institute for animal experimentation, tohoku university graduate school of medicine, were maintained under controlled lighting (12-hour light cycles) and temperature (24c). these were allowed for free access to food (ain-93 g : oriental yeast co., ltd., tokyo, japan) and water during a 2-week acclimatization period after which each female was time mated with a male. pregnant females (n = 36) were then housed singly and administered either control (c) or protein restricted (pr) diets ad libitum all throughout pregnancy (embryonic stage, e0 to e17). these were then further subdivided into 6 groups and subjected to either plain normosaline solution (c - s, pr - s) or 100 g / kg dexamethasone sodium phosphate (decadron, msd k.k., tokyo, japan) in normosaline solution (c - d / s, pr - d / s) by subcutaneous injection daily during late gestation (e10 to e17). maternal weights on days e0, e10, and e17 were recorded, as well as fetal weights on e17. on embryonic day 17, whole brain samples collected from 2 male and 2 female fetuses from each litter were supercooled in liquid nitrogen and stored at 80c. a total of 6 toray 3d - gene mouse oligo chip 24 k (toray industries, inc., tokyo, japan) microarrays were analyzed per treatment. each chip utilized a 0.5 g portion of combined total rna from a matched pair of male and female samples. rna was amplified and labeled using an amino allyl messageamp ii arna amplification kit (life technologies japan ltd.) according to the manufacturer 's instructions. each sample of arna was labeled with fluorescence cy3 or cy5 and cohybridized at 37c for 16 hours. hybridization signals were scanned using scan array express (perkin elmer, ma, usa) and global background analysis was performed using genepx pro (mds analytical technologies, ca, usa). all 36 arrays were then normalized together as one experiment to reduce nonbiological variability. to validate microarray results, qpcr was performed on 2 selected genes, microtubule - associated protein 1b (mtap1b) and 3-hydroxy-3-methylglutaryl - coa synthase 1 (hmgcs1), using the c and c - d / s treatments. total rna was extracted from whole fetal brains (n = 6 per treatment) using qiazol lysis reagent (qiagen, hilden, germany) and cleaned with an allprep dna / rna mini kit (qiagen, hilden, germany) according to the manufacturer 's protocol. complimentary dna was synthesized using the superscript iii first - strand synthesis system (invitrogen, carlsbad, ca) and quantitative pcr was conducted with express sybr greener supermix with premixed rox (invitrogen, carlsbad, ca) on an eppendorf realplex mastercycler (eppendorf, hamburg, germany). amplified transcripts were quantified and normalized against hypoxanthine phosphoribosyltransferase 1 (hprt1). microarray data were subjected to t - test analyses with standard bonferroni correction for multiple comparisons. the p value was set at 0.05 and a threshold of 1.5-fold was applied to determine significantly regulated genes. these were subjected to an ontological review and a subset of neurodevelopmental genes for genetic profiling was determined by hierarchical clustering. targeted gene transcripts of interest on the microarrays were treated to one - way anova with post - hoc analysis (bonferroni post - test). confirmation of selected genes by qpcr was validated through fold change analysis (threshold of 1.5-fold). data management, statistical analysis, and gene ontology were performed using geworkbench software (https://gforge.nci.nih.gov/frs/?group_id=78) and mgi gene ontology tools (http://www.informatics.jax.org/gotools/). mean maternal weight gain patterns, between groups, were similar before (e0 to e10) and during treatment (e10 to e17). mean fetal brain to body weight indices on sampling day e17 were not significantly different (figure 1). microarray analyses of 23,522 probe transcripts presented 10,946 genes without absent calls or unreadable hybridization signals. there were more upregulated genes as compared to downregulated genes across all treatment groups (figure 2, table 1). the combined number of significant genes regulated from all treatment groups versus the control was 332 (figure 3). subsequent gene ontology analysis revealed that ongoing cell organization and biogenesis, developmental processes, and transport were most rampant in the global expression survey. the discovery of genes uniquely activated per treatment and sharing similar ontologies facilitated individual treatment characterization (table 2(a)). associated genes were found for protein restriction, cell adhesion genes in both pr - d / s only (col1a1, atp1b2, ctnnd1, rpsa, and fat4), and pr - s only (cdh2, edil3, and astn1) ; for dexamethasone treatment, stress response genes in both c - d / s only (brsk1, rarres2), and pr - d / s only (klk8, myo6, ndufa6, col1a1, mapk8, and phlda3) ; and for both protein restriction, dexamethasone treatment, and dna metabolism genes for pr - d / s only (tcf3, mapk8). overall, neurodevelopmental genes were overrepresented among those significantly regulated (table 2(b)) and were associated with nervous system development (pbx3, eif2b5, nlgn1, mark4, atp2b2, nrxn3, ncam1, tnik, slitrk1, cdh2, synj1, palm, nrp1, rpl24, mtap2, rpgrip1, pou3f2, gabrb3, lrp6, sulf2, ank3, ccdc88a, atrx, nr2c2, opa1, abi2, mtap1b, tcf3, syne1, mapk8, golga2, atxn2, gfra1, snap91, slitrk5, celsr2, emx2, klk8, myo6, scn2a1, sema3c, and kif5c) ; generation of neurons (pbx3, nlgn1, atp2b2, ncam1, tnik, slitrk1, cdh2, synj1, palm, nrp1, rpl24, mtap2, rpgrip1, pou3f2, gabrb3, lrp6, ank3, ccdc88a, abi2, mtap1b, tcf3, syne1, mapk8, golga2, atxn2, gfra1, slitrk5, snap91, celsr2, emx2, klk8, myo6, sema3c, kif5c, robo2, arhgef2, brsk1, pou3f4, and sox11) ; neuron differentiation (pbx3, nlgn1, atp2b2, ncam1, tnik, slitrk1, cdh2, palm, nrp1, rpl24, mtap2, rpgrip1, pou3f2, gabrb3, lrp6, ank3, ccdc88a, abi2, mtap1b, tcf3, syne1, mapk8, golga2, gfra1, atxn2, slitrk5, snap91, celsr2, emx2, klk8, myo6, sema3c, kif5c, robo2, brsk1, pou3f4, and sox11) ; neurogenesis (pbx3, eif2b5, nlgn1, atp2b2, ncam1, tnik, slitrk1, cdh2, synj1, palm, nrp1, rpl24, mtap2, rpgrip1, pou3f2, gabrb3, lrp6, ank3, ccdc88a, abi2, mtap1b, tcf3, syne1, mapk8, golga2, atxn2, gfra1, slitrk5, snap91, celsr2, emx2, klk8, myo6, sema3c, kif5c, robo2, arhgef2, brsk1, pou3f4, and sox11) ; neuron development (pbx3, abi2, mtap1b, syne1, mapk8, golga2, nlgn1, atxn2, gfra1, snap91, slitrk5, celsr2, atp2b2, ncam1, tnik, slitrk1, klk8, cdh2, myo6, sema3c, palm, kif5c, nrp1, rpl24, robo2, mtap2, rpgrip1, brsk1, pou3f2, gabrb3, ank3, and ccdc88a) ; and neuron projection development (abi2, mtap1b, syne1, mapk8, golga2, nlgn1, atxn2, gfra1, snap91, slitrk5, celsr2, ncam1, tnik, slitrk1, klk8, cdh2, myo6, sema3c, palm, kif5c, nrp1, rpl24, robo2, mtap2, brsk1, pou3f2, ank3, and ccdc88a). a subset of 8 genes out of 332 was filtered through the hierarchical clustering method allowing segregation of treatments (figure 4). an assessment of individual biological themes within the subset revealed neurodevelopmental roles and distinct causal relationships with glucocorticoid treatment and protein restriction (table 3). the addition of stress or steroids (-s and -d / s groups) greatly affected gene regulation leading to further investigation of genes related to glucocorticoid and stress signaling pathways. mapk8, fkbp5, mkp-1, pp2a, akt, and gsk3 exhibited expression patterns across treatment groups that corresponded to an overall reduction in glucocorticoid receptor (gr) activity in the -d / s and -s groups. most significant of which were the marked differences between c - d / s and pr - d / s (mapk8, gsk3, and mtap1b) emphasizing the disparate effect on varying nutritional conditions due to dexamethasone administration (figures 5(a) and 5(b)). qpcr results demonstrated a good agreement with the microarray data for mtap1b and hmgcs1 (figure 6). the maternal - fetal compartment serves to cushion the fetus from environmental stimuli, but beyond normal circumstances, prenatal conditioning invariably occurs. microarray analysis allowed for a panoramic view of gene activity along two levels : through the global expression of genes and through individual treatment groups and their association with one another. in general, ongoing cell organization and biogenesis, developmental processes, and transport were most rampant in the global expression survey (table 2(a)). the dominance of these particular gene groups is expected in the developing fetus just as genes for growth and maturation are more likely activated in neonates. regardless, these increased gene frequencies most likely demonstrate consequent fetal reactions to acquired insults from protein restriction and glucocorticoid exposure either as compensatory regulation or protective feedback. they signaled changes within a fetus long previously believed to be immune prior to the conception of the barker theory. this was exemplified by recurring themes in biological processes related to ongoing brain development during fetal stages : multipotent progenitor differentiation and neuronal migration. their increased expression over other gene systems emphasized the significance of fetal neuroplasticity even to the detriment of visceral organ growth similar to physiologic brain sparing. this also underlined the early dependence on brain - controlled pathways that trigger bodily functions during stages when less developed organs have not yet attained full functional independence. the isolation of distinct genes associated with individual factors of protein restriction, dexamethasone, and stress were complimentary to known gene networks. studies of these genes uniquely regulated in both pr - d / s (col1a1, atp1b2, ctnnd1, rpsa, and fat4) and pr - s only (cdh2, edil3, and astn1) emphasized the crucial role of nutritional factors in maintaining the integrity of cell interaction. col1a1, a known marker of fibrosis and aging, has been linked to alterations in oxidative and antioxidant defense capacity in cells due to poor maternal nutrition. on the other hand, modifications in atp1b2, edil3, and astn1 during development lead to glial dysfunction [1416 ]. moreover, various studies on nutritional factor effects and progenitor cell differentiation included ctnnd1, fat4, and cdh2 [1719 ]. fetal dexamethasone exposure impairs development in various cell types eliciting a dose - dependent stress response. in the brain, the pituitary is the site of action of administered dexamethasone in the blockade of stress induced hypothalamic - pituitary axis (hpa) activation. the latter involves the stimulation of brain receptors, primarily, those of glucocorticoid receptors (gr) by both exogenous and endogenous corticosterone. during conditions of stress, the hpa axis releases reactive feedback which suppresses increased excitability allowing recovery from stress induced activation and facilitation of memory storage. the addition of dexamethasone can partially deplete the brain of corticosterone and in turn suppress the fetal hpa axis. studies that included the genes uniquely regulated in c - d / s (brsk1, rarres2) and pr - d / s (klk8, myo6, ndufa6, col1a1, mapk8, and phlda3) report their important roles in neuroregulation and adaptation to stress responses during brain development [2125 ]. furthermore, expression patterns of targeted genes related to stress signaling pathways revealed decreased gr activity : mapk8 (mitogen activated protein kinase 8) and fkbp5 (fk506 binding protein 5), both gr inhibitors [26, 27 ], were increased in the -d / s and -s groups ; mkp1 (mitogen activated protein kinase phosphatase 1) and pp2a (protein phosphatase 2), both map kinase inhibitors [28, 29 ], were decreased in the -d / s and -s groups (figure 5(a)). genes associated with pr - d / s only (tcf3 and mapk8) on microarray analysis, as well as two targeted genes (akt and gsk3) all function in metabolic gene networks, especially for glucose metabolism in dna synthesis. here, their specific expression patterns between -d / s groups underscored the most significant observation in this study, which was the apparent harmful effect of dexamethasone to fetuses in highly stressed conditions (pr - d / s). a diagram interrelating the targeted genes of interest with regard to gr activity is shown in figures 7(a) and 7(b). previous reports have stated that a loss of gr activity reduces dexamethasone inhibition of akt (thymoma viral protooncogene 1), which in turn decreases akt inhibition of gsk3 (glycogen synthase kinase 3), a proapoptotic gene [3032 ]. but in the pr - d / s group, a highly stressed condition, dexamethasone was evidently harmful. this disparate pattern between c - d / s and pr - d / s, significant in mapk8, gsk3, and mtap1b (p < 0.0001), denotes the possibility of ongoing altered neurodevelopment or even neurodysgenesis (figure 5(b)). the process of data mining revealed the association between regulated genes unique to individual treatment groups and certain biologic processes. their correlation provided a better understanding of underlying pathophysiology and a glimpse of key pathways for future focused studies. one possible application is the development of gene panels for genetic expression profiling as diagnostic tools. hierarchical clustering programs currently allow the generation of gene maps to be capable of distinguishing between phenotypes. in our simulation, highly regulated neurodevelopmental genes were used and these successfully segregated treatments between microarrays (figure 4). our findings strengthen our previous study 's assertion that fetal programming secondary to maternal protein restriction renders an inherent susceptibility to neural compromise in offspring and that the addition of dexamethasone to this vulnerable group results in further injury. in future studies, the investigation of both sex - specific and transgenerational effects is necessary as glucocorticoids influence endocrinological pathways differently in males and females. also, timing of exposure to glucocorticoids as well as dosage studies is no less relevant especially in the light of reported evidence that a single course of therapy profoundly affects the fetal hpa axis [3335 ]. in conclusion, the effects of antenatal steroid therapy can vary for each fetus according to maternal - fetal factors and concurrent environmental stimuli. further elucidating regulatory networks that can mark the turning point between beneficial or damaging corticosteroid actions would result in valuable adjustments of current treatment protocols. the ability to recognize conditions highly vulnerable to damage would also expand the possibility of tailored medicine more suitable to each individual 's needs. current biomolecular techniques are powerful tools in this field of study but further validation between animal and true clinical models is required.	introduction. prenatal programming secondary to maternal protein restriction renders an inherent susceptibility to neural compromise in neonates and any addition of glucocorticosteroids results in further damage. this is an investigation of consequent global gene activity due to effects of antenatal steroid therapy on a protein restriction mouse model. methods. c57bl/6n pregnant mice were administered control or protein restricted diets and subjected to either 100 g / kg of dexamethasone sodium phosphate with normosaline or normosaline alone during late gestation (e10e17). nontreatment groups were also included. brain samples were collected on embryonic day 17 and analyzed by mrna microarray analysis. results. microarray analyses presented 332 significantly regulated genes. overall, neurodevelopmental genes were overrepresented and a subset of 8 genes allowed treatment segregation through the hierarchical clustering method. the addition of stress or steroids greatly affected gene regulation through glucocorticoid receptor and stress signaling pathways. furthermore, differences between dexamethasone - administered treatments implied a harmful effect during conditions of high stress. microarray analysis was validated using qpcr. conclusion. the effects of antenatal steroid therapy vary in fetuses according to maternal - fetal factors and environmental stimuli. defining the key regulatory networks that signal either beneficial or damaging corticosteroid action would result in valuable adjustments to current treatment protocols.
the creation of a comprehensive collection of non - essential open reading frame (orf) deletions in the yeast saccharomyces cerevisiae has made this organism a primary model for genomics and high - throughput biology (1). the genomics data generated using the gene deletion collection has been central in driving the development of systems biology (2). when analyzing the orfs identified in a genome - wide yeast screen, it is possible to determine the genetic and physical interactions between them using relatively sophisticated approaches [for example, biopixie, (3) ]. additionally, using gene ontology term enrichment analysis, it is possible to determine if functional categories are enriched within a set of orfs [reviewed in (4) ]. there are also tools that provide an overview of multiple phenotypic properties (interactions, localization, etc.) for a given list of genes [for example, funspec (5) ]. however, what is lacking is a database and search tool that (i) identifies common orfs between a queried set and orfs characterized by individual genome - wide studies, (ii) orders the results based upon the likelihood of the overlap and (iii) lists the manuscripts associated with the studies. we have assembled a database from published manuscripts of hundreds of groups of orfs identified in, or derived from, large - scale yeast screens. we have focused our attention upon datasets that have systematically utilized the non - essential gene deletion collection to assay a specific phenotype. however, there are an increasing number of screens included in screentroll using collections of mutant alleles of essential genes. there are two types of screens that are commonly reported : first, those that list a set of orfs as affected. for example, alvaro. (6) screened each non - essential gene deletion for its ability to increase the frequency of nuclear foci of rad52, a key dna repair protein. the database entry for that study includes a short description of the screen phenotype : elevated rad52 foci, a summary of the manuscript describing the screen : alvaro. plos genetics. 3 ; e228 with its pubmed i d number and finally, a list of the orfs that were identified in the study. much of this type of data is not included in other databases and these data are the core of the screentroll database. the second type is genome - wide screens that report quantitative data for each deletion, but do not necessarily provide a cutoff value or a defined list of affected orfs. for example, a growth ratio on the experimental condition versus the control condition is listed for each deletion. to assemble a list of orf deletions from these quantitative screens, we chose a specific cutoff value to generate a list of orfs with the strongest phenotype and have indicated this cutoff value in the screen description. for example, the description 1.5 m sorbitol sensitive at 15 generations (competition assay > 100 fitness defect), indicates that the selection of strains chosen for the screentroll database from the study of giaever. (7) are sensitive to 1.5 m sorbitol after 15 generations and showed a further details of the definition of fitness defect are clearly explained in the manuscript describing the screen, whose link is accessible directly from the screentroll output. (8) large - scale synthetic genetic array (sga) study, where more than 1700 different query gene deletions were assayed against the entire library. the data from these screens were reported quantitatively and we have included orfs within an intermediate cutoff value defined by the authors (\|\| > 0.08, p 0.08 & p - value < 0.05) - query : ypl256c (cln2). to query the screentroll database for commonalities, we have built a web - based search tool that enables users to enter one or more yeast orfs (the query set) into a single search window. the screens that most closely match the query set are listed in a rank order based upon a rank score (a description of the statistical methods used to evaluate this score is provided on the website and in supplementary data). the rank order is not a precise statistical ranking, but allows the user to focus on screens with extensive overlap as well as screens that identify mutually exclusive sets of orfs (highlighted in blue). this latter group also provides functional insight since mutual exclusivity likely indicates that the two different phenotypes result from separate molecular pathways. additionally, when screentroll identifies an overlap, a list of orfs in common with the query set is provided along with a link to the pubmed reference for the manuscript describing the particular screen. this feature facilitates access to the details of each screen enabling users to evaluate the potential biological significance of the individual orfs identified. rank score, which is a calculation of the hypergeometric p - value of each comparison. a simple adjustment for multiple comparison testing using the bonferroni method (9) can be readily applied by multiplying the rank score by the number of screens tested (provided at the top of the results screen). first, the rank score assumes that both the user s query set and each screen in the database are derived from the same set of 4800 strains in the viable yeast deletion collection second, each published yeast screen has its own, often unknown or unreported, false positive and negative discovery rates, which directly affects the likelihood of an overlap. third, we feel that the biological importance of an overlap between two groups of orfs is best determined by carefully examining the manuscript describing how the orf list was derived. some screens in the screentroll database are the result of characterizing each deletion strain individually, however, many screens use a competition method. for this latter approach, the entire deletion collection is pooled together and exposed to experimental conditions (7). subsequent microarray hybridization analysis of bar code sequences specific for each yeast deletion reveals the relative levels of each strain in the pooled population. in this way, strains affected by the experimental condition are identified. in one such study, an exhaustive list of hundreds of different conditions and compounds were tested in both homozygous and heterozygous diploid strains (10) and much of this data is included in the screentroll database. however, competition assays do not directly test each strain separately and some users may prefer to exclude this type of data from their analysis. consequently, screentroll includes the option of excluding data from competition assays in each search. screentroll was initially designed to highlight screens that include significant analysis of the associated phenotype. these screens, although genome wide, generally focus on a specific mechanism or phenotype (e.g. rad52 focus formation, methyl methanesulfonate (mms) sensitivity, chromosome instability, etc.) and the manuscripts associated with them provide considerable detail about their findings. nevertheless, as noted above, we have also included most of the very large scale screening data from the costanzo. however, some users may prefer to restrict their search to the core screentroll data set, since the massive amount of data from the sga screens may overwhelm the output and mask overlaps with the more focused screens. hence, we have included an option to exclude the data from these large - scale synthetic genetic array experiments. primarily, users will enter a set of orfs identified in a new screen, the query set, to compare with those identified from other screens. if a strong match is found, it suggests that both the user s screen and the published screen share a common feature. for example, we entered a set of orfs identified by our laboratory as being important to prevent high levels of rad52 foci (6). screentroll identifies screens that assay for chromosomal instability (11), sensitivity to methyl methanesulfonate (12) and the sumoylation pathway (13), as those that most closely match the query set (a portion of the screentroll output is shown in figure 1). these matches confirm the shared pathway of dna damage repair for all of these screens and highlight potentially new insights into the role of sumoylation in regulating the dna damage response. in addition, having the complete list of overlapping screens is useful since some of the individual orfs further down the list, which are common to a particular screen, may be of interest to the user. for example, a screen for propanol sensitivity identified irc15 and irc25, two previously uncharacterized orfs from the alvaro screen (14) portions of the output from a screentroll search using the set of 86 orfs identified by alvaro. (6) are shown. screentroll displays a table of the screens in the database ordered by a rank score of the overlap with the query set (top). below the table, the overlap summary includes more details of each screen including the specific orfs that overlap with the query set and a link to the pubmed entry for the manuscript that describes the screen (bottom). both the competition and the costanzo. portions of the output from a screentroll search using the set of 86 orfs identified by alvaro. screentroll displays a table of the screens in the database ordered by a rank score of the overlap with the query set (top). below the table, the overlap summary includes more details of each screen including the specific orfs that overlap with the query set and a link to the pubmed entry for the manuscript that describes the screen (bottom). both the competition and the costanzo. if the user is interested in exploring a new or existing pathway, screentroll can be used to query the orfs that encode that pathway to determine whether they were enriched in previous screens. for example, the spindle assembly checkpoint (sac) is a key regulator of mitosis and it is possible to query the database with mad1, mad2, mad3, bub1 and bub3, each of which encode key non - essential components of the sac [see (15) and references therein ]. the screentroll output from this query can be viewed by selecting the example provided on the screentroll website. at the time of publication, the first four screens [excluding the costanzo. (8) sga data ] that most closely match this query set are (i) gene deletions that are synthetic lethal with kinetochore mutants (16), (ii) deletions that fail to maintain an originless plasmid (17), (iii) deletions that are sensitive to the microtubule poison benomyl (18) and (iv) deletions that result in chromosome instability (11). since the sac proteins are located at the kinetochore and help to direct chromosome segregation, these data are consistent with the known mechanism of the sac. however, the fifth screen listed is a screen for increased rad52 dna repair centers (6), reinforcing a role for the sac in preventing dna damage (19,20). if a user is interested in a single gene, screentroll can list all of the screens that identified it. for example, if a user enters rad50, the results show that this gene was identified in numerous genome - wide screens for dna damage sensitivity, consistent with its known role in dna repair. finally, there are a wealth of gene - gene and protein - protein interaction data available for yeast (8,16,18,2125) and excellent tools to query these data [for examples, see (26,27) ]. using this simple tool, similarities between screens are revealed and listed in rank order. the results of screentroll are useful for deciding which orfs identified in a new screen are of specific interest due to a shared phenotype. moreover, identifying the screen phenotype conferred by deletion of a specific orf, or set of orfs, can illuminate the biological function of the encoded protein(s) and aid in the design of new assays to test its function. we envision that screentroll will be of use to anyone interested in analyzing the results of yeast genomic data. this website includes the option to separately download the entire database, the source code for the application and information about the statistics used to generate the rank score. in addition, screentroll is available through individual orf pages on the saccharomyces genome database (yeastgenome.org). national institutes of health (gm50237 and gm67055 to r.r. and gm008798 and ca009503 to j.c.d.). funding for open access charge : national institutes of health (gm50237 and gm67055).	systematic biological screens typically identify many genes or proteins that are implicated in a specific phenotype. however, deriving mechanistic insight from these screens typically involves focusing upon one or a few genes within the set in order to elucidate their precise role in producing the phenotype. to find these critical genes, researchers use a variety of tools to query the set of genes to uncover underlying common genetic or physical interactions or common functional annotations (e.g. gene ontology terms). not only it is necessary to find previous screens containing genes in common with the new set, but also useful to easily access the individual manuscript or study that classified those genes. unfortunately, no tool currently exists to facilitate this task. we have developed a web - based tool (screentroll) that queries one or more genes against a database of systematic yeast screens. the software determines which genome - wide yeast screens also identified the queried gene(s) and the resulting screens are listed in an order based on the extent of the overlap between the queried gene(s) and the open reading frames (orfs) characterized in each individual yeast screen. in a separate list, the corresponding orfs that are found in both the queried set of genes and each individual genome - wide screen are displayed along with links to the relevant manuscript via nih s pubmed database. screentroll is useful for comparing a list of orfs with genes identified in a wide array of published genome - wide screens. this comparison informs users whether any of their queried orfs overlaps a previous study in the screentroll database. by listing the manuscript of the published screen, users can read more about the phenotype associated with that study. together, this information provides insight into the function of the queried genes and helps the user focus on a subset of them.
endometriosis is characterized by the presence of active endometrial tissue outside of the uterine cavity. endometriosis can involve the genitourinary tract, with the bladder being the most commonly affected site. symptomatic urinary tract involvement is rare, occurring in 1% to 2% of women, and it typically presents with dysuria, suprapubic pain, and, rarely, hematuria. medical therapy is palliative and definitive therapy is surgical. a 47-year - old african american woman (gravida 1, para 1) with a 25-week size fibroid uterus presented with pelvic pain and menorrhagia and wanted definitive surgical management. despite prior management with depot - lupron and a prior open myomectomy, the patient continued to complain of heavy vaginal bleeding, with increasing dysmenorrhea and occasional dyspareunia. the patient reported pelvic pressure symptoms but denied any urinary symptoms of hematuria or flank pain on evaluation and review of her past medical records. her past medical history was significant for hypertension, and her past surgical history included laparoscopic surgery for endometriosis and an open myomectomy. a pelvic examination revealed a uterus palpable 4 cm above the umbilicus that was fixed and slightly tender. there were no other masses noted on the examination and there was no fullness or tenderness of the bladder. transvaginal ultrasonography demonstrated a 17-cm uterus with multiple intramural myomas, the largest being 5 5 cm ; a 4 4-cm submucosal myoma, normal right adnexa, and a left adnexa and bladder could not be visualized. a computed tomography scan of the abdomen and pelvis from a prior emergency department visit demonstrated left hydronephrosis with marked cortical thinning and the possibility of a 5-cm bladder mass described along the dome of the bladder (figure 1). a, the arrow shows the left marked hydronephrosis with cortical thinning (b) 5.5 3.2-cm irregular enhancing lesion within the left bladder (arrow). the patient 's surgery was a joint case between the urology and gynecology departments, and the patient underwent an abdominal supracervical hysterectomy because of extensive pelvic adhesive disease, enterolysis, and transurethral resection of a bladder mass. findings at the surgery included a 25-week size uterus with multiple fibroids on the anterior uterus, fundus, and bilateral broad ligaments, overlying small intestine on the anterior surface of the uterus and adherent to the left pelvic side wall. there was also severe pelvic adhesive disease to the posterior surface of the uterus, posterior cul - de - sac endometriosis, contributing to a distorted pelvic anatomy. a cystoscopy was performed and revealed a 5- to 7-cm lobulated and nodular solid mass at the left hemitrigone that involved the left ureteral orifice (figure 2, a and b). a retrograde pyelogram demonstrated severe left hydronephrosis and narrowing of the distal ureter. despite multiple attempts, a ureteral stent was unable to be passed. a transurethral resection of the bladder mass with negative margins was performed, with a preliminary diagnosis of endometriosis. a, nodular and lobulated bladder mass found medial and superior to the left ureter on cystoscopy. a panel of immunohistochemical stains was performed on the bladder mass that were positive for estrogen and progesterone receptors and ck7 with the diagnosis of endometriosis. the patient recovered well after her surgery and is currently being treated with 3 monthly depot lupron injections and daily 5-mg norethindrone add - back therapy. she will be followed up with a cystoscopy and pelvic magnetic resonance imaging scan in 6 months to check for endometriosis recurrence. bladder endometriosis (be) usually affects women in the reproductive age - group, at an average age of 35 years. within the urinary system, as many as 30% of patients remain asymptomatic and diagnosis is incidental although symptomatic, urinary tract involvement is rare, occurring in 1% to 2% of women ; it typically presents with dysuria, suprapubic pain, cyclic urgency, and rarely hematuria, symptoms similar to those of recurrent cystitis, which may be responsible for its delayed diagnosis. according to the onset type, be is defined as primary or secondary. primary be is a spontaneously occurring disease, whereas secondary be is an iatrogenic lesion occurring after pelvic surgery. in fact, up to 50% of patients with be have a history of prior pelvic surgery with lesions from implanted endometrium or extensions from adenomyosis from the anterior uterine wall. our patient had a prior pelvic surgery of an abdominal myomectomy, and we speculate her bladder lesion may have emerged from implanted endometrial tissue. the pathogenesis of be is controversial, but the lesion has been described to evolve from the serosal surface of the bladder toward the mucosa. it is often multifocal, with the trigone and the dome the most frequently affected sites. imaging modalities for be include transvaginal bladder ultrasonography, with specificity and positive and negative predictive values of 100%, and pelvic magnetic resonance (mr) reaching a sensitivity of 88% and specificity of 99%. cystoscopy is one of the most cost - effective tests and may reveal isolated or multifocal lesions usually located at the dome or base of the bladder. calculating the distance between the ureteral orifices and the lower endometrotic margin is critically important to define the most correct surgical approach. endoscopic biopsy is critical to exclude bladder carcinomas, varices, papillomas or angiomas, as well as detrusor mesenchymal tumors. although long - term medical management is preferred over serial surgeries for the management of endometriosis, a recent study showed that 25% of patients who underwent surgery for endometriosis had additional surgery within 4 years. in our case, a supracervical hysterectomy was performed because of extensive anatomical distortion caused by her fibroids, and we have successfully controlled her symptoms postoperatively with medical suppression therapy. the main surgical debate is whether to preserve the ovaries at the time of hysterectomy. data have shown that women who undergo hysterectomy with ovarian preservation have a higher risk of undergoing repeat surgery up to 7 years later as opposed to women who have ovarian removal. however, health implications of ovarian removal need to be reviewed with the patient, and the surgical plan must be individualized based on health risks and benefits. on the other hand, the treatment of be is controversial because of the rarity of the condition. treatment includes medical therapy using gonadotrophin - releasing hormone agonist and antagonist, progestins, and combined oral contraceptives. medical therapy, however, has a high recurrence rate after treatment cessation and is often considered a palliative modality for the treatment of be. surgical management of be includes transurethral resection, which has a higher incidence of recurrence compared with partial cystectomy, laparotomy, or laparoscopy, with or without associated cystoscopy, combined transurethral partial cystectomy, and laparoscopic reconstruction of the bladder, robotic approach to surgery, and association of surgical and medical therapy ; whereas ureteral endometriosis is treated by surgery ; ureterolysis is preferred for nonbstructive lesions, and ureteral resection for obstructive lesions. both adequate diagnosis and successful treatment should be completed with a multidisciplinary team with a dedicated gynecologist and urologist. hormone therapy still remains an option, while surgical treatment leads to satisfactory long - term outcome results.	a 47-year - old woman (gravida 1, para 1) with menorrhagia and pelvic pain was found to have an enlarged fibroid uterus and bladder mass on ultrasonographic imaging. the patient underwent an abdominal supracervical hysterectomy and transurethral bladder mass resection. histopathologic findings revealed leiomyoma uteri, intramural adenomyosis, and bladder endometriosis. most case series of bladder endometriosis include women that present with urinary symptoms. this is a rare case of obstructive uropathy secondary to bladder endometriosis in a patient without any urinary signs or symptoms.
	confounding between the model covariates and causal variables (which may or may not be included as model covariates) is a well - known problem in regression models used in air pollution epidemiology. this problem is usually acknowledged but hardly ever investigated, especially in the context of generalized linear models. using synthetic data sets, the present study shows how model overfit, underfit, and misfit in the presence of correlated causal variables in a poisson regression model affect the estimated coefficients of the covariates and their confidence levels. the study also shows how this effect changes with the ranges of the covariates and the sample size. there is qualitative agreement between these study results and the corresponding expressions in the large - sample limit for the ordinary linear models. confounding of covariates in an overfitted model (with covariates encompassing more than just the causal variables) does not bias the estimated coefficients but reduces their significance. the effect of model underfit (with some causal variables excluded as covariates) or misfit (with covariates encompassing only noncausal variables), on the other hand, leads to not only erroneous estimated coefficients, but a misguided confidence, represented by large t - values, that the estimated coefficients are significant. the results of this study indicate that models which use only one or two air quality variables, such as particulate matter [less than and equal to ] 10 microm and sulfur dioxide, are probably unreliable, and that models containing several correlated and toxic or potentially toxic air quality variables should also be investigated in order to minimize the situation of model underfit or misfit.imagesfigure 1figure 2figure 3figure 4figure 5figure 6figure 7figure 8
the rising level of morbidity and mortality is a sign of social as well as individual malaise. in most parts of the world, mental health and mental illness are largely ignored or neglected, resulting in increasing burden of mental disorders in the community and a widening of treatment gap. meta - analysis of epidemiological studies reported prevalence of mental illness as 58.2 and 73 per 1000 population in india. however, even after three decades of its launch, national mental health programme is restricted only to 123 districts, that too in the rural region. urban community in the country, which is exposed to stress of migration, change in family and social dynamics, widening inequalities in economic status, widespread poverty, poor living conditions, and insecurity, hardly gets due attention in the program. lack of organised public health infrastructure and expensive treatment at private settings add to the problem. patients with mental illness have been stigmatised since long back in any community, and this stigmatisation is beyond just labelling the patients. the condition is perceived as frightening, shameful, imaginary, feigned, and incurable, while the patients are characterised as dangerous, unpredictable, untrustworthy, unstable, lazy, weak, worthless, and/or helpless in the community. furthermore, it is important to study the perception, attitude, and health - seeking behavior in the community regarding mental illness, which will help in providing mental healthcare services for the community. this was a community based cross - sectional study conducted from august 2009 to november 2009 in an urban community, south delhi, in northern india. six blocks of area were included in intensive field practice area under urban health programme of centre for community medicine of all india institute of medical sciences, new delhi. out of which, one block was randomly selected for the study by lottery method. in the selected block, any adult member (18 years) residing in a selected household for more than 6 months and volunteering for interview was recruited in the study to complete a predetermined sample size of 100 participants. focus group discussion (fgd) guide was prepared after extensive review of literature and discussion with experts in this field to identify various domains related with mental illness. focus group discussion was carried out among males and females separately in the two different blocks of the study area other than block selected for the study. on the basis of fgd, semi - structured interview schedule was designed to collect information about mental illness including causative factors, preventive measures, identifying features, treatment seeking places, and related practices in the community. this interview schedule was translated into hindi language, pretested, and then modified before use. attitude about mental illness was studied by using opinion about mental illness for chinese community (omicc) scale. hindi version was again back translated into english for checking integrity of concepts of various domains., on the basis of face validity ; building on the scale of opinion about mental illness (omi) developed by cohen and strunning and small scale survey with mental health professionals. items emphasize the distinctiveness of people with mental illness and to keep them away at a safe distancestereotyping items that fixed people with mental illness in a particular behavioral pattern, mental ability, and mannerismrestrictiveness items that held a doubtful view on the right of people with mental illnesspessimistic prediction items that held the view that people with mental illness are unlikely to improve and that how society treats them, is not optimisticstigmatization items that perceived mental illness as shameful, that sufferers should be kept from being known to others benevolence items related to kind orientation towards people with mental illness separatism items emphasize the distinctiveness of people with mental illness and to keep them away at a safe distance stereotyping items that fixed people with mental illness in a particular behavioral pattern, mental ability, and mannerism restrictiveness items that held a doubtful view on the right of people with mental illness pessimistic prediction items that held the view that people with mental illness are unlikely to improve and that how society treats them, is not optimistic stigmatization items that perceived mental illness as shameful, that sufferers should be kept from being known to others factor analysis of the omicc scale with 34 questions in six domains has been reported to yield a cronbach 's alpha of 0.866. for perception about mental illness, frequency distribution of the responses was calculated. analysis of omicc attitude scale was done like any other likert scale with five point responses. all responses under each domain were coded from one to five and reverse coded for benevolence domain. attitude in each domain was determined on the basis of pooled mean values for the respective domain. values higher than two were consider as negative attitude in the respective domain. difference in attitude across age, sex, and literacy in six domains was assessed by independent sample t test. was obtained from institute 's ethical committee of all india institute of medical sciences, new delhi., on the basis of face validity ; building on the scale of opinion about mental illness (omi) developed by cohen and strunning and small scale survey with mental health professionals. items emphasize the distinctiveness of people with mental illness and to keep them away at a safe distancestereotyping items that fixed people with mental illness in a particular behavioral pattern, mental ability, and mannerismrestrictiveness items that held a doubtful view on the right of people with mental illnesspessimistic prediction items that held the view that people with mental illness are unlikely to improve and that how society treats them, is not optimisticstigmatization items that perceived mental illness as shameful, that sufferers should be kept from being known to others benevolence items related to kind orientation towards people with mental illness separatism items emphasize the distinctiveness of people with mental illness and to keep them away at a safe distance stereotyping items that fixed people with mental illness in a particular behavioral pattern, mental ability, and mannerism restrictiveness items that held a doubtful view on the right of people with mental illness pessimistic prediction items that held the view that people with mental illness are unlikely to improve and that how society treats them, is not optimistic stigmatization items that perceived mental illness as shameful, that sufferers should be kept from being known to others factor analysis of the omicc scale with 34 questions in six domains has been reported to yield a cronbach 's alpha of 0.866. analysis of omicc attitude scale was done like any other likert scale with five point responses. all responses under each domain were coded from one to five and reverse coded for benevolence domain. attitude in each domain was determined on the basis of pooled mean values for the respective domain. values higher than two were consider as negative attitude in the respective domain. difference in attitude across age, sex, and literacy in six domains was assessed by independent sample t test. ethical clearance for the study was obtained from institute 's ethical committee of all india institute of medical sciences, new delhi. mean age of the participants was 35.8 (sd : 12.6) years with almost half (47%) belonging to the 3049 years age group. majority of the participants were female (57%), literate (84%), currently married (81%), and did not report mental illness in the family (95%) [table 1 ]. socio - demographic profile of the study participants most of the participants (32%) perceived that living without tension, living happily, and satisfied in routine life as indicators of a healthy mental status. almost one - fourth (24%) of the participants did not know the meaning of being mentally healthy. sudden change in behavior like remaining quite or over talkativeness (59%) and abusing or fighting with others (53%) were among the most common symptoms / signs of mental illness identified by the participants. almost one - third of the participants perceived that symptoms of mental illness were overt, which makes a person with mental illness easily identifiable. only few (3%) of them perceived that it would require expert to diagnose the mental illness. tension / mental stress in routine day to day life were perceived as the most common cause of mental illness (79%). importantly, one - fourth of the participants perceived the role of uppari chakkar / evil spirits in the development of mental illness. almost one - fourth of the participants perceived that mental illness is transmitted from person to person (21%) and from the mother to her child (27%) like any other communicable disease. most of the participants perceived that mental illness could be curable, but one - fifth of them (20%) perceived that these are not completely curable. almost one - third (29%) perceived that these disorders can be prevented by keeping friendly home environment and sharing problems, thoughts with others. stress relieving activities like yoga and meditations were perceived as one of the important preventive measures for development of mental illness. almost half of the participant felt that patient with mental illness can get specialised care at a mental hospital only ; 21% of the participants perceived the role of faith healers (tantrik, ojha) in the treatment of mental illness. according to the participants, community (39%) as well they themselves will prefer mental hospital over general physician for seeking care for mental illness. faith healers (tantric, ojha) were identified as health seeking places both for the community as well as for them by (12%). most of the participant felt that community (80%) ignores mentally ill patients and their families. almost one - fourth (27%) of the participants felt that people from the community tease and make fun of a person with mental illness instead of getting them treated. analysis of omicc scale showed higher (mean) scores for stereotyping (4.5), restrictiveness (3.9), and pessimistic prediction (3.8) domains and lower values for separatism (2.6), benevolence (1.8), and stigmatisation (2.3) domains [figure 1 ]. community showed kind, non - stigmatising but pessimistic attitude toward the future of the people with mental illness. at the same time, participants also felt that social relationship with these people should be restricted. difference in attitude towards mental illness across age, sex, and literacy status was found statistically non - significant (p > 0.05). most of the participants (32%) perceived that living without tension, living happily, and satisfied in routine life as indicators of a healthy mental status. almost one - fourth (24%) of the participants did not know the meaning of being mentally healthy. sudden change in behavior like remaining quite or over talkativeness (59%) and abusing or fighting with others (53%) were among the most common symptoms / signs of mental illness identified by the participants. almost one - third of the participants perceived that symptoms of mental illness were overt, which makes a person with mental illness easily identifiable. only few (3%) of them perceived that it would require expert to diagnose the mental illness. tension / mental stress in routine day to day life were perceived as the most common cause of mental illness (79%). importantly, one - fourth of the participants perceived the role of uppari chakkar / evil spirits in the development of mental illness. almost one - fourth of the participants perceived that mental illness is transmitted from person to person (21%) and from the mother to her child (27%) like any other communicable disease. most of the participants perceived that mental illness could be curable, but one - fifth of them (20%) perceived that these are not completely curable. almost one - third (29%) perceived that these disorders can be prevented by keeping friendly home environment and sharing problems, thoughts with others. stress relieving activities like yoga and meditations were perceived as one of the important preventive measures for development of mental illness. almost half of the participant felt that patient with mental illness can get specialised care at a mental hospital only ; 21% of the participants perceived the role of faith healers (tantrik, ojha) in the treatment of mental illness. according to the participants, community (39%) as well they themselves will prefer mental hospital over general physician for seeking care for mental illness. faith healers (tantric, ojha) were identified as health seeking places both for the community as well as for them by (12%). most of the participant felt that community (80%) ignores mentally ill patients and their families. almost one - fourth (27%) of the participants felt that people from the community tease and make fun of a person with mental illness instead of getting them treated. analysis of omicc scale showed higher (mean) scores for stereotyping (4.5), restrictiveness (3.9), and pessimistic prediction (3.8) domains and lower values for separatism (2.6), benevolence (1.8), and stigmatisation (2.3) domains [figure 1 ]. community showed kind, non - stigmatising but pessimistic attitude toward the future of the people with mental illness. at the same time, participants also felt that social relationship with these people should be restricted. difference in attitude towards mental illness across age, sex, and literacy status was found statistically non - significant (p > 0.05). this study describes the perception of the community regarding mental health and derangement of mental health, similar to who definition of mental health as a positive sense of well - being and not merely the absence of a illness. awareness of the community about symptoms / signs of mental illness is limited to symptoms that manifest in severe mental illness or in later stage of the illness. the reason could be either lack of awareness of participants about other common symptoms like sense of hopelessness, aloofness, and anxiety or may be that these symptoms are too common to be recognised as abnormal. this fact is supported by the observation that only few of the participants agreed that mental illness could be present in a person with normal behavior and it is not possible to diagnose it by mere observation (3%). singh., reported stressful conditions as a cause for development of mental illness similar to the observations in the present study. attribution of mental illness to upari chakkar / evil spirit / black magic was present in a substantial proportion (25%) and shows the lack of awareness of the community about bio - medical concept of causation of these disorders. the knowledge of the participant has been reflected in the health - seeking behavior of the community as tantric and ojha were reflected among health - seeking places for mental illness to get rid of evil spirits., this fact is also supported by observation that participants do regard transmission of the mental illness from person to person (21%) and from mother to child (27%). this lack of knowledge in the study population from the capital city that has a well - known institute for care for mentally ill is serious because the ignorance could possibly be more in other regions of the country. community identified stress relieving activities like yoga and satsang, supportive family environment, and sharing thoughts with others as preventive measures against mental illness. these findings are in coherence with the knowledge of the community about causality of mental illness. community attitude toward patient with mental illness was kind and non - stigmatising, which was similar to the attitude of the community reported in various studies. although participants did not support isolating person with mental illness from the society, restrictive attitude was observed with regards to marriage or child bearing. this finding corroborates with findings of the study by singh., and kermode., also, participants are pessimistic when it comes to career or job opportunity for a person with mental illness. this socially restrictive attitude is reflected in the practices of community toward psychiatric ill patients in the form of restricting visits to patient 's home and ignoring the patients. in the era of economic and social development, community still approaches tantric / ojha in the capital city. community reported restrictive, stereotyping, pessimistic, and non - stigmatizing attitude toward patient with mental illness that can be the barrier in health - seeking behavior for mental illnesses. this study reported lack of awareness about bio - medical concepts of mental illness in a community in the capital city. there is a need for creating awareness regarding biomedical concepts, availability of effective treatment for mental illness, for identification and better care for these disorders in a community as a part of national mental health programme. health education and increase in public awareness regarding factual information about mental illness can decrease the stigma attached with mental illness and improve help - seeking behavior of the community.	background : mental illness have been largely ignored or neglected because of a community 's perception and attached social stigma.materials and methods : a community based cross - sectional study was conducted in an urban community in south delhi to study perception and attitude of the community about towards mental illness. an adult member in household selected by systematic random sampling was interviewed using semi - structured interview schedule for perception about mental illness and 34 item opinion about mental illness for chinese community (omicc) scaleresults : a total of 100 adults were interviewed. mean age of the participants was 35.8 (sd : 12.6) years. living without tension and satisfaction in routine life were identified as indicators of healthy mental status. change in the behavior was perceived as the most common symptom of mental illness. although mental stress was identified as the most common cause of mental illness, 25% attributed it to evil spirits. keeping surroundings friendly and sharing problems with others were identified as - important preventive measures against mental illness. mental illness was perceived as treatable ; 12% preferred treatment from tantric / ojha. community showed negative attitude for stereotyping, restrictiveness, and pessimistic prediction domains of omicc scale with mean score of 4.5 (sd : 0.2), 3.9 (sd : 0.9), and 3.8 (sd : 0.4), respectively, with no statistically significant difference across age, sex, and literacy.conclusion:study observed lack of awareness regarding bio - medical concept of mental illness with socially restrictive, stereotyping, pessimistic, and non - stigmatizing attitude toward mental illness in the capital city.
intravenous thrombolytic therapy when given within 4.5 h from symptom onset remains the mainstay of treatment for ischemic stroke patients. while intravenous tissue plasminogen activator (iv tpa) has been shown to be effective in improving outcome, the most feared complication is symptomatic intracerebral hemorrhage (sich), which occurs in up to 7 percent of patients and significantly increases mortality and morbidity. standard management of post thrombolysis intracerebral hemorrhage includes replacement of coagulation factors with cryoprecipitate and platelets, as suggested by the american heart association, which is based on small case series and expert opinion and the efficacy of such treatment is unknown. thus there exists heterogeneity in clinical practice with respect to the strategies implemented in the management of sich. the lack of consensus on how to manage sich as well as continued poor outcomes despite treatment should create a driving force in the stroke community to investigate effectiveness and rapidity of other potential treatment options. we report a 68-year old right handed hispanic woman with a history of diabetes mellitus type ii, hypertension, hyperlipidemia, and two prior strokes with residual right hemiparesis, who presented with sudden onset vertigo, slurred speech, and blurred vision. the first stroke was a left putamen intracerebral hemorrhage with minimal residual right hemiparesis that occurred over 20 years prior to admission. the second stroke was a cryptogenic stroke that occurred around 5 years prior to admission for which she was outside the time window of thrombolytic therapy and was maintained on aspirin 81 mg daily. her initial exam showed dysarthria, left sided sensory loss, skew deviation with upgaze vertical nystagmus, mild right hemiparesis, and an nihss score of 4. initial head computed tomography (ct) (figure 1a) showed evidence of prior strokes and no acute hemorrhage. since she had a new fixed and potentially disabling neurological deficit and she was within the 4.5 h window, decision was made to administer thrombolytic therapy. an hour after the iv tpa infusion was complete, she complained of an acute severe headache without a change in neurological exam and repeat ct head showed right temporal ich with a subdural component (figure 1b). two hours after the completion of this treatment, she became somnolent and had new left hemiparesis. ct head was repeated that showed ich expansion and new intraventricular hemorrhage (figure 1c). in the next 3 h head ct at that point showed further expansion of ich and intraventricular hemorrhage (figure 1d). the decision was made to administer recombinant factor viia (50 mcg / kg) and she was subsequently taken to the operating room with successful clot evacuation. postoperatively, her exam slowly improved and she was back to her baseline neurological exam on post - operative day 3 (figure 1e). alteplase converts plasminogen to plasmin, which in turn converts fibrin into the fibrin split products causing thrombolysis. it also causes a reduction in fibrinogen the degree of which is associated with sich. using cryoprecipitate (factor viii and fibrinogen), in post thrombolysis sich increases fibrinogen levels, enhances fibrin formation and may potentially stabilize the clot thus reducing the risk of further hemorrhage. however, a study from get with the guidelines data showed that around 40 percent of patients with post thrombolysis sich have continued bleeding despite cryoprecipitate treatment. the lack of efficacy may be due to delays in diagnosis and treatment, insufficient dosing of cryoprecipitate to replenish fibrinogen, or lack of augmentation with rapid acting factors that help convert fibrinogen into fibrin. to our knowledge, this is the first case reporting the use of recombinant factor viia along with cryoprecipitate and platelets in the treatment of symptomatic ich following intravenous thrombolysis. activated factor viia has been studied in spontaneous intracerebral hemorrhage and has been shown to reduce hematoma growth with no effect on mortality and morbidity however. activated factor viia, which has a relatively quick time of onset and is an extrinsic and intrinsic pathway activator, may further enhance clot stability and potentially reduce the risk of hematoma expansion, which is likely what happened with our patient. although recombinant factor viia carries a risk of thrombosis and is relatively expensive, its use in this patient population may potentially alter the course of the disease and improve outcome. randomized studies may be considered to compare the outcome of patients with post thrombolysis sich when rapid reversal agents such as recombinant factor viia or prothrombin complex concentrate are added to the standard treatment or given in isolation.	symptomatic intracerebral hemorrhage (sich) occurs in up to 7% of stroke patients treated with thrombolytic therapy. there are limited data on the effectiveness of the reversal agents used for intravenous tissue plasminogen activator related intracranial bleeds. we report a patient with sich following intravenous thrombolysis whose intracerebral hemorrhage continued to expand despite treatment with platelets and cryoprecipitate, needing recombinant factor viia use for stabilization before surgical evacuation. factor viia along with routine reversal agents following intravenous thrombolysis related sich may further enhance clot stability and reduce the risk of hematoma expansion. it could be a bridge to definitive surgical management in those patients.
drug delivery to the brain remains a hotly debated and hugely studied area in biomedicine. the transport of a vast majority of therapeutic molecules to the brain is restricted by the presence of a natural obstacle called the blood brain barrier (bbb) (bicker., 2014). this limitation highlights the need to create systems idealized for the delivery of therapeutic as well as imaging agents across the bbb, thereby distributing drug molecules to desired site in the brain. bacteriophages (phages) as viruses that propagate their genetic material through infecting bacterial cells in a specific manner are thought to be the most ubiquitous biological entities in the biosphere. high levels of structural organization, self - assembly into structures with nanoscale properties, well - defined geometry, and the flexibility of their small genomes to be conveniently engineered have adapted them for the fabrication of nanostructured materials. phage display is a high - throughput and combinatorial screening methodology that can be used for building large nanomaterial libraries and subsequently identifying novel ligands with desirable attributes. to date, major part of the work within the field of phage nanobiotechnology has been focused on filamentous bacteriophages in particular m13 and its related phages including f1 and fd. m13 as the most predominantly used type of phage nanoparticles is a flexible and rod - shaped viral nanostructure nearly 6.5 nm in diameter carrying a single stranded dna genome (yang., 2013 nanomaterial libraries constructed by using filamentous phages such as m13 are regarded as a treasure of targeting ligands especially cell- and tissue - specific peptides. nanocarriers are emerging as attractive tools for the design of brain - targeted drug delivery vehicles. the surface of these nanoscale systems can be decorated with homing peptides derived from phage display libraries., these platforms may enable delivery of nontransportable drugs across the bbb. in this article, we present an overview of potential application of phage display with a particular focus on phage peptide libraries for the development of brain - targeted drug delivery nanocarriers. the birth of the term bbb stems back more than a century ago and the experiments undertaken by paul ehrlich in the late 19 and early 20. he noticed that the direct injection of some dyes locally into the brain could lead to the staining of this organ. however, dye peripheral injection results in the staining of the whole body except the brain (bradbury, 1979). specialized cerebral endothelial cells (cecs) with their unique restrictive properties form the major anatomical and functional components of bbb (figure 1). these endothelial cells, known as the brain gatekeepers, constitute the complex and extremely well - organized vascular system of the brain. adjacent endothelial cells lack intracellular fenestrations and are connected through high resistance tight junctions that turn the brain endothelium into a continuous layered structure keeping the blood apart from the brain. the high structural integrity of tight junctions results from a delicate and intricate network of transmembrane proteins and some cytoplasmic accessory proteins that are linked to the cellular cytoskeleton. astrocytes, pericytes, microglia, and the extracellular base membrane are other essential parts of the bbb supporting system. these components, together with nearby neurons, adjacent endothelial cells in the wall of blood vessels surrounding the brain have tight junctions that form a hardly passable and continuous barrier between the blood vessel and the brain. a well - coordinated and persistent control over the composition of extracellular fluid in the central nervous system is of particular importance to the efficient function of neurons. in the invertebrates and some ancestral vertebrates, a barrier composed of glial cells safeguards not so complex nervous system of these organisms from unwanted effects of alterations occurring in the body fluids. however, in the higher vertebrate organisms with an increased complexity in the structure of the nervous system during evolution, an endothelial barrier provides a dramatic protection to the brain. bbb plays a critical role in maintaining homeostasis of the delicate nervous tissue through creating a physical, transport, metabolic and immunological barrier between the blood and the brain. this barrier is highly selectively permeable with the main role of protecting the brain from physiological fluctuations that occur in the plasma as well as from the blood - borne compounds that may interfere with neurotransmission. it also offers a means for specific exchange of essential nutrients, minerals, ions, metabolic waste products, and signaling molecules between the blood and the brain, thereby providing an exquisite and dynamic control to the influx and efflux of different metabolites (redzic, 2011). the physiological characteristics of bbb in the selective delivery of various compounds may constitute a challenge for the transport of pharmacologically active molecules to the nervous system. in this context, bbb poses tremendous limitations to the brain - targeted delivery of drugs, while many diseases that affect the central nervous system require therapeutic intervention through transport of pharmacological agents to the involved tissue. it is commonly believed that a large number of systematically administered neurotherapeutics are not able to cross the bbb. this inefficient penetration of drugs into desired areas of the brain is recognized as a significant obstacle for the successful development of brain - targeted pharmaceutical compounds. phage nanobiotechnology mainly relies on the versatile and revolutionary technology of phage display in which genetic engineering of the phage serves as a basis for introducing exogenous peptides and proteins onto the outer surface of the virion. phage display is particularly characterized by physical linkage between the phenotype (the surface expressed peptide) and genotype (the dna sequence that encodes that peptide) within the same viral particle. these nanomaterial libraries can be used for identifying and selecting pharmaceutical ligands with favorable characteristics against various biological targets. in this context, the construction of a library is achieved through making use of randomly generated dna sequences and molecular biology methods. for this purpose, randomized oligonucleotides are spliced into the appropriate site of a gene that encodes one of the phage surface proteins. this leads to the display of a diversified library of peptides on the surface of phage nanoparticles. while the entire library contains an innumerable number of phage nanostructures, each phage displays multiple copies of a unique peptide sequence on its surface (bakhshinejad.,, phage nanomaterial libraries harbor a wide collection of nanotubes decorated with diverse peptides whose composition will be the critical determinant of physicochemical hallmarks of the whole nanoparticle. the affinity - based screening of phage display libraries can be performed straightforwardly against different targets in order to isolate peptides with tight affinity from a population millions or even billions of candidate ligands. the process of affinity - based screening of phage peptide libraries for identifying those with particular binding specificity to a given target is called panning. in panning, phage library is incubated with the desired target for a specified period of time. among phage population of the library, some phages whose surface displayed peptides are able to interact with the target with greater affinity will adhere. the unbound phages are washed away and the remaining tightly bound phages are recovered (through alteration of ph or salt concentration) from the target. the eluted fraction is used to infect host bacterial cells for amplifying the target - bound phages. on the whole, this procedure is repeated multiple times (generally 3 to 5 rounds) in order to effectively enrich the highest affinity binders. finally, target - specific binding peptides are identified by dna sequencing of the bound phages (bakhshinejad., 2014). the target that is exposed to the library through panning can have a biological or non - biological identity. for example, cells in culture can be exploited as the bait for capturing cell - specific peptides. even with the heterogeneous characteristics of the cell surface, cell biopanning has exhibited dramatic potential in the selection of cell binding ligands for numerous cell types. these nonspecific peptide ligands might bind to surface receptors that are common among different cell types leading to spurious final results. filamentous phages of the ff class in particular m13 are considered as the main phage display platforms. as phage nanobiotechnology is strictly tied to phage display technology, therefore filamentous phages have become major viral tools in nanobiotechnology. alternative phages including lambda, t4, t7 and p4 have served as display systems as well as for constructing peptide libraries. the assembly process of these phages and subsequent folding of displayed peptides occur thoroughly in the cytoplasm (castagnoli., 2001). for this reason, these systems are appropriate for display of large, globular and hydrophobic or poorly soluble fusions. although having a two - decade long history, libraries constructed based on these alternative phage display systems have not achieved commercial status and played a minor role in phage display research. filamentous phages boast some dramatic advantages over other phage types for use in phage display and accordingly in nanobiotechnology. while the phage diameter is unvarying, the virion length may change in accordance with the length of the packaged dna. long, rod - like and highly anisotropic shape leads filamentous phages to exhibit liquid - crystalline properties. the capacity to create one- and two - dimensional crystalline arrays in suspensions enables them to form ornately ordered self - assembled films and fibers (yang., 2013). also, rod - like nanoparticles generally possess a higher aspect ratio. increased length - to - diameter ratio of filamentous phages results in more efficient cellular attachment and ensuing membrane penetration (kolhar., 2013). this better cellular internalization may be due to the involvement of a higher number of ligand - receptor interactions that lead to a more considerable contact of elongated phages with the cell membrane. while spherical nanoparticles have a tendency to remain in the center of blood vessels, rod - shaped nanoparticles show preference to margination and drifting toward the vessel wall (toy., 2014). in this manner, rod - like phages may become able to more efficiently bind to receptors on the walls of blood vessels and subsequently extravasate, thereby bypassing the bbb. in line with this, the exploitation of synthetic microvascular networks that mimic natural vasculature indicated that rod - shaped polystyrene nanoparticles have higher avidity and selectivity than spherical ones to endothelial cells. also, in vivo studies confirmed the increased specificity and vascular targeting of elongated nanoparticles to the brain endothelium (kolhar., 2013). although this study was performed on polystyrene nanoparticles, the rod shape - induced enhancement of brain endothelium targeting may unveil brain targeting potential of other rod - like nanoparticles such as filamentous phages. the screening of phage display libraries can be used as an efficient tool for obtaining peptides that home to the brain cells and tissues. has been demonstrated to be capable of identifying peptides that specifically bind to human brain tumor cells. malignant glioma is known as one of the most fatal brain tumors. despite advancements in the establishment of therapeutic approaches for glioma tumors, the presence of bbb and infiltrative properties of tumor cells these hurdles highlight the need to outline strategies for targeted delivery of therapeutic cargoes to glioma tumors. in line with this scenario, the screening of phage library led to the isolation of gl1 peptide that specifically interacts with human glioma cell lines as well as primary glioma cells obtained from human biopsy specimens. also, when injected into the mouse through systemic route, gl1-bearing phages homed exclusively to human glioma xenograft in the right hemisphere of the mouse brain (ho., 2010). this peptide represents potential to be used for selective targeting of imaging labels or anticancer therapeutics to glioma cells. another study applied in vitro phage display to identify peptides that specifically bind to glioma stem cells (gscs) (beck., 2011). gscs as a subpopulation of glioma cells are thought to be the major drivers of brain tumor initiation, progression, and recurrence. therefore, preferential targeting of gscs is of particular relevance to the treatment of glioblastoma multiforme patients. this gsc - targeting peptide indicated selective binding affinity to many undifferentiated gscs, but not to their differentiated counterpart cells. the administration of gsc - homing peptide into the tumor - bearing mice resulted in effective penetration into the animal brain, and specific accumulation in gliomas arising from subcutaneous and orthotopic (intracranially injected) implantation. the identification of gsc - selective peptides that target gscs may provide a promising opportunity to establish novel diagnostic and therapeutic modalities for eradicating gscs present in many types of human brain malignancies. the panning of phage peptide libraries can also be carried out in a living organism (figure 2). in vivo panning is a means to identify peptide ligands capable of homing to specific tissues or organs. during in vivo panning, phage peptide library is intravenously administered (primarily through the tail vein) into a mouse and allowed to circulate. after a defined incubation time, the mouse is sacrificed and the desired target tissues or organs are extracted and homogenized in saline. the tissue / organ - associated phages are recovered and amplified through infecting bacterial host. this process is repeated with higher stringency by injecting the suspension of recovered phages into another mouse for an additional round of affinity selection (babickova., 2013). successive rounds of in vivo selection ultimately lead to the enrichment of a few number of peptide motifs with specific binding to a given tissue / organ. while nonspecific phages turn to be distributed through the whole body of the animal, in vivo selection causes the clustering of highly selective peptide ligands in particular tissues. this in vivo approach has been reported to provide phage - displayed peptides that are able to traverse the bbb from systemic circulation. the in vivo screening of a cyclic 7-mer phage library was shown to yield a peptide specific to brain vascular receptors. this peptide, called pepc7, showed high efficiency in translocation into the mouse brain. in vivo optical imaging analysis revealed the brain - targeting capacity of this peptide (li., 2012). also, the peptide motif termed tgn was obtained from multiple rounds of in vivo screening of a 12-mer phage library. compared with native phage, phage nanoparticles displaying the tgn peptide exhibited significantly higher efficiency in brain transport. fluorescence microscopy revealed that tgn - bearing phages extensively accumulate in the third ventricle, lateral ventricle, periventricular region of the third ventricle, and cortex of the mouse brain (li., 2011). brain - targeting peptide motifs such as pepc7 and tgn that have been identified in vivo represent huge potential to develop efficient targeted platforms for the delivery of drugs as well as imaging agents to the brain. these peptides can also be used for the discovery of new receptors or markers with potential application in brain targeting. in vivo the screening of a phage peptide library can be performed in a living organism. in vivo panning involves the following steps : systemic administration of the phage library into the mouse, animal sacrifice and extraction of the desired tissues / organs, recovery of the tissue / organ - bound phages, amplification of the recovered phages and phage genome sequencing. some mentioned here - on the use of filamentous phage - based libraries in order to identify brain - targeting peptides in vivo. nevertheless, there is a paucity of such type of information practically supporting the capacity of phages of other morphologies in navigating through the bbb. phage display with its huge capacity in ligand identification can be used to obtain ideal moieties for surface functionalization of nanocarriers. peptides derived from phage display libraries create new opportunities for the development of bbb - crossing brain - targeted drug delivery platforms. the previously mentioned tgn peptide isolated from phage display peptide library- was conjugated to the surface of peg - plga nanoparticles, while nap (a peptide drug able to inhibit a140 fibril formation) was entrapped in the tgn - coupled peg - plga nanocarriers. the neuroprotective effect of tgn - bearing nap - loaded nanocarrier was demonstrated in an in vivo mouse model of alzheimer 's disease by using morris water maze experiment, tissue histology and biochemical tests. furthermore, morphological damage and a plaques were not detected in the hippocampus and cortex treated with the tgn - targeted nanocarrier. the results revealed that tgn modification can protect drugs such as nap from enzymatic degradation in vivo and efficiently mediate drug transport into the mouse brain after intravenous administration (li., 2013). also, the attachment of peptide ligands selected through combined in vitro /ex vivo phage display screenings to the surface of doxorubicin - loaded liposome nanocarriers led to a significantly reduced tumor volume and enhanced survival in the preclinical murine models of human neuroblastoma (loi., 2013). the capability of this peptide - targeted drug delivery nanocarrier in counteracting nb progression in animal models demonstrates the efficacy of this system in crossing the bbb, thereby paving the way for the development of brain tumor - targeted drug delivery systems. the exploitation of nanoscale platforms for bypassing the bbb has been introduced as an emerging concept in the territory of brain drug delivery. these nanostructured systems can be selectively targeted toward target sites in the body (for example the brain tissue). to minimize nonselective drug transport to non - target tissues and organs as well as improve drug delivery across the bbb, the surface chemistry of nanocarriers can be modified with cell- and tissue - specific peptides. phage display libraries are known to be a rich source for the discovery of these homing peptides. the enormous capacity of phage display library as a powerful technology has bridged disciplinary boundaries and guided this screening strategy into diverse specialties ranging from materials to medical sciences. the presence of viral particles with nanosclae dimensions and properties in phage libraries has introduced them into the emerging field of nanobiotechnology. these unique properties of rod - shaped bacterial viruses have enabled phage researchers to develop commercial peptide libraries based on filamentous phages in particular m13 with extensive applications for panning studies. the commercial success of filamentous phage peptide libraries within the last several years has broadened the potential scope of phage display in nanomedicine. furthermore, some methodological innovations such as development of landscape libraries have provided new perspectives to the use of phage - based combinatorial peptide libraries for selecting tumor - avid ligands. within the framework of nanobiotechnology, phage nanomaterial libraries can be adapted for the development of phage - derived nanometric - sized materials. when surface functionalized with selective peptide ligands, nanoparticulate carriers become capable of preferential binding to their well - matched receptors on the luminal side of endothelial cells of bbb. this approach, also called molecular trojan horse strategy, lays a foundation to harness the power of receptor - mediated endocytosis for brain targeting of therapeutics. recent findings highlight the fact that phage display is a powerful strategy for developing highly efficient targeted drug delivery platforms. the huge potential of this technology paves the way for the development of sophisticated and efficient brain - homing drug delivery systems in the future.	the blood brain barrier represents a formidable obstacle for the transport of most systematically administered neurodiagnostics and neurotherapeutics to the brain. phage display is a high throughput screening strategy that can be used for the construction of nanomaterial peptide libraries. these libraries can be screened for finding brain targeting peptide ligands. surface functionalization of a variety of nanocarriers with these brain homing peptides is a sophisticated way to develop nanobiotechnology - based drug delivery platforms that are able to cross the blood brain barrier. these efficient drug delivery systems raise our hopes for the diagnosis and treatment of various brain disorders in the future.
compression therapy is used for the treatment of venous pathologies such as deep vein thrombosis and chronic - venous insufficiency. the application of the external pressure on the lower limbs acts to compress the veins thus reducing their diameter. in consequence the velocity increases, which in turn encourages the return of blood to the heart and reduces pooling. many studies have demonstrated an increase in mean deep venous velocity, reduced venous pooling, and an improved venous return in patients who wore graduated compression stockings [35 ]. the use of compression garments in sport is becoming increasingly popular due to claims that they can improve recovery from exercise, by exerting these hemodynamic effects. evidence for the efficacy of compression garments in recovery is solid with recent meta - analysis supporting the use of compression to alleviate symptoms associated with fatigue [6, 7 ]. suggested mechanisms include enhanced venous return and blood flow in passive conditions [8, 9 ] that may aid the removal of metabolic waste [10, 11 ], reduce edema [12, 13 ], and improve muscle oxygenation [14, 15 ]. however in some cases there is little evidence to support some of the purported benefits and gaps in knowledge are still evident [16, 17 ]. the heterogeneity of effects could be explained by the disparity in terms of compression garments in all studies [6, 7 ]. for example, findings of french. indicate that recovery and regeneration appear unaffected by wearing compression garments for 12 h after a hard training session compared with passive recovery. however, it should be clearly stated that one limitation of this study is that compression garments used were reported to have an average compression pressure of 12 mmhg at the calf. indeed venous return and other hemodynamic benefits which may aid recovery were previously described to be significantly improved with a minimum compression pressure of 1520 mmhg and with a peak for a pressure of around 40 mmhg [2, 18 ]. some other studies present such limitation [19, 20 ] and recent meta - analysis suggest understanding the discrepancy of results well to focus on the characteristics of compression garments especially compression pressure [6, 7 ]. therefore the aim of the present study was to assess the changes in tissue oxygen saturation (sto2) in response to the application of the main commercially available calf compression sleeves. we focused on sto2 because it has been extensively documented as a hemodynamic benefit of compression garments during recovery. it also presents the advantage of being noninvasively measured using near - infrared spectroscopy (nirs). eight healthy subjects (no history of cardiopulmonary disease or medication) were studied (mean sd : age, 32.4 4.8 years ; height, 174.5 1.9 cm ; body mass, 66.1 2.2 kg ; calf circumference at larger part : 36.4 0.2 cm). they were informed about the procedures and risks associated with participation in the study and all provided their written informed consent prior to participation. the study protocol was approved by the local ethics committee and was in accordance with the declaration of helsinki of the world medical association with regard to research conduct. the subjects came to the laboratory (temperature : 20.0 1.0c ; humidity : 50 1.0%) to complete a session in seated position including 10 min of quiet rest followed by 3 min measuring calf sto2 without compression sleeves and then alternating of 3 min of quiet rest and 3 min measuring sto2 with calf compression sleeves. a total of 15 different commercially available compression sleeves were studied in a randomized order (figure 1). using nirs technique, the inspectra sto2 tissue oxygenation monitor, model 650 (hutchinson, mn, usa), provides continuous noninvasive assessment of sto2 at a maximum depth of 15 mm. the measurement principles of this technology have been described and its accuracy and reproducibility have been previously established. the microcirculatory sto2 assessment is defined as the ratio [hbo2]/([hb]+[hbo2 ]) expressed as percent, with hbo2 and hb being oxy- and deoxygenated hemoglobin, respectively. sto2 was measured at the level of the right gastrocnemius muscle, 12 cm below the fibula head. a transparent film was placed between the skin and the probe to protect it from sweat. sto2 was measured during three minutes without compression and during three minutes with each calf compression sleeve. sto2 values were analyzed with sto2 researcher 's analysis software version 4 (hutchinson, mn, usa). only the mean of the last minute of each 3 min period was considered. the pressure of each calf sleeve was measured at the same area as the sto2 measurement using a pneumatic measuring system (picopress, microlabitalia, padua, italy). the pressure transducer consists of a flat plastic pressure probe (5 cm diameter) that is filled with 2 ml of air for the pressure measurement. fluctuations of pressure on this probe are transformed into electronic signals that can be recorded continuously. data are presented as mean sd. a p value < 0.05 was considered as significant. the normality of distribution was tested using the kolmogorov - smirnov test. to assess the effects of the calf compression sleeves, sto2 was significantly increased with all compression sleeves (p < 0.05) compared with no compression (from + 6.9% for a to + 22.6% for o). sto2 was positively correlated with compression pressure (p < 0.05 ; r = 0.84). the present study aimed at investigating the changes in sto2 in response to the application of the main commercially available calf compression sleeves. (1) wearing all compression sleeves significantly increased sto2 and (2) the most effective increases of sto2 were correlated with the highest compression pressures. firstly, sto2 increased with calf compression sleeves (from + 6.9% for a to + 22.6% for o). these results are in accordance with previous works that reported an increase in sto2 with calf compression sleeves before and after running or cycling exercises. this higher sto2 was attributed to the increased muscle flow rate [8, 9 ] and changes in skin blood flow [26, 27 ]. indeed, wearing compression on the lower limbs venous emptying may increase arteriovenous pressure gradient, increasing arterial flow rate, oxygen supply, and therefore sto2. as previously described, arterial vessels dilate in response to a fall of the transmural vessel pressure gradient. the pressure applied by sleeves is transmitted into the tissue and thus reduces the transmural pressure gradient of the arterial vessels. finally, changes in skin blood flow must also be considered [26, 27 ]. indeed, sto2 was recorded at a maximum depth of 15 mm, including cutaneous and muscular vessels. moreover, previous studies suggest that compression sleeves may affect cutaneous sto2 through temperature changes [14, 27 ] and pressure - induced skin vasodilation [26, 30 ]. this study also revealed that increase of calf sto2 with compression sleeves was positively correlated with compression pressure (p < 0.05 ; r = 0.84). this finding is in agreement with previous studies suggesting a dose - response of compression pressure on venous hemodynamics including the velocity of venous circulation, venous pump function, or the degree of decrease in edema [2, 3, 31 ]. however, the relation between the compression pressure and its effects on hemodynamics is not systematically demonstrated [3133 ]. a possible explanation for this lack of relation is that hemodynamics may also be affected by other factors such as pressure gradient [24, 32 ] and elastic properties [34, 35 ]. for example, it has been shown that with the same pressure inelastic material is more effective than elastic [34, 35 ]. by extension the seamless knitting could be in favor of long lasting effects on sto2 : no fraying and stitch defects making the sleeves loose fit and negatively affecting compression and elastic properties. this study provides support for the hypothesis that wearing compression sleeves from various brands may differently affect recovery, by virtue of their varied effects on sto2. these results contribute to understanding well the large differences reported in recent meta - analysis [6, 7 ] about effects of compression garments during recovery. since higher compression pressure was associated with higher sto2 this work suggests focusing on compression garments with high pressure level for recovery. in conclusion, this study shows that wearing compression sleeves from various brands differently increases tissue oxygen saturation. differences were linked to the compression pressure : higher compression pressures were associated with higher sto2.	aim. the purpose was to examine the changes in tissue oxygen saturation (sto2) in response to the application of different commercially available calf compression sleeves. methods. eight subjects came to the laboratory to complete a session in seated position including 10 min of quiet rest followed by 3 min measuring calf sto2 without compression sleeves and then alternating of 3 min of passive rest and 3 min measuring sto2 with calf compression sleeves. a total of 15 different commercially available compression sleeves were studied in a randomized order. calf sto2 was recorded using near - infrared spectroscopy. results. sto2 was significantly increased with all compression sleeves (p < 0.05) compared with no compression (from + 6.9% for the least effective to + 22.6% for the most effective). large differences were observed between compression sleeves (p < 0.05). sto2 was positively correlated with compression pressure (p < 0.05 ; r = 0.84). conclusion. this study shows that wearing compression sleeves from various brands differently affects tissue oxygen saturation. differences were linked to the compression pressure : higher compression pressures were associated with higher sto2.
atherosclerosis has a complex etiology that leads to arterial obstruction and often results in inadequate perfusion of the distal limbs. patients with atherosclerosis can have severe complications of this condition, with widespread systemic manifestations, and the operations undertaken are often challenging for anesthesiologists. a 79-year - old woman with chronic heart failure and respiratory dysfunction presented with bilateral gangrene of the distal lower extremities with obstruction of the left common iliac artery due to atherosclerosis. general anesthesia was induced after performing multiple nerve blocks including quadratus lumborum, sciatic nerve, femoral nerve, lateral femoral cutaneous nerve, and obturator nerve blocks. the surgery was completed ; the patient remained comfortable and awake without the need for further analgesics. quadratus lumborum block may be a useful anesthetic technique to perform femoral femoral bypass. the quadratus lumborum block (qlb) was first reported as anesthesia for abdominal wall surgery. recently, ultrasound - guided qlb has been reported for postoperative analgesia following abdominal surgery. however, it was reported that the analgesia region of the qlb is broader than that of the transverse abdominis plane block, and the qlb additionally has some splanchnodynia. atherosclerosis is a systemic disease which can affect blood vessels, resulting in tissue ischemia, often with devastating clinical consequences. patients with atherosclerosis commonly have widespread systemic manifestations such as ischemic heart disease, brain infarction, aortic aneurysm, and aortic dissection. a 79-year - old woman had obstruction of the left common iliac artery due to atherosclerosis and consequently developed gangrenous necrosis affecting both distal lower extremities. the past medical history included a left thoracoplasty for pulmonary tuberculosis, and refractory congestive heart failure with atrial fibrillation. echocardiography showed cardiomegaly with mild aortic valve regurgitation, mild mitral valve regurgitation, and moderate tricuspid valve regurgitation. she was initially planned to undergo extensive debridement of both feet to limit progression of infection. however, the surgery was canceled because spinal anesthesia failed due to severe scoliosis and the vertebral deformity. two weeks later, she had a fever of 38.5c, and laboratory data revealed a white blood cell count of 20,700/l and a c - reactive protein level of 5.3 mg / dl, consistent with systemic inflammation. the surgeons in charge of her care decided to perform emergency amputation of both feet due to more extensive necrosis, and a femoral femoral bypass graft to allow her to keep as much of her lower extremities as possible to facilitate future rehabilitation. general anesthesia was considered for the planned procedure ; however, the patient was critically ill. her respiratory condition worsened and the percutaneous oxygen saturation (by pulse oximetry) decreased to 93% while receiving 3 l / min of oxygen by nasal prongs. these nerve blocks included the qlb for the femoral femoral bypass and a lumbar plexus block and sciatic nerve block for the bilateral foot amputations. the patient was in the prone position and the qlb was performed under ultrasound guidance with a 6 to 13-hz high - frequency linear probe and a 22-gauge peripheral nerve block needle. the probe was placed over the lateral abdomen to identify the abdominal muscles, and then moved dorsally to confirm the location of the quadratus lumborum muscle (fig. we inserted the nerve block needle and injected radiocontrast (15 ml of 0.08% iotrolan) (fig. the contrast material spread from the iliac crest to the inferior costal margin, which indicated correct position of the tip of the needle. the injection point for the quadratus lumborum block is on the posterior aspect of the quadratus lumborum muscle. this triangular image suggests that the quadratus lumborum block was performed by sub - fascial injection of the local anesthetic agent. the lumbar plexus could not be successfully identified using the nerve stimulator or ultrasound guidance due to the severe deformity of the vertebrae. instead of a lumbar plexus block, we performed a combination of nerve blocks including a femoral nerve block, a lateral femoral cutaneous nerve block, and an obturator nerve block. local anesthetic, 0.125% levobupivacaine was used (7 ml for the femoral nerve, 3 ml for lateral femoral cutaneous nerve, 8 ml for the obturator nerve, and 10 ml for the sciatic nerve) for all nerve blocks. the total amount of local anesthetic used for all peripheral nerve blocks was 86 ml. general anesthesia was induced using 1% sevoflurane with 6l / min of 50% oxygen administered by facemask, and without muscle relaxants to maintain spontaneous ventilation. the blood pressure decreased from 100/70 to 80/60 mm hg, and the heart rate increased from 90 to 140 bpm, with intermittent intravenous administration of 4 mg of ephedrine and/or 0.1 mg of phenylephrine, and continuous infusion of 0.01 mg of noradrenaline. we decided to stop general anesthesia about 10 minutes after starting the procedure because of continuing deterioration in hemodynamics. at that time, the surgeons were exposing the right femoral artery, and had not yet started the left side. after stopping sevoflurane inhalation, the anesthesia used for performing a femoral femoral bypass graft is usually general anesthesia, spinal anesthesia, or epidural anesthesia. general anesthesia is the most popular approach for this procedure, but it is also associated with higher morbidity compared to regional anesthesia. in the case of a critically ill patient, femoral peripheral nerves derived from the lumbar plexus are widely distributed in the inguinal region, the area involved with a femoral femoral bypass, and explains why local anesthetic infiltration may be insufficient to relieve surgical pain during a femoral femoral bypass. the qlb is reported to induce analgesia from t10 to l1. we expected that a qlb would be useful for performing a femoral femoral bypass. one hypothesis is that local anesthetic spreads from the quadratus lumborum muscle to the neighboring paravertebral space, and acts at several nerve roots. the qlb has been reportedly used for postoperative analgesia of various abdominal procedures including cesarean section, laparoscopy, colostomy, and pyeloplasty this is the first report of using a qlb to perform a femoral femoral bypass.	abstractintroduction : atherosclerosis has a complex etiology that leads to arterial obstruction and often results in inadequate perfusion of the distal limbs. patients with atherosclerosis can have severe complications of this condition, with widespread systemic manifestations, and the operations undertaken are often challenging for anesthesiologists.case report : a 79-year - old woman with chronic heart failure and respiratory dysfunction presented with bilateral gangrene of the distal lower extremities with obstruction of the left common iliac artery due to atherosclerosis. femoral femoral bypass graft and bilateral foot amputations were planned. spinal anesthesia failed due to severe scoliosis and deformed vertebrae. general anesthesia was induced after performing multiple nerve blocks including quadratus lumborum, sciatic nerve, femoral nerve, lateral femoral cutaneous nerve, and obturator nerve blocks. however, general anesthesia was abandoned because of deterioration in systemic perfusion. the surgery was completed ; the patient remained comfortable and awake without the need for further analgesics.conclusion:quadratus lumborum block may be a useful anesthetic technique to perform femoral femoral bypass.
a number of endocrine alterations have been described in patients with lipodystrophy, and this has been attributed to adipocyte malfunction and rare coding mutations in the genes responsible for adipogenesis.[13 ] hyperinsulinemia, metabolic syndrome, fatty liver, and dyslipidemia are frequently described in patients with lipodystrophy. ovarian dysfunctions including subfertility and polycystic ovarian syndrome have also been reported in these patients. there are only a few case reports of pcos in patients with partial lipodystrophy. here a 22-year - old female presented to the endocrinology unit with complaints of irregular periods since menarche and hyperpigmentation of face and neck for the past 5 years. there had been acneform eruptions on the face since the last 3 years, but she denied any hirsuitism. she had noticed changes in her physical appearance, with face and neck getting fuller and muscles of hands and legs getting more prominent.there was no history of diabetes mellitus, pcos or similar physical appearances in any of the family members. on examination, she was of average built with height 160.8 cm and weight 52.8 kg, and bp 110/60 mmhg. there were changes in the fat distribution pattern in her body, with loss of subcutaneous fat in the abdominal and gluteal region and accumulation of fat in the face, neck, and in the paraumbilacal region.acanthosis nigricans was present on the face (tip of the nose was spared), neck, axilla, and pubic region. asymmetry in her breast size was present, with left being bigger in size than the right one. acneform eruptions were present on the face with minimal hair on the chin.there were no significant findings on cardiovascular / cns and chest examination. 97 mg / dl, 1 hr. 197 mg / dl, 2 hr. 157 mg / dl.) and basal and post - glucose insulin levels were high (0 hr 40.05 iu / ml, 1 hr. 882.67 iu / ml and 2 hr.- 281.94 iu / ml), respectively. high triglycerides and low hdl levels were noted (t. cholesterol : 168 mg/ dl, hdl 29 mg / dl, ldl 96 mg / dl, vldl - 43 mg / dl, and triglycerides:213 mg / dl). hormonal profile revealed normal tft, fsh, and lh values (t3 - 3.66 pg / ml, t4 - 1.10 ng/ dl, tsh - 4.10miu / l, lh - 5.22 miu / ml, fsh - 7.43 miu / ml, respectively). nmol / l), free testosterone was 0.649 pg / ml(0.4 - 4.18 pg / ml), dheas - 0.72 g / ml (0.48 - 2.75 g / ml), and 17 ohp - 1.44 ng/ ml (0.2 - 1.3 ng/ ml) levels were normal. ultrasound abdomen and adnexae revealed- hepatomegaly with diffuse fatty infiltration, and both the ovaries revealed multiple small follicles in peripheral distribution with increase in stromal echogenicity suggestive of polycystic pattern of ovaries (right ovary measured 3.2 1.9 1.7 cms with a vol of 5.5 cc. and left ovary measured- 2.7 1.8 1.5 cms with a volume of 4.1 cc) [figure 1 ]. non - enhanced computed tomographic scan of the neck, chest, and abdomen revealed excessive accumulation of face and neck with marked reduction of fat in the chest and abdomen [figures 2 and 3 ]. there was a loss of fat from the breasts with preserved muscle bulk with fibroglandular tissue within the breasts. peritoneal fat was preserved, and excessive deposition of fat was also noted in the perineal region and labia majora. transvesical ultrasound reveals polycystic ovaries with typical peripheral distribution of follicles (case 1) axial non - enhanced ct at the level of maxilla reveals excessive accumulation of facial subcutaneous fat (case 1) unenhanced transverse ct scan at the level of mid abdomen shows sparing of the peritoneal fat (case 1) a 26-year - old female from nepal presented with the complaints of irregular periods from the age of 14 yrs. she had noticed hair growth on face and chin, which started from the age of 22 yrs, with hair getting coarser over the years. she had similar complains of changes in her looks like in the case 1, with muscles over the limbs getting more prominent with fullness over face and chin. she has been on metformin for about 6 months, but she denied any change in appearance / hirsuitism with the medication. on examination, muscles of legs and arms and abdomen were hypertrophied, and less subcutaneous fat was noted. metformin was stopped for 1 week and gtt and other hormones evaluated. 1 and 2 hour hr - 85 mg / dl, 1 hr - 163 mg / dl, and 2 hr - 141 mg / dl) and were associated with a rise in both basal and post - glucose insulin levels (0 hr 21.15 iu/ ml, 1 hr - 717.9 iu / ml, 2 hr. 717.9 iu/ ml).her lipid profile demonstrated low hdl and a high triglyceride levels (total cholesterol - 254 mg / dl, hdl cholesterol- 42 mg / dl, ldl cholesterol - 176 mg / dl, vldl cholesterol - 36 mg/ dl, triglycerides - 178 mg/ dl). hormonal profile revealed normal tft, lh, fsh, and prolactin levels respectively (tsh - 1.8miu / l, ft4 - 1.0 ng / dl, ft3 - 4.0 pg/ ml, lh - 4.5 miu / ml, fsh 5.5 miu/ ml, total testosterone -3.34 nmol / l(0.198 -2.67 nmol / l) and dheas - 3.71 g / ml (0.48 - 2.75 ug / ml), free testosterone -7.11 pg / ml (0.04 - 4.18 pg / ml)and 17 ohp - 3.01 ng / ml (0.2 -1.3 ng/ ml) levels were elevated. (right ovary measured to be 3.3 2.8 1.8 cm with a volume of 9.1 cc, and the left ovary measured 3.2 3.1 2.4 cms with a volume of 13.4 cc) [figure 4 ]. transabdominal ultrasound in case 2 shows bilateral enlarged ovaries with mild increase in stromal echogenicity and multiple small subcentimeter follicles arranged along the rim of the ovaries, consistent with polycystic pattern of ovaries a 22-year - old female presented to the endocrinology unit with complaints of irregular periods since menarche and hyperpigmentation of face and neck for the past 5 years. there had been acneform eruptions on the face since the last 3 years, but she denied any hirsuitism. she had noticed changes in her physical appearance, with face and neck getting fuller and muscles of hands and legs getting more prominent.there was no history of diabetes mellitus, pcos or similar physical appearances in any of the family members. on examination, she was of average built with height 160.8 cm and weight 52.8 kg, and bp 110/60 mmhg. there were changes in the fat distribution pattern in her body, with loss of subcutaneous fat in the abdominal and gluteal region and accumulation of fat in the face, neck, and in the paraumbilacal region.acanthosis nigricans was present on the face (tip of the nose was spared), neck, axilla, and pubic region. asymmetry in her breast size was present, with left being bigger in size than the right one. acneform eruptions were present on the face with minimal hair on the chin.there were no significant findings on cardiovascular / cns and chest examination. 97 mg / dl, 1 hr. 197 mg / dl, 2 hr. 157 mg / dl.) and basal and post - glucose insulin levels were high (0 hr 40.05 iu / ml, 1 hr. 882.67 iu / ml and 2 hr.- 281.94 iu / ml), respectively. high triglycerides and low hdl levels were noted (t. cholesterol : 168 mg/ dl, hdl 29 mg / dl, ldl 96 mg / dl, vldl - 43 mg / dl, and triglycerides:213 mg / dl). hormonal profile revealed normal tft, fsh, and lh values (t3 - 3.66 pg / ml, t4 - 1.10 ng/ dl, tsh - 4.10miu / l, lh - 5.22 miu / ml, fsh - 7.43 miu / ml, respectively). nmol / l), free testosterone was 0.649 pg / ml(0.4 - 4.18 pg / ml), dheas - 0.72 g / ml (0.48 - 2.75 g / ml), and 17 ohp - 1.44 ng/ ml (0.2 - 1.3 ng/ ml) levels were normal. ultrasound abdomen and adnexae revealed- hepatomegaly with diffuse fatty infiltration, and both the ovaries revealed multiple small follicles in peripheral distribution with increase in stromal echogenicity suggestive of polycystic pattern of ovaries (right ovary measured 3.2 1.9 1.7 cms with a vol of 5.5 cc. and left ovary measured- 2.7 1.8 1.5 cms with a volume of 4.1 cc) [figure 1 ]. non - enhanced computed tomographic scan of the neck, chest, and abdomen revealed excessive accumulation of face and neck with marked reduction of fat in the chest and abdomen [figures 2 and 3 ]. there was a loss of fat from the breasts with preserved muscle bulk with fibroglandular tissue within the breasts. peritoneal fat was preserved, and excessive deposition of fat was also noted in the perineal region and labia majora. transvesical ultrasound reveals polycystic ovaries with typical peripheral distribution of follicles (case 1) axial non - enhanced ct at the level of maxilla reveals excessive accumulation of facial subcutaneous fat (case 1) unenhanced transverse ct scan at the level of mid abdomen shows sparing of the peritoneal fat (case 1) a 26-year - old female from nepal presented with the complaints of irregular periods from the age of 14 yrs. she had noticed hair growth on face and chin, which started from the age of 22 yrs, with hair getting coarser over the years. she had similar complains of changes in her looks like in the case 1, with muscles over the limbs getting more prominent with fullness over face and chin. she has been on metformin for about 6 months, but she denied any change in appearance / hirsuitism with the medication. on examination, muscles of legs and arms and abdomen were hypertrophied, and less subcutaneous fat was noted. metformin was stopped for 1 week and gtt and other hormones evaluated. 1 and 2 hour hr - 85 mg / dl, 1 hr - 163 mg / dl, and 2 hr - 141 mg / dl) and were associated with a rise in both basal and post - glucose insulin levels (0 hr 21.15 iu/ ml, 1 hr - 717.9 iu / ml, 2 hr. 717.9 iu/ ml).her lipid profile demonstrated low hdl and a high triglyceride levels (total cholesterol - 254 mg / dl, hdl cholesterol- 42 mg / dl, ldl cholesterol - 176 mg / dl, vldl cholesterol - 36 mg/ dl, triglycerides - 178 mg/ dl). hormonal profile revealed normal tft, lh, fsh, and prolactin levels respectively (tsh - 1.8miu / l, ft4 - 1.0 ng / dl, ft3 - 4.0 pg/ ml, lh - 4.5 miu / ml, fsh 5.5 miu/ ml, prolacin - 11.1 ng/ ml). total testosterone -3.34 nmol / l(0.198 -2.67 nmol / l) and dheas - 3.71 g / ml (0.48 - 2.75 ug / ml), free testosterone -7.11 pg / ml (0.04 - 4.18 pg / ml)and 17 ohp - 3.01 ng / ml (0.2 -1.3 ng/ ml) levels were elevated. (right ovary measured to be 3.3 2.8 1.8 cm with a volume of 9.1 cc, and the left ovary measured 3.2 3.1 2.4 cms with a volume of 13.4 cc) [figure 4 ]. transabdominal ultrasound in case 2 shows bilateral enlarged ovaries with mild increase in stromal echogenicity and multiple small subcentimeter follicles arranged along the rim of the ovaries, consistent with polycystic pattern of ovaries lipodystrophy is a diverse clinical disorder with a complete or partial lack of adipose tissue (lipoatrophy) and / or lack of adipose tissue in certain body areas, with excess of adipose tissue (lipohypertophy) elsewhere. lipodystrophic patients manifest a group of unique features such as hyperlipidemia, insulin resistance, progressive liver disease, and increased metabolic rate. patients with lipodystrophy have primarily a loss of mature, functional adipocytes as opposed to an absence of lipids in otherwise normal adipocytes.[13 ] the underlying defects could be associated with failure of adipogenesis, adipocyte apoptosis, or a failure to store triglycerides in existing adipocytes because of ineffective lipogenesis or excessive lipolysis. lipodystrophy is classified into generalized and partial both, these are further subdivided into congenital and acquired forms. partial lipodystrophy is characterized by selective regional fat loss and is often associated with hypertrophy of adipose tissue in non - atrophic areas. the inherited forms could be face - sparing (dunnigan variety) or could be restricted to the extremities (kobberling type).other types of partial lipodystrophies may be due to mutations in genes like pparg mutations (fpld3,akt2, and cav1). acquired partial lipodystrophy show a female dominance and is characterized by fat loss that progresses in cephalocaudal fashion. excessive fat accumulation is seen over the lower abdomen, gluteal region, thighs, and calves. polycystic ovarian disease, a common endocrine disorder of reproductive age group, is characterized by oligo - amennorhea and hyperandrogenism, resulting in acne and hirsuitism and obesity. insulin also inhibits hepatic production of sex hormone binding globulin, thereby increasing free testosterones levels.post-receptor binding defects in insulin signaling have been described in fibroblasts, adipocytes, and skeletal muscle cells of women with pcos. insulin responsive transcription factor involved in fat and glucose metabolism has been shown to upregulate testosterone forming gene 17 hsd type v.since both insulin and testosterone enhance each other 's action, it is controversial which of the two is primary and which is secondary. women with severe insulin resistance due to insulin receptor antibodies or due to genetic abnormalities of the insulin receptor have severe hyperandrogenism and virilization. since lipodystrophy is a rather rare disorder, there are only a few cases of polycystic ovarian syndrome described in patients with lipodystrophy. according to joy., 4 of the 25 patients with fpld had pcos in comparison with 14 of the 3,326 control subjects. reported that the mean number of live children per woman was 1.7 in lmna - related fpld affected patients vs. 2.8 in non - affected relatives. in this study, 54% of lmna - mutated women exhibited a clinical phenotype of pcos. both our patients had polycystic ovarian disease on ultrasound and also had very high insulin levels (above 700 iu / ml post - glucose load) and impaired glucose tolerance, in spite of lean phenotype. one was hirsuite with high androgen levels, whereas the other had normal androgen levels with no hirsuitism. this possibly indicates that hyperinsulinemia is the primary factor involved in polycystic ovaries in patients with lipodystrophy, hyperandrogenism, and its peripheral manifestations ensue secondarily. in conclusion, these were two rare cases of polycystic ovarian syndrome in patients with lipodystrophy.	lipodystrophy is a clinical disorder characterized by maldistribution of body fat. hyperinsulinemia, insulin resistance, and abnormalities of glucose homeostasis are commonly described among these patients. hyperinsulinemia is also involved in the pathogenesis of polycystic ovarian syndrome, a condition, described rarely in patients with lipodystrophy. here, we describe 2 females of partial lipodystrophy who presented with features of polycystic ovarian disease. both had severe hyperinsulinemia and irregular periods, one had hyperandrogenism and hirsuitism while the other was non - hirsuite.
as the leading cause of gastroenteritis in young children under the age of five, rotavirus (rv) infections annually are responsible for approximately 600,000 deaths worldwide [1, 2 ]. during infection, the rv nonstructural protein 4 (nsp4) functions as a viral enterotoxin by binding an extracellular receptor and activating a signal transduction pathway which increases intracellular calcium ([ca]i) levels through the release of er calcium stores [3, 4 ]. this increase in [ca]i induces secretory chloride currents which result in diarrhea, but only when initiated from the exofacial leaflet of the plasma membrane (pm). the initiated increases in intracellular, calcium levels fail to induce the chloride secretory response [46 ]. traditionally defined as an er glycoprotein, nsp4 contains a single transmembrane domain that serves to anchor the protein into the er membrane, such that a short n - terminal domain (amino acids [aa ] 124) remains within the lumen of the er while the longer c - terminus (aa 45175) extends into the cytoplasm. interactions with numerous viral and cellular proteins occur within the extended c - terminal tail of nsp4 [812 ]. also contained within the c - terminal cytoplasmic tail is an amphipathic -helix (aah), coiled - coil domain (aa 95137) [13, 14 ]. cross - linking and crystallographic experiments reveal that this region of nsp4 primarily oligomerizes into dimers and tetramers and contains a cation - binding site [1315 ]. residing within the amphipathic -helix, coiled - coil domain is the enterotoxic peptide region (aa 114135) as well as the caveolin-1 (cav-1) binding domain and a putative cholesterol recognition amino acid consensus (crac) sequence. l / v-(x)(1 - 5)-y-(x)(1 - 5)-r / k-, where (x)(1 - 5) represents between one and five unspecified residues. however, the presence of such a sequence does not assure an interaction with cholesterol, as this sequence is highly variable and likely is not the only requirement for cholesterol binding. yet a number of viral proteins bind cholesterol, including the hiv-1 gp41 transmembrane glycoprotein [17, 20 ], the influenza m2 protein, and the f1 subunit of the fusion protein of sendai virus. there is compelling evidence that the enterotoxic peptide, nsp4114 - 135, and the full - length nsp4 protein interact with cav-1. in vivo laser scanning confocal microscopy (lscm) colocalizations, fluorescent energy transfer (fret) analyses, and co - immunoprecipitation data from our laboratory verify that nsp4 binds cav-1, the main constituent protein of caveolae, at multiple sites within the cell, including the pm. yeast two - hybrid and in vitro binding assays confirm an interaction between nsp4 and cav-1 and map the cav-1 binding domain to nsp4114 - 135. using deletion and site - directed mutagenesis, the binding site delineated to three hydrophobic residues in the enterotoxic region indicating that nsp4 and cav-1 associate via a hydrophobic interaction (unpublished). additional studies reveal that the cav-1 binding site for nsp4 maps, to both the n- and c - termini of cav-1, residues 231 and 161178, respectively. cav-1 is an intracellular, 21 kd protein bound by the inner leaflet of the pm in a hairpin - like structure such that both the n- and c - termini are oriented towards the cytoplasm [23, 25 ]. numerous signaling molecules, such as those involved in calcium signaling, are localized to caveolae and their function appears to be dependent on interaction with cav-1 [16, 26, 27 ]. cav-1 also binds cholesterol, which has been shown to be vital to caveolae biogenesis and the transport of cholesterol to caveolae at the pm [2831 ]. purified nsp4 and nsp4114 - 135 peptides interact with caveolae - like model membranes, that is, those that have a high radius of curvature and are rich in anionic phospholipids and cholesterol [32, 33 ]. upon interaction with model membranes, both the protein and the peptide undergo a change in secondary structure characterized by an increase in -helix formation. additional secondary structure studies of other nsp4 peptides that overlap the enterotoxic peptide and cav-1 binding domain confirm that this region is important for membrane interactions. when caveolae are isolated from enriched pm fractions of rv - infected mdck cells, the full - length, fully - glycosylated nsp4 is present in the isolated caveolae fractions verifying transport of nsp4 to the pm and caveolae. it is possible that the transport of nsp4 to caveolae occurs through an interaction with cav-1 and cholesterol, although additional studies are needed to for verification. our studies reveal the exposure of the nsp4 c - terminus and the enterotoxic region, but not the n - terminus, on the outer pm leaflet and subsequent release into culture media at a time when the membrane is intact as verified by a lack of exposure of cav-1 and other intracellular markers [3436 ]. in this paper, we have extended these studies using synthetic peptides to address the following questions. (ii) do the two termini of cav-1 interact with one another and thus facilitate binding of nsp4 to both termini ? (iv) do the overlapping nsp4-cav-1 binding, crac motif, and enterotoxin regions interact with cholesterol ? (v) does alteration(s) of nsp4-cholesterol binding have a biological effect ? to answer these questions, we employed peptide - peptide and -cholesterol direct fluorescence - binding assays to ascertain the interaction and determine the binding affinities (kd). we also employed circular dichroism (cd) to investigate secondary structural changes upon interaction of the peptides in the absence or presence of model membranes. trifluoroacetic acid (tfa), 1-hydroxy - benzotriazole (hobt), and o - benzotriazole - n, n, n,n-tetramethyluronium - hexafluoro - phosphate (hbtu) were purchased from american bioanalytical (natick, ma). n, n - diisopropylethylamine (dipea) and n, n-diisopropylcarbodiimide (dipcidi) were purchased from creosalus (louisville, ky). thioanisole, ethanedithiol, and anisole were purchased from emd chemicals (gibbstown, nj). cholesterol, sephadex g-25, and trifluoroethanol (tfe) were purchased from sigma (st. louis, mo). phospholipids dops (1,2-dioleoyl - sn - glycero-3-[phosphor - l - serine ]) and popc (1-palmitoyl-2-oleoyl - sn - glycero-3-phosphocholine) were purchased from avanti polar lipids (alabaster, al). antibodies specific to the nsp4 peptide aa 150175 (nsp4150 - 175 ; deduced from the simian rotavirus sa11 nsp4 sequence) were generated in rabbits by immunizing with peptide cross - linked to keyhole limpet hemocyanin as previously described. anti - nsp4150 - 175 was affinity purified against the inoculating peptide linked to preactivated cyanogen bromide sepharose 4b beads according to the manufacturer (amersham pharmacia biotech, piscataway, nj). guinea pig anti - nsp5, a viroplasm (virus factory in the cell) marker, was a gift from dr. oscar burrone (international center for genetic engineering and biotechnology, trieste, italy). f(ab)2 fragments of goat anti - guinea pig igg - cy3 and goat anti - rabbit igg - cy2 were purchased from jackson immuno research (west grove, pa). ht29.f8 cells are a spontaneously polarizing cell line that was cloned from the human adenocarcinoma ht29 intestinal cell line. cells were maintained in dulbecco 's modification of eagle 's media (dmem) with 4.5 g / l glucose, 2 mm l - glutamine, and 1 mm sodium pyruvate (mediatech, inc., herndon, va) and supplemented with 5% fetal bovine sera, 5% serum supreme, and antibiotics (100 u / l penicillin, 100 ug / l streptomycin, 0.25 ug / l amphotericin b) (cambrex, east rutherford, nj). for infection, cells were incubated in the absence of sera exactly as described and exposed to virus for 1 h (multiplicity of infection (moi) = 2) [23, 35, 36 ]. all peptides (table 1) were synthesized by fluorenylmethoxycarbonyl (fmoc) solid - phase chemistry with either 1-hydroxy - benzotriazole (hobt), o - benzotriazole - n, n, n,n-tetramethyluronium - hexafluoro - phosphate (hbtu) and n, n - diisopropylethylamine (dipea), or hobt and n, n-diisopropylcarbodiimide (dipcidi) activation using the model 90 peptide synthesizer (advanced chemtech ; louisville, ky). following synthesis, the peptides were cleaved from the solid resin support and all side - chain protecting groups were removed by the addition of reagent r (90% trifluoroacetic acid (tfa), 5% thioanisole, 3% ethanedithiol, and 2% anisole). the peptide / reagent r cleavage mixture was incubated at rt for a maximum of 2 hours with gentle mixing. to separate the peptides from the solid support, the mixture was filtered through a sintered glass filter into a 50 ml conical tube containing cold diethyl ether in a dry ice / ethanol bath. following 2 - 3 rinses of the filter with tfa, the ether solution containing the supernatant was removed and additional cold diethyl ether was added to the peptide pellet. the mixture was allowed to cool in the dry ice / ethanol bath for several minutes before repelleting. this step was repeated an additional two times ; the crude peptide was dried under n2, resolubilized in 10% acetic acid and lyophilized. the lyophilized crude peptide was resuspended in 510% acetic acid and purified from organic contaminants and incomplete peptide fragments by gravimetric gel filtration chromatography (sephadex g25 medium). the eluted peptide was lyophilized and further purified by reverse - phase hplc using either a reverse phase c4 delta pak column (waters chromatography division, milford, ma) or a reverse phase c18 column (beckman - coulter, fullerton, ca) depending on the hydrophobicity of the peptide. eluted peaks were lyophilized and characterized by matrix - assisted laser desorption / ionization (maldi) mass spectrometry (laboratory for biological mass spectrometry, department of chemistry, texas a&m university, college station, tx). small unilamellar vesicles (suvs) composed of the neutral lipid popc, cholesterol, and the anionic phospholipid dops in the molar ratio 55 : 35 : 30 were prepared following a previously published protocol. this membrane composition was chosen as a result of previous data showing that this composition and curvature promote an interaction with nsp4-specific peptides as observed by an increase in -helix formation [32, 33 ]. stock solutions of the lipids dissolved in chloroform were mixed together in the proper ratio in an amber glass vial. the solvents were removed under n2 with constant rotation so that the dried lipids formed a thin film on the wall of the glass vial. the vial containing the dried lipids was further dried under vacuum for a minimum of 4 h. the dried lipids were resuspended in 10 mm mops buffer, ph 7.4 (filtered through a 0.45 m filter ; millipore, bedford, ma), vortexed and bath sonicated. the resulting multilamellar membrane suspension was sonicated with a microprobe under n2 at 4c at 2 min intervals, followed by 1 min pauses to prevent overheating of the lipid solution. the sonicated lipid solution then was centrifuged at 110,000 g for 4 h to remove any multilamellar vesicles and titanium debris from the sonicator probe. the lipid concentration of the suv solution was determined by a standard phosphate assay as described. briefly, the suv solutions were mixed with a 10% magnesium nitrate (mg(no3)2) solution and heated for 30 min at 120c. each sample was ashed in a flame, 600 l of 0.5 n hcl was added, and the samples were heated in boiling water for 15 min. each sample was mixed with 1400 l of a 10% ascorbic acid solution that contained 6 parts of a 0.42% ammonium molybdate solution in 1 n sulfuric acid (h2so4) and incubated for 20 min at 45c before reading the absorbance at 660 nm (a660). lipid concentrations of the suvs were determined by comparison to a standard curve of 0200 nmol phosphate. a fluorescence - binding assay was utilized to investigate direct binding of the nsp4112 - 140 peptide with each of the cav-1 peptides (n - cav2 - 20, n - cav19 - 40, cav68 - 80, and c - cav) [20, 39 ]. all of the cav-1 peptides directly were labeled with a cy3 fluorescent dye, using the cy3 monoreactive dye pack from amersham biosciences according to the manufacturer 's protocol. briefly, each peptide was dissolved in 50 nm phosphate buffer, ph 7.0, at a concentration of 1 mg / ml, and added to a vial containing lyophilized cy3 dye. the solution gently was mixed and incubated at 25c for at least 2 h with intermittent mixing. labeled peptides were separated from unlabeled peptides by sephadex g25 gel filtration chromatography. to demonstrate a direct peptide - peptide interaction between the nsp4112 - 140 peptide and each of the cav-1 peptides, increasing concentrations of nsp4112 - 140 (10500 nm) were added to 25100 nm of the cy3-labeled cav-1 peptides in 2 ml of phosphate - buffered saline (pbs, ph 7.4) in either the absence or presence of small unilamellar vesicles (suvs, 1 m). the cy3 fluorophore was excited at 550 nm and emission spectra were scanned from 560 to 700 nm. fluorescence emission spectra were obtained at 25c with a pc1 photon - counting spectrofluorometer with excitation and emission slit widths of 1.0 (iss, inc.). calculation of the dissociation constants (kd) was performed from the titration curves plotted as quenching in cy3-peptide fluorescence intensity (f0 f, where f0 and f represented the cy3-cav-1 peptide fluorescence intensities in the absence and presence of nsp4112 - 140 or cav-1 peptide, resp. the kd also was obtained by a reciprocal plot of 1/(1 f / fmax) and cl / f / fmax according to the following equation : y = bx + y0, where f is the fluorescence intensity at a given concentration of ligand, fmax is the maximal fluorescence obtained, and cl is the ligand concentration. similarly, the nsp4112 - 140-cholesterol interaction and binding affinity were determined by a direct fluorescent binding assay in which the peptide was labeled with a cy5 fluorophore using the cy5 monoreactive dye pack from amersham biosciences (piscataway, nj). a concentrated cholesterol stock solution (20 um) was prepared by dissolving the cholesterol in ethanol. to analyze a binding interaction between nsp4112 - 140 and cholesterol, an increasing quantity of cholesterol (535 nm) was added to 10 nm of the cy5-labeled nsp4112 - 140 in 2 ml of pbs (ph 7.4). the cy5 fluorophore was excited at a wavelength of 649 nm, and the emission spectra were scanned from 655 to 720 nm using a pci photon - counting spectrofluorometer (iss, inc. fluorescence emission spectra were obtained at 25c with excitation and emission slit widths of 1.0. as with the peptide - peptide interactions, spectra were corrected for background and maximal fluorescence intensities were measured. calculation of the kd was determined from the plotted titration curves whereby the cy5-peptide fluorescence intensity was quenched and measured as a function of cholesterol concentration (f0f, where f0 and f represented the cy5- nsp4112 - 140 fluorescence intensities in the absence and presence of cholesterol, resp. the sigmoidal curves also were fitted to a hill plot according to the following equation : y = ax/(c + x), where y and x correspond to (f0f) and the ligand concentration at each point, while a, b, and c represent the maximum binding (bmax), the number of binding sites (n), and the kd value, respectively. kd values were calculated with the sigmoidal function of sigma plot (spss, chicago, il) utilizing the hill plot feature. the secondary structures of the nsp4 and cav-1 specific peptides were determined by circular dichroism following a previously published protocol [32, 33 ]. briefly, each peptide (1535 m) was suspended in 10 mm potassium phosphate buffer, ph 7.4, or 50% trifluoroethanol (tfe) to promote a hydrophobic environment and folding of the peptide, in the presence or absence of lipid vesicles (1 mm) peptide concentrations were determined by amino acid analysis (protein chemistry laboratory, department of biochemistry, texas a&m university, college station, tx). cd spectra were obtained in a 1 mm circular quartz cell using a model j-710 jasco spectropolarimeter (jasco, easton, md) or in a 1 mm rectangular quartz cell in a model 202 aviv spectrometer (aviv biomedical, lakewood, nj). the spectra for each of the peptides were recorded from 185 nm to 260 nm, with a step resolution of 1 nm, speed of 50 nm / min, response of 1 sec, bandwidth of 2.0 nm, and sensitivity of 10 mdeg. data were averaged from 5 scans, background subtracted, smoothed, and converted into mean residue molar ellipticity [] (deg cm / dmol). to determine the percent -helix for each of the nsp4- and cav-1 specific peptides, the following equation was used : 222 = (fh /n)[h 222 ] [12, 21, 22 ]. in this equation, 222 is the mean residue molar ellipticity at 222 nm, fh is the fraction in -helical form, is the number of helices, is a wavelength - specific constant with a value of 2.6 at 222 nm, n is the number of residues in the peptide, and h 222 is the molar ellipticity for a helix of infinite length at 222 nm, that is, 39,500 deg cm / dmol. mdck cells were infected with rv at a multiplicity of infection (moi) of 2 and incubated for 12 hpi. the cells were washed and treated in triplicate with the cholesterol altering drugs, fillipin, and nystatin exactly as described. chlorpromazine [40, 42 ] and nocodazole were utilized as negative and positive controls, respectively. cells were fixed with methanol : acetone (1 : 1) at 20c for 10 min, blocked with 5% dry milk for 20 min, incubated with anti - nsp4150 - 175 and anti - rabbit - igg - fitc, and examined under a uv microscope (zeiss). the cell surface carefully was observed and the presence or absence of fluorescence carefully noted. primary and secondary antibody controls were negative. to ensure the lack of drug toxicity, a separate set of cells were treated and then stained with trypan blue. we previously demonstrated that nsp4114 - 135 interacts with both the n- and c - termini of cav-1 using yeast-2-hybrid and pull - down assays, which is unusual. to further investigate this finding and determine if there was a preferential binding of nsp4 to the n- or c - terminus of cav-1, the nsp4112 - 140 peptide that encompasses aa 114135 and various cav-1 peptides (n - cav2 - 20, n - cav19 - 40, and c - cav161 - 178) were utilized in a direct fluorescence - binding assay. upon titration with increasing concentrations of nsp4112 - 140, each of the cy-3-labled n- or c - terminal cav-1 peptides showed an increase in fluorescence intensity at 565 nm, indicative of an interaction. plots of nsp4112 - 140 concentrations versus maximum fluorescence intensities revealed saturated binding curves for each of the cav-1 peptides (figure 1). linear reciprocal plots were used to calculate the kd for each peptide - peptide pair (table 2). the calculated kd values indicated that nsp4112 - 140 bound the n - cav19 - 40 peptide with the strongest affinity (40 10 nm), while it bound the c - cav161 - 178 peptide with the weakest affinity (217 35 nm). the n - cav2 - 20 peptide bound with intermediate affinity (85 6 nm). none of the cav-1 peptides bound to the control peptide corresponding to the c - terminus of nsp4 (nsp4150 - 175ala), which is known to not bind cav-1. we now show that there is a preferential interaction of nsp4112 - 140 with the n - terminus of cav-1, which, to our knowledge, is the first report of a preferential binding to one termini of cav-1. previous cd analyses of nsp4 peptides corresponding to the cav-1 binding domain show that aa 114135 interacts with model membranes (suvs) [32, 33 ]. therefore, nsp4-cav-1 peptide - peptide interactions also were investigated in the presence of the same suv membranes. the suvs were mixed with each of the cy3-labeled cav-1 peptides in pbs and then titrated with increasing concentrations of nsp4112 - 140 (figure 2). the presence of lipid vesicles had no effect on the interaction of nsp4112 - 140 with either n - cav19 - 40 or c - cav161 - 178 (figures 2(b) and 2(c)). binding affinities in the presence of membranes were similar to those calculated in the absence of membranes (table 2). however, the presence of the suvs resulted in an increased affinity between nsp4112 - 140 and n - cav2 - 20. the calculated kd value was determined to be 26 4 nm, an approximate 3-fold increase over that observed in the absence of membranes (85 6 nm) and about a1.5-fold increase over the kd of n - cav19 - 40 in the absence of membranes (40 10 nm). these results strongly suggest that the presence of lipid vesicles enhances binding between nsp4112 - 140 and the extreme n - terminus of cav-1 (aa 2 - 20), but not the adjacent n - terminal cav-1 peptide, n - cav19 - 40. to evaluate the mechanism of the interaction of nsp4 with both cav-1 termini, we examined whether the two cav-1 termini bound one another to facilitate the interaction with nsp4 by employing the fluorescence - binding assay. c - cav161 - 178 was labeled with a cy3-fluorophore and titrated with either the n - cav2 - 20 or n - cav19 - 40 peptide. titration of c - cav161 - 178 with increasing concentrations of either n - terminal peptide resulted in no change in fluorescence intensity at 565 nm, indicative of a lack of association (figure 3). hence, we propose that the n- and c- termini of cav-1 do not bind one another and the interaction between nsp4 and the cav-1 termini does not result from an initial binding between the cav-1 n- and c - termini. to our knowledge, this is the first report of the cav-1 termini not interacting. additional studies are needed to dissect the mechanism and implications of both cav-1 termini binding nsp4. the structure of the nsp4112 - 140 peptide was first determined in an aqueous buffer (10 mm potassium phosphate buffer, ph = 7.4) (figure 4, dark circles). the cd spectrum showed double minima at 208 and 222 nm and a single maximum peak at 190 nm, indicative of some -helical secondary structure. using the molar ellipticity value at 222 nm, the -helical content of the nsp4112 - 140 peptide was calculated to be 30.6 2.4%. to enhance innate peptide structure, the secondary structure of nsp4112 - 140 was determined in 50% tfe, a hydrophobic solvent that promotes intramolecular hydrogen bonding (figure 4, open circles). the cd spectrum showed a dramatic increase in -helix formation of the peptide, as evidenced by an increase in both the negative molar ellipticity at 208 and 222 nm and the positive molar ellipticity at 190 nm. the -helical content was calculated using the molar ellipticity value at 222 nm and determined to be 79.6 4.6% (table 3). previous cd experiments with the enterotoxic peptide, nsp4114 - 135 demonstrate that the -helical content increases in the presence of suvs containing popc, cholesterol, and dops at a 55 : 35 : 10 molar ratio [32, 33 ]. to determine the secondary structural changes that occur in the presence of membranes, nsp4112 - 140 was mixed with suv membranes and changes in -helical content the cd spectrum of the nsp4112 - 140 peptide in the presence of 1 mm suv showed nearly a 2-fold increase in -helix formation over that in aqueous buffer, as evidenced by the increase in both the negative molar ellipticity as 208 and 222 nm and the positive molar ellipticity at 190 nm (figure 5). the -helical content was calculated using the molar ellipticity value at 222 nm and determined to be 57.9 1.6% (table 3). the secondary structures of the cav-1 peptides were determined and evaluated in the presence of 50% tfe and 1 mm suvs (55 : 35 : 10 ; popc : cholesterol : dops) by cd (table 3). in aqueous buffer, the -helical content of n - cav2 - 20, n - cav19 - 40, and cav68 - 80 was quite similar, at 18.9%, 20.7%, and 23.4%, respectively (figures 6(a)6(c), dark circles). the -helical contents of the c - terminal peptide (c - cav161 - 178) was approximately twice (43.4%) that of the n - terminal peptides (table 3). when placed in 50% tfe, the -helical content of n - cav2 - 20, n - cav19 - 40, cav68 - 80, and c - cav161 - 178 peptides were calculated to be 16.5%, 33.4%, 23.1%, and 67.1% respectively (figure 6, open circles). only n - cav19 - 40 and c - cav161 - 178 showed an increase in -helix formation in the presence of 50% tfe. when mixed with the suvs, none of the cav-1 peptides demonstrated a change in -helix formation over that seen in aqueous buffer (figure 6, dark triangles). this result was anticipated as none of these peptides corresponded to a cav-1 membrane interacting or transmembrane domain. analyses by direct fluorescence - binding assays revealed that n - cav19 - 40 bound nsp4112 - 140 with a stronger affinity than c - cav161 - 178. we therefore investigated whether structural changes occurred upon the association of the nsp4 and cav-1 peptides, in particular with the amino terminus. each of the cav-1 peptides (n - cav2 - 20, n - cav19 - 40, cav68 - 80, and c - cav161 - 178) was mixed with the nsp4112 - 140 peptide and was analyzed by cd. cav68 - 80 was used as a negative control, as previous studies have shown that nsp4 does not interact with this region of cav-1 [23, 24 ]. analyses of the mixing experiments were achieved by comparing the spectrum of each peptide - peptide mixture (observed) with the sum of the individual spectra of each peptide (theoretical). the -helical content was calculated and significant differences (student 's t - test, p < 0.05) between the observed and theoretical values indicated a change in secondary structure and binding between the two peptides. however, a lack of secondary structural alterations upon mixing the peptides did not negate binding between the nsp4112 - 140 and the cav-1 peptide being tested. while direct fluorescent binding assays revealed the affinity of each of the peptide - peptide interactions, the cd experiments disclosed the extent to which the interaction(s) caused a change in the secondary structure. when each of the cav-1 peptides was mixed with nsp4112 - 140 in an aqueous buffer, only the nsp4112 - 140-c - cav161 - 178 mixture showed a significant difference between the observed and theoretical values (25.0 1.7% versus 35.3 1.6% -helix) (figure 7(d) ; table 4). no change in secondary structure was observed for the nsp4112 - 140-n - cav2 - 20 (21.7 0.8% versus 23.6 2.6%), the nsp4112 - 140-n - cav19 - 40 (23.8 1.2% versus 24.4 0.6%), or the nsp4112 - 140-cav68 - 80 negative control (24.2 0.3% versus 23.9 0.7%) mixtures even though n - cav19 - 40 had the lowest kd (figures 7(a)7(c) ; table 4). similarly, when each peptide - peptide pair was placed in 50% tfe, only the nsp4112 - 140-c - cav161 - 178 mixture showed a significant change in secondary structure (44.2 10.6% versus 67.8 3.2%) (table 4). these data confirmed the weak binding between nsp4112 - 140 and c - cav161 - 178 and verified that secondary structure alterations do not always occur upon an interaction. cav-1 is critical to both the structure and function of caveolae, is the major constituent of caveolae, and is controller of caveolae formation. nsp4 is present in isolated caveolae from rv - infected cells, and together with nsp4114 - 135, preferentially interacts with caveolae - like model membranes. therefore we evaluated the extent the suvs influenced secondary structure alterations of the nsp4-cav-1 peptide - peptide interactions. even though the nsp4112 - 140-c - cav161 - 178 peptide pair showed the most change in -helical content in aqueous buffer and 50% tfe, in the presence of suvs there was not a significant conformational change indicating that this interaction was not enhanced by the presence of model membranes (table 4). similarly, the nsp4112 - 140-n - cav19 - 40 showed the strongest affinity by direct fluorescent binding assays (table 2), yet this interaction failed to result in a significant change in secondary structure when mixed with membranes. the observed -helical content did not vary from the expected theoretical value, regardless of whether the peptide mixture was in aqueous buffer, 50% tfe, or mixed with suvs. these results suggest that the strong binding between nsp4112 - 140 and n - cav19 - 40 required neither a change in structure nor the presence of specific lipids. only the nsp4112 - 140-cav68 - 80 (negative control) mixture showed a significant change in the -helical content in the presence of the suvs (31.3 0.2% versus 37.5 1.9%) (figure 8(c) ; table 4). it is currently unclear why the control peptide mixture resulted in an alteration in helical structure and requires further study. the nsp4112 - 140 peptide, which contains the crac motif, was labeled with a cy5-fluorophore and titrated with cholesterol in a direct fluorescence - binding assay. the maximum solubility of cholesterol in water is 4.7 m and the critical micellar concentration (cmc) is 2540 nm, so cholesterol concentrations were kept below these limits in the binding assays. in the absence of cholesterol, the cy5-nsp4112 - 140 peptide showed maximum fluorescence at 665 nm (figure 9). upon titration with increasing concentrations of cholesterol (535 nm), cy5-nsp4112 - 140 showed a decrease in fluorescence intensity, indicative of an interaction. measurements of fluorescent intensities at 665 nm of cy5-nsp4112 - 140 in the presence of increasing concentrations of cholesterol were corrected for background (cy5-nsp4112 - 140 in buffer alone) and plotted as a function of cholesterol concentration, demonstrating a saturable binding curve (figure 9(b)). the kd of cholesterol for nsp4112 - 140 was calculated to be 8 1 nm. a hill plot revealed a single cholesterol binding site (n = 1) in the 28 residue peptide. a control peptide (nsp4150 - 175ala), corresponding to the c - terminus of nsp4 and lacking the crac motif, failed to demonstrate a change in fluorescence intensity in the presence of cholesterol, indicative of a lack of binding (figures 9(c) and 9(d)). we evaluated the effect(s) of drugs known to disrupt cholesterol (fillipin, nystatin, lovastatin) [40, 41, 45 ], hence caveolin / caveolae transport properties, an inhibitor of clathrin - coated pit processes (chloropromazine) [40, 42 ], and a disruptor of the cytoskeleton (nocodazole). cells were treated at the recommended effective dose, evaluated with trypan blue to ensure a lack of toxicity, and nsp4 transport to the cell periphery was noted. whenever cholesterol trafficking was disrupted, nsp4 likewise failed to transport to the cell surface as evidenced by a lack of peripheral staining (table 5). several reports highlight the use of peptides as a means of investigating the interactions of full - length proteins [3, 4750 ]. this study similarly demonstrated the utility of synthetic peptides by showing differential binding of nsp4112 - 140 to the cav-1 termini and disclosing secondary structural changes that were not necessary for the interaction between the nsp4 and cav-1 binding domains. the kd was calculated as 8.0 1 nm and a hill plot revealed a single binding site for cholesterol when reacted with nsp4112 - 140. an interaction between nsp4114 - 135 and the cellular protein cav-1 [2325 ] as well as caveolae is well established. additionally, we report the interaction of nsp4 with both the n- and c - termini of cav-1 (aa 231 and 161178, resp.) based on yeast two - hybrid analyses and in vitro peptide binding assays. herein, we confirmed the interaction between nsp4 and the n- and c - termini of cav-1 and calculated the binding affinities of those interactions using peptides and direct fluorescence - binding assays. nsp4112 - 140, which encompasses the cav-1 binding domain and overlaps the aah and enterotoxic peptide, was utilized with cav-1 peptides corresponding to the n- (n - cav2 - 20 and n - cav19 - 40) and c- (c - cav161 - 178) termini and a central region (cav68 - 80). calculations of the binding affinities revealed that nsp4112 - 140 bound the n - terminus of cav-1 (n - cav19 - 40) with an affinity over 5 times stronger than that of the c - terminus (c - cav161 - 178) (40 10 nm versus 217 35 nm, resp.). when mixed with suvs, the kd values showed an increase in binding affinity for the nsp4112 - 140-n - cav2 - 20 interaction such that this peptide - peptide interaction occurred with similar affinity (26 4 nm) as that observed between nsp4112 - 140 and n - cav19 - 40 in the absence of membranes (40 10 nm). no change, however, was observed in the binding affinities between nsp4112 - 140 and n - cav19 - 40 or c - cav161 - 178 in the presence of the lipid vesicles indicating that lipids were not involved in these interactions. the functional significance of the preferential binding to n - terminal cav-1 currently is unknown. while we did not specifically analyze the oligomerization of the nsp4112 - 140 peptide in this study, our previous data on a similar and overlapping peptide (nsp4114 - 135) showed oligomerization / aggregation at a peptide concentration of ~50 um. the peptide concentration utilized in the binding assays stayed within the nm range, well below the 50 um concentration at which the oligomerization occurred with the nsp4114 - 135 peptide. following confirmation of an interaction between nsp4 and both termini of cav-1, we analyzed potential secondary structural changes upon peptide - peptide association by cd. previous secondary structure analysis of nsp4114 - 135 yielded an estimate of 37% -helix for the peptide [32, 33 ]. analyses of the secondary structure of the full - length nsp4 protein showed ~26% -helix when analyzed by cd. to our knowledge, all other structural studies of nsp4 were completed on specific fragments of nsp4 and not the full - length protein. cd analysis of nsp4112 - 140 showed 30% -helix, which is within the range calculated for the enterotoxic peptide and the full - length protein. when placed in the presence of suvs, which mimics the more biologically relevant caveolae environment, nsp4112 - 140 demonstrated an increase in -helical content. this increase in -helix formation indicated that this peptide behaved similarly to the nsp4114 - 135 peptide and the presence of membranes influenced the structure. to date the crystallographic structure of cav-1 has not been resolved ; however, limited secondary structural studies and bioinformatics analyses have provided insight into its folded conformation. cd analysis of aa 1101 reveals that the n - terminus contains 20% -helix, with aa 7996 constituting the -helix portion, while aa 178 likely lacks significant secondary structure. an additional study, which used a bioinformatics approach, notes that aa 95101 contains -helical structure, while aa 8494 forms two -strands. further, cav-1 is known to form high molecular weight oligomers that requires the cav-1 scaffolding domain (csd, aa 82101) [5254 ]. additionally, the c - terminus is palmitoylated on three cysteines, which helps anchor the protein to the membrane and may thus explain the preferential binding of nsp4 to the n - terminus of cav-1 [5456 ]. peptides corresponding to the n - terminus of cav-1 displayed ~20% -helix, whereas the cav-1 c - terminal peptide unexpectedly showed 43% -helix, twice that of the n - terminus when peptides were analyzed by cd. this was surprising as the bioinformatics study predicted that the c - terminus would contain primarily random secondary structure. hence, our data show that the cav-1 c - terminus contains helical structure, suggesting that it may not exclusively be random, and supports the consensus structural predictions of cav-1 aa 134167. cd analysis of nsp4-cav-1 peptide - peptide interactions revealed that there was no significant change in -helix formation upon binding of nsp4112 - 140 and the n - cav19 - 40 peptide. however, a structural change was noted upon interaction of nsp4112 - 140 with n - cav2 - 20 and c - cav161 - 178. taken together with the binding assays, these results reveal that while the interaction between nsp4112 - 140 and n - cav19 - 40 occurs with a strong affinity, binding does not require a conformational change. however, the secondary structure change observed when the nsp4112 - 140 and c - cav161 - 178 peptides were mixed likely occurred to allow the two peptides to interact, albeit more weakly. a statistically significant conformational change was observed when the nsp4112 - 140-cav68 - 80 mixture was combined with model membranes. since cav-168 - 80 is located near the n - terminal membrane attachment domain (n - mad ; aa 82101), as well as the transmembrane domain (aa 102134) of cav-1, it was postulated that the observed conformational change was due to the interaction of cav68 - 80 with the lipid vesicles. however, when cav68 - 80 was mixed with suvs in the absence of nsp4112 - 140, no change in secondary structure was observed. extensive studies are needed to dissect how the suvs alter the structure of the nsp4112 - 140 and cav68 - 80 mixture. the interaction of nsp4 with both termini of cav-1 is unique, as most cav-1 binding proteins interact with the csd [57, 58 ]. since nsp4 (aa 112140) interacted with the n - terminus of cav-1 more strongly than the c - terminus, it is possible that the interaction with the c - terminus is transitory. nsp4 activates signaling pathways that mobilize [ca]i, requiring the protein to interact with membrane - associated signaling molecules [59, 60 ]. the weak binding between nsp4 and the c - terminus of cav-1 may serve to present and/or orient the viral protein for interactions with signaling molecules or lipids, such as the phosphoinositides. once nsp4 is properly presented to signaling molecules within the membrane, the c - terminus of cav-1 may then quickly disassociate thus allowing nsp4 to carry out its biological function(s). since the c - terminus of the cav-1 protein is closely associated with membranes and does not extend into the cytoplasm to the same extent as the n - terminus, it likely has less flexibility and/or accessibility for interactions with other proteins. this lack of freedom is another potential explanation for the weak binding observed between nsp4 and the c - terminus of cav-1. it has been shown that nsp4 is released from rv - infected cells in different forms dependent on the cell type, virus strain, and moi [36, 61, 62 ]. the differential binding of nsp4 to the n- and c - termini of cav-1 could also contribute to the presentation and transport of nsp4 across the pm and provide a key target to block nsp4 from exiting the cell. results of the fluorescence - binding assay showed that the n- and c - termini of cav-1 do not interact, so this possibility can be ruled out. lastly, we demonstrated that an rv nsp4 peptide directly interacted with cholesterol and this interaction overlapped the amphipathic -helix, the enterotoxic peptide, and cav-1 binding domains (aa 112140), as well as a putative crac motif. the interaction between cholesterol and the nsp4 crac sequence has implications for the trafficking of nsp4 in rv - infected cells. given that caveolae are involved in de novo cholesterol transport from the er to pm caveolae [30, 39 ] and cav-1 assists in cholesterol transport [29, 30, 63, 64 ], contains a crac motif, and binds cholesterol in a 1 : 1 ratio, it is reasonable to propose that cav-1 and cholesterol function in nsp4 intracellular localization and transport [65, 66 ]. indeed the interaction between nsp4 and cholesterol supports the hypothesis that nsp4 traffics via a cholesterol transport pathway in rv - infected cells. likewise, nsp4 interacts with cav-1, has a proposed crac motif, traffics to the cell surface via a golgi - bypassing, unconventional pathway [7, 34, 36, 67 ], and, as we show herein, interacts with cholesterol with a kd of 8 1 nm. we also showed that the nsp4-cholesterol interaction was specific to aa 112140, as there was no binding to a c - terminal nsp4150 - 175ala peptide. based on these results using synthetic peptides, we hypothesize that nsp4 traffics with cholesterol and cav-1 from the er to the pm, and to viroplasms via association to cholesterol. additional studies are needed to verify this hypothesis, dissect nsp4 transport to the pm, and resolve viroplasm localization, all of which may constitute novel targets of reducing nsp4 effects.	rotavirus (rv) nsp4, the first described viral enterotoxin, is a multifunctional glycoprotein that contributes to viral pathogenesis, morphogenesis, and replication. nsp4 binds both termini of caveolin-1 and is isolated from caveolae fractions that are rich in anionic phospholipids and cholesterol. these interactions indicate that cholesterol / caveolin-1 plays a role in nsp4 transport to the cell surface, which is essential to its enterotoxic activity. synthetic peptides were utilized to identify target(s) of intervention by exploring the nsp4-caveolin-1 and -cholesterol interactions. nsp4112140 that overlaps the caveolin-1 binding domain and a cholesterol recognition amino acid consensus (crac) motif and both termini of caveolin-1 (n - caveolin-1220, 1940 and c - caveolin-1161180) were synthesized. direct fluorescence - binding assays were employed to determine binding affinities of the nsp4-caveolin-1 peptides and cholesterol. intracellular cholesterol alteration revealed a redistribution of nsp4 and disintegration of viroplasms. these data further imply interruption of nsp4112140-n - caveolin-11940 and cholesterol interactions may block nsp4 intracellular transport, hence enterotoxicity.
micrornas (mirnas) are short (2024 nucleotide) noncoding rnas involved in posttranscriptional regulation of gene expression. mirna genes can be epigenetically regulated and mirnas can themselves repress key enzymes that drive epigenetic remodeling and directly modulate gene transcription in the nucleus through recognition of specific target sites in promoter regions. resistant 3t3-l1 adipocytes, approximately 80 mirnas have been found to be up- or downregulated, while mir-320 and mir-29 have been demonstrated to regulate insulin action through the pi3k / akt pathway [5, 8 ]. polycystic ovary syndrome (pcos) is one of the most common endocrine disorders, affecting 79% of reproductive - aged women, even when defined conservatively. about 6070% of pcos patients demonstrate insulin resistance (ir) above and beyond that predicted by body mass, race, or age, resulting in compensatory hyperinsulinemia and an increased risk for type 2 diabetes mellitus (t2 dm) and metabolic syndrome. the underlying cellular mechanisms leading to ir in pcos remain to be completely elucidated, as no gross defects in the traditional insulin signaling pathways have been found, including insulin binding, insulin receptor expression, and the irs-1/pi3 k / akt pathway [10, 11 ]. we previously reported that mir-93 is upregulated in adipose tissue (at) from pcos and non - pcos women who display ir. overexpressed mir-93 directly inhibits glucose transporter isoform 4 (glut4) expression, influencing glucose metabolism. in addition we also observed that mir-223 was abnormally expressed in pcos women with ir. mir-223 is overexpressed in insulin resistant myocardial cells and, paradoxically, overexpression of mir-223 by transfection has been reported to increase glut4 protein expression but not mrna, thereby improving glucose uptake in cardiomyocytes. it is unclear whether mir-223 may also regulate ir in adipocytes. in the present study, we examined the role of mir-223 in the at of four groups of women : those without pcos or ir ; those without pcos, but with ir ; those with pcos, but without ir ; and women with pcos and ir. we hypothesized that abnormal expression of mir-223 plays a role in the metabolic dysfunction of pcos and ir. subcutaneous abdominal at samples from 33 women (30 white, 1 black, and 2 asian) were studied. the diagnosis of pcos was performed as previously described. in brief, the diagnosis of pcos was made according to the national institutes of health (nih) 1990 criteria : (i) clinical evidence of hyperandrogenism and/or hyperandrogenemia ; (ii) oligoovulation ; and (iii) the exclusion of related disorders. specific criteria for defining clinical hyperandrogenism, hyperandrogenemia, oligoovulation, and the exclusion of related disorders have been previously described. all subjects had no significant illness including diabetes, had not received hormonal therapy or medications that could alter the metabolic or hormonal status for at least three months before the study, and were between the ages of 18 and 45 years. the study was approved by the institutional review board, and all subjects gave informed written consent. hormonal assays for total and free testosterone (t), dehydroepiandrosterone sulfate (dheas), insulin, and glucose were performed as previously described. approximately 5 g of subcutaneous at was excised through a small incision in the lower abdomen, as previously described (http://www.youtube.com/watch?v=gy2pfujdldm). total rna was extracted using the miracle isolation kit (jinfiniti biosciences, augusta, ga). first - strand cdnas of mrna and mirna were synthesized using the high capacity cdna reverse transcription kit (applied biosystems, foster city, ca) and first - strand cdna synthesis kit for mirna (origene, rockville, md). real - time pcr was performed using an itaq universal sybr green supermix (bio - rad laboratories, inc. relative fold change of targets genes expression was calculated by using the 2 method. to induce differentiation, preadipocytes were cultured to full confluence and then maintained in differentiation medium (cat # dm-2, zen - bio inc., research triangle park, nc) for one week (day 7 of differentiation) before being cultured in adipocyte medium (cat # am-1, zen - bio inc., research triangle park, nc) for an additional week (day 14 of differentiation). for western blot analysis, blots were probed with specific primary antibodies and the appropriate secondary antibodies (jackson immunoresearch lab. briefly, for each well of 6-well plate, 2 g of plasmid was used for transfection. mir-223 overexpression plasmid (cat # sc400292), noninsert empty plasmid control (cat # pcmvmir), and transfection reagent megatran 1.0 (cat # tt200002) were purchased from origene (rockville, md). the 3utr luciferase plasmid (1 g) with either mir-223 overexpression or empty plasmid (2 g) was transfected in each well of a 12-well plate. 48 hours after transfection luciferase activity was assayed by a luciferase assay system (promega, madison, wi) measured on a fluorescence microplate reader (polarstar omega, bmg labtech, germany). 6-nbdg (6-(n-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-6-deoxyglucose ; life technologies, carlsbad, ca) was used to determine insulin - stimulated glucose uptake in human differentiated adipocytes. briefly, insulin - stimulated glucose uptake was determined by first changing the adipocyte medium to a low - glucose serum free (lgsf) medium (0.1% bsa) for 4 hours. after incubation, 6-nbdg (20 m) was added and incubated for 40 minutes. after incubation with 6-nbdg, adipocytes were washed three times with pbs, lysed by adding lysis buffer. 6-nbdg in cell lysate was measured on a fluorescence microplate reader (polarstar omega, bmg labtech, germany ; excitation : 485 nm, emission : 535 nm). insulin resistance at baseline was estimated using the homeostasis model assessment (homa - ir) ; a homa - ir value < 2.5 was considered normal and a homa - ir value 2.5 indicated ir. comparisons of multiple groups were carried out by anova followed by a posttest analysis using the fisher (among groups) and dunnett (compared to controls) tests (xlstat software, ny). group comparisons (pcos versus non - pcos and ir versus non - ir) were carried out by unpaired student 's t - test (sas 9.3, sas institute inc., cary, nc). of the 33 subjects included, 15 (7 without and 8 with pcos) did not have ir as defined. among the 18 subjects with ir, table 1 depicts the clinical characteristics of the subjects included. as expected, subjects with pcos had higher values for terminal body and facial hair growth and free t ; and subjects deemed to have ir by homa - ir also had higher insulin levels than those without ir. while no subjects had diabetes as measured by fasting glucose, mean glucose in women with pcos and ir was higher than non - pcos non - ir women. the expression of mir-223 was significantly increased among all women with ir (p = 0.0004 ; figure 1(a)). however, no difference in mir-223 expression was detected (figure 1(b)) with regard to pcos status. comparing all four subgroups (7 subjects without pcos and without ir, 8 without pcos but with ir, 8 with pcos but without ir, and 10 with both pcos and ir), mir-223 was only significantly overexpressed in the two groups of women with ir, compared to subjects without pcos and without ir (p < 0.01 ; figure 1(c)). next, we examined the association of mir-223 expression with measures of ir, including homa - ir. our results indicated that mir-223 expression was positively correlated with homa - ir (r = 0.64, p < 0.01 ; figure 1(d)) subjects with ir (regardless of the presence of pcos) tended to have a greater mean body mass index (bmi) than subjects without ir (table 1), a difference that reached significance only in women without pcos, between those with ir and those without ir. there were no statistical differences in age. to gauge the possible effects of these differences on mir-223 expression we first determined whether an association existed between mir-223 expression and age or bmi for the entire group combined. our results indicate that mir-223 expression did not vary according to age (r = 0.11, p = 0.288) but was positively correlated with bmi (r = 0.46, p = 0.01). consequently, we compared mir-223 expression values adjusted for bmi for subjects with and without pcos and with and without ir. the adjustment did not change our results, with the difference in mir-223 expression between women with and without ir (p = 0.0193) and the absence of a difference between women with and without pcos (p = 0.1178) (table 2) remaining. to determine the role of and mechanism by which mir-223 induced ir in adipocytes, we overexpressed mir-223 in human differentiated adipocytes in vitro to achieve an approximately twofold increase in expression compared to empty plasmid controls (p < 0.01 ; figure 2(a)), similar to the level of mir-223 overexpression in human at (figure 1(a)). we found overexpression of mir-223 inhibited glucose uptake stimulated by insulin in human differentiated adipocytes in vitro (figure 2(b)). in addition, our data indicated that the induced overexpression of mir-223 was associated with a decrease in glut4 protein content (figure 2(c)), but not glut4 gene expression (figure 2(d)). analysis of glut4 3utr sequence using the free energy - based mirna prediction program pita revealed one potential target site for mir-223 in glut4 (figure 2(e)). to address whether direct binding of mir-223 to the glut4 3utr is responsible for the observed suppression of glut4, we performed a luciferase assay in which direct binding of mir-223 to the vector glut4 3utr gene transcript would repress a luciferase reporter. transient cotransfection of mir-223 and luciferase expression plasmids in human differentiated adipocytes demonstrated direct binding of mir-223 to the glut4 3utr site, resulting in a significant reduction in luciferase (figure 2(f)). as tumor necrosis factor- (tnf-) induces ir in adipocytes, the role of tnf- in the regulation of mir-223 expression in human differentiated adipocytes was also examined. consistent with the hypothesis that tnf- increases ir in adipocytes, at least in part, via the modulation of mir-223 expression, we observed that treatment of human differentiated adipocytes with tnf- (10 ng / ml) for 24 hours significantly increased mir-223 expression (figure 3). in a previous study, we examined the expression of mir-223 in at from a total of 25 subjects, and our findings indicated that mir-223 tended to be overexpressed in pcos and non - pcos women with ir. these trends were confirmed in the present study, analyzing a larger number of subjects, such that mir-223 was significantly overexpressed in women with ir, regardless of pcos status. glut4 is the major protein responsible for insulin - mediated glucose translocation into adipocytes and plays an important role in the regulation of glucose homeostasis. in adipocytes moreover, at - specific glut4 impacts glucose tolerance, insulin sensitivity, and glucose metabolism in vivo [22, 23 ]. glut4 gene expression in at correlated with homa - ir. in cardiomyocytes, overexpression of mir-223 stimulates glucose uptake and increases glut4 protein content but not the level of mrna. in the present study similar to cardiomyocytes, overexpression of mir-223 in adipocytes did not alter glut4 mrna expression. however, unlike cardiomyocytes, mir-223 overexpression was associated with a decrease in glut4 protein content and glucose uptake in at. however, mir-223 does appear to be overexpressed in at and the myocardium of ir subjects and suggests that mir-223 may serve as a therapeutic target for ir. in cardiomyocytes, overexpression of mir-223 enhances insulin - stimulated glucose uptake by increasing glut4 but not by altering insulin signaling and ampk activity (baseline and phosphorylation). this suggests that reduced insulin - stimulated glucose uptake in mir-223 overexpressed human differentiated adipocytes could be due to decreased levels of glut4, not by altering glut4 translocation. that mir-223 decreased glut4 protein, but not mrna, in adipocytes which suggests that mir-223 may regulate glut4 expression by binding to its 3utr. although in silico analysis (algorithms miranda, pictar, and targetscan) indicated that glut4 was not a predicted target of mir-223, we found one potential binding site in the 3utr sequence of glut4 by using the free energy - based mirna prediction program pita. furthermore, by the glut4 3utr reporter assay, we demonstrated that mir-223 regulates glut4 expression by direct binding to its 3utr site. we previously reported that the expression of mir-93 was significantly increased in the subcutaneous abdominal at of all pcos patients studied and non - pcos women with ir. together, these data suggest that mir-93 expression is associated with both ir and pcos, whereas mir-223 is not involved in pcos per se but is related to ir. as we previously noted that pcos women with ir had the lowest expression of glut4, it is possible that mir-93 and mir-223 may have additive effects on the regulation of glut4 expression. in addition to our findings that mir-223 and mir-93 regulate ir in at by targeting glut4, these two mirnas have also been found to suppress proinflammatory activation of macrophages by targeting irak4 (for mir-93) and pknox1 (for mir-223). macrophage activation is associated with ir ; therefore, these data suggest that mir-223 and mir-93 could also regulate ir by regulating inflammation. mir-223 and mir-93 have been found to have similar functions yet they may or may not target the same genes. both mirnas regulate cancer activity by targeting the same gene e2f1 [27, 28 ]. however, to promote cancer activity, they also target different genes including c / ebp, foxo1, nfi - a, stat5a, artn, fbxw7, and sept6 (for mir-223) [2933 ] and fus1, rhoc, pten, cdkn1a, tgfr2, and nrf2 (for mir-93) [3438 ]. both mirnas act as antiangiogenesis regulators, but mir-93 directly targets vascular endothelial growth factor a (vegf - a), while mir-223 targets 1 integrin. these data suggest that mir-223 and mir-93 may also have additive effects on these functions. in conclusion, our data indicates that mir-223 is overexpressed in the subcutaneous at of subjects with ir, regardless of pcos status, and that mir-223 expression is positively associated with ir in vivo. overexpression of mir-223 decreased glut4 protein content and inhibited insulin - stimulated glucose uptake in cultured human adipocytes. in addition tnf- induced mir-223 expression in vitro, suggesting that tnf- exerts its negative effect on insulin action at least in part through its modulation of the expression of this mirna. together these data suggest the possibility that mir-223 could be a potential therapeutic target for ir.	micrornas (mirnas) are short noncoding rnas involved in posttranscriptional regulation of gene expression and influence many cellular functions including glucose and lipid metabolism. we previously reported that adipose tissue (at) from women with polycystic ovary syndrome (pcos) or controls with insulin resistance (ir) revealed a differentially expressed microrna (mirna) profile, including upregulated mir-93 in pcos patients and in non - pcos women with ir. overexpressed mir-93 directly inhibited glucose transporter isoform 4 (glut4) expression, thereby influencing glucose metabolism. we have now studied the role of mir-223, which is also abnormally expressed in the at of ir subjects. our data indicates that mir-223 is significantly overexpressed in the at of ir women, regardless of whether they had pcos or not. mir-223 expression in at was positively correlated with homa - ir. unlike what is reported in cardiomyocytes, overexpression of mir-223 in human differentiated adipocytes was associated with a reduction in glut4 protein content and insulin - stimulated glucose uptake. in addition, our data suggests mir-223 regulates glut4 expression by direct binding to its 3 untranslated region (3utr). in conclusion, in at mir-223 is an ir - related mirna that may serve as a potential therapeutic target for the treatment of ir - related disorders.
the prevalence of childhood obesity has been rising during the past decades in many parts of the world. in portugal this picture is particularly alarming owing to the increasing risk of developing cardiovascular diseases in overweight and obese individuals [4, 5 ]. over the long term, childhood / adolescence overweight is strongly associated with adult obesity [6, 7 ]. therefore, it is of clinical and public health importance to examine the risk trends in order to develop effective preventive strategies targeting those at risk start as early as possible. human obesity is a multifactorial disorder where both genes and lifestyle factors, including diet and physical activity are important contributors. both maternal and paternal body mass index (bmi) has also a strong influence on offspring 's risk of obesity [10, 11 ]. other determinants of childhood obesity include birth weight and weight gain that occur during the first years of life [1214 ]. it has been suggested that obesity during the pre - school years is associated with other clinical factors easily assessed at birth. for instance, it was found an association between birth weight and the risk of being obese in children at the age of 4, 8, 10, and 12 years. besides the previously mentioned factors, there exist other potentially modifiable factors that increase the risk of overweight in childhood and adolescence. these include : (i) intrauterine life : excessive gestational weight gain [17, 18 ], and maternal smoking during pregnancy [13, 19, 20 ] ; (ii) infancy and pre - school period : reduced breastfeeding duration, excessive weight gain in the first 2 years of life [12, 22 ], excessive television [2325 ], short sleep duration [12, 26, 27 ], and low levels of physical activity (pa) [2830 ]. studies examining the associations between pa and body fat in young children are scarce [12, 28, 30 ], and to the best of our knowledge, few studies have estimated the associations between objectively measured pa and bmi in preschoolers [28, 30 ]. furthermore, there is no information available in portuguese population. the purpose of this study was to analyze the association between objectively measured pa and bmi in portuguese preschoolers. this is a cross - sectional study carried out in portuguese (metropolitan area of porto) kindergartens enrolled in the preschool physical activity, body composition and lifestyle study (prestyle). a total of 281 healthy pre - school children (55.9% boys) aged 46 years with complete information on the variables of interest were included in the study. study procedures were approved by the portuguese foundation for science and technology and by the scientific board of physical activity and health phd program. body weight and height body weight was measured to the nearest 0.10 kg, with participants lightly dressed (underwear and tee - shirt) using a portable digital beam scale (tanita inner scan bc 532). body height was measured to the nearest millimetre in bare or stocking feet with children standing upright against a holtain portable stadiometer (tanita). bmi was calculated as body mass (kg) divided by height (m) squared. children were classified as either non - overweight (now) or overweight (ow) according to the sex - adjusted bmi z - score (1680 cpm for moderate pa, and > 3360 cpm for vigorous pa (vpa). in this study, the epoch duration was set to 5 seconds, which seems to be more accurate and suitable concerning the spontaneous and intermittent activities of the young children. a minimum of 10 hours per day was considered as valid data for the analysis. parents were instructed to place the accelerometer on the child right after waking up and remove it before going to sleep. the accelerometer was adjusted at the child 's right hip by an elastic waist belt under clothing (own cloth and school coat). a data sheet was given to the children 's teachers, who were instructed to record the time when the child arrived and left the school. children belonging to the first, second, and third tertiles were defined as low, middle and high pa levels, respectively. mothers reported information regarding gestational weight gain, maternal smoking during pregnancy, birth weight as well as body weight and height during their offspring 's first and second year of life. gestational weight gain was categorized according to institute of medicine as below, optimal, and above gestational weight gain, while maternal smoking during pregnancy was categorized as yes or no. mothers also reported the amount of screen time (watching television and/or playing videogames) the child spends daily as well as the sleeping time for both week days and weekends. screen time questions were analyzed as continuous variables (converted to minutes) and also evaluated as a dichotomous variable based on young children recommendation. then, children were classified as those who accomplished guidelines (watching.05). logistic regression analysis showed that children with low vigorous pa had higher odds ratio (or) to be classified as ow compared to those with high vigorous pa (or = 4.4 ; 95% ci : 1.413.4 ; p =.008) after adjusting for bmi at first and second years of life and other potential confounders (table 2). this study examined the association of different pa intensity levels with weight status of portuguese preschoolers after adjusting for several potential confounding factors. this is an important and relevant topic since, to the best of our knowledge, little is known about how pa intensity is associated with obesity in pre - school children. our data showed that differences in levels of vpa were associated with weight status in children as young as 4 to 6 years. this is worthy to notice because our data suggest that the vpa influenced the change in bmi from those earlier ages. despite that, no statistical significant differences were found for levels of total and moderate pa. our findings concur with other studies showing that low levels of vpa were associated with body fatness during the adiposity rebound period. further, they also agree with studies in children and adolescents showing that only vpa (but not lower intensity levels) was associated with body fat. additionally, it was shown that within intervention groups, those who participated regularly and maintained the highest heart rates during pa sessions showed the greatest decreases in body fat and the greatest increases in bone density [43, 44 ]. on the other hand, adolescents who engaged in relatively large amounts of free - living vigorous pa were likely to be relatively fit and lean.. these findings are worth commenting in terms of both pa interventions and public health policies. the large standard deviations found in our study suggest a wide individual variations and highlight the importance of the participants ' intraindividual variability in pa behaviour. therefore, variation in pa levels may be particularly important in preschool children with regard to weight status. while there is a need to better understand the factors that influence pa in preschoolers and to learn how to help them to become more active, our study shows that pa promotion and interventions should focus on the more intense pa activities. children have a natural tendency towards movement, there is information suggesting a decline of discretionary time on children 's daily life and, thus, the time allocated to spontaneous pa, which, in turn, tend to be highly active it is reduced and several sedentary behaviors such as tv viewing, video games, and other activities involving many hours standing took the lead on children 's daily behaviour [12, 24 ]. therefore, promotion of organized pa programmes such as physical education at schools and organized sports activities that usually request more intense activities must be taken into account when pa promotion strategies are being developed first, the study included pre - school children from one metropolitan area, which made it difficult to generalize these findings. secondly, it is not possible to inferr causal relationships between pre - school pa level and overweight status with such a cross - sectional study design. nevertheless, this study focuses on the assessment of pa levels in a pre - school sample using an objective measure, which enhances the confidence of our findings owing to the fact that accelerometers provide more valid pa assessment in children. our data suggests that vpa may play a key role in the obesity development already at pre - school age.	aim. to examine the association between objectively measured physical activity (pa) and body mass index (bmi) in preschool children. methods. the study comprised 281 children (55.9% boys) aged from 4 to 6 years. pa was measured by accelerometer. children were categorized as non - overweight (now) and overweight / obese (ow) according to the sex - adjusted bmi z - score (.05). logistic regression analysis showed that children with low - vigorous pa had higher odds ratio (or) to be classified as ow compared to those with high - vigorous pa (or = 4.4 ; 95% ci : 1.413.4 ; p =.008) after adjusting for bmi at first and second years of life and other potential confounders. conclusion. the data suggests that vigorous pa may play a key role in the obesity development already at pre - school age.
glandular odontogenic cyst (goc) is a rare lesion that arises in the tooth bearing areas of the jaws. padayachee and van wyk initially reported it as a sialodontogenic cyst in 1987 based on the possibility of salivary gland origin but its odontogenic origin was first described in 1988 by gardner., who proposed the name goc because the cyst wall epithelium was odontogenic and contained mucin elements with no evidence of salivary tissue involvement. the term mucoepidermoid cyst or mucous producing cyst was used by sadeghib in 1991 due to the microscopic findings of mucus producing cells and squamous cells. in the 1992 world health organization (who) typing of odontogenic tumors, goc was defined as a cyst arising in the tooth - bearing areas of the jaws characterized by an epithelial lining with cuboidal or columnar cells both at the surface and lining crypts or cyst - like spaces within the thickness of the epithelium. goc is relatively rare lesion with a frequency rate of 0.012 - 1.3% of all the jaw cysts and its prevalence rate is 0.17%. it has two clinically important attributes : a high recurrence rate and an aggressive growth potential. goc primarily occurs in middle - aged patients with slight male predilection and the most common site of occurrence is mandibular anterior region where it usually presents as a painless, slow - growing swelling. radiographically, these cysts are described as well - defined, unilocular or multilocular without specific diagnostic characteristics. histologically, goc shows a non - keratinized stratified squamous epithelial lining, focal plaque like thickenings within the lining, microcysts or intraepithelial crypts containing mucin, mucous cells and hyaline bodies, eosinophilic cuboidal or columnar cells that may be ciliated, papillary projections of epithelium and absence of inflammation in the subepithelial connective tissue. the relative rarity of the lesion prompted us to add one more of our case and review the literature. a 30-year - old female patient reported with a swelling in the upper right back region of the jaw. the swelling was present since 8 months which was painless and increased gradually in size. intraorally a diffuse, non fluctuant and firm swelling was seen with normal overlying mucosa extending from the buccal aspect of 11 - 17 obliterating the vestibule [figure 1 ]. panoramic radiographic examination revealed a well - defined unilocular radiolucency extending from 15 - 17. 16 was carious with root resorption and roots of 15 and 17 were displaced [figure 2 ]. gross examination showed a smooth to rough mass measuring 2.5 2 cm and the cut section showed a cystic wall filled with necrotic material [figure 3 ]. histopathologic examination, revealed a cystic cavity lined by a non keratinized stratified squamous epithelium with surface layer composed of ciliated columnar cells [figures 4 and 5 ]. immunohistochemistry (ihc) staining was done using ck-18, ck-19, p53, ki-67. among them clinical photograph shows swelling in the upper right back region of the jaw orthopantomogram shows radiolucent area in 15, 16, 17 region gross specimen showing a smooth lobulated mass photomicrograph shows lining epithelium (h&e stain, 100) photomicrograph shows surface ciliated columnar epithelium (h&e stain, 400) photomicrograph shows special stained mucous cells (pas stain, 400) photomicrograph shows strong positive immunoreactions to the ki-67 protein (ihc stain, 100) photomicrograph shows strong positive immunoreactions to the ck-19 protein (ihc stain, 100) goc is a relatively rare entity. magnusson and co - authors evaluated 5900 cases of jaw bone cysts and found only 7 cases of goc, about 0.12% ; whereas van heerden and others reported 1.3% of goc in their study. in the present case the patient is a middle - aged female whereas existing literature reports a slight male predilection. the most common site of occurrence is the anterior region of mandible followed by anterior region of maxilla and posterior region of mandible. about three cases have been reported till date and ours is probably the fourth case. a diagnosis based only on clinical and radiological examination is difficult because of similarities with various other intrabony pathologies, hence a histopathological evaluation becomes mandatory. the histopathological characteristics of goc have been divided into major and minor categories by kaplan. goc should be distinguished from lateral periodontal cyst, botryoid odontogenic cyst, surgical ciliated cyst, radicular cyst with mucous metaplasia and central mec as it exhibits considerable overlapping of histopathological features [figure 9 ]., in their study found that goc showed positivity for p53 and ki-67. when compared to mec, these markers could be auxillary aids in the differential diagnosis of these lesions. according to various authors, positive immunostaining with ck-18 and ck-19 in goc may further help in differentiating goc from central mucoepidermoid carcinoma (mec). a recent study found significantly higher expression of both cytoplasmic and nuclear maspin in the mucous cells in low grade mec (16.5% cytoplasmic, 1.7% nuclear) as compared with goc (1.5% and 0.3%) or odontogenic cysts with mucous metaplasia (1% and 0.4%). several treatment modalities have been used which include curettage, enucleation with careful dissection of the margins and local block excision. however, the aggressive nature of the lesion has been reported and the recurrence rate is directly related to the size of the lesion. therefore, large lesions should be treated more aggressively and followed for a long period. it is important to consider histopathological features for its diagnosis since it bears resemblance to lesions like mec.	glandular odontogenic cyst (goc) is an uncommon jaw bone cyst of odontogenic origin described in 1987 by gardner. it is a cyst having an unpredictable and potentially aggressive behavior. the increased recurrence rate can be due to its multilocularity and incomplete removal of the lining following conservative treatment. clinically, the most common site of occurrence is the anterior region of mandible. goc has a slight male predilection and occurs primarily in middle - aged patients. this article presents a case of glandular odontogenic cyst in a 30-year - old female patient in the posterior region of the maxilla, which is quite rare.
the shortened dental arch concept seems to be a relevant approach from a cost - effective point of view. the shortened dental arch concept is a potentially cost - effective approach in the management of reduced dentitions. a body of mainly circumstantial evidence shows that shortened dental arches, comprising all anterior teeth and three to five occluding units, provide a stable and functional dentition with respect to chewing ability, aesthetics and oral comfort [25 ]. the functionality of shortened dental arches has been reflected in outcomes of studies on oral health - related quality of life (ohrqol). the outcomes are rather controversial : on the one hand, shortened dental arches are found to be related to ohrqol impairment, especially when first molar contacts were absent and on the other hand, subjects with a shortened dental arch reported to be satisfied with their oral status. oral health care aims at the retention of at least a functional and natural dentition throughout life. therefore, besides functionality, longevity of shortened dental arches should also be taken into account when considering application of the shortened dental arch concept. the fact that shortened dental arch subjects have lost molars in the past implicitly indicates an increased risk for dental diseases in these subjects. it is reasonable to expect that this predisposition to dental diseases is not eliminated after applying the shortened dental arch concept and hence necessitate more treatment in course of time including additional tooth extractions. further tooth loss may endanger the longevity of the shortened dental arch status and thus compromise oral function. the consequences of this predisposition might be even more manifest in subjects with a shortened dental arch restored with removable dental prosthesis (rdp) because rdps have been associated with increased incidence of caries and periodontal breakdown [9, 10 ]. however, a randomised clinical trial revealed no statistically significant difference in frequency of tooth loss after 3 years of follow - up among shortened dental arch subjects with and without rdp. furthermore, quality of life levels of subjects with a shortened dental arch with rdp were found to be almost identical to those of subjects with a shortened dental arch without rdp. in another study, subjects with a shortened dental arch only perceived benefits of rdp from a ohrqol perspective if anterior teeth replacements are included. to our knowledge, the longest follow - up reports on shortened dental arches are based on a 9-year observational cohort study (3-, 6- and 9-year observations) [1315 ]. it was concluded that shortened dental arches could provide a functional dentition with long - term occlusal stability [13, 14 ]. furthermore, the study reported similar frequencies of signs and symptoms of temporomandibular disorders for shortened dental arches with and without rdp and complete dental arches (cda). the present study is evaluating the initial cohort by analysing 27 to 35 years follow - up data on the basis of information from patient records. the objective of this study was to evaluate the clinical course of shortened dental arches by (1) assessing its longevity ; (2) investigating the management of tooth loss and (3) analysing interventions provided during the follow - up period. it was hypothesised that shortened dental arches have shorter longevity and receive more restorative interventions and tooth extractions than cda. moreover, it was hypothesised that these effects are more prone in shortened dental arches plus rdp. for this study, data from patient records of subjects who participated in a prospective observational cohort study on shortened dental arches (sda) were used. the subjects from this cohort were regular patients of the nijmegen dental school clinic for checkups and all necessary dental treatments. the initial cohort, a convenient sample, comprised subjects with shortened dental arches in at least one jaw with three to four posterior occluding pairs (pops) and intact anterior areas without distal extension rdp (sda group, n = 74), subjects with a shortened dental arch extended by rdp (sda plus rdp group, n = 25), and subjects with cda (cda group, n = 72, control group). teeth replaced by fixed dental prostheses (fdps) were considered as present ; occluding posterior fdp replacements were counted as pops. for the present study, data were extracted from the available patient records of the subjects of the initial cohort. all restorative interventions provided from the time the subjects had subscribed at the dental school until may 2011, or as long as information was available, were extracted from these records. from the moment dentitions were identified as sda or sda plus rdp, the following interventions were considered : direct restorations (fillings), indirect restorations (crowns, in- and onlays), endodontic treatments, and tooth extractions. to be able to describe the changes in functional status of the dentitions, the total number of lost teeth (excluding third molars) and the number of pops at baseline and endpoint were determined (table 2). also, tooth replacements were recorded, including type of replacements (resin bonded fdp, conventional fdp, partial rdp and complete dentures) and location in the dental arch. if subjects became edentulous or if dental records were closed (i.e. subjects decided to stop attending the dental school or died), data recording ceased. accuracy of the patient records was checked by information of available x - rays and data from the 9-year follow - up observations of the original cohort study. mean age at baseline of cda subjects was significantly higher than that of sda subjects (p value of 0.045). because comparing groups with a t test can not eliminate age as a potential confounding variable, the groups were compared using linear regression analyses with age and group as independent variables. since the variable age is only used to eliminate confounding from all regression analyses, only the effect (i.e. the difference corrected for age) of the variable group is reported. the group effects with or without gender in the multivariate model were nearly identical, so gender is not a confounder in this study. it appeared that in less than 10 % of the analyses, gender had an effect and these effects were extremely small compared to the group effects. sda was compared with sda plus rdp and with cda. for the analyses presented in tables 3 and 4, third molars were taken into account to be able to get insight in the total number of treatments provided in the groups. first, baseline and endpoint status regarding numbers of teeth with direct and indirect restorations and absent teeth were compared. next, the number of direct and indirect restorations made and the endodontic treatments and tooth extractions provided per year were analysed for each group. finally, to get insight in which dental regions most interventions were needed, the number of direct restoration provided per tooth per year for the in which the third molars were excluded, only the time teeth were actually present was taken into account and for the molar region only sda subjects having molars at baseline were analysed. for this study, data from patient records of subjects who participated in a prospective observational cohort study on shortened dental arches (sda) were used. the subjects from this cohort were regular patients of the nijmegen dental school clinic for checkups and all necessary dental treatments. the initial cohort, a convenient sample, comprised subjects with shortened dental arches in at least one jaw with three to four posterior occluding pairs (pops) and intact anterior areas without distal extension rdp (sda group, n = 74), subjects with a shortened dental arch extended by rdp (sda plus rdp group, n = 25), and subjects with cda (cda group, n = 72, control group). teeth replaced by fixed dental prostheses (fdps) were considered as present ; occluding posterior fdp replacements were counted as pops. for the present study, data were extracted from the available patient records of the subjects of the initial cohort. all restorative interventions provided from the time the subjects had subscribed at the dental school until may 2011, or as long as information was available, were extracted from these records. from the moment dentitions were identified as sda or sda plus rdp, the following interventions were considered : direct restorations (fillings), indirect restorations (crowns, in- and onlays), endodontic treatments, and tooth extractions. to be able to describe the changes in functional status of the dentitions, the total number of lost teeth (excluding third molars) and the number of pops at baseline and endpoint were determined (table 2). also, tooth replacements were recorded, including type of replacements (resin bonded fdp, conventional fdp, partial rdp and complete dentures) and location in the dental arch. if subjects became edentulous or if dental records were closed (i.e. subjects decided to stop attending the dental school or died), data recording ceased. accuracy of the patient records was checked by information of available x - rays and data from the 9-year follow - up observations of the original cohort study. mean age at baseline of cda subjects was significantly higher than that of sda subjects (p value of 0.045). because comparing groups with a t test can not eliminate age as a potential confounding variable, the groups were compared using linear regression analyses with age and group as independent variables. since the variable age is only used to eliminate confounding from all regression analyses, only the effect (i.e. the difference corrected for age) of the variable group is reported. gender was also checked for being a potential confounding variable. the group effects with or without gender in the multivariate model were nearly identical, so gender is not a confounder in this study. it appeared that in less than 10 % of the analyses, gender had an effect and these effects were extremely small compared to the group effects. sda was compared with sda plus rdp and with cda. for the analyses presented in tables 3 and 4, third molars were taken into account to be able to get insight in the total number of treatments provided in the groups. first, baseline and endpoint status regarding numbers of teeth with direct and indirect restorations and absent teeth were compared. next, the number of direct and indirect restorations made and the endodontic treatments and tooth extractions provided per year were analysed for each group. finally, to get insight in which dental regions most interventions were needed, the number of direct restoration provided per tooth per year for the in which the third molars were excluded, only the time teeth were actually present was taken into account and for the molar region only sda subjects having molars at baseline were analysed. eventually, patient records of 59 subjects of the original cohort (35 %) appeared to be retrievable from the database of the dental school. table 1 presents mean age at baseline, gender distribution and mean time of follow - up of each group (sda, sda plus rdp and cda).table 1number of subjects, mean age at baseline (sd), gender distribution and mean time of follow - up (sd) of the sda group, sda plus rdp group and cda group (control)sdasda plus rdpcdan (% of original cohort)23 (31.1)13 (52.0)23 (31.9)mean age at baseline (sd)37.8 (11.2)40.0 (9.7)31.7 (8.0)male % 21.738.547.8mean time of follow - up27.4 (7.1)32.6 (7.3)35.0 (5.6) number of subjects, mean age at baseline (sd), gender distribution and mean time of follow - up (sd) of the sda group, sda plus rdp group and cda group (control) the majority (87 %) of the subjects in the sda group still had an sda status comprising at least three pops at the end of the follow - up period (mean 27.4 years, sd 7.1), despite the loss of 67 teeth in this group during this period (table 2). three subjects, accountable for 52 % of the 67 lost teeth, lost their sda status : one subject became edentulous and in two subjects shortened dental arches became interrupted dental arches (ida). in the remaining 20 sda subjects, fdps replaced 16 lost teeth, thereby maintaining the sda status of the subjects. another 16 lost teeth were not replaced, of which 12 teeth (75 %) had no opposing tooth.table 2clinical course of sda, sda plus rdp and cda subjects ; tooth loss (excluding third molars) and management of tooth loss during follow - up period and dental functional status at end of follow - updental status at baselinesda (n = 23)sda plus rdp (n = 13)cda (n = 23)tooth loss and management of tooth losstooth loss : tooth loss : tooth loss : 67 teeth lost in 17 subjects (6 subjects had no tooth loss) 63 teeth lost in 12 subjects (1 subject had no tooth loss) 15 teeth lost in 10 subjects (13 subjects had no tooth loss)management : management : management: 16 teeth not replaced (24 %) 11 teeth not replaced (17 %) 7 teeth not replaced (47 %) 16 teeth by fixed replacement (24 %) : 3 teeth by fixed replacement (5 %) : 8 teeth by fixed replacement (53 %): conventional fdp, 11 conventional fdp, 3 conventional fdp, 6 resin - bonded fdp, 1 resin - bonded fdp, 1 implant, 4 implant, 1 35 teeth replaced by rdp (52 %) : 49 teeth replaced by rdp (78 %) : no rdp replacement (0 %) acrylic rdp, 8 teeth (in 2 rdps) metal frame rdp, 27 (in 8 rdps) complete denture, 27 teeth (in 1 cd) complete denture, 22 (in 1 cd)dental functional status at end of follow - up and change in number of popsdental status in subjects at end of follow - up : dental status in subjects at end of follow - up : dental status in subjects at end of follow - up : sda, 20 sda with rdp, 6 cda, 16 ida with rdp, 2 sda without rdp, 3 ida, 3 edentulous, 1 ida with rdp, 3 sda (slightly), 4 edentulous, 1pops change in subjects : pops change in subjects : pops change in subjects: lost pops: lost pops: lost pops : none, 16 none, 3 none, 16 12, 4 12, 4 1, 7 all, 1 3, 1 all, 3 gained pops: gained pops: gained pops : 1, 2 12, 2 n.a.n.a. not applicable clinical course of sda, sda plus rdp and cda subjects ; tooth loss (excluding third molars) and management of tooth loss during follow - up period and dental functional status at end of follow - up at the end of the follow - up period, the functional status of the subjects of the sda plus rdp group is far more diverse than for subjects of the sda group. after a mean follow - up time of 32.6 years (sd 7.3), fewer than half of the subjects (46 %) still had the status sda plus rdp. proportionally, more teeth were lost in this group than in the sda group (63 teeth in 13 sda plus rdp subjects vs. 67 teeth in 23 sda subjects). generally, the replacement of lost teeth in the sda plus rdp group was accomplished by (adding teeth to a present) rdp (78 % of the lost teeth). four out of seven subjects who lost their sda plus rdp status did so because of further tooth loss : one subject became edentulous and three lost their status because of dental arch interruptions and loss of pops. the other three subjects lost their sda plus rdp status because two of them had their rdps replaced by free - end fdp and one subject ceased wearing the rdp (table 2). seventy percent of cda subjects maintained their status at the end of the follow - up period (35.0 years, sd 5.6). the number of teeth lost was relatively low in this group compared to the sda group (15 teeth in 23 cda subjects vs. 67 teeth in 23 sda subjects). none of the subjects lost more than one pop (table 2). at baseline, there were no statistically significant differences in the mean number of teeth with direct restorations and indirect restorations between the sda group and the sda plus rdp group (table 3). considering absent teeth at baseline, the sda group had more absent teeth in the upper jaw but fewer absent teeth in the lower jaw compared to the sda plus rdp group. at the end of follow - up, both sda group and sda plus rdp group had fewer teeth with direct restorations in the upper jaw than at baseline. this decrease is explained by the increase of the number of teeth with indirect restorations (direct restorations were replaced by indirect restorations) and the increase of the number of absent teeth.table 3number of teeth with direct restorations and indirect restorations and number of absent teeth for upper and lower jaw for sda, sda plus rdp and cda subjects at baseline and end of follow - up (mean number (sd))status per jaw sda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % cidirect restorationsupperbaseline5.74 (3.74)6.00 (3.96)6.43 (3.32)0.480.716(3.14, 2.78)0.580.602(2.81, 1.65)endpoint4.00 (3.22)3.23 (2.09)6.87 (3.75)0.760.469(1.31, 2.83)2.970.009(5.16, 0.77)lowerbaseline3.39 (2.39)2.92 (2.02)5.83 (2.02)0.410.602(1.99, 1.17)3.70<0.001(5.07, 2.34)endpoint4.52 (2.13)2.69 (1.80)4.52 (2.13)0.930.239(0.65, 2.50)1.320.064(2.72, 0.08)indirect restorationsupperbaseline0.35 (0.65)0.08 (0.28)0.22 (0.67)0.280.160(0.12, 0.67)0.070.719(0.34, 0.49)endpoint4.09 (3.01)3.77 (3.19)2.00 (2.47)0.110.915(2.00, 2.22)2.420.006(0.72, 4.12)lowerbaseline0.17 (0.58)0.37 (0.86)0.13 (0.34)0.100.682(0.58, 0.38)0.030.840(0.32, 0.26)endpoint2.04 (2.48)2.08 (1.44)2.52 (2.17)0.160.833(1.67, 1.35)0.190.791(1.63, 1.25)absent teethupperbaseline4.09 (1.88)2.62 (2.10)0.91 (0.95)1.540.032(0.14, 2.94)2.89<0.001(2.00, 3.78)endpoint5.22 (2.78)5.85 (4.10)1.70 (0.82)0.440.697(2.75, 1.86)3.28<0.001(2.01, 4.55)lowerbaseline5.35 (1.15)6.23 (0.83)0.83 (0.94)0.920.017(1.67, 0.17)4.54<0.001(3.88, 5.20)endpoint6.04 (2.25)7.69 (3.23)1.91 (0.73)1.580.096(3.45, 0.30)4.05<0.001(3.01, 5.09)effect, p value and 95 % ci are corrected for age number of teeth with direct restorations and indirect restorations and number of absent teeth for upper and lower jaw for sda, sda plus rdp and cda subjects at baseline and end of follow - up (mean number (sd)) effect, p value and 95 % ci are corrected for age the mean numbers of indirect restorations, direct restorations, endodontic treatments and tooth extractions provided per year did not differ statistically among the sda group and sda plus rdp group (table 4). focusing on direct restorations provided in the different dental regions also revealed no statistical significant differences between the groups (table 5). in the sda group, the following rdp - related interventions were provided during the follow - up period : two partial rdps and one complete denture ; for the sda plus rdp group, this was 26 replacement partial rdps (all subjects received 14 new / replacement rdps), 3 additional partial rdps (in opposite jaw), 24 relinings, 13 repairs and 9 extensions to add lost teeth to a present rdp and one complete denture.table 4restorative interventions and tooth extractions provided per year in sda, sda plus rdp and cda subjects for upper and lower jaw (mean number (sd))treatment per jawsda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % cidirect restorationsupper0.72 (0.36)0.69 (0.41)0.58 (0.42)0.040.755(0.23, 0.32)0.110.371(0.14, 0.36)lower0.38 (0.23)0.42 (0.23)0.42 (0.22)-0.020.803(0.17, 0.13)-0.070.308(0.21, 0.07)indirect restorationsupper0.18 (0.16)0.19 (0.14)0.08 (0.09)-0.020.744(0.13, 0.09)0.110.008(0.03, 0.19)lower0.10 (0.13)0.09 (0.06)0.08 (0.06)0.000.914(0.07, 0.08)0.040.221(0.03, 0.10)endodontic treatmentsupper0.05 (0.05)0.07 (0.08)0.03 (0.04)-0.020.407(0.06, 0.03)0.020.154(0.01, 0.05)lower0.03 (0.04)0.03 (0.04)0.02 (0.03)-0.010.699(0.03, 0.02)0.010.351(0.01, 0.03)tooth extractionsupper0.06 (0.08)0.12 (0.12)0.03 (0.03)-0.050.124(0.12, 0.02)0.030.186(0.01, 0.06)lower0.05 (0.10)0.06 (0.10)0.03 (0.03)-0.050.878(0.08, 0.07)0.840.610(0.04, 0.05)effect, p value and 95 % ci are corrected for agetable 5direct restorations provided per year in sda, sda plus rdp and cda subjects per tooth for upper and lower jaw (mean number (sd)) (third molars excluded)jawregionsda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % ciupperanterior0.074 (0.049)0.073 (0.049)0.034 (0.046)0.0020.922(0.033, 0.037)0.0340.025(0.005, 0.064)premolar0.062 (0.041)0.038 (0.032)0.042 (0.029)0.0240.077(0.003, 0.051)0.0190.098(0.004, 0.041)molar0.025 (0.032)0.036 (0.034)0.053 (0.036)0.0130.231(0.035, 0.009)0.0250.021(0.047, 0.004)loweranterior0.019 (0.026)0.031 (0.026)0.002 (0.003)0.0100.247(0.027, 0.007)0.0120.022(0.002, 0.022)premolar0.055 (0.035)0.056 (0.037)0.045 (0.038)0.0000.976(0.026, 0.025)0.0140.207(0.008, 0.037)molar0.011 (0.020)0.005 (0.009)0.056 (0.027)0.0080.147(0.003, 0.019)0.0490.001(0.064, 0.034)effect, p value and 95 % ci are corrected for age. for the molar region, only sda subjects having molars at baseline were includedn = 18n = 13n = 8n = 5 restorative interventions and tooth extractions provided per year in sda, sda plus rdp and cda subjects for upper and lower jaw (mean number (sd)) effect, p value and 95 % ci are corrected for age direct restorations provided per year in sda, sda plus rdp and cda subjects per tooth for upper and lower jaw (mean number (sd)) (third molars excluded) effect, p value and 95 % ci are corrected for age. for the molar region, only sda subjects having molars at baseline were included although the sda subjects have, by definition, fewer teeth than the cda subjects, the mean number of teeth with direct restorations and indirect restoration at baseline was not statistically significantly different between both groups, except for direct restorations in the lower jaw in the cda group (table 3). at the end of follow - up, the mean number of teeth with direct and indirect restorations was still not statistically significantly different for the lower jaw. for the upper jaw however, the number of direct restorations at the end of follow - up was lower in the sda group compared to the cda group (4.00 vs. 6.87) whereas the number of indirect restorations was higher in the sda group (4.09 vs. 2.00, table 3). the mean numbers of indirect restorations, direct restorations, endodontic treatments and tooth extractions provided per year were only statistically significantly different for indirect restorations in the upper teeth (0.18 indirect restorations per year in sda compared to 0.08 per year in cda, p = 0.008) (table 4). for anterior teeth, statistically significant (upper jaw p = 0.025, lower jaw p = 0.022) more direct restorations per year were provided in the sda group than in the cda group (table 5). there was no statistically significant difference in the number of direct restorations per year in premolars, whilst fewer direct restorations were made per year in molars in the sda group compared to cda group (upper jaw p = 0.021, lower jaw p = 0.001) (table 5). eventually, patient records of 59 subjects of the original cohort (35 %) appeared to be retrievable from the database of the dental school. table 1 presents mean age at baseline, gender distribution and mean time of follow - up of each group (sda, sda plus rdp and cda).table 1number of subjects, mean age at baseline (sd), gender distribution and mean time of follow - up (sd) of the sda group, sda plus rdp group and cda group (control)sdasda plus rdpcdan (% of original cohort)23 (31.1)13 (52.0)23 (31.9)mean age at baseline (sd)37.8 (11.2)40.0 (9.7)31.7 (8.0)male % 21.738.547.8mean time of follow - up27.4 (7.1)32.6 (7.3)35.0 (5.6) number of subjects, mean age at baseline (sd), gender distribution and mean time of follow - up (sd) of the sda group, sda plus rdp group and cda group (control) the majority (87 %) of the subjects in the sda group still had an sda status comprising at least three pops at the end of the follow - up period (mean 27.4 years, sd 7.1), despite the loss of 67 teeth in this group during this period (table 2). three subjects, accountable for 52 % of the 67 lost teeth, lost their sda status : one subject became edentulous and in two subjects shortened dental arches became interrupted dental arches (ida). in the remaining 20 sda subjects, fdps replaced 16 lost teeth, thereby maintaining the sda status of the subjects. another 16 lost teeth were not replaced, of which 12 teeth (75 %) had no opposing tooth.table 2clinical course of sda, sda plus rdp and cda subjects ; tooth loss (excluding third molars) and management of tooth loss during follow - up period and dental functional status at end of follow - updental status at baselinesda (n = 23)sda plus rdp (n = 13)cda (n = 23)tooth loss and management of tooth losstooth loss : tooth loss : tooth loss : 67 teeth lost in 17 subjects (6 subjects had no tooth loss) 63 teeth lost in 12 subjects (1 subject had no tooth loss) 15 teeth lost in 10 subjects (13 subjects had no tooth loss)management : management : management: 16 teeth not replaced (24 %) 11 teeth not replaced (17 %) 7 teeth not replaced (47 %) 16 teeth by fixed replacement (24 %) : 3 teeth by fixed replacement (5 %) : 8 teeth by fixed replacement (53 %): conventional fdp, 11 conventional fdp, 3 conventional fdp, 6 resin - bonded fdp, 1 resin - bonded fdp, 1 implant, 4 implant, 1 35 teeth replaced by rdp (52 %) : 49 teeth replaced by rdp (78 %) : no rdp replacement (0 %) acrylic rdp, 8 teeth (in 2 rdps) metal frame rdp, 27 (in 8 rdps) complete denture, 27 teeth (in 1 cd) complete denture, 22 (in 1 cd)dental functional status at end of follow - up and change in number of popsdental status in subjects at end of follow - up : dental status in subjects at end of follow - up : dental status in subjects at end of follow - up : sda, 20 sda with rdp, 6 cda, 16 ida with rdp, 2 sda without rdp, 3 ida, 3 edentulous, 1 ida with rdp, 3 sda (slightly), 4 edentulous, 1pops change in subjects : pops change in subjects : pops change in subjects: lost pops: lost pops: lost pops : none, 16 none, 3 none, 16 12, 4 12, 4 1, 7 all, 1 3, 1 all, 3 gained pops: gained pops: gained pops : 1, 2 12, 2 n.a.n.a. not applicable clinical course of sda, sda plus rdp and cda subjects ; tooth loss (excluding third molars) and management of tooth loss during follow - up period and dental functional status at end of follow - up at the end of the follow - up period, the functional status of the subjects of the sda plus rdp group is far more diverse than for subjects of the sda group. after a mean follow - up time of 32.6 years (sd 7.3), fewer than half of the subjects (46 %) still had the status sda plus rdp. proportionally, more teeth were lost in this group than in the sda group (63 teeth in 13 sda plus rdp subjects vs. 67 teeth in 23 sda subjects). generally, the replacement of lost teeth in the sda plus rdp group was accomplished by (adding teeth to a present) rdp (78 % of the lost teeth). four out of seven subjects who lost their sda plus rdp status did so because of further tooth loss : one subject became edentulous and three lost their status because of dental arch interruptions and loss of pops. the other three subjects lost their sda plus rdp status because two of them had their rdps replaced by free - end fdp and one subject ceased wearing the rdp (table 2). seventy percent of cda subjects maintained their status at the end of the follow - up period (35.0 years, sd 5.6). the number of teeth lost was relatively low in this group compared to the sda group (15 teeth in 23 cda subjects vs. 67 teeth in 23 sda subjects). at baseline, there were no statistically significant differences in the mean number of teeth with direct restorations and indirect restorations between the sda group and the sda plus rdp group (table 3). considering absent teeth at baseline, the sda group had more absent teeth in the upper jaw but fewer absent teeth in the lower jaw compared to the sda plus rdp group. at the end of follow - up, both sda group and sda plus rdp group had fewer teeth with direct restorations in the upper jaw than at baseline. this decrease is explained by the increase of the number of teeth with indirect restorations (direct restorations were replaced by indirect restorations) and the increase of the number of absent teeth.table 3number of teeth with direct restorations and indirect restorations and number of absent teeth for upper and lower jaw for sda, sda plus rdp and cda subjects at baseline and end of follow - up (mean number (sd))status per jaw sda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % cidirect restorationsupperbaseline5.74 (3.74)6.00 (3.96)6.43 (3.32)0.480.716(3.14, 2.78)0.580.602(2.81, 1.65)endpoint4.00 (3.22)3.23 (2.09)6.87 (3.75)0.760.469(1.31, 2.83)2.970.009(5.16, 0.77)lowerbaseline3.39 (2.39)2.92 (2.02)5.83 (2.02)0.410.602(1.99, 1.17)3.70<0.001(5.07, 2.34)endpoint4.52 (2.13)2.69 (1.80)4.52 (2.13)0.930.239(0.65, 2.50)1.320.064(2.72, 0.08)indirect restorationsupperbaseline0.35 (0.65)0.08 (0.28)0.22 (0.67)0.280.160(0.12, 0.67)0.070.719(0.34, 0.49)endpoint4.09 (3.01)3.77 (3.19)2.00 (2.47)0.110.915(2.00, 2.22)2.420.006(0.72, 4.12)lowerbaseline0.17 (0.58)0.37 (0.86)0.13 (0.34)0.100.682(0.58, 0.38)0.030.840(0.32, 0.26)endpoint2.04 (2.48)2.08 (1.44)2.52 (2.17)0.160.833(1.67, 1.35)0.190.791(1.63, 1.25)absent teethupperbaseline4.09 (1.88)2.62 (2.10)0.91 (0.95)1.540.032(0.14, 2.94)2.89<0.001(2.00, 3.78)endpoint5.22 (2.78)5.85 (4.10)1.70 (0.82)0.440.697(2.75, 1.86)3.28<0.001(2.01, 4.55)lowerbaseline5.35 (1.15)6.23 (0.83)0.83 (0.94)0.920.017(1.67, 0.17)4.54<0.001(3.88, 5.20)endpoint6.04 (2.25)7.69 (3.23)1.91 (0.73)1.580.096(3.45, 0.30)4.05<0.001(3.01, 5.09)effect, p value and 95 % ci are corrected for age number of teeth with direct restorations and indirect restorations and number of absent teeth for upper and lower jaw for sda, sda plus rdp and cda subjects at baseline and end of follow - up (mean number (sd)) effect, p value and 95 % ci are corrected for age the mean numbers of indirect restorations, direct restorations, endodontic treatments and tooth extractions provided per year did not differ statistically among the sda group and sda plus rdp group (table 4). focusing on direct restorations provided in the different dental regions also revealed no statistical significant differences between the groups (table 5). in the sda group, the following rdp - related interventions were provided during the follow - up period : two partial rdps and one complete denture ; for the sda plus rdp group, this was 26 replacement partial rdps (all subjects received 14 new / replacement rdps), 3 additional partial rdps (in opposite jaw), 24 relinings, 13 repairs and 9 extensions to add lost teeth to a present rdp and one complete denture.table 4restorative interventions and tooth extractions provided per year in sda, sda plus rdp and cda subjects for upper and lower jaw (mean number (sd))treatment per jawsda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % cidirect restorationsupper0.72 (0.36)0.69 (0.41)0.58 (0.42)0.040.755(0.23, 0.32)0.110.371(0.14, 0.36)lower0.38 (0.23)0.42 (0.23)0.42 (0.22)-0.020.803(0.17, 0.13)-0.070.308(0.21, 0.07)indirect restorationsupper0.18 (0.16)0.19 (0.14)0.08 (0.09)-0.020.744(0.13, 0.09)0.110.008(0.03, 0.19)lower0.10 (0.13)0.09 (0.06)0.08 (0.06)0.000.914(0.07, 0.08)0.040.221(0.03, 0.10)endodontic treatmentsupper0.05 (0.05)0.07 (0.08)0.03 (0.04)-0.020.407(0.06, 0.03)0.020.154(0.01, 0.05)lower0.03 (0.04)0.03 (0.04)0.02 (0.03)-0.010.699(0.03, 0.02)0.010.351(0.01, 0.03)tooth extractionsupper0.06 (0.08)0.12 (0.12)0.03 (0.03)-0.050.124(0.12, 0.02)0.030.186(0.01, 0.06)lower0.05 (0.10)0.06 (0.10)0.03 (0.03)-0.050.878(0.08, 0.07)0.840.610(0.04, 0.05)effect, p value and 95 % ci are corrected for agetable 5direct restorations provided per year in sda, sda plus rdp and cda subjects per tooth for upper and lower jaw (mean number (sd)) (third molars excluded)jawregionsda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % ciupperanterior0.074 (0.049)0.073 (0.049)0.034 (0.046)0.0020.922(0.033, 0.037)0.0340.025(0.005, 0.064)premolar0.062 (0.041)0.038 (0.032)0.042 (0.029)0.0240.077(0.003, 0.051)0.0190.098(0.004, 0.041)molar0.025 (0.032)0.036 (0.034)0.053 (0.036)0.0130.231(0.035, 0.009)0.0250.021(0.047, 0.004)loweranterior0.019 (0.026)0.031 (0.026)0.002 (0.003)0.0100.247(0.027, 0.007)0.0120.022(0.002, 0.022)premolar0.055 (0.035)0.056 (0.037)0.045 (0.038)0.0000.976(0.026, 0.025)0.0140.207(0.008, 0.037)molar0.011 (0.020)0.005 (0.009)0.056 (0.027)0.0080.147(0.003, 0.019)0.0490.001(0.064, 0.034)effect, p value and 95 % ci are corrected for age. for the molar region, only sda subjects having molars at baseline were includedn = 18n = 13n = 8n = 5 restorative interventions and tooth extractions provided per year in sda, sda plus rdp and cda subjects for upper and lower jaw (mean number (sd)) effect, p value and 95 % ci are corrected for age direct restorations provided per year in sda, sda plus rdp and cda subjects per tooth for upper and lower jaw (mean number (sd)) (third molars excluded) effect, p value and 95 % ci are corrected for age. for the molar region, only sda subjects having molars at baseline were included although the sda subjects have, by definition, fewer teeth than the cda subjects, the mean number of teeth with direct restorations and indirect restoration at baseline was not statistically significantly different between both groups, except for direct restorations in the lower jaw in the cda group (table 3). at the end of follow - up, the mean number of teeth with direct and indirect restorations was still not statistically significantly different for the lower jaw. for the upper jaw however, the number of direct restorations at the end of follow - up was lower in the sda group compared to the cda group (4.00 vs. 6.87) whereas the number of indirect restorations was higher in the sda group (4.09 vs. 2.00, table 3). the mean numbers of indirect restorations, direct restorations, endodontic treatments and tooth extractions provided per year were only statistically significantly different for indirect restorations in the upper teeth (0.18 indirect restorations per year in sda compared to 0.08 per year in cda, p = 0.008) (table 4). for anterior teeth, statistically significant (upper jaw p = 0.025, lower jaw p = 0.022) more direct restorations per year were provided in the sda group than in the cda group (table 5). there was no statistically significant difference in the number of direct restorations per year in premolars, whilst fewer direct restorations were made per year in molars in the sda group compared to cda group (upper jaw p = 0.021, lower jaw p = 0.001) (table 5). at baseline, there were no statistically significant differences in the mean number of teeth with direct restorations and indirect restorations between the sda group and the sda plus rdp group (table 3). considering absent teeth at baseline, the sda group had more absent teeth in the upper jaw but fewer absent teeth in the lower jaw compared to the sda plus rdp group. at the end of follow - up, both sda group and sda plus rdp group had fewer teeth with direct restorations in the upper jaw than at baseline. this decrease is explained by the increase of the number of teeth with indirect restorations (direct restorations were replaced by indirect restorations) and the increase of the number of absent teeth.table 3number of teeth with direct restorations and indirect restorations and number of absent teeth for upper and lower jaw for sda, sda plus rdp and cda subjects at baseline and end of follow - up (mean number (sd))status per jaw sda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % cidirect restorationsupperbaseline5.74 (3.74)6.00 (3.96)6.43 (3.32)0.480.716(3.14, 2.78)0.580.602(2.81, 1.65)endpoint4.00 (3.22)3.23 (2.09)6.87 (3.75)0.760.469(1.31, 2.83)2.970.009(5.16, 0.77)lowerbaseline3.39 (2.39)2.92 (2.02)5.83 (2.02)0.410.602(1.99, 1.17)3.70<0.001(5.07, 2.34)endpoint4.52 (2.13)2.69 (1.80)4.52 (2.13)0.930.239(0.65, 2.50)1.320.064(2.72, 0.08)indirect restorationsupperbaseline0.35 (0.65)0.08 (0.28)0.22 (0.67)0.280.160(0.12, 0.67)0.070.719(0.34, 0.49)endpoint4.09 (3.01)3.77 (3.19)2.00 (2.47)0.110.915(2.00, 2.22)2.420.006(0.72, 4.12)lowerbaseline0.17 (0.58)0.37 (0.86)0.13 (0.34)0.100.682(0.58, 0.38)0.030.840(0.32, 0.26)endpoint2.04 (2.48)2.08 (1.44)2.52 (2.17)0.160.833(1.67, 1.35)0.190.791(1.63, 1.25)absent teethupperbaseline4.09 (1.88)2.62 (2.10)0.91 (0.95)1.540.032(0.14, 2.94)2.89<0.001(2.00, 3.78)endpoint5.22 (2.78)5.85 (4.10)1.70 (0.82)0.440.697(2.75, 1.86)3.28<0.001(2.01, 4.55)lowerbaseline5.35 (1.15)6.23 (0.83)0.83 (0.94)0.920.017(1.67, 0.17)4.54<0.001(3.88, 5.20)endpoint6.04 (2.25)7.69 (3.23)1.91 (0.73)1.580.096(3.45, 0.30)4.05<0.001(3.01, 5.09)effect, p value and 95 % ci are corrected for age number of teeth with direct restorations and indirect restorations and number of absent teeth for upper and lower jaw for sda, sda plus rdp and cda subjects at baseline and end of follow - up (mean number (sd)) effect, p value and 95 % ci are corrected for age the mean numbers of indirect restorations, direct restorations, endodontic treatments and tooth extractions provided per year did not differ statistically among the sda group and sda plus rdp group (table 4). focusing on direct restorations provided in the different dental regions also revealed no statistical significant differences between the groups (table 5). in the sda group, the following rdp - related interventions were provided during the follow - up period : two partial rdps and one complete denture ; for the sda plus rdp group, this was 26 replacement partial rdps (all subjects received 14 new / replacement rdps), 3 additional partial rdps (in opposite jaw), 24 relinings, 13 repairs and 9 extensions to add lost teeth to a present rdp and one complete denture.table 4restorative interventions and tooth extractions provided per year in sda, sda plus rdp and cda subjects for upper and lower jaw (mean number (sd))treatment per jawsda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % cidirect restorationsupper0.72 (0.36)0.69 (0.41)0.58 (0.42)0.040.755(0.23, 0.32)0.110.371(0.14, 0.36)lower0.38 (0.23)0.42 (0.23)0.42 (0.22)-0.020.803(0.17, 0.13)-0.070.308(0.21, 0.07)indirect restorationsupper0.18 (0.16)0.19 (0.14)0.08 (0.09)-0.020.744(0.13, 0.09)0.110.008(0.03, 0.19)lower0.10 (0.13)0.09 (0.06)0.08 (0.06)0.000.914(0.07, 0.08)0.040.221(0.03, 0.10)endodontic treatmentsupper0.05 (0.05)0.07 (0.08)0.03 (0.04)-0.020.407(0.06, 0.03)0.020.154(0.01, 0.05)lower0.03 (0.04)0.03 (0.04)0.02 (0.03)-0.010.699(0.03, 0.02)0.010.351(0.01, 0.03)tooth extractionsupper0.06 (0.08)0.12 (0.12)0.03 (0.03)-0.050.124(0.12, 0.02)0.030.186(0.01, 0.06)lower0.05 (0.10)0.06 (0.10)0.03 (0.03)-0.050.878(0.08, 0.07)0.840.610(0.04, 0.05)effect, p value and 95 % ci are corrected for agetable 5direct restorations provided per year in sda, sda plus rdp and cda subjects per tooth for upper and lower jaw (mean number (sd)) (third molars excluded)jawregionsda (n = 23)sda plus rdp (n = 13)cda (n = 23)comparison between sda and sda plus rdpcomparison between sda and cdaeffectp value95 % cieffectp value95 % ciupperanterior0.074 (0.049)0.073 (0.049)0.034 (0.046)0.0020.922(0.033, 0.037)0.0340.025(0.005, 0.064)premolar0.062 (0.041)0.038 (0.032)0.042 (0.029)0.0240.077(0.003, 0.051)0.0190.098(0.004, 0.041)molar0.025 (0.032)0.036 (0.034)0.053 (0.036)0.0130.231(0.035, 0.009)0.0250.021(0.047, 0.004)loweranterior0.019 (0.026)0.031 (0.026)0.002 (0.003)0.0100.247(0.027, 0.007)0.0120.022(0.002, 0.022)premolar0.055 (0.035)0.056 (0.037)0.045 (0.038)0.0000.976(0.026, 0.025)0.0140.207(0.008, 0.037)molar0.011 (0.020)0.005 (0.009)0.056 (0.027)0.0080.147(0.003, 0.019)0.0490.001(0.064, 0.034)effect, p value and 95 % ci are corrected for age. for the molar region, only sda subjects having molars at baseline were includedn = 18n = 13n = 8n = 5 restorative interventions and tooth extractions provided per year in sda, sda plus rdp and cda subjects for upper and lower jaw (mean number (sd)) effect, p value and 95 % ci are corrected for age direct restorations provided per year in sda, sda plus rdp and cda subjects per tooth for upper and lower jaw (mean number (sd)) (third molars excluded) effect, p value and 95 % ci are corrected for age. for the molar region, although the sda subjects have, by definition, fewer teeth than the cda subjects, the mean number of teeth with direct restorations and indirect restoration at baseline was not statistically significantly different between both groups, except for direct restorations in the lower jaw in the cda group (table 3). at the end of follow - up, the mean number of teeth with direct and indirect restorations was still not statistically significantly different for the lower jaw. for the upper jaw however, the number of direct restorations at the end of follow - up was lower in the sda group compared to the cda group (4.00 vs. 6.87) whereas the number of indirect restorations was higher in the sda group (4.09 vs. 2.00, table 3). the mean numbers of indirect restorations, direct restorations, endodontic treatments and tooth extractions provided per year were only statistically significantly different for indirect restorations in the upper teeth (0.18 indirect restorations per year in sda compared to 0.08 per year in cda, p = 0.008) (table 4). for anterior teeth, statistically significant (upper jaw p = 0.025, lower jaw p = 0.022) more direct restorations per year were provided in the sda group than in the cda group (table 5). there was no statistically significant difference in the number of direct restorations per year in premolars, whilst fewer direct restorations were made per year in molars in the sda group compared to cda group (upper jaw p = 0.021, lower jaw p = 0.001) (table 5). this observational cohort study demonstrated that shortened dental arches could be preserved for periods of 27 years and over. on dentition level the number of restorative interventions provided per year was not significantly different among the groups, expect that cda. partially this is due to the high number of abutment crowns needed for the high number of fdps provided in sda subjects. this indicates that on dentition level the cost of restorative treatment in a shortened dental arch is at least as high as the costs of restorative treatment in a cda. however, on tooth level it was found that in sda group compared to cda group more direct restorations were provided per tooth per year, except for molars. a plausible explanation for these higher numbers of direct restorations per tooth per year in shortened dental arches is that a predisposition to dental diseases in this group, that caused the loss of molars in the first place, continues to have its effect on the remaining dentition. however, the reasons for restorative treatment were often not available from the records. besides the initial restoration of carious lesions, fillings are also made to replace previous restorations for reasons such as fracture of the filling or secondary caries. a review of 10 surveys including 32.777 direct restorations revealed that more than 50 % of the provided restorations were replacements of previous restorations. therefore, it is assumable that considerable numbers of direct restorations provided in this cohort were replacement restorations. hence, the high numbers of restorations provided per year per tooth in sda subjects (table 5) can probably partly be explained by the fact that sda subjects already had relatively higher restoration levels (i.e. comparable numbers of teeth with restorations but in total significantly fewer teeth) at baseline than cda subjects (table 3). the only exception was the number of teeth with direct restorations in the lower jaw (5.83 in cda group vs. 3.39 in sda), which can be explained by the large difference in numbers of teeth present among the groups (0.83 teeth absent in cda group vs. 5.35 in sda). another explanation might be that in shortened dental arches fewer teeth have to bear the loads that occur during chewing. consequently, increased loading of fewer teeth in shortened dental arches compared to cdas possibly results in a higher failure rate of fillings in shortened dental arches. however, a study on masticatory performance showed that in shortened dental arches significantly lower occlusal forces could be measured than in complete dental arches. in line with this, it is feasible that the higher number of direct restorations made in shortened dental arches is not due to overloading and subsequent failure of fillings. for the present study, information from patient records from the dental school was used. if subjects incidentally visited a general dentist outside the dental school for treatment it is likely that relevant information is missing. in the netherlands however, where this investigation was conducted, patients are generally loyal to their dentist and only seldom switch temporarily. therefore we trust that the information in the dental school records is reasonably complete. however, to confirm the accuracy of the records, the data were compared with available x - rays and the investigation forms of the original cohort study. the small sample size and selected group of dental school patients might limit external validity of this study, e.g. due to stricter maintenance protocols applied to these patients. on the other hand, we consider the quality of the data satisfactory for conclusive outcomes. sixty - five percent of the dental records of the subjects of the original cohort were not retrievable, mainly of subjects who stopped attending the dental school. according to the dutch legislation, patient files must be kept at least for 10 years from the moment patients unsubscribe. fortunately, most files were kept longer, but still a reasonable number of archived files were destroyed. probably most of these were destroyed at the time that the nijmegen dental school changed from paper to electronic patient files in 2003. the destruction of archived records seems to be rather arbitrary and as a result selection bias is considered absent or small. the number of female subjects was proportionally high for the sda group and sda plus rdp group, whereas gender distribution for the cda group was even (table 1). the cda subjects, as being a control group, were selected by purpose sampling aiming at equal gender proportions. however analyses did not reveal gender effects and therefore correction for gender was not considered necessary. previous longitudinal studies on tooth loss reported mean numbers of 0.03 to 0.24 teeth lost per year [17, 18 ]. this is in accordance with incidence of tooth loss found in the present study ; incidence varied from 0.03 to 0.12 teeth per year depending on location and group, with the lowest incidence for the lower jaw in cda group and highest incidence for the upper jaw in sda plus rdp group. in the majority of sda subjects in the present study however, tooth loss did not lead to loss of their sda status : a considerable number of lost teeth were molars without opposing tooth whilst lost teeth causing interruption of the dental arch were replaced by fdps, by what means the sda status was maintained. however, especially as incidence of tooth loss has been reported to increase with age, further tooth loss can be expected for this meanwhile aged cohort, which can endanger the functionality of the dentitions [18, 19 ]. it is striking that three of the 23 sda subjects (these were also the subjects who lost their sda status) were accountable for 52 % of the lost teeth. in contrast to this, 6 sda subjects did not lose any tooth at all during the follow - up period. apparently in these subjects the predisposition to dental diseases, as argued above, could be stopped or at least substantially decreased. to what extent and how risk factors for tooth loss exactly continue to have their effect in sda subjects, is a phenomenon that needs further investigation. at the start of the study it was hypothesised that adverse effects are more prone in sda plus rdp subjects than in sda subjects. however, it appeared that the number of tooth extractions per year was not statistically significant different. this is in accordance with the outcomes of a randomised clinical trial on tooth loss in shortened dental arches with or without rdp ; kaplan - meier survival rates were not statistically significant different between the two groups in a 3-year follow up period. although the incidence of tooth loss is not significantly different between groups, 7 out of 13 sda plus rdp subjects lost their sda plus rdp status during the follow - up period whilst only 3 out of 23 sda subjects lost their sda status. this is also reflected in the loss of pops ; 62 % of the sda plus rdp subjects lost one or more pop vs. 22 % of the sda subjects. however, not all subjects lost their sda plus rdp status due to further tooth loss ; three subjects lost this status because they stopped wearing their rdp and two of them actually gained pops by having their rdps replaced by free - end fdps. the number of restorative interventions for sda plus rdp group provided per year during the follow period was not significantly different indicating that the costs at dentition level are the same as in sda. when the costs related to rdp are taken into account, it can be concluded that the total costs in the sda plus rdp group was higher whereas the longevity appeared to be lower compared to shortened dental arches without rdp. additionally, apart from costs, every new rdp or rdp adjustment can bring discomfort and will make a considerable appeal on the adaptability of a patient. moreover, it is questionable whether sda patients actually benefit from rdp. as stated before,. showed that rdps in shortened dental arches did not improve masticatory performance and mckenna. showed that both prosthetic rehabilitation to a functional dentition as well as full rehabilitation including rdp did not improve the nutritional status as reflected in hematological markers. several studies, including the present study, showed that rdps often even have an adverse effect [10, 2123 ]. in a randomised clinical trial on caries incidence following restoration of shortened lower dental arches in an elderly sample of patients, it was found that 2 years after restoration, there was a significantly greater incidence of new and recurrent caries lesions in subjects restored with rdps compared with cantilever resin - bonded bridges. in the same sample of elderly, it was found that subjects considered restoration with cantilever resin - bonded bridges more comfortable than restoration with rdp. also, a higher maintenance frequency for rdps compared to resin - bonded fdps in shortened lower dental arches was reported. in summary, it can be stated that replacement of absent posterior teeth by a free - end rdp in a shortened dental arch is not recommendable ; fixed appliances (cantilever (resin - bonded) fdp or implant supported fdp) might be preferable alternatives. recently, the body of evidence on the sda concept was assessed by means of the grading of recommendation assessment and evaluation.the conclusion of this assessment was that the quality of the evidence for recommendation of the management of shortened dental arches is low because of the lack of evidence provided by randomised clinical trials. however, conducting well - designed randomised clinical trials may be not feasible because of concerns of ethical and practical nature. although the present study is not a randomised clinical trial, the strength of the present study is that it is a long - term clinical observational cohort study that provides valuable, long - term clinical data on the clinical course of shortened dental arches. this study shows that shortened dental arches can last for 27 years and over. on dentition level, the number of treatments provided is comparable with complete dentitions. herewith, this study contributes to the body of evidence that the sda concept is a cost - effective approach. moreover, replacement of absent posterior teeth by free - end rdp in shortened dental arches is not recommendable since rdp seems to be associated with a less favourable clinical course. this article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.	objectivesthe objective of this study was to investigate the clinical course of shortened dental arches (sda group) compared to sdas plus removable denture prosthesis (sda plus rdp group) and complete dental arches (cda group, controls).materials and methodsdata (numbers of direct and indirect restorations, endodontic treatments, tooth loss and tooth replacements) were extracted from patient records of subjects attending the nijmegen dental school who previously participated in a cohort study on shortened dental arches with three to four posterior occluding pairs (pops).resultsrecords of 35 % of the original cohort were retrievable. at the end of the follow - up (27.4 7.1 years), 20 out of 23 sda subjects still had sda with 34 pops compared to 6 out of 13 for sda plus rdp subjects (follow - up 32.6 7.3 years). sixteen out of 23 cda subjects still had cda ; none of them lost more than one pop (follow - up 35.0 5.6 years). sda group lost 67 teeth : 16 were not replaced, 16 were replaced by fdp and 35 teeth (lost in three subjects) replaced by rdp. mean number of treatments per year in sda subjects differed not significantly compared to cda subjects except for indirect restorations in the upper jaw.conclusionshortened dental arches can last for 27 years and over. clinical course in sda plus rdp is unfavourable, especially when rdp - related interventions are taken into account.clinical relevancethe shortened dental arch concept seems to be a relevant approach from a cost - effective point of view. replacement of absent posterior teeth by free - end rdp can not be recommended.
endotracheal suctioning (ets) is one of the most common supportive measures in intensive care units (icu). closed system suctioning (css) decreases the rate of cardiorespiratory complication mainly due to continuation of ventilatory support and oxygenation during procedure. css has questionable efficacy, therefore higher values of negative pressure has been recommended to enhance the efficacy of css. this study was designed to evaluate the effects on gas exchange of 200 mmhg suctioning pressure compared with 100 mmhg in css. two consecutive ten seconds css using suction pressures of 100 and 200 mmhg, in random order applied in each subject with the two hours wash out period. effects of two levels of suction pressure on gas exchange were measured by recording the spo2 values at 4 times. repeated measure analysis of variance did n't show any significant difference between two levels of pressure (p = 0.315), but within each groups (100 and 200 mmhg) spo2 changes was significant (p = 0.000). there was a mild but significant and transient increase in heart rate following both suction pressures, but no significant difference between two groups. the results show that css with suction pressure 200 mmhg has no detrimental effect on cardiorespiratory function of mv icu patients. since the safety of 200 mmhg suctioning pressure was approved, using 200 mmhg suction pressures is recommended for ets of mv patients. patients admitted to intensive care units require respiratory care and in particular endotracheal suctioning (ets) to remove excess respiratory secretions and to improve respiratory function. ets is one of the most common supportive measures and the most common procedures performed in patients with artificial airways. airway management of mechanically ventilated patients (mv) is one of the most important responsibilities of critical care nurses. incorrect airway management can lead to increased mortality and morbidity, lengthy hospital stay and extra cost. although essential for critical patients, ets may be associated with complications, sometimes leading to life threatening conditions. major complications following ets include atelectasis, bronchospasm, microbial contamination of lower respiratory tracts, ventilator associated pneumonia, decreased spo2, disrythmia, anxiety and dyspnea. arterial hypoxemia is the most common and most important reported complication of suctioning and may precipitate heart rate abnormalities and compromises in hemodynamic status. ets complications mainly results from reduction of functional residual capacity (frc) secondary to disconnecting the ventilator, and applying the negative suction pressure. in fact, removal of airway secretions invariably associated with suctioning the alveolar gas out of the lungs, resulting in alveolar collapse. disconnection of the patient from the ventilator is the most determinant of hypoxemia resulting from ets. patients with high degrees of respiratory support and in particular those with high levels of peep are very sensitive to deleterious effects of tbs. for example, the likelihood of desaturation associated with tbs can be reduced by a brief pre - oxygenation period before initiation of ets. in traditional method of ets, patient discontinued from mv during ets. disconnecting from mv in critical patients with high levels of ventilator support, particularly those in need of high levels of peep, invariably leads to dramatic reduction of oxygenation due to decreasing lung volumes. to overcome this pitfall, two systems are available to perform ets : the single - use, open suction system (oss) and the multiple used, closed suction system (css). the most common suctioning technique used is oss, which involves disconnecting the ventilator, followed by insertion of a suction catheter into the trachea while negative pressure is generated. however, disconnecting the ventilator causes a large drop in airway pressure, loss of lung volume, and oxygen desaturation ; so, open suctioning can be considered inappropriate for patients with acute respiratory distress syndrome. open suction has partly been replaced by closed suctioning systems, which was developed in the 1980s, obviates the necessity of disconnecting the patient from the ventilator, thus decreasing the loss of lung volume and avoiding gas - exchange impairment during suctioning. css has become increasingly popular in the past decade. in the united states, 58 and 4% of intensive care units used css and oss respectively. causes of universal interest of critical care units to change from oss to css are primarily css benefits reports in preventing hypoxia and alveolar collapse resulted by oss in severe respiratory disease with high level of peep. css consists of a suction catheter enclosed within a flexible plastic film sleeve. according to the manufacturer, css connected to this catheter is placed between the endotracheal tube and the y - piece of the ventilator circuit, thus can be used for repeated ets tries. the benefits of css over oss include the maintenance of positive pressure ventilation during suctioning, less desaturation, and a reduced risk of contaminating tracheobronchial tree. in addition, many critical care nurses find css more convenient to use, less time - consuming and better tolerated by the patients than the traditional method of oss. compared with oss, the css results in fewer adverse changes in cardiorespiratory functions and lower contamination of respiratory tracts. although css is a safe method of endotracheal suctioning, there is a concern of less effectiveness than open system in removing secretions. this issue was investigated by an in vitro test, in which css recovered less material than oss. another animal research indicates less efficacy for css at recovering thin and thick simulated secretions in the injured lung, irrespective of ventilation mode. sigismond 's study, in patients with acute lung injury, confirms the result of animal studies and support the clinical hypothesis that oss is more efficient than css for tracheal secretion removal. blackwood and web reported that nurses found the system poorly effective in 39% of the suctioning procedures performed. one solution suggested generating more negative pressure during closed suctioning to produce adequate secretion removal. copnell and colleagues found that, suction pressure has less influence on loss of lung volume than catheter size in css. it is recommended that the diameter of the suction catheter should be less than half that of the ett. further studies by sigismond and colleagues showed that css followed by a recruitment maneuver prevents hypoxia resulting from oss but decreases secretion removal. increasing suction pressure enhances suctioning efficiency without impairing gas exchange. to prevent decrease in blood oxygenation caused by suctioning, induction of hyperoxygenation as there is no disconnection from the ventilator during suctioning, administration of high inspired oxygen continues during the suctioning. in clinical practice the patient should receive preoxygenation by the delivery of 100% oxygen for at least 30 seconds prior to, during and after the suctioning procedure. although numerous studies have been repeatedly performed to compare the effectiveness of oss with css, the study on enhancing css efficiency by increasing suction pressure on human is limited and mostly has combined with recruitment maneuvers after css, which is not recommended in most guidelines. it must be pointed out that, these studies have rarely been carried out on clinical patients and mostly they have used animal laboratory models. therefore there is a lack of enough knowledge regarding the safe and effective level of suction pressure in patients undergoing ets with css. the purpose of this study was to compare the effects on gas exchange of two different negative pressures, applied during css with hyperoxygenation and without recruitments maneuvers as recommended by clinical guidelines, in mv adult patients admitted to a teaching hospital intensive care unit. to select the levels of suctioning pressure, if proper suctioning catheter is used, the level of suctioning pressure could be increased up to 200 mmhg. therefore, the high level of suction pressure in this study was presupposed to be 200 mmhg. this research was a double blind cross - over clinical trial in patients acting as their own controls. after institutional approval and informed patient 's family consent, 50 adult icu patients, older than 18 years, undergoing mechanical ventilation, using volume modes, were studied. patients with hemodynamic instability (dbp > 100 mmhg, or 20 mmhg in spo2 and 20 b / min in hr), those requiring suctioning in wash out period (discussed below), and when the patient 's family was unwilling to continue the research, they were excluded from the study. in addition patients must have mv duration for at least 24 hrs, orotracheal intubation, with no sever hypoxemia (spo2 70 mmhg, hr < 130/min) to make them eligible for the trial. the study involved consecutive application of two different suction pressures of 100 and 200 mmhg to each patient. to make the carry over effect as low as possible, therefore a cross - over model of ab - ba was used and patients were consecutively assigned to either ab or ba group, that is to receive either 100 mmhg suction pressures first, and then 200 mmhg, or the reverse order. due to the relatively small sample size and because of extreme time to time variability in physiologic conditions of icu patients, we decided to use a minimization model. with an appropriate minimization model, we can minimize the differences between two groups (ab, ba) and at the same time to enroll subjects randomly into groups, hence eliminating selection bias and the predictability of subject assignment. to further decrease the carry over effect, we incorporate a wash - out period of two hours between two episodes of suctioning. that is, the patients underwent tracheal suctioning with one level of suction pressure (say for example 100 mmhg) and after a wash - out period of two hours the next level of suction pressure was applied. minimization factors included age, gender, base spo2, admission diagnosis, ventilator mode, and length of icu stay. the minimization was performed using minimpy computer software carrying out the complex parts of minimization procedures. biased coin minimization was selected as the probability method and marginal balance was used as the distance measure. chief researcher, who performed the suctioning procedure, was blinded regarding the level of suction pressure and patient 's assigned group. assignment of subjects to each group and setting the suction pressure for each round of suctioning were carried out by the second researcher in position, who was not participated in the act of suctioning and data measurements. tracheal suctioning at each level of suction pressure was performed using a closed suctioning system. if not contraindicated, patients were placed in semi fowler position and procedure was explained to those who were conscious. each suctioning episode was involved hyperoxygenation using inspired oxygen fraction of one, for two minutes before, during and after suctioning. ets was performed using two different - size catheters : 14 french for 7.5, 8 mm endotracheal tubes and 16 french for 8.5 and 9 mm endortacheal tubes. during the closed suctioning procedure, patients remained connected to the ventilator, and the suction catheter was inserted into the endotracheal tube, via the y - piece connector. the duration of active suctioning was 10 second during which the catheter was gently rotated and finally withdrawn. at the end of suctioning, the catheter was then irrigated through the irrigation port with sterile normal saline while applying suction. after first round of suctioning, each patient was allowed to stabilize and the next suction episode was performed two hours later, using the other suction pressure (group ab : 100 - 200 mmhg, group ba : 200 - 100 mmhg). age, gender, duration of icu stay, diagnosis, and ventilator mode were recorded as baseline variables. spo2 and heart rate were recorded before and at one, three and twenty minutes after suctioning. data were represented as mean (sd) or n (%) where applicable. means of quantitative variables were compared between two levels of suction pressure using repeated measure analysis of variance with two factors, one for the level of suction pressure (two levels) and the other for different times at which the variable was measured (four levels). other quantitative data were compared between two levels of suction pressure using paired sample student t - test. frequency data were compared between two levels of suction pressure using an appropriate chi - square statistic. to test the balance of cross - over method, data were compared between two orders of applying suction pressure (ab versus ba). marginal balance was used to represent the efficacy of minimization model for assigning subject to cross - over groups. p values were reported with a precision of three decimal figures. if the exact p value was not known the relative expressions of p < 0.05, p < 0.01, etc., was used. twenty five subjects received 100 mmhg suction pressure as their first suction episode and 200 mmhg as the next (16 male and nine female), and 25 subject received the reverse order of suction pressures (16 male and nine female). two groups of suction pressure orders were comparable with respect to demographic and basal physiologic variables [table 1 ]. comparing demographic and basal physiologic variables between two groups of suction pressure order repeated measure analysis of variance with one factor for the level of suction pressure and another for the repeated measurement did n't show any significant difference between two levels of pressure (100 and 200 mmhg), but within each group spo2 changes was significant compared to the basal values. hyperoxygenation before and after suctioning transiently and significantly increased spo2 and returned to baseline value 20 minutes after the suctioning [figure 1 ]. trends of spo2 for two levels of suction pressure in different times there was a mild but significant increase in heart rate following application of both 100 and 200 mmhg suction pressures, which returned to basal value after three minutes in 100 mmhg groups but remained elevated for three minutes in 200 mmhg group [table 2 ]. the result of this study shows that in css with hyperoxygenation before, during and after the procedure, a suction pressure of 100 mmhg is comparable to 200 mmhg with respect to spo2 levels and hr changes. in both levels of suction pressure, an initial hyperoxia and mild tachycardia developed, due to the baseline values within approximately three minutes after termination of suctioning. evidence for this is comparable means of spo2 and hr for two levels of suction pressures. it seems that increasing the level of suction pressure to 200 mmhg has no detrimental effect on cardiorespiratory function of mechanically ventilated icu patients. it seems that in css, suction pressure up to 200 mmhg is relatively safe and does not produce cardiorespiratory disturbances. the fact that ventilatory support and high inspired oxygen concentration, continue during css, is the main cause of more cardiorespiratory stability in css compared with oss. this has been approved by previous studies, which show the superiority of css versus oss in terms of cardiorespiratory functions. sigismond., showed that during css hypoxia does not occur compared to frequent episodes of desaturation, observed with oss. in the study by fernandez., in contrast to large decrease in lung volumes with oss, they observed relative maintenance of lung volumes during css. in demir 's study the expected fall in pao2 and sao2 levels was not seen when closed suction was used even in the absence of hyperoxygenation. nazmiyeh., were able to demonstrate a rise in pao2 coupled with a decrease in arterial co2 tension using closed endotracheal suctioning. it seems that provision of enough cpap during css is necessary to prevent loss of lung volumes and subsequent desaturation as observed by lindgren. copnell., failed to demonstrate the beneficial effect of css on cardiorespiratory functions during tbs in neonatal piglets using ordinary suction catheters used in clinic for adults patients, which signifies the importance of suction catheter diameter relative to the size of tracheal tube, as indicated by van veenendaal. continuation of ventilatory support during css seems to be the main cause of lower effectiveness of ets observed with css compared to oss. in fact the positive pressure resulted from ventilatory support counteracts the negative pressure produced by the suction apparatus and the precise result would be less effective suctioning of respiratory secretion sigismond., showed that suction pressure of more than 150 mmhg is necessary to enhance the efficacy of css in removing respiratory secretions, although these findings were not supported in animal studies (lindgren), which is attributable to differences between small animals and clinical patients in size of respiratory tract relative to catheter diameter. since css does not preclude disconnection of the patient from the ventilator, the loss of lung volume resulting from endotracheal suctioning is significantly lower compared with oss. loss of lung volume is one of the most important factors for endotracheal suctioning induced hypoxemia. majority of studies comparing css with oss, report that in optimal situation, such as suitable catheter size, and hyperoxygenation, suctioning induced hypoxemia will not occur in css. we can enhance css efficacy with increasing the suction pressure without gas exchange impairment, with the catheter size less than half of the ett internal diameter. based on spo2 changes, our results demonstrate that css did n't induce significant deleterious changes in gas exchange during the procedure itself, as shown in our study. since the effectiveness of tracheal suctioning is directly proportional to the applying negative pressure and owing to the relative safety of higher suction pressure for css, as shown in this study, we can safely recommend a suction pressure of 200 mmhg for using with css in mechanically intubated icu patients. further increases in suction pressure may not be safe and necessary ; although further clinical investigations seem necessary to evaluate the advantages and disadvantages of higher suction pressures. the result of this study may not generalize to icu patients who require excessive ventilatory support. further trials are needed to reliably conclude the relative safety and efficacy of css in icu patients in need of heavy ventilatory supports. in conclusion, the result of this study shows the safety of 200 mmhg suction pressure for using during closed suction procedures in mechanically ventilated adult icu patients. it is recommended that future clinical trials of css take into account other more important outcomes, such as duration of mechanical ventilation and icu / hospital stay, and final mortality of patients. in addition it seems logical to have a preview of relative cost / benefit of css compared with oss.	background : endotracheal suctioning (ets) is one of the most common supportive measures in intensive care units (icu). ets may be associated with complications including hypoxia and tachycardia. closed system suctioning (css) decreases the rate of cardiorespiratory complication mainly due to continuation of ventilatory support and oxygenation during procedure. css has questionable efficacy, therefore higher values of negative pressure has been recommended to enhance the efficacy of css. this study was designed to evaluate the effects on gas exchange of 200 mmhg suctioning pressure compared with 100 mmhg in css.materials and methods : fifty mechanically ventilated (mv) icu patients were selected for the study. two consecutive ten seconds css using suction pressures of 100 and 200 mmhg, in random order applied in each subject with the two hours wash out period. effects of two levels of suction pressure on gas exchange were measured by recording the spo2 values at 4 times.results:repeated measure analysis of variance did n't show any significant difference between two levels of pressure (p = 0.315), but within each groups (100 and 200 mmhg) spo2 changes was significant (p = 0.000). there was a mild but significant and transient increase in heart rate following both suction pressures, but no significant difference between two groups.conclusion:the results show that css with suction pressure 200 mmhg has no detrimental effect on cardiorespiratory function of mv icu patients. since the safety of 200 mmhg suctioning pressure was approved, using 200 mmhg suction pressures is recommended for ets of mv patients.
prostate cancer is the most common malignancy among men in the united states and is the second leading cause of male cancer death. the incidence of prostate cancer varies widely among ethnic populations, and african american men in the united states have the highest incidence of prostate cancer. the prostate - specific antigen (psa) if the serum psa is more than 4 ng / ml, a man is considered to be at high risk of prostate cancer and a biopsy usually follows. in 2002, 75% of men aged 50 years and older had undergone at least 1 psa testing, and 57% had been tested within the previous 2 years, despite debate about the value of screening for prostate cancer in terms of lowering prostate cancer mortality. the american cancer society recommends that psa and a digital rectal examination be offered annually to men aged 50 years or more who are expected to live at least 10 years. prostate cancer screening is important because early detection of the disease reduces prostate cancer mortality. however, there are disparities with psa screening in the united states ; african americans are less likely to undergo psa screening than are whites. researchers previously reported a higher rate of elevated psa (greater than 4.0 ng / ml) and a higher prostate cancer detection rate in african americans than in white men in a community - based screening study. researchers have found that health care access, insurance coverage, and socioeconomic status (ses) are associated with psa screening behavior. the purpose of this study was to investigate the effects of sociodemographic and behavioral factors on psa screening practice. the 2005 california health interview survey (chis 2005) was a collaborative project of the ucla center for health policy research, the california department of health services, and the public health institute. the survey focused on a number of public health topics including health status and conditions, health - related behaviors, insurance coverage, and access to health care services. the survey was administered as a random - digit - dialing (rdd) telephone survey of california households that was designed to produce reliable estimates for the whole state, including medium and small - size counties. chis 2005 is the third data collection cycle (following chis 2001 and 2003) and was conducted between july 2005 and april 2006. it surveyed 42,000 households and interviewed 58,407 persons (43,020 adults aged 18 years and older, 4,029 adolescents, and 11,358 children) randomly drawn from every county, and it is the largest state survey in the united states. this study considered sociodemographic information, ses, health behaviors, and access to health care as factors affecting psa screening. sociodemographic indicators included age, which was categorized into the age groups of 40 & 60% of the race difference in prostate cancer stage at diagnosis. resnick reported in patients with low - risk prostate cancer treated by radical prostatectomy that there existed no significant differences in surrogate measures of disease control, risk of disease upgrading, estimated tumor volume, or recurrence - free survival between whites and african americans. therefore, concern about the racial differences in prostate cancer screening is not negligible. considering racial disparities, we categorized our respondents into 4 racial groups : white, non - white latin, non - white african american, and asian american, and compared the psa screening practice among the groups. compared with whites, there was no statistically significant difference in psa screening practice among non - white african americans and asian americans. there was no statistically significant difference among the 3 different races compared with whites in the adjusted analysis. the majority of the sample, 82.2%, was white, compared with 7.7% non - white latin, 4.2% non - white african american, and 5.7% asian american. screening efforts are typically aimed at detecting cancer earlier in its natural history, and age is one of the most important factors influencing the choice of the optimal treatment arm and its outcome. as radical prostatectomy and radiation therapy continue to evolve for prostate cancer, it becomes increasingly important to understand the prognostic factors that affect outcomes. age, stage, and grade are among the most important treatment factors to analyze, because they are used ubiquitously to guide prostate cancer treatment. particularly in prostate cancer, watchful waiting is an important treatment modality and men undergoing surveillance have lower local tumor stages, grades, and psa and are older than are those who received active primary treatment (p<0.001). our study found a strong association between psa screening and age in both the unadjusted and the adjusted analysis. the results revealed that the possibility of undergoing psa screening increased in proportion to increasing age. the group aged 50 - 59 years old was 3.49 times as likely to undergo psa as was the group aged 40 - 49 years old, and the group aged 60 - 69 years old was 9.52 times as likely to undergo psa screening as was the group aged 40 - 49 years old. this might be because of more exposure to cancer education and increased awareness among the older population ; people are more likely to be exposed to cancer education or materials as they get older and they are also more likely to pay attention to issues of cancer screening. after we controlled for all other factors, age was still a statistically significant factor associated with psa screening. it would be meaningful to investigate different age groups related to psa screening behaviors and the factors that affect those behaviors. clegg analyzed population - based cancer registry data from the surveillance, epidemiology, and end results (seer) program at the national cancer institute (nci) and computed cohort - based age - adjusted cancer incidence rates. men and women with less than a high school education had elevated lung cancer rate ratios of 3.01 and 2.02, respectively. those with annual family incomes less than $ 12,500 had incidence rates that were more than 1.7 times the lung cancer incidence rate of those with incomes of $ 50,000 or higher. lower income was also associated with a statistically significantly increased risk of distant - stage breast cancer among women and distant - stage prostate cancer among men. with ses the group at 200 - 299% of the poverty level was 0.68 times less likely to undergo psa screening than was the group with a poverty level of more than 300%. the odds ratio of the group at 100 - 199% of the poverty level compared with the group at a poverty level of more than 300% was 0.66 (p=0.001) and it was statistically significant with control for other factors (table 3). in addition, people who were married were more likely to undergo psa screening than were those who were divorced or separated or those who were never married. this might be because those in a marital group had more responsibility for their spouse and family economics, and they would pay more attention to their health and cancer prevention. we expected that the likelihood of undergoing psa screening would be decreased in people with lower educational attainment, those with lower awareness of cancer screening, and those who paid less attention to health promotion and prevention. people who had a college education were 0.87 times less likely to undergo psa screening than were people who had more than a graduate school education, but the difference was not statistically significant in the multivariate analysis. people whose educational attainment was less than high school were 0.54 times less likely to undergo psa screening than were people who had a graduate school education, and this difference was statistically significant with control for other factors (p=0.001). finally, we analyzed the association between psa screening and regular health access. there was a strong association between having a usual source of health care and receiving screening for breast and cervical cancers [11 - 14 ]. even generalizations about the relationship between insurance coverage and cancer screening were not possible because that relationship has been examined in few studies. it is generally accepted that there is a positive correlation between the source of health care and performing cancer screening. in our study, people who had regular health care access were more likely to undergo psa screening than were people who had no regular health care access. people who have regular access would have a greater chance of receiving screening tests along with a physician 's recommendation regarding preventive behavior. this result indicates that access to health care is a critical factor for psa screening practice, and we need to consider ways to advocate psa cancer screening to people who do n't have regular access to health care. first, it was a cross - sectional study, so we did not evaluate the time to start psa screening or the regularity of psa screening. second, the chis is a telephone survey ; therefore, it potentially excludes people of low ses and people with severely impaired physical or mental health. not only prostatic disease, but also chronic medical diseases, such as diabetes mellitus and cardiovascular diseases, have been known to affect whether a man decides to undergo psa testing or not. this point could be a pitfall of this study. however, this was a huge, community - based telephone survey. we think that the large number of the population can overcome the effect of someone 's medical condition on his psa - screening behavior. last, our results for these surveys may not be representative of the entire country. these limitations notwithstanding, our results corroborate previous studies of not only psa screening in prostate cancer, but also other popular cancer screening programs. briefly, our results show that the likelihood of psa screening was positively associated with increased age, marital status, higher socioeconomic status, and health care access. additionally, our research suggests that there is a need to find effective ways of widening psa screening to prostate cancer screening - nave groups, especially those who are older or unmarried and lower socioeconomic groups. ses reflects psa screening behavior in males over 40 years old in california, united states. the likelihood of psa screening was positively associated with increased age, marital status (married), higher ses (higher federal poverty level and higher educational attainment), and health care access. however, there was no statistically significant association of psa screening with race, employment, exercise, smoking, or drinking status. these results corroborate previous studies of not only psa screening in prostate cancer, but also other popular cancer screening programs.	purposethe purpose of this study was to investigate social and behavioral factors associated with prostate - specific antigen (psa) screening in men in california, united states, who were over 40 years of age and had ever heard about psa screening.materials and methodsthis survey was administered as a random - digit - dialing telephone survey to produce reliable estimates of medium - sized counties. it surveyed 42,000 households and interviewed 58,407 people randomly. it considered socioeconomic status and health behavior as affecting psa screening. access to health care was measured as having regular health care access. the main outcome measure was self - report of ever having undergone psa screening at least once in the respondent 's lifetime.resultsof 8,864 respondents, 82.2% were white, 7.7% were latin, 4.2% were african american, and 5.9% were asian. the respondents ' mean age was 60.13 years. age was the significant factor for psa screening. respondents aged 50 - 59 years were 3.5 times as likely to have undergone psa screening as were those aged 40 - 49 years (or=3.49, p0.001). race was not statistically significant after considering other factors. people who had never married had statistically significantly lower screening than did people who were married (or=0.71, p=0.001). poverty levels were statistically significant in both the unadjusted and the adjusted analysis. people who had no regular health care access were much less likely to have undergone psa screening than were people who had regular health care access (or=0.22, p=0.001).conclusionsthe likelihood of psa screening was positively associated with increased age, marital status (married), higher socioeconomic status (higher federal poverty level and higher educational attainment), and health care access. however, there was no statistically significant association of psa screening with race, employment, exercise, smoking, or drinking status.
meningitis is common and is among the most serious infections occurring in individuals with hiv infection [1, 2 ]. the etiology of meningitis in hiv - endemic areas has been significantly altered in favor of cryptococcal meningitis and tb meningitis [1, 3, 4 ]. evidence shows that cryptococcal meningitis is the most common fungal meningitis and an important opportunistic infection in patients living with hiv [2, 58 ]. tb meningitis has also been shown to be the second most common cause of meningitis, with a case fatality rate of up to 67% among hiv - infected individuals [4, 9, 10 ]. the symptoms of meningitis among hiv - infected individuals may vary depending on the cause. in one study done in durban, south africa, among hiv patients coinfected with tuberculosis (tb), the most common combination of presenting clinical features for patients suspected to have meningitis was headache and neck stiffness, seen in 78.6% of patients. the triad of headache, vomiting, and neck stiffness was observed in 35.7% whereas only 1% of patients presented with fever. in another study done in zimbabwe, patients with pyogenic meningitis presented with fever and marked alteration in mental status, while the main presenting feature of cryptococcal meningitis was headache. patients with tb tended to be admitted with marked mental impairment, compared with that seen with other forms of meningitis. the diagnosis of certain types of meningitis, particularly tb meningitis, is often difficult in resource - limited settings due to the low sensitivity of standard smear for acid - fast bacilli (afb), which is often the only diagnostic assay available. currently, the true prevalence of specific microbiological etiologies, clinical characteristics, and outcomes of meningitis in our setting are not well defined. in order to optimize patient care, the epidemiologic trends of meningitis among hiv - infected patients should be examined frequently because any change may influence the choice of initial empiric antibiotics. therefore, it was the aim of this study to determine the laboratory - confirmed etiological agents, clinical characteristics, and outcomes of meningitis among hiv - infected adults admitted to the medical wards of bugando medical centre with symptoms and signs of meningitis. this was a cross - sectional study with prospective follow - up to determine in - hospital mortality / outcomes involving all hiv - infected adult patients 18 years old admitted to the medical wards of bmc for symptoms and signs of meningitis. it is located on the shore of lake victoria where the prevalence of hiv is over 6%. we serially enrolled all hiv - infected patients aged 18 years who were admitted to bmc medical wards with clinical suspicion of meningitis over a six - month period. critically ill patients, patients with focal neurological signs or papilloedema, and those who had been treated for meningitis in the past one month were excluded. all hiv - infected adults 18 years old admitted to the medical wards of bmc during the study period were screened for symptoms and signs of meningitis. patients (or their caretakers) were interviewed using a standardized data collection tool / structured questionnaire to collect demographic information, clinical symptoms, and other information. then, patients were examined within 24 hours of admission to determine the presence or absence of physical signs of meningitis. patients with lateralizing signs and/or papilloedema on fundoscopy were excluded from the study because lumbar punctures would be contraindicated given our inability to rule out a space - occupying lesion with a computed tomography scan. for all enrolled patients, laboratory investigations including csf analysis included biochemistry, cytology, gram stain, afb smear using ziehl - neelsen stain, tb culture, and india ink stain. cryptococcal antigen test (crag) was performed using latest agglutination test kit (calas, meridian bioscience europe, nice, france) according to the manufacturer 's instructions. other laboratory investigations included full blood picture, erythrocyte sedimentation rate (esr), and cd4 t - cell (cd4) count. the cd4 counts were performed using automated facs calibur flow cytometry machine (bd, san jose, usa). all results were provided to clinicians who made all decisions about treatment for meningitis and other conditions. all patients with clinical meningitis were followed up for at least 2 weeks or until the time of discharge. patients discharged prior to 2 weeks from study enrollment were contacted at 2 weeks to determine outcomes. to test for cryptococcal meningitis, all hiv - infected patients had an additional 5 milliliters of blood collected for serum cryptococcal antigen assay. after lumbar puncture, about 4 milliliters of csf was sent for both cryptococcal antigen and india ink staining. testing of both serum and csf for crag relied on the cryptococcal antigen assay (immuno - mycologics inc. this assay is a world health organization (who) approved test that is used routinely for diagnosis of cryptococcal meningitis at bmc. other bacteria were identified by gram staining of centrifuged sediment from csf and were isolated using bacterial culture on blood and chocolate agars for 72 hours. data were double entered into microsoft excel and analyzed using stata version 11 (college station, texas). continuous variables were presented as means (standard deviation (sd)) or medians (interquartile range (iqr)), and binary variables were presented as proportions (%). we analyzed clinical characteristics associated with various meningitis syndromes using the wilcoxon rank - sum and chi - squared or fisher 's exact tests where appropriate. associations between variables were considered to be significant if the p value was 5 cells / mm on csf but no bacteria or fungi on microscopy or culture). the other 5 patients (8.3%) had sterile csf with normal wbc counts and, hence, were regarded as not having meningitis. low recent cd4 count was a significant predictor of mortality among this population, with patients who died having a median current cd4 count of 50 [15100 ], compared with 98 [46338 ] in those who did not die (p = 0.01). also turbid csf was found to be a significant predictor of mortality among these patients (p value = 0.001) (table 3). this was the first cross - sectional study to determine different etiologies of meningitis among adult hiv - infected patients admitted at bmc. among 60 adult hiv - infected patients enrolled in this study, 14 (23%) of them had confirmed microbiological etiologies and 41 (68%) others had no defined isolates in the csf though they had laboratory findings (elevated csf wbc) which were suggestive of meningitis. our study also supports findings of other studies from sub - saharan africa that have shown cryptococcus followed by tuberculosis is one of the leading causes of meningitis diagnosed in this population [3, 9 ]. low recent cd4 count and turbid csf were significantly associated with mortality from meningitis in our study population. as described in two previous studies done at our hospital (bmc), cryptococcal meningitis remains a common cause of meningitis and death, among adult hiv / aids patients in our setting [6, 11 ]. this finding is also in keeping with studies from muhimbili national hospital and another study done in durban, south africa [2, 3 ]. in our study, the sensitivity of india ink in the diagnosing cm was high (72.7%) compared to previous studies. this could be explained by the fact that our patients were art - nave, and hence they may have had high fungal burdens and therefore a high positivity india ink csf stains, consistent with other studies [6, 9, 12, 13 ]. among patients with culture - proven tb meningitis, 75% had positive afb smear ; this is high sensitivity of smear microscopy compared to a study in cape town, south africa, where a very low level of 1.3% was observed. the high sensitivity of the afb smear of 75% observed in our study could be due to the use of large volume of csf (10 mls) ; this confirmed what was described previously in vietnam whereby the use of large volume csf increased the diagnostic yield for tbm from < 50% to 69%. our study finding concurs with another study done in the philippines whereby only 4/91 (4.4%) patients with chronic meningitis had confirmed tbm by culture or afb smear. however, in that study, the additional use of another test (like basal meningeal enhancement on contrast ct scan of the head) demonstrated that 44 patients fulfilled the criteria of definite tbm. the use of this test in our setting is not cost - effective. taken together, this study and ours highlight the continued challenges of diagnosing tuberculous meningitis and the urgent need for improved diagnostic resources. diagnosis of other types of bacterial meningitis in our study may also have been complicated by the sterilizing effect of antibiotics in the csf. because antibiotics are readily available at any local pharmacy in our setting, clinical experience suggests that most patients presenting to the hospital with fever have already tried several courses of antibiotics at home. this is evidenced by several recent studies that documented that most patients report the use of either prescribed or self - prescribed antibiotics prior to their admission to our hospital [16, 17 ]. we suspect that some of the cases classified as aseptic meningitis may have been partially treated bacterial meningitis whose csf no longer had viable bacteria. it was observed that, among hiv - infected patients with meningitis in this study, 36.7% died within the first 2 weeks of hospital admission. this finding is slightly lower compared with one study done in south africa in which meningitis was associated with poor outcomes including high mortality in about 40% of diagnosed patients. importantly, among our study patients with cryptococcal meningitis alone, the mortality rate is relatively lower at 36.4%. though these numbers are small, our work suggests some improvement compared to previous studies done in our hospital setting which found mortality rates of 66%, which decreased to 43% after implementation of routine serial lumbar punctures for patients with cryptococcal meningitis [6, 11 ]. we have continued to use serial lumbar punctures, together with high - dose intravenous fluconazole, to manage patients admitted with cryptococcal meningitis to our hospital. the very high 75% mortality rate for patients with tbm draws attention to the continued need for better diagnosis and treatment. of 3 deaths, 2 had afb smear - positive, suggesting a high burden of mycobacteria. this high mortality rate among patients with tbm is supported by another larger study done in south africa where the mortality rate was about 66.7%. cryptococcal meningitis is the most prevalent laboratory - confirmed isolate among adult hiv - infected patients admitted with features suggestive of meningitis to the bmc medical wards. tuberculous meningitis is the second most common cause of confirmed meningitis ; however, it remains difficult to diagnose due to challenges with diagnostic tools and likely has a higher prevalence in reality. our work calls attention to the ongoing need for improved diagnosis and management for patients presenting with meningitis in resource - limited settings.	background. limited information exists on the etiologies, clinical characteristics, and outcomes of meningitis among hiv - infected patients in africa. we conducted a study to determine the etiology, clinical characteristics, and outcomes of meningitis among hiv - infected adults. methods. a prospective cross - sectional hospital based study was conducted among hiv - infected patients aged 18 years admitted to the medical wards with symptoms and signs of meningitis. sociodemographic and clinical information were collected using a standardized data collection tool. lumbar puncture was performed to all patients ; cerebrospinal fluid samples were sent for analysis. results. among 60 hiv - infected adults clinically diagnosed to have meningitis, 55 had csf profiles consistent with meningitis. of these, 14 (25.5%) had a laboratory - confirmed etiology while 41 (74.5%) had no isolate identified. cryptococcus neoformans was the commonest cause of meningitis occurring in 11 (18.3%) of patients followed by mycobacterium tuberculosis (6.7%). the in - hospital mortality was 20/55 (36.4%). independent predictors of mortality were low baseline cd4 count and turbid csf appearance. conclusion. cryptococcal meningitis is the most prevalent laboratory - confirmed etiological agent among adult hiv - infected patients with suspected meningitis admitted to medical wards in western tanzania. mortality rate in this population remains unacceptably high. improving diagnostic capacity and early treatment may help to decrease the mortality rate.
during a 12-month period (10/20019/2002), 199 consecutive environmental specimens were submitted for possible detection of b. anthracis. hemolysis types were determined by subculturing them on 5% horse, sheep, and human blood agar plates : -, -, and -hemolysis were defined, according to standard criteria (13). strong -hemolysis was characterized as hemolysis clearly extending the colony margin, and weak -hemolysis was characterized by a narrower hemolysis zone or slight hemolysis below colonies. cultures were incubated at 35c for 1824 h in air ; blood agar plates were incubated for 48 h. motility testing was performed by using sterile h2o at time 0, as well as trypticase soy broth (tsb) at time 0 and after a 2-h incubation at 35c. part of a colony was dissolved in h2o and tsb and examined microscopically (2). media were supplied from bioprepare (gerakas, greece), except for human blood agar plates prepared in house with red blood cell units obtained from blood banks and a blood agar base (scharlau chemie, barcelona, spain). specific pcr protocols amplifying a 152-, a 747-, and a 264-bp fragment of the chromosomal ba813, the paga (pxo1), and the capc gene (pxo2) sequences, respectively (5). a pcr recommended by the world health organization, which targets a 639-bp sequence of the chromosomal b. anthracis s - layer gene, control strains included the nc08234 - 03 b. anthracis sterne strain (pxo1/pxo2), a b. anthracis strain isolated from the malignant pustule of an agricultural anthrax patient, and the bacillus subtilis eo-1 reference strain (kindly provided by the hellenic agricultural ministry). diverse hemolytic activity was demonstrated by the 72 bacilli on different blood agar plates. at 24 h, strong -hemolysis was produced by 55 (76%), 41 (57%), and 55 (76%) strains on human, sheep, and horse blood agar plates, respectively, while 6 (8%), 10 (14%) and 7 (10%) strains demonstrated weak -hemolysis (table). prolongation of incubation to 48 h resulted in increased detection of strong -hemolysis on all media. both b. anthracis strains produced -hemolysis on all media at 24 h, except for slight -hemolysis below areas of confluent growth on human blood agar plates. after 48 h they remained -hemolytic on horse and sheep blood agar plates ; however, both produced strong -hemolysis on human blood agar plates. at time zero of incubation, motility was detected in 33 (46%) and 45 strains (63%) examined in h2o and tsb, respectively. the 2-h incubation step in tsb detected another 13 motile strains (total number of motile strains, 58 ; 81%) and made recognition of motility much easier. the capc and paga gene sequences were not amplified ; however, the ba813 sequence was amplified in seven strains (10% ; specificity 90%), and the s - layer sequence was amplified in another two strains (3% ; specificity 97%). twenty - four isolates (33%) grew on plet ; 21 of them were uniformly -hemolytic. a positive correlation between the ability to grow on plet and ba813 pcr - positivity was detected. five out of 24 strains (21%) that grew on plet were positive by this pcr in comparison with 2 of 48 strains (4%) that did not grow on plet (fisher exact test, p = 0.037). although other genera are known to produce distinct hemolysis types on different blood agar plates (14), comparative studies for bacilli have not been reported. however, various blood agar plates manifested different abilities to support the expression of -hemolysis as well as to demonstrate weak and strong -hemolysis. weak -hemolysis must thus be interpreted with caution ; isolates will be incubated for another 24 h or considered nonhemolytic strains. -hemolysis was easier to recognize on all media after 48 h, but sheep blood agar plates were the least effective medium in detecting -hemolysis. finally, -hemolysis results obtained with horse and human blood agar plates, although not identical, were usually in agreement and differed from those obtained with sheep blood agar plates (data not shown). the production of strong -hemolysis on human blood agar plates by the b. anthracis strains was unexpected, as this organism has been considered traditionally nonhemolytic. recently, however, the ability of b. anthracis to express -hemolysis was reported (15,16). broth culture supernatants possessed hemolytic activity against human and sheep erythrocytes, whereas richness of media affected hemolysis expression (15). another study demonstrated the induction of strong -hemolysis on human but not sheep blood agar plates under anaerobic conditions (16). in fact, a study conducted in 1957 reported 45 -hemolytic strains among 120 b. anthracis isolates that had been cultured on rabbit blood agar plates (17). therefore, withholding the use of human blood agar plates would be prudent ; horse blood agar plates should be used as the most informative medium. according to our findings, the 2-h incubation of bacilli in tsb greatly improves recognition of motile strains. increased motility detection using tsb rather than h2o has been demonstrated with 12 non b. apparently, motile bacilli become immobilized in distilled water, while the practice of incubating them in a rich broth until they reach exponential growth phase was actually recommended in the past (19). all bacilli tested negative for the presence of capc and paga sequences, but seven strains were positive for ba813. these results prompted us to assess the specificity of the s - layer pcr, which, to our knowledge, has not been evaluated before. only two strains, different from the above seven, were positive : a motile, strongly -hemolytic strain and a nonmotile, -hemolytic strain. with the exception of the laboratory response network real - time pcr (9), the specificity of other pcr protocols (48,20) has not been evaluated before by testing field isolates from suspected bioterrorism incidences. false - positive results have been reported with other cap sequence pcr assays (4,6), although efforts to establish a specific chromosomal assay have been frustrating (6,7,20). as b. anthracis strains cured from one or both plasmids exist naturally or may be obtained in vitro (3), and false - negative results may be encountered with plasmid - specific pcr assays (4), the availability of a chromosomal pcr is desirable. our results indicate that to preserve the positive predictive value of the evaluated molecular tests, chromosomal assays should always be performed in conjunction with plasmid pcr. because environmental and, to a lesser extent, clinical samples may be heavily contaminated, a selective medium for b. anthracis would be useful. plet is used in environmental investigations of agricultural anthrax outbreaks (3), because it inhibits other bacilli and gram - negative rods (10). in our study, the specificity of plet was low, but plet is still valuable, because by inhibiting two thirds of contaminating bacilli as well as other bacteria, background will decrease and isolating colonies will be easier and faster. however, the characteristic colony morphology of the two b. anthracis strains on blood agar was not reproduced on plet. examination of a large number of b. anthracis strains is required to confirm these observations. a positive correlation was detected between the ability to grow on plet and ba813 pcr - positivity. anthracis strains previously reported to be ba813 pcr positive were isolated by using plet (20). ba813-positive bacilli may be very closely related to b. anthracis and demonstrate, therefore, phenotypic similarities like the ability to grow on plet. in conclusion, horse blood agar plates provide better recognition of -hemolysis, and testing after a 2-h - incubation in tsb improves motility detection. the application of these tests along with plet agar will have a substantial impact on public health laboratories that process large numbers of specimens. workload will decrease, and the presence of b. anthracis will be ruled out faster, leading to earlier termination of chemoprophylaxis and diminished anxiety of exposed persons. standardization and validation of molecular assays as direct detection tests will further decrease turnaround time ; however, these methods only complement conventional testing. selective or differential media and further refinement of conventional techniques will still be needed.	optimization of methods for ruling out bacillus anthracis leads to increased yields, faster turnaround times, and a lighter workload. we used 72 environmental non b. anthracis bacilli to validate methods for ruling out b. anthracis. most effective were horse blood agar, motility testing after a 2-h incubation in trypticase soy broth, and screening with a b. anthracis selective agar.
the ph - sensing ion - sensitive field - effect transistor (isfet), first proposed by bergveld in 1970, has become the basis for many contemporary semiconductors and their respective biosensors.1 in an isfet, the ions within the sample media undergo multiple environment - influenced reactions. the resulting molecules from these reactions accumulate upon the gate oxide layer (gol), and the resulting change in charge affects the conductance in the isfet channel.2,3 consequently, the conductance between the source and the drain will differ, and this change is expressed as an electrical signal. the gols of isfets are usually made up of dielectric materials, such as sno2,47 zno,8 sio2,9,10 al2o3,11 si3n4,12,13 ta2o5,14 tio2,15 and wo3,16 which readily react with the h and oh of the media. dielectric materials that have a high reactivity with ions are used as either ph sensor or gas sensor.17 however, because other ions within the sample media also affect the surface charge on the gol, the electrical characteristics such as the threshold voltage and channel conductance will be influenced. isfet - based biosensors, which detect bioanalytes, are affected by the undesirable ions in the media, and the resulting fluctuations or noise may cause the results to be deemed untrustworthy. although the signal may stabilize as time progresses and the reaction becomes saturated (reaches equilibrium state), the noise factor must be acknowledged when evaluating the final signal. because the target bioanalyte is already in small amounts inside the target solution, any other factors that may affect the signal, such as the ions within the solution media, will affect the sensitivity of the biosensor. when the biosensor applies highly reactive nanowires and thin films to enhance its sensitivity, the unwanted noise factor may also be increased and affect the result even more. in this study, we report a strategy to minimize the sensing voltage error in the isfet biosensor. to improve specific bioanalyte binding and to reduce undesirable ion reactions, an optimal presurface treatment on the gate oxide is demonstrated. in addition, the sensing voltage drift error (vdf) of the isfet biosensor before presurface treatment and after presurface treatment is analyzed. finally, because multiple teams that study and utilize the isfet biosensor dilute the media to obtain a longer debye screening length, we analyzed the vdf for 1 phosphate buffered saline (pbs) and 0.01 pbs solutions the gol of an isfet biosensor was fabricated by depositing an sno2 (99.9%) thin film on the top of an indium tin oxide (ito) glass (ito thickness : 300 nm). the 80 nm sno2 film was deposited using a radio frequency (rf) magnetron sputtering system (rf power : 50 w, base pressure : 210 torr, work pressure : 18 mtorr, ar gas flow : 5 sccm). the polydimethylsiloxane (pdms) block was manufactured from a sylgard 184 silicone elastomer kit (dow corning, seoul, republic of korea), which was composed of a base and a curing agent. the base and curing agent were mixed at a 10:1 ratio and baked at 60c for 4 h. the pdms block was then punctured with 6 mm holes to form a sample media reservoir. to attach the pdms to the surface of gol, the gol was sonicated in deionized water for 1 min and then sonicated in ethanol for 1 min. the pdms block and gol were then placed inside an o2 plasma system (cute - mpr ; femto science, gyeonggi - do, republic of korea) and treated with o2 plasma (dc power : 70 w, time : 1 min, o2 flow : 30 sccm, base pressure : 510 torr, working pressure : 510 torr). the pdms block and gol were then attached together to form the sensing gate (figure 1). the gol surface of the sensing gate was treated with plasma to form oh functional groups on the reservoir surface. then, 5% 3-aminopropyltriethoxysilane (aptes) was prepared and quickly added to the surface of the gol for the formation of nh2 functional groups. after the addition of the aptes, the gol was placed inside a petri dish and the petri dish was sealed with parafilm for 1 h. the chemical reaction should occur in a dark place. after 1 h, the sensing gate was sonicated in ethanol for 1 min and dried with n2 gas. the sensing gate was baked on a hot plate at 120c. to functionalize the gol surface of the sensing gate with cooh functional groups, 5% 1 m succinic anhydride was made from succinic anhydride powder and dimethyl formamide (dmf) and added onto the surface of the gol. the petri dish was sealed with parafilm and placed inside an incubator at 37c for overnight. the presurface - treated sensing gate was washed with dmf and deionized water for 20 s. this gol was then treated with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (edc) hcl and sulfo - n - hydroxysulfosuccinimide (nhs) chemistry.18 gol after the addition of edc and sulfo - nhs was identified as a surface - treated gol (st - gol). antibodies were then added to the wells. here, we used prostate - specific membrane antigen (psma) antibodies it had an igg2b isotype structure and was specific to the c - terminal of a psma antigen. the psma antibody was conjugated onto the sensing gate surface at a concentration of 100 nm. to prevent unwanted reactions with unreacted chemical cross - linkers left on the surface, 1 m ethanolamine (ph 8.5) was added. after adding the ethanolamine to the st - gol, the st - gol was washed with 1 pbs. in order to protect the st - gol from nonspecific binding, 10% bovine serum albumin (bsa) was added and left to undergo the chemical reaction for 1 h. finally, the st - gol was washed with 1 pbs (figure 2). a commercial ag / agcl reference electrode (qrins, mf-2097), a commercial cmos transistor (on semiconductor, mc14007ub, n - type mosfet), and a high precision semiconductor parameter analyzer (4200-scs ; keysight technologies, santa rosa, ca the experiment was conducted under different conditions. in the initial condition, the vdr of the i v curves was measured at the 0, 1, 3, and 5 min marks after inserting a 0.01 pbs solution into pdms reservoirs on all the sensing gates. in the second condition, the 0.01 pbs was replaced with 1 pbs and the solution was added into the pdms reservoirs on all the sensing gates. the measurement was taken at the same time points as the initial condition (0, 1, 3, and 5 min marks). the chemical compositions of the pbs solution are as follows : 1) potassium phosphate monobasic (kh2po4) 1.0589 mm, 2) sodium chloride (nacl) 155.172 mm, and 3) sodium phosphate dibasic (na2hpo47h2o) 2.9665 mm. in addition, to measure the vdf difference between the different surface treatments of the gol, 1 pbs was added to bare gol, st - gol without antibodies, and st - gol with antibodies. the vdr was measured at the 0, 1, 3, 5, and 10 min marks (figure 1). the gol of an isfet biosensor was fabricated by depositing an sno2 (99.9%) thin film on the top of an indium tin oxide (ito) glass (ito thickness : 300 nm). the 80 nm sno2 film was deposited using a radio frequency (rf) magnetron sputtering system (rf power : 50 w, base pressure : 210 torr, work pressure : 18 mtorr, ar gas flow : 5 sccm). the polydimethylsiloxane (pdms) block was manufactured from a sylgard 184 silicone elastomer kit (dow corning, seoul, republic of korea), which was composed of a base and a curing agent. the base and curing agent were mixed at a 10:1 ratio and baked at 60c for 4 h. the pdms block was then punctured with 6 mm holes to form a sample media reservoir. to attach the pdms to the surface of gol, the gol was sonicated in deionized water for 1 min and then sonicated in ethanol for 1 min. the pdms block and gol were then placed inside an o2 plasma system (cute - mpr ; femto science, gyeonggi - do, republic of korea) and treated with o2 plasma (dc power : 70 w, time : 1 min, o2 flow : 30 sccm, base pressure : 510 torr, working pressure : 510 torr). the pdms block and gol were then attached together to form the sensing gate (figure 1). the gol surface of the sensing gate was treated with plasma to form oh functional groups on the reservoir surface. then, 5% 3-aminopropyltriethoxysilane (aptes) was prepared and quickly added to the surface of the gol for the formation of nh2 functional groups. after the addition of the aptes, the gol was placed inside a petri dish and the petri dish was sealed with parafilm for 1 h. the chemical reaction should occur in a dark place. after 1 h, the sensing gate was sonicated in ethanol for 1 min and dried with n2 gas. the sensing gate was baked on a hot plate at 120c. to functionalize the gol surface of the sensing gate with cooh functional groups, 5% 1 m succinic anhydride was made from succinic anhydride powder and dimethyl formamide (dmf) and added onto the surface of the gol. the petri dish was sealed with parafilm and placed inside an incubator at 37c for overnight. the presurface - treated sensing gate was washed with dmf and deionized water for 20 s. this gol was then treated with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (edc) hcl and sulfo - n - hydroxysulfosuccinimide (nhs) chemistry.18 gol after the addition of edc and sulfo - nhs was identified as a surface - treated gol (st - gol). antibodies were then added to the wells. here, we used prostate - specific membrane antigen (psma) antibodies. it had an igg2b isotype structure and was specific to the c - terminal of a psma antigen. the psma antibody was conjugated onto the sensing gate surface at a concentration of 100 nm. to prevent unwanted reactions with unreacted chemical cross - linkers left on the surface, 1 m ethanolamine (ph 8.5) was added. after adding the ethanolamine to the st - gol, the st - gol was washed with 1 pbs. in order to protect the st - gol from nonspecific binding, 10% bovine serum albumin (bsa) was added and left to undergo the chemical reaction for 1 h. finally, the st - gol was washed with 1 pbs (figure 2). a commercial ag / agcl reference electrode (qrins, mf-2097), a commercial cmos transistor (on semiconductor, mc14007ub, n - type mosfet), and a high precision semiconductor parameter analyzer (4200-scs ; keysight technologies, santa rosa, ca, usa) were utilized for the measurement of the vdf. the experiment was conducted under different conditions. in the initial condition, the vdr of the i v curves was measured at the 0, 1, 3, and 5 min marks after inserting a 0.01 pbs solution into pdms reservoirs on all the sensing gates. in the second condition, the 0.01 pbs was replaced with 1 pbs and the solution was added into the pdms reservoirs on all the sensing gates. the measurement was taken at the same time points as the initial condition (0, 1, 3, and 5 min marks). the chemical compositions of the pbs solution are as follows : 1) potassium phosphate monobasic (kh2po4) 1.0589 mm, 2) sodium chloride (nacl) 155.172 mm, and 3) sodium phosphate dibasic (na2hpo47h2o) 2.9665 mm. in addition, to measure the vdf difference between the different surface treatments of the gol, 1 pbs was added to bare gol, st - gol without antibodies, and st - gol with antibodies. the vdr was measured at the 0, 1, 3, 5, and 10 min marks (figure 1). we investigated the vdf of a bare gol, an st - gol without antibodies, and an st - gol with antibodies in 0.01 pbs (figure 3a c). after adding 0.01 pbs into all respective pdms reservoirs of the gol and waiting for 1 min, the voltage values were measured. subsequent analyses were conducted in 2 min intervals and repeated two times to identify the vdf. in the case of the bare gol, a large vdf of 21.5 mv for 5 min (4.3 mv / min) was observed. this error value reaches 36.3% of an fet s nernst limit (59.3 mv / ph).19,20 this result implies that in a situation where sensing is conducted in a low antigen concentration range, which is lower than the ionic concentration change range following a change in 1 ph, it is hard to obtain a trustworthy sensing signal. an additional phenomenon that was observed was the consistent shift of the vdf as time passes. this is because the nonpreconditioned gol has an unstable surface and, thus, reacts with numerous ions of the pbs (oh, h, and o2), for a long time. this phenomenon contributes to sensors being unable to produce reliable results when exposed to extended periods of testing. in the cases of the st - gol without antibodies and the st - gol with antibodies, the st - gol without antibodies showed a vdf of 11.37 mv/5 min (2.3 mv / min), and the st - gol with antibodies showed a vdf 7.13 mv/5 min (1.4 mv / min). these values are only 19.2% of the nernst limit and 12% of the nernst limit, respectively. the reasons for the decreased vdf can be thought to be due to the following. first, the random chemical reactions between the chemical links on the surface of gol and ions of the pbs were restricted by the presurface treatment. second, the number of residual chemical links that can react and bind to the ions within the pbs is limited and this causes saturation to occur very quickly. figure 4a and b shows the vdf values of adding undiluted 1 pbs solution to an st - gol without antibodies and to an st - gol with antibodies. the experiment was conducted under the same conditions as the experiment of figure 3. as can be seen from the results, the vdf results are much smaller than the vdf of its 0.01 pbs counterpart : the st - gol without antibodies has a vdf of 0.37 mv / min and the st - gol with antibodies has a vdf of 0.33 mv / min. the significant reduction of the vdf values is because of the debye screening length in the 1 pbs. the 1 pbs has the much smaller debye screening length of 0.7 nm than 0.01 pbs s debye screening length of ~7.3 nm.21,22 consequentially, the gol can only detect much smaller ions in 1 pbs, and as a result, the chemical reaction is rapidly saturated (or stabilized). figure 5 shows the results for all gol vdf values that were measured at the 0, 1, 3, 5, 10, 15, and 20 min marks in 1 pbs. for the bare gol, the chemical links of the sno2 surface reacted continuously with the ions in the pbs and the vdf increased as time passed.. however, gol that has undergone presurface treatment showed complete saturation by the ions in 1 pbs by the 1 min mark. consequently, a presurface - treated gol utilizing 1 pbs can decrease the noise from unwanted ions and produce a reliable biosensing signal. the results clearly indicate that in scenarios where the isfet is used to sense biomarkers, the undiluted 1 pbs could produce trustworthy biosensing signals. however, the 1 pbs will lead to a much shorter debye screening length and subsequent biomarker detection limit. this can lead to problems if a lengthy or bulky bioconjugate, such as whole antibodies, is utilized. to solve the problem from the short debye screening length, small capture linkers, such as antibody fragments, aptamers, and peptides, this study used sno2 as a gate oxide sensing layer in an isfet biosensor to capture biomarkers and analyze their biosignals. the results demonstrate that proper surface treatment of a gate oxide sensing layer in an isfet can significantly reduce the sensing signal error. because the amounts of biomarkers in samples are usually minuscule, a biosensor must be sensitive enough to detect these biomarkers at low concentrations. to produce a longer debye screening length for the isfet biosensor, the sample media, which were the pbs solutions in this study, are diluted. however, this could lead to a situation where the media itself can cause both a large vdf and a large margin of error, thus making the resulting biosensing signal unreliable. to decrease such error from the media, a more concentrated medium, such as 1 pbs, the 1 pbs medium quickly reacts and saturates the surface of sensing gate and subsequently stabilizes the electrical potential. an unfortunate side result from adding the concentrated medium is the shortening of the debye screening length. to overcome this obstacle, aptamers, peptides, and antibody fragments and immobilization materials that are shorter than a whole antibody need to be utilized to maintain a reliable sensor sensitivity outcome.	an ion - sensitive field - effect transistor (isfet) biosensor is thought to be the center of the next era of health diagnosis. however, questions are raised about its functions and reliability in liquid samples. consequently, real - life clinical applications are few in number. in this study, we report a strategy to minimize the sensing signal drift error during bioanalyte detection in an isfet biosensor. a nanoscale sno2 thin film is used as a gate oxide layer (gol), and the surface of the gol is chemically modified for improving bioanalyte - specific binding and for reducing undesirable ion reactions in sample solutions. the isfet biosensor with surface - modified gol shows significantly reduced sensing signal error compared with an isfet with bare gol in both diluted and undiluted phosphate buffered saline solutions.
thimerosal is a preservative that is widely used in medical products, including as a preservative in vaccines, immunoglobulin preparations, skin test antigens, antivenins, ophthalmic and nasal products, and tattoo inks, and is composed of 49.6 percent ethylmercury by weight. the widespread use of thimerosal exposes many to its potential toxic effects, especially in utero and in neonates. we report the results of a series of experiments using cultured normal human astrocytes (nha) exposed to thimerosal to study the compound 's effect on astrocyte mitochondria. the brain utilizes 20% of the oxygen consumed by the body but constitutes only 2% of the body 's mass. the majority of superoxide generated in cells comes from the reaction of molecular oxygen with flavin or quinone radicals, which are partly generated during respiration within complexes of the mitochondrial respiratory chain. the rate of reactive oxygen species (ros) production increases steeply with increased mitochondrial membrane potential. superoxide has a very short half - life in cells as it is rapidly dismutased by either the cytosolic cu - zn superoxide dismutase (sod) or the mn - sod in the mitochondrial matrix, producing molecular oxygen and hydrogen peroxide. thus, generation of superoxide is always accompanied by hydrogen peroxide production, and so opens up the possibility of hydroxyl radical (ho) generation via fenton / haber - weiss chemistry. fenton metals, including iron and copper, catalyze the production of ho from superoxide / hydrogen peroxide and so the free, unchelated levels of transition metals inside cells are very low and normally all stored in an oxidized state. normally, these metals are tightly bound to various metallochaperones, such as the ferric iron chelator ferritin. astrocytes are the major supporting cells of the brain and one of their key features is their ability to become reactive towards infectious agents and use chemical warfare, upregulating inos to generate high levels of nitric oxide and nadph oxidase to generate superoxide, hydrogen peroxide, peroxynitrite, and other oxidative per - species (see and references within). the types and levels of antioxidant enzymes of nha are rather different from most other cell types and the levels of different enzymatic antioxidant enzyme change when nha transition from unreactive to reactive states. in many cell types the main defense against peroxide stress are selenol containing enzymes including the glutathione peroxidases (gpx) and thioredoxin reductase (trxr). gpx is not present in detectable levels in human unreactive astrocytes in normal brain and it appears that gpx is only present in high levels in reactive astrocytes [8, 9 ]. trxr levels in normal human brain are also low, but is significantly elevated in the brains of alzheimer 's patients, especially at the site of amyloid plaques where reactive astrocytes are present. it has been shown that in cultured nha that trxr expression is under tight regulation, with increases from very low basal levels, under the control of cytokines and growth factors. peroxiredoxins, including the mitochondrial peroxiredoxin v, are an important class of peroxide / peroxynitrite detoxification enzymes that are sensitive to organomercury. like the selenol - based antioxidant enzymes, these thiol - based antioxidant proteins are only found in very low levels in human astrocytes. there is much evidence to suggest that catalase, rather than cysteine or selenocysteine - based peroxidases, is the main enzymatic peroxidase in unreactive nha. nha also have high levels of reduced glutathione (gsh), capable of detoxifying peroxides via direct chemistry, and high levels of all three superoxide dismutases [15, 16 ]. catalase and the manganese superoxide dismutase are both upregulated when astrocytes are subjected to oxidative stress [14, 16 ]. in cell types where selenol / thiol containing peroxidases are the major enzymes that detoxify peroxides, organomercury toxicity tends to result from loss of antioxidant enzyme function coupled with an increase in the rate of oxidant production [17, 18 ]. there is a large literature examining the role of organomercury toxicity and the involvement of selenoenzymes trxr and glutathione peroxidase, gpx, see and references therein ; however, these data may not apply to nha, especially unreactive nha which appear not to make extensive use of these organomercury sensitive detoxification enzymes. ethylmercury is a lipophilic cation which can cross the blood - brain barrier [1922 ]. the octanol / water partition coefficients of methyl and ethylmercury are 1.4 to 1.8 [21, 23 ], at intracellular ph and [cl ], thus both organomercury compounds will predominately exist as lipophilic cations inside cells. mitchell demonstrated that lipophilic cations accumulate inside mitochondria, in a nernstian fashion, driven by the steady state membrane potential. given that the typical mitochondrial membrane potential of astrocytes and neurons is between 140170 mv, one would, a prior, expect the concentration of these organomercury compounds within mitochondria to be approximately 1000 times greater than the cytosolic concentration. we postulate that this compound is preferentially taken up into the mitochondria of nha causing damage to the respiratory chain and subsequent ros production. the damage of a cell 's mitochondria leads to the activation of the apoptotic cascade and subsequent cell death [3, 4, 24, 2631 ]. this may be clinically relevant in the setting of a patient who harbors a known or unknown mitochondrial disorder. in the setting of a mitochondrial disorder we designed this series of experiments to examine the effects of thimerosal - derived ethylmercury on human astrocyte apoptosis by choosing a time course of cell examination after treatment that would showcase the early stages of apoptosis. we proposed that by examining the cells in an early phase, sixty minutes after ethylmercury dosing, we could visualize the compound 's effect on the mitochondria and mitochondrial dna (mtdna). normal human astrocytes (nha) were obtained from lonza (walkersville, md, usa) and grown subject to their recommendations. nha were grown to confluency in astrocyte cell basal medium supplemented with 3% fbs, glutamine, insulin, fhegf, ga-1000 and ascorbic acid in 16-well lab - tek slide chambers (nalge nunc, rochester, ny, usa), in a total volume of 240 l. firstly, a 50 l aliquot of ice - cold 8% pfa was added to each well, then gently aspirated and the wells were twice washed with ice - cold 2% pfa and then allowed to completely fix at 4c. after fixation cells were washed twice in x1 pbs (thermo fisher scientific, rockford, il, usa). the tanks were then removed from the slides, the well area covered with fluoromount - g (southernbiotech, il, usa), cover - slipped and sealed with nail varnish. h1398), mitochondrial membrane potential with 500 nm mitotracker red (cat no. m22425), hydrogen peroxide using 5 m h2dcfam [31, 32 ] (cat no. d399), mitochondrial superoxide generation with 5 m mitosox red (cat no. m36008) ; ho was assayed using 5 m hydroxyphenyl fluorescein (hpf) (cat no. h36004), with reagents obtained from molecular probes (eugene, or, usa). hydrazine reactive aldehyde / ketones were labeled using 225 m biotin - xx hydrazide (cat no. the activity of caspase-3 in fixed, 0.1% triton permeabilized cells was measured using the molecular probes r110-enzchek assay kit (cat no. the measurements and quantification of dna 3oh (ddtunel), oxidized dna bases (fpg - ddtunel) and blunt ended breaks by use of the ddtunel and blunt - ended ligation were performed as described in our recent publications [35, 36 ]. biotinylated ddutp and biotinylated blunt ended oligonucleotide probe a tdt reaction buffer was prepared daily diluting a stock solution 1 : 5 of tunel buffer (125 mm tris - hcl, 1 m sodium cacodylate, 1.25 mg / ml bsa, ph 6.6) and a 25 mm cobalt chloride stock solution, 1 : 25. each well was twice washed in this reaction buffer and then incubated with 50 l of reaction buffer containing 20 units / ml of tdt and 250 nm of biotin-16-ddutp (roche, in, usa). each sample, having previously undergone ddtunel, was washed and incubated with ne buffer 3 for 30 minutes and then with 50 l of the same buffer containing 100 units / ml of calf intestinal alkaline phosphatases (sigma) for 2 hours and the newly generated, 3po43oh, ends. following ddtunel / ciap - ddtunel, capping all 3oh/3po4 ends with authentic, unlabeled avidin, samples were washed twice in 10 mm hepes, 10 mm nacl, 2 mm edta and 0.1% bsa and then 50 l of the same buffer containing 100 units / ml of formamidopyrimidine dna glycosylase (fpg) (usb, cleveland, oh, usa) was applied to each of the wells, then incubated in a humidified box 2 hours. each sample was washed twice in x1 pbs (thermo fisher scientific, rockford, il, usa) twice in nebuffer 3 and 50 l of the same buffer containing 100 units / ml of ciap was applied to each section and incubated for 2 hours ; samples then underwent a third round of ddtunel and labeling with fitc - avidin. the wells were preincubated in the ligation buffer without the probe (66 mm - tris hcl, ph 7.5, 5 mm mgcl2, 0.1 mm dithioerythritol, 1 mm atp, and 15% polyethylene glycol-8000) to ensure even saturation. the buffer was aspirated, and the full ligation mix containing the ligation buffer with probe, 35 g/l, and 0.5 u/l t4 dna ligase (new england biolabs, ipswich, ma, usa) was applied to the sections, which were then incubated in a humidified box overnight. thimerosal 97% (hplc) and all unspecified regeants were obtained from sigma - aldrich (st. louis, mo, usa), unless otherwise specified. thimerosal solutions were prepared in x1 pbs (thermo fisher scientific, rockford, il, usa) to a maximum concentration of 360 m and 10 l were added to the 240 l astrocytic volume. 3% fcs was present in the nha media throughout the time course. to generate the time course shown in figure 1, nha were exposed to mitotracker, h2dcfam and hoechst at t = 0. additions of 10 l aliquots were added at 10 minute intervals, to different wells in sequence, so that all the cells had the same length of exposure to the reporters, but different temporal exposure to thimerosal. the signal was acquired using a nikon eclipse te2000-e fluorescent microscope equipped with a coolsnap es digital camera system (roperscientific) containing a ccd-1300-y / hs 1392 1040 imaging array cooled by a peltier device. images were recorded and analyzed using nikon nis - elements software and images were stored as both.jpeg200 and.jpg files. the effect of ethylmercury on the fluorescence levels of the three reporters was investigated in two ways. the concentration dependence of ethylmercury towards nha was studied by adding to 014.4 m thimerosal to the cell media at t = 0. in addition, we investigated the temporal changes caused by the addition of 14.4 m thimerosal at t = 0, 10, 20, 30, 40, and 50 minutes before fixation at 60 minutes. we imaged the center field of three independent wells, at each time point or concentration, collecting the fluorescence levels of the three reporters of an average of 44 18 individual astrocytes per center field. in figure 1 we show the changes in the levels of mt and ros (via dcf formation) as a function of thimerosal concentration (figure 1(a)) and of changes induced by incubation with 14.4 m thimerosal over time. it can be seen that low concentrations of ethylmercury cause an increase in both signals. the finding that ethylmercury increases ros generation is not surprising, given the well - known effects this agent has in disrupting cellular thiol / glutathione - based antioxidant defenses [20, 22, 30 ]. the hyperpolarization of mitochondrial membrane potential was unexpected, given that depolarization of mitochondria has been observed in most cell types prior to apoptosis. at higher concentrations (> 7.2 m thimerosal) a loss of mitochondrial signal and of dcf is observed. this loss of signal, when comparing > 7.2 m with 40 minutes, and this drop in the levels of the cellular ros reporter also correspond the observation of cell shrinkage and the formation of cytoplasmic blebs. in figure 2 we show the colocalization of mitochondrial and ros signals in high resolution images of control nha treated for 60 minutes with 14.4 m thimerosal. in figure 2(a), upper panels, we present the mitotracker (red), ros - induced dcf (green), and nuclear hoechst staining (blue) of nha taken at magnifications of 60 in the absence (left) and presence (right) of 14.4 m thimerosal. the fluorescence levels of all three panels are matched in the two images, so that the color levels absolutely reflect signal levels and show that thimerosal causes an approximately 50% drop in mitochondrial membrane potential and a two - fold increase in ros. it is clear that the majority of mitochondria in the cells are in a vermiform network and that there appears to be a strong colocalization of the mitochondrial and ros signals. in figure 2(b) the images of control and treated cells obtained at 150 magnification are shown. here, the red mitochondrial signals are multiplied by a factor of four in the 14.4 m thimerosal - treated astrocytes, so as to allow visual identification of the distribution of the mitochondria within these cells. the three treated cells shown are reasonably representative of the population with the central cell being shrunken and with a highly distorted nucleus. the square outlines are areas of the cells where we present individual mitotracker and ros images, and the overlaid images of these fluorophores of these chosen areas, figure 2(c). these images clearly show that an orange colored horseshoe shaped signal in the control cell, shown in figure 2(b), consists of a network of mitochondria and that this mitochondrial network is mirrored in the dcf, ros, image. the correlation of mitochondrial signaling in the treated cells is also indicated, and in one of the treated cells we have identified a lightening - bolt shaped mitochondrial network. one can observe that this lightening bolt feature consists of mitotracker positive network of mitochondria and dcf signals. both images in figure 2(b) have a diagonal line running from top - left to bottom - right. the bottom panel, figure 2(d), shows the intensity profile of mt, dcf, and hoechst along these two lines (with the mt signal 4 in the thimerosal treated image). the red lines correspond to the fluorescence signal of mt, the blue lines to hoechst and the green lines to ros generated dcf. in both plots there is an additional black line, which matches the line shape and amplitude to the dcf signal. this black line is our fit to the ros signal, based on the amplitudinal changes of mt and hoechst. in the control panel the ros signal is best simulated by 0.44 multiplied by the mt signal and 0.39 multiplied by the hoechst signal. in the thimerosal - treated cells the relationship between hoechst staining and dcf levels is within 3% of that in the control cells modeled at 0.38 multiplied by hoechst fluorescence. however, the fit with mt labeling is strikingly different, with the best simulation generating a value of 0.117 for the ratio of actual mt signal to ros. we compared the cross - correlation of the simulated fit with the actual dcf signal and found the slopes were 1 0.01 in both cases and that the r values were greater than 0.99 in both controls and treated cells. thus, thimerosal treated astrocytic mitochondria are generating four times the amount of ros as the control mitochondria, but the steady state generation of ros in areas with no mitochondria, especially the nucleus, is unchanged. in figure 3 we show that damage from ros, in the form of aldehyde / ketones (carbonyls), is also colocalized with mitochondrial membrane potential, and that more carbonyls are present in thimerosol treated nha. figure 3(a) shows control and 14.4 m thimerosal prepared using mt and hoechst, then treated with biotin - xx hydrazide carbonyl labeling, which was visualized using fitc - avidin. figure 3(a) shows control / thimerosal - treated cells where all three fluorophores have the same scale. we chose to present the images of a large ethylmercury - treated cell, somewhat unrepresentative of the population size distribution, as larger cells allow easier discrimination of the mitochondrial network. what is noticeable is that there is an increase in green ros damaged cell contents as a function of distance from the nucleus, in both images. the two boxes in figure 3(a) show areas we have chosen to highlight the correlation between mt and carbonyl signals. these areas are shown as single images of mt and carbonyls, and as a merged image in figure 3(b). in the control cells it is clear that the network of mitochondria is colocalized with some networks of carbonyls, but there are some well - defined structural networks which show evidence of oxidative stress that do not correlate with mitochondria. we observe a similar pattern in thimerosal - treated astrocytes ; there are quite clearly networks of mitochondria and carbonyls and structures that contain evidence of ros damage, but without polarized mitochondria. the two vertical lines in figure 3(a) indicate the position the fluorophores were interrogated to generate the fluorophore profiles shown in figure 3(c). again the three colors represent different fluorophores, mt (red), carbonyls (green) and hoechst (blue), and the black line is a simulation of the levels of ros damage generated by combining fractions of the mt and hoechst signals. in both samples the simulation is a poor match for the actual ros - induced signal, but control cells give a much poorer fit than do thimerosal - treated astrocytes. cross - correlations of ros versus our simulation of carbonyl levels generate slopes of 0.75 and 1.1 for controls and ethylmercury - treated cells, and prove r values of only 0.68 and of 0.86, respectively. therefore, although we observe that generation of ros is highly localized to mitochondria (figure 2), the cellular distribution of markers of ros damage is poorly localized with mitochondria. it therefore appears that proteins suffering ros damage, and so having carbonyls, are transported from the regions where they have been damaged. vesicles containing high levels of carbonyls are present in both the controls and treated cells ; however, in the cells that have been incubated with ethylmercury we observe a large number of small, 0.98, and thus superoxide generation leads to fenton / haber - weiss chemistry inside mitochondria. treatment of nha with ethylmercury leads to a 90% increase in superoxide generation per cell, even though under the same conditions we observe a 50% drop in mitochondrial membrane potential. deconvolution of superoxide and ho signals show that the presence of ethylmercury results in 60% more ho generation per superoxide. figures 5(b) and 5(c) show that superoxide generation correlates with nonnuclear, thus mtdna damage in the form of ddtunel 3oh dna ends and also of highly damaging blunt - ended dna breaks. the scaling of the two green channels in figures 5(b) and 5(c) differ by a factor of 4, and this indicates that there are on average 9 times as many 3oh ends as there are dna breaks in the control mitochondria. in figure 6 we present a bar plot showing the summarized changes we observe in nha following a one - hour exposure to 14.4 m thimerosal. five images were taken from three parallel experiments with an average of 44 18 individual astrocytes per visual field, and the error bars represent the sd of the population. ethylmercury causes a 50% collapse in membrane potential in astrocytes at 1 hour. accompanying this collapse in membrane potential we observe a significant increase in the levels of various ros. the internal mitochondrial steady state level of superoxide increases by 70% in treated cells and is matched by an increase in cellular hydrazine reactive carbonyls. using h2dcf - am we observe a 200% increase in steady state production of reactive oxidants, which from deconvolution we know to be mitochondrially generated (figure 2). mitochondrial dna, and not nuclear dna, is far more vulnerable to ethylmercury - induced damage. we observe a 240% increase in the levels of mitochondrial dna breaks, a 300% increase in 3oh dna nicks and 460% increase in the levels of oxidized bases / apurinic or apyrimidinic sites. as mtdna is localized within the mitochondrial matrix, it follows that this is the main site of ros generation. as fenton / haber - weiss chemistry is the primary generator of ho in biological systems, this finding suggests that ethylmercury is also increasing the levels of fenton metals, such as iron and copper, inside the astrocytes ' mitochondria. in the final pair of bars were shown the change in the levels of caspase-3 activity, measured by examining the cleavage of a z - devd - r110 substrate. we also find a five - fold increase in caspase-3 activity, indicating that this pathway has been activated in thimerosal - treated cells. we find that treatment of nha with ethylmercury causes an increase in mitochondrial superoxide generation as shown in figure 5. however, the increase in superoxide generation is identical to the increase in the levels of protein carbonyls as shown in figure 6. h2o2-induced formation of dichlorofluoresein from h2dcf - am is only approximately 20% greater than superoxide / carbonyl formation, which suggests that the loss of peroxidase function is not a feature of nha ethylmercury toxicity. this is consistent with the effect of methylmercury on hela cells, where mitochondrial matrix generation of superoxide was implicated as the most damaging ros. hela cells can be protected from methylmercury toxicity by upregulating mitochondrial mn - sod but not cytosolic cu / zn - sod, gpx or catalase. the majority of protein carbonyls in controls and in ethylmercury - treated nha are also colocalized with mitochondria, as shown in figure 2. the peroxides measured via h2dcf - am and protein carbonyls are derived from mitochondrial ros generation, as shown by colocalization of signals with the specific mitochondrial superoxide probe, mitosox, as shown in figure 5. these findings are in broad agreement with the known generation of ros on either side of the inner mitochondrial membrane in normal mitochondria and effects of methylmercury on rodent astrocytes observed by shanker and coworkers, as they too identified that mitochondria are the main production sites of increased superoxide generation. in addition to measuring peroxide / superoxide generation we also examined the formation of ho using the specific probe hpr and using the fpg - ddtunel assay which measures oxidized dna bases. the conversion of guanine to 8-hydroxyguanine and 8-hydroxyguanine to more oxidized dna hydantoin lesions, spiroiminodihydantoin and guanidinohydantoin, is generally believed to be due to ho or to fenton 's reagent (oxy - ferry ; fe = o) and oxy - cupryl cu = o). 8-hydroxyguanine, spiroiminodihydantoin, and guanidinohydantoin are substrates from the fpg - ddtunel assay [35, 42 ]. in figure 4 we demonstrated that while the levels of damaged nuclear dna and mtdna are very low in untreated cells, ethlymercury induces a large increase in oxidized mtdna lesions. the highest levels of damaged mtdna and protein carbonyls occur in structures that appear to be flocculated mitochondria. these grainy, oxidized, structures are not present as bright grains when viewed using mitotracker, when carbonyl rich grains can be identified, shown in figure 2. these same vermiform structures are also identified in treated cells labeled with specific probes for both superoxide and ho seen in figure 5. however, although we observe an increase in the levels of cytosolic (hence mitochondrial) blunt - ended breaks and nicks in figure 5, very high levels of dna breaks are not present in granular form. thus, these flocculated mitochondria represent a dead - end mitochondrial state and given the close correlation between fpg - ddtunel and caspase-3 upregulation shown in figure 6, it is reasonable to conclude these are mitochondria that have undergone the permeability transition, resulting in the release of proapoptotic proteins like cytochrome c and diablo from the intermembrane space, mitoposis, and the initiation of the caspase-3 apoptotic cascade. it has long been known that organomercury reacts with iron sulfur centers ; indeed methylmercury has been used as an aid to identify mercury adducts in iron - sulfur protein crystal structures for decades. the reaction of organomercury with iron sulfur centers in proteins such as aconitase results in loss of enzymatic function, the formation organomercury thioether adducts, and exposure to the bulks aqueous phase to redox active iron or release of free iron. it has been shown that, in mouse brain, the mitochondrial iron - sulfur complex rich enzyme nadh / quinone oxidoreductase (complex i) is highly sensitive to methylmercury. in a study by lebel. the potent iron - chelator, deferoxamine, protected rat cerebellum from ros following an injection of methylmercury. iron chelation also protected neurons from ros following in vitro exposure to methylmercury, but there was no evidence of deferoxamine - mercurial complex formation. methylmercury treatment of isolated mitochondria, from the cerebrum, the cerebellum and from liver, causes an inhibition of respiration and increased superoxide / hydrogen peroxide formation, mostly via damage to succinate dehydrogenase. the three iron - sulfur centers of succinate dehydrogenase on the matrix side of the inner mitochondrial membrane are the likely site of inhibition and possible iron release given that these clusters are sulphide / iron labile towards the thiophilic reagent, p - chloromercuribenzoate. based on the work reported here and by others, we suggest a mechanism for the toxicity of organomercury, which is shown in diagrammatic form in figure 7. as a lipophilic cation, ethylmercury will become concentrated inside astrocytes, with respect to the bulk extracellular phase, following the plasma membrane potential of 45 mv by a factor of 5.6 fold, and cytosolic ethlymercury will partition into the mitochondria by a factor of 1,000 fold, its accumulation driven by the approximate 180 mv mitochondrial membrane potential, figure 7(a). inside the mitochondria the ethylmercury will react with iron - sulfur centers, causing the release of iron into the mitochondrial matrix, figure 7(b). the role of ethlymercury in ros species formation and detoxification is shown in figure 7(c). the iron - sulfur centers of oxidoreductases (e.g., succinate dehydrogenase) when damaged by organomercury not only generate free iron, (figure 7(b) i), but also form intraenzyatic carbon radical species (figure 7(b) ii) that will react with molecular oxygen to give rise to superoxide, (figure 7(b) iii). superoxide can react with either free iron generation, the ferrous ion, or be dismutated into hydrogen peroxide by the mitochondrial mn - sod. ferrous ion, and hydrogen peroxide react to generate the highly oxidizing radical, hydroxyl radical, (figure 7(b) iv), an agent implicated in pathology and ageing [47, 48 ]. the levels of hydrogen peroxide would be generally lowered by the mitochondrial antioxidants, including glutathione - dependent selenol / thio - based peroxidases, like gpx and trxr. however, these enzymes are inhibited by organomercury indirectly by depletion of glutathione, (figure 7(b) v), and directly by the capping of the active site selenol / thiol by organomercury, (figure 7(b) vi). thus, the release of iron catalyzes fenton / haber - weiss chemistry leading to the formation of the highly oxidizing ho. ho has multiple targets, including sensors of the permeability transition complex and also mtdna. high levels of ho cause mitoposis, leading to cytochrome c release from the mitochondria and the initiation of apoptosis. we find that a consequence of ethylmercury exposure to nha is damage to the mitochondrial genome. we find an increase in dna nicks, breaks and most importantly, in the level of oxidized bases. mitochondria typically have 150 copies of mtdna and during aging or with exposure to environmental stressors, the number of error free copies of mtdna undergoes a decline. according to harman 's free radical / mitochondrial theory of aging [47, 48 ], the production of ros by mitochondria leads to mtdna damage and mutations. these in turn lead to progressive respiratory chain deficits, which result in yet more ros production, producing a positive feedback loop. the results of this study suggest that ethylmercury is a mitochondrial toxin in human astrocytes. we believe that this finding is important, particularly since the number of diseases in which mitochondrial dysfunction has been implicated are rapidly increasing.	thimerosal generates ethylmercury in aqueous solution and is widely used as preservative. we have investigated the toxicology of thimerosal in normal human astrocytes, paying particular attention to mitochondrial function and the generation of specific oxidants. we find that ethylmercury not only inhibits mitochondrial respiration leading to a drop in the steady state membrane potential, but also concurrent with these phenomena increases the formation of superoxide, hydrogen peroxide, and fenton / haber - weiss generated hydroxyl radical. these oxidants increase the levels of cellular aldehyde / ketones. additionally, we find a five - fold increase in the levels of oxidant damaged mitochondrial dna bases and increases in the levels of mtdna nicks and blunt - ended breaks. highly damaged mitochondria are characterized by having very low membrane potentials, increased superoxide / hydrogen peroxide production, and extensively damaged mtdna and proteins. these mitochondria appear to have undergone a permeability transition, an observation supported by the five - fold increase in caspase-3 activity observed after thimerosal treatment.
keratoconus is an ectatic corneal disease characterized by corneal protrusion, irregular astigmatism, and decreased visual acuity due to progressive corneal thinning. keratoconus leads to biomechanical changes in the cornea, and its definite cause is unknown. the biomechanical features of the cornea are determined by its collagen structure, composition, and collagen fibril bonds. corneal resistance is primarily determined by the three - dimensional configuration of the collagen lamellae. the corneal collagen structure and organization changes, the extracellular matrix alteration, and keratocyte apoptosis are the main factors in keratoconus that cause corneal biomechanical weakness [3, 4 ]. accommodation is the adjustment of the eye 's dioptric power to produce a clear retinal image when looking at objects at various distances. the ciliary muscles, zonular fibrils, lens capsule, and lens substance make up the functional accommodation unit. the contraction of the ciliary muscles during accommodation leads to relaxation of the zonular fibrils attached to the crystalline lens equator, resulting in a change in the shape and thickness of the lens [5, 7 ]. generally keratoconus is diagnosed at young age, and visual complaints in this age group stand out. functional accommodation unit of young people works full capacity, and we believe that tonic accommodation can not be ignored when we evaluated visual problems of keratoconus patients. for this purpose we investigated cycloplegic and noncycloplegic changes to get information about tonic accommodation of keratoconus patients. measurement of accommodative biometric changes during tonic accommodation in phakic eyes will provide information about the ways in which the eye responds to tonic accommodation. as far as we are aware, the only study on accommodation in keratoconus patients was conducted in 1990 by ohmi.. their study included a limited number of subjects and reported accommodative deficiency in keratoconus patients. our aim in this study was to obtain information about effect of tonic accommodation on keratometric and biometric measurements in keratoconus patients with and without cycloplegia by using an optical low coherence reflectometer (lenstar ls 900). this prospective study was conducted at the ophthalmology department of the inonu university faculty of medicine. the study was planned according to the helsinki declaration and after the permission of the local ethics committee was received (reference number : 2015/91). the study group (group 1) included one eye each from 48 subjects diagnosed with keratoconus, for a total of 48 eyes. the control group (group 2) consisted of the 52 eyes of 52 healthy age- and sex - matched subjects who had come to our clinic for refraction. this examination included refraction biomicroscopic cornea and anterior segment evaluation, fundus examination, and intraocular pressure measurement. the keratoconus diagnosis was made with the classic corneal biomicroscopic findings and the use of the collaborative longitudinal evaluation of keratoconus (clek) study criteria to evaluate the topographical findings [1, 9, 10 ]. the exclusion criteria were a history of corneal or intraocular surgery, a history of contact lens use, a history of ocular trauma, an ocular allergy or dry eye symptoms, the presence of a corneal scar, current pregnancy and/or nursing, and diabetes or a collagen tissue disease. refractive measurements of the patients were done with an auto kerato - refractometer (kr-8900 ; topcon co., tokyo, japan). keratometric and biometric measurements of the patients were done with the lenstar ls 900 (haag streit ag, koeniz, switzerland). cycloplegic refraction examination was performed 45 minutes after the last drop and repeat measurements were taken with the lenstar ls 900. we first focused and aligned the lenstar using the eye 's image on the computer monitor. the subject fixated on an internal fixation light, and we then asked the subject to blink before the measurements. we obtained 5 measurements (about 20 seconds each) per subject as recommended by the manufacturer. we recorded the flat meridian of the anterior corneal surface (k1), steep meridian of the anterior corneal surface (k2), spherical equivalent (se), lens thickness (lt), anterior chamber depth (acd), and axial length (al) results. the relative lens position (rlp) values were manually recorded following calculation with the following formula : (lt/2 + acd)/al. all rpl values in both groups conformed to a normal distribution (p > 0.05), while the other variables did not (p < 0.05). the variables that conformed to a normal distribution were presented as mean sd and the ones that did not as median (min - max). the wilcoxon t - test and paired t - test were used for intragroup comparisons, while student 's t - test and the mann the age distribution was 24 (1235) years in group 1 and 24 (1335) years in group 2. group 1 consisted of 25 female and 23 male subjects, and group 2 consisted of 27 female and 25 male subjects. the eye distribution was 23 right and 25 left eyes in group 1 and 26 right and 26 left eyes in group 2. comparisons of before cycloplegia versus after cycloplegia keratometric parameters, including se, lt, acd, al, and rlp, are presented in tables 1 and 2. the median k1 before cycloplegia and after cycloplegia in group 1 was 45.64 and 45.42 d, respectively, and the difference was statistically significant (p = 0.017). the median k1 in group 2 was 42.84 d before cycloplegia and 42.84 d after cycloplegia, and the difference was not significant (p = 0.363). the median k2 before cycloplegia and after cycloplegia in group 1 was 50.96 and 50.17 d, respectively, and the difference was significant (p = 0.001). the median k2 in group 2 was 44.49 d before cycloplegia and 44.56 d after cycloplegia and the difference was not significant (p = 0.660) (figure 1). there were significant differences in se, lt, acd (figure 2), and rlp (figure 3) between before cycloplegia and after cycloplegia in both group 1 (all p < 0.001) and group 2 (all p < 0.001). there were not statistically significant differences in al between before cycloplegia and after cycloplegia in either group 1 (p = 0.533) and group 2 (p = 0.529). a significant difference was present in terms of the k1, k2, se, acd, and rlp measurements in both the noncycloplegic and cycloplegic states in intergroup comparisons (all p < 0.001). no significant difference was present in terms of the lt or al in the noncycloplegic and cycloplegic states (p = 0.280, p = 0.357, resp., and p = 0.503, p = 0.506, resp.) as far as we are aware, our study is the first to evaluate the effects of cycloplegia on ocular biometry measurements and lens parameters in keratoconus patients. some studies have found corneal steepening with ciliary contraction and corneal flattening with cycloplegia [11, 12 ] while others have not found such an effect [13, 14 ]. studies on myopic eyes have revealed corneal flattening with cycloplegia [12, 15, 16 ]. some of the above studies have been performed in children and some on myopic eyes ; we therefore believe that the low ocular tissue rigidity in the patient groups of these studies is responsible for the results. as far as we are aware, there is no study on the effect of accommodation on the cornea in keratoconus patients. the biomechanically weak cornea in keratoconus patients suggests that it may be influenced by the contraction of the adjacent ciliary muscles. our results demonstrated that the k1 and k2 values showed a statistically significant decrease following cycloplegia in the keratoconus group, meaning that the cornea had become flatter. we believe that the relaxation in the ciliary muscles following cycloplegia could be responsible for the decrease in k1 and k2. we did not see such an effect in the control group, possibly because the cornea is biomechanically more stable. this change in corneal curvature in keratoconus patients due to the movement of ciliary muscles leads to a continuous change in k values and concomitant accommodation in various degrees during the day, causing constantly changing refractive values. we feel that this factor could be contributing to the constantly changing visual fluctuations in keratoconus patients and the difficulty in fitting contact lenses in some of these patients. the significant difference in se values both within and between groups indicates the presence of an effective accommodation in the patients. a blocked accommodation and the resultant decrease in lens power have historically been thought to be the reason for the postcycloplegia refractive changes. however, it is possible that the corneal power, acd, and al changes that are also present in this state influence the refractive state following cycloplegia. this can be explained as the acd changes are likely due to lens changes and the changes in corneal power can be calculated from the changes in k readings before and after cycloplegia. our results show that cycloplegia has no significant effect on the al in the keratoconus or the control group. there is no previous study on the effect of cycloplegia in keratoconus patients, but other studies on various patient groups stated that cycloplegia has no significant effect on the al [1719 ]. an increase in the acd in keratoconus patients is widely recognized when compared with the age - matched control subjects.. found that the acd showed a significant increase with an increase in the keratoconus stage and that this increase could be due to anterior protrusion of the cornea. our results also indicated that the acd values in keratoconus patients were significantly higher than in the control group. we found increased acd values in keratoconus patients when the accommodative effect was eliminated with cycloplegia, and the control group showed a similar change. the increased acd following cycloplegia is due to the backwards movement and flattening of the lens [15, 17 ]. the lack of any change in the al with cycloplegia supports the notion that the acd increase originates from the lens. these studies have reported an increase in the acd following the elimination of accommodation with cycloplegia [17, 19 ]. our results also indicate that such a relationship between accommodation and the acd continues in keratoconus patients. these changes are important, as the acd value is used in biometric formulae such as haigis and holladay 2 and for phakic intraocular lens (iol) insertion. studies that have measured acd changes following the stimulation of accommodation have found lower acd values with increasing accommodation [2124 ]. we also did not prefer accommodation stimulation in our study, and this may be one of our limitations. the increased lens thickness is the result of a forward advancement of the lens anterior surface, but there are various reports about the backward displacement of the lens posterior surface on lens thickness. monkey studies have shown that 75% of the increased lens thickness is due to anterior advancement of the anterior surface, while 25% is due to posterior displacement of the posterior surface [26, 27 ]. we found that noncycloplegic and cycloplegic lens thickness was similar between the keratoconus patients and the control group. ernst and hsu have reported a lens thickness of 3.92 0.42 mm in kc patients and 4.03 0.40 mm in the emmetrope group using immersion - ultrasound biometry, which is not a statistically significant difference. however, their lens thickness results were much higher than ours. we believe this difference is due to the age of their subjects because their subjects are older than our subjects. also this difference may be due to the measurement device used. another study comparing ultrasound biometry with the lenstar has reported results that support this theory. we found a decrease in the lens thickness following cycloplegia in the keratoconus group, and the control group also showed a decrease. the lack of a significant difference between the lens thicknesses of the keratoconus and control groups following cycloplegia also indicates a similar degree of response to cycloplegia in the two groups. it has been stated that the rlp can provide an idea as to the ciliary process location. our noncycloplegic rlp results indicated that the lens was 0.09 units more posterior in the kc group than in the control group. we believe this difference was due to the difference in the acd, as there was no change in the other variables (lt, al) used in the rlp calculation. the cycloplegic rlp measurement was found to increase similarly in both groups, indicating a posterior movement of the lens center. the difference between the cycloplegic and noncycloplegic rlp was similar in both groups, and so the posterior movement was similar in the two groups. the similar rlp change indicates similar functional responses to cycloplegia in both the keratoconus and control groups. a recently published study reported that the use of mini scleral lens causes impaired accommodative response in keratoconus patients. the authors speculated that it may be associated with microstructural changes in the posterior chamber caused by scleral lenses resting on the bulbar conjunctiva and sclera. we found that keratoconus patients had myopic refractive values, but physiological accommodation resulted in effective lens thicknesses and refractive results (a difference in the se) as in the control group. the similar lens thicknesses, thickness changes, and lens movement amounts indicate normal accommodative function in keratoconus patients. many studies on the change in biometric parameters and lens parameters with accommodation have used low resolution measurement devices or subjective methods, leading to a wide range of results. taking measurements from the other eye in such studies after stimulating accommodation makes the results suspect. we obtained measurements following the physiological accommodation stimulated by the device and then evaluated changes in the parameters of the same eye following cycloplegia in our study. our measurements were taken with a noncontact optical low coherence reflectometer that has proven accuracy and reliability [36, 37 ]. we believe our study could guide others in studies on the keratometric, biometric, and lenticular changes in keratoconus patients, as well as in obtaining more exact and desired results from the refractive surgery procedures (such as phakic iol insertion) that may be required in such patients. we also believe that this information may be useful for refractive examination and contact lens application, which are problematic in keratoconus patients. in conclusion, we detected a flattened corneal curvature, a positive shift in se, and an increase in the acd following cycloplegia in keratoconus patients. the decrease in lens thickness and backward movement of the lens were at significant levels. our results indicate that the crystalline lens is relatively more posterior in keratoconus patients, but the ciliary process offered a normal response to the accommodation - cycloplegia process.	purpose. to obtain information about effect of cycloplegia on keratometry and biometry in keratoconus. methods. 48 keratoconus (group 1) and 52 healthy subjects (group 2) were included in the study. we measured the flat meridian of the anterior corneal surface (k1), steep meridian of the anterior corneal surface (k2), lens thickness (lt), anterior chamber depth (acd), and axial length (al) using the lenstar ls 900 before and after cycloplegia. results. the median k1 in group 1 was 45.64 d before and 45.42 d after cycloplegia, and the difference was statistically significant (p 0.05). there were significant differences in se, lt, acd, and rlp between before and after cycloplegia in either group 1 (all p < 0.05) or group 2 (all p < 0.05). there were not statistically significant differences in al between before cycloplegia and after cycloplegia in either group 1 (p = 0.533) or group 2 (p = 0.529). conclusions. flattened corneal curvature and increase in acd following cycloplegia in keratoconus patients were detected.
albopictus mosquito was designated as permanently established in 6 southeast departments (administrative districts) in metropolitan france as follows : alpes - maritimes (2004), the 2 departments that comprise corsica, haute - corse (2006) and corse - du - sud (2007), var (2007), bouches - du - rhne (2009), and alpes - de - haute - provence (2010). entomological surveillance, based on data from the monitoring of ovitraps (3), enabled information on distribution of this mosquito to be updated within a few weeks. in addition to entomologic surveillance, since 2006, health authorities in france have implemented 3 complementary epidemiologic surveillance systems to identify new dengue and chikungunya infections : a notifiable diseases system that relies on mandatory notification, a laboratory - based surveillance system that operates at the national level, and an enhanced surveillance system, activated each year during may the notifiable diseases system requires mandatory notification by practitioners and biologists to collect clinical and biological information about recent symptomatic dengue cases. notifiable cases are defined by recent fever (within 7 days of medical examination) associated with pain (headache, arthralgia, myalgia, low back pain, or retro - orbital pain) and positive test results for 1 of the following biologic results indicative of dengue infection : reverse transcription pcr (rt - pcr), nonstructural protein 1 [ns1 ] antigenic test, or igm serologic analysis. notification is centralized by the french institute for public health surveillance for the purpose of epidemiologic analysis. it has been shown that mandatory notification systems lack completeness (of unknown magnitude) and representativeness, and overrepresent hospitalized case - patients (6), leading to unequal probability of being included in a sample (catchability) (7) of dengue cases. the laboratory - based national surveillance system is a voluntary network that comprises 6 specialized laboratories that monitor the trends of dengue diagnosis (8). dengue cases are defined by positive rt - pcr, ns1 or igm serologic test results, regardless of clinical signs. a survey during 2006 showed that this laboratory network aggregated 85% of the biologic diagnoses of dengue performed in metropolitan france (9). the enhanced surveillance system is implemented in the departments where the vector is established, during its period of activity from may 1november 30 each year. unlike mandatory notification, the basis of enhanced surveillance is the immediate reporting of all clinically suspected cases of dengue fever by practitioners to the regional health authorities. this facilitates accelerated biologic confirmation by the national reference laboratory for arboviruses and, when appropriate, the rapid implementation of local control measures such as perifocal vector control activities and active case finding (3,4). for example, during the period of vector activity, dengue cases obtained from mandatory notification or from the laboratory network are immediately reported by the french institute for public health surveillance to the regional officers supervising the enhanced surveillance system. a person with an imported case was defined as having traveled in an area where the dengue virus circulates within the previous 15 days before the onset of symptoms. as no substantial local transmission cycle occurred during the study period, all cases without patient information on travel history were considered imported cases. we used the capture recapture method to estimate the incidence of imported dengue cases in metropolitan france during 20072010. by identifying common cases from several systems, this method provides an estimate of the number of cases not captured by any data sources. consequently, the total number of cases and the capture probabilities of cases within each source can be estimated. to identify common cases, we checked the 3 data sources to find the patient s date of birth, sex, and postal code of residence or of the laboratory where blood samples were collected, and the date of blood sampling. first, 1 of the 3 data sources, the enhanced surveillance system, operates in a limited area during 7 months each year. second, the functional interrelationships between the 3 dengue surveillance systems appear to be limitations to the use of the standard 2-source capture recapture methods and need to be quantified. the odds ratio implemented with the capture recapture technique, developed by wittes., is an estimate of the increased probability of a dengue case being reported in a first source when it is also reported in a second source. to investigate the relationship between these sources, the analysis is restricted to cases identified by a third source. the dependence analysis of the sources was restricted to the year 2010 because of an insufficient number of dengue cases before this date. figure 2 shows the distribution among the 3 surveillance systems of the 199 biologically confirmed dengue cases detected during may 1november 30, 2010, in the 6 departments of southeast france where the mosquito was established. the enhanced surveillance system is highly dependent on both the mandatory notification and the laboratory network. in contrast, mandatory notification and the laboratory network are systems that do not seem to be substantially interdependent ; accordingly, we retained only these 2 reporting mechanisms to estimate the annual dengue incidence. distribution of 199 dengue cases among 3 surveillance systems, southeast france, may 1november 30, 2010. second, the capture recapture method was applied to these 2 national - level sources by using 2 estimators of population size : the chapman - seber (cs) and the chao estimates. the cs estimator (12,13) is a commonly used formula and is considered. this formula uses the hypotheses of independence between sources and equal catchability by each source. instead, it has been shown recently that chao s estimator, as formulated by brittain, is less biased than the cs estimator when there is dependence between sources or unequal catchability of cases (14). therefore, in this study, we gave priority to the results obtained by using chao s estimator. for both estimators, the 95% cis associated with population size estimates were calculated with the log - transformation suggested by burnham and used by chao (15,16). the corresponding completeness values and their 95% cis, obtained by using monte - carlo simulations, were calculated for mandatory notification, for the laboratory network, and for the combined surveillance systems. albopictus mosquito was established versus other areas and by period of the year (vector activity period versus the rest of the year) to take into account and reduce the potential inequality in catchability. to acquire an understanding of the general shape of the curve of monthly number of cases and to compare it with that obtained for the french west indies, we used the cs estimator with stratification according to geographic area, as many zero values precluded using the chao estimator. albopictus mosquito was designated as permanently established in 6 southeast departments (administrative districts) in metropolitan france as follows : alpes - maritimes (2004), the 2 departments that comprise corsica, haute - corse (2006) and corse - du - sud (2007), var (2007), bouches - du - rhne (2009), and alpes - de - haute - provence (2010). entomological surveillance, based on data from the monitoring of ovitraps (3), enabled information on distribution of this mosquito to be updated within a few weeks. in addition to entomologic surveillance, since 2006, health authorities in france have implemented 3 complementary epidemiologic surveillance systems to identify new dengue and chikungunya infections : a notifiable diseases system that relies on mandatory notification, a laboratory - based surveillance system that operates at the national level, and an enhanced surveillance system, activated each year during may the notifiable diseases system requires mandatory notification by practitioners and biologists to collect clinical and biological information about recent symptomatic dengue cases. notifiable cases are defined by recent fever (within 7 days of medical examination) associated with pain (headache, arthralgia, myalgia, low back pain, or retro - orbital pain) and positive test results for 1 of the following biologic results indicative of dengue infection : reverse transcription pcr (rt - pcr), nonstructural protein 1 [ns1 ] antigenic test, or igm serologic analysis. notification is centralized by the french institute for public health surveillance for the purpose of epidemiologic analysis. it has been shown that mandatory notification systems lack completeness (of unknown magnitude) and representativeness, and overrepresent hospitalized case - patients (6), leading to unequal probability of being included in a sample (catchability) (7) of dengue cases. the laboratory - based national surveillance system is a voluntary network that comprises 6 specialized laboratories that monitor the trends of dengue diagnosis (8). dengue cases are defined by positive rt - pcr, ns1 or igm serologic test results, regardless of clinical signs. a survey during 2006 showed that this laboratory network aggregated 85% of the biologic diagnoses of dengue performed in metropolitan france (9). the enhanced surveillance system is implemented in the departments where the vector is established, during its period of activity from may 1november 30 each year. unlike mandatory notification, the basis of enhanced surveillance is the immediate reporting of all clinically suspected cases of dengue fever by practitioners to the regional health authorities. this facilitates accelerated biologic confirmation by the national reference laboratory for arboviruses and, when appropriate, the rapid implementation of local control measures such as perifocal vector control activities and active case finding (3,4). for example, during the period of vector activity, dengue cases obtained from mandatory notification or from the laboratory network are immediately reported by the french institute for public health surveillance to the regional officers supervising the enhanced surveillance system. a person with an imported case was defined as having traveled in an area where the dengue virus circulates within the previous 15 days before the onset of symptoms. as no substantial local transmission cycle occurred during the study period, all cases without patient information on travel history were considered imported cases. we used the capture recapture method to estimate the incidence of imported dengue cases in metropolitan france during 20072010. by identifying common cases from several systems, this method provides an estimate of the number of cases not captured by any data sources. consequently, the total number of cases and the capture probabilities of cases within each source can be estimated. to identify common cases, we checked the 3 data sources to find the patient s date of birth, sex, and postal code of residence or of the laboratory where blood samples were collected, and the date of blood sampling. first, 1 of the 3 data sources, the enhanced surveillance system, operates in a limited area during 7 months each year. second, the functional interrelationships between the 3 dengue surveillance systems appear to be limitations to the use of the standard 2-source capture recapture methods and need to be quantified. the odds ratio implemented with the capture recapture technique, developed by wittes., is an estimate of the increased probability of a dengue case being reported in a first source when it is also reported in a second source. to investigate the relationship between these sources, the analysis is restricted to cases identified by a third source. the dependence analysis of the sources was restricted to the year 2010 because of an insufficient number of dengue cases before this date. figure 2 shows the distribution among the 3 surveillance systems of the 199 biologically confirmed dengue cases detected during may 1november 30, 2010, in the 6 departments of southeast france where the mosquito was established. the enhanced surveillance system is highly dependent on both the mandatory notification and the laboratory network. in contrast, mandatory notification and the laboratory network are systems that do not seem to be substantially interdependent ; accordingly, we retained only these 2 reporting mechanisms to estimate the annual dengue incidence. distribution of 199 dengue cases among 3 surveillance systems, southeast france, may 1november 30, 2010. second, the capture recapture method was applied to these 2 national - level sources by using 2 estimators of population size : the chapman - seber (cs) and the chao estimates. this formula uses the hypotheses of independence between sources and equal catchability by each source. instead, it has been shown recently that chao s estimator, as formulated by brittain, is less biased than the cs estimator when there is dependence between sources or unequal catchability of cases (14). therefore, in this study, we gave priority to the results obtained by using chao s estimator. for both estimators, the 95% cis associated with population size estimates were calculated with the log - transformation suggested by burnham and used by chao (15,16). the corresponding completeness values and their 95% cis, obtained by using monte - carlo simulations, were calculated for mandatory notification, for the laboratory network, and for the combined surveillance systems. albopictus mosquito was established versus other areas and by period of the year (vector activity period versus the rest of the year) to take into account and reduce the potential inequality in catchability. the total variance was calculated by adding the variance of each stratum. to acquire an understanding of the general shape of the curve of monthly number of cases and to compare it with that obtained for the french west indies, we used the cs estimator with stratification according to geographic area, as many zero values precluded using the chao estimator. during 20072010 in metropolitan france, 773 cases of dengue were reported by mandatory notification, 3,192 by the laboratory network, and 180 by the enhanced surveillance system. a total of 3,432 distinct cases were reported by the 3 sources, distributed throughout the french departments (figure 1). of these cases, 3,423 were reported by 1 of the 2 national level sources : mandatory notification or the laboratory network. the male : female sex ratio of the patients was 0.99:1, and the median age of the patients was 41 years. positive biologic diagnosis of dengue infection was made by igm serology (83%) and by an antigenic method (17%, rt - pcr : 13% and ns1 test : 4%). for 1,204 cases (35%), anamnestic and biologic information was sufficient to determine the viremic status of the patients in metropolitan france. among them, 48.5% were biologically viremic (positive rt - pcr or ns1 test), 47.8% were potentially viremic (the delay between the onset of symptoms and their subsequent return journey to france was 8,300 cases with laboratory evidence of recent dengue infection were imported into metropolitan france during 20072010. approximately 4,500 of them occurred in 2010 ; this high number was mainly attributed to epidemics of unusually intense and long duration in the french west indies (19). a correlation between a substantial number of imported cases of disease in metropolitan france and an intense epidemic in french overseas territories was observed with the dengue epidemic in the french west indies in 2001 (20) and with the chikungunya epidemic on reunion island in 2006 (21). a similar contemporary association was observed in germany, where an increase in imported dengue cases during 2002 was directly linked to an epidemic in brazil (22). albopictus mosquito was established, and > 90% of the infected persons may have been viremic. the increase in the number of imported cases in southeast france and the high vector density in some urban areas were major factors in the emergence of a local transmission cycle. two cases of autochthonous dengue fever were reported in the alpes - maritimes department in september 2010 (4). the capture recapture method which we applied to estimate the incidence of imported dengue cases is widely used in epidemiologic surveillance studies when several sources of data are available (23). several assumptions must be checked when using this method (23,24) to avoid biases. among these, independence between sources and equal catchability of cases by each source, which are interdependent concepts (7), are of great importance. when log - linear modeling is used, the availability of at least 3 sources ensures that the dependence between sources and the unequal catchability when estimating the true number of cases (24,25) can be taken into account. when only 2 sources of data are available, as is the case for dengue surveillance in metropolitan france at the national level, statistical alternatives are necessary. in our study, the alternative used was the chao estimator which relaxes the assumption that sources are independent, and provides more reliable estimates when the differences between the identifying probabilities of the 2 sources are large (26,27). in contrast, with increasing dependencies between sources, the commonly used cs estimator underestimates the true number of cases (14). furthermore, we reduced unequal catchability by stratifying the results by period of year and geographic area. other factors associated with unequal catchability should be taken into consideration, but it was not possible to do so comprehensively in our study. in particular, patients with severe disease may have had a higher probability of being captured by surveillance systems, which would lead to an underestimation of dengue infections (28). conversely, the risk for false positives when using igm detection for dengue diagnosis may have led to an overestimation of this number. as in other countries, the dengue surveillance systems in france aim to identify symptomatic patients. the proportion of asymptomatic or mildly symptomatic dengue infections fluctuates within endemo - epidemic countries (29) and equals 75% (29,30) of all dengue infections. our estimate, based on symptomatic cases, must therefore be multiplied by 4 to provide a total number of imported dengue cases in france : 33,000 cases for the 20072010 period, including 1,300 cases in the area where the competent vector was established and during its period of activity. however, the role of asymptomatic dengue cases in the transmission of the virus to the competent vector is still not well known. in other words, viremia could be lower and shorter in duration in asymptomatic persons than in their symptomatic counterparts (31) and it is not certain that viremia of asymptomatic or mildly symptomatic persons is sufficient to be infective. from a public health point of view completeness of the 2 national - level surveillance systems differed greatly : the variation was 10% for mandatory notification and 40% for the laboratory network. for both surveillance systems, completeness was much higher in the area where the competent vector was established, and during the vector s period of activity ; these factors represent the main target of the surveillance system. although this finding is comforting in terms of ensuring the implementation of measures aimed at limiting the risk for a local cycle transmission, additional efforts should be made to further increase completeness. the low completeness level of mandatory notification brings up the question of its real usefulness for the early detection of cases and the implementation of control measures, especially because it only marginally improves the completeness of the laboratory network. however, the mandatory notification system in france does monitor the trends of imported cases, including those from countries where no dengue surveillance systems are in place, as is the case in most countries in western africa (32). furthermore, the mandatory notification system collects additional clinical information (symptoms, severity) which can be analyzed according to the serotype. the laboratory network system is used for the monitoring of spatial and temporal trends of dengue fever among travelers, and the assessment of the risk for importation into metropolitan france, including areas where the vector is already established or is likely to become established. in our study, the observed geographic origin of imported cases can probably be simultaneously explained by the global epidemiology of dengue, traveler flows to france, and the practices used to request laboratory diagnosis. travelers returning from antilles during intense dengue epidemics were among those who introduced the greatest number of cases. such a situation may recur more frequently in the future as the epidemiology of dengue continues to become hyperendemic in these territories (19). furthermore, the number of imported cases may increase because of the expansion of dengue and the increase of travelers. it contributes to the detection of a few additional cases that were not detected by the other 2 surveillance systems. the enhanced surveillance system leads to faster detection of the great majority of cases in the areas where ae. moreover, this local enhanced surveillance supports the annual mobilization of professionals during the vector activity period, including health stakeholders in the areas where the vector is expanding.	imported dengue cases pose the public health risk for local circulation in european areas, especially southeast france, where the aedes mosquito is established. using a capture recapture method with chao s estimator, we estimated the annual incidence of dengue fever and the completeness of existing mandatory notification and laboratory network surveillance systems. during 20072010, > 8,300 cases with laboratory evidence of recent dengue infection were diagnosed. of these cases, 4,500 occurred in 2010, coinciding with intense epidemics in the french west indies. over this 4-year period, 327 cases occurred in southeast france during the vector activity period. of these, 234 cases occurred in 2010, most of them potentially viremic. completeness of the mandatory notification and laboratory network systems were 10% and 40%, respectively, but higher in southeast areas during may november (32% and 69%, respectively). dengue surveillance systems in france provide complementary information that is essential to the implementation of control measures.
the use of imaging to assess the choroidal layer is valuable in the diagnosis and monitoring of several ocular conditions such as central serous retinopathy [1, 2 ], polypoidal choroid vasculopathy, and high myopia [4, 5 ] ; abnormal choroidal thickness has been implicated in the pathophysiology of those conditions. among the many modalities (high - frequency ultrasound and magnetic resonance imaging) [6, 7 ] used to image the choroid, optical coherence tomography (oct), especially spectral domain - oct (sd - oct) devices, is increasingly being used for that purpose due to ease of use and higher reproducibility. newer imaging techniques like enhanced depth imaging (edi) and averaging of high - density line scans have improved visualization of the chorio - scleral interface. imaging can be especially helpful in diagnosing diseases that have asymmetrical or unilateral presentations, early in their course. however, some degree of nonpathologic asymmetry can exist between fellow eyes as demonstrated by previous studies on retinal nerve fiber layer and macular parameters [911 ]. recently a number of papers discussing choroidal thickness have emerged comparing normal values across different age groups, in addition to studies on choroidal changes in children with amblyopia [1214 ]. it is important to define the limits of normal interocular variations in choroidal thickness in order to differentiate pathologic from nonpathologic asymmetry. two studies have reported interocular differences in choroidal thickness in adult populations ; neither showing any statistically significant differences [8, 15 ]. in children, the limits of nonpathologic interocular asymmetry have not been explored although choroidal thickness measurements have been reported to be influenced by age [3, 10, 16 ]. in our cross - sectional study, we used the cirrus sd - oct to image healthy children between 6 and 17 years of age to determine whether any significant nonpathologic interocular variation in choroidal thickness exists. this was a cross - sectional study of healthy white and middle eastern children 6 to 17 years of age visiting the pediatric ophthalmology clinic at the american university of beirut medical center for refractive error evaluation over a year. this study was approved by the american university of beirut institutional review board. written parental informed consent was obtained from parents or legal guardians ; children and adolescent assent forms were also provided for children above 7 years of age. detailed demographic data were obtained during the clinic encounter. included in the study were subjects with no ocular abnormality except refractive error less than 7.00 diopters (of hyperopic or myopic spherical equivalent) and normal fundoscopy. excluded were patients with history of intraocular surgery, strabismus, anisometropia more than 1.50 diopters, amblyopia, retinal pathology, glaucoma, high intraocular pressure, optic nerve cup to disc ratio > 0.5, or asymmetry of > 0.2 between fellow eyes. patients with history of prematurity, neurologic, metabolic, or other systemic diseases were also excluded. all subjects received a comprehensive ophthalmologic exam by a pediatric ophthalmologist (christiane al - haddad). the visual acuity of each eye was recorded using the snellen chart ; intraocular pressure assessment, motility exam, stereoacuity testing, slit lamp exam, cycloplegic refraction, and dilated fundoscopy were performed. manual retinoscopy was performed 30 minutes after the last drop by a pediatric ophthalmologist (christiane al - haddad). this was also confirmed by automated refraction (canon rk - f1 autorefractor ; canon, tokyo, japan). axial length (al) measurements were obtained using the iol master (carl zeiss ag, oberkochen, germany). multiple al measurements (at least 3) were taken and an average value was recorded. cirrus hd - oct (carl zeiss, dublin, ca, usa) device was used to obtain high - definition images. internal fixation was used to ensure proper alignment of the eye and the best centration on the foveal center. sd - oct images through the fovea were obtained for each patient using an internal fixation target to measure choroidal thickness and perform initial comparisons between fellow eyes. both horizontal and vertical single line scans were performed first for the right eye then the left eye. multiple scans were performed and those with the best definition of the sclerochoroidal interface and centration on the fovea (as marked by the bright foveal reflex) were used for analysis. individual thicknesses were measured manually using the calipers available on the sd - oct machine by two separate masked observers. subfoveal choroidal thickness was measured as the perpendicular distance from the outer aspect of the retinal pigment epithelium (rpe) to the inner aspect of the sclera. in most of the images there was a hyperreflective line between the choroid and the sclera marking the sclerochoroidal interface. when the boundary was unclear in the foveal center, a smooth line joining the outer limits of the choroid vascular space was drawn to delineate the scleral layer ; the choroidal thickness would then be measured up to that limit. choroidal thickness was similarly measured at 1500 m nasally and temporally from the foveal center in horizontal scans and at 1500 m superiorly and inferiorly from the foveal center in vertical scans. data were entered in a microsoft excel sheet and then transferred to the statistical package for social sciences program (spss, version 19) for data management and analyses. descriptive statistics were reported as mean and standard deviation, as well as the 5th and 95th percentiles for continuous variables, and the number and percent for categorical ones. mean interocular differences for choroidal thicknesses were calculated by subtracting left eye parameters from right eye parameters, and their respective p values were reported using the paired sample t - test. mean differences were thus positive when right eyes had higher values and negative when left eyes had greater measurements. subjects were also divided into two age groups, those younger than 11 years (610 years) and those 11 years and older (1117 years), to explore any differences related to growth. correlation analyses were utilized to assess the effect of demographic characteristics (age, gender, spherical equivalent, and axial length) on the different thicknesses, where the correlation coefficient was reported along with the p value. we also computed the intraclass correlation coefficients (iccs) to measure agreement between the two observers. for each of the studied thicknesses, an average of the two observers ' measurements was computed and used for analysis. in addition, bonferroni correction was utilized when comparing choroidal thicknesses in right and left eyes because several statistical tests were performed on the same data set. scatter plots were used to explore the data and to analyze agreement among measurements between fellow eyes of the same subject. bland - altman plots for interocular choroidal thickness agreement were performed by calculating the difference between right and left eyes plotted against the mean thickness of the two eyes. horizontal dashed lines were drawn at the 95% limits of agreement, which were defined as the mean difference 1.96 standard deviations of the differences. twenty - two subjects were later excluded : 5 had decentered scans and 17 did not have a clear view of the choroidal layer boundaries. the final analysis included 91 subjects (182 eyes), 56 females and 35 males, with mean age of 10.40 3.17 years. no significant difference was noted when comparing spherical equivalent and axial length between right and left eyes. interobserver correlation was high with intraclass correlation coefficient (icc) values higher than 0.9 for all parameters studied (table 2). the central foveal thickness measured 318.38 53.55 m in right eyes and 311.59 50.72 m in left eyes (table 3). mean values of the choroidal thicknesses were calculated, as well as the median, 5th percentile, and 95th percentiles (table 3). interocular comparisons for the different thicknesses revealed no significant differences (p > 0.05). bland - altman plots also showed the differences to be scattered well within the limits of agreement between right and left eyes. this also applied when subjects were subgrouped into the younger (610 years, n = 49) and the older (1117 years, n = 42) age groups. the younger group consisted of 18 males and 31 females, while the older group included 17 males and 25 females, which was similar to the gender distribution in the group as a whole. when comparing choroidal thickness in different locations, the trend was for the central thickness to be highest followed by the inferior thickness, temporal thickness, superior thickness, and finally nasal thickness, but this was not statistically significant (tables 3 and 4). the younger age group tended to have thicker choroids at all locations, but this was not statistically significant (table 4). there was a trend for right eyes to have higher values in all thicknesses, except the superior thickness where the left eyes had the higher values both in all subjects and in the different age subgroups (table 5). correlation analysis was performed between the measured choroidal thicknesses and four parameters : gender, age, axial length, and spherical equivalent (table 6). most of the choroidal thickness values correlated positively with spherical equivalent and this was statistically significant. there was a trend for choroidal thickness to be negatively correlated with female gender, increasing age, and increasing axial length. it is noteworthy to mention that the patient baseline parameters were significantly correlated as expected : age being positively correlated with axial length (p = 0.04) but negatively correlated with spherical equivalent (p = 0.003) and axial length being negatively correlated with spherical equivalent (p = 0.01). this study aimed at examining interocular symmetry of macular choroidal thickness as measured by cirrus sd - oct in children between 6 and 17 years of age. we did not detect statistically significant interocular differences at any of the studied locations (subfoveal, nasal, temporal, superior, and inferior) ; this was also consistent when analyzing the younger and older subgroups separately. when comparing the different thicknesses, there was a trend for the central subfoveal thickness to be highest followed by the inferior, temporal, superior, and finally nasal thickness. a few previous studies in the literature have documented the presence of nonpathologic interocular differences in oct parameters in children < 16 years [911 ]. these reports mainly studied retinal nerve fiber layer and macular parameters showing consistent significant differences. with the introduction of new oct upgrades, the choroidal layer is now better visualized and although there is no commercially available software to measure it, manual measurements are feasible with the high definition images obtained using sd - oct. several reports in the literature have shown that choroidal measurements are reproducible in children and many have reported normal choroidal thickness values in healthy children at different locations [1621 ]. these pediatric studies either used randomly one eye for analysis or grouped right and left eyes together. the current study is the first to explore interocular differences in choroidal thickness in children. interobserver agreement in choroidal thickness measurements was high in our study with icc above 0.9 for all locations measured (table 2) ; this is in agreement with the similar study by chen. ; cho. also recorded high interobserver iccs in a repeatability study of choroidal thickness oct measurements ; however, repeatability was lower in cases with thicker choroids. although choroidal thickness has to be measured manually, the high definition images provided by sd - oct do provide clear boundaries for the layer in question ; using gray scale images and enhancing the contrast additionally facilitates measurements. standard deviations (sds) and ranges for the different thicknesses were in agreement with other authors ' works [1620 ]. our sds for the mean values ranged between 50 and 63 m ; other authors reported sds ranging between 60 and 85 m [1821, 23 ]. even higher sd values were recorded when measuring choroidal thicknesses in adults, reaching up to 103 m. interocular symmetry in choroidal thickness has been studied in one report in adults ; no similar report is available in the pediatric population. chen. found no significant differences between right and left eyes in 50 adult subjects, with a median (range) interocular difference (right minus left eye) in foveal choroidal thickness of 21 (0.38, 135.13) m and mean (sd) difference of 1.0 (42) m. spaide., in a feasibility study of choroidal thickness measurements on oct, described a high correlation between right and left eyes in 17 adult subjects with an absolute mean interocular difference of 17 m. in our study, we computed interocular differences in choroidal thicknesses in 91 healthy children ; median (range) difference for the subfoveal thickness was 9 (87, 117) m and mean (sd) was 6.79 (43.63) m. although the interocular difference was small, the range between minimum and maximum values was large (tables 4 and 5) ; this was similarly the case in the work by chen. choroidal thickness is also known to vary by age and diurnal rhythm, which could contribute to the wide range of values observed. although differences were nonsignificant in our population, right eyes tended to have higher values for all thicknesses except the superior value. chen. also found a trend for higher values in right eyes except in the temporal thickness. we have no explanation for this trend, but studies on rnfl and macular thickness symmetry have demonstrated significantly thicker nasal, temporal, and inferior rnfl quadrants in right eyes and thicker outer nasal and outer inferior macular quadrants in left eyes. comparing the choroidal thicknesses in the various locations studied, no significant difference was noted. there was a trend for subfoveal thickness to be highest, followed by the inferior, temporal, superior, and nasal thickness. this was observed both in right and in left eyes and in both the younger and older age groups. similarly measured choroidal thickness at different locations but at 3 mm from the fovea, while in the current study a distance of 1500 m was chosen. this distance was selected in conformity with our earlier study on interocular symmetry in retinal parameters. the choroidal thickness profile described by chen. was slightly different from ours with the foveal thickness being highest, followed by the superior, inferior, temporal, and then nasal thickness. again there is no consensus in the literature on a macular choroidal thickness pattern, but pediatric studies have agreed that the thinnest measurements were obtained nasally [16, 17, 20, 24, 25 ] and inferonasally [17, 19 ]. measurements in other locations did not show the same consistency. in the correlation analysis, only spherical equivalent had a significant positive correlation with choroidal thickness in our study (table 6).. demonstrated that the choroidal layer was thinner (on average 50 m) at all locations in myopic children when compared to nonmyopes. others have observed varying correlations with age [17, 19, 23 ], axial length [16, 18, 19 ], and body weight [16, 17 ]. although we observed a negative correlation with age and axial length, it did not reach statistical significance. have shown that children less than 10 years of age exhibited thicker choroids than older children [4, 20 ]. this was the rationale for the cut - off at 10 years in our age subgroups. we did not however notice any discrepancies between the 2 age groups with respect to interocular differences or thickness profiles. read. however showed that in early years (46 years) the choroid was thinner than in later years in childhood more recent papers have shown variable correlations with age with some showing negative correlations and others none [12, 13, 26 ]. chen. described a weak correlation with axial length only in subjects with increased axial length measurements ; refractive error data was not available. our subjects belonged to a group of mostly uniform axial length (table 1) and we purposely excluded children with high refractive errors to avoid any outliers. disparities in correlations of choroidal thickness with axial length among different studies could be attributed to the use of different oct devices, varying axial length distributions in subjects, and varying distances from the foveal center where paramacular choroidal thickness measurements were performed. limitations of this study include the relatively small sample size and the uniform ethnic group (white middle eastern). we also did not account for the possible diurnal variation in choroidal thickness ; our measurements were taken at various times during the day. measurements were performed manually ; currently no commercial software exists to accomplish this more objectively. another limitation is the fact that 22 subjects could not be included in the study because the image quality made it difficult to perform measurements. thicker choroids may have caused this, which might bias the results towards subjects with thinner choroids. in conclusion, foveal choroidal thickness measurements in children obtained using sd - oct were reliable and showed consistent interocular symmetry at all locations studied. this information is valuable both to the clinician while interpreting any observed asymmetry in the choroidal layer on oct scans and to the researcher while selecting one eye in studies using oct.	objective. to report interocular differences in choroidal thickness in children using spectral domain optical coherence tomography (sd - oct) and correlate findings with biometric data. methods. this observational cross - sectional study included 91 (182 eyes) healthy children aged 6 to 17 years with no ocular abnormality except refractive error. after a comprehensive eye exam and axial length measurement, high definition macular scans were performed using sd - oct. two observers manually measured the choroidal thickness at the foveal center and at 1500 m nasally, temporally, inferiorly, and superiorly. interocular differences were computed ; correlations with age, gender, refractive error, and axial length were performed. results. mean age was 10.40 3.17 years ; mean axial length and refractive error values were similar between fellow eyes. there was excellent correlation between the two observers ' measurements. no significant interocular differences were observed at any location. there was only a trend for right eyes to have higher values in all thicknesses, except the superior thickness. most of the choroidal thickness measurements correlated positively with spherical equivalent but not with axial length, age, or gender. conclusion. choroidal thickness measurements in children as performed using sd - oct revealed a high level of interobserver agreement and consistent interocular symmetry. values correlated positively with spherical equivalent refraction.
the purpose of dentistry is to respond to the patients needs and desires, in other words to restore function, comfort, esthetics, speech, health and enhance the quality of life. dental implants are alloplastic materials which are surgically inserted into residual alveolar bone primarily as a prosthetic foundation. implant dentistry, especially dental implant prosthodontics is unique which is capable to achieve the mentioned goal with predictable success regardless of the atrophy, disease or injury of the stomatognathic system. initially, implant licensing was limited to prosthodontists and oral surgeons and then periodontists ; however, predictable outcomes, more patients demands and willingness of general dentists for surgical training for restorative training soon resulted in a flexible approach to training. from the date of introducing dental implant for the treatment of edentulous patients by branemark, it approximately took two decades for dental implant to be introduced into the undergraduate dental curriculum and after that the american college of implantology presented curriculum guidelines for predoctoral implant dentistry in 1990. in 1974, 33% and in 1989, 73% of us dental schools had predoctoral dental implant programs [47 ]. weintraub reported that 86% of dental schools participating in their survey had implemented a predoctoral implant dentistry program and a similar level of interest was noted by lim in 2005. there have been additional publications comparing dental school education in europe and the united states [710 ]. there has been some discussion about dental school education in the middle east [1113 ] and africa. there is also some discussion whether it is necessary for the predoctoral students to take an implant dentistry in developing countries. there have not been any recently published surveys assessing the trends in predoctoral implant education in dental schools of the developed and developing countries. one of the research priorities in junction with the mentioned issues is to investigate the condition of dental implant education in the predoctoral curriculum. what are the reasons for training or not training this subject ? is dental implant training in the predoctoral level elective or mandatory ? therefore, the purpose of this survey was to determine the current status of implant dentistry course in predoctoral curriculum of dental schools in different countries around the world in 2008. this descriptive survey was conducted by removable prosthodontics department of islamic azad dental school in 2008. one - hundred thirty five dental schools from 223 dental schools were randomly selected provided by the ministry of science and technology of islamic republics of iran representing 73 developing and developed countries in the world. between one and five dental schools per country and eleven dental schools from the united states were randomly selected and a questionnaire was electronically mailed to the dean of the selected dental schools. we requested the dean to forward the questionnaires to an individual in their schools who would be able to respond most accurately to the questions. following the first correspondence, 34 dental schools responded ; subsequently, the second and third correspondences were sent requesting their response emphasizing on the importance and impact of this evaluation on the modification of predoctoral curricular of removable prosthodontics department of our schools in the sphere of implant dentistry. following these emails, 58 other schools responded which totally comprised 92 schools, representing 49 countries, yielding a response rate of 62%. the survey contained seventeen questions including, having the dental implant program in the predoctoral implant dentistry curriculum or not, reason for the absence of a program, topics, lecture hours, availability on the internet, required or recommended and the name of the textbooks, the responsible department, clinical and laboratory course, observation of patients and laboratory work, students - to - faculty ratio, prosthodontics faculty teaching predoctoral implant dentistry course, implant systems used, type of restorations treated by predoctoral students and whether predoctoral students actually treat implant patients. the design of questions was similar to some previous surveys which were conducted in north america and european dental schools and were approved by six faculty members from two other tehran dental schools. of the 92 dental schools that responded to the questionnaire, 79 (86%) indicated that they have a predoctoral implant dentistry curriculum. of these, 35 (44%) were from north america and europe ; and 44 (56%) were from asia, africa and south america. the remaining 13 (14%) schools did not have such a curriculum. of these, four (31%) schools were from north america and europe, and nine (69%) were from asia, africa and south america. the faculty - to- student ratio for the implant dentistry course ; 23 (29%) of the dental schools reported a ratio of 1:15, 21 (26.5%) reported a ratio of 1:15 to 1:10, 18 (23%) reported a ratio of 1:10 to 1:5 and 17 (21.5%) reported a ratio of 1:5. the results for the year implant dentistry was first offered are summarized in table 2. twenty of the 35 responding schools from north america and europe first offered predoctoral implant dentistry curriculum prior to 2000, four of the 44 responding schools from asia, africa and south america first offered the similar curriculum prior to 2000. the answers to which department is responsible for implant education to the predoctoral students is summarized in table 3. thirty one dental schools (39%) reported fewer than 10 lecture hours for their predoctoral implant dentistry course ; 23 (29%) reported 11 to 20 hours ; 12 (15%) reported 21 to 30 hours ; 5 (6%) reported 31 to 40 hours ; and 8 (10%) did not respond to this question. regarding lecture availability on the internet ; 10 schools (13%) reported that their lectures are available on the internet whilst 62 schools (78%) reported that their lectures are not available on the internet and seven schools did not respond to this question. thirty one schools (39%) reported that they require textbook(s) for their implant course, 37 schools (47%) reported they do not require textbook(s) for their implant dentistry course and 11 schools (14%) did not respond to this question. of the 31 schools that required a textbook, 11 (35%) used mish s dental implant prosthesis and contemporary implant dentistry, five (16%) used spiekermann s implantology, three (9.6%) used branemark s tissue integrated prosthesis osseointegration in implant dentistry, three (9.6%) used worthlington s osseointegration in dentistry, two (6.5%) used zarb s prosthodontic treatment for edentulous patient and seven (23%) used others textbooks. thirty nine (49%) dental schools reported that they involve predoctoral students in surgical and prosthodontics clinical procedures mainly as an observer, in 11 schools (14%), pre - doctoral students surgically placed implants and in 26 (33%) out of the 79 dental schools, the students only restore implant cases. the most common restoration was the single tooth implant followed by implant - supported over - denture and implant - supported fixed partial denture. thirty two dental schools (40%) offered a laboratory course in conjunction with the pre - doctoral dental implant program. the results to which implant system(s) was utilized surgically and restoratively in the pre - doctoral program are summarized in table 6. in three decades, dentistry has changed tremendously due to the incorporation of dental implant in increasing the options of dental treatment and patient satisfaction, and it has changed the perspective of dental therapy with respect to the long term successful outcomes. implant dentistry has become a vital part of prosthodontics for partially and completely edentulous patients and hence education of postgraduate and also undergraduate students in the world. the survey showed that the number of dental schools in the world teaching the predoctoral implant dentistry curricula has increased. this number of dental schools which offer lectures has doubled from 2000 to the present time. however, most of these dental schools are in asia, south america and africa. the majority of schools in north america and europe started offering the course before 2000 [49 ]. these studies were conducted primarily in developed countries with the similar socio - economic level ; however, the aim of this study was to survey the pre - doctoral implant course in different countries with various socio - economical levels. in some countries, although dental schools did not offer a separate predoctoral implant course, they incorporated implant - related lectures into prosthodontics, surgical and periodontal courses. the primary reasons for not having predoctoral implant dentistry curriculum in dental schools around the world are similar, as shown in table i. it seems that these dental schools may face challenge in order to incorporate new dental curricula into the existing program. it should be mentioned that to overcome this challenge these dental schools may profit from other dental schools that have implemented predoctoral implant dentistry curriculum for their students education, because there is some evidence that has emphasized on the fact that dental students should have a background in implant dentistry which allows them to use this treatment option in their daily practice. there is no meaningful difference for which department is main responsible for implant education to the predoctoral students and there is a trend towards multidisciplinary participations. one of the valuable and important results of this research was the fact that dental implant education in the predoctoral level is a multidisciplinary approach and there is not an independent implantology department. the predoctoral dental implant course was offered to senior students in the world and similar results were drawn from other studies, in other words the prerequisites for dental implant education were subjects such as prosthodontics, maxillofacial surgery and periodontology. the topics (core contents) presented in this course are different among dental schools, the core contents are more comprehensive in schools in which the onset year was prior to 2000. the required textbooks used most widely were mish s dental implant prosthesis and contemporary implant dentistry and spiekermann s implantology in order from high to low. mish s dental implant prosthesis first edition, perhaps due to its step - by - step guidance, is the most popular textbook among different dental schools. thirty - nine (49%) dental schools reported that they involve predoctoral students in surgical and prosthodontics clinical procedures, in which they are mainly observer. of 92 respondent dental schools from 135 world schools, 32 dental schools (40%) offered a preclinical laboratory course in their program. these findings appear to be consistent with seckinger and afsharzand s surveys. it should be mentioned that those dental schools which already offered an implant course prior to 2000, are pioneers in the performance of implant related preclinical laboratory work by students. in this survey, only one dental school in asia, south america and africa had a pre - clinical course for dental students prior to 2000 ; however this has increased to six dental schools after 2000. since the reason for not offering a preclinical course, was not asked in this study it is one of the limitations of this survey. iti (straumann, waldendurg, switzerland) (in 25% of the instances) and nobel biocare (yorba linda, ca) (in 21% of the instances) implant systems were used most frequently, both in surgical and restorative phases of treatment. weintraub showed that nobel biocare was used most frequently in us dental schools. however, afsharzand presented that iti and nobel biocare were used mostly in europe. one probable reason may be that some implant manufacturers have agreed to provide implants, abutments, instruments and demonstration kits for hands - on applications free of charge to undergraduate dental schools. the companies should be complimented for their generosity and more importantly, for their strategic awareness of the future of dental implant therapy, especially in the developing countries for overcoming the challenges which are faced. a survey of 92 respondent dental schools from 135 world schools demonstrated that 79 (85%) dental schools include predoctoral implant dentistry in their educational program. the percent of hands - on course is higher in north america and europe than in asia, south america and africa. the course content, ratio of faculty to students, lecture hours, required textbooks and onset year of predoctoral implant curriculum, implant systems used both surgically and prosthetically are different among countries. there is not a separate implantology department rather than the departments of prosthodontics, oral surgery and periodontics frequently, assuming the administrative roles for predoctoral implant dentistry programs. few countries and iranian dental schools do not have comprehensive curriculum guidelines for implant dentistry. these countries face some challenge, for example lack of an adequately trained faculty, not enough time in an already overfilled dental school curriculum, and scarce financial resources. today, many specialists have been trained ; thus, it should not be an issue. other challenge is unwillingness to modify the traditional aspects of dental school education curriculum in order to accommodate dental implant educational in pre - doctoral curriculum.	objective : predoctoral dental implant education is included in dental school teaching curricula in most of the developed and some developing countries ; however, it was not introduced into undergraduate curriculum of some countries and iranian dental schools.our purpose was to investigate the status of the predoctoral dental implant education of dental schools in the world.materials and methods : one hundred - thirty five dental schools were randomly selected representing 62 countries divided into two regions. the first region included north america and europe, and the second region comprised of asia, south america and africa. a questionnaire including onset year, lecture hours, lectures available on the internet, required textbooks, department jurisdictions, the year of dental school the course was offered, clinical and laboratory courses, implant systems used surgically and in restorative phase, and type of restorations treated by predoctoral students was mailed electronically to the predoctoral implant dentistry directors.results:ninety-two (68%) schools responded ; of which 79 (86%) incorporated implant dentistry in their predoctoral teaching curricula, 39 (49%) offered surgical and prosthodontics courses in which students mainly observe. of these 39 dental schools, 28 (71%) and 11 (29%) dental schools are from the first and second region, respectively.conclusion:a large percentage of responding schools included implant education in the predoctoral dental curriculum. onset year of course, topics included in lecture series, lecture hours, faculty to student ratio and practical course vary among schools. fifty percent of responding dental schools including iranian dental schools do not have curriculum guidelines for predoctoral implant dentistry.
initial mri showed decreased volume in the left hippocampus without signal abnormality and abnormal t2 signal in the right hippocampus without volume loss. wada test scores were 5/5 using the left hemisphere (right carotid injection) and 3/5 using the right hemisphere. at the age of 21, she underwent invasive eeg monitoring, which captured 10 seizures arising from the right hippocampus and 1 from the left. convulsive seizures resolved with surgery, but both complex partial seizures and nonepileptic events continued. (a) section stained with luxol fast blue for orientation (original magnification 20). (b) a neun immunohistochemical preparation reveals very few brown - stained neurons in ca4. (c) immunohistochemistry for astrocytes using glial fibrillary acidic protein shows gliosis (original magnification 20). (d) a dysplastic neuron expressing neurofilament protein from ca4 (original magnification 400). at the age of 24, she began to have gait difficulties with mild leg stiffness. two years later left arm dysmetria and gait ataxia become prominent, consistent with cerebellar dysfunction. her anti - gad level was found to be greater than 300 u / ml (radioimmunoassay, normal range 01.1). csf studies showed oligoclonal bands and an igg / total protein ratio of 0.01 but were otherwise normal. she is now on regular iv immunoglobulin (ivig) infusions with mild improvement in gait. immunohistochemical studies using antibodies for t cells (cd3), t cell subsets (cd4 and cd8), b lymphocytes (cd20), plasma cells (cd138), and granzyme were performed and did not reveal lymphocytes or plasma cells in the parenchyma or subarachnoid space. (a) section stained with luxol fast blue for orientation ; ca4 is seen in the center between the blades of the fascia dentata (original magnification 20). (d) high - power (original magnification 200) view of the fascia dentata showing dispersion and migration of neurons stained with neun. five months after surgery, he began to report stiffness and spasms of the back. on examination at that time, he was found to have increased muscle tone in the lower extremities and myoclonic jerks. findings later included gaze - evoked diplopia and respiratory dysfunction due to stiffness of the respiratory musculature. on laboratory testing, serum anti - gad level was found to be greater than 300 u / ml. approximately 3 years after surgery, he developed a cerebellar syndrome with speech changes, diplopia, dysmetria, and ataxia. initial mri showed decreased volume in the left hippocampus without signal abnormality and abnormal t2 signal in the right hippocampus without volume loss. wada test scores were 5/5 using the left hemisphere (right carotid injection) and 3/5 using the right hemisphere. at the age of 21, she underwent invasive eeg monitoring, which captured 10 seizures arising from the right hippocampus and 1 from the left. convulsive seizures resolved with surgery, but both complex partial seizures and nonepileptic events continued. (a) section stained with luxol fast blue for orientation (original magnification 20). (b) a neun immunohistochemical preparation reveals very few brown - stained neurons in ca4. (c) immunohistochemistry for astrocytes using glial fibrillary acidic protein shows gliosis (original magnification 20). (d) a dysplastic neuron expressing neurofilament protein from ca4 (original magnification 400). at the age of 24, she began to have gait difficulties with mild leg stiffness. two years later left arm dysmetria and gait ataxia become prominent, consistent with cerebellar dysfunction. her anti - gad level was found to be greater than 300 u / ml (radioimmunoassay, normal range 01.1). csf studies showed oligoclonal bands and an igg / total protein ratio of 0.01 but were otherwise normal. she is now on regular iv immunoglobulin (ivig) infusions with mild improvement in gait. immunohistochemical studies using antibodies for t cells (cd3), t cell subsets (cd4 and cd8), b lymphocytes (cd20), plasma cells (cd138), and granzyme were performed and did not reveal lymphocytes or plasma cells in the parenchyma or subarachnoid space. (a) section stained with luxol fast blue for orientation ; ca4 is seen in the center between the blades of the fascia dentata (original magnification 20). ((d) high - power (original magnification 200) view of the fascia dentata showing dispersion and migration of neurons stained with neun. five months after surgery, he began to report stiffness and spasms of the back. on examination at that time, he was found to have increased muscle tone in the lower extremities and myoclonic jerks. findings later included gaze - evoked diplopia and respiratory dysfunction due to stiffness of the respiratory musculature. on laboratory testing, serum anti - gad level was found to be greater than 300 u / ml. approximately 3 years after surgery, he developed a cerebellar syndrome with speech changes, diplopia, dysmetria, and ataxia. we describe 2 patients who initially presented with medically refractory tle due to ilae type 3 hs, were found to have high levels of anti - gad antibodies, and later developed sps and cerebellar syndromes. one of the patients remains free of seizures after temporal lobectomy ; the other continues to have seizures, the frequency of which has not clearly been altered by immune modulatory treatment. however, in both patients, sps and cerebellar syndromes did respond to immune modulatory treatment. high gad antibody levels were found in 2.8% of patients with epilepsy in a recent study that included patients with both well - controlled and uncontrolled epilepsy. ilae type 3 hs has been described in a small number of specimens from other patients with presumed autoimmune - related epilepsy, including a patient with suspected anti - gad related limbic encephalitis. bien. described pathologic specimens from 3 patients with anti - gad encephalitis in which there was no immunoglobulin or complement deposition, arguing against an antibody - mediated mechanism. on the other hand, markers of a t cell mediated cytotoxic process, while present, reflected less - intense activation than that seen in other forms of autoimmune encephalitis due to intracellular antigens. the rarity of ilae type 3 hs and the overlap between the pathologic findings in these cases and previously published descriptions of specimens from patients with anti - gad related epilepsy strongly suggest that anti - gad antibodies underlie these patients ' epilepsy and sps with cerebellar ataxia. the cases described here contribute to our understanding of the phenomenon of anti - gad related epilepsy in 2 ways. first, they illustrate the evolution of anti - gad related neurologic syndromes from epilepsy to other branches of the condition, which has been less well - described than transitions and overlaps between sps and cerebellar syndromes. second, there are few descriptions of pathologic specimens from patients with tle and anti - gad antibodies. these 2 cases strengthen the hypothesis of an association between anti - gad antibodies and some cases of ilae type 3 hs. they were obtained late in the course of the development of the epilepsy, leaving open the possibility of cytotoxic processes. the other neurologic manifestations of anti - gad related autoimmunity, however, developed after these specimens were obtained. similar to the cases described by bien., the presence of oligoclonal bands in case 1 and anti - thyroid and anti - parietal antibodies in case 2 suggests a possible role for antibody - mediated mechanisms. if an antibody - mediated process is relevant in these cases, it is unclear whether anti - gad antibodies themselves or coexisting antibodies to an unknown antigen are pathogenic. although a small sample, these cases suggest that ilae type 3 hs may be immunologically mediated in some cases and that tle due to ilae type 3 hs may be one component of a broader anti - gad related neurologic syndrome in some patients. if there is a unifying explanation of the mechanisms of anti - gad related neuropathology, these cases suggest that hypotheses will have to accommodate the development of hs, sps, and cerebellar dysfunction in the same patient. patrick lasala proofread and edited the document for content, particularly regarding the neurosurgical details. graber serves on a scientific advisory board for novacure, inc. and a data safety monitoring board for stemedica, inc., was formerly on a speakers ' bureau for biogen idec, and received research support from diogenix, novartis, biogen, and radiation therapy oncology group.	objective : to describe the neuropathologic findings and clinical course of 2 patients who underwent temporal lobectomy for medically refractive epilepsy and were later found to have high anti glutamic acid decarboxylase (gad) concentrations.methods:small case series.results:neuropathologic examination of both patients revealed international league against epilepsy (ilae) type 3 hippocampal sclerosis. following surgery, both developed signs and symptoms of stiff person syndrome and later cerebellar ataxia. laboratory studies demonstrated high concentrations of anti - gad antibodies in both patients.conclusions:these cases suggest that ilae type 3 hippocampal sclerosis may be immunologically related to and may exist as part of a broader anti - gad related neurologic syndrome in some instances.
in january 2012, a previously unknown severe disease was observed in pigs on several farms in northern and eastern china. in shandong province, > 80,000 pigs were infected. the affected pigs had high fever (> 40.5c), anorexia, coughing, respiratory distress, conjunctival serous and mucinous secretion, and posterior paralysis. the disease was first observed in older pigs and spread within 23 days to younger pigs. viscera (e.g., lung, kidney, heart, liver, and spleen) and serum samples were collected from dead pigs from different provinces. pathologic examination showed the most striking gross lesions were consolidated in the lungs (figure 1, panel a), with edema and hemorrhage (figure 1, panel b). in addition, foci of yellow - white necrosis were observed in the kidneys of some dead pigs (figure 1, panel c). c) kidney with many yellow - white necrotic spots (arrows). to gain insight into the etiologic agent of the disease, we conducted extensive and systematic diagnostic testing, including pcr, elisa, viral isolation, immunohistochemical staining, and standard bacteriologic culture, to evaluate the specimens. a specific prv monoclonal antibody was used, and immunopositive cells were observed in infected tissue (technical appendix figure 1, panels a, b). the pcr for inocula samples showed that many glycoprotein (g) genes of prv could be amplified by using the primers specific to the unique gene fragments (technical appendix figure 2). the prv ge - elisa assays (idexx laboratories, westbrook, me, usa) indicated that serum samples from the sick pigs contained antibodies against wild - type, virulent prv glycoprotein e but not against the vaccine strain (table). our results also ruled out other suspected agents, such as classical swine fever, african swine fever, porcine reproductive and respiratory syndrome virus, and some bacterial infections. the 3 isolates found here are referred to as nvdc - prv - bj, nvdc - prv - heb, and nvdc - prv - sd, according to the provinces from which they were isolated. alignment the partial sequences of glycoprotein (g) c (a), gd (b), and ge (c) genes of pseudorabies virus at the nucleotide level. s / n ratio was calculated as a ratio of the absorbance of a well with serum to the absorbance of a control well without serum. the pigs vaccinated with attenuated live prv vaccines still showed clinical signs of prv during the outbreak. to confirm the presence of prv in these herds, 15 pigs were vaccinated with the current vaccine strain and then challenged with the nvdc - prv - sd strain 21 days after vaccination. the results indicated that the vaccinated pigs had not been given completely effective protection against infection and exhibited obvious clinical signs of disease similar to the typical symptoms observed in the field, suggesting that the virulence of the newly isolated prv strains had changed. to better understand the genetic relationship of the 3 prv isolates found here to other prv isolates, we amplified and sequenced the 15 major genes of the 3 isolates (technical appendix table 1). compared with other prv isolates (technical appendix table 2), there was a 21-nt insertion from nucleotide positions 185205 in the gc gene, similar to sa215, bj, dg, ea, fa, and p - prv strains (figure 2, panel a), which shared 100% nt identity with each other. the gd gene, like isolates ea, fa, sa215, and yangsan, had 6 nt at positions 801806 and shared 99.4%99.8% identity with each other (figure 2, panel b). there were 2 insertions of 6 discontinuous nucleotides each at positions 138140 and 14721474 in the ge gene (figure 2, panel c). the rest of the genes from the 3 isolates had no nucleotide insertions or deletion in common with the other prv isolates. we further analyzed the relationship of these 3 isolates with other prv isolates using a phylogenetic tree based on the ge gene ; the 3 isolates formed a tightly clustered branch and were very closely related to other isolates from asia (technical appendix figure 3). we describe and analyzed a major outbreak of prv in pigs in china. in these herds, all pigs had been vaccinated against prv 3 times a year, at approximately the same time as each other. the disease spread to > 6 provinces (including autonomous cities and regions) and caused considerable economic losses among local pig farms. prv has been recognized as a source of infection for pigs and continues to circulate globally among herds (9). in particular, pigs receiving attenuated live prv vaccines showed typical clinical symptoms, which suggest that these isolates might have evolved new types of pathogenicity. even though the prv isolates showed nucleotide insertions in the gc, gd, and ge genes, the molecular mechanisms underlying their high pathogenesis have yet to be elucidated. the origin of these lethal isolates within china is still obscure, although phylogenetic trees based on the ge gene here indicated that the 3 isolates are more closely related to the asia prv isolates, especially the china isolates, than to isolates from other countries. because the virulence and origin of prv is thought to be associated with multiple factors, whether such insertions are related to the virulence of prv remains an issue and requires further investigation. in summary, our study indicates that an outbreak of disease in pigs in china, which was of unprecedented scale, was caused by prv infection. pseudorabies virus target genes and primers ; sequences obtained from genbank used in this study ; immunohistochemical staining of lung and brain specimens of clinically sick pigs ; pcr of infected tissues with specific primers for pseudorabies virus glycoprotein d specific primers ; and phylogenetic trees of glycoprotein e sequence.	in 2012, an unprecedented large - scale outbreak of disease in pigs in china caused great economic losses to the swine industry. isolates from pseudorabies virus epidemics in swine herds were characterized. evidence confirmed that the pathogenic pseudorabies virus was the etiologic agent of this epidemic.
a 26-year - old female was referred to our department of oral and maxillofacial surgery with a chief complaint of deviated nose and smaller nostril on the right side. past surgical history revealed that she had undergone cleft lip repair at the age of 3 years. extra oral examination findings were nasal pyramid was tilted to the cleft side, the columella was short on the cleft side and deviated towards the noncleft side, the lateral crux of the lower lateral cartilage was displaced lower and to the cleft side resulting in excessive skin on the dome of lower lateral cartilage on the cleft side, nasal tip was asymmetrical, nostril on the cleft side was small and the entire nostril was retropositioned [figure 1a c ]. columella short on the cleft side and deviated towards the noncleft side ; the lateral crux of the lower lateral cartilage was displaced lower and to the cleft side intraoral examination revealed a class i molar relation on the right and left the side with generalized spacing of upper and lower anteriors and a missing left upper lateral incisor with an alveolar cleft [figure 2 ]. (lateral incisor absent) a definitive open rhinoplasty was planned for the cleft nasal deformity. the surgery was carried out under general anesthesia through orotracheal intubation. an inverted - v transcolumellar incision with bilateral marginal incisions was made, the lower lateral cartilage and septal cartilage were exposed [figure 3a ], the cartilaginous septum was separated from the maxillary crest and secured to the midline using 50 pds suture, deviated portions of the septum were then removed and the excess cartilage is preserved for graft in future use [figure 3b ], while preserving an adequate dorsal and caudal strut. the tip projection and symmetry was increased with a strut graft in the columella in a pocket between medial crura, medial advancement of lower lateral cartilage was done [figure 4 ]. alar hooding was improved and alar collapse was prevented by placing a spreader graft [figure 5 ]. (a) inverted - v transcolumellar inscision with marginal extention. exposure of nasal septum and lower lateral cartilatge. (b) harvested excess septal cartilage columellar strut graft to support the columella spreader graft is placed to prevent alar collapse postoperatively the healing was satisfactory with no evidence of infection or wound dehiscence. the symmetry of the nasal tip was achieved, nostril on the cleft side was of the same size as the noncleft side, there was good projection of the nasal dorsum and nasal tip postoperatively [figure 6 ]. the results were stable with no evidence of relapse with a period of follow - up of 1-year. unilateral cleft lip nasal deformity is the result of undue forces to which the nasal tip is subjected as a consequence of uncoupling of the palatal shelves. the drawbacks of primary rhinoplasty are relapse and growth impairment, however the studies by mccomb and salyer stated that nasal cartilage growth is unaffected by nasal surgery but in our case a definitive rhinoplasty was done. the goals of definitive rhinoplasty include creation of symmetry, definition of nasal base and tip, relief of nasal obstruction and management of nasal scarring and webbing. one of the cleft lip nasal deformities is the alar columellar web deformity in which excess skin overhangs the superomedial side of the nostril. tajima and maruyama described a reverse u incision with a suture suspension of repositioned cleft lower lateral cartilage. nakajima. modified the technique by adding a z - plasty in the lateral nasal vestibule. cronin and denkler reported on v - yplasty of nasal mucosa left by the advancement of the lateral crus. they proposed that the vestibular lining of the lateral crus remain attached to add circulation and support especially when scoring of the cartilage is needed. maeda. reported using a bilateral reverse u incision in combination with cronins method. nakajima and yoshimura used a bilateral reverse u incision combined with a short banked forked flap in bilateral cleft lip nasal deformity. a traditional inverted - v transcolumellar incision advocated by potter and merville and popularized by goodman was used in this case and there was good visibility and access to the displaced structures with this incision. some stress the need for lateral to medial advancement and lateral release of the lateral crus, others prefer a medial to lateral rotation, however, only a few use total detachment of the lateral crus from the vestibular skin. some surgeons mobilize the lateral crus together with vestibular skin to create a medially based chondrocutaneous flap. a lateral to medial advancement was preferred in our case. different techniques are described to repair the lateral vestibular wall following medial advancement of the crus. tajima and maruyama state that there is no redundant skin whereas gubisch uses a surplus of vestibular skin to close a gap between two flaps at the lateral nostril. millard excises not only part of the lateral crus but also the skin excess from the vestibular fold. most authors report a defect in the lateral wall and suggest direct approximation or standard flaps such as z - plasty or v - y advancement. published a series of cases where composite conchal cartilage was used in various forms to repair columellar deficit, to form nasal tubercle and nostril sill in cleft lip nasal deformity patients and concluded that conchal cartilage achieved symmetric and functional results. turkaslan. described a technique to place a cartilage graft at the posterior dome area after the release of cleft side ala from vestibular mucosa and skin to elevate the ala depression and tip projection. septal cartilage was used in presented case and was satisfactory and a second donor site morbidity was avoided. flores published a retrospective review where a combination of dibbell and tajima was used and concluded that there was a statistically significant decrease in alar base width, increase in columellar height and nostril height on the affected side. there are very few studies to assess the outcomes of cleft lip rhinoplasty in terms of patients satisfaction. evaluated esthetic and respiratory outcome with active change in nasal airflow and hydraulic diameter could be found and hence stated that while esthetic improvement of the cleft nose is a goal, which can be achieved in regularity nasal respiration still seems to be a challenge in cleft patients. analysis of respiratory outcome was not done in the case presented though the patient was satisfactory about the aesthetic result. there are very few studies to assess the outcomes of cleft lip rhinoplasty in terms of patients satisfaction. evaluated esthetic and respiratory outcome with active change in nasal airflow and hydraulic diameter could be found and hence stated that while esthetic improvement of the cleft nose is a goal, which can be achieved in regularity nasal respiration still seems to be a challenge in cleft patients. analysis of respiratory outcome was not done in the case presented though the patient was satisfactory about the aesthetic result. sandor and ylikontiola in their study on 35 patients with cleft nasal deformity treated by external rhinoplasty evaluated for satisfaction and perception of outcomes. the highest improvement was seen for the tip, followed by alar position, dorsum and symmetry of nostrils. leipzig in a similar study described high satisfaction rates by patients undergoing surgery for cleft nasal deformities. correction of the deformity requires a thorough and in detail understanding of the anatomy of cleft pathology and accurate assessment of both esthetic and functional impairments. open external approach rhinoplasty allows maximum exposure for structural graft placement to improve tip projection, definition, support, and function.	it is universally accepted that correction of cleft lip nose deformity remains a formidable challenge for any cleft surgeon. the nose is a prominent part of the face, and hence a masterly executed cleft lip repair directs the beholders eyes from the deformed lip to the deformed nose. a deformed nose that results from unilateral cleft of the lip and palate is likened to a tent whose one side is depressed. many investigators believe that the deformity of the nose is produced by the malpositioning of essentially normal structures, on the other hand some cleft surgeons contend that it is the intrinsic defects in nasal structures that result in cleft nasal deformity. depressed and hypoplastic bony scaffolding is the most important aspect of cleft nose deformity and addressing this aspect of cleft nose deformity is the secret of success of a perfect secondary rhinoplasty. controversy still exists on timing of cleft nasal deformity. proponents of delayed nasal repair suggest that altering the cartilages in early nasal repair at the time of lip repair would complicate future corrective nasal surgeries if the primary repair would prove unsatisfactory. the correction of nasal deformity could be performed with closed or open technique. this paper highlights one such challenging unilateral cleft lip nasal deformity in a adult patient treated by secondary rhinoplasty by open technique.
primary breast sarcomas are rare and comprise 5 cm (7 cm 6.5 cm) and modified radical mastectomy with axillary dissection was done, but no adjuvant therapy was given. to rule out possibility of secondary sarcoma of breast, patient was thoroughly checked and relevant investigations were done. however, no other primary tumor was detected. besides, patient had no previous history of radiotherapy or chemotherapy especially for primary breast carcinoma. all authors have assisted in preparation of the first draft of the manuscript or revising it critically for important intellectual content. all authors have read and approved the content of the manuscript and confirmed the accuracy or integrity of any part of the work.	primary sarcoma of the breast is very rare and constitutes less than 1% of all breast cancers. herein, we report a case of pleomorphic rhabdomyosarcoma (prms) of the right breast in a 49-year - old female patient presented with a mass (7 cm 6.5 cm). mammography and ultrasonography suspected a malignant lesion and a diagnosis of poorly differentiated carcinoma was made on fine needle aspiration cytology. modified radical mastectomy was carried out. histopathological examination revealed a high grade stromal sarcoma with rhabdoid morphology and multinucleated tumor giant cells. the tumor cells were strongly positive for desmin, vimentin and myo d1 focally. the tumor cells were immunonegative for cytokeratin, epithelial membrane antigen (ema), cd34, cd45, sma, s100, cd68 and hmb45. a final diagnosis of prms was rendered. surgical margins were free and no metastasis was seen in axillary lymph nodes. neither post - operative radiotherapy nor adjuvant chemotherapy was given and the patient has remained disease free 12 months post - operatively.
approximately 150,000 patients are diagnosed with colorectal cancer (crc) in the us each year and one third of patients die annually from this disease 1. nearly 8,000 patients are diagnosed with synchronous peritoneal surface malignancy (psm) each year 2. hence, psm is a frequent manifestation in the natural history of colorectal cancer (crc), and is associated with marked deterioration in quality of life (qol) and limited survival. despite advances in early detection of crc, peritoneal disease spread continues to be a common mode of disease progression, as 8% of patients with crc have synchronous peritoneal spread of disease at time of primary resection, and up to 25% of patients with recurrent colorectal cancer have disease confined to the peritoneal cavity 3.in about 30% of patients, psm remains the primary reason for death in patients with crc 4. confinement of disease to the peritoneal surface, in the absence of systemic metastasis, serves as the basis for surgical eradication of disease through aggressive multi - modality therapy consisting of cytoreductive surgery (crs) plus hyperthermic intra - peritoneal chemotherapy (hipec). overall survival in patients with psm and crc treated with systemic 5-flourouracil (5-fu) alone is dismal, with mean survival of only 5 to 7 months 4, 5. overall survival is even worse (~3 months) inpatients, who suffer from psm due to crc and have simultaneous bowel obstruction 6. aretrospective pooled analysis of over 2,000 study subjects enrolled in north central cancer treatment group (ncctg) phase iii trials n9741 and n9841 demonstrated a median survival of 12.7 months in patients with peritoneal spread of crc 7. treatment - adjusted analysis showed that patients with psm and crc have worse survival compared to patients with advanced crc and distant metastases without psm (p=0.0006). oncological outcome in patients with psm of crc origin treated by second line5-fu + leucovorin + oxaliplatin (folfox) was not significantly improved. this is in contradistinction to reported median survival rates between 19 and 63 months in experienced centers using crs + hipec to treat psm of crc origin, underscoring the advantage of this multi - modality therapeutic approach 8 - 11. although folfox was found to be superior to irinotecan + 5-fu / leucovorin (ifl) and irinotecan + oxaliplatin (irox) as first line therapy in the pooled analysis of the ncctg trials by franko. systemic multi - drug chemotherapy has not altered the natural history of peritoneal carcinomatosis, as patients suffer disease progression and functional deterioration due to visceral obstruction, malignant ascites and cancer cachexia over a limited median survival 2. the multi - modality therapy approach, using systemic chemotherapy plus aggressive crs and hipec has shown clearly promising results. the randomized controlled trial (rct) of verwaal. demonstrated a statistically significant survival advantage for this therapeutic approach 9. this was an rct comparing crs + hipec versus 5-fu - based systemic chemotherapy, which demonstrated a significant os benefit with median survival of 22 months versus 12 months and 2-year survival of 44% versus 22%, respectively 9, 10. other studies have shown that patients with peritoneal carcinomatosis from crc treated with chemotherapy alone havea median survival of 5 to 13 months, whereas those treated with crs + hipec for early peritoneal carcinomatosis from crc have reported median survival in the range of 48 - 63 months and 5-year survival of ~50%. completeness of cytoreduction and limited disease are associated with longer survival, yet early peritoneal carcinomatosis is undetectable by conventional imaging. a major problem in patients with psm of crc origin is that approximately 50% will have recurrence of disease after treatment 12, 13. second look laparotomy to identify patients that could potentially benefit from second crs + hipec, at a time when none of the patients had clinical or radiographic evidence of recurrent psm 14 - 16. the rationale for performing second look laparotomy is to identify psm of crc origin early in the natural history of the disease in patients at high risk of having disease recurrence, when tumor volume would be below an important threshold peritoneal cancer index (pci) of 20, where the oncological impact of crs + hipec conducted with curative intent is greatest 17. the concept of second look operation in cancer treatment is more than 60years old, and was most likely established in 1948, when first described by wangensteen 18 - 20. second look approach in a range of tumor entities for a number of oncological or surgical purposes : 1. second look laparotomy went through a renaissance for the treatment of psm around the year 2000 12 - 16, 18, 19, 21 - 37. the early reports and history of second look operation have been described by sugarbaker 12. although, second look laparotomy can successfully identify early psm, its role and potential benefit has been specifically recommend to patients with high risk of developing peritoneal carcinomatosis 12. first and foremost, surgical exploration and consecutive crs and hipec are of major potential value if psm can be identified early and complete cytoreduction can be achieved. it is anticipated that as data from different centers of excellence investigating second laparotomy accumulates important insights will be gained, particularly defining an optimal time point following operation for the primary crc when a second laparotomy should be performed. importantly, clinical and pathological parameters, and biomarkers will be identified that inform risk prediction models and clinical decision support tools to individualize risk stratification and treatment intervention. this precision medicine approach will in turn contribute to the development of novel targeted diagnostic and therapeutic approaches in the future. historical data suggests that patients presenting with perforated primary tumor, bleeding or obstructing lesions requiring emergent surgical intervention, those with regional nodal metastases, synchronous peritoneal carcinomatosis, and/or ovarian metastasesare at high risk of subsequent peritoneal carcinomatosis 12. esquivel and sugarbaker investigated studied patients with psm of appendiceal origin during a 12-year period 14. of 321 patients, 98 (31%) underwent a second - look procedure (laparotomy, and crs + hipec when indicated). the overall 5-year survival rate in the 98/321patients was 74% compared to 68% in 223/321 patients. these data suggest that there is a sub - population of patients that can benefit from second look laparotomy and crs + hipec. those patients, who presented with symptomatic bowel obstruction or had a high peritoneal surface tumor burden, however, had significantly worse survival. as patients with large tumor burden (pci > 20) have questionable benefit from crs + hipec, the role of second look operation following cytoreduction in these patients with high - volume disease is questionable 17. in the study from france by elias., 29 patients without clinical or radiographic evidence of psm recurrence underwent second look operation 13 months after resection of the primary colon cancer 23. more than 50% (16/29) of these patients had gross morphological evidence of psm recurrence during second look laparotomy, corresponding to 10 patients with initial peritoneal carcinomatosis, three patients with synchronous ovarian metastases, and three patients with a perforated primary tumor. eight out of these 16 patients (50%) that underwent second look laparotomy remained disease - free, four had psm relapse (25%) and four (25%)developed isolated visceral metastases after a median post - second look follow - up of 27 months. this study emphasizes the fact that psm in crc patients often does not have clinically- or radiographically - apparent signs until disease has reached an advanced stage with high tumor burden. importantly, at - risk patients are those having synchronous macroscopic psm, synchronous ovarian metastases and perforated primary tumor. the french group published recently their experience with 41 patients over a 10-year time - period with a median follow up of 30 months 15 replicating their initial published results. investigated 41 patients with psm of crc origin that underwent second look operation, who had no clinical or radiographic signs of peritoneal surface disease recurrence at the time of second look. fifty - six percent (23/41) of the asymptomatic patients with negative diagnostic imaging were found to have peritoneal surface malignancy which was treated with crs + hipec at time of second look laparotomy, and 18 (44%) underwent complete cytoreduction 16. the reported grade 3/4 morbidity rate was 9.7% with a 5-year overall survival rate of 90%, and a 5-year disease - free survival rate of 44%. peritoneal recurrences occurred in 6 of the 23 (26%) found to have psm at second look laparotomy and treated with crs+hipec, and in one of 18 (6%) patients who had no evidence of psm at time of second look exploration. this study emphasizes the fact that over 50% of at - risk patients with treated primary crc will have gross manifestations of psm at time of second look laparotomy, and that surgical intervention with crs + hipec is associated with favorable oncological outcomes. sugarbaker emphasized clinical parameters that may support surgical decision making in at - risk patients and published suggested guidelines for second look laparotomy and crs + hipec with curative intent 12, 13. to that end, he pointed out that the major focus must be complete cytoreduction (r0 resection, cc-0/1resection). he further argued that the limited extent of peritoneal surface tumor burden found at time of second look laparotomy increases likelihood of complete resection of grossly apparent disease, and optimizes the chances of favorably impacting prognosis. patients considered to be at high - risk of having psm at second look laparotomy are those : 1. presenting with perforated primary crc, or primary tumors causing bleeding or obstruction necessitating emergent surgical intervention ; 2 : with regional nodal metastases ; 3. with synchronous peritoneal carcinomatosis ; and/or, 4. with ovarian metastases. the aggressive approach of a so - called programmed second look operation is thought to be most clinically relevant in selected at - risk patients at a time when peritoneal tumor burden is low. the optimal timing of second look laparotomy following incident operation for the primary tumor remains to be defined. what we know thus far is that approximately 50% of patients at - risk for psm will have psm identified at time of second look laparotomy performed within approximately a year of primary operation 14, 16, 23. this preliminary data based on incidence and extent of psm at time of second exploration suggest that the preferred time point for performing second look laparotomy may be between 6 - 12 months of primary operation. in 2010 the nci initiated a rct (nct01095523) for second look laparotomy to address the question : does mandatory second look laparotomy with crs + hipec prolong overall survival compared to the standard of care in patients who are at high risk for developing peritoneal carcinomatosis from crc ? 32 a number of risk factors have been identified that are associated with early recurrence of psm in crc. positive peritoneal cytology, visible evidence of peritoneal carcinomatosis at time of initial operation, perforated primary tumor, and synchronous ovarian metastasis are among these risk factors. in addition, emergently treated bleeding or obstructed primary tumors or mucinous t3 stage or t4 stage tumors with adjacent organ involvement, as well as margin positive resection are high risk factors, which may be responsible for early recurrence of psm of crc origin 12. careful patient selection is an important component in the decision making process for second look laparotomy. medical co - morbidities (heart, lung, kidney, low performance status), poor nutritional status, 3 or more liver metastases are relative contraindications for second look laparotomy. a recent study, however, suggested that morbidity is not significantly increased when performing hepatobiliary surgery during crs and hipec 38. potential contraindications depending on severity of presentation include obesity, and acute abdomen with ileus 3. bucci. stated in 1994 that the serum tumor marker cea (carcinoembryonic antigen) -directed second - look surgery is not a reliable or cost - effective approach 22. an elevated serum cea today prompts cross sectional and functional diagnostic imaging, which as discussed previously, is typically unrevealing for psm of crc origin. the above studies provide an evidence basis to forego imaging and proceed straight to second look surgery inpatients at high risk for psm due to crc. other factors that should be considered in selecting patients for second look laparotomy include tumor differentiation, and subtype (e.g. signet ring cell histology), synchronous versus metachronous psm. it is well established that signet ring cell adenocarcinoma is a virulent form of gastrointestinal malignancy that is associated with a dismal prognosis ; second look operation in patients with this tumor subtype is unlikely to be of significant benefit. therefore, it is useful to determine the histopathological subtype of tumor in high risk patients by use of a precise immunohistochemical (ihc) approach 39. a locally advanced primary tumor stage category reflects depth of tumor invasion with high likelihood of lymphatic dissemination, and it has been shown previously that more advanced t - stage primary tumors such as stage ii and iii t-4 tumors have 25% incidence of peritoneal spread as the only metastatic site of disease 40. the tumor - node - metastasis (tnm) staging classification is an evolving document based on advances in evidence - based medicine. in the future other disease - specific aspects may be taken into account as well ; for example, recent morphometric analysis revealed that the peritoneal elastic lamina was a useful marker of level of tumor invasion, and powerful indicator of prognosis in crc 41. interestingly it has been demonstrated that the angiogenic phenotype may differ between intestinal and diffuse type gastric cancer 42 - 44. translating these data to crc signet ring cell adenocarcinoma, mucinous adenocarcinoma and perhaps metastatic phenotype may also be of value in risk stratification for psm. lymphatic as well as vascular invasion and peri - neural infiltration are clinically relevant parameters amongst the various types of gastrointestinal cancers in terms of tumor biology and prognosis. the risk benefit ratio for second look operation in a patient with extensive lymphovascular invasion histopathologically would not favor this approach based on the low likelihood of benefit. tumor heterogeneity remains a complex phenomenon that pertains to the primary tumor as well as the individual patient with advanced disease given the observed genotypic heterogeneity evident between the primary tumor and different metastatic sites 45. recently showed that although patients with psm and ascites may not be cured by a multi - modality approach, these patients may derive palliative benefit from laparoscopic heated intra - peritoneal chemotherapy 46 ; randomized trials are not available and are needed 47. multi - modality treatment approaches in both the neoadjuvant and adjuvant setting is an important part of the clinical pathway in gastrointestinal malignancy. defining the value of adding systemic therapy after crs + hipec, particularly after performing a second look laparotomy is an oncological challenge. another goal of the future will be the assessment of treatment response, specifically selecting patients for multi - modality therapy based on reliable indicators of tumor biology 48. however, careful consideration ought to be given to the fact that 35 years after the (only) experiment, which lead to the world health organization classification of tumor response to treatment, no additional studies have been conducted or proposed 49. targeted therapy directed by tumor specific testing at either the gene or protein expression is another basis for ' next generation ' or precision cancer therapy. despite rapid advances in our understanding of targeted therapy for gi cancers, the durable impact on cancer survival has been marginal overall. targeted anti - angiogenic therapy, for instance, can also have unpredictable results and be a ' double - edged sword ' for while vascular endothelial growth factor (vegf) inhibitors reduce primary tumor growth, they may simultaneously promote tumor growth and metastatic spread through other mechanisms 50 - 52. minimal residual disease may reside within these adhesions ; therefore, complete adhesiolysis is imperative during any kind of second look cancer operation and crs + hipec with curative intent. the fact that tumor cells become sequestered in avascular intra - peritoneal adhesions explains partly the resistance to, and ineffectiveness of systemic chemotherapy alone for peritoneal carcinomatosis. the presence of an anatomic barrier, the peritoneal - plasma partition, has enabled administration of high local concentrations of chemotherapy at the peritoneal surface, far in excess of systemically administered agents when drug delivery is intra - peritoneal as opposed to intravenous. high molecular weight agents such as mitomycin c (334 da), and oxaliplatin (397 da), for example, have favorable pharmacokinetic profiles (auc, peritoneal fluid relative to plasma : mitomycin c, 75:1 ; oxaliplatin, 25:1) permitting dose - dense intra - peritoneal therapy over prolonged periods with rapid tissue concentration (in residual tumor deposits and peritoneum), but limited systemic absorption or toxicity. this particular therapeutic approach addresses the problem of systemic chemotherapy resistance and, with its reduced systemic toxicity, provides distinct pharmacological advantage over systemic drug delivery. this makes completeness of cytoreduction imperative, which is conducted with the intent to eradicate macroscopic deposits of tumor and optimize the efficacy of hyperthermic chemotherapy in obliterating minimal residual disease. optimal therapeutic synergy is achieved when intra - peritoneal heated chemotherapy is administered immediately following maximal cytoreduction, thereby minimizing trapping of viable peritoneal tumors cells in fibrin and post - operative adhesions, and maximizing kill of tumor cells shed during resection. adhesions are lysed during cytoreduction to facilitate uniform distribution of heated chemotherapeutic perfusate, maximize direct contact of drug with residual peritoneal tumor cells, and harness the advantage of thermo - chemotherapeutic anti - tumor synergism. bristow. showed that using a hyaluronate - carboxymethylcellulose (ha - cmc) barrier for prevention of pelvic adhesion formation in women undergoing primary cytoreductive surgery with radical oophorectomy for locally advanced epithelial cancer is associated with a significant reduction in the extent and density of pelvic adhesion 53. it might also be possible that, in the future, a patient who undergoes primary resection of a colon cancer and is found to have high - risk features, such as local psm, that the operation is completed, ha - cmc applied to the viscera prior to abdominal closure, and the patient subsequently referred to a center of excellence in psm for subsequent second look operation and cytoreductive surgery + hipec. knowles and wu recently published a provocative report stating that immuno - positron emission tomography (immuno - pet) might provide a non - invasive approach, for obtaining target - specific information useful for titrating doses of radioimmunotherapy, for patient risk stratification and selection of targeted therapies, evaluation of therapeutic response, and for predicting adverse treatment effects 54. clinical implementation of immuno - pet may indeed advance precision medicine. a validated gene expression signature that may predict recurrence in patients with early stage crc was recently described 55.levine. compared genetic profiles of patients with peritoneal metastases from colorectal and appendiceal primaries 56. efforts such as these and next generation sequencing of human tumor specimens may become an integral part of precision medicine, specifically clinical decision support systems that may risk stratify patients and individualize application of second look laparotomy and crs + hipec as well as yield agent specific predictions of targeted systemic therapy response. approximately 50% of patients who develop psm from crc may have curative multi - modality treatment including complete resection of all grossly apparent disease. studies of patient with high - risk clinical and pathological features undergoing second look laparotomy have an incidence of psm exceeding 50% following resection of the primary tumor. unfortunately psm can not be detected pre - operatively in asymptomatic patients, as current diagnostic tests and/or standard imaging platforms lack sufficient sensitivity 2. factors identifying patients at high risk for peritoneal dissemination of crc have been described and treatment guidelines suggested by sugarbaker and the french group 12, 23.patients undergoing complete crs + hipec (r0-resection)have a 2-year survival of up to 60%. cytoreductive surgery, hipec and systemic chemotherapy are not competitive therapies - a fact emphasized in france based on broad a multi - modality therapeutic paradigm incorporated into the french guidelines 23. in germany it will be integrated in to the treatment guidelines as a therapeutic option in 2012. patient selection is key to maximizing oncological benefit over aggregate risk of multiple treatment modalities (crs + hipec + systemic therapy). clinical decision support systems based on specific clinical, pathological, biomarker and patient data will ultimately facilitate risk stratification, further enable patient selection for second look laparotomy and individualize multi - modality therapy in patients with psm in crc. immuno - pet antibody - based imaging will make possible detection of cell surface tumor biomarkers 54 and enhance the accuracy of multi - modality treatment response assessment. this diagnostic imaging platform will provide detailed determination of minimal residual disease as well as sub - clinical recurrence in patients with psm crc and fulfill an unmet need in functional diagnostic imaging. novel diagnostic imaging platforms coupled with clinical decision support tools will make precision medicine possible for patients with psm of crc origin. this will efficiently and effectively direct efforts incorporating systematic second look surgery to maximize therapeutic benefit inpatients at risk for psm, or in those asymptomatic patients with early psm from crc 26. we suggest using an effective and comprehensible algorithm in treating patients suffering from primary colorectal carcinoma (figure 1) as well as secondary colorectal carcinoma patients or those who had been selected already for 2 look operation (figure 2).	peritoneal surface malignancy (psm) is a frequent occurrence in the natural history of colorectal cancer (crc). although significant advances have been made in screening of crc, similar progress has yet to be made in the early detection of psm of colorectal cancer origin. the fact that advanced crc can be confined to the peritoneal surface without distant dissemination forms the basis for aggressive multi - modality therapy consisting of cytoreductive surgery (crs) plus hyperthermic intra - peritoneal chemotherapy (hipec), and neoadjuvant and/or adjuvant systemic therapy. reported overall survival with complete crs+hipec exceeds that of systemic therapy alone for the treatment of psm from crc, underscoring the advantage of this multi - modality therapeutic approach. patients with limited peritoneal disease from crc can undergo complete cytoreduction, which is associated with the best reported outcomes. as early or limited peritoneal carcinomatosis is undetectable by conventional imaging modalities, second look laparotomy is an important means to identify disease in high - risk patients at a stage most amenable to complete cytoreduction. this review focuses on the identification of patients at risk for psm from crc and discusses the role of second look laparotomy.
an ongoing reliable and comparative analysis of causes of death in different age groups, particularly in neonates and young children is the basis for national and international decision - making and planning process in the health system. these data are very useful in health policies for disease prevention and control especially, where shortage of financial and human resources limit treatment options. moreover, rate and pattern of child mortality is a sensitive indicator of a country 's development and a good source of evidence for its priorities and values. global mortality in children younger than 5 years has been reduced in the past two decades from more than 12.5 million deaths in 1990 to 7.0 million in 2010 and 6.6 million in 2012 ; as a result of more efficient treatments, innovative ways of delivering critical interventions to the poor population, and sustained political commitment. the causes of death could be much more variable in different regions and even at different times in the same center. therefore, this study was designed to analyze data for the in - patient children mortality in all during a 2-year period. this is a cross - sectional study designed to analyze data for the in - patient mortality among children in all shiraz teaching hospitals from march 2011 to march 2013. there are three main children 's teaching hospitals ; include one general and two referral hospitals, all having pediatric emergency wards. however, at the time of this study, there was only one medical pediatric intensive care unit (picu) in teaching hospitals with 10 beds. in this study, managing physicians collected information on the admitted children to these teaching hospitals at the end of each month during the study. this information included age, sex, underlying disease, final diagnosis, duration of hospitalization, description of the hospital course and cause of death, for the patients who expired. patients < 30 days and more than 18 years old were excluded from this study. the study has been approved by the ethics committee of shiraz university of medical sciences. the statistical analysis of the data was performed using statistical package for social sciences version 16 (spss inc., the results related to the survival rate of the patients analyzed by the life table method. this is a cross - sectional study designed to analyze data for the in - patient mortality among children in all shiraz teaching hospitals from march 2011 to march 2013. there are three main children 's teaching hospitals ; include one general and two referral hospitals, all having pediatric emergency wards. however, at the time of this study, there was only one medical pediatric intensive care unit (picu) in teaching hospitals with 10 beds. in this study, managing physicians collected information on the admitted children to these teaching hospitals at the end of each month during the study. this information included age, sex, underlying disease, final diagnosis, duration of hospitalization, description of the hospital course and cause of death, for the patients who expired. patients < 30 days and more than 18 years old were excluded from this study. the study has been approved by the ethics committee of shiraz university of medical sciences. the statistical analysis of the data was performed using statistical package for social sciences version 16 (spss inc., the results related to the survival rate of the patients analyzed by the life table method. this is a cross - sectional study designed to analyze data for the in - patient mortality among children in all shiraz teaching hospitals from march 2011 to march 2013. there are three main children 's teaching hospitals ; include one general and two referral hospitals, all having pediatric emergency wards. however, at the time of this study, there was only one medical pediatric intensive care unit (picu) in teaching hospitals with 10 beds. in this study, managing physicians collected information on the admitted children to these teaching hospitals at the end of each month during the study. this information included age, sex, underlying disease, final diagnosis, duration of hospitalization, description of the hospital course and cause of death, for the patients who expired. patients < 30 days and more than 18 years old were excluded from this study. the study has been approved by the ethics committee of shiraz university of medical sciences. the statistical analysis of the data was performed using statistical package for social sciences version 16 (spss inc., the results related to the survival rate of the patients analyzed by the life table method. from a total of 18,915 patients, 9584 were admitted in 2011 and 9331 in 2012. of 18,915 picu admissions, 256 (23.6%) patients died in the hospital of which 256 died 152 deaths (59%) occurred in the picu with a mortality rate of 16.6%. and 104 patients (41%) died in the wards other than picu with a mortality rate of 0.58%. mean age of the 256 patients who died in the hospital was 4.3 5.2 years with a range of 1-month to 17 years with male to female ratio of 1.37. table 1 shows age distribution of the patients. of the 256 deaths, 23 (9%) occurred within the first 24 h after admission and 60 (23.5%) during the first 2 days [table 2 ]. age distribution of 256 in - patient deaths of the study group duration of hospital admission of the study group an underlying disease [table 3 ] was present in 70.7% of the patients, and in 88.5% of all of the expired patients, the leading causes of death were directly related to the known underlying diseases. the most common underlying diseases were congenital heart disease and cardiomyopathy in 50 (27.6%). underlying diseases of the expired study patients the four main causes of deaths [table 4 ] were sepsis (14.8%), pneumonia (14.5%), congestive heart failure (9.8%) and hepatic encephalopathy (9.8%). unusual causes of death were diabetic ketoacidosis in two and diarrhea, asthma, and bronchiolitis in three patients. however, no case of acquired immunodeficiency syndrome (aids), pertussis, diphtheria, poliomyelitis, tetanus, measles or tuberculosis (except for bcgitis as a disseminated bacillus calmette - guerin infection) was detected in the expired children. causes of deaths of the study group duration of hospitalization ranged from < 24 h to 68 days (mean 8.52 9.53 days). in this study, sepsis, pneumonia, chf and hepatic encephalopathy were the most common causes of death respectively, and majority of the patients had some type of underlying diseases. sepsis was the most common cause of death probably due to significant number of immune compromised patients and those with chronic liver or heart diseases in this referral center. this cross - sectional study of the pattern of death in children and infants in the three pediatric centers in shiraz. is the first of its kind in iran one of the largest similar series is from northern cameroon that includes deaths in all age ranges from neonatal period to adulthood. nonetheless, our study is unique in many aspects : (1) including large number of in - patients and their related mortality information with no missing data, (2) covering almost all the admitted nonsurgical pediatric patients, (3) including infants and children and excluding neonates, (4) differentiating the death in picu from regular wards, (5) including data of both general and subspecialty hospitals and their emergency wards, (6) collecting the data of our study was concurrent in contrast to some other similar studies, (7) identifying the underlying diseases and their relations to the present illness. the overall mortality rate in different reports on admitted children is from 6% to 17.8%, and in picu from 2.8% to 32.9%, the difference in the mortality rate can be related to the availability of adequate picu beds and the related facilities, the physician experience, availability of special nurses, the diseases leading to picu admission and the underlying diseases. in addition, the low rate of mortality in the wards other than picu may be due to the large number of patients in the general hospitals and in the emergency wards. about one - third of deaths in our patients occurred in the first 6-month and about 45% during the 1 year of life. probably because of mass immunization of children in, the related infectious diseases such as measles, pertussis, and diphtheria, severe forms of tuberculosis or poliomyelitis were rarely observed in our patients. surprisingly, unlike other reports, diarrhea and malnutrition were unusual causes of death, and malaria was not observed in this study. improvement in socioeconomic and educational status of the community may be an important factor for low rate of death due to malnutrition and diarrhea. in addition, religious beliefs and restrictions may be important factors for very low rate of aids in our patient population. in a report of 5909 in - patient children by bucens., the three most common causes of death have been lower respiratory tract infection, central nervous system (cns) infection, and malnutrition. in another recent study, furthermore, in an older report of 1364 admitted children, 75% of deaths were due to acute respiratory tract infection, acute diarrhea, and severe malnutrition. additionally, in a similar study of 8826 pediatric admissions, acute diarrhea, and severe malnutrition were the most important causes of death. moreover, in a large series of death in children and adults, acute lower respiratory tract infection, malaria and diarrheal disease were the most common causes of mortality in children. in our study, in contrast to most of the above reports, cardiac, gastrointestinal, hepatic and cns diseases together with malignancies were the common causes of death. this difference may be explained in part by the fact that our center is the tertiary referral center for these groups of patients from different provinces and also including different age groups of children. in one recent report on 282 picu admissions and 32.9% mortality, sepsis, cardiac diseases, and neurological disorders were the most common causes of death. the latter study had a higher mortality rate than our study even though some of the causes of death were similar to our patient population. cns disorders and malignancies are reported as the second and third common causes of death respectively at the natural hospital in dili. in our report, an underlying disease was present in about 70% of the patients who died and in 88.5% of these patients the leading cause of death was directly related to their underlying diseases. this has created an important task for the health providers to help the patients with chronic diseases such as chd and hepatic cirrhosis by providing access to organ transplantation or advanced surgical operations. they can also provide the means by allocating budget for preparing drugs and facilities for prevention or early detection and proper management of malignancies. if they achieve this goal, there will be more regular picu beds available for other patients to be admitted. moreover, another way to decrease mortality rate is to provide advanced picu beds and the related facilities. in most other reports, the percent of death during the 1 day of admission is greater than in our study. this may be related to the facilities in our health system which can manage and stabilize pediatric emergencies before they arrive to the referral hospitals. limitation of this study was that all information about the patients who were discharged from hospital was not available. we can conclude that after sepsis and pneumonia, chf and hepatic encephalopathy are the two most leading causes of death. most patients who died had underlying diseases that should lead the health care authorities to re - evaluate the health policies to address these issues.	introduction : causes of death are different and very important for policy makers in different regions. this study was designed to analyze the data for our in - patient children mortality.materials and methods : in this cross - sectional study from march 2011 to march 2013, all patients from 2 months to 18 years who died in pediatric intensive care unit, emergency room or medical pediatric wards in the teaching hospitals were studied.results:from a total of 18,915 admissions during a 2-year - period, 256 deaths occurred with a mean age of 4.3 5 years and mortality 1.35%. an underlying disease was present in 70.7% of the patients and in 88.5% of them the leading causes of death were related to the underlying diseases. the most common underlying diseases were congenital heart disease and cardiomyopathy in 50 (27.6%). the four main causes of deaths were sepsis (14.8%), pneumonia (14.5%), congestive heart failure (9.8%), and hepatic encephalopathy (9.8%).conclusion : we may conclude that after sepsis and pneumonia, congestive heart failure, and hepatic encephalopathy are the leading causes of death. most patients who died had underlying diseases including malignancies, heart and liver diseases as the most common causes.
the nose is a part of the airway system which is most easily accessible for morphological and pathophysiological evaluation of changes occurring as a response to various stimuli. after total laryngectomy in advanced laryngeal cancer patients, upper airway can not do its physiological functions because upper and lower airways are separated. the nose warms, cleans, and humidifies the inspired air. the absence of a physiological air flow stimulus after total laryngectomy leads to clinical, cytological, and histological changes of the nasal mucosa. the nasal mucosa was found to become thinner, and its color was observed to be changed over time [25 ]. reduction of blood flow, deteriorated sense of smell and taste, changes in mucociliary transport and nasal flora are the other alterations [6, 7 ]. in this paper we aimed to determine the long term histopathological changes in nasal mucosa in total laryngectomized patients breathing through tracheastoma instead of the nose. relationship between the duration of air cessation and the progression of histopathologic findings were also investigated. eleven postoperative total laryngectomy patients were studied at taksim education and research hospital in istanbul. the study protocol was approved by the ethical committee of taksim education and research hospital. local anaesthesia was used to permit taking enough tissue for proper morphological analysis. for local anaesthesia 2% lidocaine hcl, 0.125% epinefrine solution (jetokain, adeka) injected into the mucosa of the inferior turbinate. biopsy specimens were taken from the lower edge of the inferior turbinate and fixed in 10% buffered formaldehyde. serial 3 - 4 m thick tissues were cut at a plane perpendicular to the mucosal surface. sections of the inferior turbinate were stained with hematoxylin - eosin and examined by leica dmls light microscope (leica microsystems, wetzlar, germany). all patients included in the study were male, and the average age was 58. all of the patients previously underwent total laryngectomy due to advanced stage laryngeal squamous cell carcinoma. atrophy in cilindiric epithel (focal or total), destruction of goblet cells, subepithelial glands and cilia, fibrosis of stroma, neovascularization, congestion and myxoid degeneration of the stroma were detected (figures 1, 2, 3, 4, and 5). all of the patients (100%, n = 11) demonstrated at least one alteration in one of the above mentioned parameters (table 1). the most frequently observed findings were goblet cell and stroma destruction (81%, n = 9) and the less frequent findings were total atrophy and myxoid degeneration of stroma (27%, n the average postoperative time until taking the biopsies was 31 months (minimum 6 months, maximum 84 months). patients were divided into three groups according to biopsy time. the first group included four patients (36%) that biopsies were taken in the first postoperative year. second group included two patients (18%), and biopsies were taken between the first and third years after total laryngectomy. statistically there was no significant difference when the histopathologic changes were compared among groups, except for congestion (p <.005) ; see table 2. the anatomical changes resulting from total laryngectomy have a serious impact on several important physical functions and thus on the patients quality of life. the laryngectomy patient provides us a convenient model to study nasal mucosal reaction to functional inactivity. when the laryngectomized patients examined rhinoscopically the nasal mucosa was found to become thinner and its color to be changed over time. mucosa was histologically examined to determine the response of the nasal cavity and six to twelve months after surgery the smear contained little mucus and cellular elements were found to be considerably decreased. nuclei of the cells were slightly enlarged, their structures were erased, and the membrane and chromatin distribution became hardly visible. during a 15 year postlaryngectomy period, neither mucus nor goblet cells were observed. nasal biopsies showed that each patient had at least one change in histopahologic parameters. in eight patients (73%) atrophy of the epithelium was observed and five of them (46%) were focal atrophy. epithelium was preserved in three patients. due to lack of physiological irritation of the mucosa by the air current, the multilayered cylindrical epithelium with cilia changes and goblet cells disappeared. in our study, little or no mucous was visible on the epithelium surface as a consequence of the decrease in mucus producing cells. reduction in the amount of secretion or a loss of humidity at the mucosal surface would tend to cause destruction of the ciliated cells. in a study that nasal function was experimentally cut off by surgical obstruction of both nasal openings ; epithelium reduced to a single layer of cubical cells. lamina propria at some sites was swollen due to connective tissue expansion, capillaries were dilated, and thickening of some blood vessel walls was observed. in our study, lamina propria became wider due to fibrosis in nine patients (81%) and congestion in four (36%). we thought that by cessation of nasal air current, histopathologic changes might progress over time, however, our data was unable to confirm this. the reason may be that the observed histopathologic changes are already the last stage of mucosal, goblet cellular, ciliar, and glandular destruction, stromal fibrosis, and atrophy. there is a potential relationship between the histological changes in nasal mucosa and the qualitative / quantitative changes in nasal dysfunction in laryngectomized patients. due to reduction of blood flow, changes in mucociliary transport and deteriorated sense of smell and taste have been previously reported [6, 7 ]. with the observed histological findings some functional changes also occurred in our patients such as dryness in the nose, smelling, and taste problems. however, we did not routinely perform objective taste and smell tests. based on our results and the previous data, rehabilitation programs concerning the problems in olfaction and taste for laryngectomized patients artificial stimulation of the respiratory mucous by air stream may protect and normalize the epithelium but the question whether it would be a way to improve the capacity of smelling of the patients or not, still needs to be investigated. pseudostratified columnar ciliated epithelium changes, decrease in goblet cells and submucosal glands, fibrosis in stroma, myxoid degeneration, neovascularization, and congestion in lamina propria at some sites are detected in histopathologic examination. the changes in the nasal mucosa after airflow cessation are dynamic and require months to equilibrate. stimulation of the respiratory mucous membrane by air stream may be important factor for normal functioning of the ciliary apparatus, glandular, and vascular elements of the nasal mucosa.	objective. to determine the long - term histopathologic changes in nasal mucosa and the relationship between progression of the histopathologic changes and the duration without air current stimulation. material and method. biopsies were taken from the inferior turbinates of 11 laryngeal cancer patients after total laryngectomy. specimens were stained with hematoksilen - eosin and several histopathologic parameters were examined under light microscopy. results. all of the patients demonstrated at least one histopathologic abnormality (100%, n = 11). goblet destruction and stromal fibrosis were the most common findings (81%, n = 9), followed by focal epithelial atrophy and subepithelial seromusinous gland destruction (45%, n = 5), neovascularization and congestion (36%, n = 4), complete epithelial atrophy and mixoid degeneration (27%, n = 3). according to the duration between laryngectomy and biopsy, patients were grouped in to three : group 1 ; less than 12 months (36%, n = 4), group 2 ; 1236 months (18%, n = 2), and group 3 ; more than 36 months (45%, n = 5). only congestion was found to be decreased as the duration increased (p <.005). conclusion. in laryngeal cancer patients histopathologic changes occur in nasal mucosa eventuate due to the cessation of air current stimulation, however there was no relation between progression of the histopathologic findings and the duration of cessation.
the atomic level description of these interactions, the so - called interactome (1), gives access to the molecular bases of biological activity and the eventual rational intervention for medical purposes. at present, only a tiny fraction of complexes from the estimated number of all possible protein protein interactions (2) have an available 3d structure due to the limitations of high - resolution structural biology methods, such as x - ray crystallography or nuclear magnetic resonance (nmr) (3). fortunately, low - resolution methods, especially small - angle scattering (sas), are of more general application and could be applied in a high - throughput fashion as compared to x - ray crystallography or nmr techniques (45). small - angle x - ray scattering (saxs) is a powerful methodology for the structural and dynamic characterization of biomolecules at low resolution (69). recent advances in saxs instrumentation and the development of software for the comprehensive interpretation of saxs data in terms of structure make this technique an optimal tool to address the structural characterization of the interactome. methods based on rigid - body modeling of saxs data, such as sasref (10), can generate structural models for protein protein complexes by simultaneously fitting multiple saxs / sans data using simulated annealing algorithm. however, given that these methods rely exclusively on the sas data, the resulting models display an inherent degeneracy. in addition, these techniques miss the high - resolution information reporting on the details of intermolecular interactions. therefore, other strategies are necessary to incorporate the interacting surfaces of the partners to enrich the quality of the resulting models. one such strategy is the use of saxs data in combination with advanced computational approaches, such as protein these methods are mostly based on rigid - body (or semi - flexible) sampling of the interacting molecules, followed by scoring and/or energy minimization (1115). however, the recent capri experiments (http://www.ebi.ac.uk/msd-srv/capri/) (2125) have highlighted the limitations of current docking approaches and the necessity of using experimental information to help to identify the correct docking models (20,26). computational docking tools can be used to generate a large number of poses that are subsequently filtered and scored based on their capacity to describe the experimental data. this strategy has been applied to specific cases (2730) and has been implemented and systematically benchmarked in a few computational methods that combine saxs and docking for the structural modeling of protein protein complexes, such as pydocksaxs (31), foxsdock (32) or haddock (33). among them, we previously reported the first of such methods, pydocksaxs (31), which provided a 2-fold increase in the success rate for the prediction of protein complexes as compared to that of the individual approaches based on energy - based docking or saxs data alone (31). here, a server that makes pydocksaxs available is described. this server provides comprehensive structural models of biomolecular assemblies using the experimental saxs curve and the structure of the interacting partners as the only input. this strategy can be efficiently used for the high - throughput resolution of protein complexes at large scale with saxs data. the pydocksaxs method integrates saxs data and pydock energy - based scoring (16) to determine the structure of a protein protein complex from its components. this integrative method uses ftdock to generate 10 000 rigid - body docking poses, which are re - scored by a combination of pydock energy and the value defining the goodness of fit to the saxs data computed with crysol 2.8 (34) : (1)\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{upgreek } \usepackage{mathrsfs } \setlength{\oddsidemargin}{-69pt } \begin{document } } { } \begin{equation } { \rm pydocksaxs } = e_{{\rm pydock } } + w_c \cdot \chi _ { { \rm crysol } }, \end{equation}\end{document } where wc is a parameter that was previously optimized on 62 cases of the protein protein docking benchmark 2.0, using synthetic saxs data obtained from the complex structures after adding noise. the structural modeling capabilities of the server have been validated on 81 complexes of the protein protein benchmark 4.0 (35) which were not present in the previous training of the scoring function, using saxs data synthetically obtained from the complex structure after adding noise. we considered only complexes in which the molecular mass did not significantly vary between the unbound and the complex structures, as previously described (31). the pydocksaxs server identifies an acceptable docking model (i.e. with ligand rmsd < 10 from the reference structure after superimposing the receptor molecules) within the top 10 predictions in 25.9% of the cases (as compared to 13.6% success rate when using energy - based scoring alone) (figure 1). this is a similar improvement as that previously reported for the stand - alone version on the benchmark 2.0 (31). saxs - based scoring is sensitive to large conformational changes between the unbound structures (used in docking) and the bound state (from which saxs data are derived). indeed, in rigid cases, i.e. those with unbound bound interface c rmsd < 1.5, the pydocksaxs server improved the top 10 success rate up to 36.5% (as compared to 15.4% when using docking alone). this means that in rigid cases, the saxs - based scoring is more efficient in identifying the correct docking models. on the other hand, the overall results strongly depend on the quality of the docking poses generated by ftdock. when considering only those rigid cases in which ftdock is able to generate at least a near - native solution with ligand rmsd < 5, the success rate for pydocksaxs is 47.4% (as compared to 26.3% for docking alone). this observation suggests that future improvements in the docking algorithm used to generate the docking poses will have a strong impact on the predictive capabilities of the server. protein docking benchmark 4.0 which were not used for training, as compared to that of pydock alone. as an example, we have applied pydocksaxs to rebuild the structure of the alvinella pompejana cu, zn superoxide dismutase homo - dimer (pdb 3f7l), using the x - ray coordinates of one monomer (chain a) (36) and the experimental saxs data deposited in biosis database (37). this complex presents a spherical shape, which is challenging for modeling based only on saxs data (31). the server finds a near - native docking solution as rank 1, and additional acceptable solutions within the top 10 docking models. actually, six of the top 10 docking models were within (or slightly above) acceptance criteria in capri (figure 2). however, the other four docking models (not shown in figure 2) were significantly far from the correct orientation, which indicates that docking results in blind conditions should always be considered with caution. output of the pydocksaxs server showing the results for rebuilding the dismutase oxidase homo - dimer (pdb 3f7l). models 1 and 2 represent near - native solutions (ligand rmsd < 10). model 9 would also be acceptable by capri criteria, since interface rmsd < 4. other models (e.g. 4, 5, 6) have also good interface - rmsd values just above the usual acceptance cutoff. as another example, we used the pydocksaxs server to model the complex between the redox proteins adrenodoxin (adx) and cytochrome c (cc) which has been identified as a short - lived encounter complex (38). the authors stabilized the complex by engineering both proteins in order to cross - link them using two cysteine mutants : l80c and v28c from adx and cc, respectively. the cross - linked complex was structurally characterized by nmr and saxs (38). this is a challenging case involving expectedly weak interaction forces given its transient nature. in this type of cases, pydocksaxs can be easily used to generate models compatible with the experimental saxs profile and energetically accurate. using the experimental saxs data stored in the sasbdb repository (39), and the x - ray structures of adx (pdb 1ayf) and cc (pdb 2ycc), the pydocksaxs server generated many different docking orientations. after manually filtering the results from the pydocksaxs server to keep only the docking poses with the residues adx c80 and cc c28 within 10- distance in order to describe the cross - linked complex, a model similar to the nmr structure (pdb 2jqr) was found within the top 10 pydocksaxs docking poses. the other nine of the top 10 docking poses showed large variability in the mutual orientation between the two molecules. interestingly, without using the saxs data, this near - native solution would not have been identified within the top 10 docking poses. this example highlights the capacities of integrating saxs data with computational docking, and the power that additional residue - specific information has to enrich final solutions. however, while pydocksaxs provides a reduced set of models that typically includes one or several correct solutions, the existence of high - scoring incorrect models could complicate the identification of the correct assembly. the user is requested to upload the structure files for the two interacting proteins in the protein data bank (pdb) format (40). the choice of molecules as receptor or ligand is arbitrary, although for the sake of efficiency it is recommended to set the receptor as the largest molecule. incomplete residues are rebuilt with scwrl 3.0 (41). at present, cofactors are not considered in the calculations but this possibility will be implemented in future versions of the server. in addition, the server expects a file with the saxs experimental curve compatible with crysol software. thus, it should be a plain - text file where the first line is a title ignored by the software and the following lines are composed by three columns of numerical data separated by blanks or commas, which represent momentum transfer, scattering intensity and experimental error, respectively. if experimental errors are not specified, they are automatically estimated by crysol (2% of intensity values). users can customize some crysol execution parameters. at present, the available options for crysol calculations implemented in pydocksaxs are : (i) the use or not of constant subtraction and (ii) to specify different angular units of the saxs experimental data provided. other parameters such as the number of spherical harmonics are set to their standard values that have been proven to provide accurate estimation of theoretical saxs curves. the option of specifying a rigid - body docking set from previous pydockweb (42) executions has also been implemented for the convenience of advanced users. this option allows the user to upload pre - filtered rigid - body docking poses to be evaluated by the server. residue distance restraints based on binding site residues, already implemented in the general pydockweb server (26), or to filter manually specific orientations of the complex by the user. this possibility is relevant when residue - specific information is available from other techniques, i.e. nmr, mutagenesis data or bioinformatics tools. after submitting the job for calculation, this page is unique for the job and its url is highly recommended to bookmark, if a contact e - mail address was not provided by the user. the job information and results page is periodically auto - refreshed to provide the user updated information of the status of the submitted job. the information displayed is (i) an energy table of the top 100 complex orientations predicted and scored by pydocksaxs (including other relevant energetic terms as pydock scoring energy and crysol value) and available to download as a pdf format file (figure 2), (ii) a graphical representation of the fitting of the top 10 docking models to the experimental saxs data provided and (iii) a jsmol (jsmol.sourceforge.net/) interactive representation of the top 10 models predicted by the server (figure 2). the output of the server is also available for downloading as a gzip (gzip.org) compressed tar file and includes all the result files organized by folders. input_data which include the different input files provided by the user, (ii) pydock with the protein protein docking information data generated by pydock method, (iii) fit_top10_saxs contains the fitting files for the top 10 docking orientations according to crysol value and (iv) top100 folder, containing the top 100 structures scored by pydocksaxs in pdb file format (the crysol fit parameters the organization and format of the result files has been carefully optimized following the feedback provided by community users of the server and it is well described in the faq and help section of the server as well as in the the implementation of the web server is based on a three - components architecture : (i) a web front end that acts as user input source and makes results available to display and download when job is completed, (ii) a relational database where the job information is stored and (iii) a back end application which periodically polls the database for queued user projects and schedules jobs for parallel calculation of pydocksaxs using the slurm batch queuing system (slurm.schedmd.com). the web front end has been implemented using the web2py (www.web2py.com) free and open source web framework, and has been tested in all major modern web browsers. the back end application has been written in python version 2.7 with the use of external libraries as numpy and matplotlib. the pydocksaxs method is part of the pydock software version 3 and calls internally crysol software to evaluate the fitness of each of the predicted protein protein complexes to the saxs experimental data. the server runs on a multi - user cluster with access to two nodes composed of 16 cores (4 intel xeon e5620 quad core at 2.4 ghz) and 32 cores (2 amd opteron abu dhabi 6376 cpus), respectively, with 11 tb of total available disk space and 256 gb of physical memory. the user is requested to upload the structure files for the two interacting proteins in the protein data bank (pdb) format (40). the choice of molecules as receptor or ligand is arbitrary, although for the sake of efficiency it is recommended to set the receptor as the largest molecule. incomplete residues are rebuilt with scwrl 3.0 (41). at present, cofactors are not considered in the calculations but this possibility will be implemented in future versions of the server. in addition, the server expects a file with the saxs experimental curve compatible with crysol software. thus, it should be a plain - text file where the first line is a title ignored by the software and the following lines are composed by three columns of numerical data separated by blanks or commas, which represent momentum transfer, scattering intensity and experimental error, respectively. if experimental errors are not specified, they are automatically estimated by crysol (2% of intensity values). users can customize some crysol execution parameters. at present, the available options for crysol calculations implemented in pydocksaxs are : (i) the use or not of constant subtraction and (ii) to specify different angular units of the saxs experimental data provided. other parameters such as the number of spherical harmonics are set to their standard values that have been proven to provide accurate estimation of theoretical saxs curves. the option of specifying a rigid - body docking set from previous pydockweb (42) executions has also been implemented for the convenience of advanced users. this option allows the user to upload pre - filtered rigid - body docking poses to be evaluated by the server. residue distance restraints based on binding site residues, already implemented in the general pydockweb server (26), or to filter manually specific orientations of the complex by the user. this possibility is relevant when residue - specific information is available from other techniques, i.e. nmr, mutagenesis data or bioinformatics tools. after submitting the job for calculation, the user is redirected to the job information and results page. this page is unique for the job and its url is highly recommended to bookmark, if a contact e - mail address was not provided by the user. the job information and results page is periodically auto - refreshed to provide the user updated information of the status of the submitted job. the information displayed is (i) an energy table of the top 100 complex orientations predicted and scored by pydocksaxs (including other relevant energetic terms as pydock scoring energy and crysol value) and available to download as a pdf format file (figure 2), (ii) a graphical representation of the fitting of the top 10 docking models to the experimental saxs data provided and (iii) a jsmol (jsmol.sourceforge.net/) interactive representation of the top 10 models predicted by the server (figure 2). the output of the server is also available for downloading as a gzip (gzip.org) compressed tar file and includes all the result files organized by folders. input_data which include the different input files provided by the user, (ii) fit_top10_saxs contains the fitting files for the top 10 docking orientations according to crysol value and (iv) top100 folder, containing the top 100 structures scored by pydocksaxs in pdb file format (the crysol fit parameters are included in the header of each structure as a remark section for user convenience). the organization and format of the result files has been carefully optimized following the feedback provided by community users of the server and it is well described in the faq and help section of the server as well as in the the implementation of the web server is based on a three - components architecture : (i) a web front end that acts as user input source and makes results available to display and download when job is completed, (ii) a relational database where the job information is stored and (iii) a back end application which periodically polls the database for queued user projects and schedules jobs for parallel calculation of pydocksaxs using the slurm batch queuing system (slurm.schedmd.com). the web front end has been implemented using the web2py (www.web2py.com) free and open source web framework, and has been tested in all major modern web browsers. the back end application has been written in python version 2.7 with the use of external libraries as numpy and matplotlib. the pydocksaxs method is part of the pydock software version 3 and calls internally crysol software to evaluate the fitness of each of the predicted protein protein complexes to the saxs experimental data. the server runs on a multi - user cluster with access to two nodes composed of 16 cores (4 intel xeon e5620 quad core at 2.4 ghz) and 32 cores (2 amd opteron abu dhabi 6376 cpus), respectively, with 11 tb of total available disk space and 256 gb of physical memory. the motivation behind the pydocksaxs web server was to provide access to the scientific community to the efficient pydocksaxs method, which integrates saxs experimental data with pydock protein the pydocksaxs web server is an on - going project that will implement new features according to the future scientific community feedback. in the next upgrade, cofactors, ions and other non - peptidic molecules will be able to be considered during calculations. we also plan to implement a filter by symmetry, for the use on homo - meric complexes, and an extended input to analyze docking sets from different docking methods. programa estatal i+d+i, the spanish ministry of economy and competitiveness [bio2013 - 48213-r to j.f.- r. ] ; agence nationale de la recherche [spin - hd - anr - chex-2011 and atip - avenir program to p.b. ] ; fpu fellowship, the spanish ministry of science and innovation [bes-2011 - 045634 to b.j.g. ]. funding for open access charge : spanish ministry of economy and competitiveness [bio2013 - 48213-r ] ; agence nationale de la recherche [spin - hd - anr - chex-2011 ].	structural characterization of protein protein interactions at molecular level is essential to understand biological processes and identify new therapeutic opportunities. however, atomic resolution structural techniques can not keep pace with current advances in interactomics. low - resolution structural techniques, such as small - angle x - ray scattering (saxs), can be applied at larger scale, but they miss atomic details. for efficient application to protein protein complexes, low - resolution information can be combined with theoretical methods that provide energetic description and atomic details of the interactions. here we present the pydocksaxs web server (http://life.bsc.es/pid/pydocksaxs) that provides an automatic pipeline for modeling the structure of a protein protein complex from saxs data. the method uses ftdock to generate rigid - body docking models that are subsequently evaluated by a combination of pydock energy - based scoring function and their capacity to describe saxs data. the only required input files are structural models for the interacting partners and a saxs curve. the server automatically provides a series of structural models for the complex, sorted by the pydocksaxs scoring function. the user can also upload a previously computed set of docking poses, which opens the possibility to filter the docking solutions by potential interface residues or symmetry restraints. the server is freely available to all users without restriction.
participants performed aerobic and resistance exercise at least three times per week and had been doing so for at least 6 months (table 1). participant characteristics the research took place in the human and environmental physiology research unit at the university of ottawa. after being informed of the purpose, protocol, and possible risks of the study, participants gave written consent and completed physical activity readiness questionnaires (american heart association / american college of sports medicine health / fitness facility preparticipation screening questionnaire). hand - held glucose meters (onetouch ultra, lifescan, johnson & johnson, milpitas, ca) and test strips (with identical code) were provided for capillary glucose tests. on a separate visit, participants underwent an incremental workload running test on a treadmill with a monitored electrocardiogram (quinton q4500, quinton, bothell, wa) to determine peak oxygen consumption (vo2peak). vo2peak was determined by measuring the volume and concentration of expired oxygen and carbon dioxide (ametek model s-3a/1 and cd 3a, applied electrochemistry, pittsburgh, pa). muscular strength (eight repetition maximum [8-rm ]) was recorded as the maximum weight that participants could lift eight times with good form for chest press (pectoralis major), leg press (quadriceps, biceps femoris, gluteus maximus), seated row (latissimus dorsi, rhomboids, trapezius), leg curl (biceps femoris), shoulder press (deltoids), and lat pull - down (latissimus dorsi). a venous blood sample was drawn for determination of hba1c, which was measured by automated heterogeneous immunoassay with latex - enhanced turbidimetric detection on a roche cobas integra 800 analyzer (roche diagnostics corp., indianapolis, in). the cgms system gold (medtronic, northridge, ca) was used in this study. participants were blinded to their glucose values and could not change their regular behavior patterns based on real - time glucose monitoring. twenty - four hours before each experimental session, the cgm sensor was inserted subcutaneously in the abdomen or in the upper gluteal area. participants performed capillary glucose tests and calibrated the cgm unit four times daily using the hand - held glucose meter provided. on the third day, 24 h postexercise, participants removed the sensors and the researchers retrieved the monitors. data were downloaded using a medtronic com - station and minimed solutions software version 3.0 (medtronic). they ate the same breakfast, same lunch, and same supper each day of sensor wear and kept their insulin doses the same each of these days to the greatest extent possible. participants avoided exercise (apart from that performed in our laboratory) for 24 h before inserting the sensor (48 h before each study exercise session) as well as during the 3 days of sensor wear. participants arrived at the laboratory at 1600 h. intravenous catheters were inserted soon after arrival. each participant performed two experimental sessions in random order separated by at least 5 days : aerobic exercise before resistance exercise session (ar) : a 45-min bout of moderate - intensity aerobic exercise (treadmill running at 60% of their predetermined vo2peak), followed by a 45-min bout of resistance training (three sets of eight repetitions with 90 s of rest between sets). resistance exercise before aerobic exercise session (ra) : the same exercises as above were performed, with the resistance exercise completed before the aerobic exercise. women were using monophasic oral contraceptives and were tested during the active pill consumption phase. on the days that exercise was scheduled (day 2 of each 3-day monitoring period), participants were asked to decrease their insulin doses (a 10% decrease in long- or intermediate - acting for patients receiving multiple daily injections and a 50% decrease in basal rate 1 h pre - exercise for patients receiving a continuous subcutaneous insulin infusion). a further 25% basal rate decrease was made for continuous subcutaneous insulin infusion patients if their capillary glucose was 5 standardized snacks (glucerna chocolate graham snack bars, 150 calories, 25 g of carbohydrate ; abbott laboratories, abbott park, il) were provided and consumed at 1600 h each day of monitoring. before starting exercise capillary glucose tests were performed upon arrival at the laboratory, 30 min before and immediately before exercise. if capillary glucose levels were 10.9 mmol / l were categorized as hyperglycemic. total time spent in hypoglycemia, euglycemia, and hyperglycemia for the predetermined periods and the area under the curve (auc, defined as the absolute distance from the described limits, multiplied by the time spent outside those limits) for time spent hypo- and hyperglycemic was determined along with the maximum, minimum, and mean interstitial glucose for each time period. variables were compared between exercise treatments, and pre- and postexercise values were compared within treatments using related - samples wilcoxon signed rank tests. these tests were also used to examine differences in insulin and carbohydrate intake (calculated from the participants food and insulin diaries) between days within exercise treatments (day 1 vs. 2), and between exercise treatments (days 1 through 3). pearson correlation analyses were performed comparing capillary glucose values recorded by the participants during nonexercise periods to cgm data to assess the accuracy of the sensors throughout each 3-day measuring period. the research took place in the human and environmental physiology research unit at the university of ottawa. after being informed of the purpose, protocol, and possible risks of the study, participants gave written consent and completed physical activity readiness questionnaires (american heart association / american college of sports medicine health / fitness facility preparticipation screening questionnaire). hand - held glucose meters (onetouch ultra, lifescan, johnson & johnson, milpitas, ca) and test strips (with identical code) were provided for capillary glucose tests. on a separate visit, participants underwent an incremental workload running test on a treadmill with a monitored electrocardiogram (quinton q4500, quinton, bothell, wa) to determine peak oxygen consumption (vo2peak). vo2peak was determined by measuring the volume and concentration of expired oxygen and carbon dioxide (ametek model s-3a/1 and cd 3a, applied electrochemistry, pittsburgh, pa). muscular strength (eight repetition maximum [8-rm ]) was recorded as the maximum weight that participants could lift eight times with good form for chest press (pectoralis major), leg press (quadriceps, biceps femoris, gluteus maximus), seated row (latissimus dorsi, rhomboids, trapezius), leg curl (biceps femoris), shoulder press (deltoids), and lat pull - down (latissimus dorsi). a venous blood sample was drawn for determination of hba1c, which was measured by automated heterogeneous immunoassay with latex - enhanced turbidimetric detection on a roche cobas integra 800 analyzer (roche diagnostics corp., indianapolis, in). the cgms system gold (medtronic, northridge, ca) was used in this study. participants were blinded to their glucose values and could not change their regular behavior patterns based on real - time glucose monitoring. twenty - four hours before each experimental session, the cgm sensor was inserted subcutaneously in the abdomen or in the upper gluteal area. participants performed capillary glucose tests and calibrated the cgm unit four times daily using the hand - held glucose meter provided. on the third day, 24 h postexercise, participants removed the sensors and the researchers retrieved the monitors. data were downloaded using a medtronic com - station and minimed solutions software version 3.0 (medtronic). they ate the same breakfast, same lunch, and same supper each day of sensor wear and kept their insulin doses the same each of these days to the greatest extent possible. participants avoided exercise (apart from that performed in our laboratory) for 24 h before inserting the sensor (48 h before each study exercise session) as well as during the 3 days of sensor wear. participants arrived at the laboratory at 1600 h. intravenous catheters were inserted soon after arrival. each participant performed two experimental sessions in random order separated by at least 5 days : aerobic exercise before resistance exercise session (ar) : a 45-min bout of moderate - intensity aerobic exercise (treadmill running at 60% of their predetermined vo2peak), followed by a 45-min bout of resistance training (three sets of eight repetitions with 90 s of rest between sets). resistance exercise before aerobic exercise session (ra) : the same exercises as above were performed, with the resistance exercise completed before the aerobic exercise. women were using monophasic oral contraceptives and were tested during the active pill consumption phase. on the days that exercise was scheduled (day 2 of each 3-day monitoring period), participants were asked to decrease their insulin doses (a 10% decrease in long- or intermediate - acting for patients receiving multiple daily injections and a 50% decrease in basal rate 1 h pre - exercise for patients receiving a continuous subcutaneous insulin infusion). a further 25% basal rate decrease was made for continuous subcutaneous insulin infusion patients if their capillary glucose was 5 standardized snacks (glucerna chocolate graham snack bars, 150 calories, 25 g of carbohydrate ; abbott laboratories, abbott park, il) were provided and consumed at 1600 h each day of monitoring. before starting exercise, participants were required to have blood glucose levels between 5.5 and 13.9 mmol / l. capillary glucose tests were performed upon arrival at the laboratory, 30 min before and immediately before exercise. if capillary glucose levels were 10.9 mmol / l were categorized as hyperglycemic. total time spent in hypoglycemia, euglycemia, and hyperglycemia for the predetermined periods and the area under the curve (auc, defined as the absolute distance from the described limits, multiplied by the time spent outside those limits) for time spent hypo- and hyperglycemic was determined along with the maximum, minimum, and mean interstitial glucose for each time period. variables were compared between exercise treatments, and pre- and postexercise values were compared within treatments using related - samples wilcoxon signed rank tests. these tests were also used to examine differences in insulin and carbohydrate intake (calculated from the participants food and insulin diaries) between days within exercise treatments (day 1 vs. 2), and between exercise treatments (days 1 through 3). pearson correlation analyses were performed comparing capillary glucose values recorded by the participants during nonexercise periods to cgm data to assess the accuracy of the sensors throughout each 3-day measuring period. energy expenditure was measured during exercise and recovery together for both sessions in 9 of the 12 participants. there were no differences in energy expenditure between ar (4,277 729 kj) and ra (4,247 589 kj). plasma glucose levels for exercise and recovery (supplementary table 1) are plotted in fig. 1. a significant effect of time (p = 0.001) and an interaction of treatment and time (p = 0.004) the aerobic exercise performed in the ar treatment caused a substantial decline in blood glucose concentration, resulting in plasma glucose levels that were lower than baseline within the first 10 min of exercise, persisting until the end of aerobic exercise (9.1 2.4 at baseline ; 5.5 2.4 mmol / l at 45 min ; p < 0.01) and continuing into resistance exercise. glucose then increased during resistance exercise, producing levels that were similar to baseline by the end of exercise. conversely, the ra treatment did not produce significant changes from baseline during resistance exercise. after the change in exercise modality in ra, glucose levels were only significantly different from baseline after 75 (p = 0.044) and 90 (p = 0.018) min of exercise. glucose was lower in the ar treatment than in the ra treatment until the end of exercise, with differences achieving statistical significance between 30 and 60 min (p < 0.05). mean se plasma glucose during exercise and recovery for aerobic exercise performed before resistance exercise (ar, dashed line with) and resistance exercise performed before aerobic exercise (ra, solid line with) (n = 11). change throughout recovery from end - exercise level where p < 0.05. during the postexercise recovery period, there was a significant effect of time (p < 0.01) for changes in plasma glucose, but no effect of treatment or interaction of treatment and time. significant increases in plasma glucose from the end of exercise were seen throughout recovery after ar where none were observed after exercise in ra (fig. total daily insulin doses did not differ significantly between treatments on the first 2 days of cgm wear before the experimental exercise session, or between the first and second day within each treatment. insulin adjustments for exercise were similar between treatments (supplementary table 2). on the day after the exercise testing session, insulin intake was lower after the ar session compared with ra (36.1 16.3 vs. 38.8 18.5 units, p = 0.028). ten of 12 participants required carbohydrate supplementation during the ar session compared with only 6 of 12 during ra ; however, there were no statistically significant differences between groups in total carbohydrate intake during exercise and recovery in the laboratory (supplementary table 3) and in the 6 h after exercise (supplementary table 4). pearson correlations between capillary glucose readings from nonexercise periods and sensor readings over the monitoring period were 0.95 for ar and 0.91 for ra (p < 0.001). there were no significant differences between treatments with respect to hypoglycemia and hyperglycemia (number of excursions, time, auc) as well as mean, maximum, and minimum glucose on the night before or 24 h before exercise. average maximum nocturnal glucose levels were significantly lower after exercise than the previous (nonexercise) night (pre - exercise = 9.5 3.0 mmol / l, postexercise maximum = 8.8 4.0 mmol / l ; p = 0.04). within the ar treatment, there was a trend toward greater auc postexercise for nocturnal hypoglycemia (p = 0.06) compared with ra. although the frequency of nocturnal hypoglycemic events did not differ between the two exercise sessions, the duration and depth of hypoglycemia tended to be longer and more severe after ar than after ra (table 2). mean glucose (n = 12) as measured by continuous glucose monitoring from 1 to 12 h after exercise following aerobic exercise performed before resistance exercise (ar, dashed line) and resistance exercise performed before aerobic exercise (ra, solid line). (a high - quality color representation of this figure is available in the online issue.) summary of overnight (2400 to 0600 h) continuous glucose monitoring data for the night before and the night after exercise plasma glucose levels for exercise and recovery (supplementary table 1) are plotted in fig. 1. a significant effect of time (p = 0.001) and an interaction of treatment and time (p = 0.004) the aerobic exercise performed in the ar treatment caused a substantial decline in blood glucose concentration, resulting in plasma glucose levels that were lower than baseline within the first 10 min of exercise, persisting until the end of aerobic exercise (9.1 2.4 at baseline ; 5.5 2.4 mmol / l at 45 min ; p < 0.01) and continuing into resistance exercise. glucose then increased during resistance exercise, producing levels that were similar to baseline by the end of exercise. conversely, the ra treatment did not produce significant changes from baseline during resistance exercise. after the change in exercise modality in ra, glucose levels were only significantly different from baseline after 75 (p = 0.044) and 90 (p = 0.018) min of exercise. glucose was lower in the ar treatment than in the ra treatment until the end of exercise, with differences achieving statistical significance between 30 and 60 min (p < 0.05). mean se plasma glucose during exercise and recovery for aerobic exercise performed before resistance exercise (ar, dashed line with) and resistance exercise performed before aerobic exercise (ra, solid line with) (n = 11). change throughout recovery from end - exercise level where p < 0.05. during the postexercise recovery period, there was a significant effect of time (p < 0.01) for changes in plasma glucose, but no effect of treatment or interaction of treatment and time. significant increases in plasma glucose from the end of exercise were seen throughout recovery after ar where none were observed after exercise in ra (fig. total daily insulin doses did not differ significantly between treatments on the first 2 days of cgm wear before the experimental exercise session, or between the first and second day within each treatment. insulin adjustments for exercise were similar between treatments (supplementary table 2). on the day after the exercise testing session, insulin intake was lower after the ar session compared with ra (36.1 16.3 vs. 38.8 18.5 units, p = 0.028). ten of 12 participants required carbohydrate supplementation during the ar session compared with only 6 of 12 during ra ; however, there were no statistically significant differences between groups in total carbohydrate intake during exercise and recovery in the laboratory (supplementary table 3) and in the 6 h after exercise (supplementary table 4). pearson correlations between capillary glucose readings from nonexercise periods and sensor readings over the monitoring period were 0.95 for ar and 0.91 for ra (p < 0.001). there were no significant differences between treatments with respect to hypoglycemia and hyperglycemia (number of excursions, time, auc) as well as mean, maximum, and minimum glucose on the night before or 24 h before exercise. average maximum nocturnal glucose levels were significantly lower after exercise than the previous (nonexercise) night (pre - exercise = 9.5 3.0 mmol / l, postexercise maximum = 8.8 4.0 mmol / l ; p = 0.04). within the ar treatment, there was a trend toward greater auc postexercise for nocturnal hypoglycemia (p = 0.06) compared with ra. although the frequency of nocturnal hypoglycemic events did not differ between the two exercise sessions, the duration and depth of hypoglycemia tended to be longer and more severe after ar than after ra (table 2). mean glucose (n = 12) as measured by continuous glucose monitoring from 1 to 12 h after exercise following aerobic exercise performed before resistance exercise (ar, dashed line) and resistance exercise performed before aerobic exercise (ra, solid line). (a high - quality color representation of this figure is available in the online issue.) summary of overnight (2400 to 0600 h) continuous glucose monitoring data for the night before and the night after exercise this study evaluated, in the context of a combined resistance and aerobic exercise session, the effects of exercise order on blood glucose levels in individuals with type 1 diabetes. as we had anticipated, performing resistance exercise before aerobic exercise rather than the reverse resulted in attenuated declines in glucose concentration during exercise, fewer exercise - induced hypoglycemic events, and less need for carbohydrate supplementation. furthermore, we observed beneficial effects from this sequence on subsequent 12-h glycemic trends where the duration and severity of hypoglycemia was reduced. the benefits of performing resistance exercise before aerobic exercise instead of the reverse were observed despite overall energy expenditure being equal between experimental sessions. other types of high - intensity exercise combining aerobic and anaerobic metabolism (e.g., high intensity cycling) can increase the rate of glucose appearance to a greater extent than the rate of glucose utilization (seven and four times, respectively) during exercise in type 1 diabetes (18). this may cause glucose levels to increase during exercise, producing postexercise hyperglycemia if intense exercise is sustained for 12 or more minutes (19). shorter anaerobic exercise bouts (intermittent 4-s sprints or 10-s sprints before or after low - intensity aerobic exercise) attenuated declines in blood glucose both during and after exercise when combined with low - intensity (40% vo2peak) cycling (68). elevated glucose production from very high - intensity exercise is generally attributed to increased levels of circulating epinephrine [known to triple with short sprints (6,8,9) and increase up to 14 times its resting value (18) after 12 min of exhaustive cycling ] and norepinephrine, which augment glycogenolysis throughout exercise and early recovery (18,19). although we did not measure catecholamines during the sessions, responses to high - intensity exercise are known to be comparable (18,20) or slightly attenuated (19,21) in individuals with type 1 diabetes compared with nondiabetic counterparts. catecholamines can increase to three or four times resting values during moderate - intensity resistance exercise in individuals without diabetes (22), with responses increasing in proportion to exercise intensity (23). if our participants experienced similar responses to resistance exercise as individuals without diabetes, then increases in epinephrine may have contributed to the attenuated rate of decline in blood glucose during the first 15 min of aerobic exercise in ra, and to the increase in glucose during resistance exercise in ar (fig. 1). the latter should be interpreted with caution, because most participants needed glucose supplements to prevent hypoglycemia during aerobic exercise in this session. it is also possible that exercise - related growth hormone (gh) secretion differed between treatments, potentially affecting fuel selection during exercise. goto. (24) found that in nondiabetic individuals, endurance exercise performed before resistance exercise produced lower gh secretion than resistance exercise alone. they also found that resistance exercise performed 20 min or less before endurance exercise produced elevated levels of gh and greater rates of lipolysis during the subsequent aerobic activity compared with endurance exercise alone (16). because higher gh levels are known to decrease muscle glucose uptake and increase lipolysis in nondiabetic individuals (25), this may have been a factor in the attenuated declines in blood glucose during aerobic activity in ra. high - intensity cycling increases blood lactate levels during and up to 40 min after exercise in individuals with type 1 diabetes (6,7,9,18,19). we are unaware of published data describing lactate responses to resistance exercise in this population. resistance exercise protocols similar to the one we used have produced lactate concentrations up to four times those measured at rest, with levels remaining significantly higher than baseline until 30 min postexercise in trained nondiabetic individuals (26). because elevated lactate could serve to increase gluconeogenesis (7), it could be a contributing factor in the attenuated decline in glucose during the first 15 min of aerobic exercise in ra as well as in the increases in postexercise glucose levels in ar. studies suggest that high - intensity exercise may be associated with a greater frequency of nocturnal hypoglycemia in type 1 diabetic individuals (10,11). nocturnal hypoglycemia has been identified as a risk inherent with intensive insulin therapy (27), and it is possible that overnight hypoglycemia in our study was more related to insulin therapy than to exercise. it is noteworthy that hypoglycemic events occurring after ar tended to be longer and more severe than those experienced in ra, as demonstrated by a greater auc. studies using glucose clamp found that counter - regulatory responses to subsequent hypoglycemia were blunted after exercise, even in the absence of significant changes in glucose levels during exercise (28). in addition, even mild hypoglycemia (3.9 mmol / l) in nondiabetic individuals is sufficient to elicit counter - regulatory reactions that can blunt neuroendocrine responses to subsequent hypoglycemia within 24 h (29). because decreases in blood glucose were greater during ar (reaching a mean of 5.5 2.4 vs. 6.9 3.1 mmol / l in ra), it is plausible that subsequent responses to declining blood glucose could have been subject to impairment after exercise. although there are advantages to admitting study subjects the night before testing to control participant activity and food intake, we chose a study design more reflective of real - life conditions. participants controlled their meals and insulin but were asked to eat the same breakfast, lunch, and dinner at the same time for every day of sensor wear and to match their insulin intake as closely as possible. exercise took place at 1700 h when many individuals who work during the day opt to exercise, unlike several other studies where midmorning exercise was performed (69,18,19). glucose responses may be different if exercise is performed at another time of day because hormone and exogenous insulin concentrations are both likely to be different. our participants were fit, habitual exercisers, and the effects of exercise may be less pronounced in unfit individuals exercising at the same relative intensity because the activity would be at a lower absolute intensity. in nondiabetic subjects running at very high relative intensity, glucose production and catecholamine concentrations increase more in athletes than in physically untrained individuals, resulting in hyperglycemia after exercise in the former group because glucose production falls more slowly than glucose utilization when exercise ends (30). further research on different subpopulations of type 1 diabetic individuals, including those with lower fitness levels and poorer glycemic control, is warranted. this study is limited by its small sample size (n = 12), which may have prevented us from finding all of the significant differences in plasma glucose levels during exercise. to examine our participants in a real - life scenario, we compromised a certain amount of experimental control such as having complete control over all food and insulin intake. the ability to interpret the data would have been improved by having catecholamine, lactate, and gh measurements. finally, having a relatively fit sample with moderate to good control of their diabetes makes the applicability of the outcomes to individuals who are inactive or have poor glycemic control uncertain. in summary, our findings suggest that trained individuals with type 1 diabetes who perform both resistance and moderate aerobic exercise should consider performing their resistance exercise first if they tend to develop exercise - associated hypoglycemia because doing so may attenuate declines in glucose levels during subsequent aerobic exercise. this order of exercise could lead to a lower reliance on glucose supplementation during exercise and might also decrease the severity of potential nocturnal hypoglycemia. conversely, individuals having exercise - associated hyperglycemia may wish to perform aerobic exercise before resistance training. both approaches should still be accompanied by careful monitoring of blood glucose levels, both during and after exercise.	objectiveto determine the effects of exercise order on acute glycemic responses in individuals with type 1 diabetes performing both aerobic and resistance exercise in the same session.research design and methodstwelve physically active individuals with type 1 diabetes (hba1c 7.1 1.0%) performed aerobic exercise (45 min of running at 60% vo2peak) before 45 min of resistance training (three sets of eight, seven different exercises) (ar) or performed the resistance exercise before aerobic exercise (ra). plasma glucose was measured during exercise and for 60 min after exercise. interstitial glucose was measured by continuous glucose monitoring 24 h before, during, and 24 h after exercise.resultssignificant declines in blood glucose levels were seen in ar but not in ra throughout the first exercise modality, resulting in higher glucose levels in ra (ar = 5.5 0.7, ra = 9.2 1.2 mmol / l, p = 0.006 after 45 min of exercise). glucose subsequently decreased in ra and increased in ar over the course of the second 45-min exercise bout, resulting in levels that were not significantly different by the end of exercise (ar = 7.5 0.8, ra = 6.9 1.0 mmol / l, p = 0.436). although there were no differences in frequency of postexercise hypoglycemia, the duration (105 vs. 48 min) and severity (area under the curve 112 vs. 59 units min) of hypoglycemia were nonsignificantly greater after ar compared with ra.conclusionsperforming resistance exercise before aerobic exercise improves glycemic stability throughout exercise and reduces the duration and severity of postexercise hypoglycemia for individuals with type 1 diabetes.
the cilium is a microtubule - rich organelle that protrudes from the apical membrane of most vertebrate cells (figure 1). observed initially via a light microscope over 300 years ago, and largely thought of as vestigial or rudimentary organelles, cilia garnered attention in 1976 because of their association with pcd (also known as kartagener syndrome when associated with situs inversus) by bjorn afzelius. he described four patients with chronic sinusitis, bronchitis, frequent ear infections and immotile sperm, three of whom displayed situs inversus totalis (reversal in placement of body organs). he observed a lack of ciliary motion in biopsy samples from bronchial mucosa of one patient, along with an absence of the normal numbers of dynein arms in ciliary electron micrographs. the seemingly stationary cilia in these patients led to the initial naming of the disease as immotile - cilia syndrome. further investigation into the disorder, however, showed the cilia to have dysfunctional motility, rather than a lack of all movement ; thus the clinical disorder was renamed primary ciliary dyskinesia. a. scanning electron micrograph of mouse nodal cilia (image reproduced with permission from shigenori nonaka). b. motile cilia are usually found at a density of several hundred per cell, as shown in this scanning electron micrograph of the mammalian trachea (image from). c. primary cilia are typically one per cell, as exemplified by primary cilia in renal tubule epithelia (image from). d. schematic representation of a cilium, with cross sections at the distal end showing the microtubule arrangements in the nodal, motile and non - motile (primary) cilia, and the basal body at the apical side of the cell. cilia can be found on cells within almost all organ systems in the body (figure 1a, b, c). historically, cilia have been divided into two types based on their ability to move : motile cilia and primary (non - motile) cilia (figure 1d). while motile cilia achieved prominence through their connection to pcd, and their functions in cell movement (e.g. sperm) and flow generation (e.g. mucosa), the importance of primary cilia remained underappreciated for several years after their discovery. the first evidence of an important sensory function for primary cilia came from the discovery that the mutation underscoring the cystic renal phenotype of the tg737 mouse mutant was a hypomorphic allele in the gene encoding ift88, a protein important for the assembly of flagella in chlamydomonas. subsequently, it was shown that the proteins responsible for autosomal dominant polycystic kidney disease also localized to the renal primary cilia in healthy cells, and were involved in calcium conductance, while mutations discovered in genes encoding basal body and axonemal proteins in patients with the pleiotropic bardet - biedl syndrome phenotype highlighted the near ubiquitous critical roles of cilia across tissues. it is now well - established that primary, non - motile, cilia play crucial roles in facilitating several signaling pathways, such as wnt and hedgehog signaling, and can also function as chemosensory, mechanosensory and photosensory mediators [912 ]. for several years, only non - motile cilia were thought to be sensory organelles. the ability of motile cilia to move or beat is due to the differences in microtubule composition when compared to immotile primary cilia (figure 1d). all cilia are composed of a microtubule - core structure, the axoneme, and are encased in a membrane that is continuous with the plasma membrane. ciliary microtubule formation is nucleated at the basal body, an anchoring structure at the base of the cilium that originates from the centrioles. an intraflagellar transport (ift) system, consisting of several raft and motor proteins that move bi - directionally along the axoneme, is used to transport protein components from the cytoplasm to the ciliary tip. there are nine microtubule doublets connected by nexin links that circle the periphery of the cilium. motile cilia have one microtubule doublet in the center (the central pair), generating a 9 + 2 arrangement that is not found in non - motile cilia (which have a 9 + 0 arrangement). motile cilia also have two dynein arms, an inner and an outer (idas and odas, respectively), along the length of each microtubule doublet, which hydrolyze atp to generate movement ; these are also absent in non - motile cilia. a third category of cilia that shows characteristics intermediate between the two traditionally defined groups have been described at the embryonic node, a structure critical for establishing the first break of laterality in the body plan. these nodal cilia have a 9 + 0 arrangement and dynein arms, facilitating a rotational movement, which is different to the planar beating of motile cilia in other tissues. individuals with pcd have defects in the function of both motile and also nodal cilia, suggesting that similar mechanisms must lead to the rotational and beating movements. patients affected with pcd present primarily with neonatal respiratory distress and chronic sinopulmonary disease that may be accompanied by organ laterality defects (heterotaxy) and, later, male infertility. the sinopulmonary symptoms of pcd can be confused with other congenital diseases, such as cystic fibrosis (incidence of ~1:3500 births in populations of european descent). in the presence of clinical symptoms, a pcd diagnosis can be made through examination of the respiratory ciliary ultrastructure via electron microscopy, measurement of nasal nitric oxide levels, which are typically reduced in pcd patients [2224 ], and functional testing of pattern and frequency of ciliary movement using high - speed video imaging. pcd is genetically heterogeneous, with > 30 causative genes reported (table 1), accounting for ~65% of pcd cases. thus, for genetic testing to become a comprehensive diagnostic tool, additional genes need to be uncovered to account for pcd in the remaining ~35% of patients. different transmission electron microscopy (tem) defects were observed in different populations of pcd patients with mutations in ccdc151. microtubule disorganization was found in 5 - 15% of patients ; horani. did not observe any ultrastructural defects in their cohort of patients with ccdc65 mutations, suggesting that mutations in ccdc65 cause mild structural defects. defects were seen in a small proportion of cilia ; most ciliary ultrastructure appeared normal. ccno and mcidas cause a pcd - like phenotype classified as reduced generation of multiple motile cilia (rgmc). functional studies of the mutation and also investigation of the ultrastructural and ciliary beat phenotypes have not been reported. b, bronchiectasis ; drc, dynein regulatory complex ; ida, inner dynein arm ; oda, outer dynein arm ; om, otitis media ; na, not available ; nrd, neonatal respiratory distress ; ri, respiratory infection ; sd, situs defect ; here, we give an overview of pcd as a clinically distinct ciliopathy ; we highlight the advantages and disadvantages of the currently used diagnostic methods ; and we discuss how pcd gene discovery has improved our understanding of motile ciliary assembly. motile cilia are found on cells lining the airways of the nasal cavity, middle ear, paranasal sinuses and the lower respiratory tract. in addition, motile cilia are found on brain ventricular ependymal cells, and also line the fallopian tubes in women. thus, although less common than other pcd symptoms, reduced female fertility, possibly increased risk of ectopic pregnancy and hydrocephalus have been noted in some pcd patients [3035 ]. bronchiectasis, or lung disease, is an almost universal outcome of chronic sinusitis in pcd patients and can require lung transplantation, and chronic middle ear infections can lead to transient or permanent hearing loss. the presence of heterotaxy or complex changes to the arrangement of organs (12% of pcd patients) is also associated with complex cardiac malformations requiring surgery. early diagnosis of pcd and early treatment may help ameliorate some symptoms, and also prevent deterioration of lung function through regular physiotherapy and antibiotic treatment. in some instances, pcd can co - segregate with x - linked mental retardation caused by mutations in ofd1 (oral - facial - digital type 1), or with x - linked retinitis pigmentosa caused by rpgr depletion (table 1) [4245 ]. furthermore, a pcd - like phenotype caused by reduced generation of multiple motile cilia (rgmc) has been described, which is characterized by sinopulmonary symptoms and fertility defects similar to those observed in pcd patients. the residual motile cilia in rgmc caused by mutations in ccno show a normal ciliary beat, while the few remaining motile cilia in patients with rgmc caused by mcidas mutations are immotile. however, no situs defects have been observed in any patients with rgmc, thus suggesting that the function of nodal cilia is intact. the similarity of the respiratory symptoms of pcd with common childhood problems, and the lack of awareness of this rare disorder (prevalence of ~1 in 10,000) often impede early diagnosis. a recent study reported that the median age at diagnosis was ~5.3 years. by this time, there can already be considerable damage to the lung tissue in affected children if untreated. transmission electron microscopy (tem) of cilia from nasal brushings can identify defects in the ciliary structure, such as defective odas or disorganized microtubules. however, since ~30% of pcd patients do not show defects in ciliary structure, this method can not be used as an exclusive means to diagnose the disease. nasal brushings can be analyzed directly or can also be maintained in cell culture to assess ciliary movement by high - speed video microscopy. however, such analyses require specialized personnel and laboratories (as does tem) to look at cilia structure, and are not readily accessible to all patients. in addition, ciliary dysfunction can also be acquired from infections that result in inflammation, known as secondary ciliary dyskinesia (scd) [5456 ]. therefore, it is important to distinguish whether abnormalities in ciliary structure or function are due to pcd or scd. a relatively simple screening method is measurement of nitric oxide (no) levels in the nasal passage, which are reduced typically in pcd patients compared to healthy individuals. however, other conditions, such as cystic fibrosis and severe sinusitis, can also cause abnormally low levels of no, and the range of nasal no values that distinguish between pcd and these other conditions are yet to be standardized. in addition, some pcd - causing mutations may not result in nasal no levels low enough to offer a conclusive diagnosis. therefore, this test can provide a first pass screen for pcd in children > 5 years of age, rather than a diagnosis of the disorder. finally, dna sequencing to identify causal mutations is becoming the benchmark for diagnosis of several genetic disorders. the applicability of clinical genetic testing for pcd diagnosis is currently limited by the fact that pcd is highly genetically heterogeneous. the first gene shown to be mutated in individuals with pcd was dnai1, encoding an axonemal dynein intermediate chain. pennarun. used a candidate gene approach to screen a pcd cohort for dnai1 mutations because a chlamydomonas reinhardtii mutant bearing mutations in the orthologous gene showed flagella with a tem defect affecting odas similar to that observed in some pcd patients. pcd - related phenotypes uncovered initially and studied in model organisms, such as chlamydomonas, medaka, zebrafish, sea urchins, xenopus, mice and even dogs have led to the sequencing and identification of several causal pcd genes [60 - 67 ] (table 1). not surprisingly, many of these genes are structural components of the axoneme, involved in the composition of the odas or their attachment to microtubules (e.g. dnah5, txndc3, dnai2, dnal1, armc4, ccdc114, and ccdc151). mutations in these genes result typically in the complete or partial absence of the odas as observed by tem (figure 2), and corroborated by the complete or partial absence of oda markers, such as dnah5, dnai2 and dnah9 in affected axonemes [59,61,65,6880 ]. these ultrastructural ciliary defects are characteristic of mutations in genes involved at different steps of cilia assembly and function, including the assembly of the inner and outer dynein arms by cytoplasmic assembly factors. transmission electron microscopy (tem) images are shown of a control sample (a, reproduced with permission from elsevier) and patients with mutations in the following : b. dnah5, showing defective outer dynein arms (odas) (reproduced with permission from elsevier), c. ccdc40, showing defective inner dynein arms (idas) and nexin links (reproduced with permission from nature publishing group), d. lrrc50, showing missing idas and odas (reproduced with permission from elsevier), e. ccdc164, showing defects in the nexin- dynein regulatory complex (n - drc) (reproduced with permission from nature publishing group), and f. rsph1, showing missing central pair of microtubules (reproduced with permission from elsevier). in addition to aiding diagnosis, gene discovery has advanced our understanding of basic cellular processes underscoring ciliary biogenesis and function. this is exemplified by the discovery of ktu / dnaaf2, a locus that, when mutated, causes a loss of both the odas and idas, but is not detectable in the ciliary fraction of cell extracts. subsequent experiments showed that ktu is a cytoplasmic protein involved in the pre - assembly of both odas and idas before they are transported into the cilium (figure 2). this discovery introduced a novel paradigm to explain motile cilia formation ; prior to the implication of ktu in pcd, the existing repertoire of causal genes were structural components of the cilium and their site of assembly during ciliogenesis was not known. following ktu, nine other cytoplasmic proteins have been linked causally to pcd (ccdc103, dnaaf3, dnaaf1, lrrc6, heatr2, zmynd10, c21orf59, spag1, and dyx1c1 ; table 1). to date, mutations in all the cytoplasmic dynein assembly factors associated with pcd appear to cause defects in both the idas and odas according to tem (figure 2). this has also been shown by the absence, reduction or mislocalization of oda and ida markers, as visualized by the immunofluorescent evaluation of respiratory epithelial cells [60,63,66,81 - 89 ]. the identification of genes mutated in pcd cohorts displaying concomitant ida and central pair defects have elucidated the composition and roles of the nexin - dynein regulatory complex (n - drc) in ciliary formation (figure 2). isolated ida defects have not been reported in pcd ; rather, complete or partial absence of idas have thus far been associated with disorganization of peripheral microtubule doublets (in some instances, the central pair of microtubules may also be absent, displaced, or supernumerary). these defects are caused by mutations in proteins involved in the attachment of the idas to the microtubules, and in the assembly of the n - drc (ccdc40, ccdc39, and ccdc65 ; table 1) [64,67,88,90 - 93 ]. therefore the ida defects are also accompanied by defects in the n - drc, as visualized by the absence or reduction of n - drc marker proteins (such as gas11). this sub - group of pcd proteins is unique because, when rendered dysfunctional, they leave only odas unaffected ; as a result, the force - generating structures are intact, but lack the proper beat regulation likely conferred by the idas, the n - drc and central pair microtubules. mutations in a subset of proteins, primarily the components of the radial spokes (rsph1, rsph9, rsph4a, and hydin ; table 1), give rise to abnormalities in the central pair without affecting the odas or idas (figure 2). in contrast to individuals displaying the gamut of classic pcd symptoms that are caused by ida and n - drc defects, accompanied by central pair aberrations, patients carrying mutations that affect only the central pair of microtubules do not present with laterality defects. notably, accumulating clinical data from this pcd subcohort show that the movement of nasal epithelial cilia carrying a defective central pair of microtubules is circular, distinctly different from the planar beating of healthy cilia. this movement is reminiscent of that of nodal cilia, which do not have a central pair of microtubules. thus, a credible explanation for an absence of left - right asymmetry defects in patients harboring central pair abnormalities is that nodal cilia exhibit normal movement and beat frequency. while ciliary ultrastructural defects are a hallmark of pcd in the majority of patients, a significant fraction of individuals with clinical pcd symptoms present with normal ciliary structure (~30%), but abnormal function. of this subset, conservative estimates indicate that 22% of patients have biallelic mutations in dnah11, although one study that also considers the contribution of possibly pathogenic rare alleles estimates that as many as 70% of patients have candidate causal biallelic variants in this locus (table 1). it is intriguing that this gene codes for a component of the dynein heavy chain, although no adverse effects on ciliary structure, both via tem or immunofluorescence analysis, have been detected in patient respiratory epithelia. analysis of ciliary movement from individuals harboring dnah11 mutation, using high - speed video microscopy, shows a non - flexible and hyperkinetic pattern that is different to the nearly immotile cilia seen in patients with dnah5 or dnai1 mutations (abnormal oda ; figure 2), and more closely resembles that of disrupted n - drc. the normal ultrastructure of cilia in patients with dnah11 mutations was a key discovery in pcd biology as it indicated that not all instances of pcd manifested in ciliary structural defects. it also highlighted the need for several diagnostic avenues, such as high - speed microscopy to visualize cilia movement and identification of genetic mutations / lesions in addition to tem, in providing a clinical diagnosis. despite the differences in the ultrastructural phenotypes at the organellar level and the resulting ciliary beat differences in dnah11 versus dnah5 or dnai1 mutation - bearing individuals, loss of function mutations in any of these loci result in the classic pcd phenotype. one notable exception may be the observation by schwabe. that fertility does not seem to be affected in the presence of dnah11 mutations. since normal fertility was noted only in one male from one affected family, caution is warranted in concluding that this is a general characteristic of dnah11 mutations. however, it is possible that effects of ciliary gene mutations differ between motile cilia in respiratory epithelia and sperm flagella. this notion is supported by the reported differences in axoneme composition, specifically the dynein heavy chain subunits, between these two types of cilia. in addition, mutations in another gene (ccdc114) have also been shown to cause pcd without an overt infertility phenotype (table 1). together, these observations suggest that the ultrastructural differences resulting from different pcd mutations result in similar end phenotypes in patients, with the noted exceptions of situs defects and fertility. although an individual 's clinical pcd symptoms may not be sufficient to elucidate which group of genes may harbor mutations, the tem and immunofluorescence analysis of cilia structure can be helpful in narrowing the pool of candidates. for example, defects in both odas and idas are indicative of underlying mutations in cytoplasmic dynein assembly factors ; and the absence of any ultrastructural defect in the presence of pcd - like symptoms suggests the increased likelihood of mutations in dnah11 or other genes that have been associated with subtle or unappreciable tem defects, such as ccdc65, ccdc164 or hydin. correlations of axonemal ultrastructure and functional output data with gene groups stratified by function have been used to direct sequencing efforts and facilitate diagnosis. the majority of mutations reported in pcd patients are null alleles (frameshift or nonsense). characterized a missense mutation in zmynd1 (v16 g) as a hypomorph in cell - based assays and in drosophila models. however, even though cilia from patients homozygous for v16 g retained some motility, the clinical phenotypes of these patients were similar to those of pcd individuals harboring null alleles. similarly, knowles. reported leaky expression of the full - length mrna in a patient with two splicing mutations in ccdc114, suggesting that the alleles had residual function, although the patient 's phenotype was indistinguishable from that of patients with dnai1 or dnah5 mutations. panizzi. determined, through functional studies in zebrafish, that a missense mutation in ccdc103 (h154p) identified in pcd patients was a hypomorph. even so, the clinical data from the ccdc103 mutation - bearing patients were consistent with full pcd diagnostic criteria. together, these observations suggest that the tolerance threshold for motile ciliary perturbations is low, and that correlations between pcd protein function and disease phenotypes may be imperfect. a study comparing different types of mutations in dnah5 concluded that two mutations causing premature termination of translation resulted in a complete loss of the odas in those patients, while cilia with a splicing mutation in dnah5 had a partial absence of odas. however, how these ultrastructural defects correlated with the clinical symptoms of the patients carrying these mutations was not provided. therefore, more studies that compare the severity of mutations through functional tests and the clinical phenotypes of patients are needed to understand the contributions of mild versus severe mutations to the pcd phenotype. hundreds of genes have been implicated in motile cilia structure and function, thus representing a sizeable repertoire of candidate genes that could be involved in pcd etiology. gene discovery in the pcd field has accelerated, as whole exome and whole genome sequencing (wes / wgs) have become increasingly affordable and widely used. over half of the causal pcd genes (16) have been uncovered within the last 4 years, compared to nine that were implicated in the 11 years after the association of dnai1 with the disease (table 1). as more patient cohorts are sequenced, we will likely discover new candidate genes to account for the 35% of the remaining patient population with an unresolved molecular genetic diagnosis. despite the genetic heterogeneity underlying pcd, the patient phenotypes reported are largely similar, with few examples of gene- or mutation - specific differences (table 1). the exceptions include an absence of situs defects and infertility. in a recent study, knowles. observed that their cohort of patients with mutations in rsph1 had mild pcd phenotypes, which included a lower incidence of neonatal respiratory distress, later onset of respiratory problems, better lung function and higher nasal no levels when compared to patients with mutations in dnah11. in general, the phenotype of patients with rsph1 mutations is milder, compared to pcd patients with mutations that cause ultrastructural defects affecting the inner or outer dynein arms. an earlier study, however, did not find significantly milder phenotypes in patients with rsph1 mutations. nevertheless, the rsph1 observation is notable ; it is among the few reports of a possible genotype - phenotype correlation in pcd and it highlights the importance of having comprehensive and quantitative clinical data to enable comparisons between groups of patients. in comparison to the primary ciliopathies, we note with interest that a significant proportion of variants associated causally with pcd genes are null mutations. is this observation due to an ascertainment bias in which severe, syndromic patients undergo molecular analysis ? pcd cohorts in genetic studies are diagnosed typically based on clinical symptoms and cilia structure / function analysis. however, this approach can be problematic, as many of these symptoms can be due to other causes. it is possible that residual activity in many of the pcd - causing genes is sufficient to spare the organism from pathology, or that the hypomorph of pcd might be a completely different disorder, a paradigm well - described for the primary ciliopathies. consistent with the lack of clinical variability in pcd, and despite the accumulating evidence for oligogenic phenomena contributing to the phenotypic variability observed in the primary ciliopathies, genetic interactions in pcd have been essentially unexplored. one possibility is that mutations in pcd genes have an all or none effect on motile ciliary function, such that an increase in the number of mutations in ciliary genes is not expected to exacerbate the clinical phenotype. the fact that mutations in most causal pcd genes produce the classic pcd phenotype argues in favor of this possibility. alternatively, the concept of ciliary gene mutational load can not be excluded as a contributor to the phenotype in some patients. the exacerbation of the phenotypic severity or the manifestation of certain endophenotypes by the genetic interaction of two or more ciliary gene mutations is a well - established phenomenon in other ciliopathies. to appreciate what role, if any, genetic interaction plays in pcd, we need a detailed understanding of genotype - phenotype correlations both within pcd pedigrees with multiple affected individuals, and also among unrelated individuals who harbor mutations at the same locus. additionally, unbiased approaches, such as wes and wgs, are required to identify the primary driver of pcd mutations as well as potential phenotypic modifier mutations. looking forward, a key goal is to identify more causal pcd genes that can improve the diagnostic power when combined with other approaches, such as tem and ciliary function analysis. moreover, the continued standardization and improved quantitative means of reporting clinical phenotyping will aid our ability to make informed correlations between mutational burden and phenotype, both within and across families. we anticipate that the continued intersection of robust in vivo and in vitro tools with comprehensive genetic and clinical data will ultimately decrease time to diagnosis and improve clinical outcomes for this life - threatening disorder.	primary ciliary dyskinesia (pcd) is a ciliopathy, but represents the sole entity from this class of disorders that results from the dysfunction of motile cilia. characterized by respiratory problems appearing in childhood, infertility, and situs defects in ~50% of individuals, pcd has an estimated prevalence of approximately 1 in 10,000 live births. the diagnosis of pcd can be prolonged due to a lack of disease awareness, coupled with the fact that symptoms can be confused with other more common genetic disorders, such as cystic fibrosis, or environmental insults that result in frequent respiratory infections. a primarily autosomal recessive disorder, pcd is genetically heterogeneous with > 30 causal genes identified, posing significant challenges to genetic diagnosis. here, we provide an overview of pcd as a disorder underscored by impaired ciliary motility ; we discuss the recent advances towards uncovering the genetic basis of pcd ; we discuss the molecular knowledge gained from pcd gene discovery, which has improved our understanding of motile ciliary assembly ; and we speculate on how accelerated diagnosis, together with detailed phenotypic data, will shape the genetic and functional architecture of this disorder.
in recent studies, drug - eluting stents (des) were more widely used than bare - metal stents (bms) in patients who underwent percutaneous coronary intervention (pci).1 recently, several significant complications after implantation of des have been reported, and stent thrombosis (st) is a rare but fatal complication among them. discontinuation of dual antiplatelet therapy is known to be a risk factor for st in patients after implantation of des.2 - 4 therefore, dual antiplatelet therapy is recommended to be maintained for at least 12 months after stent implantation to prevent late stent thrombosis (lst) or very late stent thrombosis (vlst). however, it is still unclear how long dual antiplatelet therapy is needed and when the antiplatelet therapy can be safely stopped. here we report a case of a patient with acute myocardial infarction due to vlst that occurred 1 week after discontinuation of 5 years of dual antiplatelet therapy after implantation of a sirolimus - eluting stent. a man with no risk factors for coronary artery disease except smoking underwent pci in may 2005 at age 44. a 3.023 mm cypher stent was deployed in the proximal right coronary artery. seven days after the discontinuation of clopidogrel, he experienced severe chest pain and was transported to the emergency room by ambulance. a physical examination revealed a temperature of 36.0, blood pressure of 90/60 mmhg, and a regular heart rate of 100 beats / min without murmur or gallop. pulmonary rales, peripheral edema, or other clinical signs of congestive heart failure were not present. an electrocardiogram revealed st - segment elevation in lead ii, iii, and avf. the peak level of creatine kinase (ck) was 1,334 u / l, ck - mb was 75.4 u / l, and troponin - i was 38.1 ng / ml. transthoracic echocardiography in the emergency room revealed inferior wall akinesia, and his ejection fraction was 45%. the patient received 300 mg of aspirin and 600 mg of clopidogrel as a loading dose and was transferred to the cardiac catheterization laboratory. his pain to door time was about 60 minutes, and the door to balloon time was 72 minutes. an emergent coronary angiogram revealed a thrombotic total occlusion at the proximal right coronary artery (fig. the occluded right coronary artery was revascularized successfully by balloon angioplasty with a 3.020 mm balloon (fig. after pci, ultegra rapid platelet function assay (rpfa)-asa and ultegra rpfa - p2y12 (verifynowassay) were performed to determine aspirin and clopidogrel resistance. the patient was discharged uneventfully and followed up with dual antiplatelet therapy of aspirin and clopidogrel. there have been no adverse events with clinical follow - up for 1 year, and a follow - up coronary angiogram revealed no significant stent restenosis. des interrupt re - endothelialization of the vessels, which results in a lower rate of target lesion revascularization than with bms. long and multiple stents, stent under - expansion or stent malposition, residual dissection, and resistance to aspirin and clopidogrel have been suggested as other possible causes of st.5 - 7 several studies revealed a higher rate of lst and vlst after des implantation than after bms implantation. dual antiplatelet therapy reduces subacute thrombotic events after pci, and at least 12 months of dual antiplatelet therapy after pci is recommended in the current guidelines to prevent st. whether long - term maintenance of dual antiplatelet therapy can prevent lst or vlst is still controversial. park reported that clopidogrel continuation beyond 1 year did not appear to decrease stent thrombosis and clinical events after des implantation,8 although tanzili concluded that 2 years of dual antiplatelet therapy can prevent the occurrence of vlst after des implantation.9 triple antiplatelet therapy adding cilostazol is considered to be another choice for preventing stent thrombosis in patients with clopidogrel resistance or for the prevention of recurrent stent thrombosis. the disadvantage of triple therapy is the bleeding tendency, but the bleeding tendency of triple therapy was reported to be not much higher than that of dual antiplatelet therapy in several studies. however, the effect of triple therapy on long - term survival or cardiac events is controversial as well.10,11 in this patient, there were no risk factors for st except former smoking and no evidence of aspirin or clopidogrel resistance. the patient had been treated with dual antiplatelet agents for enough time (5 years) after des implantation, but vlst occurred at 1 week after discontinuation of clopidogrel. we concluded that 12 months of dual antiplatelet therapy may not be enough for the prevention of lst or vlst after des implantation in some patients who do not show complete re - endothelialization of the coronary artery. concerning the decision to cease clopidogrel therapy, we suggest that it should depend on the condition of the patient and risk factors for st such as underlying disease, the length or location of the lesion, the resistance of aspirin or clopidogrel, and so on. perhaps the development of imaging systems such as optical coherence tomography will give us more precise information. we suggest that physicians educate their patients about the hazards of premature cessation of dual antiplatelet therapy and delay performing surgical procedures until 1 year after implantation of des.	drug - eluting stents (des) have reduced the rate of repeated revascularization of target lesions. for this reason, des are considered to be superior to bare - metal stents in reducing the restenosis rate. however, some problems have been reported after implantation of des. one of them, stent thrombosis, has arisen as a fatal complication. dual antiplatelet therapy is recommended for at least 12 months after implantation of des to prevent stent thrombosis. here, we report a case of very late stent thrombosis that occurred 1 week after discontinuation of clopidogrel at 5 years (1832 days) after implantation of a sirolimus - eluting stent.
twelve women (median age, 56 y ; range, 46 - 69 y ; 9 white and 3 african american) were enrolled in an ongoing, open - label, single - site feasibility study of hirrem for individuals with diverse psychophysiological conditions. procedures were approved by the wake forest university health sciences institutional review board, and all participants provided a written informed consent form. hot flash symptoms were reported by all participants and documented by use of a daily hot flash diary. individuals with a history of known sleep apnea, restless legs / periodic leg movement disorder, seizure disorder, or severe hearing impairment ; a need for ongoing treatment with opiates, benzodiazepines, or antipsychotic medications ; or ongoing use of recreational drugs or alcohol were excluded. after meeting eligibility criteria, each participant completed a pre - hirrem visit for enrollment and data collection, a baseline hirrem assessment, a series of hirrem sessions, and a post - hirrem data collection visit. procedures for the provision of hirrem have been discussed in detail previously.13 self - reported comorbidities before starting the hirrem sessions, each participant underwent a baseline hirrem assessment, which obtained information regarding brain electrical frequencies and amplitudes. the baseline assessment consisted of very brief recordings of brainwaves obtained from at least six standard locations on the scalp (f3/f4, c3/c4, p3/p4, t3/t4, fz / oz, and o1/o2), with the recipient at rest and carrying out a task. the assessment includes 1-minute recordings at each location with eyes closed, eyes partially open, and eyes open while performing a specific mental task appropriate for the location (ie, recalling numbers, reading a passage, etc). this assessment (45 min) allows for identification of the relative balance between homologous brain regions and for the proportionation or distribution of amplitudes among different frequency bands at each location. hirrem was received as a series of sessions lasting approximately 90 minutes (range, 54 - 102 min), consisting of four to nine individualized protocols, and addressing multiple brain locations and frequencies. some protocols were performed with eyes closed and some with eyes open, with the participant sitting or reclining comfortably in a chair. the hirrem sessions were scheduled to maximize frequency and efficiency, with participants generally completing two sessions in half a day separated by a 20- to 30-minute break. because hirrem is a unique, individualized process for each recipient, the specific protocols and session lengths vary between participants. certified hirrem technologists set session frequency and identified protocols (a combination of sensor montage and specific software design to address multiple locations and frequency bands during each session) to facilitate balance and proportionation between and within cortical regions, based on data from the initial assessment or the preceding hirrem sessions, as previously reported.15 during protocols, a proprietary mathematical algorithm selected the specific auditory tone to be reflected back to the participant by identifying the dominant frequency through high - resolution spectral analysis of noninvasively recorded real - time brain electrical activity. the dominant frequency was translated into an auditory tone and presented bilaterally, simultaneously, to the participant through earphones (creative ep-630 or sony stereo headphones mdr - ex58v) with a delay of as little as 8 milliseconds. the primary outcomes for this analysis included changes in hot flash scores from baseline to post - hirrem and serial values for the sum of high - frequency amplitudes at t3 and t4. secondary outcomes included self - report insomnia (insomnia severity index [isi ]) and depression (center for epidemiological studies depression scale [ces - d ]) questionnaires at baseline and after the hirrem intervention. hot flash diaries provide a valid and reliable approach to understanding a participant s experience of hot flashes.16 diaries measure the daily frequency (number of hot flashes) and severity of each hot flash. hot flash severity categories are as follows : 1, mild ; 2, moderate ; 3, severe ; 4, very severe. the hot flash severity score for each day was calculated as the sum of the number of hot flashes within each severity category, multiplied by the severity score for that category, with the resulting sum divided by the total number of hot flashes. participants were asked to complete a paper - and - pencil hot flash diary for up to 1 week before beginning the hirrem sessions to provide a more accurate reflection of the baseline pattern of hot flashes. postintervention hot flash scores were derived from the final day of reporting available for each individual participant. serial values for the sums of high - frequency amplitudes (23 - 36 hz) at t3/t4 (v) were evaluated by analysis of 1-minute epochs of brain electrical data recorded during the hirrem assessment at baseline and during the penultimate minute of the first four hirrem sessions and the last four hirrem sessions. analysis focused on high - frequency amplitudes at the temporal regions (sum of amplitudes at t3 and t4) owing to their proximity to underlying cortical regions implicated in autonomic regulation, with notation of change in values from baseline to the final hirrem session. the isi is a seven - item survey that assesses the severity, nature, and impact of insomnia symptoms on quality of life in the previous 2 weeks.17 it is scored on a five - point likert scale from 0 (no problem) to 4 (very severe problem) on a composite score range from 0 to 28. composite scores can be stratified into the following clinical severities of insomnia : absent (0 - 7), subthreshold (8 - 14), moderate (15 - 21), and severe (22 - 28).18 the internal consistency for isi was 0.74, and a correlation with sleep diaries was also established.19 the ces - d is a 20-item survey that assesses affective depressive symptoms to screen for risk of depression.20 each question identifies a depressive symptom and is scored on a four - point likert scale from 0 (rarely ; < 1 d / wk) to 3 (most or all of the time ; 5 - 7 d / wk). participants were instructed to respond based on how they have felt during the past week. the cumulative score ranges from 0 to 60, with a score of 16 commonly used as a clinically relevant cutoff.21 its internal consistency varies by demographics, with coefficients between 0.60 and 0.90 and with 3-month test - retest validity higher than 0.60.22,23 continuous blood pressure and heart rate data were acquired from noninvasive finger arterial pressure measurements for a minimum of 5 minutes while participants were in supine position. systolic blood pressure and r - r interval files (biopac acquisition software ; biopac systems, santa barbara, ca) acquired at 1,000 hz were analyzed using nevrokard baroreflex sensitivity software (medistar, ljubljana, slovenia) for measures of baroreflex sensitivity (as low - frequency and high - frequency indices ; sequence baroreflex sensitivity), heart rate variability, and blood pressure variability as power of systolic blood pressure spectra calculated as low - frequency systolic arterial pressure and sd of the mean arterial pressure. specific heart rate variability measures included the power of r - r interval spectra in low and high frequency ranges, the sd of beat - to - beat r - r interval, and the root mean square of successive beat - to - beat differences in r - r interval duration. data are summarized as sample frequencies and median / interquartile ranges. changes from baseline to the post - hirrem data collection visit were evaluated using wilcoxon signed rank test. spaghetti plots were used to illustrate longitudinal trajectories for the diary - based hot flash scores during the course of the hirrem intervention.24 all analyses were performed using the r statistical computing environment.25 before starting the hirrem sessions, each participant underwent a baseline hirrem assessment, which obtained information regarding brain electrical frequencies and amplitudes. the baseline assessment consisted of very brief recordings of brainwaves obtained from at least six standard locations on the scalp (f3/f4, c3/c4, p3/p4, t3/t4, fz / oz, and o1/o2), with the recipient at rest and carrying out a task. the assessment includes 1-minute recordings at each location with eyes closed, eyes partially open, and eyes open while performing a specific mental task appropriate for the location (ie, recalling numbers, reading a passage, etc). this assessment (45 min) allows for identification of the relative balance between homologous brain regions and for the proportionation or distribution of amplitudes among different frequency bands at each location. hirrem was received as a series of sessions lasting approximately 90 minutes (range, 54 - 102 min), consisting of four to nine individualized protocols, and addressing multiple brain locations and frequencies. some protocols were performed with eyes closed and some with eyes open, with the participant sitting or reclining comfortably in a chair. the hirrem sessions were scheduled to maximize frequency and efficiency, with participants generally completing two sessions in half a day separated by a 20- to 30-minute break. because hirrem is a unique, individualized process for each recipient, the specific protocols and session lengths vary between participants. certified hirrem technologists set session frequency and identified protocols (a combination of sensor montage and specific software design to address multiple locations and frequency bands during each session) to facilitate balance and proportionation between and within cortical regions, based on data from the initial assessment or the preceding hirrem sessions, as previously reported.15 during protocols, a proprietary mathematical algorithm selected the specific auditory tone to be reflected back to the participant by identifying the dominant frequency through high - resolution spectral analysis of noninvasively recorded real - time brain electrical activity. the dominant frequency was translated into an auditory tone and presented bilaterally, simultaneously, to the participant through earphones (creative ep-630 or sony stereo headphones mdr - ex58v) with a delay of as little as 8 milliseconds. the primary outcomes for this analysis included changes in hot flash scores from baseline to post - hirrem and serial values for the sum of high - frequency amplitudes at t3 and t4. secondary outcomes included self - report insomnia (insomnia severity index [isi ]) and depression (center for epidemiological studies depression scale [ces - d ]) questionnaires at baseline and after the hirrem intervention. hot flash diaries provide a valid and reliable approach to understanding a participant s experience of hot flashes.16 diaries measure the daily frequency (number of hot flashes) and severity of each hot flash. hot flash severity categories are as follows : 1, mild ; 2, moderate ; 3, severe ; 4, very severe. the hot flash severity score for each day was calculated as the sum of the number of hot flashes within each severity category, multiplied by the severity score for that category, with the resulting sum divided by the total number of hot flashes. participants were asked to complete a paper - and - pencil hot flash diary for up to 1 week before beginning the hirrem sessions to provide a more accurate reflection of the baseline pattern of hot flashes. postintervention hot flash scores were derived from the final day of reporting available for each individual participant. serial values for the sums of high - frequency amplitudes (23 - 36 hz) at t3/t4 (v) were evaluated by analysis of 1-minute epochs of brain electrical data recorded during the hirrem assessment at baseline and during the penultimate minute of the first four hirrem sessions and the last four hirrem sessions. analysis focused on high - frequency amplitudes at the temporal regions (sum of amplitudes at t3 and t4) owing to their proximity to underlying cortical regions implicated in autonomic regulation, with notation of change in values from baseline to the final hirrem session. hot flash diaries provide a valid and reliable approach to understanding a participant s experience of hot flashes.16 diaries measure the daily frequency (number of hot flashes) and severity of each hot flash. hot flash severity categories are as follows : 1, mild ; 2, moderate ; 3, severe ; 4, very severe. the hot flash severity score for each day was calculated as the sum of the number of hot flashes within each severity category, multiplied by the severity score for that category, with the resulting sum divided by the total number of hot flashes. participants were asked to complete a paper - and - pencil hot flash diary for up to 1 week before beginning the hirrem sessions to provide a more accurate reflection of the baseline pattern of hot flashes. postintervention hot flash scores were derived from the final day of reporting available for each individual participant. serial values for the sums of high - frequency amplitudes (23 - 36 hz) at t3/t4 (v) were evaluated by analysis of 1-minute epochs of brain electrical data recorded during the hirrem assessment at baseline and during the penultimate minute of the first four hirrem sessions and the last four hirrem sessions. analysis focused on high - frequency amplitudes at the temporal regions (sum of amplitudes at t3 and t4) owing to their proximity to underlying cortical regions implicated in autonomic regulation, with notation of change in values from baseline to the final hirrem session. the isi is a seven - item survey that assesses the severity, nature, and impact of insomnia symptoms on quality of life in the previous 2 weeks.17 it is scored on a five - point likert scale from 0 (no problem) to 4 (very severe problem) on a composite score range from 0 to 28. composite scores can be stratified into the following clinical severities of insomnia : absent (0 - 7), subthreshold (8 - 14), moderate (15 - 21), and severe (22 - 28).18 the internal consistency for isi was 0.74, and a correlation with sleep diaries was also established.19 the ces - d is a 20-item survey that assesses affective depressive symptoms to screen for risk of depression.20 each question identifies a depressive symptom and is scored on a four - point likert scale from 0 (rarely ; < 1 d / wk) to 3 (most or all of the time ; 5 - 7 d / wk). participants were instructed to respond based on how they have felt during the past week. the cumulative score ranges from 0 to 60, with a score of 16 commonly used as a clinically relevant cutoff.21 its internal consistency varies by demographics, with coefficients between 0.60 and 0.90 and with 3-month test - retest validity higher than 0.60.22,23 continuous blood pressure and heart rate data were acquired from noninvasive finger arterial pressure measurements for a minimum of 5 minutes while participants were in supine position. systolic blood pressure and r - r interval files (biopac acquisition software ; biopac systems, santa barbara, ca) acquired at 1,000 hz were analyzed using nevrokard baroreflex sensitivity software (medistar, ljubljana, slovenia) for measures of baroreflex sensitivity (as low - frequency and high - frequency indices ; sequence baroreflex sensitivity), heart rate variability, and blood pressure variability as power of systolic blood pressure spectra calculated as low - frequency systolic arterial pressure and sd of the mean arterial pressure. specific heart rate variability measures included the power of r - r interval spectra in low and high frequency ranges, the sd of beat - to - beat r - r interval, and the root mean square of successive beat - to - beat differences in r - r interval duration. the isi is a seven - item survey that assesses the severity, nature, and impact of insomnia symptoms on quality of life in the previous 2 weeks.17 it is scored on a five - point likert scale from 0 (no problem) to 4 (very severe problem) on a composite score range from 0 to 28. composite scores can be stratified into the following clinical severities of insomnia : absent (0 - 7), subthreshold (8 - 14), moderate (15 - 21), and severe (22 - 28).18 the internal consistency for isi was 0.74, and a correlation with sleep diaries was also established.19 the ces - d is a 20-item survey that assesses affective depressive symptoms to screen for risk of depression.20 each question identifies a depressive symptom and is scored on a four - point likert scale from 0 (rarely ; < 1 d / wk) to 3 (most or all of the time ; 5 - 7 d / wk). participants were instructed to respond based on how they have felt during the past week. the cumulative score ranges from 0 to 60, with a score of 16 commonly used as a clinically relevant cutoff.21 its internal consistency varies by demographics, with coefficients between 0.60 and 0.90 and with 3-month test - retest validity higher than 0.60.22,23 continuous blood pressure and heart rate data were acquired from noninvasive finger arterial pressure measurements for a minimum of 5 minutes while participants were in supine position. systolic blood pressure and r - r interval files (biopac acquisition software ; biopac systems, santa barbara, ca) acquired at 1,000 hz were analyzed using nevrokard baroreflex sensitivity software (medistar, ljubljana, slovenia) for measures of baroreflex sensitivity (as low - frequency and high - frequency indices ; sequence baroreflex sensitivity), heart rate variability, and blood pressure variability as power of systolic blood pressure spectra calculated as low - frequency systolic arterial pressure and sd of the mean arterial pressure. specific heart rate variability measures included the power of r - r interval spectra in low and high frequency ranges, the sd of beat - to - beat r - r interval, and the root mean square of successive beat - to - beat differences in r - r interval duration. changes from baseline to the post - hirrem data collection visit were evaluated using wilcoxon signed rank test. spaghetti plots were used to illustrate longitudinal trajectories for the diary - based hot flash scores during the course of the hirrem intervention.24 all analyses were performed using the r statistical computing environment.25 participants had a median of 13 (range, 8 - 23) hirrem sessions (90 min each) administered for a median of 9.5 days (range, 4 - 32 d). all participants returned for a follow - up data collection visit at a median of 10 days (range, 0 - 20 d) after completion of their final hirrem session. participants maintained the hot flash diary for a median of 3.5 days (range, 1 - 11 d) before starting the hirrem sessions. the median change in hot flash severity score was 0.97 (range, 3.00 to 1.00 ; p = 0.015). figure 1a, b illustrates changes in hot flash severity score for each individual participant during the period of her diary recordings. general inspection shows that much of the benefits associated with hirrem accrued quickly, within the first 7 days of the beginning of the intervention. changes in hot flash (hf) severity scores across time as a percentage of baseline score for the entire cohort (a) and with focus on the 0% to 150% range that included most participants (b). the x axis indicates the number of days since the start of high - resolution, relational, resonance - based, electroencephalic mirroring (hirrem) sessions. the median total t3/t4 high - frequency amplitude was 8.44 v (range, 6.27 - 16.66 v) at baseline, decreasing by a median of 2.96 v (range, 11.05 to 0.65 ; p = 0.0005) by the final hirrem session. figure 2a, b provides an example (from one study participant) of the type of changes generally seen in high - frequency amplitudes, with initially high amplitudes in high - frequency ranges (fig. a, b : fast fourier transform spectral display of electroencephalic data with frequency (hz ; central y axis) plotted against transformed amplitude (v ; x axis). data represent 1 minute of data from the t3/t4 montage with eyes closed at baseline assessment (a) and at the penultimate minute of the final session (b) for one participant (a woman aged 47 y). note the change in amplitudes in the range 23 to 36 hz (dark purple) outlined by red boxes. symptom scales for insomnia and depression saw a decrease in median scores post - hirrem. at baseline, participants had a median isi score of 16 (range, 4 - 27) and a median decrease of 8.5 (range, 20 to 1 ; p = 0.022). ten of 12 participants reported at least subthreshold insomnia (isi score 8) at baseline. eight of these 10 participants reported no insomnia post - hirrem (table 2). changes in clinical category for insomnia after hirrem, by isi score baseline ces - d scores showed a median value of 14 (range, 3 - 36) with a median change of 5.5 (range, 32 to 8 ; p = 0.015). six of 12 participants reported clinically relevant depressive symptoms (ces - d score 16) at baseline. four of these six participants reported depressive symptoms below the clinically relevant threshold post - hirrem. one participant who reported subthreshold depressive symptoms at baseline (ces - d score, 11) indicated clinically relevant symptoms of depression after the intervention (ces - d score, 19). in this open - label study, use of hirrem by perimenopausal and postmenopausal women was associated, on average, with significant reductions in hot flash frequency and severity, decreased symptoms of insomnia and depression, and decreased amplitudes in the high - frequency range of brain electrical activity, as measured from bilateral temporal scalp recordings. interpretation of our findings is limited by the sample size of the study, the absence of a control group, and the lack of long - term follow - up. a current model for the genesis of vasomotor symptoms focuses on changes in the thermoregulatory neutral zone, as defined by the hypothalamus.26 in this model, vasomotor symptoms result from a narrowing between the upper limits and the lower limits of body temperature, producing sweating and shivering, respectively. narrowing of the thermoregulatory neutral zone is in turn explained as a consequence of the changing rhythms of ovarian steroid circulation and their influence on neurotransmitter activity in the hypothalamus, serotonergic system, and noradrenergic system.12 noradrenergic systems are demonstrated to contribute to hot flashes. injection of yohimbine, an 2 antagonist that increases norepinephrine availability, produces increased vasomotor symptoms.27 in contrast, noradrenergic reuptake inhibitors have been shown to be efficacious for reducing vasomotor symptoms, suggesting that restoring norepinephrine levels is a way to stabilize thermoregulatory mechanisms.11 these divergent effects seem to be further confirmation of the brain adaptation model for menopausal symptoms in that the role of brain norepinephrine in vasomotor symptoms may lie not on its absolute excess or deficiency but on irregular fluctuations in the dynamics of its availability and activity. hirrem helps the brain to self - optimize activity patterns toward more flexibly adaptive and recipient - unique set points, in contrast to pharmacological agents that stabilize the brain by clamping neurotransmitters at relatively fixed activity levels. the findings from this study are consistent with the idea that hirrem may support symptom reduction by facilitating shifts in brain electrical activity patterns toward adaptively lower amplitudes in the high - frequency range. increased amplitudes in the high - frequency range of brain electrical activity are observed not only in menopause14 but also in insomnia.28 we did not find changes in autonomic cardiovascular control, although such changes may be more reliably detected by recording autonomic activity in direct association with a hot flash event, as has been performed by others.29 the speed with which clinical changes were reported by study participants stands in contrast with other studies of relaxation techniques, in which benefits were typically not measured or demonstrated for at least 4 weeks after the start of the intervention.7 the rapidity of benefits in the current study was similar to our observations in a clinical trial of hirrem for individuals with insomnia13 and, preliminarily, may offer further evidence that self - optimization of brain activity at the cortex could be a viable upstream approach to achieving health objectives. the current feasibility results do not allow for an evaluation of the duration of effects. prior studies showed a persistent reduction in symptoms of insomnia at 1 month after hirrem completion13 and a clinically relevant reduction in probability of headache at 2 months after hirrem completion in a cohort with episodic migraine.30 future controlled trials should include a delay in collection of primary outcomes to allow for resolution of placebo effect and to assess duration of benefits. recent null findings from studies of alternative techniques for reducing menopausal symptoms have led to a sense of frustration.31 the data from this exploratory study suggest that hirrem merits further study in controlled trials with longer follow - up to support the brain adaptation process undergone by women in menopause.	abstractobjectiveincreased amplitudes in high - frequency brain electrical activity are reported with menopausal hot flashes. we report outcomes associated with the use of high - resolution, relational, resonance - based, electroencephalic mirroring a noninvasive neurotechnology for autocalibration of neural oscillations by women with perimenopausal and postmenopausal hot flashes.methodstwelve women with hot flashes (median age, 56 y ; range, 46 - 69 y) underwent a median of 13 (range, 8 - 23) intervention sessions for a median of 9.5 days (range, 4 - 32). this intervention uses algorithmic analysis of brain electrical activity and near real - time translation of brain frequencies into variable tones for acoustic stimulation. hot flash frequency and severity were recorded by daily diary. primary outcomes included hot flash severity score, sleep, and depressive symptoms. high - frequency amplitudes (23 - 36 hz) from bilateral temporal scalp recordings were measured at baseline and during serial sessions. self - reported symptom inventories for sleep and depressive symptoms were collected.resultsthe median change in hot flash severity score was 0.97 (range, 3.00 to 1.00 ; p = 0.015). sleep and depression scores decreased by 8.5 points (range, 20 to 1 ; p = 0.022) and 5.5 points (range, 32 to 8 ; p = 0.015), respectively. the median sum of amplitudes for the right and left temporal high - frequency brain electrical activity was 8.44 v (range, 6.27 - 16.66) at baseline and decreased by a median of 2.96 v (range, 11.05 to 0.65 ; p = 0.0005) by the final session.conclusionshot flash frequency and severity, symptoms of insomnia and depression, and temporal high - frequency brain electrical activity decrease after high - resolution, relational, resonance - based, electroencephalic mirroring. larger controlled trials with longer follow - up are warranted.
remote magnetic navigation (mn) for atrial fibrillation (af) catheter ablation is efficient and provides increased comfort for the operators. despite the lack of randomized trials, mn seems to be associated with less peri - procedural complications compared with manual technique. the latest generation of mn system (niobe es, stereotaxis ; stx) allows faster remote manipulation of a soft catheter by means of a steerable magnetic field. it may be coupled with two types of catheter advancement systems : one that fully controls both the catheter and a robotic deflectable sheath (rsh) or one which is a catheter - only advancement system (cas) using a standard fixed - curve sheath. between january 2012 and december 2013 consecutive patients who underwent af ablation using mn coupled with the rsh (rsh group), were prospectively included. the control group consisted of consecutive af ablation cases with mn combined with a fixed - curve sheath and a cas in our centre before the availability of rsh (cas group). this study was approved by the institutional committee on human research. according to institutional guidelines all patients received anticoagulation therapy with vitamin k antagonists (vka) for at least 1 month before the procedure (target international normalized ratio, inr, 23). transoesophageal echocardiography was performed within the procedure to exclude left atrium (la) thrombus and to guide transseptal puncture. were introduced (i) a deflectable decapolar catheter positioned within the coronary sinus with the distal electrode positioned at 45 o'clock along the mitral annulus in the 30 left anterior oblique radiographic projection ; (ii) a 20 pole, variable diameter circumferential mapping catheter to guide pulmonary vein isolation (pvi) (lasso 2550, biosense webster inc.) introduced within a long sheath (preface multipurpose, biosense webster inc. or fast - cath sl1) ; and (iii) a 3.5 mm tip externally irrigated magnetic catheter (thermocool rmt, biosense webster inc.) within a second long sheath. the second long sheath was the robotic deflectable sheath (rsh group, figure 1) or a standard fixed - curve long sheath (fast - cath sl1) in the cas group. figure 1the robotic deflectable sheath (v - cas deflect) fully undeflected (left panel) and fully deflected (right panel). the robotic deflectable sheath (v - cas deflect) fully undeflected (left panel) and fully deflected (right panel). two separate transseptal punctures were performed under combined fluoroscopic and real - time transoesophageal echocardiography guidance. immediately before the first transseptal puncture, additional heparin boluses were given if necessary to maintain the act between 300 and 350 s. ablation strategy was circumferential antral pvi (cpvi) in paroxysmal af (paf) with lasso - proven pvi as an endpoint. radiofrequency (rf) was delivered in a point - by - point manner with minimum 30 s burns (aiming electrograms (egms) modification favouring transmural lesion) at each ablation site. robotic deflectable sheath loop in the la was systematically used for targeting the ostia of the right pv (figure 2). a stepwise approach was used for persistent af patients, with additional lesions targeting fractionated egms in the la, inside the coronary sinus and in the right atrium (ra), as well as la roof and in some cases left isthmus lines. in case of af termination by transformation into an atrial tachycardia, the critical isthmus of conduction was localized and targeted with the endpoint of sinus rhythm restoration ; if af persisted after ablation of all suitable sites, an electrical cardioversion was performed within 48 h after the procedure. an electroanatomical mapping system was used for all procedures (carto 3, biosense webster inc.). circumferential antral pvi was performed in all patients, as widely in the antrum as possible, with the endpoint of abolition or dissociation of activities in the pvs (entrance block). pulmonary vein potentials were distinguished from eventual far - field potentials with pacing techniques from the left atrial appendage, or ra. figure 2a loop with the robotic sheath in the la was systematically used for targeting the ostia of the right pvs : (a) antero - posterior fluoroscopic image ; (b) map of the la ; and (c) merge with the computed tomographic scan reconstruction of the la. a loop with the robotic sheath in the la was systematically used for targeting the ostia of the right pvs : (a) antero - posterior fluoroscopic image ; (b) map of the la ; and (c) merge with the computed tomographic scan reconstruction of the la. in patients under general anaesthesia, oesophageal temperature was continuously monitored, and rf delivery was immediately stopped whenever oesophageal temperature increased by > 0.5c. the procedure duration was defined as the time from the start of the first venous puncture until sheaths withdrawal at the end of the procedure. radiofrequency application duration was defined as the cumulative length of all rf applications necessary to achieve the endpoint. setup time was defined as the time from the start of the procedure to operator transfer into the control room. right and left cpvi step duration was defined as the time from the first rf delivery to the total abolition or dissociation of pv potentials for each of the pv pairs., the mn consists of two permanent giant magnets, positioned on both sides of the fluoroscopy table (axiom artis, siemens, germany), and creating a steerable computer - controlled magnetic field of an intensity of 0.08 or 0.1 tesla (t). the soft magnetic catheters equipped with three magnets near its distal tip tend to be aligned to the direction of the magnetic field. a catheter advancement system allows remote push and pull movements of the catheter and its sheath. two versions of this system were compared in this study : a cas (quick - cas, stx ; figure 3), and a catheter advancement system that fully controls both the catheter and a robotic deflectable sheath (v - cas deflect, stx). full remote control is also available for the variable diameter steerable circular catheter by means of another disposable (v - loop, stx). v - cas deflect and the v - loop are connected to one / two robotic arms (v - drive or v - drive duo, figure 4a). complete remote manoeuvring of all the components is performed via a controller (v - drive controller, figure 4b). figure 3final setup of the catheter - only advancement system with a fixed curve sheath. figure 4(a) final setup of the arms of the v - drive duo (with v - cas deflect and v - loop) at the sheath insertion site. (b) the v - drive controller that allows remote manipulation of the ablation catheter, its sheath and of the lasso. (a) final setup of the arms of the v - drive duo (with v - cas deflect and v - loop) at the sheath insertion site. (b) the v - drive controller that allows remote manipulation of the ablation catheter, its sheath and of the lasso. single operators, sitting in the control room, via a computer interface (navigant, stereotaxis, integrated into carto system), control the orientation of the magnetic field and advancement and retraction of catheters and sheaths. the v - cas deflect is a remote navigation platform that allows the operator to manoeuvre a robotic deflectable sheath from a remote interface. the system consists of a robotic drive unit, a remote controller, and a catheter - specic disposable set that interfaces the drive unit with both the robotic sheath and the magnetic catheter (figure 4). robotic deflectable sheath is a 79 cm length, 12.8 fr diameter deflectable irrigated magnetic sheath with four 1.3 cm spaced platinum electrodes that allow location and identification in the mapping system. the operator controls both rsh and catheter motion by manipulating the remote controller (figure 4b) from the remote workstation. operations governed by the remote controller include advancement, retraction, rotation, deection, looping, and unlooping movements. nominal variables were compared by use of the test (or fisher 's exact test if test was inappropriate).the log - rank test was used to compare ablation results in the two groups. between january 2012 and december 2013 consecutive patients who underwent af ablation using mn coupled with the rsh (rsh group), were prospectively included. the control group consisted of consecutive af ablation cases with mn combined with a fixed - curve sheath and a cas in our centre before the availability of rsh (cas group). this study was approved by the institutional committee on human research. according to institutional guidelines all patients received anticoagulation therapy with vitamin k antagonists (vka) for at least 1 month before the procedure (target international normalized ratio, inr, 23). transoesophageal echocardiography was performed within the procedure to exclude left atrium (la) thrombus and to guide transseptal puncture. were introduced (i) a deflectable decapolar catheter positioned within the coronary sinus with the distal electrode positioned at 45 o'clock along the mitral annulus in the 30 left anterior oblique radiographic projection ; (ii) a 20 pole, variable diameter circumferential mapping catheter to guide pulmonary vein isolation (pvi) (lasso 2550, biosense webster inc.) introduced within a long sheath (preface multipurpose, biosense webster inc. or fast - cath sl1) ; and (iii) a 3.5 mm tip externally irrigated magnetic catheter (thermocool rmt, biosense webster inc.) within a second long sheath. the second long sheath was the robotic deflectable sheath (rsh group, figure 1) or a standard fixed - curve long sheath (fast - cath sl1) in the cas group. figure 1the robotic deflectable sheath (v - cas deflect) fully undeflected (left panel) and fully deflected (right panel). the robotic deflectable sheath (v - cas deflect) fully undeflected (left panel) and fully deflected (right panel). two separate transseptal punctures were performed under combined fluoroscopic and real - time transoesophageal echocardiography guidance. immediately before the first transseptal puncture, a bolus of 50 iu / kg heparin was administered. additional heparin boluses were given if necessary to maintain the act between 300 and 350 s. ablation strategy was circumferential antral pvi (cpvi) in paroxysmal af (paf) with lasso - proven pvi as an endpoint. radiofrequency (rf) was delivered in a point - by - point manner with minimum 30 s burns (aiming electrograms (egms) modification favouring transmural lesion) at each ablation site. robotic deflectable sheath loop in the la was systematically used for targeting the ostia of the right pv (figure 2). a stepwise approach was used for persistent af patients, with additional lesions targeting fractionated egms in the la, inside the coronary sinus and in the right atrium (ra), as well as la roof and in some cases left isthmus lines. in case of af termination by transformation into an atrial tachycardia, the critical isthmus of conduction was localized and targeted with the endpoint of sinus rhythm restoration ; if af persisted after ablation of all suitable sites, an electrical cardioversion was performed within 48 h after the procedure. an electroanatomical mapping system was used for all procedures (carto 3, biosense webster inc.). circumferential antral pvi was performed in all patients, as widely in the antrum as possible, with the endpoint of abolition or dissociation of activities in the pvs (entrance block). pulmonary vein potentials were distinguished from eventual far - field potentials with pacing techniques from the left atrial appendage, or ra. figure 2a loop with the robotic sheath in the la was systematically used for targeting the ostia of the right pvs : (a) antero - posterior fluoroscopic image ; (b) map of the la ; and (c) merge with the computed tomographic scan reconstruction of the la. a loop with the robotic sheath in the la was systematically used for targeting the ostia of the right pvs : (a) antero - posterior fluoroscopic image ; (b) map of the la ; and (c) merge with the computed tomographic scan reconstruction of the la. in patients under general anaesthesia, oesophageal temperature was continuously monitored, and rf delivery was immediately stopped whenever oesophageal temperature increased by > 0.5c. the procedure duration was defined as the time from the start of the first venous puncture until sheaths withdrawal at the end of the procedure. radiofrequency application duration was defined as the cumulative length of all rf applications necessary to achieve the endpoint. setup time was defined as the time from the start of the procedure to operator transfer into the control room. right and left cpvi step duration was defined as the time from the first rf delivery to the total abolition or dissociation of pv potentials for each of the pv pairs. the mn system was described elsewhere. in brief, the mn consists of two permanent giant magnets, positioned on both sides of the fluoroscopy table (axiom artis, siemens, germany), and creating a steerable computer - controlled magnetic field of an intensity of 0.08 or 0.1 tesla (t). the soft magnetic catheters equipped with three magnets near its distal tip tend to be aligned to the direction of the magnetic field. a catheter advancement system allows remote push and pull movements of the catheter and its sheath. two versions of this system were compared in this study : a cas (quick - cas, stx ; figure 3), and a catheter advancement system that fully controls both the catheter and a robotic deflectable sheath (v - cas deflect, stx). full remote control is also available for the variable diameter steerable circular catheter by means of another disposable (v - loop, stx). v - cas deflect and the v - loop are connected to one / two robotic arms (v - drive or v - drive duo, figure 4a). complete remote manoeuvring of all the components is performed via a controller (v - drive controller, figure 4b). figure 3final setup of the catheter - only advancement system with a fixed curve sheath. figure 4(a) final setup of the arms of the v - drive duo (with v - cas deflect and v - loop) at the sheath insertion site. (b) the v - drive controller that allows remote manipulation of the ablation catheter, its sheath and of the lasso. (a) final setup of the arms of the v - drive duo (with v - cas deflect and v - loop) at the sheath insertion site. (b) the v - drive controller that allows remote manipulation of the ablation catheter, its sheath and of the lasso. single operators, sitting in the control room, via a computer interface (navigant, stereotaxis, integrated into carto system), control the orientation of the magnetic field and advancement and retraction of catheters and sheaths. the v - cas deflect is a remote navigation platform that allows the operator to manoeuvre a robotic deflectable sheath from a remote interface. the system consists of a robotic drive unit, a remote controller, and a catheter - specic disposable set that interfaces the drive unit with both the robotic sheath and the magnetic catheter (figure 4). robotic deflectable sheath is a 79 cm length, 12.8 fr diameter deflectable irrigated magnetic sheath with four 1.3 cm spaced platinum electrodes that allow location and identification in the mapping system. the operator controls both rsh and catheter motion by manipulating the remote controller (figure 4b) from the remote workstation. operations governed by the remote controller include advancement, retraction, rotation, deection, looping, and unlooping movements. nominal variables were compared by use of the test (or fisher 's exact test if test was inappropriate).the log - rank test was used to compare ablation results in the two groups. the study population consisted of 45 patients in the rsh group (57.8 11 years, 59% male) and 37 patients in the cas group (58.8 9 years, 78% male). table 1patients ' clinical characteristicscharacteristicrsh group (n = 45)cas group (n = 37)pmale sex (n) (%) 22 (59.46)29 (78.38)0.079age (years)57.8 1158.8 90.34bmi (kg / m)25.8 426.5 40.25af type (paroxysmal / persistent)23/2218/190.81cha2ds2-vasc score1.54 1.461.40 1.360.65la diameter (antero - posterior ; ultrasound ; mm)43.0 9.145.8 6.50.09la volume (ct scan ; ml)117 53124 530.30lvef (%) 66.1 9.162.4 11.20.93common left pv trunck550.77bmi, indicates body mass index ; af, atrial fibrillation ; la, left atrium ; lvef, left ventricular ejection fraction ; pv, pulmonary vein. patients ' clinical characteristics bmi, indicates body mass index ; af, atrial fibrillation ; la, left atrium ; lvef, left ventricular ejection fraction ; pv, pulmonary vein. looping of the robotic sheath in the la was successfully performed in all patients allowing a direct approach (from left to right) for right pvi. right cpvi step was significantly shorter in the rsh group (46 9 vs. 63 12 min, p 10 years with three commercially available systems. widespread use of mn for af ablation began in 2008 with the availability of irrigated magnetic catheters. when compared with manual technique, mn shows similar results for af ablation. longer mn procedure times have been reported, but these seem compensated by shorter fluoroscopy exposure and increased safety. for the operator, the advantage of remotely performing lengthy procedure while seating is undeniable. for repeat af ablation procedures, mn has been related to fewer recurrences when compared with manual conventional technique. all the above data concern the second - generation mn system (niobe ii, stx) which used a fixed - curve sheath and the cas, representing for us the control group. since 2012, the third generation mn (niobe es), provides faster magnetic field direction changes and can be coupled with one or two robotic arms allowing remote control of the circular mapping catheter and of the ablation catheter sheath. these systems provide robotic assistance for conventional stiff catheters by means of robotic steerable sheaths ; the operator movements are transmitted to the steerable sheath which in turn directs the catheter. we use the sheath to provide an anchoring point for the magnetic catheter inside the la, in a region opposite to the ablation target site (e.g. posteriorly in the la for anterior ablation targets like the ridge between the left pv and the la appendage ; leftwards in the la, pointing rightwards by means of a loop (figure 2) for targeting the right pv). thus, a longer length of the magnetic catheter is available for alignment with the magnetic field, improving navigation and tissue contact. since the rsh is visualized on the mapping system, steering, rotation, advancement, and retraction of the sheath may be performed without fluoroscopy ; for safety reasons, before each remote manipulation we ensured that a sufficient length of the magnetic catheter was outside the sheath (i.e. the most distal flexion point) to serve as a soft leader guide. solid data exist showing the predictive value of catheter tissue contact for the transmurality of ablation lesions. the use of steerable sheaths technology has been reported to increase catheter stability, tissue contact, and improve ablation outcome. robotic assistance for conventional stiff catheters by means of a robotic steerable sheath has also been reported to improve catheter stability. maximal contact force provided by magnetic catheters was inferior to that obtained with conventional catheters in experimental studies (26.8 vs. 45.4 g). this inferior maximum pressure is compensated by the better catheter stability provided by the mn. magnetic catheters deliver rf energy with a lower mean temperature and with less variability of temperature during ablation, thus enhancing tissue energy transfers. we consider the absence of contact force direct measurement for the magnetic catheters and the rsh as a safety limitation for the use of the rsh to provide a nevertheless, using the semi - quantitative contact tool of the mn system (based on the angulation between the catheter and the magnetic field direction), we regularly use the rsh advancement (towards the left pv) and orientation of the rsh tip (slightly anteriorly if the body of the sheath is oriented towards the posterior wall) for ablation along the ridge between the left pv and the la appendage. robotic deflectable sheath combines the advantages of both mn and remote robotic manoeuvring of a steerable sheath. by improving catheter stability, this technology improved the results of af ablation compared with our historical cohort of mn and decreased procedure duration. since the new version of the mn system (niobe es) with its robotic arms (v - drive duo) replaced the previous version, only a historical cohort could serve as a control group. we voluntarily chose to use from the very beginning the new robotic deflectable sheath in order to take advantage of the full system 's capabilities. thus, no information is available concerning the improvement brought by each component of the new version (faster magnets and rsh, respectively). the two techniques (rsh and cas) should be evaluated in a randomized trial with the same mn system version. since the new version of the mn system (niobe es) with its robotic arms (v - drive duo) replaced the previous version, only a historical cohort could serve as a control group. we voluntarily chose to use from the very beginning the new robotic deflectable sheath in order to take advantage of the full system 's capabilities. thus, no information is available concerning the improvement brought by each component of the new version (faster magnets and rsh, respectively). the two techniques (rsh and cas) should be evaluated in a randomized trial with the same mn system version. the use of the new remotely controlled steerable sheath coupled with the latest generation of mn is safe and improves result of af ablation. looping of the rsh inside the la fastens right pvi, rf delivery time is shortened and procedure time is thus decreased. the proper net benefit brought respectively by the robotic sheath and the new version of mn system is difficult to assess.	aimsthe magnetic navigation (mn) system may be coupled with a new advancement system that fully controls both the catheter and a robotic deflectable sheath (rsh) or with a fixed - curve sheath and a catheter - only advancement system (cas). we aimed to compare these approaches for atrial fibrillation (af) ablation.methods and resultsatrial fibrillation ablation patients (45, 23 paroxysmal and 22 persistent) performed with mn rsh (rsh group) were compared with a control group (37, 18 paroxysmal and19 persistent) performed with mn cas (cas group). setup duration was measured from the procedure 's start to operator transfer to control room. ablation step duration was defined as the time from the beginning of the first radiofrequency (rf) pulse to the end of the last one and was separately acquired for the left and the right pulmonary vein (pv) pairs. clinical characteristics, left atrial size, and af - type distribution were similar between the groups. setup duration as well as mapping times was also similar. ablation step duration for the left pvs was similar, but was shorter for the right pvs in rsh group (46 9 vs. 63 12 min, p < 0.0001). radiofrequency delivery time (34 9 vs. 40 11 min, p = 0.007) and procedure duration (227 36 vs. 254 62 min, p = 0.01) were shorter in rsh group. no complication occurred in rsh group. during follow - up, there were five recurrences (11%) in rsh group and 11 (29%) in cas group (p = 0.027).conclusionthe use of the rsh for af ablation with mn is safe and improves outcome. right pv isolation is faster, rf delivery time and procedure time are reduced.
loss of control, is a chronic relapsing disorder similar to diabetes or hypertension.1 it has a considerable component of genetic susceptibility and is also influenced by environmental factors.2 therefore, long - term maintenance therapy is very important. we should recognize redrinking by alcoholics as a symptom such as relapse in cancer or re - injury of a joint sprain. in addition, we have to take into account not only the abstinence from alcohol but also the recovery of quality of life. psychological factors of the patient than by therapeutic interventions.3 the first study4 about the prognosis of alcoholism in japan found that a good prognosis was related more strongly to social factors than physical factors. in particular, the continuation of therapy was strongly related to a good prognosis. however, there are only a few studies in japan on the factors associated with a good prognosis. the three chief traditional guidelines for sobriety (3cgs) in japan are regular medical checkups, participation in self - help groups, and therapy with antidipsotropics.5 3cgs have been extensively used in the treatment of alcohol dependence in japan. prospective evidence to support these guidelines has been obtained abroad, but they have not been extensively studied in japan. with regard to the first guideline, alcoholics tend to discontinue attending medical checkups. in addition, scivoletto reported that a half or more number of patients stopped attending consultations within several months, and only 16% continued attending checkup sessions for 1 year after the first consultation. on the other hand, continuing to attend medical checkups is strongly related to a good prognosis.8 similarly, in japan, more than half of the patients with alcoholism stopped attending medical checkups within 6 months, and only 21.1% of patients were seen 1 year after their first consultation.9 japanese patients with alcoholism who continued therapy had a significantly higher rate of abstinence after 1 year, indicating that continued attendance of checkup sessions is strongly related to abstinence.4 many studies support the usefulness of the second guideline, participation in self - help groups. for example, the rate of abstinence of those who participate in alcoholics anonymous (aa) is approximately twice that of those who do not participate in any self - help group.10 in japan, research has supported the usefulness of dansyukai (a traditional japanese self - help group). in addition, nishikawa11 reported that continued participation in self - help groups is related to a significantly higher rate of continuing to attend checkup sessions. the effectiveness of abstinence with using antidipsotropics has not been evaluated via double - blind, randomized controlled trials in japan. in a questionnaire study12 in japan however, research on the ideal duration of antidipsotropic usage is lacking. according to japanese guidelines for the treatment of alcoholism and related disorders,13 psychotherapy is more important than the effects of antidipsotropics, and there are many differences in the efficacy of antidipsotropics between facilities and researchers. in addition, naltrexone, nalmefene, and acamprosate were not registered in japan during the research period. many reports support the effectiveness of disulfiram1420 and cyanamide,21 but compliance to the administration regimen is also important.22 diehl reported that disulfiram is more effective than acamprosate, particularly in patients with a long duration of alcohol dependence, and berglund14 reported evidence from a meta - analysis of a possible additive effect for naltrexone as well as for aversive treatment (disulfiram) in alcohol dependence. the aim of the current study was to assess 3cgs by an examination of the prognosis of patients with alcohol dependence 2 years after their discharge from a residential treatment program. subjects recruited for this prospective study were patients with alcohol dependence, who were diagnosed according to the criteria of the international statistical classification of diseases, tenth revision,23 and the diagnostic and statistical manual of mental disorders, fourth edition,24 and who were hospitalized in the mental care center, prefecture of mie, japan. participants were recruited within 2 weeks of admission after a period of withdrawal symptoms. the exclusion criteria for this study were any of the following at the time of recruitment : severe episode of a depressive or manic mood, diagnosis of dementia, psychomotor excitement, compulsory admission, pregnancy, or severe liver, kidney, or cardiac dysfunction. of the 117 patients who we attempted to recruit for this study, 15 fell under the exclusion criteria, two refused our request, and two dropped out after entry because they felt something troublesome to cooperate this research. the mean term of residential treatment was 74.6 days (standard deviation [sd ], 28.7). in residential treatment, the participants received psychotherapy, pharmacotherapy, group therapy, kinesitherapy, and motivation enhancement therapy. to keep identities of the participants in the clinical settings, therefore, we decided to assign them to each chief guideline groups at their discharge. to prospectively examine the association between subjects abstinence from alcohol and their attendance at medical checkups, participation in self - help groups, and treatment with antidipsotropics, we obtained permission to interview each participant by telephone 2 years after discharge, even if the participant had stopped attending medical checkups or had only irregularly attended. however, we included them in the second analysis : the comparison of intention to participate in self - help groups before discharge and prognosis (table 1) and antidipsotropics consumption before discharge and 2 years after discharge (table 2)., we obtained information on age, sex, family medical history, educational level, age at first drink, age at onset of alcoholism, duration of drinking habit, first time in residential treatment or not, and cross - addictions. in addition, mean corpuscular volume as well as blood levels of aspartate aminotransferase, alanine aminotransferase, and gamma - glutamyl transferase was measured (carbohydrate - deficient transferrin was not registered in japan). participants were also tested for brain atrophy. computed tomography scans were assessed by a trained psychiatrist and radiologist, and we recognized positive brain atrophy only if the opinions of both experts matched. before participants were discharged from residential treatment, we asked about their intentions to participate in self - help groups and checked whether they were taking antidipsotropics. two years after discharge, we investigated the relationship between 3cgs compliance and abstinence rates as the primary outcome. in addition, we examined the following as secondary outcomes : the time to first drink after discharge, whether participants were readmitted to residential treatment, the number of days to readmission, the number of heavy drinking days, self - assessed health maintenance, employment status, social participation (voluntary participation and contribution to the community through attendance at school, self - help group, and vocational aid center ; volunteer activity), and recovery that is defined in detail in the following sections. there is a custom of checking about heavy drinking as an indicator of the severity of redrinking in japan. participants were interviewed by telephone 2 years after discharge even if they had stopped attending checkup sessions. we trusted the patients self - reports for the number of days to redrinking corroborated, if possible and with patients permission, with information about drinking from families and medical attendants. the degree of abstinence was divided into two categories : perfect abstinence, which was defined as no drinking of alcohol, and partial abstinence, which was defined as drinking several times but not drinking continuously during the 2 years since discharge. we utilized the definition of the ministry of health, labour, and welfare in japan25 of heavy drinking as drinking > 60 g of alcohol per day. recovery was evaluated by the japanese version of the self - identified stage of recovery, part a (sisr - a).26 a patient was defined as having achieved sisr - a recovery if he / she had reached the rebuilding or growth stages of recovery. a second measure of recovery (criteria of recovery from alcohol and drug dependence in japan, cradj) utilized the criteria from a previous study27 and from the betty ford institute consensus panel,28 which defined recovery as a voluntarily maintained lifestyle characterized by sobriety, personal health, and citizenship. we used the betty ford institute s criteria of sobriety and personal health, but we expanded their definition of citizenship from voluntary contributions to the community through working and school attendance to include also the participation in self - help groups or vocational aid center and other volunteer activities. in brief, we judged a patient to have achieved cradj recovery if he / she exhibited sobriety (perfect abstinence or partial abstinence), personal health, and citizenship. participation in self - help groups was also divided into two categories : frequent participation, in which the participant attended most meetings, and partial participation, in which the participant attended at least half of the meetings. only patients in the frequent participation category could be said to meet the criteria of 3cgs. participants were defined as attending regular medical checkups only if they had been attending continuously for 2 years. the ethics committee of the mental care center, prefecture of mie, approved this study, and all subjects provided written consent. we performed t - tests for continuous variables with an approximately normal distribution (mean number of rehospitalization, mean number of days until rehospitalization, mean heavy drinking days, and mean number of days until first drink) and tests for categorical variables (perfect and partial abstinence, health maintenance, employed social participation, cradj with perfect and partial abstinence, sisr - a recovery, partial and participation in self - help groups, health maintenance, regular medical checkups, employed, and social participation). in addition, logistic regression analysis was used to evaluate the association between perfect abstinence rate and each chief guideline. age, sex, and each chief guideline were then mutually adjusted (adjusted odds ratio, aor) using a forced entry method. all statistical tests were two tailed, and the significance level was set at 0.05. all statistical analyses were carried out with spss statistics 17.0 software (spss inc., chicago, il, usa). subjects recruited for this prospective study were patients with alcohol dependence, who were diagnosed according to the criteria of the international statistical classification of diseases, tenth revision,23 and the diagnostic and statistical manual of mental disorders, fourth edition,24 and who were hospitalized in the mental care center, prefecture of mie, japan. participants were recruited within 2 weeks of admission after a period of withdrawal symptoms. the exclusion criteria for this study were any of the following at the time of recruitment : severe episode of a depressive or manic mood, diagnosis of dementia, psychomotor excitement, compulsory admission, pregnancy, or severe liver, kidney, or cardiac dysfunction. of the 117 patients who we attempted to recruit for this study, 15 fell under the exclusion criteria, two refused our request, and two dropped out after entry because they felt something troublesome to cooperate this research. the mean term of residential treatment was 74.6 days (standard deviation [sd ], 28.7). in residential treatment, the participants received psychotherapy, pharmacotherapy, group therapy, kinesitherapy, and motivation enhancement therapy. to keep identities of the participants in the clinical settings, therefore, we decided to assign them to each chief guideline groups at their discharge. to prospectively examine the association between subjects abstinence from alcohol and their attendance at medical checkups, participation in self - help groups, and treatment with antidipsotropics, we obtained permission to interview each participant by telephone 2 years after discharge, even if the participant had stopped attending medical checkups or had only irregularly attended. however, we included them in the second analysis : the comparison of intention to participate in self - help groups before discharge and prognosis (table 1) and antidipsotropics consumption before discharge and 2 years after discharge (table 2). at baseline, we obtained information on age, sex, family medical history, educational level, age at first drink, age at onset of alcoholism, duration of drinking habit, first time in residential treatment or not, and cross - addictions. in addition, mean corpuscular volume as well as blood levels of aspartate aminotransferase, alanine aminotransferase, and gamma - glutamyl transferase was measured (carbohydrate - deficient transferrin was not registered in japan). participants were also tested for brain atrophy. computed tomography scans were assessed by a trained psychiatrist and radiologist, and we recognized positive brain atrophy only if the opinions of both experts matched. before participants were discharged from residential treatment, we asked about their intentions to participate in self - help groups and checked whether they were taking antidipsotropics. two years after discharge, we investigated the relationship between 3cgs compliance and abstinence rates as the primary outcome. in addition, we examined the following as secondary outcomes : the time to first drink after discharge, whether participants were readmitted to residential treatment, the number of days to readmission, the number of heavy drinking days, self - assessed health maintenance, employment status, social participation (voluntary participation and contribution to the community through attendance at school, self - help group, and vocational aid center ; volunteer activity), and recovery that is defined in detail in the following sections. there is a custom of checking about heavy drinking as an indicator of the severity of redrinking in japan. participants were interviewed by telephone 2 years after discharge even if they had stopped attending checkup sessions. we trusted the patients self - reports for the number of days to redrinking corroborated, if possible and with patients permission, with information about drinking from families and medical attendants. the degree of abstinence was divided into two categories : perfect abstinence, which was defined as no drinking of alcohol, and partial abstinence, which was defined as drinking several times but not drinking continuously during the 2 years since discharge. we utilized the definition of the ministry of health, labour, and welfare in japan25 of heavy drinking as drinking > 60 g of alcohol per day. recovery was evaluated by the japanese version of the self - identified stage of recovery, part a (sisr - a).26 a patient was defined as having achieved sisr - a recovery if he / she had reached the rebuilding or growth stages of recovery. a second measure of recovery (criteria of recovery from alcohol and drug dependence in japan, cradj) utilized the criteria from a previous study27 and from the betty ford institute consensus panel,28 which defined recovery as a voluntarily maintained lifestyle characterized by sobriety, personal health, and citizenship. we used the betty ford institute s criteria of sobriety and personal health, but we expanded their definition of citizenship from voluntary contributions to the community through working and school attendance to include also the participation in self - help groups or vocational aid center and other volunteer activities. in brief, we judged a patient to have achieved cradj recovery if he / she exhibited sobriety (perfect abstinence or partial abstinence), personal health, and citizenship. participation in self - help groups was also divided into two categories : frequent participation, in which the participant attended most meetings, and partial participation, in which the participant attended at least half of the meetings. only patients in the frequent participation category could be said to meet the criteria of 3cgs. participants were defined as attending regular medical checkups only if they had been attending continuously for 2 years. the ethics committee of the mental care center, prefecture of mie, approved this study, and all subjects provided written consent. we performed t - tests for continuous variables with an approximately normal distribution (mean number of rehospitalization, mean number of days until rehospitalization, mean heavy drinking days, and mean number of days until first drink) and tests for categorical variables (perfect and partial abstinence, health maintenance, employed social participation, cradj with perfect and partial abstinence, sisr - a recovery, partial and participation in self - help groups, health maintenance, regular medical checkups, employed, and social participation). in addition, logistic regression analysis was used to evaluate the association between perfect abstinence rate and each chief guideline. age, sex, and each chief guideline were then mutually adjusted (adjusted odds ratio, aor) using a forced entry method. all statistical tests were two tailed, and the significance level was set at 0.05. all statistical analyses were carried out with spss statistics 17.0 software (spss inc., the perfect abstinence rate 2 years after discharge was 36.7% (36 of 98 participants). the perfect and partial abstinence rates for the patients who followed all the principles of 3cgs were significantly higher than those for patients who did not follow any of the three guidelines (p<0.05 and p<0.01, respectively). however, only six patients followed the 3cgs perfectly. in the logistic regression analyses between perfect abstinence rate and each guideline, perfect abstinence rate was statistically associated with regular medical checkups (aor = 5.33, 95% confidence interval = 1.3521.0) and participation to self - help group (aor = 3.79, 95% confidence interval = 1.1712.3). table 4 shows the attendance of medical checkups and prognosis. the perfect and partial abstinence rates, and some indicators, for patients who had attended checkup sessions were significantly higher than those for patients who had discontinued attendance. in addition, patients who had been regularly attending medical checkups were rehospitalized significantly more number of times. the partial abstinence rates for patients who participated in self - help groups were significantly higher than those for patients who did not participate. table 6 shows the use of antidipsotropics (28 had taken disulfiram and two had taken cyanamide) after discharge and prognosis. the perfect and partial abstinence and regular attendance of checkup sessions for patients who had been taking antidipsotropics were significantly higher than those for patients who had not been taking antidipsotropics. we did not receive any reports of severe side effects from the use of antidipsotropics for 2 years. for patients who were administered antidipsotropics before discharge, the rates of perfect and partial abstinence, regular attendance of checkup sessions, partial participation in self - help groups were significantly higher than those for patients who were not administered antidipsotropics before discharge (table 2). the perfect abstinence rates for patients who had continued regular medical checkups (p<0.001) and who were taking antidipsotropics (p<0.05) were significantly higher than those for patients who did not follow these components of 3cgs (tables 4 and 6). the partial abstinence rates for patients who had continued attending checkup sessions (p<0.001), who had participated in self - help groups (p<0.05), and who were taking antidipsotropics (p<0.001) were significantly higher than those for patients who did not follow any of the components of 3cgs (tables 46). the results of this study indicate that 3cgs can enhance abstinence and recovery rates for at least 2 years after discharge from residential treatment. the logistic regression analyses also supported the effectiveness of regular medical checkups and participation in self - help groups. however, only six patients followed the 3cgs perfectly. therefore, 3cgs is not only effective but also very difficult to follow. therefore, we discuss the results of the each chief guideline in the following sections. the prognosis 2 years after discharge was significantly better for patients who were taking antidipsotropics before discharge. we believe that readiness is an important factor in the treatment of alcohol dependence, and the decision to take antidipsotropics depends on the patient s level of motivation. similarly, the use of antidipsotropics is likely to have important effects in combination with psychotherapy on motivational enhancement. this study showed that participants who were taking antidipsotropics at the time of discharge had a significantly better prognosis 2 years after discharge. we believe that antidipsotropics are psychologically needed to maintain abstinence without reduction of craving by the action of the medication. during the research period (20072008), we could not use acamprosate in japan, and we had been able to use it from 2013. from now that period may vary depending on the individual, and in our hospital, we often prescribe antidipsotropics for 23 years. findings from our study, including the absence of severe side effects even after 2 years of antidipsotropic administration, indicate that usage for a longer term than the period recommended in the questionnaire study12 is reasonable. therefore, we feel that a larger study about the usefulness of antidipsotropics is needed. on the other hand, the combine study29 demonstrated that placebo was also effective in the treatment of alcohol dependence, and the importance of pill taking was pointed out. therefore, we might be able to say the same thing for antidipsotropics in this research, because we have no control group. regular meetings of dansyukai are held in 16 places in mie, japan, whereas aa meetings are held in only two places. because none of the participants in this study attended aa meetings, we were not able to compare the two types of self - help programs. however, no previous evidence indicates a difference in efficacy between dansyukai and aa, and it seems that attendance in either program would fulfill the self - help group requirement of 3cgs. from the results of this study, participants who made the decision to participate in self - help groups before discharge from residential treatment had a significantly better prognosis 2 years after discharge than those who did not make this decision, especially if they were also taking antidipsotropics. in addition, an earlier study3 reported that enrollment in dansyukai had a meaningful influence on convalescence. therefore, we believe that the prognosis improved more by continuous participation in regular meetings of self - help groups. however in the handbook of alcoholism treatment approaches,30 participation in self - help groups and taking antidipsotropics are a statistically negative evaluation. attending regular medical checkups has been shown to be the most important factor in convalescence from alcohol dependence.4,8 the results of our study support the importance of regular medical checkups. furthermore, we would like to focus on the fact that the frequency of medical checkups attended was higher in this study, as compared to previous studies.7,9,14 it is a well - known fact that alcoholics may recover even if they drink during treatment or are rehospitalized, as long as they are connected to a medical support system. finally, the patients who had been regularly attending medical checkups were rehospitalized significantly more number of times. however, we believe that regular medical checkups enhance the motivation to decide their voluntary admissions. although for many sufferers, substance dependence is a chronic relapsing disorder similar to hypertension, diabetes, and asthma,1 a study in the us showed that 24.4% of alcoholics recover without hospital consultations or self - help group attendance.31 it is possible that some of the patients who dropped out of this study experienced this so - called natural recovery. we had no control group and did not randomly assign the groups. therefore, our data had a large bias in grouping. although we assured participants that their privacy would be protected, we can not be certain that their self - reports about redrinking were reliable. with the permission of the participants, we attempted to confirm their reports with information from their families or medical attendants, but we can not deny that reporting bias may have occurred. therefore, the accuracy of redrinking was poor because we decided by self - declaration, interview by telephone, and information from informants. we also feel that participants tend to underreport their failure to attend medical checkups. however, we believe that the bias in this category may be lower than for redrinking because participants who have attended medical checkups can not be classified as abstinent by using objective findings such as information from family members and biochemical examination by medical staff. participants who were taking antidipsotropics had a lower mortality rate compared to participants who were not taking antidipsotropics. in addition, participants who were taking antidipsotropics were required to attend regular medical examinations. both of these factors may have supported the effectiveness of antidipsotropics. furthermore, we did not check the compliance to the antidipsotropic regimen, because disulfiram may well have positive effects on drinking if medication compliance procedures are employed.15,3234 the number of participants in this study was small, and we examined only alcoholics who were voluntarily attending inpatient treatment. furthermore, because rehabilitation is usually attempted during hospitalization, residential treatment in japan tends to be for a longer term than in other countries. an additional limitation of this study is the possible bias introduced by patients who refused to participate or who dropped out during the research. the prognosis 2 years after discharge was significantly better for patients who were taking antidipsotropics before discharge. we believe that readiness is an important factor in the treatment of alcohol dependence, and the decision to take antidipsotropics depends on the patient s level of motivation. similarly, the use of antidipsotropics is likely to have important effects in combination with psychotherapy on motivational enhancement. this study showed that participants who were taking antidipsotropics at the time of discharge had a significantly better prognosis 2 years after discharge. we believe that antidipsotropics are psychologically needed to maintain abstinence without reduction of craving by the action of the medication. during the research period (20072008), we could not use acamprosate in japan, and we had been able to use it from 2013. from now that period may vary depending on the individual, and in our hospital, we often prescribe antidipsotropics for 23 years. findings from our study, including the absence of severe side effects even after 2 years of antidipsotropic administration, indicate that usage for a longer term than the period recommended in the questionnaire study12 is reasonable. therefore, we feel that a larger study about the usefulness of antidipsotropics is needed. on the other hand, the combine study29 demonstrated that placebo was also effective in the treatment of alcohol dependence, and the importance of pill taking was pointed out. therefore, we might be able to say the same thing for antidipsotropics in this research, because we have no control group. regular meetings of dansyukai are held in 16 places in mie, japan, whereas aa meetings are held in only two places. because none of the participants in this study attended aa meetings, we were not able to compare the two types of self - help programs. however, no previous evidence indicates a difference in efficacy between dansyukai and aa, and it seems that attendance in either program would fulfill the self - help group requirement of 3cgs. from the results of this study, participants who made the decision to participate in self - help groups before discharge from residential treatment had a significantly better prognosis 2 years after discharge than those who did not make this decision, especially if they were also taking antidipsotropics. in addition, an earlier study3 reported that enrollment in dansyukai had a meaningful influence on convalescence. therefore, we believe that the prognosis improved more by continuous participation in regular meetings of self - help groups. however in the handbook of alcoholism treatment approaches,30 participation in self - help groups and taking antidipsotropics are a statistically negative evaluation. attending regular medical checkups has been shown to be the most important factor in convalescence from alcohol dependence.4,8 the results of our study support the importance of regular medical checkups. furthermore, we would like to focus on the fact that the frequency of medical checkups attended was higher in this study, as compared to previous studies.7,9,14 it is a well - known fact that alcoholics may recover even if they drink during treatment or are rehospitalized, as long as they are connected to a medical support system. finally, the patients who had been regularly attending medical checkups were rehospitalized significantly more number of times. however, we believe that regular medical checkups enhance the motivation to decide their voluntary admissions. although for many sufferers, substance dependence is a chronic relapsing disorder similar to hypertension, diabetes, and asthma,1 a study in the us showed that 24.4% of alcoholics recover without hospital consultations or self - help group attendance.31 it is possible that some of the patients who dropped out of this study experienced this so - called natural recovery. although we assured participants that their privacy would be protected, we can not be certain that their self - reports about redrinking were reliable. with the permission of the participants, we attempted to confirm their reports with information from their families or medical attendants, but we can not deny that reporting bias may have occurred. therefore, the accuracy of redrinking was poor because we decided by self - declaration, interview by telephone, and information from informants. we also feel that participants tend to underreport their failure to attend medical checkups. however, we believe that the bias in this category may be lower than for redrinking because participants who have attended medical checkups can not be classified as abstinent by using objective findings such as information from family members and biochemical examination by medical staff. participants who were taking antidipsotropics had a lower mortality rate compared to participants who were not taking antidipsotropics. in addition, participants who were taking antidipsotropics were required to attend regular medical examinations. both of these factors may have supported the effectiveness of antidipsotropics. furthermore, we did not check the compliance to the antidipsotropic regimen, because disulfiram may well have positive effects on drinking if medication compliance procedures are employed.15,3234 the number of participants in this study was small, and we examined only alcoholics who were voluntarily attending inpatient treatment. furthermore, because rehabilitation is usually attempted during hospitalization, residential treatment in japan tends to be for a longer term than in other countries. an additional limitation of this study is the possible bias introduced by patients who refused to participate or who dropped out during the research. in this study, we reported on the effectiveness of 3cgs for the first time. according to a literature review,17 a treatment period of 12 months has been classified as a long period for alcohol dependence. this study examined the recovery rate of alcoholics 2 years after discharge from residential treatment. however, due to the chronic nature of alcoholism, further studies are required to investigate the efficacy of 3cgs beyond 2 years.	backgroundin japan, the three chief traditional guidelines for sobriety (3cgs) are regular medical checkups, participation in self - help groups, and pharmacotherapy with antidipsotropics. however, the official record of the origins of 3cgs is not clear. the aim of this current study was to assess 3cgs by an examination of the prognosis of patients with alcohol dependence 2 years after their discharge from a residential treatment program.subjects and methodsthe association between subjects abstinence from alcohol and their regular medical checkups, participation in self - help groups, and treatment with antidipsotropics were prospectively examined. two years after discharge, the relationship between the 3cgs compliance and abstinence rates was investigated as the primary outcome. in addition, the following were examined as secondary outcomes : the time taken till the first drink after discharge, whether the participants were readmitted to residential treatment, the number of days to readmission, the number of heavy drinking days, and recovery.resultsa total of 98 patients participated. the perfect and partial abstinence rates for patients who followed all the principles of 3cgs were significantly higher than those for patients who followed no guidelines (p<0.05 and p<0.01, respectively). the perfect abstinence rates for patients who had continued attending checkup sessions (p<0.001) and who were taking antidipsotropics (p<0.05) were significantly higher than those for patients who did not follow these components of 3cgs. however, the perfect abstinence rates were not higher for patients who had continued to participate in self - help groups. in addition, the perfect abstinence rate was statistically associated with regular medical checkups (adjusted odds ratio = 5.33, 95% confidence interval = 1.3521.0) and participation in self - help groups (adjusted odds ratio = 3.79, 95% confidence interval = 1.1712.3).conclusionthis study, reports the effectiveness of 3cgs for the first time. the recovery rate of alcoholics 2 years after discharge from residential treatment was examined. however, due to the chronic nature of alcoholism, further studies are required to investigate the efficacy of 3cgs beyond 2 years.
the interpretation of a raised amylase in the acute surgical patient is crucial yet complicated as it is raised in a large number of conditions but with a low specificity. this report argues that a transient rise in serum amylase not caused by sepsis or pancreatitis can be caused by a splenic infarction. therefore any cause of a non - diagnostic amylase rise must not be over- looked as it may be of diagnostic value in a life threatening surgical condition. a 49-year - old previously well male, presented with a 24 hour history of vomiting, abdominal pain and fever. his abdominal pain was of rapid onset and localised to the epigastrium and left upper quadrant. there was no history of trauma but he did admit to a recent history of alcohol excess. clinical examination revealed diffuse upper abdominal tenderness, a mild tachycardia and a low grade pyrexia. blood work up revealed an amylase of 270 u / l and crp of 125mg / l. ct showing evidence of splenic infarction secondary to infective endocarditis a provisional diagnosis of alcohol - induced pancreatitis was made. he received standard management as mild pancreatitis (glasgow score 0) with ward level care. an ultrasound showed no abnormality. due to diagnostic uncertainty and failure of symptoms and signs to rapidly resolve, subsequent echocardiogram for a source of emboli showed multiple valvular vegetations, aortic regurgitation and a 16 mm pericardial effusion. treatment with intravenous flucloxacillin and gentamicin was undertaken and transfer to the regional cardio - thoracic unit was arranged. there he underwent urgent aortic valve replacement with a tissue valve following which he made an uncomplicated recovery. these can be broadly grouped into 3 subdivisions : pancreatic (eg. pancreatitis, pancreatic tumour or trauma)extra - pancreatic intra - abdominal disease (eg. cholecystitis, perforated duodenal ulcer, bowel ischaemia)extra - abdominal processes (eg. macro - amylasaemia) pancreatic (eg. pancreatitis, pancreatic tumour or trauma) extra - pancreatic intra - abdominal disease (eg. cholecystitis, perforated duodenal ulcer, bowel ischaemia) extra - abdominal processes (eg. macro - amylasaemia) interpretation of a raised amylase in the surgical patient is crucial, potentially avoiding dangerous misdiagnosis. many conditions cause hyperamylasaemia making the specificity of elevated serum amylase level less than 70%. its low specificity drops further after the first 24 hours of hospital admission (1,2). elevated serum amylase activity in pancreatitis is attributed to pancreatic auto - digestion, but its pathophysiology is unknown in many other causes. endocarditis is a well known cause of splenic thrombosis and consequent infarction and first described in germany in 1869 (3). there have been reports of raised amylase in non - pancreatic sepsis, some showing that this could be used as a prognostic marker in the septic patient (4). however, in this patient the transient amylase rise dropped despite worsening sepsis, suggesting an alternative cause for the disturbance. recent studies by antopolsky examined clinical presentations in 49 episodes of acute splenic infarction. the most common symptom was abdominal or left flank pain (80% of episodes) with the most common sign being upper left quadrant tenderness (35% of episodes) (5). clinicians should be aware of splenic infarction as a clinical entity, and consider it in cases of upper abdominal pain, particularly if there is a non - diagnostic amylase rise.	we present what maybe the only case of splenic infarction causing hyperamylasaemia in a patient with bacterial endocarditis. a 49-year - old gentleman presented a 24 hour history of vomiting, abdominal pain and fever. clinical examination showed diffuse upper abdominal tenderness, a mild tachycardia and a low grade pyrexia. blood investigations showed a hyperamylasaemia. his failure to improve on treatment for a provisional diagnosis of alcohol induced pancreatitis lead to a ct abdomen, which showed a splenic infarct and an echo showing aortic valve vegetation 's as a source of emboli. he underwent urgent aortic valve replacement with a tissue valve following which he made an uncomplicated recovery.
the last couple of years have seen a marked growth of interest in the topic of crossmodal correspondences (see marks, 2004 ; spence, 2011, for reviews). crossmodal correspondences have been defined as a tendency for a sensory feature, or attribute, in one modality, either physically present or merely imagined, to be matched (or associated) with a sensory feature in another sensory modality (see parise & spence, in press ; spence, 2012). crossmodal correspondences have now been documented between pretty much every pair of sensory modalities (see spence, 2012). crossmodal correspondences affect behavior in a wide range of experimental paradigms everything from the redundant target paradigm through to the implicit association test (see spence, 2011). but how should such phenomena be explained at the computational / neural level ? at the computational level, bayesian coupling priors appear to provide a powerful tool to model the effects of crossmodal correspondences on multisensory integration (ernst, 2007 ; parise & spence, 2009 ; spence, 2011). the latest cognitive neuroscience research is now starting to provide answers regarding the time course and cerebral localization of these, often surprising, cross - sensory mappings (bien, ten oever, goebel, & sack, 2012 ; sadaghiani, maier, & noppeney, 2009 ; seo,. one critical research question in this area concerns whether crossmodal correspondences are all of a kind or whether instead there are different kinds / mechanisms of correspondence at work (spence, 2011). one might, for example, want to know whether those correspondences that are based on the internalization of the correlations between stimuli / dimensions present in the environment are represented differently than the semantic correspondences associated with our tendency to use the same terms to describe, for example, certain sounds as having a high frequency while at the same time also using the same descriptor when talking about certain elements in a perfume or perhaps wine aroma (so - called high notes). while discriminating between different kinds of crossmodal correspondence has sometimes been possible using behavioral techniques (gallace & spence, 2006), it is undoubtedly true that more robust insights into the shared vs. distinct mechanism(s) underlying various examples of crossmodal correspondence are likely to emerge from a better understanding of the neural substrates underpinning these effects. in their latest research, 2012) utilized a simplified version of the psychophysical paradigm developed by parise and spence (2009) demonstrating enhanced multisensory integration for crossmodally corresponding pairs of auditory and visual stimuli (small or large circles and low- vs. high - pitched sounds ; with integration being assessed by means of the magnitude of the spatial ventriloquism effect). using event - related potentials (erps), bien. (2012) looked for any differences in the pattern of neural activation on those trials where crossmodally congruent vs. incongruent pairs of stimuli were presented. 2010) have also demonstrated similar effects when comparing the erps elicited by crossmodally congruent vs. incongruent combinations of abstract visual symbols and orthonasally presented odors (see also kovic., 2009). interestingly, the magnitude of the p2 component at parietal recording sites correlated with the effects reported behaviorally in the study of bien. these researchers then used source localization to infer the likely source of this congruency effect as originating in right intraparietal sulcus, a site that was then temporarily lesioned by applying offline transcranial magnetic stimulation (tms). crucially, this intervention led to the elimination of the effect of crossmodal congruency on participants ' behavioral performance (not to mention on the erp signal). (2012) builds nicely on the earlier psychophysical research of parise and spence (2009) while also complementing the results of a study by sadaghiani. (2009) that highlighted differing neural substrates for natural, metaphorical, and linguistic mappings (or crossmodal correspondences). that said, given that bien. (2012) did not fit psychometric curves to their data, it is still an open question whether the effects induced by tms are due to the reduced integration of crossmodally congruent stimulus pairs or else to a horizontal shift in perceptual space. in an earlier tms study by muggleton, tsakanikos, walsh, and ward (2007), lesioning of right intraparietal cortex using tms knocked out stroop - like interference effects in a group of synesthetic participants. however, before jumping to the conclusion that the same neural substrates may underlie both crossmodal correspondences and synesthesia, it is worth noting that the cortical site targeted in the two studies was actually separated by a few centimeters. of course, the fact that tms was not applied over a control site in the study of bien. (2012) also means that it is not possible to know exactly how specific (in neural terms) their tms effects really were. the temporary lesioning approach to the study of crossmodal correspondences highlighted by bien. (2012) complements previous anecdotal reports that damage to other neighboring regions (e.g., the angular gyrus, located within the temporal parietal occipital, region) results in the loss of the takete maluma effect (see figure 1). in the future, our understanding of the mechanism(s) underlying the many forms of crossmodal correspondence that have been documented behaviorally in recent years (see parise & spence, in press ; spence, 2011, 2012) are likely to be greatly enriched by further cognitive neuroscience research using techniques such as tms. indeed, one might even go so far as to consider whether certain coupling priors underpinning crossmodal correspondences (e.g., between auditory and visual stimuli) might not be encoded in the intraparietal sulcus itself (cf. better fits with the angular shape shown on the left, whereas the word maluma fits better with the rounded shape displayed on the right. even those individuals from cultures without any written language have been shown to exhibit this effect (see bremner. the only exceptions to this generalization appear to be those suffering from damage to the angular gyrus (ramachandran & hubbard, 2003) and certain individuals suffering from autism spectrum disorder (oberman & ramachadran, 2008 ; ramachandran & oberman, 2006).	in a recent article, n. bien, s. ten oever, r. goebel, and a. t. sack (2012) used event - related potentials to investigate the consequences of crossmodal correspondences (the natural mapping of features, or dimensions, of experience across sensory modalities) on the time course of neural information processing. then, by selectively lesioning the right intraparietal cortex using transcranial magnetic stimulation, these researchers went on to demonstrate (for the first time) that it is possible to temporarily eliminate the effect of crossmodal congruency on multisensory integration (specifically on the spatial ventriloquism effect). these results are especially exciting given the possibility that the cognitive neuroscience methodology utilized by bien. (2012) holds for dissociating between putatively different kinds of crossmodal correspondence in future research.
it ovary stops to produce estrogen and progesterone hormones and cancels the women 's power of reproducing. the age range of 45 to 55 years is known as natural menopausal time of worldwide women.1 but in bangladesh the maximum range is up to 55 years.2 if any woman 's period stops before 45 years old is called early menopause3 and if after 50 years old is called as late menopause in this research. after the change of period the women face many physical problems as well as psychosocial problem.45 important impacts in the daily, social and sexual life of postmenopausal women have to faces for menopause.678 the number of health criteria changed rapidly in her body like tiredness, sleeping problem, hot flashes, hair loss, sweats etc. many women are likely to live for more than 15 to 20 (one third of life) years after menopause. for decreasing energy and increasing physical as well as mental problems those women are considered as risk population.9 so 35 to 45 years old women 's health issue is the most public health concerning topic around the world. world health organization defines quality of life (qol) whose essential component in clinical practices is to study about early menopausal women. but qol holds very little information about early menopausal women of developing countries.10 it is well documented that every menopausal symptoms have effect on qol of menopausal women.11 every menopausal symptoms impact on lifestyle is not same. it varies from one region to another as well as one country to another according to their culture. it is observed that a significant variation is present among western menopausal women, north american menopausal women, european menopausal women and asian menopausal women. most of the women are uneducated and have no consciousness about menopausal symptoms effect on quality of life. some women 's menopause stops early before 45 years and some late after 51 years. both cases women have to face menopausal symptoms impact on life. but there is no documentation about both early and late menopausal women of bangladesh. like as western countries this study aimed to document the menopausal related symptoms for both early and late menopausal women of tangail region of bangladesh. this study is an ongoing multicenter population - based study to investigate the relationship among lifestyle factors of causing early and late menopause, type 2 diabetics and problem for abnormal menopausal time. collected data consisted with 150 participants (all are women), enrolled into the recorded data between 2013 and 2014, in 3 study centers across 3 different palaces in bangladesh (i.e. santosh, palpara, goshpara in tangail). in recorded data the majority participants were between 50 and 70 years old although recorded data hold 42 to 90 years old participants information. pregnant, breast feeding, hormone therapy taken women, and women with uncontrolled medical conditions like type 2 diabetics, hypertension or coherent heart disease were participated in our cross - sectional study. some participants gave written informed consent and others were in viva - voce, and the study was approved by the local committees at the participating centers and department of biotechnology and genetic engineering research and ethics committee, mawlana bhashani science and technology university. with socio demographic information, menstruation status based data were reported according to the length of time since last menstrual period and the experience of symptoms on qol. at primary stage, questionnaires and computer - guided, face - to face interviews were used to record information about basic lifestyle, illness, problems for abnormal menopausal stage (early menopause or late menopause). mainly literature review, exploratory research and qualitative piloting informed the development and refinement to structure a questionnaire in english. questionnaire information on lifestyle covered lifetime history as well as current habits (at recruitment time) of physical activity without work, body mass index (bmi) in height (m) / weight (kg) where height and weight were measured by following standardized procedures. although regular exercise is mentioned here as physical activity without work which makes man happy with good health and improves qol. besides, majority participants were not concerned about problems of bmi, only 15% were careful. the other information in questionnaire was close and open ended including series of questions whose are associated with abnormal menopausal factors such as age, blood pressure, hot flashes, osteoporosis, type 2 diabetics, coherent heart disease, heart beating, feeling tense or nervous, sleeping problem, excitable, concentrating problem, feeling tried or lacking in energy and dizzy, depression, physical problem (pain, backaches, bloating, sore breasts, headaches diarrhea, food cravings etc.) during menstruation, irritability, pressure or tightness in head or body, parts of body feel numb or tingling, headache, muscle and joint pain, loss of feeling in hands or feet, breathing problem, sweating at night etc. the answer of questions could be categorized as numeric number for age, height and weight factors, high or low for blood pressure factor, early or late for menopausal status factor and yes or no for rest of factors. a total of 67% participants who had reported early menopausal status at the time of baseline recruitment and 33% participants were late menopausal status. as for collecting data from different places may carry duplicate and missing values which can help to provide wrong investigational result. so data cleaning (also known as data pre - processing) is a vital step not only for minimization of memory but also normalization of values what used to represent information in database. in this study duplicate values (1.33% in whole collection) were discarded and missing values (2% in whole collection) were provided according to other participants ' information of those places. finally 150 participants ' data were enlisted for research study what was checked using waikato environment for knowledge analysis (weka) toolkit of 3.6.5 version. the goals of research are to analyze early menopause and late menopause with association among factors (mentioned in questionnaire). with regard to menopausal status (goal) variables, study participants were categorized according to menopausal status at the time of recruitment (early, late). subjects who reported early menopausal stage at baseline were further categorized by the lifestyle factors (dispersion, tiredness, sleeping problem etc.) and disease factors (hot flashes, osteoporosis, diabetics etc.) what happened for early menopause. participants were divided into quartile categories of bmi with gender (all are female) specific quartile cut points based on full collected data. the participants having bmi range (0 - 24, 25 - 28, 29 +) categorized as (low, medium, high). the bmi range of category is selected through the diabetic 's factors assessment for bangladeshi population by ahmed.13 the data were analyzed using ms excel spread sheet 2010, weka of version 3.6.5. using ranker algorithms the factors (both lifestyle and disease factors) were ranked for both menopausal status. spss result enlisted the most significant lifestyle and disease factors. in statistical analysis, to evaluate the quality of life of women with menopausal symptoms, different techniques were used in several researches like menopause - specific qol (menqol),10 t - test,14 test,15 etc. through menqol (consisted with 22 factors) technique, all data was divided into four domains : vasomotor, psychological, physical and coherent disease. vasomotor domain consisted with hot flashes, osteoporosis and sweating at night factors in while coherent disease domain consisted with type 2 diabetics, coherent heart disease factors. chi - test () is used for calculating correlation among qol factors for both cases participants. the frequency distribution in table 1 is calculated using equation 1. this study is an ongoing multicenter population - based study to investigate the relationship among lifestyle factors of causing early and late menopause, type 2 diabetics and problem for abnormal menopausal time. collected data consisted with 150 participants (all are women), enrolled into the recorded data between 2013 and 2014, in 3 study centers across 3 different palaces in bangladesh (i.e. santosh, palpara, goshpara in tangail). in recorded data the majority participants were between 50 and 70 years old although recorded data hold 42 to 90 years old participants information. pregnant, breast feeding, hormone therapy taken women, and women with uncontrolled medical conditions like type 2 diabetics, hypertension or coherent heart disease were participated in our cross - sectional study. some participants gave written informed consent and others were in viva - voce, and the study was approved by the local committees at the participating centers and department of biotechnology and genetic engineering research and ethics committee, mawlana bhashani science and technology university. with socio demographic information, menstruation status based data were reported according to the length of time since last menstrual period and the experience of symptoms on qol. at primary stage, questionnaires and computer - guided, face - to face interviews were used to record information about basic lifestyle, illness, problems for abnormal menopausal stage (early menopause or late menopause). mainly literature review, exploratory research and qualitative piloting informed the development and refinement to structure a questionnaire in english. questionnaire information on lifestyle covered lifetime history as well as current habits (at recruitment time) of physical activity without work, body mass index (bmi) in height (m) / weight (kg) where height and weight were measured by following standardized procedures. although regular exercise is mentioned here as physical activity without work which makes man happy with good health and improves qol. besides, majority participants were not concerned about problems of bmi, only 15% were careful. the other information in questionnaire was close and open ended including series of questions whose are associated with abnormal menopausal factors such as age, blood pressure, hot flashes, osteoporosis, type 2 diabetics, coherent heart disease, heart beating, feeling tense or nervous, sleeping problem, excitable, concentrating problem, feeling tried or lacking in energy and dizzy, depression, physical problem (pain, backaches, bloating, sore breasts, headaches diarrhea, food cravings etc.) during menstruation, irritability, pressure or tightness in head or body, parts of body feel numb or tingling, headache, muscle and joint pain, loss of feeling in hands or feet, breathing problem, sweating at night etc. the answer of questions could be categorized as numeric number for age, height and weight factors, high or low for blood pressure factor, early or late for menopausal status factor and yes or no for rest of factors. a total of 67% participants who had reported early menopausal status at the time of baseline recruitment and 33% participants were late menopausal status. as for collecting data from different places may carry duplicate and missing values which can help to provide wrong investigational result. so data cleaning (also known as data pre - processing) is a vital step not only for minimization of memory but also normalization of values what used to represent information in database. in this study duplicate values (1.33% in whole collection) were discarded and missing values (2% in whole collection) were provided according to other participants ' information of those places. finally 150 participants ' data were enlisted for research study what was checked using waikato environment for knowledge analysis (weka) toolkit of 3.6.5 version. the goals of research are to analyze early menopause and late menopause with association among factors (mentioned in questionnaire). with regard to menopausal status (goal) variables, study participants were categorized according to menopausal status at the time of recruitment (early, late). subjects who reported early menopausal stage at baseline were further categorized by the lifestyle factors (dispersion, tiredness, sleeping problem etc.) and disease factors (hot flashes, osteoporosis, diabetics etc.) what happened for early menopause. participants were divided into quartile categories of bmi with gender (all are female) specific quartile cut points based on full collected data. the participants having bmi range (0 - 24, 25 - 28, 29 +) categorized as (low, medium, high). the bmi range of category is selected through the diabetic 's factors assessment for bangladeshi population by ahmed.13 the data were analyzed using ms excel spread sheet 2010, weka of version 3.6.5. using ranker algorithms the factors (both lifestyle and disease factors) were ranked for both menopausal status. collected data were also analyzed using spss version 20.0 software (spss, inc., chicago, il, usa). finally comparing weka and spss result enlisted the most significant lifestyle and disease factors. in statistical analysis, to evaluate the quality of life of women with menopausal symptoms, different techniques were used in several researches like menopause - specific qol (menqol),10 t - test,14 test,15 etc. through menqol (consisted with 22 factors) technique, all data was divided into four domains : vasomotor, psychological, physical and coherent disease. vasomotor domain consisted with hot flashes, osteoporosis and sweating at night factors in while coherent disease domain consisted with type 2 diabetics, coherent heart disease factors. chi - test () is used for calculating correlation among qol factors for both cases participants. the frequency distribution in table 1 is calculated using equation 1. among all female participants the mean of age and bmi were 61.55 10.7 and 24.33 4.41 respectively. the mean length of time since menopause for all participants was 14.13 11.17 years. among all participants only 60.7% was involved in physical activity work out their job work and 39.3% was not directly or indirectly involved in physical exercise. an overview of all participants the result is showing in table 2 that early menopausal female number is twice than late menopausal female number in bangladeshi women. table 2 shows for bmi that 56% participants in good level, 23.3% ongoing in bad level and 20.7% already reached in bad level. the research work has been done by two approaches like data mining approaches and statistical approaches. through data mining approach, table 3 shows that feeling tried or lacking in energy & dizzy and depression are the most significant factors for both early and late menopausal women. it also shows that coherent heart disease and type 2 diabetics are the least significant factors for both early and late menopausal women perspective to bangladesh. osteoporosis holds the 3 rank for late menopausal women in while feeling tense or nervous for early menopausal women. osteoporosis factor has more impact on qol of both early and late menopausal women than hot flashes. but table 3 shows that osteoporosis and hot flashes have high impact on qol of late menopausal women than early menopausal women. other factors ranking is mentioned in details on table 3 that is designed using data mining technique. finally table 3 is showing that physical and disease factors have more impact on qol of late menopausal women than early menopausal women but psychological factors have vice - versa impact. through table 1, in vasomotor domain osteoporosis (around 72%) factor has highest impact on qol of women for all cases and hot flashes (64%) has second highest place. similarly in psychosocial domain depression (around 81.3%) holds first rank among all factors and feeling tense or nervous (around 76.7%) is in second rank. feeling tried or lacking in energy and dizzy (around 82.7%) factor has most significant impact on qol of both early and late menopausal women not only in physical domain but also among all domain. table 1 shows that early menopausal women have faced more physical problem than late menopausal women. it also shows that coherent disease (like type 2 diabetics, coherent heart disease) may have no correlation with menopausal status. the natural menopausal age has been examined in several bangladesh studies215 as well as south asian studies16 and compared to other regions of the world.17 the mean age of participants in this research was 61.55 10.7 years and the mean menopausal time length was 14.13 11.17 years. this is higher than studies down in several places in bangladesh (51.14 years)15 and (53.31 years),2 in singapore (50 years),16 in nigeria (57.2 years).18 this research evaluated qol of women in bangladesh with menopausal symptoms on weka toolkit and menqol. menqol was using since 1996 with four domains : vasomotor, psychological, physical and sexual (but here used coherent disease). it has been applied in some developing countries1920 and also in europe.21 in this study feeling tried (83%) is the highest significant factor among 25 factors for both early and late menopausal women in bangladesh which is quite similar with the report of other place in bangladesh2 and the study.22 african - american women reported23 that hot flashes is most frequent (45.6%) factor followed by caucasians (31.2%), hispanic (35.4%), chinese (20.5%) and japanese (17.6%). in our study hot flashes factor is 64% quite similar with the report.102425 but osteoporosis (72%) is more frequent than hot flashes in our study. depression (81%) has the 2 highest impact on qol of bangladeshi women what is conducted with the other report.26 according to study frequency response of vasomotor symptoms was 72% and psychological symptoms was 91% both are quite similar to pakistan10 and thailand27 but higher than china.28 the final result for all domains suggested that psychosocial, physical and vasomotor menopausal symptoms are strongly associated with qol for both early and late menopausal women respectively. but this research also describes that the early menopausal women have to face more problem of menopausal symptoms than late menopausal women in bangladesh. all data was collected through face to face interview using bengali questions what might be contained wrong information for participant 's mistake. the frequency of menopausal symptoms might be changed for large amount of data for more places.	objectivesevery physical abnormal criterion has an impact on the health. late menopause causes different physiological problems which alike early menopause. the research interest is associated with both early and late menopausal women of bangladesh as only few menopausal studies available in south east asia especially in bangladesh. the aims of this study are not only to assess the symptoms of menopausal abnormality but also to determine the impact of these symptoms on the quality of life (qol) of the female society in bangladesh.methodsdata mining techniques are used to rank the 22 factors (conducted with questionnaire) commonly associated with menopause. among the participants menstruation that stops before 45 years was considered as early menopausal status and after 50 years as late menopausal. the mean of age and mean length of time in years, since menopause for all participants were 61.5510.7 and 14.1311.17, respectively. recorded data indicated 67% were early menopausal women and 33% were late menopausal women.resultsresults indicated that feeling tired or lacking in energy and dizziness (83%) and depression (82%) have worst impact on qol among all factors, respectively. the next prevalent symptoms included hot flashes (64%), osteoporosis (72%), sweating at night (63%), concentration problem (75%), irritability (63%), feeling tense (77%), headache (66%). however, less frequent factors included breathing problems (33%), loss of feeling (31%), coherent heart disease (13%) and type2 diabetics (9%).conclusionour study indicates that early menopausal women are facing more physiological problems than the late menopausal women on their qol.
chemotherapy - induced nausea and vomiting (cinv) negatively impacts the quality of life in cancer patients and may lead to nonadherence to or dose reductions in chemotherapy. potential cardiac effects of antiemetics warrant special attention, given an estimated 1360% burden of cardiovascular - related diseases that increases with age, among cancer patients [35 ]. cardiovascular disease (cvd) can be preexisting, a result or natural progression of the malignancy or an adverse event resulting from chemotherapeutic treatment, such as anthracyclines and alkylating agents [6, 7 ]. for example, cyclophosphamide treatment has been associated with a 728% incidence of heart failure, cisplatin has been associated with an 8.5% incidence of venous thromboembolism, including deep vein thrombosis and pulmonary embolism, and doxorubicin / daunorubicin has been associated with 0.53% incidence of arrhythmias. aprepitant is currently the only fda - approved neurokinin (nk1) receptor antagonist (ra) that, when coadministered with other antiemetics, such as corticosteroids (dexamethasone) and serotonin 5-ht3 receptor antagonists (e.g., dolasetron, granisetron, ondansetron, and palonosetron), augments the prevention of acute and, particularly, delayed cinv. although aprepitant has been shown to be generally well tolerated in clinical trials, isolated cases of serious adverse events, such as bradycardia and hypertension, have been reported in two highly emetogenic chemotherapy (hec) studies comparing aprepitant plus ondansetron and dexamethasone to the standard regimen of ondansetron and dexamethasone, alone [14, 15 ]. other cardiovascular events (> 0.5% and greater than standard therapy), regardless of causality, have also been reported in patients treated with the aprepitant regimen in either hec or mec studies, including myocardial infarction, tachycardia, deep vein thrombosis, flushing, hypertension, and hypotension. however, results from clinical trials may not reflect those observed in clinical practice, and population - based studies of the cardiovascular effects of aprepitant are lacking. we aimed to quantify background rates of several cvd - related events among hec and/or mec - treated cancer patients for two purposes : to understand expected rates among cancer patients in order to contextualize events which may be seen in our clinical development program of a similar patient population with a similar drug and to further understand at a high level whether rates differed by the decision to treat with aprepitant, recognizing that users versus nonusers may differ with respect to disease severity, access to care, preexisting conditions, and other factors. therefore, the objective of this study was to use a large, us healthcare claims database to assess the frequency of cvd - related events among hec and/or mec - treated cancer patients and to determine if the frequency was impacted by the decision to treat with aprepitant. a retrospective cohort study of adult patients with select cancers, treated with hec and/or mec, was conducted using 20052007 data from the impact national benchmark database (optuminsight, eden prairie, mn), a comprehensive, deidentified healthcare claims database that is representative of the nonelderly, insurance - carrying population in the united states. at the time of our analysis, the database contained inpatient / outpatient and pharmacy claims, a subset of lab results and enrolment information on over 82 million members from 45 healthcare plans serving nine census regions from 1997 to 2007. the study included several cancer types commonly treated with hec or mec, namely, breast, colorectal, head and neck, lung, and ovarian cancer patients (table 4), in adults with 4 cycles of hec and/or mec as documented in one or more claims in the year 2006. we choose 4 cycles because two - thirds of all treated patients had up to and including 4 cycles. the study analysis period was defined as the first day of the first hec and/or mec cycle to 30 days past the first day of the last cycle. the start of a new cycle of chemotherapy was defined by a period of more than 7 days but less than 45 days between cycles. the start of treatment was the first hec and/or mec claim in 2006, with 3 months prior with no claim (wash - in period) to ensure that there was no cvd effect of hec / mec treatment in 2005 that was carried over into 2006. the end of treatment was reached after 45 days of no additional hec and/or mec claim following the last claim (wash - out period) to ensure that all cvd effects from hec / mec treatment in 2006 were captured. to illustrate, for patients whose first hec or mec claim was between january 1, 2006 and march 31, 2006, the enrolment criteria for inclusion in the study extended as far back as october 1, 2005. for patients whose last claim in 2006 was seen after december 1, 2006, enrolment into 2007 to look for further treatment and the 45 day wash - out data on aprepitant exposure and chemotherapy was obtained from the inpatient / outpatient and pharmacy claims. chemotherapeutic agents were defined as hec if they were associated with > 90% of treated patients having emesis, and mec, if associated with 3090% of patients having emesis (table 5). chemotherapies were classified by a physician within our department using previously published criteria as guidance [16, 17 ]. cardiovascular outcomes of interest included arterial and venous thromboembolic events, individually as well as a composite event, as well as cardiac arrest, hypertension, hypotension, increased platelets, sudden death, and syncope (table 4). patient characteristics included gender, age, tumor type, and prior history of cardiovascular disease. prior cvd was defined as the presence of a claim for hypertension, diabetes, coronary artery disease, myocardial infarction, congestive heart failure, ischemic stroke, transient ischemic attack, deep vein thrombosis, or pulmonary embolism anytime before hec or mec initiation. subjects who used either hec or mec were categorized into 3 emetogenic chemotherapy groups : hec - only, mec - only, or hec / mec combined. all analyses, including the distribution (% or mean) of patient characteristics and the frequency of cvd outcomes of interest, were tabulated overall and stratified by aprepitant usage and emetogenic category of chemotherapy. analyses were not further stratified by number of chemotherapy cycles, however, due to insufficient sample size. this study was purely descriptive, and therefore, no formal statistical comparison was made between aprepitant users and nonusers. rather, the data was visually inspected for noteworthy absolute differences of 5% or relative differences of 1.5 times. the number of cancer patients with the cancer types of interest who had at least 3 months of continuous enrolment and pharmacy benefit, at least one hec or mec claim, and 4 cycles of chemotherapy was 5827. among these patients, the distribution of patients by cancer type was 60.4% with breast, 25.7% with lung, 7.0% with colorectal, 5.9% with head and neck, and 5.6% with ovarian cancer (table 1). over 90% of patients had treatment by mec - only, followed by 5.7% with hec - only and 3.9% with both hec and mec. females comprised the majority across chemotherapy groups (55% hec - only ; 80% mec - only ; 58% hec / mec combination), and this gender difference was greater among those who took aprepitant compared to those who did not. the mean age (~55 years) was similar across the chemotherapy groups, as was the percentage aged 60 years or older. those taking aprepitant, however, were 2 to 4.8 years younger, on average, and comprised fewer patients aged 60 + years compared to those who did not take aprepitant. in hec - only patients, 32% of aprepitant users were 60 + compared to 39% of nonusers ; in mec - only patients, the percentages were 20% versus 38%, respectively ; and in the hec / mec combination group, the percentages were 35% versus 36%, respectively. using a more traditional cutpoint of age 65 + years, similar results were found with aprepitant users having a smaller proportion of older patients than nonusers. over half of patients had a history of cvd before their chemotherapy treatment, with the hec - only group having a higher burden (62%) compared to the mec - only group (50%) and hec / mec combined group (56%). the proportion with a prior history of cvd was lower in aprepitant users compared to nonusers. overall, the frequencies of cardiovascular and thromboembolic - related events following any hec or mec treatment were mostly driven by the mec - only treatment group, comprising 90% of patients (table 2). the frequencies of increased platelets, arterial disorder, arterial occlusive disease, cardiac disorder, cardiogenic shock, iliac artery embolism, intermittent claudication and peripheral ischemia were low (n 10) in this cohort. hypertension occurred in 16% of the mec - only chemotherapy group and was slightly higher among the smaller hec - only and hec / mec combination groups. chest pain or discomfort occurred in 12% of the mec - only patients, in 19% of hec - only patients, and in 21% of combined hec / mec patients. all other single adverse cvd events occurred at a frequency less than 5%, including mi and cerebrovascular accident, with the exception of hypotension, which occurred in 5.3% of those treated with hec / mec combined. the composite measure for arterial thromboembolic events, excluding chest pain and discomfort, ranged from 4% among the mec - only group to 7% in the hec - only group. the composite of venous thromboembolic events was 12% for the hec - only and the hec / mec combined groups and stratified by the decision to include aprepitant in the antiemetic regimen (table 3), the analysis demonstrated that in the mec - only treated group, the composite of arterial thromboembolic events (without chest pain and discomfort), cardiac arrest, cardiorespsiratory arrest, cerebral ischemia, cerebrovascular accident, embolism, hypotension, and hypertension were more frequent (1.5 times or 5% absolute difference) among those who did not use aprepitant compared to those who did. though based on small numbers (n 10), nonusers also had a higher rate of circulatory collapse (10 versus 3), increased platelet (6 versus 1), intermittent claudication (3 versus 1), and myocardial ischemia (9 versus 2). in all but two events (arterial disorder and arterial occlusive disorder) of the cvd - related categories among the mec - only treated group, the frequency of cvd events was lower among aprepitant users versus nonusers. for the hec - only and the combined hec / mec chemotherapy groups, the numbers of individual cardiovascular - related events were generally too small (n 10) to make reliable comparisons across aprepitant status. however, where cells sizes were larger, hec - only - treated patients who did not use aprepitant compared to users had a higher frequency of chest pain / discomfort as a diagnosis, a composite diagnosis of arterial thromboembolic events, excluding chest pain and discomfort, hypertension, and a composite measure of venous thromboembolic events. though rare (n 10), additional events that were more frequent among nonusers compared to aprepitant users included angina pectoris (2 cases versus 1), embolism (5 versus 3), and hypotension (7 versus 4) ; in contrast, aprepitant users had a higher frequency of syncope (4 cases versus 8) than nonusers. among patients treated with both hec and mec, there was a higher frequency of chest pain and discomfort as a diagnosis and a composite diagnosis of arterial thromboembolic events, including chest pain, in nonusers of aprepitant compared to users. users had a higher frequency of hypotension (6 cases versus 6), intermittent claudication (2 versus 1), and peripheral embolism (2 versus 2). the proportion of patients with cvd events was low (5%) for many events across all chemotherapy groups, except for hypertension and the composite measures for arterial thromboembolic and venous thromboembolic events. this is in line with population - based data showing an annual incidence (per 1000 persons) of myocardial infarction of about 4 for men and 2 for women (atherosclerosis risk in communities surveillance data, 19872001), an annual incidence (per 1000 persons) of angina pectoris of 4 to over 8 among men ages 4554 and 65 + years, respectively, and 0.9 to over 4 among women ages 4554 and 65 + years, respectively (national heart, lung, and blood institute data, 2006), and a 33.6% prevalence of hypertension among us adults 20 years and older (national health and nutrition examination survey data, 20032006). cvd occurrences were slighter higher for those treated with hec only or hec / mec combined than those treated with mec - only. in addition, the hec / mec combined group experienced a slightly elevated frequency of hypotension compared to the hec - only or mec - only groups. it is noteworthy that sample sizes for the hec - only and hec / mec combination groups are orders of magnitude smaller than the mec - only group, and, thus, slightly higher percentages observed in these two groups may be due to sample variability. those who did not use aprepitant compared to those who did generally experienced higher frequencies of certain cvd - related events, namely, cardiac arrest, hypertension, hypotension, the composite of arterial thromboembolic events without chest pain / discomfort, and, in particular, cardio - respiratory arrest, cerebral ischemia, cerebrovascular accident, and embolism among the mec - only treated group ; arterial thromboembolic events with chest pain among the hec / mec combined chemotherapy groups ; arterial thromboembolic events without chest pain, hypertension, and venous thromboembolic events in the hec - only treated group. while there were some cvd - related events that occurred at a higher frequency among aprepitant users compared to nonusers, the absolute number of events was small, and most events were either similar across the two groups or higher in the nonaprepitant user group. in particular, in the mec - only group, with its large numbers of users and nonusers, arterial disorder was higher among aprepitant users but the occurrence of all other events was either similar or lower among aprepitant users compared to nonusers. this may be explained by the fact that nonusers were more likely than users to be older and have a prior history of cardiovascular disease. aprepitant is a substrate and dose - dependent inhibitor and inducer of the cytochrome p4503a4 (cyp3a4) isoenzyme, and drugs metabolized by cypa34 can have a potential drug interaction with aprepitant. for example, cyclophosphamide is an anticancer agent that is metabolized to its active metabolites by cypa34 and is also associated with cardiac side effects such as acute heart failure, pericardial effusion, and arrhythmia. coadministration with aprepitant causes a decrease in plasma concentrations of the active metabolites of cyclophosphamide by 5%, a level which may not be clinically significant. some 5-ht3 ra antiemetics (e.g., dolasetron, granisetron and ondansetron) have been associated with reversible, clinically insignificant changes to electrocardiographic (ecg) parameters (i.e., pr, qts, qt, and jt intervals), and their coadministration could have a diluting or enhancing effect on the occurrence of cardiovascular events. as with all administrative databases, the claims data collected were not designed for research purposes, and, thus, are limited in scope and lack detailed clinical information available in medical records, such as ecg readings and lab data on mi - induced elevations of troponin, and so forth. a claim may represent a condition to be ruled out rather than diagnosis of the condition, itself. discharge diagnosis for the identification of cardiovascular and thromboembolic events can have several sources of error, including variation in coding procedures, coding errors, incomplete coding, lack of specificity in available codes, and error in clinical diagnosis. nevertheless, the usefulness of claims data for certain cvd events has been assessed by other investigators. for example, a validation study of claim codes from a commercial insurance claims database, similar to impact, against the gold standard medical records, showed a positive predictive value of 88% for both myocardial infarction and ischemic stroke. this was a high - level analysis performed to provide overall background rates in a population of cancer patients similar to those under study in our clinical development program. it was not designed to draw causal inferences in differences between users of aprepitant and nonusers. the decision whether to treat with aprepitant most likely depends on many factors, such as the ability to pay for medications, physician experience, emetogenic potential of the chemotherapeutic agent, drug - drug interactions, and whether treatment is for acute or delayed cinv [24, 25 ]. we did not attempt to unmask or correct for potential channeling bias, nor did we consider other possible confounding factors between the aprepitant user and nonuser groups, including drug severity and comorbidity. our comparisons did not take into account possible confounding due to drug - drug interactions with specific cardiotoxic chemotherapeutic agents or other coadministered antiemetics. we did not account for chemotherapeutic drug dosages and did not have adequate sample size for assessing effects among individual cycles of chemotherapy. as a next step, we would have corrected for as many of these shortcomings as possible in a subsequent, more rigorous pharmacoepidemiology study had our clinical development program advanced. despite these limitations, this analysis provided a real world clinical practice baseline picture of the frequency of cvd - related events that occur during use of highly or moderately emetogenic chemotherapy, serving as a useful benchmark for safety signals identified during one of our clinical trial programs. the preliminary information on experiences of the aprepitant antiemetic group compared to nonusers was helpful but should be interpreted cautiously.	studies on cardiovascular safety in cancer patients treated with highly or moderately emetogenic chemotherapy (hec or mec), who may have taken the antiemetic, aprepitant, have been limited to clinical trials and postmarketing spontaneous reports. our study explored background rates of cardiovascular disease (cvd) events among hec- or mec - treated cancer patients in a population - based setting to contextualize events seen in a new drug development program and to determine at a high level whether rates differed by aprepitant usage. medical and pharmacy claims data from the 20052007 impact national benchmark database were classified into emetogenic chemotherapy categories and cvd outcomes. among 5827 hec / mec - treated patients, frequencies were highest for hypertension (1621%) and composites of venous (712%) and arterial thromboembolic events (47%). aprepitant users generally did not experience higher frequencies of events compared to nonusers. our study serves as a useful benchmark of background cvd event rates in a population - based setting of cancer patients.
complex sleep behaviors (csbs) are complex activities, normally associated with wakefulness, that occur when the subject is in a sleep - like state after taking a hypnosedative drug ; when the subject awakens the next morning, the subject has little or no memory of the activity. csbs include sleepwalking with object manipulation,1,2 sleep - related eating disorders,3,4 and sexual assault.5 these behaviors may not occur frequently, but clinical awareness of the potential for associated danger and harm is necessary. csbs induced by hypnosedatives have been the focus of much attention, especially after the us food and drug administration requested in march 2007 that manufacturers of 13 kinds of hypnosedative drugs modify their product labeling to include new safety warnings about these potentially dangerous behaviors.6 zolpidem, a nonbenzodiazepine receptor agonist, is a highly effective hypnotic with a short half - life, minimal daytime residual side effects at the recommended dose, a low risk for tolerance, dependence, or abuse,7,8 a low rate (1.1%) of adverse events, and no life - threatening events.9 zolpidem does cause decreased rapid eye movement sleep while increasing total sleep time. incidents of zolpidem - associated nocturnal wandering and abnormal sleep behavior have previously been reported as rare side effects.10 zopiclone, also a nonbenzodiazepine hypnotic with even greater addictive potential than benzodiazepines, has been described as a benzodiazepine in disguise.1113 it is thought to act on the gabaa receptor complex at a site distinct from the benzodiazepine binding site.14 tolerance to the effects of zopiclone can develop after a few weeks use and abrupt withdrawal, particularly with prolonged and high doses. zopiclone can also cause seizures and delirium.15,16 it is the frst cyclopyrrolone possessing a pharmacological profle of high effcacy and low toxicity similar to that of benzodiazepines.17 its elimination half - life is 56 hours, it does not accumulate upon repeated administration, and its pharmacokinetic profle is not substantially modifed in the elderly and renal failure patients.18 in clinical trials, zopiclone (usually 7.5 mg) improved sleep in chronic insomniacs similarly to nitrazepam 5 mg, flurazepam 1530 mg, triazolam 0.5 mg, and temazepam 20 mg, but in a single study was slightly less effective than funitrazepam 2 mg in some evaluation criteria.17 the drug is generally well tolerated by patients of all ages and the most frequently reported adverse effects are bitter taste and dry mouth.14 treatment for withdrawal due to adverse effects is seldom required and reports of rebound insomnia after zopiclone withdrawal are rare.14 minimal impairment of psychomotor skills and mental acuity may occur in the morning after a bedtime dose of zopiclone.17 in this study, we employed a case - control design to address the issue of csbs in nonbenzodiazepine users. specifically, we were most interested in testing whether medication, sex, and age would be risk predictors for csbs. data were collected through extensive chart reviews of nonpsychotic outpatients treated with zolpidem or zopiclone for insomnia at psychiatric services of tri - service general hospital (taipei city, taiwan) over a 16-month period in 20062007. the inclusion criteria were : (1) 1886 years of age ; (2) prescribed zolpidem or zopiclone ; (3) diagnosed with affective disorders, anxiety disorders, or simple sleep disturbance ; and (4) cohabited with others, such as a family member or partner. exclusion criteria were living alone, also taking benzodiazepines at night, or history of eating disorders, mental retardation, dementia, attention - defcit / hyperactivity disorders, substance abuse, and/or seizure disorders. a total of 1,220 patients were eligible for the study (486 males, 734 females). all of the patients were taking hypnotic medications after evaluation and diagnosis by a psychiatrist on the basis of diagnostic and statistical manual of mental disorders, 4th edition, text revision criteria. the patients were then given a structured interview by a trained assistant with a special focus on the quality of sleep and associated complaints after zolpidem or zopiclone use. data on the patients demographic and personal history, including age, sex, drug category, and diagnosis, were recorded. descriptive results of continuous variables were expressed as mean (standard deviation) and categorical variables were expressed as frequency (%). all statistical analyses were performed with student s t - test, chi - square tests, and/or fisher s exact test using the statistical package for social sciences version 20.0 (spss, inc, chicago, il, usa). among 1,220 zolpidem or zopiclone users, 40 (3.28%) patients reported incidents of somnambulism or amnesic sleep - related behavior problems. the average age was 39.16 years, and the average dosage of zolpidem / zopiclone was 10.0 mg per day. the fve most common diagnoses were : major depressive disorder, recurrent ; dysthymic disorder ; major depressive disorder, single episode ; insomnia ; and bipolar disorder. the behavioral problems included 20 patients who could not remember what happened after taking zolpidem / zopiclone. among them, eleven ate food, four walked in their houses, two talked with others, and three had other symptoms such as dizziness (table 1). there was no signifcant association with older age (.65 years), sex, side effects, or drug category, although those who had side effects were younger than those without side effects (34.20 years versus 39.33 years, p = 0.033) (table 2). csbs are categorized as parasomnias in the international classifcation of sleep disorders (icsd-2), which defnes parasomnia as a sleep disturbance characterized primarily by undesirable physical events or experiences that occur during entry into sleep, within sleep, or during arousal from sleep.19 the incidence, mechanisms, and management of csbs have been reported,20 especially for zolpidem - induced amnesia and somnambulism.21 the only unique risk predictor of zolpidem - related csbs was a high dosage of zolpidem (.10 mg / day).22 however, comparisons of short - acting hypnotics are limited in taiwan. we performed a chart review study for zolpidem and zopiclone in order to determine the incidence and risk factors for z - drug - related csbs. a possible mechanism for hypnosedative csbs and amnesia is enhanced gaba activity at gabaa receptors, especially the 1-gabaa receptors. the amnesia that accompanies csbs is possibly due to inhibition of the consolidation of short- to long - term memory, suggesting that the risk may extend to nongabaergic effects as well. while amnesia and gaba - related receptor actions are the most frequently discussed mechanisms for csbs in the literature, they do not fully explain such behaviors. this suggests that other mechanisms and factors play a role. in comparison with the data of hwang and tsai,21 our investigation focused on adverse reactions to zolpidem and zopiclone in nonpsychotic taiwanese patients. for zolpidem, our study included 1,132 patients, which was 4.49.1 times larger than samples in the previous two articles. for zopiclone, our study included 88 patients ; the previous two articles did not study zopiclone. the incidence of csbs. with these two short - acting z - drugs was 3.28%, which was lower than the 5.1% reported by tsai or the 15.2% reported by hwang.21,22 we suggest that the main causes for the difference is our study s larger patient sample size, removal of psychotic patients, and collecting data from outpatients treated by different attending physicians. although mean age of those with csbs was younger than those without csbs in our study, clinicians should still be cautious when prescribing z - drugs in the treatment of elderly patients with sleep problems. despite the lower incidence of csbs shown in our study compared to previous studies, careful attention when prescribing these short - acting z - drugs is still advised. much more severe adverse effects have been reported for zolpidem or other nonbenzodiazepine hypnotics, such as falls in hospitalized patients23 or even hip fracture in nursing home residents.24 the relationship between zolpidem- or zopiclone - related csbs and falls and hip fracture remains unclear, but is important to clarify in future studies.	objectivecomplex sleep behaviors (csbs) are classified as parasomnias in the international classifcation of sleep disorders, second edition (icsd-2). to realize the potential danger after taking two short - acting z - hypnosedative drugs, we estimated the incidence of csbs in nonpsychotic patients in taiwan.methodssubjects (n = 1,220) using zolpidem or zopiclone were enrolled from the psychiatric outpatient clinics of a medical center in taiwan over a 16-month period in 20062007. subjects with zolpidem (n = 1,132) and subjects with zopiclone (n = 88) were analyzed. all subjects completed a questionnaire that included demographic data and complex sleep behaviors after taking hypnotics.resultsamong zolpidem and zopiclone users, 3.28% of patients reported incidents of somnambulism or amnesic sleep - related behavior problems. the incidence of csbs with zolpidem and zopiclone were 3.27%, and 3.41%, respectively, which was signifcantly lower than other studies in taiwan.conclusionthese results serve as a reminder for clinicians to make inquiries regarding any unusual performance of parasomnic activities when prescribing zolpidem or zopiclone.
nanoporous silica particles were synthesized and characterized as described previously and as detailed in supplementary figure 1 and the supplementary methods section. particles larger than 150-nm in diameter were removed via differential centrifugation or size - exclusion chromatography (see supplementary figs. 1a and 1d). protocells were formed by fusing 120-nm liposomes to the nanoporous core as reported previously, and the composition of the slb was optimized to reduce non - specific binding associated with cationic and, to a lesser extent, anionic lipids (see supplementary fig. 5). zwitterionic lipids (dopc or dppc) with 5 wt% phosphatidylethanolamine (dope or dppe, respectively), 5 wt% peg-2000 pe (18:0 or 16:0, respectively), and 30 wt% cholesterol were used in all further studies ; pegylated lipids were incorporated into the liposomes used for fusion and are, therefore, expected to be present on both the inner and outer leaflets of the slb. the size of the nanoporous core was also optimized to attain a balance between achievable cargo capacity and the rate of protocell internalization (see supplementary fig. 9) ; nanoparticles 100- to 150-nm in diameter were employed in the delivery of drugs, drug cocktails, sirna cocktails, and protein toxins. the nanoporous cores were soaked in a 10 mm solution of cargo(s) for 1 - 12 hours prior to liposome fusion ; individual components of the surrogate cargo mixture (fig. the rates of cargo release were optimized by incorporating various percentages of aeptms, an amine - containing silane, into the sol used to form nanoporous cores (see supplementary fig. particles containing 15 wt% aeptms were used to deliver drugs and drug cocktails (fig. 6), while particles containing 20 wt% aeptms were used to deliver the multicomponent mixture (fig. 5), the sirna cocktail (supplementary figs. 13 and 14), and diphtheria toxin a - chain (supplementary figs. 15 and 16).	encapsulation of drugs within nanocarriers that selectively target malignant cells promises to mitigate side effects of conventional chemotherapy and to enable delivery of the unique drug combinations needed for personalized medicine. to realize this potential, however, targeted nanocarriers must simultaneously overcome multiple challenges, including specificity, stability, and a high capacity for disparate cargos. here we report porous nanoparticle - supported lipid bilayers (protocells) that synergistically combine properties of liposomes and nanoporous particles. protocells modified with a targeting peptide that binds to human hepatocellular carcinoma (hcc) exhibit a 10,000-fold greater affinity for hcc than for hepatocytes, endothelial cells, and immune cells. furthermore, protocells can be loaded with combinations of therapeutic (drugs, sirna, and toxins) and diagnostic (quantum dots) agents and modified to promote endosomal escape and nuclear accumulation of selected cargos. the enormous capacity of the high - surface - area nanoporous core combined with the enhanced targeting efficacy enabled by the fluid supported lipid bilayer allow a single protocell loaded with a drug cocktail to kill a drug - resistant hcc cell, representing a 106-fold improvement over comparable liposomes.
current ophthalmic simulators demonstrate the equipment setup and 3-dimensional (3d) image perception in a 2d environment. however they do not simulate the 3d nature of the eye so that the trainee does not appreciate the structures within the eye in true 3d, and therefore depth perception and spatial awareness are a problem. depth perception and spatial awareness are very important in that manipulation of instruments within the eye by the examiner involves distances that are microscopic. it is critical that ophthalmologists learn in three dimensions for procedures. in ocular ultrasound it is important to know where the resultant ultrasound beam is being placed according to probe position and hence the structures being examined. the most challenging aspect of ocular b - scan ultrasound is the conversion, by the operator, of 2d slice of image into 3d interpretations. this also needs to be realized in real time in order to formulate an echographic diagnostic interpretation. in photocoagulation of the retina and yag laser capsulotomy it is important to know exactly where and at what depth to aim the laser so as not to damage adjacent structures that can potentially have blinding consequences in real patient situations. hence patients will not need to have procedures done by less experienced clinicians until they are deemed competent by way of learning from these models. there is no current technology that can simulate the procedure in true 3d to give the ophthalmologist even more insight into the complexity of the procedure they are simulating. we have studied extensively 3d computer technology and its use in teaching medical procedures.16 the proposed solution is real 3d and the team has developed an eye model that can be manipulated in 3 dimensions to give a user - defined perspective of the model eye that is an ideal teaching tool (see figure 1). this technology can be integrated into simulators of medical equipment, such as ophthalmoscopes, ultrasound probes, and lasers, to give real time 3d feedback on ophthalmologists aiming and operation of the equipment and simulate the consequences of their actions, such as measuring distances in ultrasound. the system can evaluate their technique and compare their performance against a gold standard performed by a competent operator. the system can give them feedback and illustrate the gold standard performance for educational purposes. we have developed a novel approach to teach ocular ultrasound by using a novel 3d ocular model. a 3d virtual model is built using widely available, open source, software (see figure 2). the model is then used to generate movie clips simulating different orientations of the scanner head. using blender, quicktime motion clips are choreographed and collated into interactive quizzes and other pertinent pedagogical media. the process involves scripting motion vectors, rotation, and tracking, of both the virtual stereo camera and the model. the resulting sequence is then rendered for twinned right- and left - eye views. finally, the twinned views are synchronized and combined in a format compatible with the stereo projection apparatus. the process of making models and the various simulations are detailed further on our website (http://www.abdn.ac.uk/~com168/ophth/development_process.shtml) to illustrate further the potential of our models. the eye models are currently being used to teach ocular ultrasound and they have been made to simulate ultrasound positions and lesion localization (see figure 3). these models will help the student with spatial awareness and allow for assimilation of this awareness into clinical practice. it will also help with grasping the nomenclature used in ocular ultrasound as well as helping with localization of lesions and obtaining the best possible images for echographic diagnosis, accurate measurements, and reporting. a further model has been developed from our experience and work on eye modeling in blender. this model is interactive and can be manipulated in any direction and plane using a graphics interface pad. this model has much potential to teach where both trainer and trainee can interact with it. it will be used to teach not only ultrasound, but also ophthalmic anatomy, and surgical and laser procedures. to date a virtual eye model has been developed (see figure 4) and used to test the potential for learning enhancement with students of ophthalmology, as detailed table 1. we are currently working on specifying and commissioning a prototype of the hardware and drivers of peripheral devices to control a range of open source software such as openscenegraph (osg) and blender, thereby allowing real - time manipulation of the virtual eye models in pedagogical scenarios. develop the prototype peripheral hardware and electronics : globe peripheral and drivers broadcasting the orientation pitch, yaw, and tilt the real - time orientation of the globe.probe peripheral and drivers broadcasting proximity, and orientation of the probe relative to the globe, in real-time.wifi communication with host computer and osg tracking module. globe peripheral and drivers broadcasting the orientation pitch, yaw, and tilt the real - time orientation of the globe. probe peripheral and drivers broadcasting proximity, and orientation of the probe relative to the globe, in real - time. this involves writing an osg manipulator module which compiles on windows, macintosh, and linux. develop and field test software modules utilizing the generated osg manipulator data on the existing eye model, thereby manipulating and displaying : real - time orientation of the globe model affecting the virtual eye model.real-time orientation of the probe relative to the globe affecting the virtual probe and, ultimately (see 4 below), generating synthesized scanner output. real - time orientation of the probe relative to the globe affecting the virtual probe and, ultimately (see 4 below), generating synthesized scanner output. develop and field test associated ophthalmology teaching and learning modules utilizing these tools, and including refinement of the existing eye model s appearance. develop a visual synthesizer module for osg, generating an inset panel within the 3d environment displaying simulated, real - time, ultrasonic scanner output dependent on the probe s position relative to the globe extend the application display capabilities to 3d spectacles and thus fully immersive 3d augmented reality experiences, for example : within simulated microscope apparatus.a multiuser server for small group anatomy tutorials utilizing 3d spectacles. this needs to track each user s head position relative to the assumed location of the virtual model. within simulated microscope apparatus. a multiuser server for small group anatomy tutorials utilizing 3d spectacles this needs to track each user s head position relative to the assumed location of the virtual model. to date a virtual eye model has been developed (see figure 4) and used to test the potential for learning enhancement with students of ophthalmology, as detailed table 1. we are currently working on specifying and commissioning a prototype of the hardware and drivers of peripheral devices to control a range of open source software such as openscenegraph (osg) and blender, thereby allowing real - time manipulation of the virtual eye models in pedagogical scenarios. develop the prototype peripheral hardware and electronics : globe peripheral and drivers broadcasting the orientation pitch, yaw, and tilt the real - time orientation of the globe.probe peripheral and drivers broadcasting proximity, and orientation of the probe relative to the globe, in real-time.wifi communication with host computer and osg tracking module. globe peripheral and drivers broadcasting the orientation pitch, yaw, and tilt the real - time orientation of the globe. probe peripheral and drivers broadcasting proximity, and orientation of the probe relative to the globe, in real - time. this involves writing an osg manipulator module which compiles on windows, macintosh, and linux. develop and field test software modules utilizing the generated osg manipulator data on the existing eye model, thereby manipulating and displaying : real - time orientation of the globe model affecting the virtual eye model.real-time orientation of the probe relative to the globe affecting the virtual probe and, ultimately (see 4 below), generating synthesized scanner output. real - time orientation of the probe relative to the globe affecting the virtual probe and, ultimately (see 4 below), generating synthesized scanner output. develop and field test associated ophthalmology teaching and learning modules utilizing these tools, and including refinement of the existing eye model s appearance. develop a visual synthesizer module for osg, generating an inset panel within the 3d environment displaying simulated, real - time, ultrasonic scanner output dependent on the probe s position relative to the globe extend the application display capabilities to 3d spectacles and thus fully immersive 3d augmented reality experiences, for example : within simulated microscope apparatus.a multiuser server for small group anatomy tutorials utilizing 3d spectacles. this needs to track each user s head position relative to the assumed location of the virtual model. within simulated microscope apparatus. this needs to track each user s head position relative to the assumed location of the virtual model.. further refinement of these models and appropriate hardware integration will allow us to develop this tool for the benefit of teaching ocular ultrasound as well as surgical and laser procedures without having to put patients at risk. it is important for us to develop this technology further for the benefit of the ophthalmological profession and fraternity.	ocular ultrasound is now in increasing demand in routine ophthalmic clinical practice not only because it is noninvasive but also because of ever - advancing technology providing higher resolution imaging. it is however a difficult branch of ophthalmic investigations to grasp, as it requires a high skill level to interface with the technology and provide accurate interpretation of images for ophthalmic diagnosis and management. it is even more labor intensive to teach ocular ultrasound to another fellow clinician. one of the fundamental skills that proved difficult to learn and teach is the need for the examiner to mentally convert 2-dimensional b - scan images into 3-dimensional (3d) interpretations. an additional challenge is the requirement to carry out this task in real time. we have developed a novel approach to teach ocular ultrasound by using a novel 3d ocular model. a 3d virtual model is built using widely available, open source, software. the model is then used to generate movie clips simulating different movements and orientations of the scanner head. using blender, quicktime motion clips are choreographed and collated into interactive quizzes and other pertinent pedagogical media. the process involves scripting motion vectors, rotation, and tracking of both the virtual stereo camera and the model. the resulting sequence is then rendered for twinned right- and left - eye views. finally, the twinned views are synchronized and combined in a format compatible with the stereo projection apparatus. this new model will help the student with spatial awareness and allow for assimilation of this awareness into clinical practice. it will also help with grasping the nomenclature used in ocular ultrasound as well as helping with localization of lesions and obtaining the best possible images for echographic diagnosis, accurate measurements, and reporting.
the implication of gene environment interactions in the etiology of psychiatric diseases, such as depression and drug addiction is well established in humans (caspi. 2002 ; nilsson. 2007) and non - human primates (barr. is widely used to assess long - term consequences of different early experiences (ladd. 2000 ; pryce and feldon 2003). ms has been shown to strongly affect the neurocircuitries involved in drug addiction and also cause long - term effects on the propensity to voluntarily drink ethanol (gustafsson. 2008 ; oreland. 2009 ; ploj and nylander 2003 ; ploj. 2002, 2003b). in the compulsive use of ethanol, neurotransmitter systems such as dopamine, serotonin, noradrenaline and opioids are involved (koob and volkow 2010). one common factor affecting the development of these neural systems is the transcription factor activator protein (tfap) 2 (comb. 1988 ; damberg 2005). the tfap-2 may, therefore, be a target for early environmental influences and a mediator of the effects seen after ms. interestingly, early environmental factors have been associated with altered tfap-2 family gene expression in rats (meaney. 2000). in the present study, the aim was to examine possible differences in brainstem tfap-2 levels in animals genetically or environmentally predisposed to prefer high ethanol drinking and high ethanol concentration. besides rats subjected to ms, the ethanol - preferring alko, alcohol (aa) and the ethanol - avoiding alko, non - alcohol (ana) rats were studied. the aa and ana lines are among the first rodent lines produced by bidirectional selection for high ethanol preference in a two - bottle choice between ethanol and water (for review see sommer. three experiments were performed : i comparative analysis of tfap-2 levels in the aa and ana rats, ii assessment of tfap-2 levels in juvenile and adult rats subjected to different early environmental conditions using the ms model, and iii analysis of the impact of long - term voluntary ethanol consumption on adult rats reared in different early environmental conditions. experiment i twelve alcohol - nave adult male aa and ana rats were obtained from the national public health institute, finland. upon arrival, the rats were housed with 3 rats per cage in standard macrolon cages (59 38 20 cm) containing wood - chip bedding material. experiment ii and iii time - mated pregnant wistar rats (scanbur ab, sweden) arrived at the animal facility on gestational day 1415 (experiment ii) and 1213 (experiment iii). the pregnant rats were singly housed in macrolon cages. on the day of birth, postnatal day (pnd) 0, the litters were divided into litters of 910 pups (males, n = 56 ; females, the rat pups were subjected to daily 15 min (ms15) or 360 min (ms360) ms or conventional animal facility rearing (afr). the ms procedures have previously been described in detail elsewhere (gustafsson and nylander 2006). in adulthood, animals in experiment iii were singly housed from pnd 7375 and were then given free access to 5, 10 and 20% (v / v) ethanol solutions and one bottle with water (ms15e, ms360e and afre) or just water (ms15w and ms360w) for 54 days. the four - bottle choice paradigm is described in detail elsewhere (gustafsson and nylander 2006). the rats exposed to ms in experiment ii were sacrificed at 3 and 10 weeks, respectively, and rats in experiment iii at the end of the ethanol - drinking period. the brainstems were removed and immediately frozen on dry ice and stored at 80c until further analysis. all animals had free access to water and r36 labfor food pellets (lactamin ab, sweden) in a humidity- and temperature - controlled environment. all animal experiments were performed in accordance with the european communities council directives (86/609/eec). afr animal facility rearing, aa alko, alcohol, ana alko, non - alcohol, e rats having access to ethanol and water, ms15 15 min of maternal separation, ms360 360 min of maternal separation, w rats having access to only water a schematic overview of the experimental design of the three studies. afr animal facility rearing, aa alko, alcohol, ana alko, non - alcohol, e rats having access to ethanol and water, ms15 15 min of maternal separation, ms360 360 min of maternal separation, w rats having access to only water with some modifications, tfap-2 levels were analyzed using enzyme - linked immunosorbent assay as earlier described (berggard. 50 l of 14 g / ml goat polyclonal tfap-2 primary antibody (sds biosciences, sweden) together with 50 l of 1.5 g / ml donkey anti - goat igg ap conjugated secondary antibody (sds biosciences, sweden) was added per well. 25 min after adding 50 l of phosphatase substrate solution, an additional 50 l of stop solution (3 m naoh) was added. the immunoreactive (ir) tfap-2 in each sample was deciphered from a standard curve, where known log10 transformed concentrations of ir tfap-2 peptide (sds biosciences, sweden) were plotted against optical density using assayzap v3.1 (biosoft, uk). a one - way analysis of variance (anova) followed by fisher s protected least significant differences (plsd) post - hoc test was performed to compare ir tfap-2 levels between i aa and ana male rats, ii ms15l, ms360l, and afr male rats at 3 and 10 weeks of age, respectively, and iii ms15w, ms360w, ms15e, ms360e and afre male rats. two - way anova followed by fisher s plsd post - hoc test was used for comparison between the rearing environment (ms15 or ms360) and fluid intake (water or ethanol). significant differences in immunoreactive (ir) tfap-2 protein levels (f1,21 = 5.136 ; p < no ms - induced effects on ir tfap-2 protein levels were detected in either the juvenile (f4,44 = 1.379 ; p = 0.257) or adult = 0.64) were seen between the ms15w, ms15e, ms360w, ms360e and afre rats. comparing the water- and ethanol - drinking ms groups, no significant effects of rearing environment (f1,38 = 0.498 ; p = 0.48), fluid intake (f1,38 = 0.036 ; p = 0.85) or interaction between rearing environment and fluid intake (f1,38 = 0.021 ; p = 0.89) with regard to ir tfap-2 protein levels were observed (table 1). the voluntary ethanol consumption has been described in detail elsewhere (gustafsson and nylander 2006).table 1the immunoreactive levels of tfap-2 protein in the brain stem of male ratsrearing environmentageneffect of heredityeffect of rearing environmenteffect of rearing environment long - term voluntary ethanol intakeaaadult98.76 0.37anaadult116.81 0.34ms15juvenile1027.45 1.20ms360juvenile1027.86 0.73afrjuvenile925.36 0.47ms15adult1028.64 1.18ms360adult1033.52 1.71afradult1031.70 1.37ms15 wadult1014.57 0.95ms360 wadult1015.37 1.10ms15eadult1014.89 0.91ms360eadult1215.42 0.80afreadult1113.62 0.95results are shown in mean ng ir tfap-2 protein per mg total protein semafr animal facility rearing, aa alko, alcohol, ana alko, non - alcohol, e rats having access to ethanol and water, ms15 15 min of maternal separation, ms360 360 min of maternal separation, n number of rats, w rats having access to only water p < 0.01 compared to aa rats (anova followed by fisher s post - hoc test) the immunoreactive levels of tfap-2 protein in the brain stem of male rats results are shown in mean ng ir tfap-2 protein per mg total protein sem afr animal facility rearing, aa alko, alcohol, ana alko, non - alcohol, e rats having access to ethanol and water, ms15 15 min of maternal separation, ms360 360 min of maternal separation, n number of rats, w rats having access to only water p < 0.01 compared to aa rats (anova followed by fisher s post - hoc test) previous clinical studies have suggested an association between a gene variation in tfap-2 and personality (damberg. 2000), severe female alcoholism (nordquist. 2009) and depression in adolescents (nilsson. it has further been proposed that tfap-2 may be a target for factors known to influence psychopathological behavior via its effect on transcription of several monoaminergic genes in the central nervous system (for review see damberg 2005). further support for this notion stems from findings of effects of antidepressive drugs on brainstem tfap-2 protein levels in male rats (berggard. 2005), indicating a change in the serotonin network in this brain region. in addition, the levels of tfap-2 protein in the brainstem area are inversely correlated to monoamine turnover in the male rat forebrain (damberg. 2001). having these factors in mind, we selected the brainstem region, where the serotonin cell bodies are located. differences in serotonin, dopamine, noradrenaline and opioid systems between the aa and ana rats have been reported (for review see sommer. several genes of importance for these neurocircuitries have consensus sites for tfap-2. interestingly, higher levels of ir tfap-2 levels were seen in the predisposed ethanol - preferring aa rats compared to the non - preferring ana rats. ms affects various brain networks, including the dopamine, serotonin and opioid systems (arborelius and eklund 2007 ; gustafsson. 2008 ; oreland. 2009 ; ploj and nylander 2003 ; ploj., it was hypothesized that the early life environment could affect the levels of tfap-2 and thereby cause alterations in gene expression of various transmitters, receptors and transporters. in one previous study, it was reported that short ms is associated with altered hippocampal tfap-2 gene expression in rats (meaney. however, our findings suggest no ms - induced differences in brainstem ir tfap-2 levels in either juvenile or adult male rats. we also measured the ir tfap-2 brainstem levels in juvenile and adult female rats subjected to litter - wise and individual ms15 and ms360 as well as afr. also in this case no differences in ir levels were observed (data not shown). first, the ap-2 gene in the meaney study was measured in another brain area than in our study, thus, making it difficult to compare the results. the tfap-2 family consists of five known isoforms (for review see damberg 2005) and one of the isoforms other than tfap-2 could have been engaged in the differences observed by meaney and co - workers. third, alterations in gene expression do not necessarily have to mirror alterations in protein levels. the early rearing environment has been suggested to be either a protective (short ms) or a risk (prolonged ms) factor for high voluntary ethanol consumption (roman and nylander 2005). in addition, wistar rats subjected to ms were induced to changes in dopamine receptors and opioid peptide levels after long - term, voluntary ethanol self - administration (ploj. 2003a). in another study but using the same animals as experiment iii, differences in ethanol consumption and opioid peptide levels between the experimental groups have previously been reported (gustafsson and nylander 2006 ; gustafsson. therefore, we further examined whether different early life experiences would alter ir tfap-2 levels after long - term voluntary ethanol drinking. however, no differences in ir tfap-2 levels were observed. furthermore, no ethanol - induced effects on ir tfap-2 levels were observed indicating that tfap-2 is not affected by voluntary ethanol consumption in any of the experimental groups. it is worth mentioning that the standard curve for the immunoassays between the three experiments did not differ from each other. the variations seen between the three experiments are speculated to be due to differences in rat lines (wistar versus aa / ana lines) or emotional stress level (due to different housing conditions). the rats in experiment ii, i.e. rats solely exposed to different early rearing conditions, were housed in groups until they were sacrificed. however, the rats in experiment iii, i.e. having access to either water and ethanol or only water, were housed individually for 8 weeks during the entire ethanol access period. therefore, we speculate that the differences between the rats in these two experiments might be due to the emotional stress applied in the isolated rats in experiment iii. in conclusion, our data show that the genetically predisposed ethanol - preferring aa rats and ethanol - avoiding ana rats differ in ir tfap-2 protein levels. no differences in ir tfap-2 protein levels induced by the different early rearing environments were seen in the brainstem of juvenile and adult rats. furthermore, long - term voluntary ethanol consumption did not alter brainstem tfap-2 protein levels in male wistar rats subjected to ms.	genes involved in alcoholism have consensus sites for the transcription factor activator protein (tfap) 2. in the present study, we investigated tfap-2 protein levels in the ethanol - preferring alko, alcohol (aa) and the ethanol - avoiding alko, non - alcohol (ana) rat lines. furthermore, basal and ethanol - induced tfap-2 levels were examined in wistar rats exposed to different early postnatal environments that are known to affect later ethanol consumption. taken together, we found differences in brainstem tfap-2 protein between the aa and ana rats.
	exposure to pesticides, dyes, and pollutants that mimic the growth promoting effects of estrogen may cause breast cancer. the pesticide ddt and the food colorant red no. 3 were found to increase the growth of htb 133 but not estrogen receptor (er) negative human breast cells (htb 125) or rat liver epithelial cells (rle). red no. 3, beta - estradiol, and ddt increase er site - specific dna binding to the estrogen response element in htb 133 cells and increase cyclin - dependent kinase 2 activity in mcf-7 breast cancer cells. site - specific dna binding by p53 in rle, htb 125, htb 133, and mcf-7 cells was increased when they were treated with red no. 3, which suggests that cellular dna was damaged by this colorant. red no. 3 increased binding of the er from mcf-7 cells to the estrogen - responsive element. consumption of red no. 3, which has estrogenlike growth stimulatory properties and may be genotoxic, could be a significant risk factor in human breast carcinogenesis.imagesfigure 4. afigure 4. bfigure 5. afigure 5. bfigure 6.figure 7. afigure 7. bfigure 7. c
the study consisted of randomly selected 24 subjects of three groups of age 9, 16, and 27 years (four subjects of both genders in each) who reported to the department of orthodontics and dentofacial orthopaedics, tamil nadu government dental college and hospital. the subjects had no potential health influence on cervical vertebrae such as genetic abnormalities or hormonal disorders. the ct of cervical vertebrae c1, c2, and c3 was taken in subjects using multi - slice spiral ct scanner (toshiba asteion tsx-021b 4 slice ct scanner, 2007, japan). the ct images were formatted into standard dicom (digital imaging and communications in medicine, 2007, japan) and reconstructed into continuous slices of 0.6 mm thickness. the images were transferred to a workstation and reconstructed using software (version 2.1.2., 2006, merge health care, and milwaukee, usa), which is a standard software for dicom image viewing and analysis. the coronal, sagittal, and axial slices of the dicom images where then viewed and measured using reconstruction software (mimics co., materialise, belgium). the following morphological variations (bone density) with respect to cervical vertebrae were studied [figures 17 ]. cervical vertebra : (a) c1, (b) c2, (c) c3 cervical vertebra c1 reconstruction images cervical vertebra c2 reconstruction images cervical vertebra c3 reconstruction images cervical vertebra c1. (a) coronal section, (b) axial section and (c and d) transverse sections cervical vertebra c2. (a) coronal section, (b) axial section and (c and d) transverse sections cervical vertebra c3. (a) coronal section, (b) axial section and (c and d) transverse sections the middle component of c1 that gets relatively thinner with agethe superior surface of the anterior arch of c2 that becomes more prominent with increasing agethe inferior surface of the anterior tubercle of c3 that becomes more prominent with increasing age. the middle component of c1 that gets relatively thinner with age the superior surface of the anterior arch of c2 that becomes more prominent with increasing age the inferior surface of the anterior tubercle of c3 that becomes more prominent with increasing age. analysis of variance (anova) [tables 2 and 3 ]. student 's t - test was used for independent sample to identify the gender difference or comparison between males and females in the above said age groups [tables 46 ]. results were considered statistically significant at a p < 0.001. observed computed tomography values the bone density of c1, c2, and c3 in males of 9, 16, and 27 years, as measured by analysis of variance the bone density of c1, c2, and c3 in females of 9, 16, and 27 years, as measured by analysis of variance the comparison between bone densities of male and female patients of age group of 9 years using the student 's t - test the comparison between bone densities of male and female patients of age group of 16 years using the student 's t - test the comparison between bone densities of male and female patients of age group of 27 years using the student 's t - test anova done for this study showed that the middle component of c1 that gets relatively thinner with age ; the superior surface of the anterior arch of c2 that becomes more prominent with increasing age and the inferior surface of the anterior tubercle of c3 that becomes more prominent with increasing age, are highly statistically significant in both males and females. student 's t - test showed that cervical vertebrae c1 is denser in males than females at 9 years, whereas it is denser in females than males at 16 years and it is denser in males than females at 27 years. the cervical vertebrae c2 and c3 are denser in females than males at 9 years and 16 years, whereas it is denser in males than females in 27 years. these results indicate the early maturation in females when males still have some growth left. lamparski concluded that cervical vertebral indicators were same for females and males, but the females developed the changes earlier. oreilly and yanniello were able to observe statistically significant increase in various mandibular dimensions with specific maturational stages in cervical vertebrae. the objective of this study was to assess and evaluate the gender differences in maturational differences. for this, 24 subjects with the age group of 9 years, 16 years, and 27 years were randomly selected from the patients who reported to the department of orthodontics and dentofacial orthopedics, tamil nadu government dental college, chennai, and studied using 3d ct. statistical analysis anova, tukey - honestly statistical significant difference test showed that : the bone density of c2 tend to increase for both males and females as age advances (71.7% increase in the bone density of c1 tend to decrease for both males and females as age advances 5.8% decrease in females from 9 to 27 years and 20.3% decrease in males from 9 to 27 years)females from 9 to 27 years and 29.3% increase in males from 9 to 27 yearsthe bone density of c3 tend to increase for both males and females as age advances (94.7% increase in females from 9 to 27 years and 36.5% increase in males from 9 to 27 years). the bone density of c2 tend to increase for both males and females as age advances (71.7% increase in the bone density of c1 tend to decrease for both males and females as age advances 5.8% decrease in females from 9 to 27 years and 20.3% decrease in males from 9 to 27 years) females from 9 to 27 years and 29.3% increase in males from 9 to 27 years the bone density of c3 tend to increase for both males and females as age advances (94.7% increase in females from 9 to 27 years and 36.5% increase in males from 9 to 27 years). according to the mean percentage changes mentioned above, it can be concluded that : among 9 years, males have lesser bone density when compared to femalesamong 16 years, females have more bone density compared to malesamong 27 years, males have more bone density compared to females. among 9 years, males have lesser bone density when compared to females among 16 years, females have more bone density compared to males among 27 years, males have more bone density compared to females. the result of this 3d study matched with the previous report in the literature concerning shape changes with skeletal age as judged in 2d sagittal views. the results of the study concluded that as age advances, morphological variations, or changes in the bone occurs, i.e. the bone density decreases in both females and males and females mature faster than males. this study provides qualitative method of assessing gender differences of the patient by using images of cervical vertebrae by 3d approach.	introduction : the cervical vertebral maturation (cvm) method is a vital tool for assessing the biological maturation of the orthodontic patient to evaluate the amount of mandibular bone growth left.aim:to assess and visualize the cervical vertebral morphology (bone density) of orthodontic patients of the age group 9,16,27 years.material and methods : twenty four subjects with age group of 9,16,27 who were randomly selected and subjected to 3d tomographic study to estimate the biological age of the orthodontic patients by analyzing c1 c2 and c3 vertebrae.result:the results showed that bone density of males is lesser than females in 9 and 16 years, whereas they have more bone density than females in 27 years.conclusion:the study provides qualitative method of assessing the biological age of the patient by using images of cervical vertebrae by three dimensional approach. hence it can be useful for orthodontic diagnosis and treatment plan.
polycystic ovary syndrome (pcos) is one of the most common endocrine disorders, affecting around 47% of the population in women of the reproductive age. however, the etiology and pathophysiology of pcos remain unclear, and the multiple risk factors such as genetics, environment, nutrition, lifestyle, and much more are still under investigation. there is heterogeneity of symptoms and in severity of disease but most have central obesity or android fat deposition (fat at abdominal wall and viscera). android fat deposition is relatively resistant to insulin hormone [3, 4 ]. according to international diabetes federation 2005 criteria for metabolic syndrome (idf 2005), central obesity is diagnosed when waist circumference is more than 80 centimeters for asian women. both of central obesity and hyperandrogenism in pcos aggravate insulin resistance which promotes incidence of diabetes mellitus. several studies showed that overall abnormal oral glucose tolerance test (ogtt) in pcos is 4245% which impair glucose tolerance test 2531%, and diabetes mellitus 7.510%, and all the abnormalities are associated with age, higher body mass index (bmi), central obesity, and hyperandrogenemia [69 ]. acanthosis nigricans is a brown to black, poorly defined, velvety hyperpigmentation of the skin, usually present in the posterior and lateral folds of neck, axilla, groin, and other areas. the most common cause would be insulin resistance. by a precisely unknown pathophysiology, it associates with obesity, and found in pcos women is about 7.574% [1113 ]. however, this technique is very complex and requires experienced personnel, two intravenous lines throughout the study, and frequent bedside plasma glucose determinations, so this technique is not appropriate in clinical practice. rotterdam eshre / asrm - sponsor pcos consensus workshop group suggests the oral glucose tolerance test (ogtt) has been traditionally used for the diagnosis of diatbetes, by using 75 gram glucose load and measure glucose at fasting and 2 hours postloading of glucose. these diagnostic criteria are followed by american diabetes association (ada) 2007. practically, we have been trying to find a solution to measure insulin resistance by considering the concept that patients who have insulin resistance will have more insulin hormone in blood than those who does not. since insulin can not perform its duty well, this causes for higher level of glucose in blood. homeostatic measurement assessment insulin resistance (homa - ir) is an evaluation of insulin resistance by using glucose level in blood and insulin of patients while fasting to analysis. this evaluation can be also used to find the insulin resistance which has more advantage than the 75 gram ogtt that a person who receives the test is drawn blood only one. there is still no conclusion about cut - off point used in diagnosis of insulin resistance. matthews. used homa - ir more than 2.5 for diagnosis of insulin resistance in general population. studied in pubertal obese children and adolescents ; this study has shown homa cut - off point at 3.16. used cut - off point for homa - ir of at least 2.0 for diagnosis of insulin resistance in young pcos women. most studies of homa - ir in pcos women were in american and european women. homa - ir did not have the precise cut - off value used in diagnosis of insulin resistance. therefore, the objective of this study was to determine the result of using homa - ir as a diagnostic test for detection of abnormal ogtt in thai women with pcos, for discovering the proper cut - off value to diagnose glucose intolerance and getting the data important for applying in clinical practice. is based on the records of 250 pcos women who consecutively attended the gynecologic endocrinology unit of the department of obstetrics and gynecology, siriraj hospital between may 2007 and january 2009, which were reviewed and analyzed. exclusion criteria included the women who had previous surgery of one or both ovaries, used hormonal treatment, and took the medication for dyslipidemia within 3 months and/or received steroid within 6 months before participation in the study. the study protocol was approved by the ethics committee of the faculty of medicine siriraj hospital, mahidol university. this study was financially supported by siriraj routine to research (r2r) management fund. all the women with pcos who participated in this study received a physical examination including measurement of vital signs and skin lesions, and anthropometric measurements, as a prelude to a review of clinical presentations. age, body weight, height, waist circumference, blood pressure, and skin manifestations were recorded. after overnight fasting for at least 12 hours, venous blood samples were drawn twice, the first one at 810 am and the second one at 2-hour postglucose loading to measure glucose and insulin level at baseline and 2 hours following oral 75 g glucose loading. the first blood sample was also examined for baseline hormonal profiles (prolactin, cortisol, thyroid stimulating hormone (tsh), and androgen hormone) and baseline metabolic profile (glucose, insulin, and lipid). pcos was diagnosed by the revised rotterdam criteria 2003, that is, including a patient who has at least 2 in 3 of the following : (1) oligomenorrhea or amenorrhea, (2) hyperandrogenemia and/or hyperandrogenism, (3) polycystic ovaries, and excluding another causes (e.g., hyper / hypothyroidism, hyperprolactinemia, cushing 's syndrome, congenital adrenal hyperplasia (cah), or hormonal secreting tumor). glucose tolerance was evaluated using 75 g ogtt according to the american diabetes association (ada) 2007 criteria. abnormal ogtt is classified as follows : (i) impaired fasting glucose (ifg), that is, fasting glucose (fg) 100 and 0.8 ng / ml, or free testosterone > 0.006 ng / ml, or dehydroepiandrosterone sulphate (dheas) > 350 microgram / dl. all laboratory assays were performed at the laboratory unit of department of clinical pathology, faculty of medicine siriraj hospital, mahidol university, the central laboratory certified by is0 15189. all assays were done using an automatic analyzer (modular p800, roche ; for glucose and modular e170, roche ; for insulin, tsh, prolactin, cortisol). all techniques had intra- and interassay coefficients of variation (cv) less than 5%. data were presented in mean sd or number (%) as appropriate. the sensitivity specificity positive predictive value, negative predictive value, and diagnostic accuracy were calculated from 2 2 tables for homa - ir at each cut - point for detection of abnormal ogtt. receiver operator curves (rocs) for homa - ir and abnormal ogtt were created by calculating the sensitivity and specificity of fixed cut - off points of the various parameters examined. the mean age, bmi, and waist circumference (wc) were 25.4 5.8 years old, 26.2 7.6 the diagnostic criteria of pcos were 98.4% of oligomenorrhea, 49.2% of hyperandrogenism, and 97.2% of polycystic ovaries. in this study 27.2% had acanthosis nigricans. the blood level of carbohydrate metabolic profiles showed the fasting blood glucose was 85.4 22.9 mg / dl, 2 hr blood glucose was 116.4 53.8 mg / dl, fasting insulin was 15.6 34.2 mu / ml, 2 hr insulin was 106.6 89.0 mu / ml, and homa - ir was 3.53 7.74. the prevalence of an glucose intolerance is shown in table 2. an glucose intolerance was found in 20.0%, with 5.6% having type 2 diabetes mellitus, 3.2% having impaired fasting glucose levels, and 13.6% having an impaired glucose tolerance test. sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the cut - off homa - ir of more than 2.0 for detection of glucose intolerance in pcos women were 89.74%, 58.82%, 38.46%, 95.24%, and 65.71%, respectively, as in table 3. table 4 shows the relation between associating factors of glucose intolerance in pcos and homa - ir > 2.0. odds ratio for age 30 = 2.45, bmi 25 = 23.37, wc 80 cm = 24.55, hyperandrogenism = 1.97, and presence of acanthosis nigricans = 50.03. using cut - off point homa > 2.0 and the number of clinical associating factor for insulin resistance, odds ratio in each condition is shown in table 5. the significant odds ratio included the conditions of homa > 2.0 combined with 4 clinical associating factors and homa > 2.0 combined with 5 clinical associating factors ; odds ratio (95% ci) were 2.67 (1.315.42) and 9.75 (3.1630.10), respectively. insulin resistance and the consequent development of hyperinsulinemia seem to be an important pathophysiological mechanism that links pcos to its concurrent metabolic derangements. an insulin resistance is due to alterations in -cell function, it might have a key role in the impaired glucose tolerance test and the development of frank diabetes in women with pcos. it is well known that type 2 dm is an important risk factor for coronary heart disease. in previous studies, type 2 dm was found to contribute significantly to the mortality of women with pcos (odds ratio 3.6 ; 95% confidence interval 1.58.4) more than that expected in unaffected women. in this study, our data indicated that the prevalence of abnormal glucose tolerance in our study was lower than that of american women with pcos but similar to that of chinese women with pcos. according to some, differences among these studies in the selection criteria of pcos can not be ignored and the factors of ethnic background, dietary composition, and lifestyle might play an important role in the prevalence of abnormal glucose tolerance in women with pcos. therefore, an ogtt is currently the only reliable way to detect impaired glucose metabolism in pcos. this procedure is relatively time - consuming and inconvenient for the patient, which limits its use as a general screening instrument in daily practice. therefore, a more convenient screening test that minimizes the need for an ogtt is desirable. in this study, homa - ir had the close relation for detection of abnormal ogtt in thai pcos women. if using the cut - off level of homa - ir > 2.0 for detecting the glucose intolerance, it can give more sensitivity, but specificity was less than the higher cut - off level. it may be suitable for use as a screening test for detecting of glucose intolerance or insulin resistance in thai pcos women. in the cases which had a false positive test, if they received the treatment to control insulin intolerance, it did not have a serious effect on the treatment. because the early step of treatment is life style modification, control of body weight, control of diet and exercise, these methods are the better way for controlling other metabolic disorders, too. insulin sensitizing drug for example, metformin, provides benefit to control insulin resistance in pcos women. nevertheless this drug would give minor gastrointestinal side effect and no serious adverse event was reported. many studies use the homa - ir as the diagnostic criteria for insulin resistance [2, 17, 18, 24 ]. the european group for the study of insulin resistance (egir) uses the cut - off level of homa - ir > 2.0 to indicate insulin resistance or glucose intolerance. some studies used different cut - off levels of homa - ir, because of the differences of each ethnic group, the prevalence of obesity or central obesity or age group. and no consensus on the cut - off level of homa - ir exists for thai pcos women. a screening strategy that uses bmi and waist circumference, which is a low - cost and rapidly performed approach, however, if pcos women have the risk factors to develop insulin resistance, the diagnostic procedure should be done. many studies showed clinical risk factors of glucose intolerance in pcos : age, bmi, central obesity, hyperandrogenism, presence of acanthosis nigricans [69, 2628 ]. table 4 shows a statistical relation between homa - ir > 2.0 and these factors. if pcos women presented clinical risk factor and had abnormal homa - ir, especially 4 and 5 clinical risks, these women would have a significant odds ratio to have glucose intolerance (table 5). on the other hand, we can use the clinical risk to select high risk women for investigation of a specific test for glucose intolerance (75 g ogtt). limitations of this study were that it was cross - sectional study and had no control group. the majority of population in this study was younger and was an urban population ; this might not be able to fully represent all thai pcos women. to overcome these limitations, a prospective, multicenter study is needed. homa - ir was an easily obtainable, safe, low cost, and less invasive test than ogtt. homa - ir > 2.0 if the result was positive and had many clinical risk factors, a specific test should be done to prove the diagnosis.	objectives. to study the cut - off point of homeostatic measurement assessment - insulin resistance (homa - ir) as a screening test for detection of glucose intolerance in thai women with polycystic ovary syndrome (pcos). study design. cross - sectional study. setting. department of obstetrics and gynecology, faculty of medicine siriraj hospital. subject. two hundred and fifty thai pcos women who attended the gynecologic endocrinology unit, during may 2007 to january 2009. materials and methods. the paitents were interviewed and examined for weight, height, waist circumference, and blood pressure. venous blood samples were drawn twice, one at 12-hour fasting and the other at 2 hours after glucose loading. results. the prevalence of glucose intolerance in thai pcos women was 20.0%. the mean of homa - ir was 3.53 7.7. area under an roc curve for homa - ir for detecting glucose intolerance was 0.82. using the cut - off value of homa - ir > 2.0, there was sensitivity at 84.0%, specificity at 61.0%, positive predictive value at 35.0%, negative predictive value at 93.8%, and accuracy at 65.6%. conclusion. homa - ir > 2.0 was used for screening test for glucose intolerance in thai pcos women. if the result was positive, a specific test should be done to prove the diagnosis.

Subsets and Splits